RU2795683C2 - Polynucleotides encoding relaxin - Google Patents

Abstract

FIELD: pharmaceutical industry.

SUBSTANCE: method for increasing the potency of relaxin. The composition for increasing relaxin potency contains an mRNA polynucleotide compounded in an ionizable lipid nanoparticle, where the mRNA polynucleotide contains an open reading frame encoding a relaxin-based fusion protein containing the amino acid sequence set in SEQ ID NO: 1, and an immunoglobulin (Ig) fragment, wherein the ionizable lipid nanoparticle contains an ionizable lipid, which is compound 18, having the structure.

EFFECT: increasing the relaxin potency in the subject.

9 cl, 5 tbl, 15 ex, 11 dwg

Description

RELATED APPLICATIONS

This application claims priority under 35 U.S.C. § 119(e). US Provisional Application No. 62/338,470, filed May 18, 2016, which is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

Acute heart failure (AHF) is a sudden deterioration in health that prevents the heart from pumping enough blood to meet the body's blood supply needs. Signs and symptoms may include shortness of breath, swelling, and fatigue, which can lead to acute respiratory distress and death. AHF, as well as other cardiovascular diseases, can be caused by a deficiency in circulating relaxin.

Relaxin is a 6000 Da heterodimeric polypeptide endocrine and autocrine/paracrine hormone belonging to the insulin superfamily of genes. Relaxin stimulates angiogenesis and promotes the restoration of the vascular endothelium. It affects the musculoskeletal and other systems by binding to its receptor in various tissues, a process mediated by various signaling pathways. There are seven known peptides from the relaxin family, including relaxin (RLN)1, RLN2, RLN3 and insulin-like peptide (INSL)3, INSL4, INSL5, INSL6. RLN1 and RLN2 are involved in the regulation and metabolism of collagen in fibroblasts, while RLN3 is brain-specific. RLN1 and RLN2 are also involved in the hemodynamic changes that occur during pregnancy, including cardiac output, renal blood flow, and arterial compliance. In addition, RLN2 mediates vasodilation by increasing nitric oxide production through a phosphorylation cascade. Relaxin is also a cardiac stimulant and can cause vasodilation by inhibiting angiotensin II and endothelin, two potent vasoconstrictors. This hormone has also been shown to increase the sensitivity of cardiac myofilaments to calcium and increase protein kinase C phosphorylation of myofilaments. The force generated by myofilaments increases while the energy consumption of cardiomyocytes remains at the same level. In the kidneys, relaxin increases creatinine clearance and increases renal blood flow.

Relaxin, a vasoactive peptide, protects the vascular system from overwork, improves kidney function, promotes cell growth and survival, and maintains proper vascular structure. Administration of relaxin to a subject provides therapeutic benefits such as treatment and prevention of fibrosis, e.g., renal fibrosis, cardiac fibrosis, or pulmonary fibrosis, and cardiovascular disease, e.g., acute heart failure, coronary artery disease, microvascular disease, acute coronary syndrome with impaired function. heart or ischemia-reperfusion.

Standard therapy for many relaxin-deficient disorders includes beta-blockers, hydralazine/isosorbide dinitrate, digitalis alkaloids, diuretics, angiotensin-converting enzyme (ACE) inhibitors, angiotensin receptor blockers (ARBs), digoxin, anticoagulants, aldosterone antagonists, and drugs for control of comorbidities including, without limitation, high cholesterol, high blood pressure, atrial fibrillation, and diabetes. Lifestyle changes, including diet and exercise, are usually also recommended.

Although relaxin provides significant therapeutic benefits, wild-type recombinant relaxin has a short half-life, making it difficult to achieve therapeutic levels in the body. A recombinant form of relaxin called Serelaxin, supplied by Novartis, has been shown to have low toxicity, but its effectiveness is questionable because it breaks down too quickly in the bloodstream. Serelaxin has a half-life of approximately 15 minutes in serum and 7-8 hours over a continuous 48-hour infusion.

BRIEF DESCRIPTION OF THE INVENTION

The present invention provides mRNA-based therapeutic agents for the treatment of fibrosis and/or cardiovascular disease. The mRNA therapeutics of the present invention are particularly suitable for the treatment of fibrosis and/or cardiovascular disease because the technology provides intracellular delivery of mRNA encoding relaxin (RXN) followed by de novo synthesis of a functional RXN protein in target cells. The present invention includes the introduction of modified nucleotides within therapeutic mRNAs to (1) minimize unwanted immune activation (e.g., innate immune response associated with in vivo administration of foreign nucleic acids) and (2) optimize the efficiency of mRNA translation into protein. Illustrative aspects of the present invention are a combination of nucleotide modification to reduce the innate immune response and sequence optimization, particularly in the open reading frame (ORF) of therapeutic mRNAs encoding RXN, to enhance protein expression.

The mRNA therapeutic technology of the present invention also includes delivery of mRNA encoding RXN via a lipid nanoparticle (LNP) delivery system. The present invention provides novel lipid-based ionizable LNPs that have improved properties when administered in vivo, such as cellular uptake, intracellular transport, and/or endosomal release or endosomal release. The LNPs of the present invention also exhibit reduced immunogenicity associated with in vivo LNP administration.

In certain aspects, the present invention provides compositions and delivery formulations comprising a polynucleotide, e.g., a ribonucleic acid (RNA), e.g., messenger RNA (mRNA) encoding a therapeutic relaxin protein, and methods of treating heart failure and/or other disorders in needing this subject by introducing them.

Aspects of the present invention relate to an RNA polynucleotide containing an open reading frame (ORF) encoding a relaxin polypeptide. The relaxin polypeptide can be modified to provide an extended half-life. For example, the relaxin polypeptide may be part of a fusion protein.

The compositions can be formulated in an ionizable lipid nanoparticle, wherein the ionizable lipid nanoparticle has a molar ratio of about 20-60% ionizable lipid: about 5-25% non-cationic lipid: about 25-55% sterol and about 0.5-15% PEG- modified lipid. Some aspects of the present invention relate to an RNA polynucleotide containing an open reading frame (ORF) encoding a relaxin polypeptide formulated in an ionizable lipid nanoparticle.

Other aspects of the present invention relate to an RNA polynucleotide comprising an open reading frame (ORF) encoding a relaxin polypeptide formulated in an ionizable lipid nanoparticle, wherein the RNA polynucleotide in the ionizable lipid nanoparticle has a therapeutic index greater than 10% of the therapeutic index for RNA- polynucleotide alone.

In some aspects, the present invention is an RNA polynucleotide composition having an open reading frame encoding at least one relaxin protein, formulated in an ionizable lipid nanoparticle, wherein the ionizable lipid nanoparticle has a molar ratio of approximately 20-60% ionizable lipid: about 5-25% non-cationic lipid: about 25-55% sterol and about 0.5-15% PEG-modified lipid.

In other aspects, the present invention is a nucleic acid comprising an RNA polynucleotide having an open reading frame encoding at least one relaxin-based fusion protein.

In other aspects, the present invention is a polypeptide comprising a relaxin-VL fusion protein wherein relaxin has been fused to a light chain variable fragment.

In some embodiments, the relaxin polypeptide is characterized by an amino acid sequence that is at least 80% identical to the sequence under SEQ ID NO. 2. In other embodiments, the implementation of the polypeptide is characterized by an amino acid sequence that is at least 90% identical to the sequence under SEQ ID NO. 2.

In some embodiments, the relaxin protein is a relaxin-based fusion protein. The relaxin-based fusion protein may be an immunoglobulin (Ig) fragment. In some embodiments, the Ig fragment is a variable chain fragment. In other embodiments, the Ig fragment is a chain constant fragment. In some embodiments, the Ig fragment is a variable light chain fragment. In some embodiments, the light chain variable fragment is an IgG VLκ region. In some embodiments, relaxin is linked to the VLκ region of IgG via a linker.

The relaxin protein is a fusion protein and is characterized by a nucleotide sequence that is 81%-100% identical to the sequence under SEQ ID NO: 1 in some embodiments. In other embodiments, the relaxin protein is a fusion protein and is characterized by a nucleotide sequence that is 85%-99% identical to the sequence under SEQ ID NO: 1.

In other aspects, a method is provided for treating a relaxin-associated disorder in a subject in need thereof. The method includes administering to a subject a therapeutically effective amount of an RNA polynucleotide containing an open reading frame (ORF) encoding a relaxin polypeptide for the treatment of a relaxin-associated disorder.

In some embodiments, a method for treating a relaxin-associated disorder comprises a single administration of an RNA polynucleotide. In some embodiments, the method of treating a relaxin-associated disorder further comprises administering a weekly dose.

In embodiments, the relaxin-associated disorder is selected from the group consisting of acute coronary syndrome with cardiac dysfunction, ischemia/reperfusion associated with transplantation of parenchymal organs such as lung, kidney, liver, heart, extracorporeal circulation organ protection, including kidney and cornea healing, chronic heart failure, diabetic nephropathy, NASH, atrial fibrillation, cardiac fibrosis, diabetic wound healing, and cirrhosis.

In other aspects, the present invention provides a method of treating heart failure in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an RNA polynucleotide containing an open reading frame (ORF) encoding a relaxin polypeptide for the treatment of heart failure.

In some embodiments, the method comprises a single administration of an RNA polynucleotide. In other embodiments, the method further comprises administering a dose weekly, a dose every two weeks, a dose every three weeks, a dose every month, or a dose every two months.

In some embodiments, administration of an RNA polynucleotide with an ionizable lipid increases the therapeutic index of the RNA polynucleotide in the composition compared to the therapeutic index of the RNA polynucleotide alone in the absence of the ionizable lipid. In other embodiments, the therapeutic index of the RNA polynucleotide in the composition is greater than 10:1 or 50:1.

In some embodiments, when administered to a subject, the RNA polynucleotide is in a dosage form that has a pharmacokinetic (PK) profile comprising: a) T _max. , ranging from about 30 to about 240 minutes after administration, and b) a plasma concentration plateau of the drug (relaxin polypeptide formed by RNA polynucleotide) of at least 50% of C _max. , for about 60 to about 240 minutes. In other embodiments, when administered to a subject, at least a 25% or 50% increase in circulating relaxin is achieved over baseline levels. Recombinant wild-type relaxin has a short half-life; for example, serelaxin, a recombinant form of relaxin, has a serum half-life of only 15 minutes. However, as shown in Examples 14 and 15, in vivo models demonstrate that embodiments of the present disclosure have a significantly longer half-life, making them more therapeutically effective.

In other embodiments, the circulating relaxin level is achieved for a period of 2 hours to 7 days, for a period of up to 5 days, or for a period of up to 3 days.

In some embodiments, when administered to a subject, the dosage form has a PK profile wherein at least about 90% of the drug is cleared from plasma within about 5-7 days after plasma drug concentration plateaus.

In other embodiments, the implementation of the RNA contains at least one chemical modification. In some embodiments, the chemical modification is selected from pseudouridine, N1-methyl-pseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-dezazapseudouridine, 2-thio-1-methylpseudouridine, 2 -thio-5-azauridine, 2-thiodihydropseudouridine, 2-thiodihydrouridine, 2-thiopseudouridine, 4-methoxy-2-thiopseudouridine, 4-methoxypseudouridine, 4-thio-1-methylpseudouridine, 4-thiopseudouridine, 5-azauridine, dihydropseudouridine ina, 5 -methyluridine, 5-methoxyuridine and 2'-O-methyluridine.

In some embodiments, the RNA polynucleotide formulated in the ionizable lipid nanoparticle has a therapeutic index greater than 60% of the therapeutic index for the RNA polynucleotide alone. In some embodiments, the RNA polynucleotide formulated in the ionizable lipid nanoparticle has a therapeutic index greater than 10% of the therapeutic index for the RNA polynucleotide alone.

In other embodiments, the ionizable lipid is a lipid of formula (I):

or its salt or isomer, where:

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'', or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from carbocycle, heterocycle, -OR, -O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN , -N(R) ₂ ,

-C(O)N(R) ₂ , -N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , - N(R)C(S)N(R) ₂ , -N(R)R ₈ ,

-O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N( R) ₂ , -N(R)C(O)OR,

-N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , - N(OR)C(S)N(R) ₂ ,

-N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )N(R) ₂ , -C( =NR ₉ )R, -C(O)N(R)OR and -C(R)N(R) ₂ C(O)OR, and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-,

-N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P (O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R,

-S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-14 alkyl and C _3-14 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13.

In some embodiments, the subgroup of compounds of formula (I) includes compounds in which if R ₄ is -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR or -CQ(R) ₂ then (i) Q is not -N(R) ₂ if n is 1, 2, 3, 4 or 5, or (ii) Q is not 5-, 6- or 7-membered heterocycloalkyl if n is 1 or 2. In some embodiments, the subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'', or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle, 5-14 membered heteroaryl with one or more heteroatoms selected from N, O and S, -OR,

-O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O)N( R) ₂ ,

-N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C(S)N(R ) ₂ , -CRN(R) ₂ C(O)OR, -N(R)R ₈ ,

-O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N( R) ₂ , -N(R)C(O)OR,

-N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , - N(OR)C(S)N(R) ₂ ,

-N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )N(R) ₂ , -C( =NR ₉ )R, -C(O)N(R)OR and 5-14 membered heterocycloalkyl with one or more heteroatoms selected from N, O and S which are substituted with one or more substituents selected from oxo (=O ), OH, amino, mono- or dialkylamino and C _1-3 alkyl, and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-,

-N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P (O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R,

-S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-14 alkyl and C _3-14 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or isomers.

In other embodiments, the subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'', or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR, -CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle, 5-14 membered heterocycle with one or more heteroatoms selected from N, O and S, -OR,

-O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O)N( R) ₂ ,

-N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C(S)N(R ) ₂ , -CRN(R) ₂ C(O)OR, -N(R)R ₈ , -O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , - N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR,

-N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , - N(OR)C(S)N(R) ₂ ,

-N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C(O)N( R)OR, and -C(=NR ₉ )N(R) ₂ , and each n is independently selected from 1, 2, 3, 4 and 5; and if Q is a 5-14 membered heterocycle and (i) R ₄ is -(CH ₂ ) _n Q wherein n is 1 or 2, or (ii) R ₄ is -(CH ₂ ) _n CHQR in which n is 1, or (iii) R ₄ is -CHQR and -CQ(R) ₂ , then Q is either 5-14 membered heteroaryl or 8-14 membered heterocycloalkyl;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-,

-N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P (O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R,

-S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-14 alkyl and C _3-14 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or isomers.

In some embodiments, the subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'', or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of C _3-6 carbocycle, -(CH ₂ ) _n Q, -(CH ₂ ) _n CHQR,

-CHQR, -CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle, 5-14 membered heteroaryl with one or more heteroatoms selected from N, O and S, -OR,

-O(CH ₂ ) _n N(R) ₂ , -C(O)OR, -OC(O)R, -CX ₃ , -CX ₂ H, -CXH ₂ , -CN, -C(O)N( R) ₂ ,

-N(R)C(O)R, -N(R)S(O) ₂ R, -N(R)C(O)N(R) ₂ , -N(R)C(S)N(R ) ₂ , -CRN(R) ₂ C(O)OR, -N(R)R ₈ , -O(CH ₂ ) _n OR, -N(R)C(=NR ₉ )N(R) ₂ , - N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR,

-N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , - N(OR)C(S)N(R) ₂ ,

-N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C(O)N( R)OR and -C(=NR ₉ )N(R) ₂ and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-,

-N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P (O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R,

-S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-14 alkyl and C _3-14 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _2-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or isomers.

In some embodiments, the subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C _2-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'', or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle;

R ₄ is (CH ₂ ) _n Q or (CH ₂ ) _n CHQR, where Q is N(R) ₂ and n is selected from 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-,

-N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P (O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl, and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-14 alkyl and C _3-14 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _1-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or isomers.

In other embodiments, the subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C _5-30 alkyl, C _5-20 alkenyl, -R*YR'', -YR'' and -R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of C _1-14 alkyl, C _2-14 alkenyl, -R*YR'', -YR'' and -R*OR'', or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle;

R ₄ is selected from the group consisting of -(CH ₂ ) _n Q, (CH ₂ ) _n CHQR, -CHQR and -CQ(R) ₂ where Q is N(R) ₂ and n is selected from 1, 2 , 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R ₆ is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-,

-N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P (O)(OR')O-, -S(O) ₂ -, -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R is independently selected from the group consisting of C _1-3 alkyl, C _2-3 alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, -R*YR'', -YR'' and H;

each R'' is independently selected from the group consisting of C _3-14 alkyl and C _3-14 alkenyl;

each R* is independently selected from the group consisting of C _1-12 alkyl and C _1-12 alkenyl;

each Y is independently a C _3-6 carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or isomers.

In some embodiments, a subgroup of compounds of formula (I) includes compounds of formula (IA):

or their salt or isomer, where 1 is selected from 1, 2, 3, 4 and 5; m is selected from 5, 6, 7, 8 and 9; M ₁ is a bond or M'; R ₄ is unsubstituted C _1-3 alkyl or -(CH ₂ ) _n Q, where Q is OH, -NHC(S)N(R) ₂ , -NHC(O)N(R) ₂ , -N (R)C(O)R, -N(R)S(O) ₂ R, -N(R)R ₈ ,

-NHC(=NR ₉ )N(R) ₂ , -NHC(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR, heteroaryl or heterocycloalkyl; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group and a heteroaryl group; and R ₂ and R ₃ are independently selected from the group consisting of H, C _1-14 alkyl, and C _2-14 alkenyl.

In some embodiments, the nanoparticle has a polydispersity index of less than 0.4. In some embodiments, the nanoparticle has a net neutral charge at neutral pH.

In some embodiments, 80% of the uracil in the open reading frame is chemically modified. In some embodiments, 100% of the uracil in the open reading frame is chemically modified. In some embodiments, the chemical modification is located at the 5-position of uracil. In some embodiments, the chemical modification is N1-methyl-pseudouridine. In other embodiments, the uracil and thymine content of the RNA polynucleotide is 100-150% greater than that of wild-type relaxin-encoding polynucleotides.

Aspects of the present invention relate to a method for increasing the therapeutic index of an RNA polynucleotide containing an open reading frame (ORF) encoding a relaxin polypeptide, the method comprising combining the RNA polynucleotide with an ionizable lipid to form a composition, thereby increasing the therapeutic index of the RNA polynucleotide in compositions compared to the therapeutic index of the RNA polynucleotide alone.

In some embodiments, the therapeutic index of the RNA polynucleotide in the composition is greater than 10:1. In other embodiments, the therapeutic index of the RNA polynucleotide in the composition is greater than 50:1.

Additional aspects of the present invention relate to a method of treating a subject comprising administering to a subject in need thereof a composition formulated in an effective amount to treat the subject.

Aspects of the present invention relate to a method of treating heart failure and/or other disorders in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an RNA polynucleotide containing an open reading frame (ORF) encoding a relaxin polypeptide, wherein administration of the RNA polynucleotide results in an increase in deficient protein in the subject to a physiological level.

In some embodiments, a method for treating heart failure and/or other disorders involves a single administration of an RNA polynucleotide. In some embodiments, the method for treating heart failure and/or other disorders further comprises administering a weekly dose. In other embodiments, the RNA polynucleotide is formulated into an ionizable lipid nanoparticle.

In some embodiments, the implementation of the RNA polynucleotide is in the composition, as described above. In some embodiments, when administered to a subject, the dosage form has a pharmacokinetic (PK) profile comprising: a) T _max. , ranging from about 30 to about 240 minutes after administration, and b) a plasma concentration plateau of the drug (relaxin polypeptide formed by RNA polynucleotide) of at least 50% of C _max. , for about 90 to about 240 minutes.

In some embodiments, when administered to a subject, at least a 25% increase in relaxin protein levels is achieved over baseline levels. In other embodiments, when administered to a subject, at least a 50% increase in the level of relaxin protein over baseline is achieved.

In some embodiments, when administered to a subject, at least a 60% increase in the level of relaxin protein over baseline is achieved. In other embodiments, the increase in relaxin protein levels is achieved for up to 3 days. In other embodiments, the increase in relaxin protein levels is achieved for up to 5 days.

In some embodiments, the increase in relaxin protein levels is achieved for up to 7 days. In some embodiments, the increase in the level of relaxin protein is achieved within 1 hour after dosing to the subject. In other embodiments, an increase in the level of the relaxin protein is achieved within 3 hours after dosing to the subject.

In some embodiments, the RNA polynucleotide is administered once a week for 3 weeks to 1 year. In some embodiments, the RNA polynucleotide is administered to a subject by intravenous administration. In some embodiments, the RNA polynucleotide is administered to a subject by subcutaneous administration.

Some embodiments further provide for administering a standard heart failure therapy to the subject. In other embodiments, the standard therapy is selected from the group consisting of beta-blockers, hydralazine/isosorbide dinitrate, digitalis, diuretics, angiotensin-converting enzyme (ACE) inhibitors, angiotensin receptor blockers (ARBs), digoxin, anticoagulants, aldosterone antagonists, and drugs for control of comorbidities including, without limitation, high cholesterol, high blood pressure, atrial fibrillation, and diabetes.

In some embodiments, the RNA polynucleotide is present in a dose of 25 to 100 μg. In other embodiments, the method comprises administering to the subject a single dose of an RNA polynucleotide ranging from 0.001 mg/kg to 0.005 mg/kg.

Aspects of the present invention relate to a method for treating heart failure and/or disorders in a subject in need thereof, comprising administering to the subject an RNA polynucleotide containing an open reading frame (ORF) encoding a relaxin polypeptide and a standard therapy for heart failure and/or other disorders, wherein the combined administration of the RNA polynucleotide and standard therapy results in an increase in the levels of the relaxin protein in the subject to physiological levels.

The present invention provides a polynucleotide comprising an open reading frame (ORF) encoding a relaxin polypeptide, wherein the uracil or thymine content of the ORF is from 100% to about 150% of the theoretical minimum uracil or thymine content of the nucleotide sequence encoding the relaxin polypeptide (% _UTM or % T _HM , respectively). In some embodiments, the uracil or thymine content of the ORF is from about 105% to about 145%, from about 105% to about 140%, from about 110% to about 145%, from about 110% to about 140%, from about 115 % to about 145%, from about 115% to about 140%, from about 120% to about 145%, from about 120% to about 140%, from about 125% to about 145%, or from about 125% to about 140% from % U _TM or % T _TM . In some embodiments, the uracil or thymine content of the ORF is between (i) 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, or 125% and (ii ) 139%, 140%, 141%, 142%, 143%, 144% or 145% of % U _TM or % T _TM .

In some embodiments, the ORF further comprises at least one low frequency codon.

In some embodiments, the ORF is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99 % or 100% sequence identity with a sequence selected from the sequences in Table 5. In some embodiments, the relaxin polypeptide contains an amino acid sequence that is at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the wild-type relaxin protein polypeptide sequence (Table 5), and wherein the relaxin polypeptide has therapeutic activity. In some embodiments, the relaxin polypeptide is a variant, derivative, or mutant that has therapeutic activity. In some embodiments, the polynucleotide sequence further comprises a nucleotide sequence encoding a transit peptide.

In some embodiments, the polynucleotide further comprises a miRNA binding site. In some embodiments, the miRNA binding site comprises one or more nucleotide sequences selected from Table 4. In some embodiments, the miRNA binding site binds to miR-142. In some embodiments, the miRNA binding site binds to miR-142-3p or miR-142-5p. In some embodiments, miR142 comprises SEQ ID NO: 539.

In some embodiments, the polynucleotide further comprises a 5'UTR. In some embodiments, the 5'-UTR contains a nucleic acid sequence that is at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% identical to a sequence selected from the group consisting of SEQ ID NO: 545-569, or any combination thereof. In some embodiments, the polynucleotide further comprises a 3'UTR. In some embodiments, the 3'-UTR contains a nucleic acid sequence that is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98% at least about 99% or about 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 493-505 and 570-587, or any combination thereof. In some embodiments, the miRNA binding site is located within the 3'UTR.

In some embodiments, the polynucleotide further comprises a 5' cap. In some embodiments, the 5' cap comprises cap 0, cap 1, ARCA, inosine, N1-methylguanosine, 2'-fluoroguanosine, 7-deazaguanosine, 8-oxoguanosine, 2-aminoguanosine, LNA-guanosine, 2-azidoguanosine, cap 2, cap 4, cap 5'-methyl G or equivalent. In some embodiments, the polynucleotide further comprises a poly(A) region. In some embodiments, the poly(A) region has a length of at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, or at least about 90 nucleotides. In some embodiments, the poly(A) region is about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, about 80 to about 120 nucleotides in length.

In some embodiments, when administered to a subject, the polynucleotide is characterized by: (i) a longer plasma half-life; (ii) increased expression of a relaxin polypeptide encoded by ORF; (iii) lower frequency of translational arrest resulting in partial expression; (iv) greater structural stability, or (v) any combination thereof relative to the corresponding polynucleotide, which is a polynucleotide encoding wild-type relaxin.

In some embodiments, the implementation of the polynucleotide contains: (i) a 5'-terminal cap; (ii) 5'-UTR; (iii) an ORF encoding a relaxin polypeptide; (iv) 3'-UTR; and (v) poly(A) region. In some embodiments, the 3'UTR contains a miRNA binding site.

The present disclosure also provides a method for producing a polynucleotide described herein, the method comprising modifying the ORF encoding the relaxin polypeptide by replacing at least one nucleotide base of uracil with a nucleotide base of adenine, guanine, or cytosine, or by replacing at least one nucleotide base adenine, guanine or cytosine nucleotide base uracil, where all substitutions are equivalent substitutions. In some embodiments, the method further comprises replacing at least about 90%, at least about 95%, at least about 99%, or about 100% of the uracil with 5-methoxyuracil.

In certain embodiments, the subgroup of compounds of formula (I) includes compounds of formula (IIa), (IIb), (IIc) or (IIe):

or their salt or isomer, where R ₄ represents a radical described in this document.

In some embodiments, R ₄ is a radical as described herein.

In some embodiments, the compound is a compound of formula (IId),

или его соль или стереоизомер,

or a salt or stereoisomer thereof,

where R ₂ and R ₃ are independently selected from the group consisting of C _5-14 alkyl and C _5-14 alkenyl, n is selected from 2, 3 and 4, and R', R'', R ₅ , R ₆ and m are defined in paragraph 16.

In some embodiments, R ₂ is C ₈ alkyl. In some embodiments, R ₃ is C ₅ alkyl, C ₆ alkyl, C ₇ alkyl, C ₈ alkyl, or C ₉ alkyl. In some embodiments, m is 5, 7, or 9. In some embodiments, each R ₅ is H. In some embodiments, each R ₆ is H.

In another aspect, the present invention provides a nanoparticulate composition comprising a lipid component comprising a compound as described herein (e.g., a compound according to formula (I), (IA), (II), (IIa), (IIb), ( IIc), (IId) or (IIe)).

In yet another aspect, the present invention provides a pharmaceutical composition comprising a nanoparticulate composition according to the preceding aspects and a pharmaceutically acceptable carrier. For example, the pharmaceutical composition is refrigerated or frozen for storage and/or shipping (e.g., stored at or below 4°C, such as at about -150°C to about 0°C, or from about -80°C to about -20°C (e.g. approximately -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60 °C, -70°C, -80°C, -90°C, -130°C or -150°C) For example, a pharmaceutical composition is a solution that is refrigerated for storage and/or shipping, for example , comprising approximately -20°C, -30°C, -40°C, -50°C, -60°C, -70°C or -80°C.

In another aspect, the present invention provides a method for delivering a therapeutic and/or prophylactic agent (eg, mRNA) into a cell (eg, a mammalian cell). This method includes the step of administering to a subject (e.g., a mammal, e.g., a human) a nanoparticulate composition comprising (i) a lipid component comprising a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of formula (II), (IIa ), (IIb), (IIc), (IId) or (IIe) and (ii) a therapeutic and/or prophylactic agent, wherein the administration comprises bringing the cell into contact with the nanoparticle composition, whereby the therapeutic and/or prophylactic the agent is delivered to the cell.

In another aspect, the present invention provides a method for producing a polypeptide of interest in a cell (eg, a mammalian cell). The method includes the step of contacting a cell with a nanoparticle composition comprising: (i) a lipid component comprising a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of formula (II), (IIa), (IIb) , (IIc), (IId) or (IIe) and (ii) mRNA encoding the polypeptide of interest, whereby the mRNA is capable of being translated in the cell to produce the polypeptide.

In another aspect, the present invention provides a method for treating a disease or disorder in a mammal (eg, human) in need thereof. The method includes the step of administering to a mammal a therapeutically effective amount of a nanoparticle composition comprising (i) a lipid component comprising a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound of formula (I), (IA), (II), (IIa ), (IIb), (IIc), (IId) or (IIe) and (ii) a therapeutic and/or prophylactic agent (eg mRNA). In some embodiments, the disease or disorder is characterized by a dysfunctional or impaired activity of a protein or polypeptide.

In another aspect, the present invention provides a method for delivering (eg, specific delivery) a therapeutic and/or prophylactic agent to a mammalian organ (eg, liver, spleen, lung, or femur). This method includes the step of administering to a subject (e.g., a mammal) a nanoparticulate composition comprising (i) a lipid component comprising a phospholipid, a PEG lipid, a structural lipid, and a compound of formula (II), (IIa), (IIb), (IIc) , (IId) or (IIe) and (ii) a therapeutic and/or prophylactic agent (e.g., mRNA), wherein the administration comprises contacting a cell with a nanoparticle composition, whereby the therapeutic and/or prophylactic agent is delivered to the organ -target (for example, liver, spleen, lung or femur).

In another aspect, the present invention includes a method for improved delivery of a therapeutic and/or prophylactic agent (eg, mRNA) to a target tissue (eg, liver, spleen, lung, muscle, or femur). The method comprises administering to a subject (e.g., a mammal) a nanoparticulate composition, wherein the composition comprises (i) a lipid component comprising a compound of formula (I), (IA), (II), (IIa), (IIb), (IIc ), (IId) or (IIe), a phospholipid, a structural lipid, and a PEG lipid, and (ii) a therapeutic and/or prophylactic agent, wherein the administration comprises bringing the target tissue into contact with the nanoparticle composition, whereby the therapeutic and /or the prophylactic agent is delivered to the target tissue.

In some embodiments, the composition disclosed herein is a nanoparticulate composition. In some embodiments, the delivery vehicle further comprises a phospholipid. In some embodiments, the phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC),

1,2-dimyristoyl-sn-glycerophosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1.2 -distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycerophosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2- di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3- phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16:0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine , 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn -glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-racemate-(1-glycerol) sodium salt (DOPG), sphingomyelin, and any mixtures thereof.

In some embodiments, the delivery vehicle further comprises a structural lipid. In some embodiments, the structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and any mixtures thereof.

In some embodiments, the delivery vehicle further comprises a PEG lipid. In some embodiments, the PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and any mixtures thereof.

In some embodiments, the delivery vehicle further comprises an ionizable lipid selected from the group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10),

N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1 ,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31 -tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[ (9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en- 3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)) and (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9.12 -dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2S)).

In some embodiments, the delivery vehicle further comprises a phospholipid, a structural lipid, a PEG lipid, or any combination thereof.

In some embodiments, the composition is formulated for in vivo delivery. In some embodiments, the composition is formulated for intramuscular, subcutaneous, or intradermal delivery.

Each of the limitations of the present invention may cover various embodiments of the present invention. Therefore, it is contemplated that each of the limitations of the present invention, including any element or combination of elements, may be included in each aspect of the present invention. The present invention is not limited in its application to the details of construction and composition of the components set forth in the following description or illustrated in the drawings. The present invention is capable of other embodiments and is practiced or carried out in various ways. In addition, the phraseology and terminology used in this document is intended to be descriptive and should not be construed as limiting. The use of the expression "comprising", "comprising" or "having", "comprising", "involved" and variations thereof in this document means to cover the elements listed below and their equivalents, as well as additional elements.

BRIEF DESCRIPTION OF GRAPHICS/SHAPES

The above and other objects, features and advantages will be apparent from the following description of specific embodiments of the present invention, as shown in the accompanying drawings, in which the same reference symbols refer to the same parts in different images. The graphics are not necessarily to scale, but instead focus on illustrating the principles of various embodiments of the present invention.

In FIG. 1 is a diagram showing wild-type relaxin and the "VLk"-hRLN2 fusion protein. The sequence (G ₄ S) ₃ corresponds to SEQ ID NO: 589.

Fig. 2 is a series of graphs showing that VLk-RLN2 fusion protein mRNA produces a functional protein in an in vitro activity confirmation assay.

Fig. 3A and 3B are graphs showing that VLk-RLN2 fusion protein mRNA produces a functional protein with sustained activity in rats with spontaneously developed hypertension on IV administration. In FIG. 3A shows the heart rate in rats, and FIG. 3B shows diastolic blood pressure. Data are averaged over daytime and nighttime periods (mean +/- SD), with animal manipulation periods removed (N=8 rats per group).

In FIG. 4 shows data on circulating protein in rats with spontaneously developed hypertension.

In FIG. 5 shows that VLk-RLN2 relaxin fusion protein mRNA produces circulating protein levels for up to six days that are above target concentrations in the cynomolgus monkey when administered IV.

In FIG. 6 shows the results of an in vivo interpubic ligament elongation (ILE) assay demonstrating that VLk-RLN2 fusion protein mRNA produces a functional protein.

In FIG. 7 shows an in vivo screen for mRNA expression of the VLk-RLN2 fusion protein, which demonstrates that circulating relaxin protein levels exceed target concentrations for up to six days in mRNA-treated rats.

In FIG. 8 shows that VLk-RLN2 fusion protein mRNA induces expression of relaxin at a concentration above the target concentration for up to eight days in IV mice.

In FIG. 9 shows data from a repeat dose study in cynomolgus monkey (see Example 14).

In FIG. 10 shows data from a repeat dose study in cynomolgus monkey (see Example 14).

In FIG. 11 shows circulating mRNA levels of relaxin-VLk in cynomolgus monkeys after each administration (three doses).

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides mRNA-based therapeutic agents for the treatment of fibrosis and/or cardiovascular disease. Both fibrosis and cardiovascular disease can result from a deficiency in circulating relaxin. mRNA-based therapeutics are particularly suitable for the treatment of cardiovascular disease, fibrosis, and other relaxin deficient disorders, as the technology enables intracellular delivery of mRNA encoding relaxin followed by de novo synthesis of a functional relaxin protein in target cells. Once the mRNA is delivered to the target cells, the desired relaxin protein is expressed by the cells' own translational machinery, and therefore a fully functional relaxin protein replaces the defective or missing protein.

One problem with the delivery of nucleic acid therapeutics (eg, mRNA therapeutics) in vivo is due to the innate immune response that can occur when the body's immune system encounters foreign nucleic acids. Foreign mRNAs can activate the immune system through recognition through toll-like receptors (TLRs), in particular TLR7/8, which is activated by single-stranded RNA (sRNA). In non-immune cells, recognition of foreign mRNA can occur with the participation of the retinoic acid inducible gene I (RIG-I). Immune recognition of foreign mRNAs can lead to undesirable cytokine effects, including the production of interleukin-1β (IL-1β), the spread of tumor necrosis factor-α (TNF-α) and a strong response involving type I interferon (IFN type I). The present invention includes the insertion of various modified nucleotides into therapeutic mRNAs to minimize immune activation and optimize the efficiency of mRNA translation into protein. Specific aspects of the present invention are a combination of nucleotide modification to reduce the innate immune response and sequence optimization, in particular in the open reading frame (ORF) of therapeutic mRNAs encoding relaxin, to enhance protein expression.

The mRNA therapeutic technology of the present invention also includes delivery of mRNA encoding relaxin via a lipid nanoparticle (LNP) delivery system. Lipid nanoparticles (LNPs) are an ideal platform for the safe and efficient delivery of mRNA to target cells. LNPs have the unique ability to deliver nucleic acids through a mechanism including cellular uptake, intracellular transport, and endosomal release or endosomal excretion. The present invention provides novel lipid-based ionizable LNPs that have improved properties when administered in vivo. Without wishing to be bound by theory, the novel lipid-based ionizable LNPs of the present invention are believed to have improved properties, eg, cell uptake, intracellular transport, and/or endosomal release or endosomal excretion. LNP administered systemically (eg, by intravenous (IV) administration), eg, on first administration, may accelerate the elimination of LNPs administered later, eg, with additional administrations. This phenomenon is known as accelerated blood clearance (ABC) and is a key issue in particular when replacing deficient hormones (eg relaxin) in a therapeutic context. This is because repeated administration of mRNA-based therapeutics is in most cases necessary to maintain the required levels of the enzyme in target tissues in subjects (eg, subjects suffering from acute heart failure). The problem of repeated dosing can be addressed at several levels. mRNA construction and/or efficient delivery by LNP may result in increased levels and/or duration of protein (eg, relaxin) expression after the first dose, which in turn may lengthen the period between the first dose and subsequent doses. The ABC phenomenon is known to be, at least in part, transient in nature, with the immune responses underlying ABC disappearing after a sufficiently long period of time after systemic administration. Thus, increasing the duration of protein expression and/or activity following systemic delivery of an mRNA therapeutic agent of the present invention counteracts the ABC phenomenon in one aspect. Moreover, LNPs can be designed to avoid immune detection and/or recognition, and thus they can additionally avoid ABC on subsequent or re-dose. An exemplary aspect of the present invention is novel LNPs that have been designed to reduce ABC.

Relaxin

Wild-type relaxin is a 6000 Da heterodimeric polypeptide endocrine and autocrine/paracrine hormone belonging to the insulin gene superfamily. It contains an A- and a B-chain connected by two interchain disulfide bonds, and one disulfide bond within the A-chain. Relaxin stimulates angiogenesis and promotes the restoration of the vascular endothelium. It affects the musculoskeletal and other systems by binding to its receptor in various tissues, a process mediated by various signaling pathways. There are seven known peptides from the relaxin family, including relaxin (RLN)1, RLN2, RLN3 and insulin-like peptide (INSL)3, INSL4, INSL5, INSL6. RLN1 and RLN2 are involved in the regulation and metabolism of collagen in fibroblasts, while RLN3 is brain-specific. RLN1 and RLN2 are also involved in the hemodynamic changes that occur during pregnancy, including cardiac output, renal blood flow, and arterial compliance. In addition, RLN2 mediates vasodilation by increasing nitric oxide production through a phosphorylation cascade. Relaxin is also a cardiac stimulant and can cause vasodilation by inhibiting angiotensin II and endothelin, two potent vasoconstrictors. This hormone has also been shown to increase the sensitivity of cardiac myofilaments to calcium and increase protein kinase C phosphorylation of myofilaments. The force generated by myofilaments increases while the energy consumption of cardiomyocytes remains at the same level. In the kidneys, relaxin increases creatinine clearance and increases renal blood flow.

In humans, relaxin H2 (relaxin-2) is the major circulating form. Relaxin H2 function is mediated primarily by the relaxin family peptide 1 (RXFP1) receptor, although it can also activate the RXFP2 receptor with low efficiency. As used herein, the term "relaxin" refers to a heterodimeric polypeptide capable of activating RXFP1 and/or RXFP2.

In some embodiments, relaxin is a polypeptide having at least 70% sequence identity to SEQ ID NO: 1 or 3, or a fragment thereof, or encoded by a polynucleotide having at least 70% sequence identity to SEQ ID NO: 2 or 4 , or a fragment of it. In other embodiments, relaxin is a polypeptide having at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 1 or 3, or a fragment thereof, or encoded by a polynucleotide having at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 2 or 4, or its fragment.

The present invention, in some aspects, is an mRNA encoding a relaxin protein. Relaxin is a vasoactive peptide that protects the vascular system from overwork, improves kidney function, promotes cell growth and survival, and maintains proper vascular structure. Administration of relaxin to a subject provides therapeutic benefits such as treatment and prevention of fibrosis, e.g., renal fibrosis, cardiac fibrosis, or pulmonary fibrosis, and cardiovascular disease, e.g., acute heart failure, coronary artery disease, microvascular disease, acute coronary syndrome with impaired function. heart or ischemia-reperfusion.

Although relaxin provides significant therapeutic benefits, wild-type recombinant relaxin has a short half-life, making it difficult to achieve therapeutic levels in the body. A recombinant form of relaxin called Serelaxin, supplied by Novartis, has been shown to have low toxicity, but its effectiveness is questionable because it breaks down too quickly in the bloodstream. Serelaxin has a half-life of approximately 15 minutes in serum and 7-8 hours over a continuous 48-hour infusion.

In some aspects, the present invention is a therapeutic relaxin, namely mRNA encoding a stabilized relaxin or wild-type protein, such as a relaxin-immunoglobulin fusion protein, which has a significantly increased half-life and thus may be more effective in treating a disease. In other aspects, the therapeutic relaxin is a relaxin-based fusion protein. In addition, the longer half-life of the stabilized relaxin therapeutics described herein may allow for the use of fewer doses in a patient with a longer period between doses. Although pegylated forms of relaxin have been shown to be more stable than wild-type relaxin, the increase in serum stability compared to Serelaxin is only about 13.5%. The stable fusion proteins of the present invention are significantly more stable. For example, a fusion protein in which the VLk region is fused behind the A chain of relaxin has an increased serum half-life of 1-2 weeks relative to serelaxin.

The ability to activate RXFP1 and/or RXFP2 refers to an increase in activation relative to the level of activation in the absence of a relaxin-based therapeutic agent. The ability to activate can be assessed, for example, using an in vitro or in vivo assay, such as the assays described herein.

The relaxin-based fusion protein used herein is a protein composed of relaxin coupled to a stabilizing protein. In some embodiments, the stabilizing protein is an immunoglobulin protein. In other embodiments, the stabilizing protein is a VLk protein.

The relaxin nucleic acid or relaxin mRNA used herein is an RNA encoding wild-type relaxin, a variant or fragment thereof (referred to as wild-type relaxin), or an RNA encoding a relaxin-based fusion protein, i.e. relaxin associated with a stabilizing protein (called the relaxin-based stabilized fusion protein). In some embodiments, the stabilizing protein is an immunoglobulin protein. In other embodiments, the stabilizing protein is a VLk protein.

The relaxin therapeutics of the present invention are useful in the treatment of various disorders. For example, relaxin-based therapeutics are useful in the treatment of heart failure (acute or chronic), as well as single dose indications and chronic indications. Single dose indications include, but are not limited to, acute heart failure (non-ischemic), acute coronary syndrome with cardiac dysfunction, ischemia/reperfusion associated with transplantation of parenchymal organs such as lung, kidney, liver, heart, extracorporeal circulation organ protection, e.g., healing of the kidney and cornea, that is, with ophthalmic administration. Indications for long-term administration include, without limitation, chronic heart failure, diabetic nephropathy, NASH, atrial fibrillation, cardiac fibrosis, diabetic wound healing, and cirrhosis.

Heart failure (HF) involves the failure of the left ventricle to fill or eject blood, reducing the ability to deliver oxygenated blood to other parts of the body. It is more common, more costly, and causes more deaths than cancer. Heart failure is a complex disease with a variety of causes and various comorbidities. Some of the major causes of HF include: coronary heart disease, acute coronary syndrome, high blood pressure, abnormal heart valve(s), cardiomyopathy, myocarditis, congenital heart disease(s), diabetes, obesity, lung disease, and sleep apnea. In response to heart failure, the body tries to adapt and deliver the required blood, which can lead to an enlarged heart, increased heart muscle mass, increased heart rate, vasoconstriction, and blood flow away from other organs. Treatment decisions are usually made on a case-by-case basis due to the heterogeneity of the disease.

There are two types of HF: acute (approximately 10% of HF cases), which develops rapidly and requires hospitalization, and chronic (approximately 90% of HF cases), which develops gradually and requires long-term treatment. Among these two types, there are four classes of heart failure: class I (asymptomatic, 40% of patients with HF), class II (HF symptoms with moderate exertion, 30% of patients with HF), class III (HF symptoms with minimal exertion, 20% of patients with HF) and class IV (symptoms of HF at rest, 10% of patients with HF). Mortality in patients with heart failure is as follows: in-hospital (6%), 30 days after discharge (11%), one year (30%) and five years (50%).

Heart failure can be quantified using the ejection fraction (EF), a measure of how well the heart is pumping blood around the body. When determining EF, the amount of blood in the heart is compared with the amount of blood expelled. It is calculated as the amount of blood expelled divided by the amount of blood in the chambers of the heart.

In some embodiments, the relaxin mRNA of the present invention is used for the treatment of acute HF, both for inpatient dosing and post-administration. In additional embodiments, the relaxin mRNA is used to alleviate symptoms of HF, prevent disease progression and mortality, and/or reduce hospitalizations due to HF. In other embodiments, the relaxin mRNA of the present invention is used to treat diseases such as acute. coronary syndrome with impaired cardiac function, ischemia/reperfusion associated with solid organ transplantation (eg, lung, kidney, liver, and/or heart), extracorporeal circulation (eg, to protect kidney function), corneal healing, diabetic nephropathy, non-alcoholic steatohepatitis ( NASH), atrial fibrillation (fibrosis of the heart), wound healing in a diabetic patient, and cirrhosis.

One skilled in the art will appreciate that the therapeutic efficacy of a drug or treatment of the present invention can be characterized or determined by measuring the level of expression of the encoded protein in a sample or samples taken from a subject (e.g., a subject in a preclinical trial (rodent, primate, etc.). e) or in a clinical investigation subject (human).Similarly, the therapeutic efficacy of a drug or treatment of the present invention can be characterized or determined by measuring the level of activity of the encoded protein in a sample or samples taken from a subject (e.g., from a subject in a preclinical trial). (rodent, primate, etc.) or in a clinical trial subject (human) In addition, the therapeutic efficacy of a drug or treatment of the present invention can be characterized or determined by measuring the level of the relevant biomarker in the sample(s) taken at the subject. Protein and/or biomarker levels can be determined after administration of a single dose of an mRNA therapeutic agent of the present invention, or can be determined and/or monitored for several time points after administration of a single dose, or can be determined and/or monitored throughout the course of treatment eg, multiple dose treatments.

Relaxin protein expression levels

Certain aspects of the present invention include measuring, detecting and/or monitoring the level or levels of expression of the relaxin protein in a subject, eg, an animal (eg, rodents, primates, etc.) or a human. Animals include normal, healthy or wild-type animals, as well as animals from models used for the study of cardiovascular diseases and their treatment. Illustrative animal models include rodent models, for example, relaxin-deficient mice, also referred to as mice with cardiovascular disease. Relaxin protein expression levels can be measured or determined by any method known in the art to determine protein levels in biological samples, such as a serum or plasma sample. As used herein, the term "level" or "protein level" preferably means the weight, mass, or concentration of a protein in a sample or subject. One skilled in the art will appreciate that, in certain embodiments, the sample may be subjected to, for example, any of the following: purification, precipitation, separation, such as centrifugation and/or HPLC, and then a protein level determination, such as using mass spectrometric or spectrometric analyses. In exemplary embodiments, an enzyme-linked immunosorbent assay (ELISA) can be used to determine protein expression levels. In other exemplary embodiments, protein purification, separation, and LC-MS can be used as a means to determine protein levels in accordance with the present invention. In some embodiments, administration of an mRNA therapeutic agent of the present invention (e.g., a single intravenous dose) results in an increase in plasma or serum relaxin protein expression levels in the subject (e.g., 2-fold, 3-fold, 4-fold, 5 -fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold increase and/or increase by at least 50%, at least 60%, at least 70%, at least 75 %, 80%, at least 85%, at least 90%, at least 95%, or at least 100% of normal levels) for at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, at least 108 hours, at least 122 hours after administering a single dose of an mRNA-based therapeutic drug.

Relaxin protein activity

In patients with cardiovascular disease, relaxin activity is reduced, for example, to about 25%, 30%, 40%, or 50% of normal. Additional aspects of the present invention include measuring, detecting and/or monitoring the level(s) of relaxin protein activity in a subject, eg an animal (eg a rodent, primate, etc.) or a human subject. Activity levels can be measured or determined by any method known in the art to determine activity levels in biological samples. Used in this document, the term "level of activity" preferably means the activity of the protein on the volume, mass or weight of the sample or total protein in the sample.

In exemplary embodiments, an mRNA therapeutic agent of the present invention provides a pharmaceutical composition containing an mRNA dose that is effective to achieve at least 5 U/mg, at least 10 U/mg, at least 20 U/mg, at least at least 30 U/mg, at least 40 U/mg, at least 50 U/mg, at least 60 U/mg, at least 70 U/mg, at least 80 U/mg, at least 90 u/mg, at least 100 u/mg, or at least 150 u/mg of relaxin activity in tissue (eg, blood plasma) for 6-12 hours or 12-24, for 24-48 or 48- 72 hours after administration (eg, within 48 or 72 hours after administration). In exemplary embodiments, an mRNA therapeutic agent of the present invention comprises a pharmaceutical composition containing an mRNA dose that is effective to achieve at least 50 U/mg, at least 100 U/mg, at least 200 U/mg, at least at least 300 U/mg, at least 400 U/mg, at least 500 U/mg, at least 600 U/mg, at least 700 U/mg, at least 800 U/mg, at least 900 u/mg, at least 1000 u/mg or at least 1500 u/mg plasma relaxin activity within 6-12 hours or within 12-24, within 24-48 or 48-72 hours after administration (for example, within 48 or 72 hours after administration).

In exemplary embodiments, an mRNA therapeutic of the present invention comprises a pharmaceutical composition containing a single intravenous dose of mRNA that results in the levels of activity described above. In another embodiment, the mRNA therapeutic agent of the present invention comprises a pharmaceutical composition that can be administered intravenously in multiple single doses of mRNA maintaining the activity levels described above.

Relaxin biomarkers

Additional aspects of the present invention include determining the level (or levels) of a biomarker, for example, B-type natriuretic peptide (BNP), cystatin C, BNP N-terminal prohormone (NT-proBNP), determined in a sample compared to a level (for example, a reference level) of the same or a different biomarker in another sample, e.g. from the same patient, from a different patient, at a control and/or at the same or different time point and/or compared to physiological level and/or elevated level, and /or a level above the physiological, and / or a level of control. The person skilled in the art is familiar with physiological levels of biomarkers, e.g., levels in normal or wild-type animals, normal or healthy subjects, and the like, in particular the level or levels that are characteristic of subjects that are healthy and/or normally functioning. . As used herein, the phrase "elevated level" means an amount that is greater than that normally found in a normal or wild-type animal in a preclinical study, or in a normal or healthy subject, such as a human. As used herein, the term "above physiological" means an amount that is greater than is normally found in a normal or wild-type animal in a preclinical study, or in a normal or healthy subject, e.g., a human, optionally producing a substantially enhanced physiological response. Used in this document, the expression "comparison" or "compared to" preferably means a mathematical comparison of two or more values, for example, levels of biomarker(s). Thus, a person skilled in the art will understand whether one of the values is higher, lower or identical to another value or group of values if at least two such values are compared with each other. The comparison or comparison may be in the context of, for example, a comparison with a control value, for example, compared to a reference serum NT-proBNP level, a reference serum cystatin C level, and/or a reference serum BNP level in said subject prior to administration. (eg, in a person suffering from a cardiovascular disease) or in a normal or healthy subject. Comparison or comparison can also be in the context of, for example, comparison with a control value, for example, compared with a reference level of urinary excretion of NT-proBNP, or a level of BNP, cystatin C, NT-proBNP in the blood serum of a specified subject before administration (for example , in a person suffering from cardiovascular disease), or in a normal or healthy subject.

As used herein, the expression "control" is preferably a sample from a subject where the cardiovascular disease status of said subject is confirmed. In one embodiment, the control is a sample from a healthy patient. In another embodiment, the control is a sample from at least one subject having a confirmed cardiovascular disease status, such as severe, moderate, or healthy cardiovascular disease status, such as a control patient. In another embodiment, the control is a sample from a subject who is not receiving treatment for cardiovascular disease. In yet another additional embodiment, the control is a sample from a single subject or a group of samples from different subjects and/or samples taken from the subject(s) at different points in time.

The terms "level" or "level of the biomarker", as used in this document, preferably means the mass, weight or concentration of the biomarker of the present invention in a sample or subject. The biomarkers of the present invention include, for example, BNP, cystatin C, NT-proBNP. One skilled in the art will appreciate that, in certain embodiments, the sample may be subjected to, for example, one or more of the following: purification of the substance, precipitation, separation, such as centrifugation and/or HPLC, and then a biomarker level determined, for example, using masses -spectrometric analysis. In illustrative embodiments, LC-MS can be used as a means to determine the level of a biomarker in accordance with the present invention.

The term "level determination" of a biomarker, as used herein, may refer to methods that include determining the amount of at least one substance in a sample from a subject, for example, in a biological fluid from a subject (for example, in blood serum, blood plasma, urine, blood , lymph, faeces, etc.) or tissue from the subject (eg, liver, heart, spleen, kidney, etc.).

The term "reference level" as used herein may refer to levels (e.g., of a biomarker) in a subject prior to administration of an mRNA therapeutic agent of the present invention (e.g., in a human suffering from cardiovascular disease) or in a normal or healthy subjects.

As used herein, the terms "normal subject" or "healthy subject" refers to a subject not suffering from symptoms associated with cardiovascular disease. Moreover, a subject will be considered normal (or healthy) if they do not have a mutation in the functional parts or domains of a gene called relaxin (relaxin) and/or do not have a relaxin gene mutation resulting in a decrease or deficiency of relaxin or its activity, resulting in symptoms associated with cardiovascular disease. These mutations will be detected if a sample from the subject is subjected to genetic testing for such relaxin mutations. In exemplary embodiments of the present invention, a sample from a healthy subject is used as a control, or a known or standardized value of the biomarker level in samples from healthy or normal subjects is used as a control.

In some embodiments, comparing the level of a biomarker in a sample from a subject in need of treatment for a cardiovascular disease, or from a subject who is being treated for a cardiovascular disease, to a control level of the biomarker comprises comparing the level of the biomarker in a sample from the subject (in need of treatment). or receiving treatment for cardiovascular disease) with a baseline or reference level, where if the level of the biomarker in a sample from a subject (in need of treatment or receiving treatment for cardiovascular disease) is increased, increased or higher compared to baseline or reference level, this indicates that the subject is suffering from a cardiovascular disease and/or in need of treatment; and/or if the level of the biomarker in a sample from a subject (in need of treatment or receiving treatment for a cardiovascular disease) is reduced or reduced from baseline, this indicates that the subject is not suffering from a cardiovascular disease, is being successfully treated, or is not needs treatment for cardiovascular disease. The greater the reduction (e.g., at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least at least 8-fold, at least 10-fold reduction and/or at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% reduction) of a biomarker, e.g. BNP, cystatin C, NT-proBNP, over a specified period of time, e.g. hours, within 12 hours, 24 hours, 36 hours, 48 hours, 60 hours or 72 hours, and/or within a specified period of time, such as 48 hours, 72 hours, 96 hours, 120 hours, 144 hours, 1 week , 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, etc., the more successful is the treatment, such as, for example, an mRNA-based therapeutic agent of the present invention (eg, single dose or multiple administration regimen).

Reduction of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80% , at least about 90%, at least 100% or more of the biomarker level, particularly in a biological fluid (e.g., blood plasma, urine, e.g., urinary sediment) or tissue(s) in a subject (e.g. , in the liver, heart, spleen, kidney, brain or lungs), e.g. BNP, cystatin C, NT-proBNP, for 1, 2, 3, 4, 5, 6 or more days after administration indicates a dose suitable for successful treatment of cardiovascular disease, where reduction, as used herein, preferably means that the level of the biomarker, determined at the end of the specified time period (for example, after administration, for example, a single dose intravenously), is compared with the level of the same biomarker, determined at the beginning of the specified time period (eg, prior to the administration of the specified dose). Exemplary time periods include 12, 24, 48, 72, 96, 120 or 144 hours after administration, in particular 24, 48, 72 or 96 hours after administration.

A sustained decrease in substrate levels (eg, BNP, cystatin C, NT-proBNP) is particularly indicative of an mRNA therapeutic regimen and/or administration that has been successfully used to treat cardiovascular disease. Such a steady decline may be referred to herein as the "duration" of the effect. In illustrative embodiments, a reduction of at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least at least about 80%, at least about 85%, at least about 90%, or at least about 95% or more of the biomarker level, particularly in a biological fluid (e.g., blood plasma, urine, e.g., urinary sediment) or tissue(s) in a subject (e.g., liver, heart, spleen, kidney, brain, or lungs), e.g., BNP, cystatin C, NT-proBNP, for 4, 5, 6, 7, 8, or more than days after administration indicates a successful therapeutic approach. In exemplary embodiments, a sustained decrease in substrate (eg, biomarker) levels in one or more samples (eg, fluids and/or tissues) is preferred. For example, mRNA-based drugs resulting in a sustained decrease in BNP, cystatin C, NT-proBNP (as defined herein), optionally in combination with a sustained decrease in said biomarker in at least one tissue, preferably two, three, four, five or more tissue types indicate successful treatment.

In some embodiments, a single dose of an mRNA therapeutic agent of the present invention is from about 0.2 to about 0.8 mg/kg, from about 0.3 to about 0.7 mg/kg, from about 0.4 to about 0.8 mg/kg or approximately 0.5 mg/kg. In another embodiment, a single dose of an mRNA therapeutic agent of the present invention is less than 1.5 mg/kg, less than 1.25 mg/kg, less than 1 mg/kg, or less than 0.75 mg/kg.

RNA polynucleotides useful in the present invention include RNA encoding one or more relaxin proteins.

In some embodiments, the RNA polynucleotide formulated in the ionizable lipid nanoparticle has a therapeutic index greater than 10% of the therapeutic index for the RNA polynucleotide alone. In other embodiments, the RNA polynucleotide formulated in the ionizable lipid nanoparticle has a therapeutic index greater than 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the therapeutic index for the RNA polynucleotide. separately. The therapeutic index (TI) (also called therapeutic ratio) is a comparison of the amount of a therapeutic agent that produces a therapeutic effect with the amount that causes toxicity.

The present invention includes methods for improving the stability or circulation time of relaxin proteins. In some embodiments, the composition has a circulatory half-life of greater than 20 minutes. In some embodiments, the composition has a circulating half-life of 20-500 minutes, 30-500 minutes, 50-500 minutes, 30-300 minutes, 30-200 minutes, 30-100 minutes, 50-500 minutes, 50-400 minutes, 50-300 minutes, 50-200 minutes, 50-100 minutes, 100-500 minutes, 100-400 minutes, 100-300 minutes, 100-200 minutes or 100-150 minutes. In other embodiments, the relaxin-based fusion protein has at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85 %, 90%, 95%, or 99% increase in circulating half-life compared to wild-type relaxin half-life levels.

Another advantage of the methods of the present invention is that the increase in the level of relaxin protein is achieved quickly after dosing to the subject. For example, therapeutic or maximum therapeutic levels can be reached within 1, 2, 3, or 4 hours after dosing to a subject. The term "Smax". refers to the maximum (or peak) serum concentration reached by a drug in a particular compartment or test site in the body after administration of the drug and before the administration of a second dose. Tmax. refers to the time the maximum plasma concentration is reached after drug administration; when the absorption rate is equal to the release rate.

The sequences of isoforms 1 and 2 for wild-type relaxin are described in the NCBI Reference Sequence Database (RefSeq) under accession numbers NM_134441.2 and NM_005059.3, respectively ("Homo sapiens relaxin 2 (RLN2), transcript variant 1" (SEQ ID NO: 325 ) and "Homo sapiens relaxin 2 (RLN2), transcript version 2" (SEQ ID NO: 326)). The canonical sequence of the wild-type relaxin protein is described in the RefSeq database under accession number AAI26416.1 ("relaxin 2 [Homo sapiens]") (SEQ ID NO: 1).

In certain aspects, the present invention provides a polynucleotide (eg, a ribonucleic acid (RNA), eg, messenger RNA (mRNA)) comprising a nucleotide sequence (eg, an open reading frame (ORF)) encoding a relaxin polypeptide. In some embodiments, the relaxin polypeptide of the present invention is a wild-type relaxin or a variant relaxin protein. In some embodiments, the relaxin polypeptide of the present invention is a variant, peptide or polypeptide having a substitution and insertion and/or addition, deletion and/or covalent modification with respect to the wild-type relaxin protein sequence. In some embodiments, sequence markers or amino acids can be added to the sequences encoded by the polynucleotides of the present invention (eg, from the N-terminus or C-terminus), for example, to determine localization. In some embodiments, amino acid residues located at the carboxy-terminus, amino-terminus, or internal regions of the polypeptide of the present invention may optionally be removed to form fragments.

In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) comprising a nucleotide sequence (e.g., ORF) of the present invention encodes a wild-type relaxin protein sequence substitution variant, which may contain one, two, three, or more than three substitutions. In some embodiments, the substitution variant may comprise one or more conservative amino acid substitutions. In other embodiments, the variant is an insertion variant. In other embodiments, the variant is a deletion variant.

As recognized by those skilled in the art, wild type or variant relaxin protein fragments, functional protein domains, variants, and homologous proteins (orthologs) are also considered to be encompassed by the relaxin polypeptides of the present invention.

Certain compositions and methods provided in this disclosure relate to protein or polynucleotide sequences of a wild-type or variant relaxin protein. One of skill in the art will appreciate that such disclosures apply equally to any other isoforms of relaxin proteins known in the art.

Polynucleotides and Opening Frame (ORF)

In certain aspects, the present invention provides polynucleotides (eg RNA, eg mRNA) that contain a nucleotide sequence (eg ORF) encoding one or more relaxin polypeptides. In some embodiments, the encoded therapeutic polypeptide of the present invention may be selected from:

a full-length relaxin polypeptide (eg, having the same or substantially the same length as the wild-type relaxin polypeptide);

variant, such as a functional fragment of any of the wild-type relaxin proteins described herein e.g. type, but at the same time retaining the functional activity of the protein));

variant, such as a full-length or truncated wild-type relaxin protein in which one or more amino acids are replaced, e.g., variants that retain all or most of the relaxin activity in the polypeptide compared to the reference isoform (e.g., any natural or artificial variant known in the art given area); or

a fusion protein comprising (i) a full length wild-type relaxin protein, a variant of the relaxin protein, a functional fragment or variant thereof, and/or a heterologous protein.

In certain embodiments, the encoded relaxin polypeptide is a mammalian relaxin polypeptide, such as a human relaxin polypeptide, a functional fragment or variant thereof.

In some embodiments, the polynucleotide (e.g., RNA, e.g. mRNA) of the present invention increases expression levels of the relaxin protein in cells when introduced into these cells, for example, by at least 10%, at least 15%, at least 20%, by at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% compared to protein expression levels relaxin in cells prior to administration of the polynucleotide of the present invention. Relaxin protein expression levels can be measured according to methods known in the art. In some embodiments, the implementation of the polynucleotide is introduced into cells in vitro. In some embodiments, the polynucleotide is administered to cells in vivo.

In some embodiments, a polynucleotide (eg, RNA, eg, mRNA) of the present invention comprises a codon-optimized nucleic acid sequence, wherein the open reading frame (ORF) of the codon-optimized nucleic acid sequence is derived from a relaxin protein sequence. For example, for polynucleotides of the present invention containing a sequence-optimized ORF encoding a specific relaxin protein, the corresponding wild-type sequence is the native relaxin protein. Similarly, for an optimized mRNA sequence encoding a functional fragment of the relaxin protein, the corresponding wild-type sequence is the corresponding fragment from the wild-type relaxin protein.

In some embodiments, the polynucleotides (e.g., RNA, e.g., mRNA) of the present invention comprise a nucleotide sequence encoding a wild-type relaxin protein having the full-length human wild-type relaxin protein sequence (i.e., including the initiator methionine). In the mature wild-type relaxin protein, the initiator methionine can be removed to produce a "mature relaxin protein" containing amino acid residues from 2 to all of the remaining amino acids of the translated product. The teachings of the present invention, directed at the complete sequence of the human relaxin protein, also apply to the mature form of the human relaxin protein lacking the initiator methionine. Thus, in some embodiments, the polynucleotides (e.g., RNA, e.g., mRNA) of the present invention comprise a nucleotide sequence encoding a wild-type relaxin protein having a mature human wild-type relaxin protein sequence (i.e., without the initiator methionine). In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the present invention comprising a nucleotide sequence encoding a wild-type relaxin protein having a full-length or mature wild-type human relaxin protein sequence is sequence-optimized.

In some embodiments, the polynucleotides (eg, RNA, eg mRNA) of the present invention comprise a nucleotide sequence (eg, ORF) encoding a mutant relaxin polypeptide. In some embodiments, the polynucleotides of the present invention comprise an ORF encoding a relaxin polypeptide that contains at least one point mutation in the relaxin protein sequence and retains the activity of the relaxin protein. In some embodiments, the mutant relaxin polypeptide has a relaxin activity that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the relaxin activity of the corresponding wild-type relaxin protein (i.e. the same wild-type relaxin protein, but without the mutation(s) )). In some embodiments, a polynucleotide (eg RNA, eg mRNA) of the present invention containing an ORF encoding a mutant relaxin polypeptide is sequence optimized.

In some embodiments, a polynucleotide (eg, RNA, eg, mRNA) of the present invention comprises a nucleotide sequence (eg, ORF) that encodes a relaxin polypeptide with mutations that do not alter the activity of the relaxin protein. Such mutant relaxin polypeptides can be called functionally neutral. In some embodiments, the implementation of the polynucleotide contains an ORF that encodes a mutant relaxin polypeptide containing one or more functionally neutral point mutations.

In some embodiments, the mutant relaxin polypeptide has higher relaxin protein activity than the corresponding wild-type relaxin protein. In some embodiments, the mutant relaxin polypeptide has a relaxin activity that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% higher than the activity of the corresponding wild-type relaxin protein (i.e. the same wild-type relaxin protein, but without the mutation (mutations)).

In some embodiments, the polynucleotides (e.g., RNA, e.g., mRNA) of the present invention comprise a nucleotide sequence (e.g., ORF) encoding a functional fragment of a relaxin protein, such as when one or more fragments correspond to a polypeptide subsequence of a wild-type relaxin polypeptide and retain the activity of the relaxin protein. In some embodiments, the relaxin protein fragment has an activity that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80 %, at least 85%, at least 90%, at least 95%, or at least 100% of the relaxin protein activity of the corresponding full-length relaxin protein. In some embodiments, the polynucleotides (eg RNA, eg mRNA) of the present invention containing an ORF encoding a functional fragment of a relaxin protein are sequence optimized.

In some embodiments, the polynucleotide (eg, RNA, eg, mRNA) of the present invention comprises a nucleotide sequence (eg, ORF) encoding a relaxin protein fragment having higher relaxin protein activity than the corresponding full-length relaxin protein. Thus, in some embodiments, a relaxin protein fragment has a relaxin activity that is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35% %, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% higher than the relaxin activity of the corresponding full length relaxin protein.

In some embodiments, the polynucleotide (e.g., RNA, e.g. mRNA) of the present invention comprises a nucleotide sequence (e.g., ORF) encoding a relaxin protein fragment that is at least 1%, 2%, 3%, 4%, 5%, 6% %, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25% shorter than the wild-type relaxin protein.

In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the present invention contains from about 1200 to about 100,000 nucleotides (e.g., 1200 to 1500, 1200 to 1600, 1200 to 1700, 1200 to 1800, 1200 to 1900, from 1200 to 2000, from 1300 to 1500, from 1300 to 1600, from 1300 to 1700, from 1300 to 1800, from 1300 to 1900, from 1300 to 2000, from 1.425 to 1500, from 1425 to 16 00, from 1425 up to 1700, from 1425 to 1800, from 1425 to 1900, from 1425 to 2000, from 1425 to 3000, from 1425 to 5000, from 1425 to 7000, from 1425 to 10000, from 1425 to 25000, from 1425 to 5 0000, from 1425 up to 70000 or from 1425 to 100000).

In some embodiments, a polynucleotide of the present invention (e.g., RNA, e.g., mRNA) contains a nucleotide sequence (e.g., ORF) encoding a relaxin polypeptide (e.g., a wild-type sequence, a functional fragment or variant thereof), where the length of the nucleotide sequence (e.g., ORF) is at least 500 nucleotides (e.g., at least or more than about 500, 600, 700, 80, 900, 1000, 1100, 1200, 1300, 1400, 1425, 1450, 1500, 1600, 1700, 1800, 1900, 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3.400 3500 3600 , 4100, 4200, 4300, 4400, 4500 , 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5.300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 7000, 8.000, 9000, 10000, 20 000, 30000, 40000, 50000, 60000, 70000 , 80,000, 90,000 or up to and including 100,000 nucleotides).

In some embodiments, a polynucleotide of the present invention (e.g., RNA, e.g., mRNA) comprising a nucleotide sequence (e.g., ORF) encoding a relaxin polypeptide (e.g., a wild-type sequence, a functional fragment or variant thereof) further comprises at least one nucleic acid sequence an acid that is non-coding, for example, a miRNA binding site.

In some embodiments, a polynucleotide of the present invention comprising a nucleotide sequence (eg, ORF) encoding a relaxin polypeptide (eg, wild-type sequence, functional fragment, or variant thereof) is RNA. In some embodiments, a polynucleotide of the present invention is a messenger RNA or functions as a messenger RNA (mRNA). In some embodiments, the mRNA contains a nucleotide sequence (eg, ORF) that encodes at least one relaxin polypeptide and can be translated to produce the encoded relaxin polypeptide in vitro, in vivo, in situ, or ex vivo.

In some embodiments, a polynucleotide of the present invention (e.g., RNA, e.g., mRNA) comprises a sequence-optimized nucleotide sequence (e.g., ORF) encoding a relaxin polypeptide (e.g., a wild-type sequence, a functional fragment or variant thereof), wherein the polynucleotide contains at least one chemically modified nucleotide base, for example, 5-methoxyuracil. In some embodiments, the polynucleotide further comprises a miRNA binding site, such as a miRNA binding site that binds to miR-142. In some embodiments, a polynucleotide disclosed herein is formulated with a delivery vehicle, such as an ionizable lipid nanoparticle containing, for example, a lipid having formula (I), (IA), (II), (IIa), (IIb), ( IIc), (IId) or (IIe), for example any of compounds 1-232.

Signal sequences

The polynucleotides (eg RNA, eg mRNA) of the present invention may also contain nucleotide sequences encoding additional features that facilitate the movement of encoded polypeptides to therapeutically relevant sites. One such characteristic that helps a protein move is the signal sequence or targeting sequence. The peptides encoded by these signal sequences are known by a variety of names, including targeting peptides, transit peptides, and signal peptides. In some embodiments, the polynucleotide (eg, RNA, eg, mRNA) contains a nucleotide sequence (eg, ORF) that encodes a signal peptide operably linked to a nucleotide sequence that encodes the relaxin polypeptide described herein.

In some embodiments, a "signal sequence" or "signal peptide" is a polynucleotide or polypeptide, respectively, about 9-200 nucleotides (3-70 amino acids) in length, which is optionally inserted at the 5' (or N-terminus) of the coding region or polypeptide, respectively. The addition of these sequences results in the movement of the encoded polypeptide to the desired site, such as the endoplasmic reticulum or mitochondria, via one or more targeting pathways. Some signal peptides are cleaved from the protein, for example by a signal peptidase, after the proteins have been transferred to the desired site.

In some embodiments, a polynucleotide of the present invention comprises a nucleotide sequence encoding a wild-type relaxin polypeptide, wherein the nucleotide sequence further comprises a 5' nucleic acid sequence encoding a native signal peptide. In another embodiment, the polynucleotide of the present invention comprises a nucleotide sequence encoding a wild-type relaxin polypeptide, wherein the nucleotide sequence does not contain a nucleic acid sequence encoding a native signal peptide.

In some embodiments, a polynucleotide of the present invention comprises a nucleotide sequence encoding a relaxin polypeptide, wherein the nucleotide sequence further comprises a 5' nucleic acid sequence encoding a heterologous signal peptide.

Fusion proteins

In some embodiments, the relaxin therapeutic is a polypeptide or polynucleotide (eg, RNA, eg, mRNA) that contains more than one nucleic acid sequence (eg, ORF) encoding the polypeptide of interest. In some embodiments, the polynucleotides of the present invention comprise a single ORF encoding a relaxin polypeptide, functional fragment, or variant thereof. However, in some embodiments, a polynucleotide of the present invention may contain more than one ORP, for example, a first ORF encoding a relaxin polypeptide (the first polypeptide of interest), a functional fragment or variant thereof, and a second ORF expressing a second polypeptide, such as a stabilizing sequence. In some embodiments, two or more polypeptides of interest may be genetically fused, that is, two or more polypeptides may be encoded by the same ORF. In some embodiments, the polynucleotide may comprise a nucleic acid sequence encoding a linker (eg, a G ₄ S peptidic linker (SEQ ID NO: 588) or other linker known in the art) between two or more polypeptides of interest.

In some embodiments, a polynucleotide of the present invention (eg, RNA, eg, mRNA) may contain two, three, four, or more ORFs, each of which expresses a polypeptide.

In some embodiments, a polynucleotide of the present invention (e.g., RNA, e.g., mRNA) may comprise a first nucleic acid sequence (e.g., a first ORF) encoding a relaxin polypeptide and a second nucleic acid sequence (e.g., a second ORF) encoding a second polypeptide, such as stabilization sequence.

The stabilizing sequence used herein is a peptide sequence that provides stability to the fusion protein. The stabilizing sequence may, in some embodiments, be an immunoglobulin (Ig) or a fragment thereof. Immunoglobulins include four IgG subclasses (IgG1, 2, 3, and 4) in humans, named in order of their serum levels. The IgG isotype consists of two light chains and two heavy chains, where each heavy chain contains three heavy chain constant domains (C _H1 , C _H2 , C _H3 ). The two heavy chains of IgG are linked to each other and each of them with a light chain by disulfide bonds. The IgG antigen-binding site is located in the antigen-binding fragment (Fab region), which contains the light (V _L ) and heavy (V _H ) chain variable domains, as well as the light ( _CL ) and heavy (C _H1 ) chain constant domains. The crystallizable immunoglobulin fragment (Fc region) of IgG is the portion of the heavy chain containing the C _H2 and C _H3 domains that binds to the Fc receptor found on the surface of certain cells, including the neonatal Fc receptor (FcRn). The heavy chain of IgG also has a hinge region between the C _H1 and C _H2 domains that separates the Fab region from the Fc region and is involved in joining the two heavy chains together via disulfide bonds.

In some embodiments, the Ig fragment is part of a heavy chain constant region (CH ₎ or a heavy chain variable region (V _H ) derived from an Ig molecule. An Ig fragment may include any portion of a heavy chain constant or variable region, including one or more heavy chain constant or variable region domains, a hinge region, an Fc region, and/or combinations thereof.

In some embodiments, the Ig fragment is part of a light chain constant region (C _L ) or a light chain variable region (V _L ) derived from an Ig molecule. An Ig fragment may include any portion of a light chain constant or variable region, including one or more light chain constant or variable region domains, a hinge region, an Fc region, and/or combinations thereof.

In some embodiments, the Ig fragment of the fusion protein contains a single chain Fc (sFc or scFc), a monomer that is incapable of forming a dimer. In some embodiments, the fusion protein includes a sequence corresponding to the hinge region of an immunoglobulin. In various embodiments, the hinge region contains a modification that prevents the formation of a disulfide bond between the fusion protein and another fusion protein or another immunoglobulin molecule. In some embodiments, the hinge region is modified by introducing a mutation and/or deletion of one or more cysteine amino acids to prevent the formation of a disulfide bond.

In some embodiments, the Ig fragment is a kappa light chain variable region (VLk) sequence.

In a fusion protein, relaxin can be linked to the N-terminus of an Ig fragment. Alternatively, in the fusion protein, relaxin can be linked to the C-terminus of the Ig fragment. In specific embodiments, the implementation of the fusion protein contains relaxin at its N-terminus, which is associated with VLk. In other embodiments, the fusion protein contains a relaxin at its C-terminus that is linked to VLk.

The bond formation may be by a covalent bond, and preferably by a peptide bond. The fusion protein may optionally contain at least one linker. Thus, relaxin may be indirectly associated with the Ig fragment. The linker may be between the relaxin and the Ig fragment. The linker can be linked to the N-terminus of the Ig fragment or the C-terminus of the Ig fragment. In one embodiment, the linker includes amino acids. The linker may include 1-5 amino acids.

Sequence optimization of the nucleotide sequence encoding the relaxin polypeptide

In some embodiments, a polynucleotide (eg RNA, eg mRNA) of the present invention is sequence optimized. In some embodiments, the polynucleotide (e.g., RNA, e.g. mRNA) of the present invention comprises a nucleotide sequence (e.g., ORF) encoding a relaxin polypeptide, a nucleotide sequence (e.g., ORF) encoding another polypeptide of interest, 5'-UTR, 3' -UTR, miRNA, nucleotide sequence encoding the linker, or any combination thereof that is sequence optimized.

A sequence-optimized nucleotide sequence, e.g., a codon-optimized mRNA sequence encoding a relaxin polypeptide, is a sequence containing at least one synonymous nucleotide base substitution relative to a reference sequence (e.g., a wild-type nucleotide sequence encoding a relaxin polypeptide).

The sequence-optimized nucleotide sequence may partially or completely differ in sequence from the reference sequence. For example, a reference sequence encoding a polyserine uniformly encoded by TCT codons can be optimized for sequence by substituting 100% of its nucleotide bases (in each codon, replace T at position 1 with A, C at position 2 with G, and T at position 3 replace with C) to obtain a polyserine coding sequence that will be encoded uniformly by AGC codons. The percent sequence identity resulting from the global pairwise alignment of the reference nucleic acid sequence for polyserine and the sequence-optimized nucleic acid sequence for polyserine will be 0%. However, the protein products of both sequences will be 100% identical.

Several sequence optimization techniques (also sometimes referred to as codon optimization) are known in the art and may be useful in achieving one or more desired results. These results may include, for example, the selection of codon frequencies in certain target tissues and/or host organisms to ensure correct folding; shifting G/C content to increase mRNA stability or reduce secondary structures; minimizing tandem repeats of codons or base rows that can impair gene design or expression; individual choice of transcription and translation regulation sites; insertion or deletion of sequences to move the protein; deletion/addition of post-translational modification sites in the encoded protein (eg, glycosylation sites); adding, removing, or shuffling protein domains; introduction or removal of restriction sites; modification of ribosome binding sites and mRNA degradation sites; adjusting the rate of translation to allow the different domains of the protein to fold correctly; and/or reducing or eliminating problematic secondary structures within the polynucleotide. Sequence optimization tools, algorithms, and services are known in the art, and non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park, Calif.), and/or proprietary methods.

Codon options for each amino acid are shown in Table 1 below.

In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the present invention comprises a sequence-optimized nucleotide sequence (e.g., ORF) encoding a relaxin polypeptide, a functional fragment or variant thereof, wherein the relaxin polypeptide, functional fragment or variant thereof is encoded by the optimized sequence by nucleotide sequence has improved properties (e.g., compared to a relaxin polypeptide, a functional fragment thereof, or a variant encoded by a reference nucleotide sequence that is not sequence-optimized), for example, improved properties associated with expression efficiency after in vivo administration. Such properties include, but are not limited to, improved nucleic acid stability (e.g., mRNA stability), increased efficiency of translation in target tissues, reduced expression of truncated proteins, improved folding or prevention of misfolding of expressed proteins, reduced toxicity of expressed products, reduced cell death caused by expressed proteins. products, increase and/or decrease in protein aggregation.

In some embodiments, the sequence-optimized nucleotide sequence is codon-optimized for human expression, yet has structural and/or chemical characteristics that avoid one or more problems in the art, such as characteristics that are useful for composition and delivery optimization. nucleic acid-based therapeutics while maintaining structural and functional integrity; overcoming the threshold of expression; expression rate improvements; half-life and/or protein concentration; optimizing protein localization and preventing detrimental biological responses such as immune response and/or degradation pathways.

In some embodiments, the polynucleotides of the present invention comprise a nucleotide sequence (e.g., a nucleotide sequence (e.g., ORF) encoding a relaxin polypeptide, a nucleotide sequence (e.g., ORF) encoding another polypeptide of interest, 5'-UTR, 3'-UTR , miRNA, a nucleic acid sequence encoding a linker, or any combination thereof) that is sequence-optimized according to a method comprising: (i) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a relaxin polypeptide), an alternative codon to increase or decrease the content of uridine to obtain a modified uridine sequence; (ii) replacing at least one codon in the reference nucleotide sequence (eg, the ORF encoding the relaxin polypeptide) with an alternative codon with a higher codon frequency in the set of synonymous codons; (iii) replacing at least one codon in the reference nucleotide sequence (eg, the ORF encoding the relaxin polypeptide) with an alternative codon to increase the G/C content, or (iv) a combination of the two.

In some embodiments, a sequence-optimized nucleotide sequence (eg, an ORF encoding a relaxin polypeptide) has at least one improved property relative to a reference nucleotide sequence.

In some embodiments, the sequence optimization method is multivariable and includes one, two, three, four or more of the methods disclosed herein and/or other optimization methods known in the art.

Characteristics that may be found useful in some embodiments of the present invention may be encoded by or within regions of the polynucleotide, and such regions may be located upstream (5') of the region that encodes the relaxin polypeptide, downstream (3') or within it. These regions may be included in the polynucleotide before and/or after optimization of the sequence of the protein-coding region or open reading frame (ORF). Examples of such characteristics include, but are not limited to, untranslated regions (UTRs), miRNA sequences, Kozak sequences, oligo(dT) sequences, poly(A) tail, and detectable tags, and may include multiple cloning sites that are capable of being recognized by XbaI.

In some embodiments, the implementation of the polynucleotide of the present invention contains 5'-UTR, 3'-UTR and/or miRNA. In some embodiments, the implementation of the polynucleotide contains two or more 5'-UTR and/or 3'-UTR, which may be the same or different sequences. In some embodiments, the polynucleotide contains two or more miRNAs, which may be the same or different sequences. Any portion of the 5'-UTR, 3'-UTR and/or miRNA, including none, may be sequence-optimized and may independently contain one or more different structural or chemical modifications before and/or after sequence optimization.

In some embodiments, after optimization, the polynucleotide is recovered and transformed into a vector, such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes. For example, an optimized polynucleotide can be recovered and transformed into chemically competent E. coli, yeast, neurospores, maize, fruit flies, etc., in which multicopy plasmid-like or chromosome structures occur using the methods described herein.

Sequence-Optimized Nucleotide Sequences Encoding Relaxin Polypeptides

In some embodiments, a polynucleotide of the present invention comprises a sequence-optimized nucleotide sequence encoding a relaxin polypeptide as disclosed herein. In some embodiments, a polynucleotide of the present invention comprises an open reading frame (ORF) encoding a relaxin polypeptide, wherein the ORF is sequence optimized.

The sequence-optimized nucleotide sequences disclosed herein differ from the corresponding wild-type nucleotide sequences and from other known sequence-optimized nucleotide sequences, for example, these sequence-optimized nucleic acids have unique compositional characteristics.

In some embodiments, the percentage of nucleotide bases - uracil or thymine - in a sequence-optimized nucleotide sequence (e.g., encoding a relaxin polypeptide, a functional fragment or variant thereof) is modified (e.g., reduced) compared to the percentage of nucleotide bases - uracil or thymine - in a reference wild-type nucleotide sequence. Such a sequence is referred to as a uracil-modified or thymine-modified sequence. The percentage of uracil or thymine in a nucleotide sequence can be determined by dividing the amount of uracil or thymine in the sequence by the total number of nucleotides and multiplying by 100. In some embodiments, the sequence-optimized nucleotide sequence has a lower content of uracil or thymine than the content of uracil or thymine in wild-type reference sequence. In some embodiments, the uracil or thymine content of the sequence-optimized nucleotide sequence of the present invention is greater than the uracil or thymine content of the wild-type reference sequence and still retains beneficial effects, such as increased expression and/or reduced response of the Toll-like receptor ( TLR) compared to the wild-type reference sequence.

The uracil or thymine content of the sequence disclosed herein, ie the total uracil or thymine content therein, is abbreviated herein as % U _TL or % T _TL .

The uracil or thymine modified sequence encoding the relaxin polypeptide of the present invention can also be described according to its content of uracil or thymine relative to the content of uracil or thymine in the corresponding wild-type nucleic acid sequence (% U _WT or % T _WT ), or according to its content in of uracil or thymine relative to the theoretical minimum content of uracil or thymine in the nucleic acid encoding the wild-type protein sequence (% U _TM or (% T _TM ).

The phrases "uracil or thymine content relative to uracil or thymine content in a wild-type nucleic acid sequence" refers to a parameter determined by dividing the amount of uracil or thymine in a sequence-optimized nucleic acid by the total amount of uracil or thymine in the corresponding wild-type nucleic acid sequence. and multiply by 100. This parameter is abbreviated in this document as % U _WT or % T _WT .

The content of uracil or thymine relative to the theoretical minimum content of uracil or thymine refers to the parameter determined by dividing the amount of uracil or thymine in a sequence-optimized nucleotide sequence by the total amount of uracil or thymine in a hypothetical nucleotide sequence, with all codons in the hypothetical sequence replaced by synonymous codons with the lowest possible content of uracil or thymine, and multiplying by 100. This parameter is abbreviated here as % U _TM or % T _TM .

In some embodiments, the % _UTM in the uracil-modified sequence encoding the relaxin polypeptide of the present invention is below 300%, below 295%, below 290%, below 285%, below 280%, below 275%, below 270%, below 265%, below 260%, below 255%, below 250%, below 245%, below 240%, below 235%, below 230%, below 225%, below 220%, below 215%, below 200%, below 195% , below 190%, below 185%, below 180%, below 175%, below 170%, below 165%, below 160%, below 155%, below 150%, below 145%, below 140%, below 139%, below 138%, below 137%, below 136%, below 135%, below 134%, below 133%, below 132%, below 131%, below 130%, below 129%, below 128%, below 127%, below 126% , below 125%, below 124%, below 123%, below 122%, below 121%, below 120%, below 119%, below 118%, below 117%, below 116% or below 115%.

In some embodiments, the % _UTM in the uracil-modified sequence encoding the relaxin polypeptide of the present invention is greater than 100%, greater than 101%, greater than 102%, greater than 103%, greater than 104%, greater than 105%, greater than 106%, greater than 107%, above 108%, above 109%, above 110%, above 111%, above 112%, above 113%, above 114%, above 115%, above 116%, above 117%, above 118%, above 119% , above 120%, above 121%, above 122%, above 123%, above 124%, above 125% or above 126%, above 127%, above 128%, above 129% or above 130%, above 131%, above 132%, above 133%, above 134%, above 135%, above 136%, above 137% or above 138%.

In some embodiments, the % _UTM in the uracil-modified sequence encoding the relaxin polypeptide of the present invention is 131% to 133%, 130% to 134%, 129% to 135%, 128% to 136%, from 127% to 137%, 126% to 138%, 125% to 139%, 124% to 140%, 123% to 141%, 122% to 142%, 121% to 143%, from 120 % to 144% or from 119% to 145%.

In some embodiments, the % _UTM of the uracil-modified relaxin polypeptide coding sequence of the present invention is from about 125% to about 139%, for example, from 125% to 138%.

In some embodiments, the uracil-modified sequence encoding the relaxin polypeptide of the present invention has a reduced number of contiguous uracils relative to the corresponding wild-type nucleic acid sequence. For example, two consecutive leucines can be encoded by the sequence CUUUUG, which includes a cluster of four uracils. Such a subsequence can be replaced, for example, with CUGCUC, whereby the uracil cluster is removed.

Phenylalanine may be coded for UUC or UUU. Thus, even if the phenylalanines encoded by UUU are changed to UUC, the synonymous codon still contains the uracil (UU) pair. Accordingly, the number of phenylalanines in the sequence sets the minimum number of uracil pairs (UU) that cannot be eliminated without changing the number of phenylalanines in the encoded polypeptide. For example, if a polypeptide, such as a wild-type relaxin protein, has, for example, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 phenylalanines, then the absolute minimum number of uracil pairs (UU) , which may contain a modified uracil sequence encoding a polypeptide, for example, a wild-type relaxin protein, is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23, respectively.

In some embodiments, the uracil-modified sequence encoding the relaxin polypeptide has a reduced number of uracil pairs (UU) relative to the number of uracil pairs (UU) in the wild-type nucleic acid sequence. In some embodiments, the uracil-modified sequence encoding the relaxin polypeptide of the present invention has a number of uracil pairs (UU) corresponding to the minimum possible number of uracil pairs (UU) in the wild-type nucleic acid sequence.

In some embodiments, the uracil-modified sequence encoding the relaxin polypeptide of the present invention has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16 or 17 uracil pairs (UU) is less than the number of uracil pairs (UU) in the wild-type nucleic acid sequence. In some embodiments, the uracil-modified sequence encoding the relaxin polypeptide of the present invention has 13 to 29 uracil pairs (UUs).

The phrase "uracil (UU) pairs relative to uracil (UU) pairs in the wild-type nucleic acid sequence" refers to a parameter determined by dividing the number of uracil (UU) pairs in a sequence-optimized nucleotide sequence by the total number of uracil (UU) pairs in corresponding wild-type nucleotide sequence and multiplying by 100. This parameter is abbreviated herein as % UU _wt .

In some embodiments, a polynucleotide of the present invention comprises a uracil-modified sequence encoding a relaxin polypeptide as disclosed herein. In some embodiments, the uracil-modified sequence encoding the relaxin polypeptide contains at least one chemically modified nucleotide base, such as 5-methoxyuracil. In some embodiments, at least 95% of the nucleotide base (eg, uracil) in the uracil-modified sequence encoding the relaxin polypeptide of the present invention are modified nucleotide bases. In some embodiments, at least 95% of the uracil in the uracil-modified sequence encoding the relaxin polypeptide is 5-methoxyuracil. In some embodiments, the polynucleotide comprising the uracil-modified sequence further comprises a miRNA binding site, such as a miRNA binding site that binds to miR-142. In some embodiments, a polynucleotide comprising a uracil-modified sequence is formulated with a delivery vehicle, such as an LNP containing, for example, a lipid having formula (I), (IA), (II), (IIa), (IIb), (IIc ), (IId) or (IIe), for example any of compounds 1-232.

In some embodiments, a polynucleotide of the present invention comprises an open reading frame (ORF) encoding a relaxin polypeptide, where the ORF is sequence optimized and where each of % U _TL , % U _WT , % U _TM , % G _TL , % G _WT , % G _TMX , % C _TL , % G _WT , % C _TMX , % G/C _TL , % G/C _WT or % G/C _TMX , alone or in combination, is between (i) the maximum corresponding to the maximum value parameter (MAX), plus approximately 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7 .5, 8, 8.5, 9, 9.5, or 10 standard deviations (STD DEV) and (ii) the minimum corresponding to the minimum parameter value (MIN) minus 0.5, 1, 1.5, 2, 2, 5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 standard deviations (STD DEV ).

In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70 % or at least about 75% of the codons in the reference nucleic acid sequence encoding the relaxin protein are replaced with alternative codons, each alternative codon having a codon frequency greater than the codon frequency of the substituted codon in the set of synonymous codons.

In some embodiments, at least one alternative codon having a higher codon frequency has the highest codon frequency in the set of synonymous codons. In other embodiments, all alternative codons having a higher codon frequency have the highest codon frequency in the set of synonymous codons.

In some embodiments, at least one alternative codon having a lower codon frequency has the lowest codon frequency in the set of synonymous codons. In some embodiments, all alternative codons having a higher codon frequency have the highest codon frequency in the set of synonymous codons.

In some specific embodiments, at least one alternative codon has the second highest frequency, the third highest frequency, the fourth highest frequency, the fifth highest frequency, or the sixth highest frequency in the set of synonymous codons. In some specific embodiments, at least one alternative codon has the second lowest frequency, the third lowest, the fourth lowest, the fifth lowest, or the sixth lowest in the set of synonymous codons.

Codon frequency optimization can be applied globally, as described above, or locally to a reference nucleic acid sequence encoding a relaxin polypeptide. In some embodiments, when applied locally, regions of a reference nucleic acid sequence can be modified based on codon frequency, replacing all or a certain percentage of codons in a certain subsequence with codons that have higher or lower frequencies in their respective synonymous codon sets. Thus, in some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% before new ones in a subsequence of the reference nucleic acid sequence are replaced with alternative codons, each alternative codon having a codon frequency greater than the codon frequency for the substituted codon in the synonymous codon set.

In some embodiments, at least one codon in a subsequence of a reference nucleic acid sequence encoding a relaxin polypeptide is replaced with an alternative codon having a codon frequency greater than the codon frequency of the substituted codon in the synonymic codon set, and at least one codon in the subsequence of the sequence the reference nucleic acid is replaced with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.

In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70 % or at least about 75% of the codons in a subsequence of the reference nucleic acid sequence encoding the relaxin polypeptide are replaced with alternative codons, each alternative codon having a codon frequency greater than the codon frequency of the substituted codon in the synonymous codon set.

In some embodiments, at least one alternative codon substituted in a subsequence of a reference nucleic acid sequence encoding a relaxin polypeptide and having a higher codon frequency has the highest codon frequency in the synonymous codon set. In other embodiments, all alternative codons substituted in a subsequence of the reference nucleic acid sequence and having a lower codon frequency have the lowest codon frequency in the set of synonymous codons.

In some embodiments, at least one alternative codon substituted in a subsequence of a reference nucleic acid sequence encoding a relaxin polypeptide and having a lower codon frequency has the lowest codon frequency in the set of synonymous codons. In some embodiments, all alternative codons substituted in a subsequence of the reference nucleic acid sequence and having a higher codon frequency have the highest codon frequency in the synonym codon set.

In specific embodiments, a sequence-optimized nucleic acid encoding a relaxin polypeptide may comprise a subsequence having a higher or lower overall codon frequency than the overall codon frequency in the corresponding subsequence of the reference nucleic acid sequence at a particular location, e.g., from 5' - the end or 3' end of the sequence-optimized nucleic acid, or at a predetermined distance from that site (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 , 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 codons from the 5' or 3' end of the sequence-optimized nucleic acid).

In some embodiments, a sequence-optimized nucleic acid encoding a relaxin polypeptide may contain more than one subsequence having a higher or lower overall codon frequency than the total codon frequency in the corresponding subsequence of the reference nucleic acid sequence. The skilled artisan will appreciate that subsequences with higher or lower overall codon frequencies can be arranged in multiple patterns depending on whether the overall codon frequency is higher or lower, depending on the length of the subsequence, the distance between the subsequences, subsequence locations, etc.

Modified Nucleotide Sequences Encoding Relaxin Polypeptides

In some embodiments, the polynucleotide (eg RNA, eg mRNA) of the present invention contains a chemically modified nucleotide base. The present invention includes modified polynucleotides containing the polynucleotide described herein (for example, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide). Modified polynucleotides may be chemically modified and/or structurally modified. If the polynucleotides of the present invention are chemically and/or structurally modified, then the polynucleotides may be referred to as "modified polynucleotides".

The present invention provides modified nucleosides and nucleotides in a polynucleotide (eg, in RNA polynucleotides such as mRNA polynucleotides) encoding a relaxin polypeptide. The term "nucleoside" refers to a compound containing a sugar molecule (eg, pentose or ribose) or a derivative thereof in combination with an organic base (eg, purine or pyrimidine) or derivatives thereof (also referred to herein as "nucleotide base"'). The term "nucleotide" refers to a nucleoside containing a phosphate group. Modified nucleotides can be synthesized using any applicable method, such as, for example, chemical, enzymatic or recombinant, including one or more modified or non-natural nucleosides. Polynucleotides may contain a region or regions of linked nucleosides. Such regions may have variable backbone bonds. The linkages may be standard phosphodiester linkages, in which case the polynucleotides will contain stretches of nucleotides.

The modified polynucleotides disclosed herein may contain many different modifications. In some embodiments, the modified polynucleotides contain one, two or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified polynucleotide introduced into a cell may exhibit one or more of the desired properties, such as improved protein expression, reduced immunogenicity, or reduced degradation in the cell, compared to an unmodified polynucleotide.

In some embodiments, a polynucleotide of the present invention (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide) is structurally modified. As used herein, the term "structural" modification is a modification in which two or more linked nucleosides are inserted, deleted, duplicated, inverted, or randomized in a polynucleotide without significant chemical modification of the nucleotides themselves. Because chemical bonds will inevitably be broken and re-formed to effect structural modification, structural modifications are chemical in nature and thus constitute chemical modifications. However, structural modifications will result in different nucleotide sequences. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G". The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG". A "CC" dinucleotide was inserted at this location, resulting in a structural modification of the polynucleotide.

In some embodiments, the polynucleotides of the present invention are chemically modified. As used herein in relation to a polynucleotide, the terms "chemically modified" or, if appropriate, "chemically modified" refers to a modification in relation to the ribo- or deoxyribonucleosides of adenosine (A), guanosine (G), uridine (U), or cytidine (C) in one or more of their positions, patterns, percentages, or populations. As a general rule, these terms are not intended herein to refer to modifications of ribonucleotides in native 5' mRNA caps.

In some embodiments, the polynucleotides of the present invention may be characterized by a uniform chemical modification in all or any of the nucleosides of the same type, or by a group of modifications obtained by simple downward titration of the same original modification in all or any of the nucleosides of the same type, or by a measured percentage of chemical modification. in all or any of the nucleosides of the same type, but with a random inclusion, for example, where all uridines are replaced by a uridine analogue, for example, pseudouridine or 5-methoxyuridine. In another embodiment, polynucleotides can be characterized by uniform chemical modification of two, three, or four nucleosides of the same type throughout the polynucleotide (eg, all uridines and all cytosines, etc. are modified in the same way).

Pairing between modified nucleotide bases covers not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine pairings, but also base pairing formed between nucleotides and/or modified nucleotides containing non-standard or modified bases, where the arrangement of hydrogen bond donors and acceptors hydrogen bonding allows for the formation of a hydrogen bond between a non-standard base and a standard base, or between two complementary structures of non-standard bases. One example of such non-standard base pairing is base formation between a nucleotide-modified inosine and adenine, cytosine, or uracil. Any combination of base/sugar or linker can be included in the polynucleotides of the present disclosure.

A person skilled in the art will understand that, unless otherwise indicated, the polynucleotide sequences set forth in this application will describe "T" in a representative DNA sequence, but if the sequence is RNA, then "T" will be replaced by "U".

Polynucleotide modifications (e.g., RNA polynucleotides, such as mRNA polynucleotides) that are useful in the compositions, methods, and synthetic methods of the present invention include, without limitation, the following nucleotides, nucleosides, and nucleotide bases: 2-methylthio-N6-(cis-hydroxyisopentenyl ) adenosine; 2-methylthio-N6-methyladenosine; 2-methylthio-N6-threonylcarbamoyladenosine; N6-glycylcarbamoyladenosine; N6-isopentenyladenosine; N6-methyladenosine; N6-threonylcarbamoyladenosine; 1,2'-O-dimethyladenosine; 1-methyladenosine; 2'-O-methyladenosine; 2'-O-ribosyladenosine (phosphate); 2-methyladenosine; 2-methylthio-N6 isopentenyladenosine; 2-methylthio-N6-hydroxynorvalylcarbamoyladenosine; 2'-O-methyladenosine; 2'-O-ribosyladenosine (phosphate); isopentenyladenosine; N6-(cis-hydroxyisopentenyl)adenosine; N6,2'-O-dimethyladenosine; N6,2'-O-dimethyladenosine; N6,N6,2'-O-trimethyladenosine; N6,N6-dimethyladenosine; N6-acetyladenosine; N6-hydroxynorvalylcarbamoyladenosine; N6-methyl-N6-threonylcarbamoyladenosine; 2-methyladenosine; 2-methylthio-N6-isopentenyladenosine; 7-deazaadenosine; N1-methyladenosine; N6,N6-(dimethyl)adenine; N6-cis-hydroxy-isopentenyladenosine; α-thio-adenosine; 2-(amino)adenine; 2-(aminopropyl)adenine; 2-(methylthio)N6(isopentenyl)adenine; 2-(alkyl)adenine; 2-(aminoalkyl)adenine; 2-(aminopropyl)adenine; 2-(halo)adenine; 2-(halo)adenine; 2-(propyl)adenine; 2'-amino-2'-deoxy-ATP; 2'-azido-2'-deoxy-ATP; 2'-deoxy-2'-a-aminoadenosine TP; 2'-deoxy-2'-a-azidoadenosine TP; 6-(alkyl)adenine; 6-(methyl)adenine; 6-(alkyl)adenine; 6-(methyl)adenine; 7-(deaza)adenine; 8-(alkenyl)adenine; 8-(alkynyl)adenine; 8-(amino)adenine; 8(thioalkyl)adenine; 8-(alkenyl)adenine; 8-(alkyl)adenine; 8-(alkynyl)adenine; 8-(amino)adenine; 8-(halo)adenine; 8-(hydroxyl)adenine; 8-(thioalkyl)adenine; 8-(thiol)adenine; 8-azido-adenosine; azaadenin; deazaadenin; N6-(methyl)adenine; N6-(isopentyl)adenine; 7-deaza-8-aza-adenosine; 7-methyladenine; 1-deazaadenosine TP; 2'-fluoro-N6-Bz-deoxyadenosine TP; 2'-OMe-2-amino-ATP; 2'-O-methyl-N6-B7-deoxyadenosine TP; 2'-a-ethynyladenosine TP; 2-aminoadenine; 2-aminoadenosine TP; 2-amino-ATP; 2'-a-trifluoromethyladenosine TP; 2-azidoadenosine TP; 2'-b-ethynyladenosine TP; 2-bromadenosine TP; 2'-b-trifluoromethyladenosine TP; 2-chloradenosine TP; 2'-deoxy-2',2'-difluoroadenosine TP; 2'-deoxy-2'-a-mercaptoadenosine TP; 2'-deoxy-2'-a-thiomethoxyadenosine TP; 2'-deoxy-2'-b-aminoadenosine TP; 2'-deoxy-2'-b-azidoadenosine TP; 2'-deoxy-2'-b-bromadenosine TP; 2'-deoxy-2'-b-chloroadenosine TP; 2'-deoxy-2'-b-fluoroadenosine TP; 2'-deoxy-2'-b-iodadenosine TP; 2'-deoxy-2'-b-mercaptoadenosine TP; 2'-deoxy-2'-b-thiomethoxyadenosine TP; 2-fluoroadenosine TP; 2-iodadenosine TP; 2-mercaptoadenosine TP; 2-methoxyadenine; 2-methylthioadenine; 2-trifluoromethyladenosine TP; 3-deaza-3-bromadenosine TP; 3-deaza-3-chloradenosine TP; 3-deaza-3-fluoroadenosine TP; 3-deaza-3-iodadenosine TP; 3-deazaadenosine TP; 4'-azidoadenosine TP; 4'-carbocyclic adenosine TP; 4'-ethynyladenosine TP; 5'-homo-adenosine TP; 8-aza-ATP; 8-bromo-adenosine TP; 8-trifluoromethyladenosine TP; 9-deazaadenosine TP; 2-aminopurine; 7-deaza-2,6-diaminopurine; 7-deaza-8-aza-2,6-diaminopurine; 7-deaza-8-aza-2-aminopurine; 2,6-diaminopurine; 7-deaza-8-azaadenine, 7-deaza-2-aminopurine; 2-thiocytidine; 3-methylcytidine; 5-formylcytidine; 5-hydroxymethylcytidine; 5-methylcytidine; N4-acetylcytidine; 2'-O-methylcytidine; 2'-O-methylcytidine; 5,2'-O-dimethylcytidine; 5-formyl-2'-O-methylcytidine; lyzidine; N4,2'-O-dimethylcytidine; N4-acetyl-2'-O-methylcytidine; N4-methylcytidine; N4,N4-dimethyl-2'-OMe-cytidine TP; 4-methylcytidine; 5-azacytidine; pseudoisocytidine; pyrrolocytidine; α-thio-cytidine; 2-(thio)cytidine; 2'-amino-2'-deoxy-STR; 2'-azido-2'-deoxy CTP; 2'-deoxy-2'-a-aminocytidine TP; 2'-deoxy-2'-a-azidocytidine TP; 3-(deaza)-5-(aza)cytosine; 3-(methyl)cytosine; 3-(alkyl)cytosine; 3-(deaza) 5 (aza)cytosine; 3-(methyl)cytidine; 4,2'-O-dimethylcytidine; 5-(halo)cytosine; 5-(methyl)cytosine; 5-(propynyl)cytosine; 5-(trifluoromethyl)cytosine; 5-(alkyl)cytosine; 5-(alkynyl)cytosine; 5-(halo)cytosine; 5-(propynyl)cytosine; 5-(trifluoromethyl)cytosine; 5-bromo-cytidine; 5-iodine-cytidine; 5-propynylcytosine; 6-(azo)cytosine; 6-azacytidine; azacytosine; deazacytosine; N4-(acetyl)cytosine; 1-methyl-1-dezazapseudoisocytidine; 1-methyl-pseudoisocytidine; 2-methoxy-5-methylcytidine; 2-methoxycytidine; 2-thio-5-methylcytidine; 4-methoxy-1-methyl-pseudoisocytidine; 4-methoxypseudoisocytidine; 4-thio-1-methyl-1-dezazapseudoisocytidine; 4-thio-1-methyl-pseudoisocytidine; 4-thiopseudisocytidine; 5-azazebularin; 5-methylzebularine; pyrrolopseudoisocytidine; zebularine; (E)-5-(2-bromo-vinyl)cytidine TP; 2,2'-anhydrocytidine TP hydrochloride; 2'fluoro-N4-Bz-cytidine TP; 2'fluoro-N4-acetylcytidine TP; 2'-O-methyl-N4-acetylcytidine TP; 2'O-methyl-N4-Bz-cytidine TP; 2'-a-ethynylcytidine TP; 2'-a-trifluoromethylcytidine TP; 2'-b-ethynylcytidine TP; 2'-b-trifluoromethylcytidine TP; 2'-deoxy-2',2'-difluorocytidine TP; 2'-deoxy-2'-a-mercaptocytidine TP; 2'-deoxy-2'-a-thiomethoxycytidine TP; 2'-deoxy-2'-b-aminocytidine TP; 2'-deoxy-2'-b-azidocytidine TP; 2'-deoxy-2'-b-bromocytidine TP; 2'-deoxy-2'-b-chlorocytidine TP; 2'-deoxy-2'-b-fluorocytidine TP; 2'-deoxy-2'-b-iodocytidine TP; 2'-deoxy-2'-b-mercaptocytidine TP; 2'-deoxy-2'-b-thiomethoxycytidine TP; 2'-O-methyl-5-(1-propynyl)cytidine TP; 3'-ethynylcytidine TP; 4'-azidocytidine TP; 4'-carbocyclic cytidine TP; 4'-ethynylcytidine TP; 5-(1-propynyl)ara-cytidine TP; 5-(2-chloro-phenyl)-2-thiocytidine TP; 5-(4-amino-phenyl)-2-thiocytidine TP; 5-aminoallyl-STR; 5-cyanocytidine TP; 5-ethynylaracitidine TP; 5-ethynylcytidine TP; 5'-homocytidine TP; 5-methoxycytidine TP; 5-trifluoromethylcytidine TP; N4-aminocytidine TP; N4-benzoylcytidine TP; pseudoisocytidine; 7-methylguanosine; N2,2'-O-dimethylguanosine; N2-methylguanosine; viosin; 1,2'-O-dimethylguanosine; 1-methylguanosine; 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 7-aminomethyl-7-deazaguanosine; 7-cyano-7-deazaguanosine; archeosin; methylviosin; N2,7-dimethylguanosine; N2,N2,2'-O-trimethylguanosine; N2,N2,7-trimethylguanosine; N2,N2-dimethylguanosine; N2,7,2'-O-trimethylguanosine; 6-thioguanosine; 7-deazaguanosine; 8-oxoguanosine; N1-methylguanosine; α-thioguanosine; 2 (propyl)guanine; 2-(alkyl)guanine; 2'-amino-2'-deoxy-GTP; 2'-azido-2'-deoxy-GTP; 2'-deoxy-2'-a-aminoguanosine TP; 2'-deoxy-2'-a-azidoguanosine TP; 6-(methyl)guanine; 6-(alkyl)guanine; 6-(methyl)guanine; 6-methylguanosine; 7-(alkyl)guanine; 7-(deaza)guanine; 7-(methyl)guanine; 7-(alkyl)guanine; 7-(deaza)guanine; 7-(methyl)guanine; 8-(alkyl)guanine; 8-(alkynyl)guanine; 8-(halo)guanine; 8-(thioalkyl)guanine; 8-(alkenyl)guanine; 8-(alkyl)guanine; 8-(alkynyl)guanine; 8-(amino)guanine; 8-(halo)guanine; 8-(hydroxyl)guanine; 8-(thioalkyl)guanine; 8-(thiol)guanine; azaguanine; deazaguanine; N-(methyl)guanine; N-(methyl)guanine; 1-methyl-6-thioguanosine; 6-methoxy-guanosine; 6-thio-7-deaza-8-azaguanosine; 6-thio-7-deazaguanosine; 6-thio-7-methylguanosine; 7-deaza-8-azaguanosine; 7-methyl-8-oxoguanosine; N2,N2-dimethyl-6-thioguanosine; N2-methyl-6-thioguanosine; 1-Me-GTP; 2'-fluoro-N2-isobutylguanosine TP; 2'-O-methyl-N2-isobutylguanosine TP; 2'-a-ethynylguanosine TP; 2'-a-trifluoromethylguanosine TP; 2'-b-ethynylguanosine TP; 2'-b-trifluoromethylguanosine TP; 2'-deoxy-2',2'-difluoroguanosine TP; 2'-deoxy-2'-a-mercaptoguanosine TP; 2'-deoxy-2'-a-thiomethoxyguanosine TP; 2'-deoxy-2'-b-aminoguanosine TP; 2'-deoxy-2'-b-azidoguanosine TP; 2'-deoxy-2'-b-bromoguanosine TP; 2'-deoxy-2'-b-chloroguanosine TP; 2'-deoxy-2'-b-fluoroguanosine TP; 2'-deoxy-2'-b-iodoguanosine TP; 2'-deoxy-2'-b-mercaptoguanosine TP; 2'-deoxy-2'-b-thiomethoxyguanosine TP; 4'-azidoguanosine TP; 4'-carbocyclic guanosine TP; 4'-ethynylguanosine TP; 5'-homoguanosine TP; 8-bromoguanosine TP; 9-deazaguanosine TP; N2-isobutylguanosine TP; 1-methylinosine; inosine; 1,2'-O-dimethylinosine; 2'-O-methylinosine; 7-methylinosine; 2'-O-methylinosine; epoxyqueuosin; galactosylqueuosin; mannosylqueuosin; queuosin; alliamino thymidine; azathymidine; dezazathymidine; deoxy-thymidine; 2'-O-methyluridine; 2-thiouridine; 3-methyluridine; 5-carboxymethyluridine; 5-hydroxyuridine; 5-methyluridine; 5-taurinomethyl-2-thiouridine; 5-taurinomethyluridine; dihydrouridine; pseudouridine; (3-(3-amino-3-carboxypropyl)uridine; 1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine; 1-methyl-pseudouridine; 1-ethyl-pseudouridine; 2'-O-methyluridine; 2'-O-methyl-pseudouridine; 2'-O-methyluridine; 2-thio-2'-O-methyluridine; 3-(3-amino-3-carboxypropyl)uridine; 3,2'-O-dimethyluridine; 3 -methyl-pseudouridine TP; 4-thiouridine; 5-(carboxyhydroxymethyl)uridine; 5-(carboxyhydroxymethyl)uridine methyl ester; 5,2'-O-dimethyluridine; 5,6-dihydro-uridine; 5-aminomethyl-2-thiouridine ; 5-carbamoylmethyl-2'-O-methyluridine; 5-carbamoylmethyluridine; 5-carboxyhydroxymethyluridine; 5-carboxyhydroxymethyluridine methyl ester; 5-carboxymethylaminomethyl-2'-O-methyluridine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyl- 2-tyuridin; 5-carboximethylaminomethyluridine; 5-carboximethylaminomethylurine; 5-carbamilmetilurine tp; 5-methoxicarbonylomethyl-2-o-metilurine; 5-methoxicarbonylmethyl-methyluridine; 5-methoxycarbonylmetilurine; 5-methyluridine, 5-methoxyuridin; 5 - methyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine; 5-methylaminomethyl-2-thiouridine; 5-methylaminomethyluridine; 5-methyldihydrouridine; 5-hydroxyacetic acid - uridine TP; 5-hydroxyacetic acid methyl ester-uridine TP; N1-methyl-pseudouracil; N1-ethyl-pseudouracil; uridine 5-hydroxyacetic acid; uridine 5-hydroxyacetic acid methyl ester; 3-(3-amino-3-carboxypropyl)-uridine TP; 5-(isopentenylaminomethyl)-2-thiouridine TP; 5-(isopentenylaminomethyl)-2'-O-methyluridine TP; 5-(isopentenylaminomethyl)uridine TP; 5-propynyluracil; α-thiouridine; 1-(aminoalkylaminocarbonylethyleneyl)-2(thio)-pseudouracil; 1-(aminoalkylaminocarbonylethyleneyl)-2,4-(dithio)pseudouracil; 1-(aminoalkylaminocarbonylethyleneyl)-4-(thio)pseudouracil; 1-(aminoalkylaminocarbonylethyleneyl)-pseudouracil; 1-(aminocarbonylethyleneyl)-2(thio)-pseudouracil; 1-(aminocarbonylethyleneyl)-2,4-(dithio)pseudouracil; 1-(aminocarbonylethyleneyl)-4-(thio)pseudouracil; 1-(aminocarbonylethyleneyl)-pseudouracil; 1 substituted 2(thio)-pseudouracil; 1 substituted 2,4-(dithio)pseudouracil; 1 substituted 4-(thio)pseudouracil; 1 substituted pseudouracil; 1-(aminoalkylamino-carbonylethyleneyl)-2-(thio)-pseudouracil; 1-methyl-3-(3-amino-3-carboxypropyl) pseudouracil TP; 1-methyl-3-(3-amino-3-carboxypropyl)pseudo-UTP; 1-methyl-pseudo-UTP; 1-ethyl-pseudo-UTP; 2 (thio) pseudouracil; 2'-deoxyuridine; 2'-fluorouridine; 2-(thio)uracil; 2,4-(dithio)pseudouracil; 2' methyl, 2'amino, 2'-azido, 2'fluoro-guanosine; 2'-amino-2'-deoxy-UTP; 2'-azido-2'-deoxy-UTP; 2'-azido-deoxyuridine TP; 2'-O-methyl-pseudouridine; 2' deoxyuridine; 2'-fluorouridine; 2'-deoxy-2'-a-aminouridine TP; 2'-deoxy-2'-a-azidouridine TP; 2-methyl-pseudouridine; 3-(3-amino-3-carboxypropyl)uracil; 4-(thio)pseudouracil; 4-(thio)pseudouracil; 4-(thio)uracil; 4-thiouracil; 5-(1,3-diazol-1-alkyl)uracil; 5-(2-aminopropyl)uracil; 5-(aminoalkyl)uracil; 5-(dimethylaminoalkyl)uracil; 5-(guanidinealkyl)uracil; 5-(methoxycarbonylmethyl)-2-(thio)uracil; 5-(methoxycarbonylmethyl)uracil; 5-(methyl)-2-(thio)uracil; 5-(methyl)-2,4-(dithio)uracil; 5-(methyl)-4-(thio)uracil; 5-(methylaminomethyl)-2-(thio)uracil; 5-(methylaminomethyl)-2,4-(dithio)uracil; 5-(methylaminomethyl)-4-(thio)uracil; 5-(propynyl)uracil; 5-(trifluoromethyl)uracil; 5-(2-aminopropyl)uracil; 5-(alkyl)-2-(thio)pseudouracil; 5-(alkyl)-2,4-(dithio)pseudouracil; 5-(alkyl)-4-(thio)pseudouracil; 5-(alkyl)pseudouracil; 5-(alkyl)uracil; 5-(alkynyl)uracil; 5-(allylamino)uracil; 5-(cyanoalkyl)uracil; 5-(dialkylaminoalkyl)uracil; 5-(dimethylaminoalkyl)uracil; 5-(guanidinealkyl)uracil; 5-(halo)uracil; 5-(1,3-diazol-1-alkyl)uracil; 5-(methoxy)uracil; 5-(methoxycarbonylmethyl)-2-(thio)uracil; 5-(methoxycarbonylmethyl)uracil; 5-(methyl)-2(thio)uracil; 5-(methyl)2,4(dithio)uracil; 5-(methyl) 4 (thio)uracil; 5-(methyl)-2-(thio)pseudouracil; 5-(methyl)-2,4(dithio)pseudouracil; 5-(methyl)-4(thio)pseudouracil; 5-(methyl)pseudouracil; 5-(methylaminomethyl)-2-(thio)uracil; 5-(methylaminomethyl)-2,4(dithio)uracil; 5-(methylaminomethyl)-4-(thio)uracil; 5-(propynyl)uracil; 5-(trifluoromethyl)uracil; 5-aminoallyluridine; 5-bromuridine; 5-ioduridine; 5-uracil; 6 (azo)uracil; 6-(azo)uracil; 6-azauridine; allylaminouracil; azauracil; desauracil; N3-(methyl)uracil; pseudo-UTP-1-2-ethanoic acid; pseudouracil; 4-thiopseudo-UTP; 1-carboxymethyl pseudouridine; 1-methyl-1-dezazapseudouridine; 1-propynyluridine; 1-taurinomethyl-1-methyluridine; 1-taurinomethyl-4-methyluridine; 1-taurinomethyl-pseudouridine; 2-methoxy-4-thiopseudouridine; 2-thio-1-methyl-1-dezazapseudouridine; 2-thio-1-methyl-pseudouridine; 2-thio-5-azauridine; 2-thiodihydropseudouridine; 2-thiodihydrouridine; 2-thiopseudouridine; 4-methoxy-2-thiopseudouridine; 4-methoxypseudouridine; 4-thio-1-methyl-pseudouridine; 4-thiopseudouridine; 5-azauridine; dihydropseudouridine; (±)1-(2-hydroxypropyl)pseudouridine TP; (2R)-1-(2-hydroxypropyl)pseudouridine TP; (2S)-1-(2-hydroxypropyl)pseudouridine TP; (E)-5-(2-bromo-vinyl)arauridin TP; (E)-5-(2-bromo-vinyl)uridine TP; (Z)-5-(2-bromo-vinyl)arauridin TP; (Z)-5-(2-bromo-vinyl)uridine TP; 1-(2,2,2-trifluoroethyl)-pseudo-UTP; 1-(2,2,3,3,3-pentafluoropropyl)pseudouridine TP; 1-(2,2-diethoxyethyl)pseudouridine TP; 1-(2,4,6-trimethylbenzyl)pseudouridine TP; 1-(2,4,6-trimethylbenzyl)pseudo-UTP; 1-(2,4,6-trimethylphenyl)pseudo-UTP; 1-(2-amino-2-carboxyethyl)pseudo-UTP; 1-(2-aminoethyl)pseudo-UTP; 1-(2-hydroxyethyl)pseudouridine TP; 1-(2-methoxyethyl)pseudouridine TP; 1-(3,4-bis-trifluoromethoxybenzyl)pseudouridine TP; 1-(3,4-dimethoxybenzyl)pseudouridine TP; 1-(3-amino-3-carboxypropyl)pseudo-UTP; 1-(3-amino-propyl)pseudo-UTP; 1-(3-cyclopropyl-prop-2-ynyl)pseudouridine TP; 1-(4-amino-4-carboxybutyl)pseudo-UTP; 1-(4-aminobenzyl)pseudo-UTP; 1-(4-aminobutyl)pseudo-UTP; 1-(4-aminophenyl)pseudo-UTP; 1-(4-azidobenzyl)pseudouridine TP; 1-(4-bromobenzyl)pseudouridine TP; 1-(4-chlorobenzyl)pseudouridine TP; 1-(4-fluorobenzyl)pseudouridine TP; 1-(4-iodobenzyl)pseudouridine TP; 1-(4-methanesulfonylbenzyl)pseudouridine TP; 1-(4-methoxybenzyl)pseudouridine TP; 1-(4-methoxybenzyl)pseudo-UTP; 1-(4-methoxyphenyl)pseudo-UTP; 1-(4-methylbenzyl)pseudouridine TP; 1-(4-methylbenzyl)pseudo-UTP; 1-(4-nitrobenzyl)pseudouridine TP; 1-(4-nitro-benzyl)pseudo-UTP; 1(4-nitro-phenyl)pseudo-UTP; 1-(4-thiomethoxybenzyl)pseudouridine TP; 1-(4-trifluoromethoxybenzyl)pseudouridine TP; 1-(4-trifluoromethylbenzyl)pseudouridine TP; 1-(5-amino-pentyl)pseudo-UTP; 1-(6-amino-hexyl)pseudo-UTP; 1,6-dimethyl-pseudo-UTP; 1-[3-(2-{2-[2-(2-aminoethoxy)ethoxy]ethoxy}ethoxy)propionyl]pseudouridine TP; 1-{3-[2-(2-aminoethoxy)-ethoxy]-propionyl}pseudouridine TP; 1-acetyl pseudouridine TP; 1-alkyl-6-(1-propynyl)-pseudo-UTP; 1-alkyl-6-(2-propynyl)-pseudo-UTP; 1-alkyl-6-allyl-pseudo-UTP; 1-alkyl-6-ethynyl-pseudo-UTP; 1-alkyl-6-homoallyl-pseudo-UTP; 1-alkyl-6-vinyl-pseudo-UTP; 1-allyl-pseudouridine TP; 1-aminomethyl-pseudo-UTP; 1-benzoyl-pseudouridine TP; 1-benzyloxymethyl-pseudouridine TP; 1-benzyl-pseudo-UTP; 1-biotinyl-PEG2-pseudouridine TP; 1-biotinyl-pseudouridine TP; 1-butyl-pseudo-UTP; 1-cyanomethyl-pseudouridine TP; 1-cyclobutylmethyl-pseudo-UTP; 1-cyclobutyl-pseudo-UTP; 1-cycloheptylmethyl-pseudo-UTP; 1-cycloheptyl-pseudo-UTP; 1-cyclohexylmethyl-pseudo-UTP; 1-cyclohexyl-pseudo-UTP; 1-cyclooctylmethyl-pseudo-UTP; 1-cyclooctyl-pseudo-UTP; 1-cyclopentylmethyl-pseudo-UTP; 1-cyclopentyl-pseudo-UTP; 1-cyclopropylmethyl-pseudo-UTP; 1-cyclopropyl-pseudo-UTP; 1-ethyl-pseudo-UTP; 1-hexyl-pseudo-UTP; 1-homoallyl-pseudouridine TP; 1-hydroxymethyl-pseudouridine TP; 1-isopropyl-pseudo-UTP; 1-Me-2-thio-pseudo-UTP; 1-Me-4-thio-pseudo-UTP; 1-Me-alpha-thio-pseudo-UTP; 1-methanesulfonylmethyl-pseudouridine TP; 1-methoxymethyl-pseudouridine TP; 1-methyl-6-(2,2,2-trifluoroethyl)pseudo-UTP; 1-methyl-6-(4-morpholino)-pseudo-UTP; 1-methyl-6-(4-thiomorpholino)-pseudo-UTP; 1-methyl-6-(substituted phenyl)pseudo-UTP; 1-methyl-6-amino-pseudo-UTP; 1-methyl-6-azido-pseudo-UTP; 1-methyl-6-bromo-pseudo-UTP; 1-methyl-6-butyl-pseudo-UTP; 1-methyl-6-chloro-pseudo-UTP; 1-methyl-6-cyano-pseudo-UTP; 1-methyl-6-dimethylamino-pseudo-UTP; 1-methyl-6-ethoxy-pseudo-UTP; 1-methyl-6-ethylcarboxylate-pseudo-UTP; 1-methyl-6-ethyl-pseudo-UTP; 1-methyl-6-fluoro-pseudo-UTP; 1-methyl-6-formyl-pseudo-UTP; 1-methyl-6-hydroxyamino-pseudo-UTP; 1-methyl-6-hydroxy-pseudo-UTP; 1-methyl-6-iodo-pseudo-UTP; 1-methyl-6-iso-propyl-pseudo-UTP; 1-methyl-6-methoxy-pseudo-UTP; 1-methyl-6-methylamino-pseudo-UTP; 1-methyl-6-phenyl-pseudo-UTP; 1-methyl-6-propyl-pseudo-UTP; 1-methyl-6-tert-butyl-pseudo-UTP; 1-methyl-6-trifluoromethoxy-pseudo-UTP; 1-methyl-6-trifluoromethyl-pseudo-UTP; 1-morpholinomethyl-pseudouridine TP; 1-pentyl-pseudo-UTP; 1-phenyl-pseudo-UTP; 1-pivaloyl-pseudouridine TP; 1-propargyl-pseudouridine TP; 1-propyl-pseudo-UTP; 1-propynyl-pseudouridine; 1-p-tolyl-pseudo-UTP; 1-tert-butyl-pseudo-UTP; 1-thiomethoxymethyl-pseudouridine TP; 1-thiomorpholinomethyl-pseudouridine TP; 1-trifluoroacetyl-pseudouridine TP; 1-trifluoromethyl-pseudo-UTP; 1-vinyl pseudouridine TP; 2,2'-anhydro-uridine TP; 2'-bromo-deoxyuridine TP; 2'-F-5-methyl-2'-deoxy-UTP; 2'-OMe-5-Me-UTP; 2'-OMe-pseudo-UTP; 2'-a-ethynyluridine TP; 2'-a-trifluoromethyluridine TP; 2'-b-ethinyluridine TP; 2'-b-trifluoromethyluridine TP; 2'-deoxy-2',2'-difluorouridine TP; 2'-deoxy-2'-a-mercaptouridine TP; 2'-deoxy-2'-a-thiomethoxyuridine TP; 2'-deoxy-2'-b-aminouridine TP; 2'-deoxy-2'-b-azidouridine TP; 2'-deoxy-2'-b-bromouridine TP; 2'-deoxy-2'-b-chlorouridine TP; 2'-deoxy-2'-b-fluorouridine TP; 2'-deoxy-2'-b-ioduridine TP; 2'-deoxy-2'-b-mercaptouridine TP; 2'-deoxy-2'-b-thiomethoxyuridine TP; 2-methoxy-4-thio-uridine; 2-methoxyuridine; 2'-O-methyl-5-(1-propynyl)uridine TP; 3-alkyl-pseudo-UTP; 4'-azidouridine TP; 4'-carbocyclic uridine TP; 4'-ethynyluridine TP; 5-(1-propynyl)ara-uridine TP; 5-(2-furanyl)uridine TP; 5-cyanouridine TP; 5-dimethylaminouridine TP; 5'-homo-uridine TP; 5-iodine-2'-fluoro-deoxyuridine TP; 5-phenylethynyluridine TP; 5-trideuteromethyl-6-deuterouridine TP; 5-trifluoromethyluridine TP; 5-vinylarauridine TP; 6-(2,2,2-trifluoroethyl)-pseudo-UTP; 6-(4-morpholino)-pseudo-UTP; 6-(4-thiomorpholino)-pseudo-UTP; 6-(substituted phenyl)-pseudo-UTP; 6-amino-pseudo-UTP; 6-azido-pseudo-UTP; 6-bromo-pseudo-UTP; 6-butyl-pseudo-UTP; 6-chloro-pseudo-UTP; 6-cyano-pseudo-UTP; 6-dimethylamino-pseudo-UTP; 6-ethoxy-pseudo-UTP; 6-ethylcarboxylate-pseudo-UTP; 6-ethyl-pseudo-UTP; 6-fluoro-pseudo-UTP; 6-formyl-pseudo-UTP; 6-hydroxyamino-pseudo-UTP; 6-hydroxy-pseudo-UTP; 6-iodine-pseudo-UTP; 6-iso-propyl-pseudo-UTP; 6-methoxy-pseudo-UTP; 6-methylamino-pseudo-UTP; 6-methyl-pseudo-UTP; 6-phenyl-pseudo-UTP; 6-phenyl-pseudo-UTP; 6-propyl-pseudo-UTP; 6-tert-butyl-pseudo-UTP; 6-trifluoromethoxy-pseudo-UTP; 6-trifluoromethyl-pseudo-UTP; alpha-thio-pseudo-UTP; pseudouridine 1-(4-methylbenzenesulfonic acid) TP; pseudouridine 1-(4-methylbenzoic acid) TP; pseudouridine TP 1-[3-(2-ethoxy)]propionic acid; pseudouridine TP 1-[3-{2-(2-[2-(2-ethoxy)-ethoxy]-ethoxy)-ethoxy}] propionic acid; pseudouridine TP 1-[3-{2-(2-[2-{2(2-ethoxy)-ethoxy}-ethoxy]-ethoxy)-ethoxy}]propionic acid; pseudouridine TP 1-[3-{2-(2-[2-ethoxy]ethoxy)ethoxy}]propionic acid; pseudouridine TP 1-[3-{2-(2-ethoxy)-ethoxy}]propionic acid; pseudouridine TP 1-methylphosphonic acid; pseudouridine TP 1-methylphosphonic acid diethyl ether; pseudo-UTP-N1-3-propionic acid; pseudo-UTP-N1-4-butanoic acid; pseudo-UTP-N1-5-pentanoic acid; pseudo-UTP-N1-6-hexanoic acid; pseudo-UTP-N1-7-heptanoic acid; pseudo-UTP-N1-methyl-p-benzoic acid; pseudo-UTP-N1-p-benzoic acid; vibutosin; hydroxyvibutosin; isoviosin; peroxyvibutosin; submodified hydroxyvibutosin; 4-demethylviosin; 2,6-(diamino)purine; 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl: 1,3-(diaza)-2-(oxo)-phentiazin-1-yl; 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 1,3,5-(triaza)-2,6-(dioxa)-naphthalene; 2 (amino)purine; 2,4,5-(trimethyl)phenyl; 2'methyl,2'amino,2'azido,2'fluoro-cytidine; 2'methyl,2'amino,2'azido,2'fluoro-adenine; 2'methyl,2'amino,2'azido,2'fluoro-uridine; 2'-amino-2'-deoxyribose; 2-amino-6-chloropurine; 2-azainosinyl; 2'-azido-2'-deoxyribose; 2'fluoro-2'-deoxyribose; 2'-fluoro-modified bases; 2'-O-methyl-ribose; 2-oxo-7-aminopyridopyrimidin-3-yl; 2-oxopyridopyrimidin-3-yl; 2-pyridinone; 3 nitropyrrole; 3-(methyl)-7-(propynyl)isocarbostyrylyl; 3-(methyl)isocarbostyrylyl; 4-(fluoro)-6-(methyl)benzimidazole; 4-(methyl)benzimidazole; 4-(methyl)indolyl; 4,6-(dimethyl)indolyl; 5 nitroindole; 5 substituted pyrimidines; 5-(methyl)isocarbostyrylyl; 5-nitroindole; 6-(aza)pyrimidine; 6-(azo)thymine; 6-(methyl)-7-(aza)indolyl; 6-chloropurine; 6-phenyl-pyrrolo-pyrimidin-2-one-3-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phentiazin-1-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phentiazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(aza)indolyl; 7-(guanidinealkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(guanidinealkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phentiazin-1-yl; 7-(guanidinealkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(guanidinoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(guanidinoalkyl-hydroxy)-1,3-(diaza)-2-(oxo)-phentiazin-1-yl; 7-(guanidinoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(propynyl)isocarbostyrylyl; 7-(propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl; 7-deaza-inosinyl; 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 9-(methyl)-imidazopyridinyl; aminoindolyl; anthracenyl; bis-ortho-(aminoalkylhydroxy)-6-phenylpyrrolopyrimidin-2-one-3-yl; bis-ortho-substituted-6-phenylpyrrolopyrimidin-2-one-3-yl; difluorotolyl; hypoxanthine; imidazopyridinyl; inosinil; isocarbostyrilyl; isoguanosine; N2-substituted purines; N6-methyl-2-aminopurine; N6-substituted purines; N-alkylated derivative; naphthalene; nitrobenzimidazolyl; nitroimidazolyl; nitroindazolyl; nitropyrazolyl; nubularin; O6-substituted purines; O-alkylated derivative; ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolopyrimidin-2-one-3-yl; ortho-substituted 6-phenylpyrrolopyrimidin-2-one-3-yl; oxoformycin TP; para-(aminoalkylhydroxy)-6-phenylpyrrolopyrimidin-2-one-3-yl; para-substituted 6-phenylpyrrolopyrimidin-2-one-3-yl; pentacenyl; phenanthracenyl; phenyl; propynyl-7-(aza)indolyl; pyrenyl; pyridopyrimidin-3-yl; pyridopyrimidin-3-yl, 2-oxo-7-aminopyridopyrimidin-3-yl; pyrrolopyrimidin-2-on-3-yl; pyrrolopyrimidinyl; pyrrolopyrizinyl; stilbenzyl; substituted 1,2,4-triazoles; tetracenyl; tubercidin; xanthine; xanthosine-5'-TP; 2-thiosebularin; 5-aza-2-thiosebularin; 7-deaza-2-aminopurine; pyridin-4-one ribonucleoside; 2-aminoriboside-TR; formycin A TP; formycin B TP; pyrrolosine TP; 2'-OH-ara-adenosine TP; 2'-OH-ara-cytidine TP; 2'-OH-ara-uridine TP; 2'-OH-ara-guanosine TP; 5-(2-carbomethoxyvinyl)uridine TP and N6-(19-aminopentaoxanonadecyl)adenosine TP.

In some embodiments, a polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains a combination of at least two (eg, 2, 3, 4, or more) of the aforementioned modified nucleotide bases.

In some embodiments, the mRNA contains at least one chemically modified nucleoside. In some embodiments, at least one chemically modified nucleoside is selected from the group consisting of pseudouridine (ψ), 2-thiouridine (s2U), 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-dezazapseudouridine, 2 -thio-1-methylpseudouridine, 2-thio-5-azauridine, 2-thiodihydropseudouridine, 2-thiodihydrouridine, 2-thiopseudouridine, 4-methoxy-2-thiopseudouridine, 4-methoxypseudouridine, 4-thio-1-methylpseudouridine, 4-thio -pseudouridine, 5-azauridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine, 1-methylpseudouridine (m1ψ), 1-ethylpseudouridine (e1ψ), 5-methoxyuridine (mo5U), 5-methylcytidine (m5C ), α-thioguanosine, α-thioadenosine, 5-cyanouridine, 4'-thiouridine 7-deazaadenine, 1-methyladenosine (m1A), 2-methyladenine (m2A), N6-methyladenosine (m6A) and 2,6-diaminopurine, ( I), 1-methylinosine (m1I), viosin (imG), methylviosin (mimG), 7-deazaguanosine, 7-cyano-7-deazaguanosine (preQ0), 7-aminomethyl-7-deazaguanosine (preQ1), 7-methylguanosine ( m7G), 1-methylguanosine (m1G), 8-oxoguanosine, 7-methyl-8-oxoguanosine, 2,8-dimethyladenosine, 2-geranylthiouridine, 2-lyzidine, 2-selenouridine, 3-(3-amino-3-carboxypropyl )-5,6-dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 3-methylpseudouridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-aminomethyl-2-geranylthiouridine, 5 -aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2-thiouridine, 5-carboxymethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-geranylthiouridine, 5-carboxymethylaminomethyl-2-selenouridine, 5-cyanomethyluridine , 5-hydroxycytidine, 5-methylaminomethyl-2-geranylthiouridine, 7-aminocarboxypropyldemethylviosine, 7-aminocarboxypropylviosine, 7-aminocarboxypropylviosine methyl ester, 8-methyladenosine, N4,N4-dimethylcytidine, N6-formyladenosine, N6-hydroxymethyladenosine, agmatidine, cycle ical N6- threonylcarbamoyladenosine, glutamylqueuosine, methylated submodified hydroxyvibutosine, N4,N4,2'-O-trimethylcytidine, geranylated 5-methylaminomethyl-2-thiouridine, geranylated 5-carboxymethylaminomethyl-2-thiouridine, Qbase, preQ0base, preQ1base, and two or more combinations thereof. In some embodiments, at least one chemically modified nucleoside is selected from the group consisting of pseudouridine, 1-methylpseudouridine, 1-ethylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof. In some embodiments, a polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains a combination of at least two (eg, 2, 3, 4, or more) of the aforementioned modified nucleotide bases.

In some embodiments, the mRNA is a uracil-modified sequence containing an ORF encoding a relaxin polypeptide, wherein the mRNA contains a chemically modified nucleotide base, such as 5-methoxyuracil. In certain aspects of the present invention, when the 5-methoxyuracil base is linked to a ribose sugar, as in polynucleotides, the resulting modified nucleoside or nucleotide is referred to as 5-methoxyuridine. In some embodiments, the uracil in the polynucleotide is at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70 %, at least about 80%, at least 90%, at least 95%, at least 99%, or about 100% 5-methoxyuracil. In one embodiment, the uracil in the polynucleotide is at least 95% 5-methoxyuracil. In another embodiment, the uracil in the polynucleotide is 100% 5-methoxyuracil.

In embodiments where the uracil in the polynucleotide is at least 95% 5-methoxyuracil, the total uracil content can be adjusted such that the mRNA provides appropriate levels of protein expression and simultaneously induces little to no immune response. In some embodiments, the uracil content of the ORF is from about 105% to about 145%, from about 105% to about 140%, from about 110% to about 140%, from about 110% to about 145%, from about 115% to about 135%, about 105% to about 135%, about 110% to about 135%, about 115% to about 145%, or about 115% to about 140% of the theoretical minimum uracil content in the corresponding wild-type ORF ( %Utm). In other embodiments, the uracil content of the ORF is from about 117% to about 134%, or from 118% to 132% of % UTM. In some embodiments, the uracil content of the ORP encoding the relaxin polypeptide is about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% of % Utm. In this context, the term "uracil" may refer to 5-methoxyuracil and/or natural uracil.

In some embodiments, the uracil content of the mRNA ORF encoding the relaxin polypeptide of the present invention is less than about 50%, about 40%, about 30%, about 20%, about 15%, or about 12% of the total nucleotide base content of the ORF. In some embodiments, the uracil content of the ORF is from about 12% to about 25% of the total nucleotide base content of the ORF. In other embodiments, the uracil content of the ORF is from about 15% to about 17% of the total nucleotide base content of the ORF. In one embodiment, the uracil content of the ORF of the mRNA encoding the relaxin polypeptide is less than about 20% of the total nucleotide base content in the open reading frame. In this context, the term "uracil" may refer to 5-methoxyuracil and/or natural uracil.

In additional embodiments, the ORF of the mRNA encoding the relaxin polypeptide of the present invention contains 5-methoxyuracil and is characterized by a corrected uracil content containing fewer uracil pairs (UU) and/or uracil triplets (UUU) and/or uracil quadruplets (UUUU), than the corresponding wild-type nucleotide sequence encoding the relaxin polypeptide. In some embodiments, the mRNA ORF encoding the relaxin polypeptide of the present invention does not contain a uracil pair and/or uracil triplets and/or uracil quadruplets. In some embodiments, the number of uracil pairs and/or uracil triplets and/or uracil quadruplets is reduced below a certain occurrence threshold, e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 in the ORF of the mRNA encoding the relaxin polypeptide. In a specific embodiment, the ORF of the mRNA encoding the relaxin polypeptide of the present invention contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 pair and/or triplet of uracil that do not code for phenylalanine. In another embodiment, the mRNA ORF encoding the relaxin polypeptide does not contain a uracil pair and/or triplets that do not encode phenylalanine.

In additional embodiments, the ORF of the mRNA encoding the relaxin polypeptide of the present invention contains 5-methoxyuracil and is uracil-adjusted containing fewer uracil-rich clusters than the corresponding wild-type nucleotide sequence encoding the relaxin polypeptide. In some embodiments, the ORF of the mRNA encoding the relaxin polypeptide of the present invention contains uracil-rich cassettes that are shorter in length than the corresponding uracil-rich cassettes in the corresponding wild-type nucleotide sequence encoding the relaxin polypeptide.

In additional embodiments, alternative codons with a lower frequency of occurrence are used. At least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least 5 The α-methoxyuracil mRNA is replaced with alternative codons, each alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set. ORF is also characterized by a corrected uracil content as described above. In some embodiments, at least one codon in the ORF of the mRNA encoding the relaxin polypeptide is substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.

In some embodiments, when adjusted for uracil in the relaxin polypeptide-encoding ORF, the 5-methoxyuracil-containing mRNA exhibits higher levels of relaxin protein expression when introduced into a mammalian cell than the levels of relaxin protein expression with the corresponding wild-type mRNA. In other embodiments, expression levels of the relaxin protein when introduced into a mammalian cell are increased relative to the corresponding mRNA containing at least 95% 5-methoxyuracil and having a uracil content of about 160%, about 170%, about 180%, about 190% or approximately 200% of the theoretical minimum. In other embodiments, expression levels of the relaxin protein when introduced into a mammalian cell are increased compared to the corresponding mRNA, where at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the uracils are 1-methyl-pseudouracil or pseudouracil. In some embodiments, the mammalian cell is a mouse cell, a rat cell, or a rabbit cell. In other embodiments, the mammalian cell is a non-human simian cell or a human cell. In some embodiments, the human cell is a HeLa cell, a BJ fibroblast cell, or a peripheral blood mononuclear cell (PBMC). In some embodiments, the relaxin protein is expressed when the mRNA is introduced into a mammalian cell in vivo. In some embodiments, the mRNA is administered to mice, rabbits, non-human apes, or humans. In one embodiment, the mice are null mice. In some embodiments, mRNA is administered to mice in an amount of about 0.01 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, or about 0.15 mg/kg. In some embodiments, mRNA is administered intravenously or intramuscularly. In other embodiments, the relaxin polypeptide is expressed when the mRNA is introduced into a mammalian cell in vitro. In some embodiments, expression is increased at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 50-fold, at least about 500-fold, at least about 1500-fold, or up to at least about 3000 times. In other embodiments, expression is increased by at least about 10%, about 20%, about 30%, about 40%, about 50%, 60%, about 70%, about 80%, about 90%, or about 100%.

In some embodiments, when the uracil content is adjusted, the 5-methoxyuracil-containing mRNA encoding the ORF relaxin polypeptide exhibits increased stability. In some embodiments, the mRNA exhibits increased stability in the cell relative to that of the corresponding wild-type mRNA under the same conditions. In some embodiments, the mRNA exhibits increased stability, including nuclease resistance, thermal stability, and/or increased secondary structure stabilization. In some embodiments, the increased stability exhibited by mRNA is measured by determining the half-life of the mRNA (e.g., in a sample of blood plasma, cells, or tissue) and/or determining the area under the curve (AUC) for protein expression with mRNA over time (e.g., in vitro or in vivo). An mRNA is identified as having increased stability if its half-life and/or AUC is greater than the half-life and/or AUC of the corresponding wild-type mRNA under the same conditions.

In some embodiments, the mRNA of the present invention induces a detectable lower immune response (eg, innate or acquired) relative to the immune response induced by the corresponding wild-type mRNA under the same conditions. In other embodiments, the mRNA of the present disclosure induces a detectable lower immune response (e.g., innate or acquired) relative to an immune response induced by an mRNA that encodes a relaxin polypeptide but lacks 5-methoxyuracil, under the same conditions, or relative to an immune response, induced mRNA which encodes a relaxin polypeptide and which contains 5-methoxyuracil, but which does not have corrected uracil content under the same conditions. The innate immune response may be manifested by increased expression of pro-inflammatory cytokines, activation of intracellular PRRs (RIG-I, MDA5, etc.), cell death, and/or termination or reduction of protein translation. In some embodiments, a decrease in the innate immune response can be measured by the expression or level of activity of type 1 interferons (e.g., IFN-α, IFN-β, IFN-κ, IFN-δ, IFN-ε, IFN-τ, IFN-ω, and IFN -ζ) or the expression of genes regulated by interferons, such as toll-like receptors (eg, TLR7 and TLR8), and/or to reduce cell death after one or more introductions of the mRNA of the present invention into the cell.

In some embodiments, the expression of type 1 interferons by a mammalian cell in response to the mRNA of the present disclosure is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95 %, 99%, 99.9% or more 99.9% relative to the corresponding wild-type mRNA, relative to the mRNA that encodes the relaxin polypeptide but does not contain 5-methoxyuracil, or relative to the mRNA that encodes the relaxin polypeptide and which contains 5-methoxyuracil , but does not have an adjusted uracil content. In some embodiments, the interferon is IFN-β. In some embodiments, the rate of cell death associated with the introduction of the mRNA of the present invention into a mammalian cell is 10%, 25%, 50%, 75%, 85%, 90%, 95%, or greater than 95% less than the rate of cell death, observed with the corresponding wild-type mRNA, an mRNA that encodes a relaxin polypeptide but lacks 5-methoxyuracil, or an mRNA that encodes a relaxin polypeptide and that contains 5-methoxyuracil but lacks adjusted uracil content. In some embodiments, the mammalian cell is a BJ fibroblast cell. In other embodiments, the mammalian cell is a splenocyte. In some embodiments, the mammalian cell is a mouse or rat cell. In other embodiments, the mammalian cell is a human cell. In one embodiment, the mRNA of the present invention does not actually induce an innate immune response against the mammalian cell into which the mRNA is introduced.

In some embodiments, the polynucleotide is an mRNA that contains an ORF encoding a relaxin polypeptide, wherein the mRNA's uracil is at least about 95% 5-methoxyuracil, where the ORF's uracil content is from about 115% to about 135% of theoretical the minimum uracil content of the corresponding wild-type ORF, and wherein the uracil content of the ORF encoding the relaxin polypeptide is less than about 23% of the total nucleotide base content of the ORF. In some embodiments, an ORF that encodes a relaxin polypeptide is further modified to reduce the G/C content of the ORF (absolute or relative) by at least about 40% compared to the corresponding wild-type ORF. In other embodiments, the implementation of the ORF encoding the relaxin polypeptide contains less than 20 non-coding phenylalanine pairs and/or triplets of uracil. In some embodiments, at least one codon in the ORF of the mRNA encoding the relaxin polypeptide is further substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set. In some embodiments, expression of a relaxin polypeptide encoded by an mRNA containing an ORF, wherein the uracil in the mRNA is at least about 95% 5-methoxyuracil, where the uracil content of the ORF is from about 115% to about 135% of the theoretical minimum uracil content in the corresponding wild-type ORF is increased by at least about 10-fold compared to the expression of the relaxin polypeptide from the corresponding wild-type mRNA. In some embodiments, the mRNA contains an open ORF, wherein the uracil in the mRNA is at least about 95% 5-methoxyuracil, and where the uracil content of the ORF is from about 115% to about 135% of the theoretical minimum uracil content of the corresponding wild-type ORF. type, and where the mRNA does not actually induce an innate immune response against the mammalian cell into which the mRNA is introduced.

In certain embodiments, the chemical modification occurs at nucleotide bases in polynucleotides (eg, in an RNA polynucleotide, such as an mRNA polynucleotide). In some embodiments, the modified nucleotide bases in a polynucleotide (e.g., an RNA polynucleotide, such as an mRNA polynucleotide) are selected from the group consisting of 1-methylpseudouridine (m1ψ), 1-ethylpseudouridine (e1ψ), 5-methoxyuridine (mo5U), 5 -methylcytidine (m5C), pseudouridine (ψ), α-thioguanosine and α-thioadenosine. In some embodiments, the implementation of the polynucleotide contains a combination of at least two (for example, 2, 3, 4 or more) of the above modified nucleotide bases.

In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains pseudouridine (ψ) and 5-methylcytidine (m5C). In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains 1-methylpseudouridine (m1ψ). In some embodiments, the implementation of the polynucleotide (eg, RNA polynucleotide, such as mRNA polynucleotide) contains 1-ethyl-pseudouridine (e1ψ). In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains 1-methylpseudouridine (m1ψ) and 5-methylcytidine (m5C). In some embodiments, the implementation of the polynucleotide (eg, RNA polynucleotide, such as mRNA polynucleotide) contains 1-ethyl-pseudouridine (e1ψ) and 5-methylcytidine (m5C). In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains 2-thiouridine (s2U). In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains 2-thiuoridin and 5-methylcytidine (m5C). In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains methoxyuridine (mo5U). In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains 5-methoxyuridine (mo5U) and 5-methylcytidine (m5C). In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains 2'-O-methyluridine. In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains 2'-O-methyluridine and 5-methylcytidine (m5C). In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains N6-methyladenosine (m6A). In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains N6-methyladenosine (m6A) and 5-methylcytidine (m5C).

In some embodiments, a polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) is uniformly modified (eg, fully modified, modified throughout) for a specific modification. For example, a polynucleotide can be uniformly modified with 5-methylcytidine (m5C), meaning that all cytosine residues in the mRNA sequence are replaced with 5-methylcytidine (m5C). Similarly, a polynucleotide can be uniformly modified with respect to any type of nucleoside residue present in a given sequence by substitution with a modified residue such as any of the above.

In some embodiments, the chemically modified open reading frame nucleosides are selected from the group consisting of uridine, adenine, cytosine, guanine, and any combination thereof.

In some embodiments, the modified nucleotide base is a modified cytosine. Examples of cytosine-modified nucleotide bases and nucleosides include N4-acetylcytidine (ac4C), 5-methylcytidine (m5C), 5-halocytidine (e.g., 5-iodocytidine), 5-hydroxymethylcytidine (hm5C), 1-methyl-pseudoisocytidine, 2- thiocytidine (s2C), 2-thio-5-methylcytidine.

In some embodiments, the modified nucleotide base is a modified uridine. Examples of uridine-modified nucleotide bases and nucleosides include 5-cyanouridine or 4'-thiouridine.

In some embodiments, the modified nucleotide base is a modified adenine. Examples of adenine-modified nucleotide bases and nucleosides include 7-deazaadenine, 1-methyladenosine (m1A), 2-methyladenine (m2A), N6-methyladenine (m6A), and 2,6-diaminopurine.

In some embodiments, the modified nucleotide base is a modified guanine. Examples of guanine-modified nucleotide bases and nucleosides include inosine (I), 1-methylinosine (m1I), viosine (imG), methylviosine (mimG), 7-deazaguanosine, 7-cyano-7-deazaguanosine (preQ0), 7-aminomethyl- 7-deazaguanosine (preQ1), 7-methylguanosine (m7G), 1-methylguanosine (m1G), 8-oxoguanosine, 7-methyl-8-oxoguanosine.

In some embodiments, the base-modified nucleotides in a polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) are 5-methoxyuridine.

In some embodiments, a polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains a combination of at least two (eg, 2, 3, 4, or more) modified nucleotide bases.

In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) contains 5-methoxyuridine (5mo5U) and 5-methylcytidine (m5C).

In some embodiments, a polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) is uniformly modified (eg, fully modified, sequence modified) for a particular modification. For example, a polynucleotide can be uniformly modified with 5-methoxyuridine, which means that substantially all uridine residues in the mRNA sequence are replaced with 5-methoxyuridine. Similarly, a polynucleotide can be uniformly modified with respect to any type of nucleoside residue present in a given sequence by substitution with a modified residue such as any of the above.

In some embodiments, the modified nucleotide base is a modified cytosine.

In some embodiments, the modified nucleotide base is a modified uracil. Examples of nucleotide bases and modified uracil nucleosides include 5-methoxyuracil.

In some embodiments, the modified nucleotide base is a modified adenine.

In some embodiments, the modified nucleotide base is a modified guanine.

In some embodiments, the implementation of the polynucleotide may contain any applicable linker between the nucleosides. Such linkers, including backbone modifications that are useful in the compositions of the present disclosure, include, without limitation, the following: 3'-alkylene phosphonates, 3'-aminophosphoramidates, alkene-containing backbones, aminoalkyl phosphoramidates, aminoalkyl phosphotriesters, boranophosphates, -CH ₂ -ON(CH ₃ )- CH ₂ -, -CH ₂ -N (CH ₃ ) -N (CH ₃ ) -CH ₂ -, -CH ₂ -NH-CH ₂ -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino-) , methylene formacetile and thyoto -formaccetile skeletons, skeletons of methylene and methylenegrazin, morpholine bonds, -n (CH ₃ ) -Ch ₂ -CH ₂ -, oligonucleosides with heteroatomic inter -monoside bonds, phosphoradates, phosphoridias, phosphorus, phosphorotiological inter -monocleo Zida ties, phosphorotioates, complex phosphorusfores , PNA, siloxane backbones, sulfamate backbones, sulfide, sulfoxide and sulfone backbones, sulfonate and sulfonamide backbones, thionoalkylphosphonates, thionoalkylphosphotriesters and thionophosphoramidates.

Modified nucleosides and nucleotides (eg, building block molecules) that can be incorporated into a polynucleotide (eg, RNA or mRNA as described herein) can be modified at the sugar of the ribonucleic acid. For example, the 2'-hydroxyl group (OH) can be modified or replaced with several different substituents. Exemplary 2'-position substitutions include, but are not limited to, H, halogen, optionally substituted C _1-6 alkyl; optionally substituted C _1-6 alkoxy; optionally substituted C _6-10 aryloxy; optionally substituted C _3-8 cycloalkyl; optionally substituted C _3-8 cycloalkoxy; optionally substituted C _6-10 aryloxy; optionally substituted C _6-10 aryl-C _1-6 alkoxy, optionally substituted C _1-12 (heterocyclyl)oxy; sugar (eg, ribose, pentose, or any of those described herein); polyethylene glycol (PEG), -O(CH ₂ CH ₂ O) _n CH ₂ CH ₂ OR, where R is H or optionally substituted alkyl and n is an integer from 0 to 20 (for example, from 0 to 4 , 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8 , 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20); "closed" nucleic acids (LNAs) in which the 2'-hydroxyl is linked by a C _1-6 alkylene or C _1-6 heteroalkylene bridge to the 4' carbon of the same ribose sugar, where illustrative bridges include methylene, propylene, ether or amino- bridge; aminoalkyl as defined herein; aminoalkoxy as defined herein; amino, as defined herein; and amino acids as defined herein.

As a rule, RNA includes a sugar group in the form of ribose, which is a 5-membered ring with oxygen. Illustrative, non-limiting, modified nucleotides include the replacement of an oxygen in the ribose (eg, with S, Se, or an alkylene such as methylene or ethylene); addition of a double bond (for example, to replace ribose with cyclopentenyl or cyclohexenyl); ribose ring shortening (eg, to form a 4-membered cyclobutane or oxetane ring); elongation of the ribose ring (eg, to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholine, which also has a phosphoramidate backbone); polycyclic forms (e.g. tricyclic; and "open" forms such as glycolic nucleic acid (GNA) (e.g. R-GNA or S-GNA where the ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA , in which the ribose is replaced by α-L-threofuranosyl-(3'→2')), and a peptide nucleic acid (PNA, in which 2-aminoethylglycine bonds replace the ribose and phosphodiester backbones).The sugar group may also contain one or more atoms carbon which have a stereochemical configuration opposite to that of the corresponding carbon in ribose.Thus, a polynucleotide molecule may include nucleotides containing, for example, arabinose as a sugar.Such sugar modifications are set forth in International Patent Application Publications No. WO 2013052523 and WO 2014093924, content each of which is incorporated herein by reference in their entirety.

The polynucleotides of the present invention (eg, a polynucleotide comprising a nucleotide sequence encoding a relaxin polypeptide or a functional fragment or variant thereof) may include a combination of sugar, nucleotide base, and/or internucleoside bond modifications. These combinations may include any one or more of the modifications described herein.

Untranslated sections (UTRs)

Untranslated regions (UTRs) are the portions of the nucleic acid of a polynucleotide before the start codon (5'-UTR) and after the stop codon (3'-UTR) that are not translated. In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., messenger RNA (mRNA)) of the present invention comprising an open reading frame (ORF) encoding a relaxin polypeptide further comprises a UTR (e.g., a 5'-UTR or its a functional fragment, a 3'-UTR or a functional fragment thereof, or a combination thereof).

The UTR may be homologous or heterologous to a coding region in a polynucleotide. In some embodiments, the UTR is homologous to an ORF encoding a relaxin polypeptide. In some embodiments, the UTR is heterologous to an ORF encoding a relaxin polypeptide. In some embodiments, the implementation of the polynucleotide contains two or more 5'-UTR or functional fragments, each of which has the same or different nucleotide sequence. In some embodiments, the implementation of the polynucleotide contains two or more 3'-UTR or functional fragments, each of which has the same or different nucleotide sequence.

In some embodiments, the 5'-UTR or functional fragment thereof, the 3'-UTR or functional fragment thereof, or any combination thereof are sequence-optimized.

In some embodiments, the 5'-UTR or a functional fragment thereof, the 3'-UTR or a functional fragment thereof, or any combination thereof, contains at least one chemically modified nucleotide base, such as 5-methoxyuracil.

UTRs may have characteristics that provide a regulatory role, such as increased or decreased stability, localization, and/or translation efficiency. A polynucleotide containing a UTR can be introduced into a cell, tissue, or organism, and one or more regulatory characteristics can be measured by conventional methods. In some embodiments, the functional fragment of the 5'-UTR or 3'-UTR provides one or more regulatory characteristics of the full-length 5'- or 3'-UTR, respectively.

Natural 5'-UTRs have characteristics that play a role in translation initiation. They contain features such as Kozak sequences, which are known to be involved in the process by which the ribosome initiates the translation of many genes. The Kozak sequences have the consensus sequence CCR(A/G)CCAUGG (SEQ ID NO: 492) where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG) followed by another 'G'. It is known that 5'-UTRs form secondary structures that are involved in the binding of the elongation factor.

By engineering for characteristics typically found in overexpressed genes in specific target organs, the stability and protein production of a polynucleotide can be improved. For example, administration of a 5'-UTR from a liver-expressed mRNA, such as for albumin, serum amyloid A, apolipoprotein A/B/E, transferrin, alpha-fetoprotein, erythropoietin, or factor VIII, can enhance the expression of polynucleotides in liver cell lines or in liver. Similarly, the use of 5'-UTR from another tissue-specific mRNA to improve expression in this tissue is possible for muscles (eg, MyoD, myosin, myoglobin, myogenin, herculin), for endothelial cells (for example, Tie-1, CD36), for myeloid cells ( e.g. C/EBP, AML1, G-CSF, GM-CSF, CD11b, MSR, Fr-1, i-NOS) for leukocytes (e.g. CD45, CD18), for adipose tissue (e.g. CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (eg SP-A/B/C/D).

In some embodiments, the UTR is selected from a family of transcripts whose proteins share a common function, structure, characteristic, or property. For example, an encoded polypeptide may refer to a family of proteins (i.e., those that share at least one common function, structure, characteristic, location, origin, or expression profile) that are expressed in a particular cell, tissue, or over time. in the course of development. A UTR from any of the genes or mRNA can be replaced with any other UTR from the same or a different protein family to create a new polynucleotide.

In some embodiments, the implementation of the 5'-UTR and 3'-UTR may be heterologous. In some embodiments, the implementation of the 5'-UTR can be obtained from a different species than the 3'-UTR. In some embodiments, the implementation of the 3'-UTR can be obtained from a different species than the 5'-UTR.

Simultaneously filed international patent application No. PCT/US2014/021522 (Pub. No. WO/2014/164253, incorporated herein by reference in its entirety) lists illustrative UTRs that can be used as flanking regions in the polynucleotide of the present invention in ORF.

Exemplary UTRs of this application include, without limitation, one or more 5'-UTRs and/or 3'-UTRs derived from a nucleic acid sequence: a globin such as α- or β-globin (e.g., Xenopus, mouse, rabbit, or human globin ); a strong translation initiation signal from the Kozak sequence; CYBA (for example, human cytochrome b-245 α-polypeptide); albumin (eg human albumin 7); HSD17B4 (hydroxysteroid (17-β) dehydrogenase); virus (eg, tobacco etch virus (TEV), Venezuelan equine encephalitis virus (VEEV), dengue virus, cytomegalovirus (CMV) (eg, CMV immediate early response 1 (IE1)), hepatitis virus (eg, hepatitis B), Sindbis virus or barley yellow dwarf PAV virus); heat shock protein (eg hsp70); translation initiation factor (eg elF4G); a glucose transporter (eg, hGLUT1 (human glucose transporter 1)); actin (eg, human α- or β-actin); GAPDH; tubulin; histone; citric acid cycle enzyme; topoisomerases (for example, the 5'-UTR of the TOP gene lacking the 5'-TOP (oligopyrimidine tract) motif); ribosomal protein Large 32 (L32); a ribosomal protein (eg, a human or mouse ribosomal protein such as, for example, rps9); ATP synthase (for example, ATP5A1 or β-subunit of mitochondrial H ⁺ -ATP synthase); growth hormone (eg, bovine (bGH) or human (hGH)); elongation factor (eg elongation factor 1 α1 (EEF1A1)); manganese superoxide dismutase (MnSOD); myocyte enhancing factor 2A (MEF2A); β-F1-ATPase, creatine kinase, myoglobin, granulocyte colony stimulating factor (G-CSF); collagen (eg type I alpha 2 collagen (Col1A2), type I alpha 1 collagen (Col1A1), type VI alpha 2 collagen (Col6A2), type VI alpha 1 collagen (Col6A1)); ribophorin (eg, ribophorin I (RPNI)); a low-density lipoprotein receptor-associated protein (eg, LRP1); a cardiotrophin-like cytokine factor (eg, Nnt1); calreticulin (Calr); pro collagen-lysine 2-oxoglutarate-5-dioxygenase 1 (Plod1) and nucleobindin (eg Nucb1).

In some embodiments, the implementation of the 5'-UTR is selected from the group consisting of 5'-UTR β-globin; 5'-UTR containing a strong translation initiation signal from the Kozak sequence; Cytochrome b-245 α-polypeptide 5'UTR (CYBA); 5'-UTR of hydroxysteroid (17-β) dehydrogenase (HSD17B4); 5'UTR of tobacco etch virus (TEV); Venezuelan equine encephalitis virus (TEEV) 5'UTR; 5' proximal open reading frame of rubella virus (RV) RNA encoding non-structural proteins; Dengue virus 5'-UTR (DEN); 5'UTR of heat shock protein 70 (Hsp70); 5'-UTR eIF4G; 5'-UTR GLUT1; their functional fragments and any combination thereof.

In some embodiments, the 3'UTR is selected from the group consisting of β-globin 3'UTR; 3'-UTR of CYBA; 3'-UTR of albumin; growth hormone (GH) 3'UTR; 3'-UTR VEEV; 3'-UTR of hepatitis B virus (HBV); 3'-UTR of α-globin; 3'-UTR DEN; 3'-UTR of the Barley Yellow Dwarf PAV Virus (BYDV-PAV); 3'UTR of elongation factor 1 α1 (EEF1A1); 3'UTR of manganese superoxide dismutase (MnSOD); 3'-UTR β-subunit of mitochondrial H (+)-ATP synthase (β-mRNA); 3'-UTR GLUT1; 3'-UTR MEF2A; 3'-UTR β-F1-ATPase their functional fragments and their combinations.

Wild-type UTRs derived from any gene or mRNA can be inserted into the polynucleotides of the present invention. In some embodiments, the implementation of the UTR can be changed relative to the wild-type or native UTR to obtain a variant UTR, for example, by changing the orientation or location of the UTR relative to the ORF; or by the inclusion of additional nucleotides, deletion of nucleotides, substitution or rearrangement of nucleotides. In some embodiments, 5'- or 3'-UTR variants can be used, for example, wild-type UTR mutants or variants in which one or more nucleotides are added to or removed from the end of the UTR.

In addition, one or more synthetic UTRs may be used in combination with one or more non-synthetic UTRs. See, for example, Mandal and Rossi, Nat. Protocol. 2013 8(3): 568-82, and the sequences available at www.addgene.org/Derrick_Rossi/, the contents of each of which are incorporated herein by reference in their entirety. The UTRs, or portions thereof, may be placed in the same orientation as the transcript from which they were selected, or their orientation or location may be changed. Therefore, the 5'- and/or 3'-UTR can be inverted, shortened, lengthened, or combined with one or more other 5'-UTRs or 3'-UTRs.

In some embodiments, the implementation of the polynucleotide contains multiple UTR, such as double, triple or quadruple 5'-UTR or 3'-UTR. For example, a double UTR contains two copies of the same UTR, either consecutively or nearly consecutively. For example, you can use the double 3'-UTR of beta-globin (see US 2010/0129877, the contents of which are incorporated herein by reference in its entirety).

In certain embodiments, the implementation of the polynucleotides of the present invention contain 5'-UTR and/or 3'-UTR selected from any of the UTR disclosed in this document. In some embodiments, the implementation of the 5'-UTR and/or 3'-UTR contain:

In certain embodiments, the 5'-UTR and/or 3'-UTR sequence of the present invention comprises a nucleotide sequence that is at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from the group consisting of 5'-UTR sequences containing any of SEQ ID NOs: 545-569 and/or 3'-UTR sequences containing any of SEQ ID NOs: 493-505 and 570-587, and any combination thereof.

The polynucleotides of the present invention may contain combinations of characteristics. For example, an ORF can be flanked by a 5'UTR that contains a strong translation initiation signal from the Kozak sequence and/or a 3'UTR that contains an oligo(dT) sequence for template attachment of the poly(A) tail. The 5'-UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and/or different UTRs (see, for example, US 2010/0293625, incorporated herein by reference in its entirety).

Sequences other than UTRs can be used as regions or sub-regions within the polynucleotides of the present invention. For example, introns or portions of intron sequences can be inserted into the polynucleotides of the present invention. Insertion of intron sequences can increase protein production as well as polynucleotide expression levels. In some embodiments, the polynucleotide of the present invention contains an internal ribosome entry site (IRES) instead of or in addition to the UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010 394(1): 189-193 , the contents of which are incorporated herein by reference in their entirety). In some embodiments, the polynucleotide contains an IRES instead of a 5'UTR sequence. In some embodiments, the implementation of the polynucleotide contains the ORF and the sequence of the capsid of the virus. In some embodiments, the implementation of the polynucleotide contains a synthetic 5'-UTR in combination with a non-synthetic 3'-UTR.

In some embodiments, the UTR may also include at least one translation enhancer polynucleotide, translation enhancer element, or translation enhancer elements (collectively "TEE" which refers to nucleic acid sequences that increase the amount of a polypeptide or protein produced from a polynucleotide). As a non-limiting example, TEE may include those described in US 2009/0226470, incorporated herein by reference in its entirety, and others known in the art. As a non-limiting example, TEE can be located between a transcription promoter and a start codon. In some embodiments, the implementation of the 5'-UTR contains TEE.

In one aspect, TEE is a conserved element in the UTR that can promote nucleic acid translation activity, such as, but not limited to, cap-dependent or cap-independent translation.

In one non-limiting example, the TEE contains the TEE sequence in the 5' leader sequence of the Gtx protein homeodomain. See Chappell et al., PNAS 2004 101: 9590-9594, incorporated herein by reference in its entirety.

The terms "translation enhancer polynucleotide" or "translation enhancer polynucleotide sequence" refers to a polynucleotide that includes one or more TEEs provided herein and/or known in the art (see, for example, US 6310197, US 6849405, US 7456273 , US 7183395, US 2009/0226470, US 2007/0048776, US 2011/0124100, US 2009/0093049, US 2013/0177581, WO 2009/075886, WO 2007/025008, WO 20 12/009644, WO2001/055371, WO 1999/024595, EP 2610341 A1 and EP 2610340 A1, the contents of each of which are incorporated herein by reference in their entirety), or variants, homologues or functional derivatives thereof. In some embodiments, the implementation of the polynucleotide of the present invention contains one or more copies of TEE. The TEE in a translation enhancer polynucleotide may be organized into one or more sequence segments. A sequence segment may comprise one or more of the TEEs provided herein, with each TEE present in one or more copies. If multi-sequence segments are present in a translation enhancer polynucleotide, they may be homogeneous or heterogeneous. Thus, segments with multiple sequences in a translation enhancer polynucleotide can carry the same or different type of TEE provided herein, the same or different number of copies of each of the TEEs, and/or the same or different TEE organization in each sequence segment. In one embodiment, the polynucleotide of the present invention comprises a translation enhancer polynucleotide sequence.

In some embodiments, a 5'-UTR and/or a 3'-UTR containing at least one TEE described herein may be included in a monocistronic sequence, such as, but not limited to, a vector system or a nucleic acid vector.

In some embodiments, the implementation of the 5'-UTR and/or 3'-UTR of the polynucleotide of the present invention contains a TEE or a portion thereof, described in this document. In some embodiments, the TEE in the 3'UTR may be the same and/or different from the TEE located in the 5'UTR.

In some embodiments, the implementation of the 5'-UTR and/or 3'-UTR of the polynucleotide of the present invention may include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6 , at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16 at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. In one embodiment, the 5'UTR of a polynucleotide of the present invention may include 1-60, 1-55, 1-50, 1-45, 1-40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 TEE sequence. The TEE sequences in the 5'UTR of a polynucleotide of the present invention may be the same or different TEE sequences. The combination of different TEE sequences in the 5'UTR of a polynucleotide of the present invention may include combinations in which more than one copy of any of the different TEE sequences is inserted.

In some embodiments, the 5'-UTR and/or 3'-UTR contains a spacer to separate the two TEE sequences. As a non-limiting example, the spacer may be a 15 nucleotide spacer and/or other spacers known in the art. As another non-limiting example, the 5'-UTR and/or 3'-UTR contains a TEE spacer sequence module repeated at least once, at least twice, at least 3 times, at least 4 times, at least at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, or more than 10 times in the 5'-UTR and/or 3'-UTR, respectively . In some embodiments, the 5'-UTR and/or 3'-UTR comprises a TEE spacer sequence module repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times.

In some embodiments, a spacer separating two TEE sequences may include other sequences known in the art that can regulate translation of a polynucleotide of the present invention, such as the miR sequences described herein (e.g., miR binding sites and miR seed regions) . As a non-limiting example, each spacer used to separate two TEE sequences may include a different miR sequence or a miR sequence component (eg, a miR seed sequence).

In some embodiments, the implementation of the polynucleotide of the present invention contains the sequence miR and/or TEE. In some embodiments, the inclusion of a miR sequence and/or a TEE sequence in a polynucleotide of the present invention may alter the shape of the stem-loop region, which may increase and/or decrease translation. See, for example, Kedde et al., Nature Cell Biology 2010 12(10): 1014-20, incorporated herein by reference in its entirety.).

MicroRNA binding sites (miRNA)

The polynucleotides of the present invention may include regulatory elements such as microRNA (miRNA) binding sites, transcription factor binding sites, mRNA structured sequences and/or motifs, artificial binding sites designed to act as pseudoreceptors for endogenous nucleic acid binding molecules, and their combinations. In some embodiments, polynucleotides comprising such regulatory elements are referred to as including "sensor sequences". Non-limiting examples of sensor sequences are described in US Patent Application Publication No. 2014/0200261, the contents of which are incorporated herein by reference in their entirety.

In some embodiments, the polynucleotide (e.g., ribonucleic acid (RNA), e.g., messenger RNA (mRNA)) of the present invention comprises an open reading frame (ORF) encoding a polypeptide of interest and further comprises one or more miRNA binding sites. The introduction or incorporation of miRNA binding site(s) provides for the regulation of the polynucleotides of the present invention, and in turn the polypeptides encoded by them, based on tissue-specific and/or cell-type-specific expression of natural miRNAs.

A miRNA, eg, natural miRNA, is a 19-25 nucleotide long non-coding RNA that binds to a polynucleotide and reduces the activity of gene expression, either by reducing the stability or by inhibiting translation of the polynucleotide. The miRNA sequence contains a "seed" region, that is, a sequence in the region of positions 2-8 of the mature miRNA. The miRNA seed sequence may contain positions 2-8 or 2-7 of the mature miRNA. In some embodiments, the miRNA primer sequence may comprise 7 nucleotides (eg, nucleotides 2-8 of mature miRNA), where the primer's complementary site in the corresponding miRNA binding site is flanked by adenosine (A) opposite position 1 in the miRNA. In some embodiments, the miRNA primer sequence may comprise 6 nucleotides (eg, nucleotides 2-7 of mature miRNA), where the primer's complementary site in the corresponding miRNA binding site is flanked by adenosine (A) opposite position 1 in the miRNA. See, for example, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6; 27(1): 91-105. You can perform miRNA profiling of target cells or tissues to determine the presence or absence of miRNA in cells or tissues. In some embodiments, the polynucleotide (e.g., ribonucleic acid (RNA), e.g., messenger RNA (mRNA)) of the present invention comprises one or more miRNA binding sites, miRNA target sequences, complementary miRNA sequences, or complementary miRNA seed sequences. Such sequences may correspond to, for example, be complementary to any known miRNA, such as those described in US Patent Application Publication No. US 2005/0261218 and US Patent Application Publication No. US 2005/0059005, the contents of each of which are incorporated herein by reference in in all its fullness.

As used herein, "microRNA binding site (miRNA or miR)" refers to a sequence within a polynucleotide, e.g., within DNA or within an RNA transcript, including in the 5'-UTR and/or 3'-UTR, which is sufficiently complementary to the entire miRNA or a portion of it for interaction with, association with, or association with the miRNA. In some embodiments, a polynucleotide of the present invention containing an ORF encoding a polypeptide of interest further comprises one or more miRNA binding sites. In exemplary embodiments, the 5'-UTR and/or 3'-UTR of a polynucleotide (eg, ribonucleic acid (RNA), eg, messenger RNA (mRNA)) contains one or more miRNA binding sites.

The term miRNA binding site having sufficient complementarity with miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated regulation of a polynucleotide, such as miRNA-mediated translational repression or polynucleotide degradation. In exemplary aspects of the present invention, the term miRNA binding site having sufficient complementarity with miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated degradation of a polynucleotide, e.g., by mRNA cleavage mediated by a miRNA-directed RNA-inducible gene silencing complex (RISC). The miRNA binding site may have complementarity with, for example, a 19-25 nucleotide miRNA sequence, a 19-23 nucleotide miRNA sequence, or a 22 nucleotide miRNA sequence. The miRNA binding site may be complementary to only a portion of the miRNA, such as a portion that is less than 1, 2, 3, or 4 nucleotides from the full natural miRNA sequence. Continuous or complete complementarity (eg, complete complementarity or complete complementarity along the entire length or a significant part of the length of the natural miRNA) is preferred when the necessary result of regulation is the destruction of the mRNA.

In some embodiments, the miRNA binding site includes a sequence that is complementary (eg, partially or completely complementary) to the miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that has full complementarity with the miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that is complementary (eg, partially or fully complementary) to the miRNA sequence. In some embodiments, the miRNA binding site includes a sequence that is fully complementary to the miRNA sequence. In some embodiments, the miRNA binding site is fully complementary to the miRNA sequence except for 1, 2, or 3 nucleotide substitutions, terminal additions, and/or truncations.

In some embodiments, the miRNA binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA binding site is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve nucleotides shorter than the corresponding miRNA, from the 5' end, 3' end, or from both. In other embodiments, the miRNA binding site is two nucleotides shorter than the corresponding miRNA, at the 5' end, 3' end, or both. MiRNA binding sites that are shorter than the corresponding miRNAs are still able to degrade an mRNA comprising one or more of that miRNA's binding sites or prevent translation of the mRNA.

In some embodiments, the miRNA binding site binds a corresponding mature miRNA that is part of an active RISC containing Dicer. In another embodiment, binding of the miRNA binding site to the corresponding miRNA in the RISC disrupts the mRNA containing the miRNA binding site or prevents translation of the mRNA. In some embodiments, the miRNA binding site is sufficiently complementary to the miRNA so that the RISC complex containing the miRNA cleaves the polynucleotide containing the miRNA binding site. In other embodiments, the miRNA binding site has imperfect complementarity such that the RISC complex containing the miRNA induces instability of the polynucleotide containing the miRNA binding site. In another embodiment, the miRNA binding site has incomplete complementarity, so the RISC complex containing the miRNA represses transcription of the polynucleotide containing the miRNA binding site.

In some embodiments, the miRNA binding site has one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve mismatches from the corresponding miRNA.

In some embodiments, the miRNA binding site has at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one contiguous nucleotides complementary to at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty one, respectively, adjacent nucleotide of the corresponding miRNA.

By designing one or more miRNA binding sites in a polynucleotide of the present invention, the polynucleotide can be targeted to disrupt or reduce translation, provided that the desired miRNA is available. This can reduce the off-target effects of polynucleotide delivery. For example, if a polynucleotide of the present invention is not intended to be delivered to a tissue or cell, but enters said tissue or cell, then miRNA accumulated at high copy number in the tissue or cell may inhibit expression of the gene of interest if one or more binding sites miRNAs are constructed into the 5'-UTR and/or 3'-UTR of the polynucleotide.

In contrast, miRNA binding sites can be removed from polynucleotide sequences in which they are naturally present in order to increase protein expression in certain tissues. For example, a binding site for a particular miRNA can be removed from a polynucleotide to improve protein expression in tissues or cells containing the miRNA.

In one embodiment, a polynucleotide of the present invention may include at least one miRNA binding site in the 5'-UTR and/or 3'-UTR to regulate the activity of mRNA-based cytotoxic or cytoprotective therapeutics on specific cells, such as without limits normal and/or cancerous cells. In another embodiment, a polynucleotide of the present invention may include two, three, four, five, six, seven, eight, nine, ten or more miRNA binding sites in the 5'-UTR and/or 3'-UTR to regulate cytotoxic or cytoprotective the activity of mRNA-based therapeutics on specific cells, such as, without limitation, normal and/or cancer cells.

Regulation of expression in multiple tissues can be accomplished by introducing or removing one or more miRNA binding sites, eg one or more different miRNA binding sites. The decision on whether to remove or insert a miRNA binding site can be made based on the miRNA expression profile and/or analysis of their profile in tissues and/or cells during development and/or disease. Identification of miRNAs, miRNA binding sites and their expression profiles and biological roles have been reported (e.g., Bonauer et al., Curr Drug Targets 2010 11: 943-949; Anand and Cheresh Curr Opin Hematol 2011 18: 171-176; Contreras and Rao Leukemia 2012 26: 404-413 (2011 Dec 20. doi: 10.1038/leu.2011.356); Bartel Cell 2009 136: 215-233; Landgraf et al, Cell, 2007 129: 1401-1414; Gentner and Naldini, Tissue Antigens. 201 2 80: 393-403 and all references therein; each of which is incorporated herein by reference in its entirety).

The miRNA and miRNA binding sites may correspond to any known sequence, including the non-limiting examples described in US Patent Application Publication Nos. 2014/0200261, 2005/0261218, and 2005/0059005, each of which is incorporated herein by reference in its entirety.

Examples of tissues in which miRNA is known to regulate mRNA and thus protein expression include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17- 92, miR-126), myeloid cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-1d, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).

In particular, miRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen-presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B-lymphocytes, T-lymphocytes, granulocytes, natural killers, etc. Immune cell-specific miRNAs have been implicated in immunogenicity, autoimmunity, immune response to infection, inflammation, and unwanted immune response after gene therapy and tissue/organ transplantation. Immune-specific miRNAs also regulate many aspects of development, proliferation, differentiation, and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are exclusively expressed in immune cells, in particular, are multicopy in myeloid dendritic cells. It has been demonstrated that the immune response to a polynucleotide can be disabled by adding miR-142 binding sites to the 3'-UTR of the polynucleotide, resulting in more stable gene transfer into tissues and cells. miR-142 effectively degrades exogenous polynucleotides in antigen presenting cells and suppresses cytotoxic clearance of transduced cells (e.g., Annoni A et al., blood, 2009, 114, 5152-5161; Brown BD, et al., Nat med. 2006, 12(5 ), 585-591; Brown BD, et al., blood, 2007, 110(13): 4144-4152, each of which is incorporated herein by reference in its entirety).

An antigen-mediated immune response may refer to an immune response elicited by foreign antigens that, when introduced into the body, are processed by antigen-presenting cells and displayed on the surface of antigen-presenting cells. T cells can recognize the presented antigen and induce cytotoxic deletion of cells that express the antigen.

Introduction of a miR-142 binding site into the 5'-UTR and/or 3'-UTR of a polynucleotide of the present invention can selectively suppress gene expression in antigen-presenting cells by miR-142 mediated disruption, limiting antigen presentation in antigen-presenting cells (e.g., dendritic cells) and thereby preventing an antigen-mediated immune response upon delivery of the polynucleotide. The polynucleotide is then stably expressed in target tissues or cells without triggering cytotoxic clearance.

In one embodiment, binding sites for miRNAs known to be expressed in immune cells, in particular antigen presenting cells, can be engineered in a polynucleotide of the present invention to suppress expression of the polynucleotide in antigen presenting cells by miRNA-mediated RNA degradation, suppressing antigen-mediated immune response. Expression of the polynucleotide is conserved in non-immune cells where immune cell-specific miRNAs are not expressed. For example, in some embodiments, to prevent an immunogenic reaction against a liver-specific protein, any miR-122 binding site can be removed and the miR-142 (and/or mirR-146) binding site can be engineered into the 5'-UTR and/or 3'- UTR of the polynucleotide of the present invention.

To further promote selective degradation and repression in APC and macrophage, the polynucleotide of the present invention may include another negative regulatory element in the 5'-UTR and/or 3'-UTR, either alone or in combination with miR-142 and/or binding sites. or miR-146. As a non-limiting example, an additional negative regulatory element is the constitutive decay element (CDE).

Immune cell-specific miRNAs include, but are not limited to hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsa-let- 7e-5p, hsa-let-7g-3p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR- 1184, hsa-let-7f-1-3p, hsa-let-7f-2--5p, hsa-let-7f-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b -5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR -143-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR -150-3p, miR-150-5p, miR-151b, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p , miR-16-1-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR-181a-5p, miR-181a-2-3p, miR -182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR-21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223 -3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24-1-5p, miR-24-2-5p, miR -24-3p, miR-26a-1-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27a-3p, miR-27a-5p , miR-27b-3p, miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-1-5p, miR -29b-2-5p, miR-29c-3p, miR-29c-5p, miR-30e-3p, miR-30e-5p, miR-331-5p, miR-339-3p, miR-339-5p, miR -345-3p, miR-345-5p, miR-346, miR-34a-3p, miR-34a-5p, miR-363-3p, miR-363-5p, miR-372, miR-377-3p, miR -377-5p, miR-493-3p, miR-493-5p, miR-542, miR-548b-5p, miR548c-5p, miR-548i, miR-548j, miR-548n, miR-574-3p, miR -598, miR-718, miR-935, miR-99a-3p, miR-99a-5p, miR-99b-3p and miR-99b-5p. In addition, novel miRNAs can be identified by microarray hybridization and microtome analysis (e.g., Jima DD et al., Blood, 2010, 116: e118-e127; Vaz C et al., BMC Genomics, 2010, 11, 288 , the contents of each of which are incorporated herein by reference in their entirety).

MicroRNAs known to be expressed in the liver include, but are not limited to miR-107, miR-122-3p, miR-122-5p, miR-1228-3p, miR-1228-5p, miR-1249, miR-129- 5p, miR-1303, miR-151a-3p, miR-151a-5p, miR-152, miR-194-3p, miR-194-5p, miR-199a-3p, miR-199a-5p, miR-199b- 3p, miR-199b-5p, miR-296-5p, miR-557, miR-581, miR-939-3p and miR-939-5p. MiRNA binding sites from any liver-specific miRNA can be introduced into or removed from a polynucleotide of the present invention to regulate expression of the polynucleotide in the liver. Liver-specific miRNA binding sites can be designed alone or additionally in combination with immune cell (eg, APC) miRNA binding sites in a polynucleotide of the present invention.

MicroRNAs known to be expressed in the lung include, but are not limited to, let-7a-2-3p, let-7a-3p, let-7a-5p, miR-126-3p, miR-126-5p, miR-127- 3p, miR-127-5p, miR-130a-3p, miR-130a-5p, miR-130b-3p, miR-130b-5p, miR-133a, miR-133b, miR-134, miR-18a-3p, miR-18a-5p, miR-18b-3p, miR-18b-5p, miR-24-1-5p, miR-24-2-5p, miR-24-3p, miR-296-3p, miR-296- 5p, miR-32-3p, miR-337-3p, miR-337-5p, miR-381-3p and miR-381-5p. MiRNA binding sites from any lung-specific miRNA can be introduced into or removed from a polynucleotide of the present invention to regulate expression of the polynucleotide in the lungs. Lung-specific miRNA binding sites can be designed alone or additionally in combination with immune cell (eg, APC) miRNA binding sites in a polynucleotide of the present invention.

MicroRNAs known to be expressed in the heart include, but are not limited to miR-1, miR-133a, miR-133b, miR-149-3p, miR-149-5p, miR-186-3p, miR-186-5p, miR-208a, miR-208b, miR-210, miR-296-3p, miR-320, miR-451a, miR-451b, miR-499a-3p, miR-499a-5p, miR-499b-3p, miR- 499b-5p, miR-744-3p, miR-744-5p, miR-92b-3p and miR-92b-5p. MiRNA binding sites from any heart-specific miRNA can be introduced into or removed from a polynucleotide of the present invention to regulate the expression of the polynucleotide in the heart. Heart-specific miRNA binding sites can be designed alone or additionally in combination with immune cell (eg, APC) miRNA binding sites in a polynucleotide of the present invention.

MicroRNAs known to be expressed in the nervous system include, but are not limited to miR-124-5p, miR-125a-3p, miR-125a-5p, miR-125b-1-3p, miR-125b-2-3p, miR -125b-5p, miR-1271-3p, miR-1271-5p, miR-128, miR-132-5p, miR-135a-3p, miR-135a-5p, miR-135b-3p, miR-135b-5p , miR-137, miR-139-5p, miR-139-3p, miR-149-3p, miR-149-5p, miR-153, miR-181c-3p, miR-181c-5p, miR-183-3p , miR-183-5p, miR-190a, miR-190b, miR-212-3p, miR-212-5p, miR-219-1-3p, miR-219-2-3p, miR-23a-3p, miR -23a-5p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-1-3p, miR-30c-2-3p, miR-30c-5p, miR-30d-3p , miR-30d-5p, miR-329, miR-342-3p, miR-3665, miR-3666, miR-380-3p, miR-380-5p, miR-383, miR-410, miR-425-3p , miR-425-5p, miR-454-3p, miR-454-5p, miR-483, miR-510, miR-516a-3p, miR-548b-5p, miR-548c-5p, miR-571, miR -7-1-3p, miR-7-2-3p, miR-7-5p, miR-802, miR-922, miR-9-3p and miR-9-5p. MicroRNAs accumulating in the nervous system further include those specifically expressed in neurons, including but not limited to miR-132-3p, miR-132-3p, miR-148b-3p, miR-148b-5p, miR-151a-3p, miR-151a-5p, miR-212-3p, miR-212-5p, miR-320b, miR-320e, miR-323a-3p, miR-323a-5p, miR-324-5p, miR-325, miR- 326, miR-328, miR-922, and those specifically expressed in glial cells, including but not limited to miR-1250, miR-219-1-3p, miR-219-2-3p, miR-219-5p, miR -23a-3p, miR-23a-5p, miR-3065-3p, miR-3065-5p, miR-30e-3p, miR-30e-5p, miR-32-5p, miR-338-5p and miR-657 . MiRNA binding sites from any CNS-specific miRNA can be introduced into or removed from a polynucleotide of the present invention to regulate the expression of the polynucleotide in the nervous system. Nerve-specific miRNA binding sites can be designed alone or additionally in combination with immune cell (eg, APC) miRNA binding sites in a polynucleotide of the present invention.

MicroRNAs known to be expressed in the pancreas include, but are not limited to miR-105-3p, miR-105-5p, miR-184, miR-195-3p, miR-195-5p, miR-196a-3p, miR -196a-5p, miR-214-3p, miR-214-5p, miR-216a-3p, miR-216a-5p, miR-30a-3p, miR-33a-3p, miR-33a-5p, miR-375 , miR-7-1-3p, miR-7-2-3p, miR-493-3p, miR-493-5p and miR-944. MiRNA binding sites from any pancreas-specific miRNA can be introduced into or removed from a polynucleotide of the present invention to regulate expression of the polynucleotide in the pancreas. Pancreas-specific miRNA binding sites can be designed alone or additionally in combination with immune cell (eg, APC) miRNA binding sites in a polynucleotide of the present invention.

MicroRNAs known to be expressed in the kidney include, but are not limited to miR-122-3p, miR-145-5p, miR-17-5p, miR-192-3p, miR-192-5p, miR-194-3p, miR-194-5p, miR-20a-3p, miR-20a-5p, miR-204-3p, miR-204-5p, miR-210, miR-216a-3p, miR-216a-5p, miR-296- 3p, miR-30a-3p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-1-3p, miR-30c-2-3p, miR30c-5p, miR-324- 3p, miR-335-3p, miR-335-5p, miR-363-3p, miR-363-5p and miR-562. MiRNA binding sites from any kidney-specific miRNA can be introduced into or removed from a polynucleotide of the present invention to regulate the expression of the polynucleotide in the kidney. Kidney-specific miRNA binding sites can be designed alone or additionally in combination with immune cell (eg, APC) miRNA binding sites in a polynucleotide of the present invention.

MicroRNAs known to be expressed in muscle include, without limitation, let-7g-3p, let-7g-5p, miR-1, miR-1286, miR-133a, miR-133b, miR-140-3p, miR- 143-3p, miR-143-5p, miR-145-3p, miR-145-5p, miR-188-3p, miR-188-5p, miR-206, miR-208a, miR-208b, miR-25- 3p and miR-25-5p. MiRNA binding sites from any muscle-specific miRNA can be introduced into or removed from a polynucleotide of the present invention to regulate expression of the polynucleotide in muscle. Muscle-specific miRNA binding sites can be designed alone or additionally in combination with immune cell (eg, APC) miRNA binding sites in a polynucleotide of the present invention.

MicroRNAs are also differentially expressed in various cell types such as, but not limited to, endothelial cells, epithelial cells, and adipocytes.

MicroRNAs known to be expressed in endothelial cells include, but are not limited to, let-7b-3p, let-7b-5p, miR-100-3p, miR-100-5p, miR-101-3p, miR-101-5p , miR-126-3p, miR-126-5p, miR-1236-3p, miR-1236-5p, miR-130a-3p, miR-130a-5p, miR-17-5p, miR-17-3p, miR -18a-3p, miR-18a-5p, miR-19a-3p, miR-19a-5p, miR-19b-1-5p, miR-19b-2-5p, miR-19b-3p, miR-20a-3p , miR-20a-5p, miR-217, miR-210, miR-21-3p, miR-21-5p, miR-221-3p, miR-221-5p, miR-222-3p, miR-222-5p , miR-23a-3p, miR-23a-5p, miR-296-5p, miR-361-3p, miR-361-5p, miR-421, miR-424-3p, miR-424-5p, miR-513a -5p, miR-92a-1-5p, miR-92a-2-5p, miR-92a-3p, miR-92b-3p and miR-92b-5p. Many new miRNAs have been found in endothelial cells in deep sequencing analysis (eg, Voellenkle C et al., RNA, 2012, 18, 472-484, incorporated herein by reference in its entirety). MiRNA binding sites from any endothelial cell-specific miRNA can be introduced into or removed from a polynucleotide of the present invention to regulate expression of the polynucleotide in endothelial cells.

MicroRNAs known to be expressed in epithelial cells include, but are not limited to let-7b-3p, let-7b-5p, miR-1246, miR-200a-3p, miR-200a-5p, miR-200b-3p, miR -200b-5p, miR-200c-3p, miR-200c-5p, miR-338-3p, miR-429, miR-451a, miR-451b, miR-494, miR-802 and miR-34a, miR-34b -5p, miR-34c-5p, miR-449a, miR-449b-3p, miR-449b-5p, specific for ciliated epithelial cells of the respiratory tract, let-7 family, miR-133a, miR-133b, miR-126, specific for lung epithelial cells, miR-382-3p, miR-382-5p specific for kidney epithelial cells, and miR-762 specific for corneal epithelial cells. MiRNA binding sites from any epithelial cell-specific miRNA can be introduced into or removed from a polynucleotide of the present invention to regulate expression in epithelial cells.

In addition, a large group of miRNAs accumulate in embryonic stem cells, controlling stem cell self-renewal and the development and/or differentiation of various cell lines such as nerve cells, heart cells, hematopoietic cells, skin cells, osteogenic cells, and muscle cells (e.g., Kuppusamy KT et al., Curr. Mol Med, 2013, 13(5), 757-764; Vidigal JA and Ventura A, Semin Cancer Biol. 2012, 22(5-6), 428-436; Goff LA et al., PLoS One, 2009, 4: e7192; Morin RD et al., Genome Res, 2008, 18, 610-621; Yoo JK et al., Stem Cells Dev. 2012, 21(11), 2049-2057, each of which incorporated herein by reference in its entirety). MicroRNAs that are multicopy in embryonic stem cells include, without limitation, let-7a-2-3p, let-a-3p, let-7a-5p, let7d-3p, let-7d-5p, miR-103a-2-3p , miR-103a-5p, miR-106b-3p, miR-106b-5p, miR-1246, miR-1275, miR-138-1-3p, miR-138-2-3p, miR-138-5p, miR -154-3p, miR-154-5p, miR-200c-3p, miR-200c-5p, miR-290, miR-301a-3p, miR-301a-5p, miR-302a-3p, miR-302a-5p , miR-302b-3p, miR-302b-5p, miR-302c-3p, miR-302c-5p, miR-302d-3p, miR-302d-5p, miR-302e, miR-367-3p, miR-367 -5p, miR-369-3p, miR-369-5p, miR-370, miR-371, miR-373, miR-380-5p, miR-423-3p, miR-423-5p, miR-486-5p , miR-520c-3p, miR-548e, miR-548f, miR-548g-3p, miR-548g-5p, miR-548i, miR-548k, miR-5481, miR-548m, miR-548n, miR-548o -3p, miR-548o-5p, miR-548p, miR-664a-3p, miR-664a-5p, miR-664b-3p, miR-664b-5p, miR-766-3p, miR-766-5p, miR -885-3p, miR-885-5p, miR-93-3p, miR-93-5p, miR-941, miR-96-3p, miR-96-5p, miR-99b-3p and miR-99b-5p . Many predicted new miRNAs have been discovered by deep sequencing in human embryonic stem cells (e.g., Morin RD et al., Genome Res, 2008, 18, 610-621; Goff LA et al., PLoS One, 2009, 4: e7192; Bar M et al., Stem cells, 2008, 26, 2496-2505, the contents of which are incorporated herein by reference in their entirety).

In one embodiment, embryonic stem cell-specific miRNA binding sites can be included or removed from the 3'-UTR of a polynucleotide of the present invention to modulate embryonic stem cell development and/or differentiation, to inhibit stem cell aging under conditions of degeneration (e.g., degenerative disease) or to promote senescence and apoptosis of stem cells in disease conditions (eg, stem cell cancer).

As a non-limiting example, miRNA binding sites for miRNAs that are overexpressed in certain cancer and/or tumor cells can be removed from the 3'-UTR of a polynucleotide of the present invention, restoring expression repressed by overexpressed miRNAs in cancer cells, thereby improving the corresponding biological function, for example, stimulation and/or repression of transcription, cell cycle arrest, apoptosis and cell death. Normal cells and tissues in which miRNA expression is not activated will not be affected.

MicroRNAs can also regulate complex biological processes such as angiogenesis (eg miR-132) (Anand and Cheresh Curr Opin Hematol 2011 18: 171-176). In the polynucleotides of the present invention, miRNA binding sites that are involved in such processes can be removed or introduced in order to tailor the expression of the polynucleotides to biologically relevant cell types or corresponding biological processes. In this context, the polynucleotides of the present invention are defined as auxotrophic polynucleotides.

In some embodiments, the polynucleotide of the present invention comprises a miRNA binding site, wherein the miRNA binding site comprises one or more nucleotide sequences selected from Table 4, including one or more copies of any one or more miRNA binding site sequences. In some embodiments, the polynucleotide of the present invention further comprises at least one, two, three, four, five, six, seven, eight, nine, ten or more of the same or different miRNA binding sites selected from Table 4, including any combination thereof. . In some embodiments, the miRNA binding site binds to miR-142 or is complementary to miR-142. In some embodiments, miR-142 comprises SEQ ID NO: 539. In some embodiments, the miRNA binding site binds to miR-142-3p or miR-142-5p. In some embodiments, the miR-142-3p binding site comprises SEQ ID NO: 541. In some embodiments, the miR-142-5p binding site comprises SEQ ID NO: 543. In some embodiments, the miRNA binding site contains a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 541 or SEQ ID NO: 543.

In some embodiments, the miRNA binding site is inserted into the polynucleotide of the present invention at any position on the polynucleotide (eg, in the 5'-UTR and/or 3'-UTR). In some embodiments, the 5'UTR contains a miRNA binding site. In some embodiments, the 3'UTR contains a miRNA binding site. In some embodiments, the 5'-UTR and 3'-UTR contain a miRNA binding site. The insertion site in a polynucleotide can be located anywhere in the polynucleotide, as long as the insertion of the miRNA binding site in the polynucleotide does not interfere with translation of the functional polypeptide in the absence of the corresponding miRNA; and in the presence of miRNA, insertion of the miRNA binding site in the polynucleotide and binding of the miRNA binding site to the corresponding miRNA are capable of degrading the polynucleotide or preventing translation of the polynucleotide.

In some embodiments, the miRNA binding site is inserted at least about 30 nucleotides downstream of the ORF stop codon in an ORF-containing polynucleotide of the present invention. In some embodiments, the miRNA binding site is inserted at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides , at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides below the ORF stop codon in the polynucleotide of the present invention. In some embodiments, the miRNA binding site is inserted at a distance of from about 10 nucleotides to about 100 nucleotides, from about 20 nucleotides to about 90 nucleotides, from about 30 nucleotides to about 80 nucleotides, from about 40 nucleotides to about 70 nucleotides, from about 50 nucleotides up to about 60 nucleotides, from about 45 nucleotides to about 65 nucleotides below the ORF stop codon in a polynucleotide of the present invention.

The regulation of a gene by miRNA can be influenced by the sequence surrounding the miRNA, for example, without limitation, the kind of surrounding sequence, the type of sequence (for example, heterologous, homologous, exogenous, endogenous, or artificial), regulatory elements in the surrounding sequence, and/or building blocks. in the surrounding sequence. miRNA can be influenced by the 5'-UTR and/or 3'-UTR. As a non-limiting example, a non-human 3'UTR can increase the regulatory effect of a miRNA sequence on the expression of a polypeptide of interest compared to a human 3'UTR of the same sequence type.

In one embodiment, other regulatory elements and/or structural elements of the 5'-UTR may influence miRNA-mediated gene regulation. One example of a regulatory element and/or structural element is a structured IRES (internal ribosome entry site) in the 5'-UTR, which is required to bind translation elongation factors to initiate protein translation. Binding of EIF4A2 to this secondary structure element in the 5'-UTR is required for miRNA-mediated gene expression (Meijer HA et al., Science, 2013, 340, 82-85, incorporated herein by reference in its entirety). The polynucleotides of the present invention may further include this structured 5'-UTR to enhance miRNA-mediated gene regulation.

At least one miRNA binding site can be engineered into the 3'UTR of a polynucleotide of the present invention. In this context, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or more sites miRNA binding can be inserted into the 3'-UTR of the polynucleotide of the present invention. For example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2 or 1 miRNA binding site can be inserted in the 3'-UTR of the polynucleotide of the present invention. In one embodiment, the miRNA binding sites included in a polynucleotide of the present invention may be the same or may be different miRNA sites. The combination of different miRNA binding sites included in a polynucleotide of the present invention may include combinations that include more than one copy of any of the different miRNA sites. In another embodiment, the miRNA binding sites included in a polynucleotide of the present invention may target the same or different body tissues. As a non-limiting example, by introducing tissue, cell type, or disease specific miRNA binding sites into the 3'-UTR of a polynucleotide of the present invention, expression can be reduced in specific cell types (e.g., hepatocytes, myeloid cells, endothelial cells, cancer cells). etc.).

In one embodiment, a miRNA binding site can be inserted near the 5'end of the 3'UTR, approximately midway between the 5'end and 3'end of the 3'UTR, and/or near the 3'end of the 3'UTR. in the polynucleotide of the present invention. As a non-limiting example, a miRNA binding site can be inserted near the 5'end of the 3'UTR and approximately midway between the 5'end and 3'end of the 3'UTR. As another non-limiting example, a miRNA binding site can be inserted near the 3'end of the 3'UTR and approximately midway between the 5'end and 3'end of the 3'UTR. As another non-limiting example, a miRNA binding site can be inserted adjacent to the 5'end of the 3'UTR and adjacent to the 3'end of the 3'UTR.

In another embodiment, the 3'-UTR may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. The miRNA binding sites may be complementary to the miRNA, miRNA seed sequence, and/or miRNA sequences flanking the seed sequence.

In one embodiment, the polynucleotide of the present invention can be designed to include more than one miRNA site expressed in different tissues or different cell types of the subject. As a non-limiting example, a polynucleotide of the present invention can be engineered to include miR-192 and miR-122 to regulate expression of the polynucleotide in the liver and kidneys of a subject. In another embodiment, the polynucleotide of the present invention can be designed to include more than one miRNA site for the same tissue.

In some embodiments, expression of a polynucleotide of the present invention can be controlled by including at least one miR binding site in the polynucleotide and designing the polynucleotide for administration. As a non-limiting example, a polynucleotide of the present invention can be targeted to a tissue or cell by incorporating a miRNA binding site and constituting the polynucleotide in a lipid nanoparticle containing an ionizable lipid, including any of the lipids described herein.

The polynucleotide of the present invention can be designed for more targeted expression in specific tissues, cell types, or biological conditions based on miRNA expression profiles in various tissues, cell types, or biological conditions. By incorporating tissue-specific miRNA binding sites, the polynucleotide of the present invention can be designed for optimal protein expression in a tissue or cell, or in the context of a biological state.

In some embodiments, a polynucleotide of the present invention can be designed to include miRNA binding sites that either share 100% identity with known miRNA primer sequences or have less than 100% identity with miRNA primer sequences. In some embodiments, a polynucleotide of the present invention can be designed to include miRNA binding sites that have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% , 98% or 99% identity with known miRNA seed sequences. The miRNA seed sequence can be partially mutated to reduce miRNA binding affinity and actually cause a decrease in polynucleotide downregulation. In essence, the degree of pairing or mismatch between the miRNA binding site and the miRNA seed site can act as a regulator to fine-tune the miRNA's ability to modulate protein expression. In addition, a mutation in the non-primer region of the miRNA binding site may also affect the ability of the miRNA to modulate protein expression.

In one embodiment, the miRNA sequence can be inserted into a loop of a stem-loop region.

In another embodiment, the miRNA seed sequence can be inserted into the loop of the stem-loop region and the miRNA binding site can be inserted into the 5' or 3' stem of the stem-loop region.

In one embodiment, a translation enhancer element (TEE) can be inserted at the 5' end of the stem of the stem-loop region, and a miRNA seed region can be inserted into the stem of the stem-loop region. In another embodiment, the TEE can be inserted at the 5' end of the stem of the stem-loop region, the miRNA seed sequence can be inserted into the stem of the stem-loop region, and the miRNA binding site can be inserted at the 3'-end of the stem or sequence after the stem-loop region. The miRNA seed sequence and the miRNA binding site may be for the same and/or different miRNA sequences.

In one embodiment, insertion of the miRNA sequence and/or the TEE sequence changes the shape of the stem-loop region, which can increase and/or decrease translation. (See, for example, Kedde et al., "A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-22 accessibility." Nature Cell Biology. 2010, incorporated herein by reference in its entirety. completeness).

In one embodiment, the 5'-UTR of the polynucleotide of the present invention may contain at least one miRNA sequence. The miRNA sequence can be, without limitation, a 19 or 22 nucleotide sequence and/or a miRNA sequence without a seed region.

In one embodiment, the miRNA sequence in the 5'UTR can be used to stabilize the polynucleotide of the present invention described herein.

In another embodiment, the miRNA sequence in the 5'UTR of a polynucleotide of the present invention can be used to reduce the availability of a translation initiation site, such as, but not limited to, a start codon. See, for example, Matsuda et al., PLoS One. 2010 11(5): e15057; incorporated herein by reference in its entirety, which used closed nucleic acid antisense oligonucleotides (LNAs) and exon junction complexes (EJCs) around the start codon (-4 to +37, where A of AUG codons represents +1), to reduce the availability of the first start codon (AUG). Matsuda showed that changing the sequence around the start codon with LNA or EJC affects the efficiency, length, and structural stability of the polynucleotide. The polynucleotide of the present invention may contain a miRNA sequence instead of the LNA or EJC sequence described by Matsuda et al. adjacent to the translation initiation site to reduce the accessibility of the translation initiation site. The translation initiation site may be before, after or within the miRNA sequence. As a non-limiting example, the translation initiation site may be located in a miRNA sequence, such as a seed sequence or a binding site. As another non-limiting example, the translation initiation site may be located in a miR-122 sequence, such as a seed sequence or a mir-122 binding site.

In some embodiments, a polynucleotide of the present invention may include at least one miRNA to impair antigen presentation by antigen-presenting cells. The miRNA may be a complete miRNA sequence, a miRNA seed sequence, a miRNA sequence without a seed sequence, or a combination thereof. As a non-limiting example, the miRNA incorporated into a polynucleotide of the present invention may be specific to the hematopoietic system. As another non-limiting example, the miRNA inserted into the polynucleotide of the present invention to reduce antigen presentation is miR-142-3p.

In some embodiments, the implementation of the polynucleotide of the present invention may include at least one miRNA to reduce the expression of the encoded polypeptide in the tissue or cell of interest. As a non-limiting example, a polynucleotide of the present invention may include at least one miR-122 binding site to attenuate expression of an encoded polypeptide of interest in the liver. As another non-limiting example, a polynucleotide of the present invention may include at least one miR-142-3p binding site, a miR-142-3p primer sequence, a miR-142-3p binding site without a primer sequence, a miR-142-5p binding site , a miR-142-5p primer sequence, a miR-142-5p binding site without a primer sequence, a miR-146 binding site, a miR-146 primer sequence, and/or a miR-146 binding site without a primer sequence.

In some embodiments, the polynucleotide of the present invention may contain at least one miRNA binding site in the 3'-UTR to selectively degrade mRNA-based therapeutics in immune cells to suppress unwanted immunogenic reactions caused by delivery of the therapeutic. As a non-limiting example, the miRNA binding site can make the polynucleotide of the present invention more unstable in antigen presenting cells. Non-limiting examples of these miRNAs include mir-142-5p, mir-142-3p, mir-146a-5p, and mir-146-3p.

In one embodiment, a polynucleotide of the present invention contains at least one miRNA sequence in a region of the polynucleotide that can interact with an RNA-binding protein.

In some embodiments, a polynucleotide of the present invention (e.g., RNA, e.g., mRNA) comprises (i) a sequence-optimized nucleotide sequence (e.g., ORF) encoding a wild-type relaxin polypeptide, and (ii) a miRNA binding site (e.g., a miRNA binding site, which binds to miR-142).

In some embodiments, a polynucleotide of the present invention comprises a uracil-modified sequence encoding a relaxin polypeptide disclosed herein and a miRNA binding site disclosed herein, e.g., a miRNA binding site that binds to miR-142. In some embodiments, the uracil-modified sequence encoding the relaxin polypeptide contains at least one chemically modified nucleotide base, such as 5-methoxyuracil. In some embodiments, at least 95% of one type of nucleotide base (eg, uracil) in the uracil-modified sequence encoding the relaxin polypeptide of the present invention are modified nucleotide bases. In some embodiments, at least 95% of the uracil in the uracil-modified sequence encoding the relaxin polypeptide is 5-methoxyuridine. In some embodiments, a polynucleotide comprising a nucleotide sequence encoding a relaxin polypeptide disclosed herein and a miRNA binding site is formulated with a delivery vehicle, such as an LNP, containing, for example, a lipid having formula (I), (IA), (II ), (IIa), (IIb), (IIc), (IId) or (IIe), for example, any of compounds 1-232.

3'-UTR

In certain embodiments, a polynucleotide of the present invention (eg, a polynucleotide comprising a nucleotide sequence encoding a relaxin polypeptide of the present invention) further comprises a 3'-UTR.

The 3'-UTR is the part of the mRNA that immediately follows the translation termination codon and often contains regulatory regions that affect gene expression post-transcriptionally. Regulatory regions within the 3'-UTR can influence polyadenylation, translation efficiency, mRNA localization and stability. In one embodiment, the 3'-UTR useful for the present invention contains a binding site for regulatory proteins or miRNAs.

Regions with a 5'-cap

The present invention also includes a polynucleotide that contains both a 5'-cap and a polynucleotide of the present invention (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide).

The 5'-cap structure of natural mRNA is involved in nuclear export, increases mRNA stability, and binds the mRNA cap-binding protein (CBP), which is responsible for mRNA stability in the cell and the ability to translate due to the association of CBP with poly(A)-binding protein with the formation of mature cyclic mRNA species. The cap further facilitates the removal of 5'-proximal introns during mRNA splicing.

Endogenous mRNA molecules can have a 5'-end cap, forming a 5'-ppp-5'-triphosphate bond between the terminal guanosine residue of the cap and the 5'-terminal transcribed sense nucleotide of the mRNA molecule. This 5'-guanylate cap can then be methylated to give an N7-methyl guanylate residue. The ribose sugars of the terminal and/or pre-terminal transcribed nucleotides of the 5' end of the mRNA can also optionally be 2'-O-methylated. 5'-decapping by hydrolysis and cleavage of the guanylate structure of the cap can target a nucleic acid molecule, such as an mRNA molecule, to be destroyed.

In some embodiments, the polynucleotides of the present invention (eg, a polynucleotide comprising a nucleotide sequence encoding a relaxin polypeptide) include a cap fragment.

In some embodiments, the polynucleotides of the present invention (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide) contain a non-hydrolysable cap structure that prevents decapping, thereby increasing the half-life of the mRNA. Since hydrolysis of the cap structure requires cleavage of complex 5'-ppp-5'-phosphodiester bonds, modified nucleotides can be used during the capping reaction. For example, the vaccinia capping enzyme (Vaccinia Capping Enzyme) from New England Biolabs (Ipswich, MA) can be used with α-thioguanosine nucleotides according to the manufacturer's instructions to form a phosphorothioate bond in the 5'-ppp-5'-cap. Additional guanosine-modified nucleotides may be used, such as α-methylphosphonate and selenophosphate nucleotides.

Additional modifications include, but are not limited to, 2'-O-methylation of the ribose sugars of the 5'-terminal and/or 5'-pre-terminal nucleotides of the polynucleotide (as mentioned above) at the 2'-hydroxyl group of the sugar ring. Several different 5' cap structures can be used to create the 5' cap of a nucleic acid molecule, such as a polynucleotide, that functions as an mRNA molecule. Cap analogs, which are also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, are different from naturally occurring (i.e., endogenous, wild type, or physiological) 5' caps. in its chemical structure, while retaining the cap function. Cap analogs can be chemically (ie, not enzymatically) or enzymatically synthesized and/or linked to the polynucleotides of the present invention.

For example, a properly oriented cap analog (ARCA) contains two guanines connected by a 5'-5'-triphosphate group, with one guanine containing an N7-methyl group as well as a 3'-O-methyl group (i.e., N7 ,3'-O-dimethylguanosine-5'-triphosphate-5'-guanosine (m ⁷ G-3'mppp-G; which can be conventionally denoted as 3'O-Me-m7G(5')ppp(5')G The 3'-O-atom of another, unmodified, guanine becomes linked to the 5'-terminal nucleotide of the capped polynucleotide.N7- and 3'-O-methylated guanine provides the terminal fragment of the capped polynucleotide.

Another illustrative cap is mCAP which is similar to ARCA but has a 2'-O-methyl group on guanosine (i.e. N7,2'-O-dimethylguanosine-5'-triphosphate-5'-guanosine, m ⁷ Gm-ppp -G).

In some embodiments, the cap is a dinucleotide cap analog. As a non-limiting example, a dinucleotide cap analog can be modified at various phosphate positions with a boranophosphate group or a phosphoroselenate group, such as the dinucleotide cap analogs described in US Pat. No. 8,519,110, the contents of which are incorporated herein by reference in its entirety.

кэп-аналог (см., например, различные кэп-аналоги и способы синтеза кэп-аналогов, описанные в Kore et al. Bioorganic & Medicinal Chemistry 2013 21: 4570-4574; содержание которых включено в данный документ посредством ссылки во всей своей полноте). В другом варианте осуществления кэп-аналог по настоящему изобретению представляет собой 4-хлор/бромфеноксиэтиловый аналог.In another embodiment, the cap is a cap analog, which is an N7-(4-chlorophenoxyethyl)-substituted dinucleotide form of a cap analog known in the art and/or described herein. Non-limiting examples of the N7-(4-chlorophenoxyethyl)-substituted dinucleotide form of the cap analog include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and

cap analog (see, for example, the various cap analogs and methods for synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21: 4570-4574; the contents of which are incorporated herein by reference in their entirety) . In another embodiment, the cap analog of the present invention is a 4-chloro/bromophenoxyethyl analog.

Although cap analogs allow concomitant capping of a polynucleotide or portion thereof, up to 20% of transcripts may remain uncapped in an in vitro transcription reaction. This, as well as the structural differences of the cap analog from the endogenous 5'-cap structures of nucleic acids obtained using the endogenous cellular transcription mechanism, can lead to a decrease in translational ability and a decrease in stability in cells.

Polynucleotides of the present invention (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide) can also be capped after preparation (whether by IVT or chemical synthesis) using enzymes to produce more authentic 5' cap structures. As used herein, the phrase "more authentic" refers to a characteristic that accurately reflects or mimics, structurally or functionally, an endogenous or wild-type characteristic. That is, a "more authentic" characterization better reflects endogenous, wild-type, natural, or physiological cellular function and/or structure, compared to synthetic characteristics or analogues, etc. prior art, or superior to the corresponding endogenous, wild-type, natural or physiological characteristic in one or more respects. Non-limiting examples of more authentic 5'-cap structures of the present invention are those which, among others, have improved binding of cap-binding proteins, increased half-life, reduced sensitivity to 5'-endonucleases, and/or reduced 5'-decapping compared to synthetic 5'-cap structures known in the art (or from wild-type, natural or physiological 5'-cap structure). For example, a recombinant vaccinia virus capping enzyme and a recombinant 2'-O-methyltransferase enzyme can create a canonical 5'-5'-triphosphate bond between the 5'-terminal nucleotide of the polynucleotide and the guanine nucleotide of the cap, where the guanine of the cap contains N7-methylation and the 5' -terminal nucleotide of mRNA contains 2'-O-methyl. This structure is called the Cap1 structure. This cap results in higher translation capacity and stability in cells and reduced activation of cellular pro-inflammatory cytokines compared to, for example, other 5'-cap analog structures known in the art. Cap structures include, without limitation, 7mG(5')ppp(5')N, pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), and 7mG(5')-ppp(5' )NlmpN2mp (cap 2).

As a non-limiting example, capping of chimeric polynucleotides after production may be more efficient, since substantially 100% of chimeric polynucleotides can be capped. This is in contrast to ~80% of the cases where the cap analog binds to the chimeric polynucleotide during the in vitro transcription reaction.

In accordance with the present invention, 5'-end caps may include endogenous caps or cap analogs. In accordance with the present invention, the 5'-terminal cap may contain a guanine analogue. Useful guanine analogs include, without limitation, inosine, N1-methylguanosine, 2'-fluoroguanosine, 7-deazaguanosine, 8-oxoguanosine, 2-aminoguanosine, LNA-guanosine, and 2-azidoguanosine.

Poly(A) tails

In some embodiments, the polynucleotides of the present disclosure (eg, a polynucleotide comprising a nucleotide sequence encoding a relaxin polypeptide) further comprises a poly(A) tail. In further embodiments, end groups can be inserted into the poly(A) tail for stabilization. In other embodiments, the implementation of the poly(A)-tail contains des-3'-hydroxyl tails.

During RNA processing, a long chain of adenine nucleotides (a poly(A) tail) can be added to a polynucleotide, such as an mRNA molecule, to increase stability. Immediately after transcription, the 3'-end of the transcript can be cleaved to release the 3'-hydroxyl. The poly(A) polymerase then adds a chain of adenine nucleotides to the RNA. In a process called polyadenylation, a poly(A) tail is added, which may be, for example, from about 80 to about 250 residues, including about 80, 90, 100, 110, 120, 130, 140, 150, 160 , 170, 180, 190, 200, 210, 220, 230, 240, or 250 residues in length.

Poly(A) tails can also be added after the construct has been exported from the core.

In accordance with the present invention, it is possible to insert end groups into the poly(A) tail for stabilization. The polynucleotides of the present invention may include des-3'-hydroxyl tails. They may also include structural moieties or 2'-O-methyl modifications as set forth in Junjie Li, et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the contents of which are incorporated herein by reference in their entirety).

The polynucleotides of the present invention can be designed to encode transcripts with alternative poly(A) tail structures, including histone mRNA. According to Norbury, “Terminal uridylation has also been identified in replication-dependent human histone mRNAs.” The renewal of these mRNAs is believed to play an important role in preventing potentially toxic histone accumulation after completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by the absence of a 3'-poly(A) tail, whose function is instead taken over by a stable stem-loop structure and its related stem-loop binding protein (SLBP); the latter performs the same functions as PABP on polyadenylated mRNAs" (Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology; AOP, published online August 29, 2013; doi:10.1038 /nrm3645), the contents of which are incorporated herein by reference in their entirety.

The unique length of the poly(A) tail provides certain advantages for the polynucleotides of the present invention. Typically, the poly(A) tail, if present, is greater than 30 nucleotides in length. In another embodiment, the length of the poly(A) tail is greater than 35 nucleotides (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180,200,250,300,350,400,450,500,600,700,800,900,1000,1100,1200,1300,1400,1500,1600,1700,1800,1900,20 00, 2500 and 3000 nucleotides).

In some embodiments, a polynucleotide or portion thereof comprises from about 30 to about 3000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 750, 30 to 1000, 30 to 1500, 30 to 2000, 30 to 2500, 50 to 100, 50 to 250, 50 to 500, 50 to 750, 50 to 1000, 50 to 1500, 50 to 2000, from 50 to 2500, 50 to 3000, 100 to 500, 100 to 750, 100 to 1000, 100 to 1500, 100 to 2000, 100 to 2500, 100 to 3000, 500 to 750, from 500 to 1000, 500 to 1500, 500 to 2000, 500 to 2500, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 2500, 1000 to 3000, 1500 to 200 0, from 1500 to 2500, 1500 to 3000, 2000 to 3000, 2000 to 2500 and 2500 to 3000).

In some embodiments, the poly(A) tail is designed relative to the length of the entire polynucleotide or the length of a specific region of the polynucleotide. This construct may be based on the length of the coding region, the length of a particular feature or region, or the length of the end product expressed from the given polynucleotides.

In this context, the length of the poly(A) tail may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% longer than the polynucleotide or its characteristic. The poly(A) tail can also be designed as part of the polynucleotides to which it refers. In this context, the poly(A) tail may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the total length of the construct, portion of the construct, or total length of the construct minus the poly(A)tail. In addition, engineered binding sites and conjugation of polynucleotides to a poly(A) binding protein can enhance expression.

In addition, several different polynucleotides can be linked together with PABP (poly(A) binding protein) through the 3' end using modified nucleotides at the 3' end of the poly(A) tail. Transfection experiments can be carried out in appropriate cell lines and protein production can be analyzed by ELISA at 12 h, 24 h, 48 h, 72 h and 7 days after transfection.

In some embodiments, the polynucleotides of the present invention are designed to include a portion of a poly(A)-G quartet. The G-quartet is a cyclic, hydrogen-bonded four-guanine nucleotide template that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, a G-quartet is included at the end of the poly(A) tail. The resulting polynucleotide is analyzed for stability, protein production, and other parameters, including half-life, at various time points. The poly(A)-G quartet was found to result in protein production with mRNA equivalent to at least 75% of that observed using only the 120 nucleotide poly(A) tail.

Start codon region

The present invention also includes a polynucleotide that contains both the start codon region and the polynucleotide described herein (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide). In some embodiments, the polynucleotides of the present invention may have regions that are similar to or function similarly to the start codon region.

In some embodiments, translation of a polynucleotide may be initiated at a codon that is not the AUG start codon. Translation of a polynucleotide may be initiated at an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG/CUG, GTG/GUG, ATA/AUA, ATT/AUU, TTG/UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5:11, the contents of which are incorporated herein by reference in their entirety).

As a non-limiting example, translation of a polynucleotide begins with an alternative start codon, ACG. As another non-limiting example, translation of a polynucleotide begins with an alternative start codon CTG or CUG. As another non-limiting example, translation of a polynucleotide begins with an alternative start codon GTG or GUG.

Nucleotides flanking a codon that initiates translation, such as, but not limited to, a start codon or an alternative start codon, are known to affect translation efficiency, length, and/or structure of a polynucleotide. (See, for example, Matsuda and Mauro PLoS ONE, 2010 5:11; the contents of which are hereby incorporated by reference in their entirety.) Masking of any of the nucleotides flanking a translation initiating codon can be used to alter the position of translation initiation, translation efficiency, length and/or structure of a polynucleotide.

In some embodiments, a masking agent may be used adjacent to a start codon or alternative start codon to mask or hide the codon to reduce the likelihood of translation initiation at the masked start codon or alternative start codon. Non-limiting examples of masking agents include antisense closed nucleic acid polynucleotides (LNAs) and exon junction complexes (EJCs) (see, for example, Matsuda and Mauro describing masking agents LNA polynucleotides and EJCs (PLoS ONE, 2010 5:11); the content of which is included in this document by reference in its entirety).

In another embodiment, a masking agent can be used to mask the start codon of a polynucleotide to increase the likelihood that translation will be initiated at an alternative start codon. In some embodiments, a masking agent may be used to mask the first start codon or alternative start codon to increase the likelihood that translation will be initiated at a start codon or alternative start below the masked start codon or alternative start codon.

In some embodiments, the start codon or alternative start codon may be located in the absolute complement of the miR binding site. The absolute complementarity of the miR binding site can help control the translation, length and/or structure of the polynucleotide in a manner similar to a masking agent. As a non-limiting example, the start codon or alternative start codon may be located in the middle of the absolute complementarity of the miRNA binding site. The start codon or alternative start codon may be after the first nucleotide, the second nucleotide, the third nucleotide, the fourth nucleotide, the fifth nucleotide, the sixth nucleotide, the seventh nucleotide, the eighth nucleotide, the ninth nucleotide, the tenth nucleotide, the eleventh nucleotide, the twelfth nucleotide, the thirteenth nucleotide, the fourteenth nucleotide , the fifteenth nucleotide, the sixteenth nucleotide, the seventeenth nucleotide, the eighteenth nucleotide, the nineteenth nucleotide, the twentieth nucleotide, or the twenty-first nucleotide.

In another embodiment, the start codon of a polynucleotide can be removed from the polynucleotide sequence to start translation of the polynucleotide from a codon that is not a start codon. Translation of a polynucleotide may begin at a codon after the removed start codon, or at a downstream start codon or alternative start codon. In a non-limiting example, the ATG or AUG start codon is removed as the first 3 nucleotides of the polynucleotide sequence to initiate translation at the downstream start codon or alternative start codon. The polynucleotide sequence in which the start codon has been removed may further comprise at least one masker for the downstream start codon and/or alternative start codons to control or attempt to control translation initiation, polynucleotide length, and/or polynucleotide structure.

Stop codon region

The present invention also includes a polynucleotide that contains both a stop codon region and a polynucleotide as described herein (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide). In some embodiments, the implementation of the polynucleotides of the present invention may include at least two stop codons before the 3'-untranslated region (UTR). The stop codon may be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In some embodiments, the polynucleotides of the present invention comprise a TGA stop codon for DNA or a UGA stop codon for RNA, and one additional stop codon. In a further embodiment, the additional stop codon may be TAA or UAA. In another embodiment, the polynucleotides of the present invention include three consecutive stop codons, four stop codons, or more.

Inserts and substitutions

The present invention also includes a polynucleotide of the present invention which further comprises inserts and/or substitutions.

In some embodiments, the implementation of the 5'-UTR of the polynucleotide can be replaced by inserting at least one region and/or strand of nucleosides from the same base. A stretch and/or strand of nucleotides may include, without limitation, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 nucleotides, and these nucleotides may be natural and/or unnatural. As a non-limiting example, a group of nucleotides may include 5-8 adenines, cytosines, thymines, a strand of any other nucleotide disclosed herein, and/or combinations thereof.

In some embodiments, the 5'-UTR of a polynucleotide can be replaced by inserting at least two stretches and/or strands of nucleotides from two different bases, such as, but not limited to, adenine, cytosine, thymine, any other nucleotide disclosed herein, and/or their combinations. For example, the 5'-UTR can be replaced by insertion of 5-8 adenine bases followed by insertion of 5-8 cytosine bases. In another example, the 5'-UTR can be replaced by insertion of 5-8 cytosine bases followed by insertion of 5-8 adenine bases.

In some embodiments, a polynucleotide may include at least one substitution and/or insertion downstream of a transcription initiation site that can be recognized by an RNA polymerase. As a non-limiting example, at least one substitution and/or insertion can be made downstream of the transcription start site by substituting at least one nucleic acid in the region immediately downstream of the transcription start site (such as, but not limited to, +1 to +6). Alterations in the region of nucleotides immediately downstream of the transcription initiation site can affect the rate of initiation, increase the apparent nucleotide triphosphate (NTP) reaction constant, and increase the dissociation of short transcripts from the transcription complex to stabilize primary transcription (Brieba et al., Biochemistry (2002) 41:5144- 5149; incorporated herein by reference in its entirety). Modification, substitution and/or insertion of at least one nucleoside may cause a silent mutation of the sequence or may cause a mutation in the amino acid sequence.

In some embodiments, a polynucleotide may include a substitution of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least at least 9, at least 10, at least 11, at least 12, or at least 13 guanine bases downstream of the transcription initiation site.

In some embodiments, the implementation of the polynucleotide may include the replacement of at least 1, at least 2, at least 3, at least 4, at least 5 or at least 6 guanine bases in the region immediately below the site of transcription initiation. As a non-limiting example, if the nucleotides in a given region are GGGAGA, then the guanine bases can be replaced by at least 1, at least 2, at least 3, or at least 4 adenine nucleotides. In another non-limiting example, if the nucleotides in a given region are GGGAGA, then the guanine bases can be replaced by at least 1, at least 2, at least 3, or at least 4 cytosine bases. In another non-limiting example, if the nucleotides in a given region are GGGAGA, then the guanine bases can be replaced with at least 1, at least 2, at least 3, or at least 4 thymines and/or any of the nucleotides described herein.

In some embodiments, the implementation of the polynucleotide may include at least one substitution and/or insertion above the start codon. For the sake of clarity, one skilled in the art will appreciate that the start codon is the first codon of the protein coding region, while the transcription start site is the site at which transcription begins. A polynucleotide may include, without limitation, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 nucleotide substitutions and/or insertions. grounds. Nucleotide bases can be inserted or replaced at 1, at least 1, at least 2, at least 3, at least 4, or at least 5 locations upstream of the start codon. Nucleotides inserted and/or substituted can be the same base (e.g. all A or all C or all T or all G), two different bases (e.g. A and C, A and T or C and T), three different bases (eg A, C and T or A, C and T) or at least four different bases.

As a non-limiting example, the guanine base upstream of the coding region in a polynucleotide can be replaced by adenine, cytosine, thymine, or any of the nucleotides described herein. In another non-limiting example, a guanine base substitution in a polynucleotide can be designed to leave one guanine base downstream of the transcription initiation site and before the start codon (see Esvelt et al. Nature (2011) 472(7344):499-503; content incorporated herein by reference in its entirety). As a non-limiting example, at least 5 nucleotides can be inserted at 1 location downstream of the transcription initiation site but upstream of the start codon, and at least 5 nucleotides can be the same type of base.

A polynucleotide containing an mRNA encoding a relaxin polypeptide

In certain embodiments, a polynucleotide of the present invention, for example, a polynucleotide containing an mRNA nucleotide sequence encoding a relaxin polypeptide, contains from the 5' to the 3' end:

(i) 5'-cap as above;

(ii) 5'-UTR, such as the sequences presented above;

(iii) an open reading frame encoding a relaxin polypeptide, for example, a sequence-optimized nucleic acid sequence encoding the relaxin polypeptide disclosed herein;

(iv) at least one stop codon;

(v) 3'-UTR, such as the sequences presented above; And

(vi) the poly(A) tail as shown above.

In some embodiments, the polynucleotide further comprises a miRNA binding site, eg, a miRNA binding site that binds to miRNA-142. In some embodiments, the 5'UTR contains a miRNA binding site.

In some embodiments, a polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence that is at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92 %, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% protein sequence identical wild-type relaxin protein.

Methods for obtaining polynucleotides

The present invention also provides methods for producing a polynucleotide of the present invention (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide) or a sequence complementary to it.

In some aspects, a polynucleotide (eg RNA, eg mRNA) disclosed herein encoding a relaxin polypeptide can be designed using in vitro transcription. In other aspects, a polynucleotide (eg RNA, eg mRNA) disclosed herein encoding a relaxin polypeptide can be designed by chemical synthesis using an oligonucleotide synthesizer.

In other aspects, a polynucleotide (eg RNA, eg mRNA) disclosed herein encoding a relaxin polypeptide is produced using a host cell. In certain aspects, a polynucleotide (e.g., RNA, e.g., mRNA) disclosed herein encoding a relaxin polypeptide is produced by one or more of a combination of IVT, chemical synthesis, expression in host cells, or any other methods known in the art.

Natural nucleosides, non-natural nucleosides, or combinations thereof may replace, in whole or in part, natural nucleosides in a candidate nucleotide sequence and may be included in a sequence-optimized nucleotide sequence (eg RNA, eg mRNA) encoding a relaxin polypeptide. The resulting polynucleotides, eg mRNA, can then be evaluated for their ability to produce protein and/or produce relaxin as a result.

A. Transcription in vitro/enzymatic synthesis

The polynucleotides of the present invention disclosed herein (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide) can be transcribed using an in vitro transcription (IVT) system. Typically, the system contains a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, and a polymerase. NTPs can be selected without limitation from those described herein, including natural and non-natural (modified) NTPs. The polymerase can be selected without limitation from T7 RNA polymerase, T3 RNA polymerase, and mutant polymerases such as, but not limited to, polymerases capable of inserting the polynucleotides disclosed herein. See US Patent Application Publication No. US 20130259923, which is incorporated herein by reference in its entirety.

Any number of RNA polymerases or variants can be used during the synthesis of the polynucleotides of the present invention. RNA polymerases can be modified by insertion or deletion of amino acids in the sequence of the RNA polymerase. As a non-limiting example, an RNA polymerase can be modified to exhibit an increased ability to insert a 2'-modified nucleotide triphosphate compared to an unmodified RNA polymerase (see WO 2008078180 and US Patent No. 80101385, incorporated herein by reference in its entirety ).

Variants can be generated by evolution of the RNA polymerase, optimization of the amino acid sequence and/or nucleic acid sequence of the RNA polymerase, and/or other methods known in the art. As a non-limiting example, T7 RNA polymerase variants can be evolved using the continuous directed evolution system set forth in Esvelt et al. (Nature 472: 499-503 (2011), incorporated herein by reference in its entirety), wherein T7 RNA polymerase clones may encode at least one mutation such as, but not limited to, lysine at position 93 substituted with threonine (K93T ), I4M, A7T, E63V, V64D, A65E, D66Y, T76N, C125R, S128R, A136T, N165S, G175R, H176L, Y178H, F182L, L196F, G198V, D208Y, E222K, S228A, Q239R, T24 3N, G259D, M267I, G280C, H300R, D351A, A354S, E356D, L360P, A383V, Y385C, D388Y, S397R, M401T, N410S, K450R, P451T, G452V, E484A, H523L, H524N, G542V, E565K, K5 77E, K577M, N601S, S684Y, L699I, K713E, N748D, Q754R, E775K, A827V, D851N or L864F. As another non-limiting example, T7 RNA polymerase variants can encode at least a mutation as described in US Patent Application Publication Nos. 20100120024 and 20070117112; incorporated herein by reference in their entirety. RNA polymerase variants may also include, without limitation, substitution variants, conservative amino acid substitution, insertion variants, deletion variants, and/or covalent derivatives.

In one aspect, a polynucleotide can be designed to be recognized by wild-type RNA polymerases or variants of RNA polymerases. In this case, the polynucleotide can be modified to contain sites or regions of sequence changes relative to the wild type or original chimeric polynucleotide.

Polynucleotide or nucleic acid synthesis reactions can be carried out by enzymatic methods using polymerases. Polymerases catalyze the formation of phosphodiester bonds between nucleotides in a polynucleotide or nucleic acid chain. The currently known DNA polymerases can be divided into different families based on amino acid sequence comparison and crystal structure analysis. The family of DNA polymerase I (pol I) or polymerase A, including Klenow fragments from E. coli, Bacillus DNA polymerase I, Thermus aquaticus (Taq) DNA polymerase, and T7 RNA and DNA polymerase, is among the most studied from these families. Another large family is the DNA polymerase α (pol α) or polymerase B family, which includes all eukaryotic replicating DNA polymerases and polymerases from T4 and RB69 phages. Although they use a similar catalytic mechanism, these families of polymerases differ in substrate specificity, substrate analog incorporation efficiency, degree and rate of primer extension, DNA synthesis mode, exonuclease activity, and sensitivity to inhibitors.

DNA polymerases are also selected based on the optimum reaction conditions they require, such as reaction temperature, pH, and template and primer concentrations. Sometimes a combination of more than one DNA polymerase is used to achieve the required DNA fragment size and synthesis efficiency. For example, Cheng et al. raise pH, add glycerol and dimethyl sulfoxide, shorten denaturation time, increase extension time, and use a secondary thermostable DNA polymerase that has 3'-5' exonuclease activity to efficiently amplify long targets from cloned inserts and genomic DNA. person. (Cheng et al., PNAS 91:5695-5699 (1994), the contents of which are incorporated herein by reference in their entirety). RNA polymerases from the bacteriophage T3, T7 and SP6 are widely used in the production of RNA for biochemical and biophysical studies. RNA polymerases, capping enzymes, and poly(A) polymerases are disclosed in pending International Publication No. WO 2014028429, the contents of which are hereby incorporated by reference in their entirety.

In one aspect, an RNA polymerase that can be used in the synthesis of the polynucleotides of the present invention is Syn5 RNA polymerase. (See Zhu et al. Nucleic Acids Research 2013, doi: 10.1093/nar/gkt1193, which is incorporated herein by reference in its entirety). Zhu et al. recently characterized Syn5 RNA polymerase from the marine cyanophage Syn5, in which they also identified a promoter sequence (see Zhu et al., Nucleic Acids Research 2013, the contents of which are hereby incorporated by reference in their entirety). Zhu et al found that synthetic Syn5 RNA polymerase catalyzes RNA synthesis over a wider temperature and mineralization range than T7 RNA polymerase. In addition, the requirement for the initiating nucleotide in the promoter for Syn5 RNA polymerase was found to be less stringent compared to T7 RNA polymerase, making Syn5 RNA polymerase promising for RNA synthesis.

In one aspect, Syn5 RNA polymerase can be used in the synthesis of the polynucleotides described herein. As a non-limiting example, Syn5 RNA polymerase can be used in polynucleotide synthesis requiring a specific 3' end.

In one aspect, the Syn5 promoter can be used in the synthesis of polynucleotides. As a non-limiting example, the Syn5 promoter can be 5'-ATTGGGCACCCGTAAGGG-3' (SEQ ID NO: 544) as described by Zhu et al. (Nucleic Acids Research 2013).

In one aspect, Syn5 RNA polymerase can be used in the synthesis of polynucleotides containing at least one chemical modification described herein and/or known in the art (see, for example, the incorporation of pseudo-UTP and 5Me-TP described in Zhu et al., Nucleic Acids Research 2013).

In one aspect, the polynucleotides described herein can be synthesized using Syn5 RNA polymerase that has been purified using a modified and improved purification procedure described by Zhu et al. (Nucleic Acids Research 2013).

Various tools in genetic engineering are based on the enzymatic amplification of a target gene, which acts as a template. To study the sequences of individual genes or specific regions of interest, and other scientific needs, it is necessary to create many copies of the target gene from a small number of polynucleotides or nucleic acids. Such methods can be used in the preparation of the polynucleotides of the present invention.

For example, polymerase chain reaction (PCR), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), also called transcription-mediated amplification (TMA), and

rolling ring amplification (RCA) can be used in the preparation of one or more regions of the polynucleotides of the present invention.

The assembly of polynucleotides or nucleic acids by ligase is also widely used. DNA or RNA ligases provide intermolecular ligation of the 5' and 3' ends of polynucleotide chains by forming a complex phosphodiester bond.

b. Chemical synthesis

Standard methods can be used to synthesize an isolated polynucleotide sequence encoding an isolated polypeptide of interest, such as a polynucleotide of the present invention (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide). For example, a single DNA or RNA oligomer can be synthesized containing a codon-optimized nucleotide sequence encoding a particular isolated polypeptide. In other aspects, several small oligonucleotides encoding portions of the desired polypeptide can be synthesized and then ligated. In some aspects, individual oligonucleotides typically contain 5' or 3' overhang for complementary assembly.

A polynucleotide disclosed herein (eg RNA, eg mRNA) can be chemically synthesized using chemical synthesis methods and possible nucleotide base substitutions known in the art. See, for example, International Publications Nos. WO 2014093924, WO 2013052523; WO 2013039857, WO 2012135805, WO 2013151671; US Patent Application Publication No. US 20130115272 or US Patent Nos. US 8999380 or US 8710200, all of which are incorporated herein by reference in their entirety.

With. Purification of polynucleotides encoding the relaxin polypeptide

Purification of the polynucleotides described herein (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide) may include, but is not limited to, polynucleotide purification, quality control, and quality control. Purification can be accomplished using methods known in the art such as, but not limited to, AGENCOURT® microbeads (Beckman Coulter Genomics, Danvers, Massachusetts), poly(T) microbeads, LNA™ oligo-T capture probes (EXIQON® Inc., Vedbeek, Denmark). ) or HPLC-based purification methods such as, but not limited to, anion-exchange HPLC with a strong ion exchanger, anion-exchange HPLC with a weak ion exchanger, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC).

The term "purified" when used in relation to a polynucleotide, such as "purified polynucleotide", refers to a polynucleotide that is separated from at least one contaminant. As used herein, the term "contaminant" is any substance that renders another unusable, contaminated, or of inferior quality. Thus, a purified polynucleotide (e.g., DNA and RNA) is present in a form or environment that is different from that in which it is found in nature, or in a form or environment that is different from that which existed before it was subjected to the processing method. or cleaning.

In some embodiments, purification of a polynucleotide of the present invention (e.g., a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide) removes contaminants that may reduce or remove an unwanted immune response, such as reducing cytokine activity.

In some embodiments, a polynucleotide of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a relaxin polypeptide) is purified prior to administration using column chromatography (e.g., strong ion exchange anion exchange HPLC, weak ion exchange anion exchange HPLC, reverse phase HPLC (RP- HPLC) and HPLC with hydrophobic interaction (HIC-HPLC) or (LCMS)).

In some embodiments, a polynucleotide of the present invention (e.g., a polynucleotide comprising the nucleotide sequence of a relaxin polypeptide) purified using column chromatography (e.g., strong ion exchange anion exchange HPLC, weak ion exchange anion exchange HPLC, reverse phase HPLC (RP-HPLC), and HPLC with hydrophobic interaction (HIC-HPLC) or (LCMS)), shows increased expression of the encoded relaxin protein compared to the level of expression obtained with the same polynucleotide of the present disclosure, purified using a different purification method.

In some embodiments, purified using column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC) or (LCMS)) polynucleotide contains a nucleotide sequence encoding a relaxin polypeptide containing one or more point mutations known in the art.

In some embodiments, the use of the RP-HPLC purified polynucleotide increases the levels of expression of the relaxin protein in cells when introduced into these cells, for example, by 10-100%, i.e. by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% compared to the expression levels of the relaxin protein in the cells before the RP-HPLC-purified polynucleotide was introduced into the cells, or after being purified without using RP-HPLC, the polynucleotide was introduced into the cells.

In some embodiments, the use of the RP-HPLC purified polynucleotide increases the functional levels of expression of the relaxin protein in cells when introduced into these cells, for example, by 10-100%, i.e. by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% of the functional levels of expression of the relaxin protein in the cells before the RP-HPLC-purified polynucleotide is introduced into the cells, or after the purified without using RP-HPLC, the polynucleotide was introduced into the cells.

In some embodiments, the use of the RP-HPLC purified polynucleotide increases the detectable activity of relaxin in cells when introduced into these cells, for example, by 10-100%, i.e. by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% of the activity levels of the functional relaxin protein in the cells before the RP-HPLC-purified polynucleotide was introduced into cells, or after a polynucleotide purified without the use of RP-HPLC was introduced into the cells.

In some embodiments, the purified polynucleotide is at least about 80% pure, at least about 85% pure, at least about 90% pure, at least about 95% pure, at least about 96% pure, at least at least about 97% pure, at least about 98% pure, at least about 99% pure, or about 100% pure.

Quality control and/or quality control can be performed using methods such as, but not limited to, gel electrophoresis, UV absorption, or analytical HPLC. In another embodiment, the polynucleotide can be sequenced using methods including, but not limited to, reverse transcriptase PCR.

d. Quantification of Expressed Polynucleotides Encoding the Relaxin Protein

In some embodiments, the polynucleotides of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a relaxin polypeptide), their expression products, and degradation products and metabolites can be quantified according to methods known in the art.

In some embodiments, the polynucleotides of the present invention can be quantified in exosomes or when obtained from one or more bodily fluids. As used herein, the term "physiological fluids" includes peripheral blood, blood serum, blood plasma, ascitic fluid, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, earwax, chest milk, bronchoalveolar lavage fluid, semen, prostate fluid, Cooper fluid or pre-ejaculatory fluid, sweat, feces, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menstrual fluid , pus, sebum, vomiting, vaginal secretions, mucosal secretions, watery stools, pancreatic juice, sinus lavages, bronchopulmonary aspirates, blastocoel fluid, and cord blood. Alternatively, exosomes can be extracted from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestines, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver and placenta.

In the method of quantification in exosomes, a sample of no more than 2 ml is taken from the subject and exosomes are isolated using size exclusion chromatography, density gradient centrifugation, differential centrifugation, ultrafiltration through nanomembranes, immunosorbent capture, affinity purification, microfluidic separation, or combinations thereof. In the analysis, the level or concentration of a polynucleotide can be the level of expression, the presence, absence, truncation, or change of the introduced construct. It is preferable to correlate the level with one or more clinical phenotypes or with an analysis of a human disease biomarker.

Analysis can be performed using construct-specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or combinations thereof, while exosomes can be isolated using immunohistochemical methods such as enzyme-linked immunosorbent assay (eg, ELISA). Exosomes can also be isolated using size exclusion chromatography, density gradient centrifugation, differential centrifugation, ultrafiltration through nanomembranes, immunosorbent capture, affinity purification, microfluidic separation, or combinations thereof.

These methods allow the researcher to monitor in real time the level of remaining or delivered polynucleotides. This is possible because the polynucleotides of the present invention differ from endogenous forms due to structural or chemical modifications.

In some embodiments, a polynucleotide can be quantified using methods such as, but not limited to, ultraviolet-visible (UV/Vis) spectroscopy. A non-limiting example of a UV/Vis spectrometer is the NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified polynucleotide can be analyzed to determine if the polynucleotide is of the correct size, to check if degradation of the polynucleotide has occurred. Polynucleotide degradation can be tested by methods such as, but not limited to, agarose gel electrophoresis, HPLC-based purification methods such as, but not limited to, strong ion exchange anion exchange HPLC, weak ion exchange anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic HPLC. interaction (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE).

Pharmaceutical compositions and formulations

The present invention provides pharmaceutical compositions and formulations that contain any of the polynucleotides described above. In some embodiments, the composition or formulation further comprises a delivery vehicle.

In some embodiments, a composition or formulation may comprise a polynucleotide comprising a sequence-optimized nucleic acid sequence disclosed herein that encodes a relaxin polypeptide. In some embodiments, the composition or formulation may comprise a polynucleotide (e.g., RNA, e.g., mRNA) containing a polynucleotide (e.g., ORF) that has significant sequence identity with the sequence-optimized nucleic acid sequence disclosed herein that encodes a relaxin polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, such as a miRNA binding site that binds to miR-142 and/or miR-126.

Pharmaceutical compositions or formulations may optionally contain one or more additional active substances, for example therapeutic and/or prophylactic active substances. Pharmaceutical compositions or formulations of the present invention may be sterile and/or non-pyrogenic. General factors regarding the formulation and/or manufacture of pharmaceuticals can be found, for example, in Remington: The Science and Practice of Pharmacy 21 ^st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety). In some embodiments, the compositions are administered to humans, patients, or subjects. For the purposes of the present invention, the phrase "active ingredient" generally refers to polynucleotides that are to be delivered as described herein.

The compositions and pharmaceutical compositions described herein can be obtained using any method known or further developed in the field of pharmacology. In general, such preparations include the step of associating the active ingredient with the excipient and/or one or more other additional ingredients, and then, if necessary and/or required, the step of separating, shaping and/or packaging the product into the desired dosage form with a single standard dose or with several standard doses.

A pharmaceutical composition or formulation according to the present invention may be prepared, packaged and/or sold unpackaged as a single unit dose and/or as multiple unit dose units. As used herein, the term "unit dose" refers to a single amount of a pharmaceutical composition containing a given amount of an active ingredient. The amount of active ingredient is usually equal to the dose of the active ingredient that will be administered to the subject and/or a convenient fraction of such a dose, such as, for example, half or one third of such a dose.

The relative amounts of active ingredient, pharmaceutically acceptable excipient and/or any additional ingredients in a pharmaceutical composition according to the present invention may vary depending on the individual, size and/or condition of the subject to be treated and further depend on the route by which enter composition.

In some embodiments, the compositions and formulations described herein may contain at least one polynucleotide of the present invention. As a non-limiting example, a composition or composition may contain 1, 2, 3, 4 or 5 polynucleotides of the present invention. In some embodiments, the compositions or formulations described herein may contain more than one type of polynucleotide. In some embodiments, the implementation of the composition or composition may contain polynucleotide linear and circular form. In another embodiment, the composition or formulation may comprise a circular polynucleotide and an IVT polynucleotide. In yet another embodiment, the composition or formulation may comprise an IVT polynucleotide, a chimeric polynucleotide, and a circular polynucleotide.

While the descriptions of pharmaceutical compositions and formulations provided herein are generally directed to pharmaceutical compositions and formulations that are suitable for administration to humans, one skilled in the art will appreciate that such compositions are generally suitable for administration to any other animal, e.g., animals other than human, for example, non-human mammals.

The present invention provides pharmaceutical compositions that contain the polynucleotide described herein (for example, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide). The polynucleotides described herein can be formulated using one or more excipients in order to: (1) improve stability; (2) enhance cell transfection; (3) provide sustained or sustained release (eg, from a depot formulation of a polynucleotide); (4) alter biodistribution (eg, target the polynucleotide to specific tissues or cell types); (5) increase translation of the encoded protein in vivo; and/or (6) alter the release profile of the encoded protein in vivo. In some embodiments, the pharmaceutical formulation further comprises a delivery vehicle (e.g., an LNP containing, for example, a lipid having formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe), for example, any of the compounds 1-232).

The pharmaceutically acceptable excipient used herein includes, without limitation, any and all solvents, dispersion media or other liquid carriers, dispersion or suspension agents, diluents, granulating and/or dispersing agents, surfactants, isotonic agents, thickeners or emulsifiers. , preservatives, binders, lubricants or oils, colorants, sweeteners or flavors, stabilizers, antioxidants, antimicrobial or antifungal agents, osmolality regulators, pH regulators, buffers, chelating agents, cryoprotectants and/or bulking agents appropriate to the specific dosage form required . Various pharmaceutical formulation excipients and methods for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein) by reference in its entirety).

Illustrative diluents include, without limitation, calcium or sodium carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, and the like. and/or combinations thereof.

Exemplary granulating and/or dispersing agents include, without limitation, starches, pregelatinized starches or microcrystalline starch, alginic acid, guar gum, agar, poly(vinylpyrrolidone) (povidone), cross-linked poly(vinylpyrrolidone) (crospovidone), cellulose, methylcellulose, carboxymethylcellulose, cross-linked sodium carboxymethyl cellulose (croscarmellose), magnesium aluminum silicate (VEEGUM®), sodium lauryl sulfate, etc. and/or combinations thereof.

Exemplary surfactants and/or emulsifiers include, but are not limited to, natural emulsifiers (e.g., gum arabic, agar, alginic acid, sodium alginate, tragacanth, chondrus carrageenan, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, lanolin, cholesterol, wax and lecithin), sorbitan fatty acid esters (e.g. polyoxyethylene sorbitan monooleate [TWEEN®80], sorbitan monopalmitate [SPAN®40], glyceryl monooleate, polyoxyethylene esters, polyethylene glycol fatty acid esters (e.g. CREMOPHOR®), simple polyoxyethylene ethers (eg polyoxyethylene lauryl ether [BRIJ®30]), PLUORINC®F 68, POLOXAMER®188 etc. and/or combinations thereof.

Exemplary binders include, without limitation, starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., acacia, sodium alginate ), ethylcellulose, hydroxyethylcellulose, hydroxypropylmethylcellulose, etc. and their combinations.

Oxidation is a potential pathway for mRNA degradation, especially for mRNA liquid formulations. Antioxidants can be added to formulations to prevent oxidation. Exemplary antioxidants include, without limitation, alpha-tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulphite, propionic acid, propyl gallate, sodium ascorbate, and the like. and their combinations.

Exemplary chelating agents include, without limitation, ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, and the like. and their combinations.

Illustrative antimicrobial or antifungal agents include, without limitation, benzalkonium chloride, benzethonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, etc. and their combinations.

Illustrative preservatives include, without limitation, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, ascorbic acid, butylated hydroxyanisole, ethylenediamine, sodium lauryl sulfate (SLS), sodium laureth sulfate (SLES), etc. and their combinations.

In some embodiments, the pH of polynucleotide solutions is maintained between pH 5 and pH 8 to improve stability. Exemplary pH adjusting buffers may include, but are not limited to, sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, and the like. and/or combinations thereof.

Exemplary lubricants include, without limitation, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium or magnesium lauryl sulfate, and the like. and their combinations.

The pharmaceutical composition or formulation described herein may contain a cryoprotectant to stabilize the polynucleotide described herein during freezing. Illustrative cryoprotectants include, without limitation, mannitol, sucrose, trehalose, lactose, glycerol, dextrose, and the like. and their combinations.

The pharmaceutical composition or formulation described herein may contain a bulking agent in lyophilized polynucleotide formulations to produce a "pharmaceutically fine" mass, stabilizing the lyophilized polynucleotides for long term storage (eg, 36 months). Exemplary bulking agents of the present invention may include, without limitation, sucrose, trehalose, mannitol, glycine, lactose, raffinose, and combinations thereof.

In some embodiments, the pharmaceutical composition or formulation further comprises a delivery vehicle. The delivery vehicle of the present disclosure may include, without limitation, liposomes, lipid nanoparticles, lipidoids, polymers, lipoplexes, microvesicles, exosomes, peptides, proteins, polynucleotide-transfected cells, hyaluronidase, nanoparticle mimics, nanotubes, conjugates, and combinations thereof.

Delivery means

The present invention provides pharmaceutical compositions with advantageous properties. In particular, the present application provides pharmaceutical compositions containing a polynucleotide that contains a nucleotide sequence encoding a relaxin polypeptide and a lipid compound as described herein.

Accelerated blood clearance (ABC)

The present invention provides compounds, compositions, and methods of using them to reduce the effect of ABC on a re-administered active agent, such as a biologically active agent. It is clear that the reduction or complete elimination of the influence of the ABC on the administered active agent effectively increases its half-life and hence its effectiveness.

In some embodiments, the term "ABC reduction" refers to any decrease in ABC compared to a positive LNP reference that induces a control ABC, such as LNP MC3. ABC-inducing LNPs cause a decrease in circulating levels of the active agent on second or subsequent administrations over a given time interval. Thus, a decrease in ABC means a decrease in the excretion of the circulating agent after the second or subsequent dose of the agent compared to the standard LNP. The reduction may be, for example, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% , 80%, 85%, 90%, 95%, 98% or 100%. In some embodiments, the reduction is 10-100%, 10-50%, 20-100%, 20-50%, 30-100%, 30-50%, 40%-100%, 40-80%, 50-90 % or 50-100%. Alternatively, the decrease in ABC can be characterized as at least a detectable level of circulating agent after the second or subsequent administrations, or at least a 2-fold, 3-fold, 4-fold, 5-fold increase in circulating agent compared to circulating agent after standard LNP administration. . In some embodiments, the reduction is 2-100-fold, 2-50-fold, 3-100-fold, 3-50-fold, 3-20-fold, 4-100-fold, 4-50-fold, 4- 40x, 4x30x, 4x25x, 4x20x, 4x15x, 4x10x, 4x5x, 5x100x, 5x50x x, 5-40 x, 5-30 x, 5-25 x, 5-20 x, 5-15 x, 5-10 x, 6-100 x, 6-50 x, 6-40x, 6-30x, 6-25x, 6-20x, 6-15x, 6-10x, 8-100x, 8-50x, 8- 40x, 8-30x, 8-25x, 8-20x, 8-15x, 8-10x, 10-100x, 10-50x, 10-40x times, 10-30 times, 10-25 times, 10-20 times, 10-15 times, 20-100 times, 20-50 times, 20-40 times, 20-30 times or 20-25 times.

The present invention provides lipid-containing compounds and compositions that are less sensitive to clearance and therefore have a longer in vivo half-life. This applies in particular to compositions that are intended for repeated, including long-term administration, and even more particularly if such repeated administration lasts for several days or weeks.

Notably, these compositions are less sensitive or even overcome the observed accelerated blood clearance (ABC) phenomenon. ABC is a phenomenon in which certain exogenously administered agents are rapidly cleared from the blood on second and subsequent administrations. This phenomenon has been partially observed for various lipid-containing compositions, including, without limitation, lipidated agents, liposomes or other lipid-based delivery agents, and lipid-encapsulated agents. Until now, the basis of ABC has been poorly understood and in some cases explained by the humoral immune response, and therefore strategies to limit its effects in vivo, in particular in the clinical setting, remained elusive.

This disclosure provides compounds and compositions that are less sensitive or not at all sensitive to ABC. In some important aspects, such compounds and compositions are lipid-containing compounds or compositions. The lipid-containing compounds or compositions of the present invention are surprisingly not affected by ABC on second and subsequent in vivo administrations. This resistance to ABC makes these compounds and compositions particularly suitable for in vivo repeated use, including repeated use for short periods of time, including days or 1-2 weeks. This increased stability and/or half-life is due in part to the inability of these compositions to activate B1a and/or B1b cells and/or conventional B cells, pDCs and/or platelets.

Therefore, the present invention provides an elucidation of the mechanism underlying accelerated blood clearance (ABC). In accordance with the present invention and the inventions provided herein, it has been found that the ABC phenomenon, at least with respect to lipids and lipid nanoparticles, is mediated at least in part by an innate immune response involving B1a and/or B1b cells, pDC and/or platelets. B1a cells are usually responsible for the secretion of natural antibody in the form of circulating IgM. This IgM is polyreactive, that is, it is able to bind to various antigens, albeit with relatively low affinity for each of them.

In accordance with the present invention, it has been found that certain lipidated agents or lipid-containing formulations, such as lipid nanoparticles administered in vivo, trigger and are affected by ABC. In accordance with the present invention, it was found that after the introduction of the first dose of LNP, one or more cells involved in the formation of the innate immune response (referred to herein as sensors) bind such an agent, become activated, and then initiate a cascade of immune factors (referred to herein as sensors). document effectors) that stimulate ABC and toxicity. For example, B1a and B1b cells can bind to LNP, become activated (alone or in the presence of other sensors such as pDC and/or effectors such as IL6), and secrete native IgM that binds to LNP. Pre-existing natural IgM in a subject can also recognize and bind to LNP, thereby triggering complement fixation. After the first dose, the production of natural IgM begins within 1-2 hours after the introduction of LNP. As a rule, after about 2-3 weeks, natural IgM is cleared from the system as a result of the natural half-life of IgM. Natural IgG is produced approximately 96 hours after LNP administration. The agent, when administered under naive conditions, can exhibit its biological effects relatively free of natural IgM produced after activation of B1a cells or B1b cells, or natural IgG. Natural IgM and natural IgG are non-specific and therefore differ from IgM to PEG and IgG to PEG.

Although Applicant is not bound by a mechanism, LNPs are believed to trigger ABCs and/or toxicity through the following mechanisms. It is believed that when an LNP is administered to a subject, the LNP is rapidly carried by the blood to the spleen. LNPs can occur with immune cells in the blood and/or spleen. A rapid innate immune response is triggered in response to the presence of LNP in the blood and/or spleen. The applicant has shown in this document that within a few hours after the introduction of LNP, several immune sensors responded to the presence of LNP. These sensors include, but are not limited to, host immune cells such as B cells, pDCs, and platelets. The sensors may be present in the spleen, for example, in the marginal zone of the spleen, and/or in the blood. An LNP may physically interact with one or more sensors, which may interact with other sensors. In this case, the LNP interacts directly or indirectly with the sensors. The sensors may interact directly with each other in response to LNP recognition. For example, many sensors are located in the spleen and they can easily interact with each other. Alternatively, one or more sensors may interact with LNP in the blood and become activated. The activated sensor can then interact with other sensors directly or indirectly (eg, by stimulating or producing a mediator such as a cytokine, such as IL6).

In some embodiments, the implementation of the LNP can interact directly with each of the following sensors: pDC, B1a cells, B1b cells and platelets, and activate them. These cells can then interact directly or indirectly with each other to initiate the production of effectors that ultimately lead to ABC and/or toxicity associated with repeated doses of LNP. For example, Applicant has shown that administration of LNP results in pDC activation, platelet aggregation and activation, and B cell activation. In response to LNP, platelets also aggregate and become activated and aggregate with B cells. pDC cells are activated. It has been found that LNP interacts relatively quickly with the surface of platelets and B cells. Blocking the activation of any one or combination of these sensors in response to LNP is useful in attenuating the immune response that normally occurs. This weakening of the immune response leads to the prevention of ABC and/or toxicity.

As soon as the sensors are activated, effectors are produced. As used herein, the term "effector" is an immune molecule produced by an immune cell, such as a B cell. Effectors include, without limitation, immunoglobulin such as natural IgM and natural IgG, and cytokines such as IL6. B1a and B1b cells stimulate natural IgM production within 2-6 hours after LNP administration. Natural IgG can be detected within 96 hours. IL6 levels rise within hours. Natural IgM and IgG circulate in the body for days to weeks. During this time period, circulating effectors can interact with newly introduced LNPs, triggering the clearance of these LNPs from the body. For example, an effector may recognize and associate with an LNP. The Fc region of the effector can be recognized by the macrophage and initiate its uptake of the exposed LNP. The macrophage is then transported to the spleen. The production of effectors by immune sensors is a temporal response that correlates with the timing observed for ABC.

If the dose administered is a second or subsequent dose administered, and if such second or subsequent dose is administered before the previously induced natural IgM and/or IgG is cleared from the body (e.g., up to 2-3 seronegative periods), then such second or subsequent dose circulating natural IgM and/or natural IgG or Fc are targeted, which trigger an alternative pathway for complement activation and are themselves rapidly eliminated. If LNP is administered after the effectors are removed from the body or their number is reduced, then ABC is not fixed.

Thus, in accordance with aspects of the present invention, inhibiting the interaction between an LNP and one or more sensors, inhibiting the activation of one or more sensors by LNP (directly or indirectly), inhibiting the production of one or more effectors, and/or inhibiting the activity of one or more effectors. In some embodiments, the LNP is designed to limit or block the interaction of the LNP with the sensor. For example, the LNP may have a modified PC and/or PEG to prevent interactions with sensors. Alternatively, or additionally, an agent that inhibits LNP-induced immune responses can be used to achieve any one or more of these effects.

It has also been determined that normal B cells are also involved in ABC. In particular, when an agent is first administered, normal B cells, referred to herein as CD19(+), bind to and antagonize the agent. Unlike B1a and B1b cells, conventional B cells are able to first form an IgM response (starting about 96 hours after LNP administration) and then an IgG response (starting about 14 days after LNP administration), followed by a secondary immune response. Thus, normal B cells counteract the injected agent and provide an IgM (and eventually IgG) response that mediates ABC. IgM and IgG are usually IgM to PEG and IgG to PEG.

It is assumed that in some cases a significant part of the ABC response is mediated by B1a cells and B1a-mediated immune responses. In addition, it is believed that in some cases the ABC response is mediated by both IgM and IgG, with such effects being mediated by both normal B cells and B1a cells. In other cases, the ABC response is mediated by native IgM molecules, some of which are able to bind to native IgM that can be produced by activated B1a cells. Natural IgMs can bind to one or more components of the LNP, such as binding to the phospholipid component of the LNP (such as binding to the PC portion of the phospholipid) and/or binding to the PEG lipid component of the LNP (such as binding to PEG-DMG, in particular binding to the PEG fragment of PEG-DMG). Since B1a expresses CD36, for which phosphatidylcholine is the ligand, it is hypothesized that the CD36 receptor may mediate B1a cell activation and thus natural IgM production. In other cases, the ABC response is mediated primarily by normal B cells.

In accordance with the present invention, it has been found that the ABC phenomenon can be reduced or eliminated at least in part by the use of compounds and compositions (such as agents, delivery vehicles and formulations) that do not activate B1a cells. Compounds and compositions that do not activate B1a cells may be referred to herein as B1a indifferent compounds and compositions. Furthermore, in accordance with the present invention, it has been found that the ABC phenomenon can be reduced or eliminated at least in part by the use of compounds and compositions that do not activate normal B cells. Compounds and compositions that do not activate normal B cells may, in some embodiments, be referred to herein as CD19 indifferent compounds and compositions. Thus, in some embodiments provided herein, the compounds and compositions do not activate B1a cells and do not activate normal B cells. Compounds and compositions that do not activate B1a cells and normal B cells may, in some embodiments, be referred to herein as B1a/CD19 indifferent compounds and compositions.

These underlying mechanisms are still unclear, and the role of B1a and B1b cells and their interaction with normal B cells in this phenomenon has also not been evaluated.

Accordingly, the present invention provides compounds and compositions that do not stimulate ABC. They can be further characterized as being unable to activate B1a and/or B1b cells, platelets and/or pDCs, and optionally also conventional B cells. These compounds (for example, agents, including biologically active agents, such as prophylactic agents, therapeutic agents and diagnostic agents, delivery agents, including liposomes, lipid nanoparticles and other lipid-based encapsulating structures, etc.) and compositions ( eg, formulations, etc.) are especially needed for applications requiring repeated administration, and in particular, repeated administrations that take place over short periods of time (eg, within 1-2 weeks). This is the case, for example, if the agent is a nucleic acid therapeutic agent that is provided to the subject on a regular basis at short intervals. The conclusions presented in this paper can be applied to these and other agents that are similarly administered and/or exposed to ABCs.

Lipid-containing compounds, lipid-containing particles and lipid-containing compositions are of particular interest because they are known to be susceptible to ABC. Such lipid-containing compounds, particles and compositions are widely used as biologically active agents or as delivery vehicles for such agents. Thus, the ability to improve the efficacy of such agents, either by reducing the exposure of the ABC to the agent itself or to its delivery vehicle, is advantageous for a wide range of active agents.

Also provided herein are compositions that do not stimulate or enhance the acute phase response (ARP) associated with administration of repeated doses of one or more biologically active agents.

The composition in some cases may not bind to IgM, including without limitation natural IgM.

The composition may in some cases not bind to an acute phase protein such as, but not limited to, C-reactive protein.

The composition in some cases may not trigger a CD5(+) mediated immune response. As used herein, a CD5(+) mediated immune response is an immune response that is mediated by B1a and/or B1b cells. Such a response may include an ABC response, an acute phase response, natural IgM and/or IgG induction, and the like.

The composition in some cases may not trigger a CD19(+) mediated immune response. As used herein, the CD19(+) mediated immune response is an immune response that is mediated by conventional CD19(+), CD5(-) B cells. Such a response may include IgM induction, IgG induction, memory B cell induction, ABC response, anti-drug antibody (ADA) response, including protein response, where the protein can be encapsulated in LNP, and the like.

B1a cells are a subgroup of B cells involved in innate immunity. These cells are the source of circulating IgM, called natural antibody or natural serum antibody. Natural IgM antibodies are characterized as having poor affinity for a number of antigens and are therefore referred to as "polyspecific" or "polyreactive" indicating their ability to bind to more than one antigen. B1a cells are unable to produce IgG. In addition, they do not develop into memory cells and thus do not provide an adaptive immune response. However, they are able to secrete IgM when activated. Secreted IgM is typically cleared within approximately 2-3 weeks, at which point the immune system is relatively naive of the previously introduced antigen. If the same antigen is presented after this time period (eg, approximately 3 weeks after initial presentation), then the antigen is not rapidly cleared. However, it is essential that if the antigen is presented during this period of time (for example, within 2 weeks, including within 1 week or within a few days), then the antigen is cleared quickly. This delay between successive doses has rendered certain lipid-containing therapeutic or diagnostic agents unsuitable for use.

In humans, B1a cells are CD19(+), CD20(+), CD27(+), CD43(+), CD70(-) and CD5(+). In mice, B1a cells are the CD19(+), CD5(+) and CD45 isoform of B220(+) B cells. It is the expression of CD5 that typically distinguishes B1a cells from other normal B cells. B1a cells can express high levels of CD5 and on this basis can be distinguished from other B-1 cells, such as B-1b cells, which express low or undetectable levels of CD5. CD5 is a pan-T cell surface glycoprotein. B1a cells also express CD36, also known as fatty acid translocase. CD36 is a member of the class B scavenger receptor family. CD36 can bind many ligands, including oxidized low density lipoproteins, native lipoproteins, oxidized phospholipids, and long chain fatty acids.

B1b cells are another subgroup of B cells involved in innate immunity. These cells are another source of circulating natural IgM. Several antigens, including PS, are able to induce T cell-independent immunity through activation of B1b. CD27 is normally activated on B1b cells in response to antigen activation. Like B1a cells, B1b cells are usually found in specific locations in the body, such as the spleen and abdomen, and are present in very low numbers in the blood. Secreted B1b native IgM is typically cleared within about 2-3 weeks, at which point the immune system is relatively naïve to the previously introduced antigen. If the same antigen is presented after this time period (eg, approximately 3 weeks after initial presentation), then the antigen is not rapidly cleared. However, it is essential that if the antigen is presented during this period of time (for example, within 2 weeks, including within 1 week or within a few days), then the antigen is cleared quickly. This delay between successive doses has rendered certain lipid-containing therapeutic or diagnostic agents unsuitable for use.

In some embodiments, it is desirable to block the activation of B1a and/or B1b cells. One strategy for blocking B1a and/or B1b cell activation involves determining which components of the lipid nanoparticle stimulate B cell activation and neutralizing those components. It was found in this document that at least PEG and phosphatidylcholine (PC) provide interaction of B1a and B1b cells with other cells and/or activation. PEG may play a role in stimulating B1 cell and platelet aggregation, which may lead to activation. PC (ancillary lipid in LNP) is also involved in B1 cell activation, probably by interacting with the CD36 receptor on the surface of B cells. A number of particles were developed and tested with PEG lipid alternatives, lipids without PEG, and/or with PC replacement (eg, oleic acid or its analogs). The authors found that replacing one or more of these components in the LNP, which would otherwise stimulate ABC upon repeated administration, is useful in preventing ABC by reducing native IgM production and/or B cell activation. Thus, the present invention encompasses LNPs that are characterized by reduced ABC by a construct that eliminates the incorporation of B cell initiating factors.

Yet another strategy for blocking B1a and/or B1b cell activation involves the use of an agent that inhibits LNP-induced immune responses. These types of funds are discussed in more detail below. In some embodiments, these agents block the interaction between B1a/B1b cells and LNPs or platelets or pDCs. For example, the agent may be an antibody or other binding agent that physically blocks the interaction. An example of this is an antibody that binds to CD36 or CD6. The agent can also be a compound that prevents or disables signaling in a B1a-/B1b cell immediately after activation or before activation. For example, it is possible to block one or more components in the B1a/B1b signaling cascade that results from the interaction of B cells with LNPs or other immune cells. In other embodiments, the agent may act on one or more effectors produced by B1a/B1b cells upon activation. These effectors include, for example, natural IgM and cytokines.

In accordance with aspects of the present invention, it has been shown that when pDC cell activation is blocked, B cell activation in response to LNP is reduced. Thus, to avoid ABC and/or toxicity, it may be beneficial to prevent pDC activation. Similar to the strategies described above, pDC cell activation can be blocked by agents that interfere with the interaction between pDC and LNP and/or B cells/platelets. Alternatively, agents that act on the pDC to block its ability to activate, or on its effectors, can be used in conjunction with LNP to avoid ABC.

Platelets may also play an important role in ABC and toxicity. Very quickly after administration of the first dose of LNP to a subject, platelets bind to the LNP, aggregate and become activated. In some embodiments, it is desired to block platelet aggregation and/or activation. One strategy for blocking platelet aggregation and/or activation involves determining which components of the lipid nanoparticle stimulate platelet aggregation and/or activation and neutralizing those components. It was found in this document that at least PEG provides for the aggregation, activation and/or interaction of platelets with other cells. Designed and validated a number of particles with and without PEG-lipid alternatives. Applicant has found that replacing one or more of these components in the LNP, which would otherwise stimulate ABC upon repeated administration, is useful in preventing ABC by reducing native IgM production and/or platelet aggregation. Thus, the present invention encompasses LNPs that are characterized by a reduced ABC due to a design that eliminates the incorporation of platelet initiating factors. Alternatively, agents that act on platelets to block their ability to activate or on their effectors can be used in conjunction with LNP to avoid ABC.

Measurement of ABC activity and related activity

Various compounds and compositions provided herein, including LNP, do not stimulate ABC activity when administered in vivo. These LNPs can be characterized and/or identified using any of a number of assays, such as, but not limited to, those described below, as well as any of the assays disclosed in the Examples section, which includes the methods subsection of the Examples.

In some embodiments, the methods include administering LNP without generating an immune response that stimulates ABC. The immune response that ABC stimulates includes the activation of one or more sensors such as B1 cells, pDCs or platelets and one or more effectors such as native IgM, native IgG or cytokines such as IL6. Thus, administration of LNP without generating an immune response that stimulates ABC, at a minimum, includes administration of LNP without significant activation of one or more sensors and significant production of one or more effectors. The term essential, as used herein, refers to the amount that will result in the physiological consequence of accelerated blood clearance for all or part of the second dose compared to the level of blood clearance expected for the second dose of LNP triggering ABC. For example, the immune response must be attenuated such that the ABC observed after the second dose is lower than expected for the LNP triggering the ABC.

B1a or B1b activation assay

Certain compositions provided in this invention do not activate B cells, such as B1a or B1b cells (CD19+ CD5+) and/or normal B cells (CD19+ CD5-). Activation of B1a cells, B1b cells, or normal B cells can be determined using a number of methods, some of which are listed below. A population of B cells can be represented as fractionated populations of B cells, or unfractionated populations of splenocytes, or peripheral blood mononuclear cells (PBMCs). In the latter case, the cell population can be incubated with the selected LNP for a certain period of time and then harvested for further analysis. Alternatively, the supernatant can be collected and analyzed.

Increased cell surface expression of an activation marker

Activation of B1a cells, B1b cells, or normal B cells can be demonstrated as increased expression of B cell activation markers, including late activation markers such as CD86. In an exemplary non-limiting assay, unfractionated B cells are presented as a population of splenocytes or as a population of PBMCs, incubated with a selected LNP for a specified period of time, and then stained for a standard B cell marker such as CD19 and an activation marker such as CD86, and analyzed using, for example, flow cytometry. A suitable negative control involves incubating the same population with media and then performing the same staining and imaging steps. An increase in CD86 expression in the test population compared to the negative control is indicative of B cell activation.

Release of pro-inflammatory cytokines

B cell activation can also be assessed using a cytokine release assay. For example, activation can be measured by the production and/or secretion of cytokines such as IL-6 and/or TNF-alpha when exposed to LNPs of interest.

Such assays can be performed using conventional cytokine secretion assays well known in the art. Increased secretion of cytokines indicates activation of B cells.

Binding/association of LNP to B cells and/or capture by B cells

The association or binding of an LNP to B cells can also be used to evaluate an LNP of interest and to further characterize such an LNP. Association/binding and/or uptake/internalization can be assessed using a detectable label, such as fluorescently labeled, LNP, and tracking the location of such LNP in or on B cells after various incubation periods.

The present invention further contemplates that the compositions provided herein may be capable of evading recognition or detection of, and optionally binding to, downstream ABC signaling pathway mediators such as circulating IgM and/or acute phase response mediators such as acute phase proteins (e.g. , C-reactive protein (CRP).

Methods of application to reduce ABC

Also provided herein are LNP delivery methods that can encapsulate an agent, such as a therapeutic agent, to a subject without ABC stimulation.

In some embodiments, the method involves administering any of the LNPs described herein that do not stimulate ABC, eg, do not induce natural IgM production that binds to LNP, do not activate B1a cells and/or B1b cells. As used herein, an LNP that "does not stimulate ABC" refers to an LNP that does not induce immune responses leading to significant ABC, or induces in fact a low level of immune responses that is insufficient to cause significant ABC. LNP that does not induce natural IgM production that binds to LNP refers to LNPs that do not induce native IgM binding to LNP or induce a low level of natural IgM molecules that is not sufficient to cause significant ABC. LNP that does not activate B1a and/or B1b cells refers to LNPs that do not induce a B1a and/or B1b cell response with produced natural IgM binding to LNP or induce an actual low level of B1a and/or B1b responses , which is insufficient to cause significant ABC.

In some embodiments, the expressions "do not activate" and "do not induce" production represent a relative reduction compared to a reference value or condition. In some embodiments, the reference value or state is the degree of activation or induction of production of a molecule, such as IgM, by a standard LNP, such as LNP MC3. In some embodiments, the relative reduction is a reduction of at least 30%, e.g., at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75 %, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In other embodiments, the terms "do not activate cells" such as B cells and "do not induce protein production" such as IgM may refer to an undetectable amount of active cells or a particular protein.

Platelet Effects and Toxicity

The present invention is further based in part on the elucidation of the mechanism underlying dose-limiting toxicity associated with LNP administration. Such toxicity may include coagulopathy, disseminated intravascular coagulation (DIC, also referred to as consumption coagulopathy), acute or chronic, and/or vascular thrombosis. In some cases, dose-limiting toxicity associated with LNP is acute phase response (APR) or complement-activated pseudo-allergy (CARPA).

As used herein, the term coagulopathy refers to increased coagulation (increased blood clotting) in vivo. The results presented in this invention are consistent with this increased coagulation and provide a great deal of insight into the underlying mechanism. Coagulation is a process that involves a number of different factors and cell types, and until now the relationship between LNP and platelets and interactions with them has not been understood in this regard. The present disclosure provides evidence for such an interaction and also provides compounds and compositions that are modified to have a reduced platelet effect, including reduced platelet association and/or reduced platelet aggregation. The ability to modulate, including preferably down-modulate, such platelet effects may reduce the incidence and/or severity of coagulopathy following LNP administration. This, in turn, will reduce the toxicity associated with such LNP, thereby allowing the administration of higher doses of LNP and, importantly, their load to be administered to patients in need.

CARPA is a class of acute immune toxicity manifested by hypersensitivity reactions (HSRs) that can be triggered by nano-drugs and biologics. Unlike allergic reactions, CARPA does not usually involve IgE, but develops due to the activation of the complement system, which is part of the innate immune system that enhances the body's ability to rid itself of pathogens. One or more of the following pathways may be involved in CARPA: the classical complement pathway (CP), the alternative pathway (AP), and the lectin pathway (LP). Szebeni, Molecular Immunology, 61: 163-173 (2014).

The classical pathway is triggered by activation of the C1 complex, which contains: C1q, C1r, C1s, or C1qr2s2. Activation of the C1 complex occurs when C1q binds to IgM or IgG in complex with antigens, or when C1q binds directly to the pathogen surface. This binding leads to a conformational change in the C1q molecule, which leads to the activation of C1r, which in turn cleaves C1s. The C1r2s2 component then separates C4 and then C2 to give C4a, C4b, C2a and C2b. C4b and C2b bind to form the classical pathway C3 convertase (C4b2b complex), which stimulates the cleavage of C3 into C3a and C3b. C3b then binds C3 convertase to form C5 convertase (C4b2b3b complex). The alternative pathway is continuously activated as a result of spontaneous hydrolysis of C3. The P factor (properdin) is a positive regulator of the alternative pathway. Oligomerization of properdin stabilizes C3 convertase, which can then cleave significantly more C3. C3 molecules can bind to surfaces and recruit B, D, and P activities to a greater extent, resulting in increased complement activation.

The acute phase response (APR) is a complex systemic innate immune response to prevent infection and remove potential pathogens. Numerous proteins are involved in APR, and C-reactive protein is a well-characterized protein.

In accordance with the present invention, it has been found that certain LNPs are able to physically bind to platelets almost immediately after administration in vivo, while other LNPs do not bind to platelets at all or bind only at background levels. Notably, those LNPs that bind to platelets also seem to stabilize the platelet aggregates that are then formed. Physical contact of platelets with certain LNPs correlates with the ability of such platelets to remain aggregated or continuously form aggregates for a long period of time after administration. Such aggregates contain activated platelets as well as cells of the innate immune system such as macrophages and B cells.

A. lipid compound

The present invention provides pharmaceutical compositions with advantageous properties. For example, the lipids described herein (for example, any of formulas (I), (IA), (II), (IIa), (IIb), (IIc), (IId), (IIe), (III), (IV), (V) or (VI)), can advantageously be used in lipid nanoparticle compositions for the delivery of therapeutic and/or prophylactic agents to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, lipid compounds disclosed herein have lower immunogenicity than a reference lipid (eg, MC3, KC2, or DLinDMA). For example, a formulation containing a lipid disclosed herein and a therapeutic or prophylactic agent has an increased therapeutic index compared to a corresponding formulation that contains a reference lipid (eg, MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent. In particular, this application provides pharmaceutical compositions containing:

(a) a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide; And

(b) means of delivery.

In some embodiments, the delivery vehicle comprises a lipid compound of formula (I):

Where:

R ₁ is selected from the group consisting of C ₅₃₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from carbocycle, heterocycle, OR , O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H, CXH ₂ , CN, N(R) ₂ , C(O)N(R ) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ , N(R)R ₈ , O(CH ₂ ) _n OR, N(R)C(=NR ₉ )N(R) ₂ , N(R)C(=CHR ₉ )N(R) ₂ , OC (O)N(R) ₂ , N(R)C(O)OR, N(OR)C(O)R, N(OR)S(O) ₂ R, N(OR)C(O)OR, N(OR)C(O)N(R) ₂ , N(OR)C(S)N(R) ₂ , N(OR)C(=NR ₉ )N(R) ₂ , N(OR)C( =CHR ₉ )N(R) ₂ , C(=NR ₉ )N(R) ₂ , C(=NR ₉ )R, C(O)N(R)OR and C(R)N(R) ₂ C (O)OR, and each n is independently selected from 1, 2, 3, 4, and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₂₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or its salts or stereoisomers.

In some embodiments, the subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₂₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, CQ(R) ₂ and unsubstituted C ₁₆ alkyl, where Q is selected from carbo cycle, heterocycle, OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H, CXH ₂ , CN, N(R) ₂ , C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ and C(R)N(R) ₂ C(O)OR, and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₂₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers, where the alkyl and alkenyl groups may be linear or branched.

In some embodiments, the subgroup of compounds of formula (I) includes compounds in which if R ₄ is (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR or CQ(R) ₂ then (i) Q is not N(R) ₂ if n is 1, 2, 3, 4 or 5, or (ii) Q is not 5-, 6- or 7-membered heterocycloalkyl if n is 1 or 2.

In other embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₃₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, CQ(R) ₂ and unsubstituted C ₁₆ alkyl, where Q is selected from C ₃₆ carbocycle, 5-14 -membered heteroaryl having one or more heteroatoms selected from N, O and S, OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H , CXH ₂ , CN, C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ , CRN(R) ₂ C(O)OR, -N(R)R ₈ , -O(CH ₂ ) _n OR, -N(R)C( =NR ₉ )N(R) ₂ , -N(R)C(=CHR ₉ )N(R) ₂ , -OC(O)N(R) ₂ , -N(R)C(O)OR, - N(OR)C(O)R, -N(OR)S(O) ₂ R, -N(OR)C(O)OR, -N(OR)C(O)N(R) ₂ , -N (OR)C(S)N(R) ₂ , -N(OR)C(=NR ₉ )N(R) ₂ , -N(OR)C(=CHR ₉ )N(R) ₂ , -C( =NR ₉ )N(R) ₂ , -C(=NR ₉ )R, -C(O)N(R)OR and 5-14 membered heterocycloalkyl having one or more heteroatoms selected from N, O and S , which is substituted with one or more substituents selected from oxo (=O), OH, amino and C ₁₃ alkyl, and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₂₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In other embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₃₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, CQ(R) ₂ and unsubstituted C ₁₆ alkyl, where Q is selected from C ₃₆ carbocycle, 5-14 -membered heteroaryl having one or more heteroatoms selected from N, O and S, OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H , CXH ₂ , CN, C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ , CRN(R) ₂ C(O)OR and 5-14 membered heterocycloalkyl having one or more heteroatoms selected from N, O and S, which is substituted with one or several substituents selected from oxo (=O), OH, amino and C ₁₃ alkyl, and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₂₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In a few more embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₂₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, CQ(R) ₂ and unsubstituted C ₁₆ alkyl, where Q is selected from C ₃₆ carbocycle, 5-14 -membered heterocycle having one or more heteroatoms selected from N, O and S, OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H , CXH ₂ , CN, C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ , CRN(R) ₂ C(O)OR, N(R)R ₈ , O(CH ₂ ) _n OR, N(R)C(=NR ₉ )N(R) ₂ , N(R)C(=CHR ₉ )N(R) ₂ , OC(O)N(R) ₂ , N(R)C(O)OR, N(OR)C(O )R, N(OR)S(O) ₂ R, N(OR)C(O)OR, N(OR)C(O)N(R) ₂ , N(OR)C(S)N(R) ₂ , N(OR)C(=NR ₉ )N(R) ₂ , N(OR)C(=CHR ₉ )N(R) ₂ , C(=NR ₉ )R, C(O)N(R) OR and C(=NR ₉ )N(R) ₂ and each n is independently selected from 1, 2, 3, 4 and 5; and if Q is a 5-14 membered heterocycle and (i) R ₄ is (CH ₂ ) _n Q wherein n is 1 or 2, or (ii) R ₄ is (CH ₂ ) _n CHQR, in where n is 1, or (iii) R ₄ is CHQR and CQ(R) ₂ , then Q is 5-14 membered heteroaryl or 8-14 membered heterocycloalkyl;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₂₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In a few more embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₂₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, CQ(R) ₂ and unsubstituted C ₁₆ alkyl, where Q is selected from C ₃₆ carbocycle, 5-14 -membered heterocycle having one or more heteroatoms selected from N, O and S, OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H , CXH ₂ , CN, C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ , CRN(R) ₂ C(O)OR, and each n is independently selected from 1, 2, 3, 4 and 5; and if Q is a 5-14 membered heterocycle and (i) R ₄ is (CH ₂ ) _n Q wherein n is 1 or 2, or (ii) R ₄ is (CH ₂ ) _n CHQR, in where n is 1, or (iii) R ₄ is CHQR and CQ(R) ₂ , then Q is 5-14 membered heteroaryl or 8-14 membered heterocycloalkyl;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₂₃ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In several other embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₃₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, CQ(R) ₂ and unsubstituted C ₁₆ alkyl, where Q is selected from C ₃₆ carbocycle, 5-14 -membered heteroaryl having one or more heteroatoms selected from N, O and S, -OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H, CXH ₂ , CN, C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ , CRN(R) ₂ C(O)OR, N(R)R ₈ , -O(CH ₂ ) _n OR, N(R)C(= NR ₉ )N(R) ₂ , N(R)C(=CHR ₉ )N(R) ₂ , OC(O)N(R) ₂ , -N(R)C(O)OR, N(OR) C(O)R, N(OR)S(O) ₂ R, N(OR)C(O)OR, N(OR)C(O)N(R) ₂ , N(OR)C(S)N (R) ₂ , N(OR)C(=NR ₉ )N(R) ₂ , N(OR)C(=CHR ₉ )N(R) ₂ , C(=NR ₉ )R, C(O)N (R)OR and C(=NR ₉ )N(R) ₂ and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

R ₈ is selected from the group consisting of C _3-6 carbocycle and heterocycle;

R ₉ is selected from the group consisting of H, CN, NO ₂ , C _1-6 alkyl, -OR, -S(O) ₂ R, -S(O) ₂ N(R) ₂ , C _2-6 alkenyl, C _3-6 carbocycle and heterocycle;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C _3-14 alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₂₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In several other embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₂₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, CQ(R) ₂ and unsubstituted C _1-6 alkyl, where Q is selected from C _3-6 carbocycle , 5-14-membered heteroaryl having one or more heteroatoms selected from N, O and S, -OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H, CXH ₂ , CN, C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O) N(R) ₂ , N(R)C(S)N(R) ₂ , CRN(R) ₂ C(O)OR, and each n is independently selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C _3-14 alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₂₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In a few more embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₃₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₂₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is (CH ₂ ) _n Q or (CH ₂ ) _n CHQR, where Q is N(R) ₂ and n is selected from 3,4 and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₁₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In a few more embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₂₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of H, C ₂₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached, form a heterocycle or a carbocycle;

R ₄ is (CH ₂ ) _n Q or (CH ₂ ) _n CHQR, where Q is N(R) ₂ and n is selected from 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C ₁₁₈ alkyl, C ₂₁₈ alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₁₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In several other embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₃₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached , form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR and CQ(R) ₂ where Q is N(R) ₂ and n is selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , -SS-, aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₁₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In several other embodiments, another subgroup of compounds of formula (I) includes compounds in which:

R ₁ is selected from the group consisting of C ₅₂₀ alkyl, C ₅₂₀ alkenyl, R*YR'', YR'' and R''M'R';

R ₂ and R ₃ are independently selected from the group consisting of C ₁₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom to which they are attached , form a heterocycle or a carbocycle;

R ₄ is selected from the group consisting of (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR and CQ(R) ₂ where Q is N(R) ₂ and n is selected from 1, 2, 3, 4 and 5;

each R ₅ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R ₆ is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , aryl group and heteroaryl group;

R ₇ is selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R is independently selected from the group consisting of C ₁₃ alkyl, C ₂₃ alkenyl and H;

each R' is independently selected from the group consisting of C _1-18 alkyl, C _2-18 alkenyl, R*YR'', YR'' and H;

each R'' is independently selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl;

each R* is independently selected from the group consisting of C ₁₁₂ alkyl and C ₁₁₂ alkenyl;

each Y is independently a C ₃₆ carbocycle;

each X is independently selected from the group consisting of F, Cl, Br and I; And

m is selected from 5, 6, 7, 8, 9, 10, 11, 12 and 13,

or their salts or stereoisomers.

In certain embodiments, a subgroup of compounds of formula (I) includes compounds of formula (IA):

or their salt or stereoisomer, where l is selected from 1, 2, 3, 4 and 5; m is selected from 5, 6, 7, 8 and 9; M ₁ is a bond or M'; R ₄ is unsubstituted C ₁₃ alkyl or (CH ₂ ) _n Q where Q is OH, NHC(S)N(R) ₂ , NHC(O)N(R) ₂ , N(R)C(O )R, N(R)S(O) ₂ R, N(R)R ₈ , NHC(=NR ₉ )N(R) ₂ , NHC(=CHR ₉ )N(R) ₂ , OC(O)N (R) ₂ , N(R)C(O)OR, heteroaryl or heterocycloalkyl; M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), P(O)(OR')O, -SS-, aryl group and heteroaryl group; And

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl and C ₂₁₄ alkenyl.

In some embodiments, a subgroup of compounds of formula (I) includes compounds of formula (IA), or a salt or stereoisomer thereof,

Where:

l is selected from 1, 2, 3, 4 and 5; m is selected from 5, 6, 7, 8 and 9;

M ₁ is a bond or M';

R ₄ is unsubstituted C _1-3 alkyl or (CH ₂ ) _n Q, wherein Q is OH, NHC(S)N(R) ₂ or NHC(O)N(R) ₂ ;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), P(O)(OR')O, an aryl group, and a heteroaryl group; And

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl and C ₂₁₄ alkenyl.

In certain embodiments, a subgroup of compounds of formula (I) includes compounds of formula (II):

or their salt or stereoisomer, where l is selected from 1, 2, 3, 4 and 5; M ₁ is a bond or M'; R ₄ is unsubstituted C ₁₃ alkyl or (CH ₂ ) _n Q where n is 2, 3 or 4 and Q is OH, NHC(S)N(R) ₂ , NHC(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)R ₈ , NHC(=NR ₉ )N(R) ₂ , NHC(=CHR ₉ )N( R) ₂ , OC(O)N(R) ₂ , N(R)C(O)OR, heteroaryl or heterocycloalkyl; M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), P(O)(OR')O, -SS-, aryl group and heteroaryl group; And

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl and C ₂₁₄ alkenyl.

In some embodiments, the subgroup of compounds of formula (I) includes compounds of formula (II), or a salt or stereoisomer thereof, wherein:

l is selected from 1, 2, 3, 4 and 5;

M ₁ is a bond or M';

R ₄ is unsubstituted C ₁₃ alkyl or (CH ₂ ) _n Q where n is 2, 3 or 4 and Q is OH, NHC(S)N(R) ₂ or NHC(O)N(R) ₂ ;

M and M' are independently selected from C(O)O, OC(O), C(O)N(R'), P(O)(OR')O, an aryl group, and a heteroaryl group; And

R ₂ and R ₃ are independently selected from the group consisting of H, C ₁₁₄ alkyl and C ₂₁₄ alkenyl.

In some embodiments, the compound of formula (I) is a compound of formula (IIa):

or a salt thereof, where R ₄ is described above.

In some embodiments, the compound of formula (I) is a compound of formula (IIb):

or a salt thereof, where R ₄ is described above.

In some embodiments, the compound of formula (I) is a compound of formula (IIc):

or a salt thereof, where R ₄ is described above.

In some embodiments, the compound of formula (I) is a compound of formula (IIe):

or a salt thereof, where R ₄ is described above.

In some embodiments, the compound of formula (IIa), (IIb), (IIc) or (IIe) contains R ₄ which is selected from (CH ₂ ) _n Q and (CH ₂ ) _n CHQR, where Q, R and n are defined above .

In some embodiments, Q is selected from the group consisting of OR, OH, O(CH ₂ ) _n N(R) ₂ , OC(O)R, CX ₃ , CN, N(R)C(O)R, N( H)C(O)R, N(R)S(O) ₂ R, N(H)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(H)C( O)N(R) ₂ , N(H)C(O)N(H)(R), N(R)C(S)N(R) ₂ , N(H)C(S)N(R) ₂ , N(H)C(S)N(H)(R) and heterocycle, where R is defined above. In some aspects, n is 1 or 2. In some embodiments, Q is OH, NHC(S)N(R) ₂ , or NHC(O)N(R) ₂ .

In some embodiments, the compound of formula (I) is a compound of formula (IId):

or a salt thereof, wherein R ₂ and R ₃ are independently selected from the group consisting of C ₅₁₄ alkyl and C ₅₁₄ alkenyl, n is selected from 2, 3 and 4, and R', R'', R ₅ , R ₆ and m are as defined higher.

In some aspects of the compounds of formula (IId) R ₂ represents C ₈ alkyl. In some aspects of the compounds of formula (IId) R ₃ represents C ₅ -C ₉ alkyl. In some aspects of a compound of formula (IId), m is 5, 7, or 9. In some aspects of a compound of formula (IId), each R ₅ is H. In some aspects of a compound of formula (IId), each R ₆ is H.

In another aspect, the present application provides a lipid composition (eg, lipid nanoparticle (LNP)) containing: (1) a compound of formula (I); (2) optionally an accessory lipid (eg, a phospholipid); (3) optionally a structural lipid (eg sterol); and (4) optionally a lipid conjugate (eg PEG lipid). In exemplary embodiments, the lipid composition (eg, LNP) further comprises a polynucleotide encoding a relaxin polypeptide, eg, a polynucleotide encapsulated therein.

As used herein, the term "alkyl" or "alkyl group" means a linear or branched saturated hydrocarbon containing one or more carbon atoms (for example, one, two, three, four, five, six, seven, eight, nine, ten, eleven , twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more carbon atoms).

The designation "C ₁₁₄ alkyl" means a linear or branched saturated hydrocarbon containing 1-14 carbon atoms. The alkyl group may be optionally substituted.

As used herein, the term "alkenyl" or "alkenyl group" means a linear or branched hydrocarbon containing two or more carbon atoms (for example, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more carbon atoms) and at least one double bond.

The designation "C ₂₁₄ alkenyl" means a linear or branched hydrocarbon containing 2-14 carbon atoms and at least one double bond. The alkenyl group may contain one, two, three, four or more double bonds. For example, C ₁₈ alkenyl may contain one or more double bonds. The C ₁₈ alkenyl group containing two double bonds may be a linoleyl group. The alkenyl group may be optionally substituted.

Used in this document, the term "carbocycle" or "carbocyclic group" means a mono - or polycyclic system containing one or more rings of carbon atoms. The rings may be three-, four-, five-, six-, seven-, eight-, nine-, ten-, eleven-, twelve-, thirteen-, fourteen- or fifteen-membered rings.

The designation "C ₃₆ carbocycle" means a carbocycle containing one ring having 3-6 carbon atoms. Carbocycles may contain one or more double bonds and may be aromatic (eg, aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl and 1,2-dihydronaphthyl groups. The carbocycles may be optionally substituted.

Used in this document, the term "heterocycle" or "heterocyclic group" means a mono - or polycyclic system containing one or more rings, where at least one ring contains at least one heteroatom. The heteroatoms may be, for example, nitrogen, oxygen or sulfur atoms. The rings may be three-, four-, five-, six-, seven-, eight-, nine-, ten-, eleven- or twelve-membered rings. Heterocycles may contain one or more double bonds and may be aromatic (eg, heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydro furyl, thiophenyl, pyridinyl, piperidinyl, quinolyl and isoquinolyl groups. The heterocycles may be optionally substituted.

As used herein, a "biodegradable group" is a group that can promote faster lipid metabolism in a subject. The biodegradable group may be, without limitation, C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C( S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , an aryl group and a heteroaryl group.

As used herein, an "aryl group" is a carbocyclic group containing one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups.

As used herein, a "heteroaryl group" is a heterocyclic group containing one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' may be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole and thiazole. In the formulas herein, M and M' may be independently selected from the list of biodegradable groups above.

Alkyl, alkenyl and cyclyl (eg carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise indicated. Optional substituents may be selected from the group consisting, without limitation, of a halogen atom (for example, a chloride, bromide, fluoride, or iodide group), a carboxylic acid (for example, C(O)OH), an alcohol (for example, OH hydroxyl), an ester ( e.g. C(O)OR or OC(O)R), aldehyde (e.g. C(O)H), carbonyl (e.g. C(O)R, alternatively represented by C=O), acyl halide (e.g. C (O)X, in which X is a halide selected from bromide, fluoride, chloride and iodide), carbonate (for example, OC(O)OR), alkoxy (for example, OR), acetal (for example, C(OR) ₂ R'''', in which all ORs are alkoxy groups, which may be the same or different, and R'''' is an alkyl or alkenyl group), phosphate (for example, P(O) ₄ ³ ), thiol (for example , SH), sulfoxide (e.g. S(O)R), sulfinic acid (e.g. S(O)OH), sulfonic acid (e.g. S(O) ₂ OH), thioaldehyde (e.g. C(S)H) , sulfate (eg S(O) ₄ ² ), sulfonyl (eg S(O) ₂ ), amide (eg C(O)NR ₂ or N(R)C(O)R), azido (eg N ₃ ), nitro (eg NO ₂ ), cyano (eg CN), isocyano (eg NC), acyloxy (eg OC(O)R), amino (eg NR ₂ , NRH or NH ₂ ), carbamoyl (e.g. OC(O)NR ₂ , OC(O)NRH or OC(O)NH ₂ ), sulfonamide (e.g. S(O) ₂ NR ₂ , S(O) ₂ NRH, S(O) ₂ NH2 , N(R)S(O) ₂ R, N(H)S(O) ₂ R, N(R)S(O) ₂ H or N(H)S(O) ₂ H), alkyl group, alkenyl a group and a cyclyl (eg carbocyclyl or heterocyclyl) group.

In any of the previous instances, R is an alkyl or alkenyl group as defined herein. In some embodiments, the substituent groups themselves may be further substituted, for example, with one, two, three, four, five, or six substituents as defined herein. For example, a C _1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.

The compounds of any of the formulas (I), (IA), (II), (IIa), (IIb), (IIc), (IId) and (IIe) contain, as appropriate, one or more of the following features.

In some embodiments, R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, and CQ(R) ₂ , where Q is selected from C ₃₆ carbocycle, 5-14- membered aromatic or non-aromatic heterocycle having one or more heteroatoms selected from N, O, S and P, OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H, CXH ₂ , CN, N(R) ₂ , C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R )C(O)N(R) ₂ , N(R)C(S)N(R) ₂ and C(R)N(R) ₂ C(O)OR, and each n is independently selected from 1, 2, 3, 4 and 5.

In another embodiment, R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR and CQ(R) ₂ where Q is selected from C ₃₆ carbocycle, 5-14- membered heteroaryl having one or more heteroatoms selected from N, O and S, OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H, CXH ₂ , CN, C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ , C(R)N(R) ₂ C(O)OR and 5-14 membered heterocycloalkyl having one or more heteroatoms selected from N, O and S, which is substituted with one or more substituents selected from oxo (=O), OH, amino and C ₁₃ alkyl, and each n is independently selected from 1, 2, 3, 4 and 5.

In another embodiment, R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR and CQ(R) ₂ where Q is selected from C ₃₆ carbocycle, 5-14- a membered heterocycle having one or more heteroatoms selected from N, O and S, OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H, CXH ₂ , CN, C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ , C(R)N(R) ₂ C(O)OR, and each n is independently selected from 1, 2, 3, 4 and 5; and if Q is a 5-14 membered heterocycle and (i) R ₄ is (CH ₂ ) _n Q wherein n is 1 or 2, or (ii) R ₄ is (CH ₂ ) _n CHQR, in where n is 1, or (iii) R ₄ is CHQR and CQ(R) ₂ , then Q is 5-14 membered heteroaryl or 8-14 membered heterocycloalkyl.

In another embodiment, R ₄ is selected from the group consisting of C ₃₆ carbocycle, (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR and CQ(R) ₂ where Q is selected from C ₃₆ carbocycle, 5-14- membered heteroaryl having one or more heteroatoms selected from N, O and S, OR, O(CH ₂ ) _n N(R) ₂ , C(O)OR, OC(O)R, CX ₃ , CX ₂ H, CXH ₂ , CN, C(O)N(R) ₂ , N(R)C(O)R, N(R)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(R)C(S)N(R) ₂ , C(R)N(R) ₂ C(O)OR, and each n is independently selected from 1, 2, 3, 4 and 5.

In another embodiment, R ₄ is unsubstituted C ₁₄ alkyl, eg unsubstituted methyl.

In certain embodiments, the present invention provides a compound of formula (I) wherein R ₄ is (CH ₂ ) _n Q or (CH ₂ ) _n CHQR, where Q is N(R) ₂ and n is selected from 3, 4 and 5.

In certain embodiments, the present invention provides a compound of formula (I) wherein R ₄ is selected from the group consisting of (CH ₂ ) _n Q, (CH ₂ ) _n CHQR, CHQR, and CQ(R) ₂ , where Q is N (R) ₂ and n is selected from 1, 2, 3, 4 and 5.

In certain embodiments, the present invention provides a compound of formula (I) wherein R ₂ and R ₃ are independently selected from the group consisting of C ₂₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'', and R*OR'' , or R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle, and R ₄ is (CH ₂ ) _n Q or (CH ₂ ) _n CHQR, where Q is N(R) ₂ , and n is selected from 3, 4 and 5.

In certain embodiments, R ₂ and R ₃ are independently selected from the group consisting of C ₂₁₄ alkyl, C ₂₁₄ alkenyl, R*YR'', YR'' and R*OR'', or R ₂ and R ₃ together with the atom, to which they are attached form a heterocycle or carbocycle.

In some embodiments, R ₁ is selected from the group consisting of C ₅₂₀ alkyl and C ₅₂₀ alkenyl.

In other embodiments, R ₁ is selected from the group consisting of R*YR'', YR'' and R''M'R'.

In certain embodiments, R ₁ is selected from R*YR'' and YR''. In some embodiments, Y is a cyclopropyl group. In some embodiments, R* is C ₈ alkyl or C ₈ alkenyl. In certain embodiments, R'' is C ₃₁₂ alkyl. For example, R'' may be C ₃ alkyl. For example, R'' may be C ₄₈ alkyl (eg C ₄ , C ₅ C ₆ , C ₇ or C ₈ alkyl).

In some embodiments, R ₁ is C ₅₂₀ alkyl. In some embodiments, R ₁ is C ₆ alkyl. In some embodiments, R ₁ is C ₈ alkyl. In other embodiments, R ₁ is C ₉ alkyl. In certain embodiments, R ₁ is C ₁₄ alkyl. In other embodiments, R ₁ is C ₁₈ alkyl.

In some embodiments, R ₁ is C ₅₂₀ alkenyl. In certain embodiments, R ₁ is C ₁₈ alkenyl. In some embodiments, R ₁ is linoleyl.

.In certain embodiments, R ₁ is branched (e.g., is decan-2-yl, undecan-3-yl, dodecan-4-yl, tridecan-5-yl, tetradecan-6-yl, 2-methylundecan-3-yl , 2-methyldecan-2-yl, 3-methylundecan-3-yl, 4-methyldodecan-4-yl or heptadecan-9-yl). In certain embodiments, R ₁ is

.

In certain embodiments, R ₁ is unsubstituted C ₅₂₀ alkyl or C ₅₂₀ alkenyl. In certain embodiments, R' is a substituted C ₅₂₀ alkyl or C ₅₂₀ alkenyl (eg, substituted with a C ₃₆ carbocycle, such as 1-cyclopropylnonyl).

In other embodiments, R ₁ is R''M'R'.

In some embodiments, R' is selected from R*YR'' and YR''. In some embodiments, Y is C ₃₈ cycloalkyl. In some embodiments, Y is C ₆₁₀ aryl. In some embodiments, Y is a cyclopropyl group. In some embodiments, Y is a cyclohexyl group. In certain embodiments, R* is C ₁ alkyl.

In some embodiments, R'' is selected from the group consisting of C _3-12 alkyl and C ₃₁₂ alkenyl. In some embodiments, R'' adjacent to Y is C ₁ alkyl. In some embodiments, R'' adjacent to Y is C ₄₉ alkyl (eg, C ₄ , C ₅ , C ₆ , C ₇ , or C ₈ or C ₉ alkyl).

In some embodiments, R' is selected from C ₄ alkyl and C ₄ alkenyl. In certain embodiments, R' is selected from C ₅ alkyl and C ₅ alkenyl. In some embodiments, R' is selected from C ₆ alkyl and C ₆ alkenyl. In some embodiments, R' is selected from C ₇ alkyl and C ₇ alkenyl. In some embodiments, R' is selected from C ₉ alkyl and C ₉ alkenyl.

.In other embodiments, R' is selected from C ₁₁ alkyl and C ₁₁ alkenyl. In other embodiments, R' is selected from C ₁₂ alkyl, C ₁₂ alkenyl, C ₁₃ alkyl, C 13 alkenyl, C ₁₄ alkyl, C ₁₄ alkenyl, C ₁₅ alkyl, _{C 15 alkenyl} , C ₁₆ alkyl, C ₁₆ alkenyl, C ₁₇ alkyl, C ₁₇ alkenyl, C ₁₈ alkyl and C ₁₈ alkenyl. In certain embodiments, R' is branched (e.g., is decan-2-yl, undecan-3-yl, dodecan-4-yl, tridecan-5-yl, tetradecan-6-yl, 2-methylundecan-3-yl , 2-methyldecan-2-yl, 3-methylundecan-3-yl, 4-methyldodecan-4-yl or heptadecan-9-yl). In certain embodiments, R' is

.

In certain embodiments, R' is unsubstituted C ₁₁₈ alkyl. In certain embodiments, R' is a substituted C ₁₁₈ alkyl (eg, C ₁₁₅ alkyl substituted with a C ₃₆ carbocycle, such as 1-cyclopropylnonyl).

In some embodiments, R'' is selected from the group consisting of C ₃₁₄ alkyl and C ₃₁₄ alkenyl. In some embodiments, R'' is C ₃ alkyl, C ₄ alkyl, C ₅ alkyl, C ₆ alkyl, C ₇ alkyl, or C ₈ alkyl. In some embodiments, R'' is C ₉ alkyl, C ₁₀ alkyl, C ₁₁ alkyl, C ₁₂ alkyl, C ₁₃ alkyl, or C ₁₄ alkyl.

In some embodiments, M' is C(O)O. In some embodiments, M' is OS(O).

In other embodiments, M' is an aryl group or a heteroaryl group. For example, M' may be selected from the group consisting of phenyl, oxazole and thiazole.

In some embodiments, M is C(O)O. In some embodiments, M is OS(O). In some embodiments, M is C(O)N(R'). In some embodiments, M is P(O)(OR')O.

In other embodiments, M is an aryl group or a heteroaryl group. For example, M may be selected from the group consisting of phenyl, oxazole and thiazole.

In some embodiments, M and M' are the same. In other embodiments, M and M' are different.

In some embodiments, each R ₅ is H. In certain such embodiments, each R ₆ is also H.

In some embodiments, R ₇ is H. In other embodiments, R ₇ is C ₁₃ alkyl (eg, methyl, ethyl, propyl, or isopropyl).

In some embodiments, R ₂ and R ₃ are independently C ₅₁₄ alkyl or C ₅₁₄ alkenyl.

In some embodiments, R ₂ and R ₃ are the same. In some embodiments, R ₂ and R ₃ are C ₈ alkyl. In certain embodiments, R ₂ and R ₃ are C ₂ alkyl. In other embodiments, R ₂ and R ₃ are C ₃ alkyl. In some embodiments, R ₂ and R ₃ are C ₄ alkyl. In certain embodiments, R ₂ and R ₃ are C ₅ alkyl. In other embodiments, R ₂ and R ₃ are C ₆ alkyl. In some embodiments, R ₂ and R ₃ are C ₇ alkyl.

In other embodiments, R ₂ and R ₃ are different. In certain embodiments, R ₂ is C ₈ alkyl. In some embodiments, R ₃ is C ₁₇ (eg, C ₁ , C ₂ , C ₃ , C ₄ , C ₅ , C ₆ or C ₇ alkyl) or C ₉ alkyl.

In some embodiments, R ₇ and R ₃ are H.

In certain embodiments, R ₂ is H.

In some embodiments, m is 5, 7, or 9.

In some embodiments, R ₄ is selected from (CH ₂ ) _n Q and (CH ₂ ) _n CHQR.

In some embodiments, Q is selected from the group consisting of OR, OH, O(CH ₂ ) _n N(R) ₂ , OC(O)R, CX ₃ , CN, N(R)C(O)R, N( H)C(O)R, N(R)S(O) ₂ R, N(H)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(H)C( O)N(R) ₂ , N(H)C(O)N(H)(R), N(R)C(S)N(R) ₂ , N(H)C(S)N(R) ₂ , N(H)C(S)N(H)(R), C(R)N(R) ₂ C(O)OR, carbocycle and heterocycle.

In certain embodiments, Q is OH.

In certain embodiments, Q is a substituted or unsubstituted 5-10 membered heteroaryl, e.g., Q is imidazole, pyrimidine, purine, 2-amino-1,9-dihydro-6H-purin-6-one-9-yl ( or guanine-9-yl), adenine-9-yl, cytosin-1-yl or uracil-1-yl. In certain embodiments, Q is a substituted 5-14 membered heterocycloalkyl, eg, substituted with one or more substituents selected from oxo (=O), OH, amino, and C _1-3 alkyl. For example, Q is 4-methylpiperazinyl, 4-(4-methoxybenzyl)piperazinyl, or isoindolin-2-yl-1,3-dione.

In certain embodiments, Q is unsubstituted or substituted C ₆₁₀ aryl (such as phenyl) or C ₃₆ cycloalkyl.

In some embodiments, n is 1. In other embodiments, n is 2. In additional embodiments, n is 3. In certain other embodiments, n is 4. For example, R ₄ may be (CH2) ₂ OH. For example, R ₄ may be (CH ₂ ) ₃ OH. For example, R ₄ may be (CH ₂ ) ₄ OH. For example, R ₄ may be benzyl. For example, R ₄ may be 4-methoxybenzyl.

In some embodiments, R ₄ is a C ₃₆ carbocycle. In some embodiments, R ₄ is C ₃₆ cycloalkyl. For example, R ₄ may be cyclohexyl optionally substituted with, for example, OH, halogen, C ₁₆ alkyl, etc. For example, R ₄ may be 2-hydroxycyclohexyl.

In some embodiments, R is H.

In some embodiments, R is unsubstituted C ₁₃ alkyl or unsubstituted C ₂₃ alkenyl. For example, R ₄ may be CH ₂ CH(OH)CH ₃ or CH ₂ CH(OH)CH ₂ CH ₃ .

In some embodiments, R is a substituted C ₁₃ alkyl, eg CH ₂ OH. For example, R ₄ may be CH ₂ CH(OH)CH ₂ OH.

In some embodiments, R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle. In some embodiments, R ₂ and R ₃ together with the atom to which they are attached form a 5-14 membered aromatic or non-aromatic heterocycle having one or more heteroatoms selected from N, O, S, and P. In some embodiments, R ₂ and R ₃ together with the atom to which they are attached form an optionally substituted C ₃₂₀ carbocycle (eg C ₃₁₈ carbocycle, C ₃₁₅ carbocycle, C ₃₁₂ carbocycle or C ₃₁₀ carbocycle), aromatic or non-aromatic. In some embodiments, R ₂ and R ₃ together with the atom to which they are attached form a C ₃₆ carbocycle. In other embodiments, R ₂ and R ₃ together with the atom to which they are attached form a C ₆ carbocycle, such as a cyclohexyl or phenyl group. In certain embodiments, the heterocycle or C ₃₆ carbocycle is substituted with one or more alkyl groups (eg, on the same ring atom or on adjacent or non-adjacent ring atoms). For example, R ₂ and R ₃ together with the atom to which they are attached may form a cyclohexyl or phenyl group bearing one or more C ₅ alkyl substituents. In certain embodiments, the heterocycle or C ₃₆ carbocycle formed by R ₂ and R ₃ is substituted with carbocyclic groups. For example, R ₂ and R ₃ together with the atom to which they are attached may form a cyclohexyl or phenyl group substituted with cyclohexyl. In some embodiments, R ₂ and R ₃ together with the atom to which they are attached form a C ₇₁₅ carbocycle, such as a cycloheptyl, cyclopentadecanyl, or naphthyl group.

In some embodiments, R ₄ is selected from (CH ₂ ) _n Q and (CH ₂ ) _n CHQR. In some embodiments, Q is selected from the group consisting of OR, OH, O(CH ₂ ) _n N(R) ₂ , OC(O)R, CX ₃ , CN, N(R)C(O)R, N( H)C(O)R, N(R)S(O) ₂ R, N(H)S(O) ₂ R, N(R)C(O)N(R) ₂ , N(H)C( O)N(R) ₂ , N(H)C(O)N(H)(R), N(R)C(S)N(R) ₂ , N(H)C(S)N(R) ₂ , N(H)C(S)N(H)(R) and heterocycle. In other embodiments, Q is selected from the group consisting of imidazole, pyrimidine, and purine.

In some embodiments, R ₂ and R ₃ together with the atom to which they are attached form a heterocycle or carbocycle. In some embodiments, R ₂ and R ₃ together with the atom to which they are attached form a C ₃₆ carbocycle, such as a phenyl group. In certain embodiments, the heterocycle or C ₃₆ carbocycle is substituted with one or more alkyl groups (eg, on the same ring atom or on adjacent or non-adjacent ring atoms). For example, R ₂ and R ₃ together with the atom to which they are attached may form a phenyl group bearing one or more C ₅ alkyl substituents.

In some embodiments of the pharmaceutical compositions of the present invention, the compound of formula (I) is selected from the group consisting of:

and salts or stereoisomers.

In other embodiments, the compound of formula (I) is selected from the group consisting of compounds 1-232, or salts or stereoisomers thereof.

In some embodiments, ionizable lipids are provided that contain a central piperazine moiety. The lipids described herein can advantageously be used in lipid nanoparticulate compositions to deliver therapeutic and/or prophylactic agents to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, lipid compounds disclosed herein have lower immunogenicity than a reference lipid (eg, MC3, KC2, or DLinDMA). For example, a formulation containing a lipid disclosed herein and a therapeutic or prophylactic agent has an increased therapeutic index compared to a corresponding formulation that contains a reference lipid (eg, MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.

In some embodiments, the delivery vehicle comprises a lipid compound of formula (III):

or its salts or stereoisomers, where:

или

ring A is

or

t is 1 or 2;

each of A ₁ and A ₂ is independently selected from CH or N;

Z represents CH ₂ or is absent, while if Z represents CH ₂ then each of the dotted lines (1) and (2) represents a single bond; and if Z is absent, then both dashed lines (1) and (2) are absent;

R ₁ , R ₂ , R ₃ , R ₄ and R ₅ are independently selected from the group consisting of C _5-20 alkyl, C _5-20 alkenyl, -R''MR', -R*YR'', -YR'' and -R*OR'';

each M is independently selected from the group consisting of C(O)O, OC(O), OC(O)O, C(O)N(R'), N(R')C(O), C(O) , C(S), C(S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , an aryl group and a heteroaryl group;

X ¹ , X ² and X ³ are independently selected from the group consisting of bond, CH ₂ , (CH ₂ ) ₂ -, CHR, CHY, C(O), C(O)O, OC(O), -C( O) -CH ₂ -, -CH ₂ -C (O) -, C (O) O-CH ₂ , OS (O) -CH ₂ , CH ₂ -C (O) O, CH ₂ -OS (O) , CH(OH), C(S) and CH(SH);

each Y is independently a C _3-6 carbocycle;

each R* is independently selected from the group consisting of C _1-12 alkyl and C ₂₁₂ alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl and C _3-6 carbocycle;

each R' is independently selected from the group consisting of C _1-12 alkyl, C _2-12 alkenyl and H; And

each R'' is independently selected from the group consisting of C _3-12 alkyl and C ₃₁₂ alkenyl,

то:where if ring A is

That:

i) at least one of X ¹ , X ² and X ³ is not —CH ₂ — and/or

ii) at least one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is -R''MR'.

In some embodiments, the compound is a compound of any of formulas (IIIa1)-(IIIa6):

или

or

The compounds of formula (III) or any of the formulas (IIIa1)-(IIIa6) contain, as appropriate, one or more of the following features.

In some embodiments, Ring A is

In some embodiments, Ring A is

или

or

In some embodiments, Ring A is

In some embodiments, Ring A is

In some embodiments, Ring A is

In some embodiments, Ring A is

при этом атом N в кольце соединен с X².

while the N atom in the ring is connected to X ² .

In some embodiments, Z is CH ₂ .

In some embodiments, Z is absent.

In some embodiments, at least one of A ₁ and A ₂ is N.

In some embodiments, each of A ₁ and A ₂ is N.

In some embodiments, each of A ₁ and A ₂ is CH.

In some embodiments, A ₁ is N and A ₂ is CH.

In some embodiments, A ₁ is CH and A ₂ is N.

In some embodiments, at least one of X ¹ , X ² and X ³ is not —CH ₂ —. For example, in certain embodiments, X ¹ is not -CH ₂ -. In some embodiments, at least one of X ¹ , X ² and X ³ is -C(O)-.

In some embodiments, X ² is -C(O)-, -C(O)O, OC(O), -C(O)-CH ₂ -, -CH ₂ -C(O)-, C(O )O-CH ₂ , OS(O)-CH ₂ , CH ₂ -C(O)O or CH ₂ -OC(O).

In some embodiments, X ³ is -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH ₂ -, -CH ₂ -C(O)-, C(O)O-CH ₂ , OS(O)-CH ₂ , CH ₂ -C(O)O or CH ₂ -OC(O).

In other embodiments, X ³ is -CH ₂ -.

In some embodiments, X ³ is a bond or -(CH ₂ ) ₂ -.

In some embodiments, R ₁ and R ₂ are the same. In certain embodiments, R ₁ , R ₂ and R ₃ are the same. In some embodiments, R ₄ and R ₅ are the same. In certain embodiments, R ₁ , R ₂ , R ₃ , R ₄ and R ₅ are the same.

In some embodiments, at least one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is -R''MR'. In some embodiments, no more than one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is -R''MR'. For example, at least one of R ₁ , R ₂ and R ₃ may be -R''MR', and/or at least one of R ₄ and R ₅ is -R''MR'. In certain embodiments, at least one M is -C(O)O-. In some embodiments, each M is -C(O)O-. In some embodiments, at least one M is -OC(O)-. In some embodiments, each M is -OC(O)-. In some embodiments, at least one M is -OC(O)O-. In some embodiments, each M is -OC(O)O-. In some embodiments, at least one R'' is C ₃ alkyl. In certain embodiments, each R'' is C ₃ alkyl. In some embodiments, at least one R'' is C ₅ alkyl. In certain embodiments, each R'' is C ₅ alkyl. In some embodiments, at least one R'' is C ₆ alkyl. In certain embodiments, each R'' is C ₆ alkyl. In some embodiments, at least one R'' is C ₇ alkyl. In certain embodiments, each R'' is C ₇ alkyl. In some embodiments, at least one R' is C ₅ alkyl. In certain embodiments, each R' is C ₅ alkyl. In other embodiments, at least one R' is C ₁ alkyl. In certain embodiments, each R' is C ₁ alkyl. In some embodiments, at least one R' is C ₂ alkyl. In certain embodiments, each R' is C ₂ alkyl.

In some embodiments, at least one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is C ₁₂ alkyl. In certain embodiments, each of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is C ₁₂ alkyl.

In certain embodiments, the compound is selected from the group consisting of:

In some embodiments, the delivery vehicle contains compound 236.

In some embodiments, the delivery vehicle contains a compound of formula (IV):

or its salt or stereoisomer, where:

each of A ₁ and A ₂ is independently selected from CH or N, and at least one of A ₁ and A ₂ is N;

Z represents CH ₂ or is absent, while if Z represents CH ₂ then each of the dotted lines (1) and (2) represents a single bond; and if Z is absent, then both dashed lines (1) and (2) are absent;

R ₁ , R ₂ , R ₃ , R ₄ and R ₅ are independently selected from the group consisting of C ₆₂₀ alkyl and C _6-20 alkenyl;

то:where if ring A is

That:

i) R ₁ , R ₂ , R ₃ , R ₄ and R ₅ are the same and R ₁ is not C ₁₂ alkyl, C ₁₈ alkyl or C ₁₈ alkenyl;

ii) only one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is selected from C _6-20 alkenyl;

iii) at least one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ has a different number of carbon atoms than at least one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ ;

iv) R ₁ , R ₂ and R ₃ are selected from C _6-20 alkenyl and R ₄ and R ₅ are selected from C _6-20 alkyl; or

v) R ₁ , R ₂ and R ₃ are selected from C _6-20 alkyl and R ₄ and R ₅ are selected from C _6-20 alkenyl.

In some embodiments, the compound is a compound of formula (IVa):

The compounds of formula (IV) or (IVa) contain, as appropriate, one or more of the following features.

In some embodiments, Z is CH ₂ .

In some embodiments, Z is absent.

In some embodiments, at least one of A ₁ and A ₂ is N.

In some embodiments, each of A ₁ and A ₂ is N.

In some embodiments, each of A ₁ and A ₂ is CH.

In some embodiments, A ₁ is N and A ₂ is CH.

In some embodiments, A ₁ is CH and A ₂ is N.

In some embodiments, R ₁ , R ₂ , R ₃ , R ₄ and R ₅ are the same and are not C ₁₂ alkyl, C ₁₈ alkyl, or C ₁₈ alkenyl. In some embodiments, R ₁ , R ₂ , R ₃ , R ₄ and R ₅ are the same and are C ₉ alkyl or C ₁₄ alkyl.

In some embodiments, only one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is selected from C _6-20 alkenyl. In some such embodiments, R ₁ , R ₂ , R ₃ , R ₄ and R ₅ have the same number of carbon atoms. In some embodiments, R ₄ is selected from C _5-20 alkenyl. For example, R ₄ may be C ₁₂ alkenyl or C ₁₈ alkenyl.

In some embodiments, at least one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ has a different number of carbon atoms compared to at least one other of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ .

In certain embodiments, R ₁ , R ₂ and R ₃ are selected from C _6-20 alkenyl and R ₄ and R ₅ are selected from C _6-20 alkyl. In other embodiments, R ₁ , R ₂ and R ₃ are selected from C _6-20 alkyl and R ₄ and R ₅ are selected from C _6-20 alkenyl. In some embodiments, R ₁ , R ₂ and R ₃ have the same number of carbon atoms, and/or R ₄ and R ₅ have the same number of carbon atoms. For example, R ₁ , R ₂ and R ₃ or R ₄ and R ₅ may have 6, 8, 9, 12, 14 or 18 carbon atoms. In some embodiments, R ₁ , R ₂ and R ₃ or R ₄ and R ₅ are C ₁₈ alkenyl (eg, linoleyl). In some embodiments, R ₁ , R ₂ and R ₃ or R ₄ and R ₅ are alkyl groups containing 6, 8, 9, 12 or 14 carbon atoms.

In some embodiments, R ₁ has a different number of carbon atoms than R ₂ , R ₃ , R ₄ and R ₅ . In other embodiments, R ₃ has a different number of carbon atoms than R ₁ , R ₂ , R ₄ and R ₅ . In additional embodiments, R ₄ has a different number of carbon atoms compared to R ₁ , R ₂ , R ₃ and R ₅ .

In some embodiments, the compound is selected from the group consisting of:

In other embodiments, the delivery vehicle comprises a compound of formula (V):

or its salts or stereoisomers, in which:

And ₃ represents CH or N;

A ₄ is CH ₂ or NH; and at least one of A ₃ and A ₄ is N or NH;

Z represents CH ₂ or is absent, while if Z represents CH ₂ then each of the dotted lines (1) and (2) represents a single bond; and if Z is absent, then both dashed lines (1) and (2) are absent;

R ₁ , R ₂ and R ₃ are independently selected from the group consisting of C _5-20 alkyl, C _5-20 alkenyl, -R''MR', -R*YR'', -YR'' and -R*OR '';

each M is independently selected from C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C(S) S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , aryl group and heteroaryl group;

X ¹ and X ² are independently selected from the group consisting of CH ₂ , (CH ₂ ) ₂ , CHR, CHY, C(O), C(O)O, OS(O), -C(O)-CH ₂ - , -CH ₂ -C (O) -, C (O) OCH ₂ , OS (O) CH ₂ , CH ₂ -C (O) O, CH ₂ OS (O), CH (OH), C (S) and CH(SH);

each Y is independently a C _3-6 carbocycle;

each R* is independently selected from the group consisting of C _1-12 alkyl and C ₂₁₂ alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl and C _3-6 carbocycle;

each R' is independently selected from the group consisting of C _1-12 alkyl, C _2-12 alkenyl and H; And

each R'' is independently selected from the group consisting of C _3-12 alkyl and C ₃₁₂ alkenyl.

In some embodiments, the compound is a compound of formula (Va):

The compounds of formula (V) or (Va) contain, as appropriate, one or more of the following features.

In some embodiments, Z is CH ₂ .

In some embodiments, Z is absent.

In some embodiments, at least one of A ₃ and A ₄ is N or NH.

In some embodiments, A ₃ is N and A ₄ is NH.

In some embodiments, A ₃ is N and A ₄ is CH ₂ .

In some embodiments, A ₃ is CH and A ₄ is NH.

In some embodiments, at least one of X ¹ and X ² is not —CH ₂ —. For example, in certain embodiments, X ¹ is not -CH ₂ -. In some embodiments, at least one of X ¹ and X ² is -C(O)-.

In some embodiments, X ² is -C(O)-, C(O)O, OC(O), -C(O)-CH ₂ -, -CH ₂ -C(O)-, C(O) O-CH ₂ , OS(O)-CH ₂ , CH ₂ -C(O)O or CH ₂ -OC(O).

In some embodiments, R ₁ , R ₂ and R ₃ are independently selected from the group consisting of C _5-20 alkyl and C _5-20 alkenyl. In some embodiments, R ₁ , R ₂ and R ₃ are the same. In certain embodiments, R ₁ , R ₂ and R ₃ are C ₆ , C ₉ , C ₁₂ or C ₁₄ alkyl. In other embodiments, R ₁ , R ₂ and R ₃ are C ₁₈ alkenyl. For example, R ₁ , R ₂ and R ₃ may be linoleyl.

In some embodiments, the compound is selected from the group consisting of:

In other embodiments, the delivery vehicle comprises a compound of formula (VI):

or its salts or stereoisomers, in which:

each of A ₆ and A ₇ is independently selected from CH or N, where at least one of A ₆ and A ₇ is N;

Z represents CH ₂ or is absent, while if Z represents CH ₂ then each of the dotted lines (1) and (2) represents a single bond; and if Z is absent, then both dashed lines (1) and (2) are absent;

X ⁴ and X ⁵ are independently selected from the group consisting of -CH ₂ -, -(CH ₂ ) ₂ -, CHR, CHY, C(O), C(O)O, OC(O), -C(O) -CH ₂ -, -CH ₂ -C (O) -, C (O) OCH ₂ , OS (O) -CH ₂ , CH ₂ -C (O) O, CH ₂ -OS (O), CH (OH ), C(S) and CH(SH);

each of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is independently selected from the group consisting of C _5-20 alkyl, C _5-20 alkenyl, -R''MR', -R*YR'', - YR'' and -R*OR'';

each M is independently selected from the group consisting of C(O)O, OC(O), C(O)N(R'), N(R')C(O), C(O), C(S), C(S)S, SC(S), CH(OH), P(O)(OR')O, S(O) ₂ , an aryl group and a heteroaryl group;

each Y is independently a C _3-6 carbocycle;

each R* is independently selected from the group consisting of C _1-12 alkyl and C ₂₁₂ alkenyl;

each R is independently selected from the group consisting of C _1-3 alkyl and C _3-6 carbocycle;

each R' is independently selected from the group consisting of C _1-12 alkyl, C _2-12 alkenyl and H; And

each R'' is independently selected from the group consisting of C _3-12 alkyl and C ₃₁₂ alkenyl.

In some embodiments, each of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is independently selected from the group consisting of C _6-20 alkyl and C _6-20 alkenyl.

In some embodiments, R ₁ and R ₂ are the same. In certain embodiments, R ₁ , R ₂ and R ₃ are the same. In some embodiments, R ₄ and R ₅ are the same. In certain embodiments, R ₁ , R ₂ , R ₃ , R ₄ and R ₅ are the same.

In some embodiments, at least one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is C _9-12 alkyl. In certain embodiments, each of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is independently C ₉ , C ₁₂ or C ₁₄ alkyl. In certain embodiments, each of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is C ₉ alkyl.

In some embodiments, A ₆ is N and A ₇ is N. In some embodiments, A ₆ is CH and A ₇ is N.

In some embodiments, X ⁴ is -CH ₂ - and X ⁵ is -C(O)-. In some embodiments, X ⁴ and X ⁵ are -C(O)-.

In some embodiments, if A ₆ is N and A ₇ is N, then at least one of X ⁴ and X ⁵ is not -CH ₂ -, for example, at least one of X ⁴ and X ⁵ is a -C (O) -. In some embodiments, if A ₆ is N and A ₇ is N, then at least one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is -R''MR'.

In some embodiments, at least one of R ₁ , R ₂ , R ₃ , R ₄ and R ₅ is not -R''MR'.

In some embodiments, the connection is

In other embodiments, the delivery vehicle contains a compound of the following formula:

The amine moieties of the lipid compounds disclosed herein may be protonated under certain conditions. For example, the central amine moiety of a lipid of formula (I) is typically protonated (ie, positively charged) at a pH below the pKa of the amino moiety and is essentially uncharged at a pH above the pKa. Such lipids may be referred to as ionizable aminolipids.

In one specific embodiment, the ionizable amino lipid is compound 18. In another embodiment, the ionizable amino lipid is compound 236.

In some embodiments, the amount of ionizable amino lipid, for example, a compound of formula (I), is in the range of about 1 mol% to 99 mol% in the lipid composition.

In one embodiment, the amount of ionizable amino lipid, e.g., a compound of formula (I), is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 , 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 , 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 , 91, 92, 93, 94, 95, 96, 97, 98 or 99 mol% in the lipid composition.

In one embodiment, the amount of ionizable aminolipid, e.g., a compound of formula (I), is in the range of about 30 mol% to about 70 mol%, about 35 mol% to about 65 mol%, about 40 mol% to about 60 mol%. % and from about 45 mol% to about 55 mol% in the lipid composition.

In one particular embodiment, the amount of ionizable amino lipid, eg, a compound of formula (I), is about 50 mole % in the lipid composition.

In addition to the ionizable amino lipid disclosed herein, for example, a compound of formula (I), the lipid composition in the pharmaceutical compositions disclosed herein may contain additional components such as phospholipids, structural lipids, PEG lipids, and any combination thereof. .

b. Additional components in the lipid composition

(i) Phospholipids

The lipid composition in the pharmaceutical composition disclosed herein may contain one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids, or a combination thereof. Typically, phospholipids contain a phospholipid moiety and one or more fatty acid moieties.

The phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

The fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidonic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid and docosahexaenoic acid.

Certain phospholipids can facilitate membrane fusion. For example, a cationic phospholipid may interact with one or more negatively charged phospholipids of a membrane (eg, cell or intracellular membrane). Fusion of the phospholipid to the membrane may allow one or more elements (eg, therapeutic agent) of the lipid-containing composition (eg, LNP) to pass through the membrane, allowing, for example, delivery of one or more elements to the target tissue.

Non-natural phospholipid molecules are also contemplated, including natural molecules having modifications and substitutions, including branching, oxidation, cyclization, and alkylation. For example, the phospholipid may be functionalized with or linked to one or more alkynes (eg, an alkenyl group in which one or more double bonds are replaced by a triple bond). Under suitable reaction conditions, the alkyne group may undergo a copper-catalyzed cycloaddition upon contact with an azide. Such reactions may be useful in functionalizing the lipid bilayer of the nanoparticulate composition to facilitate membrane penetration or cellular recognition, or in conjugating the nanoparticulate composition to a useful component such as a targeting or imaging moiety (eg, a dye).

Phospholipids include, without limitation, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidylglycerols, and phosphatidic acids. Phospholipids also include a phosphosphingolipid such as sphingomyelin.

Examples of phospholipids include, without limitation, the following:

In certain embodiments, the implementation of the phospholipid applicable or potentially applicable in the present invention is an analog or variant of DSPC. In certain embodiments, the implementation of the phospholipid applicable or potentially applicable in the present invention is a compound of formula (IX):

or its salt, where:

each R ¹ is independently optionally substituted alkyl; or two R ¹ are optionally connected to each other via intermediate atoms to form an optionally substituted monocyclic carbocyclyl or an optionally substituted monocyclic heterocyclyl; or three R ¹ are optionally connected to each other via intermediate atoms to form an optionally substituted bicyclic carbocyclyl or an optionally substituted bicyclic heterocyclyl;

n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;

m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

или

;A has the formula

or

;

L ² is independently in each occurrence a bond or an optionally substituted C _1-6 alkylene, where one methylene unit of the optionally substituted C _1-6 alkylene is optionally substituted with O, N(R ^N ), S, C(O), C(O) N(R ^N ), NR ^N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R ^N ), NR ^N C(O)O or NR ^N C(O)N(R ^N );

R2 is independently at each occurrence optionally substituted C _1-30 alkyl, optionally substituted C _1-30 alkenyl, or optionally substituted C _1-30 alkynyl; where one or more methylene units R ² optionally independently replaced by optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R ^N ), O, S, C(O), C(O)N(R ^N ), NR ^N C(O), NR ^N C(O)N(R ^N ), С(O)O, OC(O), OC(O)O, OC(O)N(R ^N ), NR ^N C(O)O, C(O)S, SC(O), C(=NR ^N ), C(=NR ^N )N(R ^N ), NR ^N C(=NR ^N ), NR ^N C(= NR ^N )N(R ^N ), C(S), C(S)N(R ^N ), NR ^N C(S), NR ^N C(S)N(R ^N ), S(O), OS( O), S(O)O, OS(O)O, OS(O) ₂ , S(O) ₂ O, OS(O) ₂ O, N(R ^N )S(O), S(O)N (R ^N ), N(R ^N )S(O)N(R ^N ), OS(O)N(R ^N ), N(R ^N )S(O)O, S(O) ₂ , N(R ^N )S(O) ₂ , S(O) ₂ N(R ^N ), N(R ^N )S(O) ₂ N(R ^N ), OS(O) ₂ N(R ^N ) or N(R ^N )S(O) ₂ O;

^RN at each occurrence is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; And

p is 1 or 2;

provided that the compound does not have the following formula:

where R ² at each occurrence is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.

Phospholipid head modifications

In certain embodiments, the implementation of the phospholipid applicable or potentially applicable in the present invention contains a modified head of the phospholipid (for example, a modified choline group). In certain embodiments, the head-modified phospholipid is DSPC or a modified quaternary amine analogue thereof. For example, in embodiments of formula (IX), at least one R ¹ is not methyl. In certain embodiments, at least one R ¹ is not hydrogen or methyl. In certain embodiments, the compound of formula (IX) is a compound of one of the following formulas:

or its salt, where:

each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;

each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; And

each v is independently 1, 2, or 3.

In certain embodiments, the compound of formula (IX) is a compound of one of the following formulas:

or its salt.

In certain embodiments, the compound of formula (IX) is one of the following compounds:

or its salt.

In certain embodiments, a compound of formula (IX) is a compound of formula (IX-a):

or its salt.

In certain embodiments, the phospholipids useful or potentially useful in the present invention contain a modified core. In certain embodiments, the core-modified phospholipid described herein is DSPC or its equivalent with a modified core structure. For example, in certain embodiments of formula (IX-a), group A does not have the following formula:

In certain embodiments, the compound of formula (IX-a) is a compound of one of the following formulas:

or its salt.

In certain embodiments, the compound of formula (IX) is one of the following compounds:

or their salts.

In certain embodiments, the implementation of the phospholipid applicable or potentially applicable in the present invention contains a cyclic fragment instead of a glyceride fragment. In certain embodiments, the phospholipid useful in the present invention is DSPC or an analogue thereof with a cyclic moiety instead of a glyceride moiety. In certain embodiments, a compound of formula (IX) is a compound of formula (IX-b):

or its salt.

In certain embodiments, a compound of formula (IX-b) is a compound of formula (IX-b-1):

or its salt, where:

w is 0, 1, 2, or 3.

In certain embodiments, a compound of formula (IX-b) is a compound of formula (IX-b-2):

or its salt.

In certain embodiments, a compound of formula (IX-b) is a compound of formula (IX-b-3):

or its salt.

In certain embodiments, a compound of formula (IX-b) is a compound of formula (IX-b-4):

or its salt.

In certain embodiments, the compound of formula (IX-b) is one of the following compounds:

or their salts.

Phospholipid Tail Modifications

In certain embodiments, the implementation of the phospholipid applicable or potentially applicable in the present invention contains a modified tail. In certain embodiments, the implementation of the phospholipid applicable or potentially applicable in the present invention is DSPC or its equivalent with a modified tail. The "modified tail" described herein may be a tail with shorter or longer aliphatic chains, aliphatic chains with introduced substituents, aliphatic chains in which one or more methylene groups are replaced by cyclic or heteroatomic groups, or any combination of them. For example, in certain embodiments, compound (IX) is a compound of formula (IX-a) or a salt thereof, where R ² in at least one occurrence or R ² in each occurrence is an optionally substituted C _1-30 alkyl, where one or more methylene units R ² are independently replaced by optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R ^N ), O, S, C(O), C(O)N(R ^N ), NR ^N C(O), NR ^N C(O)N(R ^N ), С(O)O, OS(O), OS(O)O, OC(O)N(R ^N ), NR ^N C(O )O, C(O)S, SC(O), C(=NR ^N ), C(=NR ^N )N(R ^N ), NR ^N C(=NR ^N ), NR ^N C(=NR ^N ) N(R ^N ), C(S), C(S)N(R ^N ), NR ^N C(S), NR ^N C(S)N(R ^N ), S(O), OS(O), S(O)O, OS(O)O, OS(O) ₂ , S(O) ₂ O, OS(O) ₂ O, N(R ^N )S(O), S(O)N(R ^N ), N(R ^N )S(O)N(R ^N ), OS(O)N(R ^N ), N(R ^N )S(O)O, S(O) ₂ , N(R ^N )S (O) ₂ , S(O) ₂ N(R ^N ), N(R ^N )S(O) ₂ N(R ^N ), OS(O) ₂ N(R ^N ) or N(R ^N )S( O) _2O .

In certain embodiments, a compound of formula (IX) is a compound of formula (IX-c):

or its salt, where:

each x is independently an integer from 0 to 30 inclusive; And

G is at each occurrence independently selected from the group consisting of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R ^N ), O, S, C(O), C(O)N(R ^N ), NR ^N C(O), NR ^N C(O)N(R ^N ), С(O)O, OC(O), OC(O)O, OC(O)N(R ^N ), NR ^N C(O)O, C(O)S, SC(O), C(=NR ^N ), C(=NR ^N )N(R ^N ), NR ^N C(=NR ^N ), NR ^N C(= NR ^N )N(R ^N ), C(S), C(S)N(R ^N ), NR ^N C(S), NR ^N C(S)N(R ^N ), S(O), OS( O), S(O)O, OS(O)O, OS(O) ₂ , S(O) ₂ O, OS(O) ₂ O, N(R ^N )S(O), S(O)N (R ^N ), N(R ^N )S(O)N(R ^N ), OS(O)N(R ^N ), N(R ^N )S(O)O, S(O) ₂ , N(R ^N )S(O) ₂ , S(O) ₂ N(R ^N ), N(R ^N )S(O) ₂ N(R ^N ), OS(O) ₂ N(R ^N ) or N(R ^N )S(O) ₂ O. Each option is a separate embodiment of the present invention.

In certain embodiments, a compound of formula (IX-c) is a compound of formula (IX-c-1):

or its salt, where:

v is independently 1, 2, or 3 in each case.

In certain embodiments, a compound of formula (IX-c) is a compound of formula (IX-c-2):

or its salt.

In certain embodiments, a compound of formula (IX-c) is a compound of the following formula:

or its salt.

In certain embodiments, the compound of formula (IX-c) is the following compound:

or its salt.

In certain embodiments, a compound of formula (IX-c) is a compound of formula (IX-c-3):

or its salt.

In certain embodiments, a compound of formula (IX-c) is a compound of the following formula:

or its salt.

In certain embodiments, the compound of formula (IX-c) is the following compound:

or its salt.

In certain embodiments, the phospholipid useful or potentially useful in the present invention contains a modified phosphocholine moiety, wherein the alkyl chain connecting the quaternary amine to the phosphoryl group is not ethylene (eg, n is not 2). Therefore, in certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of formula (IX) wherein n is 1, 3, 4, 5, 6, 7, 8, 9, or 10. For example, in certain embodiments implementation of the compound of formula (IX) is a compound of one of the following formulas:

or its salt.

In certain embodiments, the compound of formula (IX) is one of the following compounds:

or their salts.

Alternative lipids

In certain embodiments, an alternative lipid is used in place of the phospholipid of the present invention. Non-limiting examples of such alternative lipids include the following compounds:

(ii) Structural lipids

The lipid composition in the pharmaceutical composition disclosed herein may contain one or more structural lipids. Used in this document, the term "structural lipid" refers to sterols, as well as lipids containing sterol fragments.

The inclusion of structural lipids in the composition of a lipid nanoparticle can help reduce the aggregation of other lipids in the particle. Structural lipids may be selected from the group including, without limitation, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, "sterols" are a subgroup of steroids consisting of steroidal alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is a cholesterol analogue. In certain embodiments, the structural lipid is alpha-tocopherol. Examples of structural lipids include, without limitation, the following compounds:

In one embodiment, the amount of a structural lipid (e.g., a sterol, such as cholesterol) in the lipid composition of a pharmaceutical composition disclosed herein is in the range of about 20 mol% to about 60 mol%, about 25 mol% to about 55 mol%, from about 30 mol% to about 50 mol%, or from about 35 mol% to about 45 mol%.

In one embodiment, the amount of structural lipid (e.g., a sterol, such as cholesterol) in the lipid composition disclosed herein is in the range of about 25 mole% to about 30 mole%, about 30 mole% to about 35 mole%, or from about 35 mol% to about 40 mol%.

In one embodiment, the amount of a structural lipid (eg, a sterol such as cholesterol) in the lipid composition disclosed herein is about 24 mole %, about 29 mole %, about 34 mole %, or about 39 mole %.

In some embodiments, the amount of structural lipid (e.g., a sterol such as cholesterol) in the lipid composition disclosed herein is at least about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 mol%.

(iii) Polyethylene glycol (PEG) modified lipids

The lipid composition in the pharmaceutical composition disclosed herein may contain one or more polyethylene glycol (PEG) modified lipids.

As used herein, the term "PEG lipid" refers to lipids modified with polyethylene glycol (PEG). Non-limiting examples of PEG lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (eg, PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1,2-diacyloxypropane-3-amines. Such lipids are also referred to as pegylated lipids. For example, the PEG lipid may be a PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

In some embodiments, the PEG lipid includes, without limitation, 1,2-dimyristoyl-sn-glycerol-methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] ( PEG-DSPE), PEG-distearylglycerol (PEG-DSG), dipalmitoleyl-PEG, dioleyl-PEG, distearyl-PEG, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEC-1,2- dimyristyloxypropyl-3-amine (PEG-c-DMA).

In one embodiment, the PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof.

In some embodiments, the lipid fragment of PEG lipid fragments having a length of from about C ₁₄ to about C ₂₂ , preferably from about C ₁₄ to about C ₁₆ . In some embodiments, the implementation of the PEG fragment, for example, mPEG-NH ₂ has a size of approximately 1000, 2000, 5000, 10000, 15000 or 20000 daltons. In one embodiment, the PEG lipid is PEG _2k -DMG.

In one embodiment, the lipid nanoparticles described herein may contain a PEG lipid, which is a non-diffusible PEG. Non-limiting examples of non-diffusing PEGs include PEG-DSG and PEG-DSPE.

PEG lipids are known in the art, such as those described in US Pat. No. 8,158,601 and International Publication No. WO 2015/130584 A2, which are incorporated herein by reference in their entirety.

In general, some of the other lipid components (e.g., PEG lipids) of various formulas described herein can be synthesized as described in International Patent Application No. PCT/US 2016/000129, filed December 10, 2016, titled " Compositions and Methods for Delivery of Therapeutic Agents", which is incorporated by reference in its entirety.

The lipid component of the lipid nanoparticle composition may include one or more polyethylene glycol-containing molecules, such as PEG or PEG-modified lipids. Such molecules may otherwise be referred to as pegylated lipids. PEG lipid is a lipid modified with polyethylene glycol. The PEG lipid may be selected from a non-limiting group including PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, the PEG lipid may be a PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

In some embodiments, the PEG-modified lipids are a modified form of PEG-DMG. PEG-DMG has the following structure:

In one embodiment, the PEG lipids useful in the present invention may be the pegylated lipids described in International Application Publication No. WO 2012099755, the contents of which are incorporated herein by reference in its entirety. Any such exemplary PEG lipids described herein may be modified to contain a hydroxyl group in the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a "PEG-OH lipid" (also referred to herein as a "hydroxy-pegylated lipid") is a pegylated lipid having one or more hydroxyl (-OH) groups in the lipid. In certain embodiments, the PEG-OH lipid contains one or more hydroxyl groups in the PEG chain. In certain embodiments, the PEG-OH- or hydroxy-pegylated lipid contains a -OH group at the end of the PEG chain. Each possible option is a separate embodiment of the present invention.

In certain embodiments, the PEG lipid useful in the present invention is a compound of formula (VII). This document provides compounds of formula (VII):

or their salts, where:

R ³ is -OR ^O ;

R ^O is hydrogen, optionally substituted alkyl, or an oxygen protecting group;

r is an integer from 1 to 100 inclusive;

L ¹ is an optionally substituted C _1-10 alkylene, wherein at least one methylene of the optionally substituted C _1-10 alkylene is independently replaced by an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, O, N(R ^N ) , S, C(O), C(O)N(R ^N ), NR ^N C(O), C(O)O, OS(O), OS(O)O, OC(O)N(R ^N ), NR ^N C(O)O or NR ^N C(O)N(R ^N );

D is a click chemistry fragment or a physiologically cleavable fragment;

m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

или

;A has the formula

or

;

L ² is independently at each occurrence a bond or an optionally substituted C _1-6 alkylene, where one methylene unit of the optionally substituted C _1-6 alkylene is optionally substituted with O, N(R ^N ), S, C(O), C(O) N(R ^N ), NR ^N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R ^N ), NR ^N C(O)O or NR ^N C(O)N(R ^N );

R ² at each occurrence is independently an optionally substituted C _1-30 alkyl, an optionally substituted C _1-30 alkenyl, or an optionally substituted C _1-30 alkynyl; where one or more methylene units R ² optionally independently replaced by optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R ^N ), O, S, C(O), C(O)N(R ^N ), NR ^N C(O), NR ^N C(O)N(R ^N ), С(O)O, OC(O), OC(O)O, OC(O)N(R ^N ), NR ^N C(O)O, C(O)S, SC(O), C(=NR ^N ), C(=NR ^N )N(R ^N ), NR ^N C(=NR ^N ), NR ^N C(= NR ^N )N(R ^N ), C(S), C(S)N(R ^N ), NR ^N C(S), NR ^N C(S)N(R ^N ), S(O), OS( O), S(O)O, OS(O)O, OS(O) ₂ , S(O) ₂ O, OS(O) ₂ O, N(R ^N )S(O), S(O)N (R ^N ), N(R ^N )S(O)N(R ^N ), OS(O)N(R ^N ), N(R ^N )S(O)O, S(O) ₂ , N(R ^N )S(O) ₂ , S(O) ₂ N(R ^N ), N(R ^N )S(O) ₂ N(R ^N ), OS(O) ₂ N(R ^N ) or N(R ^N )S(O) ₂ O;

^RN at each occurrence is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; And

p is 1 or 2.

In certain embodiments, the compound of formula (VII) is a PEG-OH lipid (ie, R ³ is -OR ^O and R ^O is hydrogen). In certain embodiments, a compound of formula (VII) is a compound of formula (VII-OH):

or its salt.

In certain embodiments, D is a click chemistry moiety (eg, triazole). In certain embodiments, a compound of formula (VII) is a compound of formula (VII-a-1) or (VII-a-2):

or its salt.

In certain embodiments, a compound of formula (VII)

is a compound of one of the following formulas:

or its salt, where

s is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

In certain embodiments, the compound of formula (VII) is a compound of one of the following formulas:

or its salt.

In certain embodiments, the compound of formula (VII) is a compound of one of the following formulas:

or its salt.

In certain embodiments, the compound of formula (VII) is a compound of one of the following formulas:

or its salt.

In certain embodiments, D is a physiologically cleavable moiety (eg, ester, amide, carbonate, carbamate, urea). In certain embodiments, a compound of formula (VII) is a compound of formula (VII-b-1) or (VII-b-2):

or its salt.

In certain embodiments, a compound of formula (VII) is a compound of formula (VII-b-1-OH) or (VII-b-2-OH):

or its salt.

In certain embodiments, the compound of formula (VII) is a compound of one of the following formulas:

or its salt.

In certain embodiments, the compound of formula (VII) is a compound of one of the following formulas:

or its salt.

In certain embodiments, the compound of formula (VII) is a compound of one of the following formulas:

or its salt.

In certain embodiments, the compound of formula (VII) is a compound of one of the following formulas:

or its salt.

In certain embodiments, the PEG lipid useful in the present invention is a pegylated fatty acid. In certain embodiments, the PEG lipid useful in the present invention is a compound of formula (VIII). Provided herein are compounds of formula (VIII):

or their salts, where:

R ³ is -OR ^O ;

R ^O is hydrogen, optionally substituted alkyl, or an oxygen protecting group;

r is an integer from 1 to 100 inclusive;

R ⁵ is optionally substituted C _10-40 alkyl, optionally substituted C _10-40 alkenyl, or optionally substituted C _10-40 alkynyl; and one or more methylene groups R ⁵ optionally replaced by optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R ^N ), O, S, C(O), C(O)N(R ^N ) , NR ^N C(O), NR ^N C(O)N(R ^N ), С(O)O, OC(O), OC(O)O, OC(O)N(R ^N ), NR ^N C (O)O, C(O)S, SC(O), C(=NR ^N ), C(=NR ^N )N(R ^N ), NR ^N C(=NR ^N ), NR ^N C(=NR ^N )N(R ^N ), C(S), C(S)N(R ^N ), NR ^N C(S), NR ^N C(S)N(R ^N ), S(O), OS(O ), S(O)O, OS(O)O, OS(O) ₂ , S(O) ₂ O, OS(O) ₂ O, N(R ^N )S(O), S(O)N( R ^N ), N(R ^N )S(O)N(R ^N ), OS(O)N(R ^N ), N(R ^N )S(O)O, S(O) ₂ , N(R ^N )S(O) ₂ , S(O) ₂ N(R ^N ), N(R ^N )S(O) ₂ N(R ^N ), OS(O) ₂ N(R ^N ) or N(R ^N ) S(O) ₂ O; And

R ^N is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group at each occurrence.

In certain embodiments, a compound of formula (VIII) is a compound of formula (VIII-OH):

or its salt. In some embodiments, r is 45.

In certain embodiments, the compound of formula (VIII) is a compound of one of the following formulas:

or its salt. In some embodiments, r is 45.

In several other embodiments, the compound of formula (VIII) is

or its salt.

In one embodiment, the compound of formula (VIII) is

In one embodiment, the amount of PEG lipid in the lipid composition of the pharmaceutical composition disclosed herein ranges from about 0.1 mol% to about 5 mol%, from about 0.5 mol% to about 5 mol%, from about 1 mol% to about 5 mol%, from about 1.5 mol% to about 5 mol%, from about 2 mol% to about 5 mol%, from about 0.1 mol% to about 4 mol%, from about 0.5 mol% to about 4 mol%, from about 1 mol% to about 4 mol%, from about 1.5 mol% to about 4 mol%, from about 2 mol% to about 4 mol%, from about 0, 1 mol% to about 3 mol%, from about 0.5 mol% to about 3 mol%, from about 1 mol% to about 3 mol%, from about 1.5 mol% to about 3 mol%, from about 2 mol % to about 3 mol%, from about 0.1 mol% to about 2 mol%, from about 0.5 mol% to about 2 mol%, from about 1 mol% to about 2 mol%, from about 1.5 mol % to about 2 mol%, from about 0.1 mol% to about 1.5 mol%, from about 0.5 mol% to about 1.5 mol%, or from about 1 mol% to about 1.5 mol%.

In one embodiment, the amount of PEG lipid in the lipid composition disclosed herein is about 2 mol%. In one embodiment, the amount of PEG lipid in the lipid composition disclosed herein is about 1.5 mol%.

In one embodiment, the amount of PEG lipid in the lipid composition disclosed herein is at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2, 1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3, 4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4, 7, 4.8, 4.9 or 5 mol%.

In some aspects, the lipid composition of the pharmaceutical compositions disclosed herein does not contain a PEG lipid.

(iv) Other ionizable aminolipids

The lipid composition in the pharmaceutical composition disclosed herein may contain one or more ionizable amino lipids in addition to the lipid of formula (I), (III), (IV), (V) or (VI).

Ionizable lipids may be selected from the non-limiting group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl -1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraazaoctatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2- dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA) , 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), (13Z,165Z) -N,N-dimethyl-3-nonyldocose-13-16-dien-1-amine (L608), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)- N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[( 3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA (2R)) and (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z ,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA (2S)). In addition to these, the ionizable amino lipid may also be a lipid containing a cyclic amino group.

Ionizable lipids may also be the compounds disclosed in International Application Publication No. WO 2017/075531 A1, incorporated herein by reference in its entirety. For example, ionizable aminolipids include, without limitation:

as well as any combination of them.

Ionizable lipids may also be the compounds disclosed in International Application Publication No. WO 2015/199952 A1, incorporated herein by reference in its entirety. For example, ionizable aminolipids include, without limitation:

as well as any combination of them.

(v) Other components of the lipid composition

The lipid composition in the pharmaceutical composition disclosed herein may contain one or more components in addition to those described above. For example, the lipid composition may contain one or more penetration enhancers, carbohydrates, polymers, surface modifying agents (eg, surfactants), or other components. For example, the permeability enhancing molecule may be the molecule described in US Patent Application Publication No. 2005/0222064. Carbohydrates may include simple sugars (eg glucose) and polysaccharides (eg glycogen and its derivatives and analogs).

The polymer can be incorporated into a pharmaceutical composition disclosed herein (eg, a lipid nanoparticulate pharmaceutical composition) and/or used to encapsulate or partially encapsulate it. The polymer may be biodegradable and/or biocompatible. The polymer may be selected without limitation from polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.

The ratio of lipid composition to polynucleotide can range from about 10:1 to about 60:1 (w/w).

In some embodiments, the ratio of lipid composition to polynucleotide may be approximately 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19: 1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44: 1, 45:1, 46:1, 47:1, 48:1, 49:1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1 or 60:1 (w/w). In some embodiments, the ratio of lipid composition to therapeutic agent-encoding polynucleotide is about 20:1 or about 15:1 w/w.

In one embodiment, the lipid nanoparticles described herein may contain polynucleotides (e.g., mRNA) at a lipid:polynucleotide weight ratio of 5:1, 10:1, 15:1, 20:1, 25:1, 30: 1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1, or 70:1, or between any of these ratios, such as, but not limited to, 5:1 to about 10:1, about 5:1 to about 15:1, about 5:1 to about 20:1, about 5:1 to about 25:1, about 5:1 to about 30:1, from about 5:1 to about 35:1, about 5:1 to about 40:1, about 5:1 to about 45:1, about 5:1 to about 50:1, about 5:1 to about 55 :1, about 5:1 to about 60:1, about 5:1 to about 70:1, about 10:1 to about 15:1, about 10:1 to about 20:1, from about 10 :1 to about 25:1, about 10:1 to about 30:1, about 10:1 to about 35:1, about 10:1 to about 40:1, about 10:1 to about 45: 1, from about 10:1 to about 50:1, from about 10:1 to about 55:1, from about 10:1 to about 60:1, from about 10:1 to about 70:1, from about 15: 1 to about 20:1, about 15:1 to about 25:1, about 15:1 to about 30:1, about 15:1 to about 35:1, about 15:1 to about 40:1 , about 15:1 to about 45:1, about 15:1 to about 50:1, about 15:1 to about 55:1, about 15:1 to about 60:1, or about 15:1 up to about 70:1.

In one embodiment, the lipid nanoparticles described herein may contain a polynucleotide at a concentration of from about 0.1 mg/mL to 2 mg/mL, such as, but not limited to, 0.1 mg/mL, 0.2 mg/mL , 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, 1.0 mg/ml, 1.1 mg/ml, 1.2 mg/ml, 1.3 mg/ml, 1.4 mg/ml, 1.5 mg/ml, 1.6 mg/ml, 1 .7 mg/ml, 1.8 mg/ml, 1.9 mg/ml, 2.0 mg/ml or more than 2.0 mg/ml.

(vi) Compositions based on nanoparticles

In some embodiments, the pharmaceutical compositions disclosed herein are formulated as lipid nanoparticles (LNPs). Accordingly, the present invention also provides nanoparticulate compositions comprising (i) a lipid composition containing a delivery agent, such as a compound of formula (I) or (III) described herein, and (ii) a polynucleotide encoding a relaxin polypeptide. In such a nanoparticulate composition, the lipid composition disclosed herein can encapsulate a polynucleotide encoding a relaxin polypeptide.

Compositions based on nanoparticles, as a rule, have dimensions of the order of micrometers or less and may contain a lipid bilayer. Nanoparticle-based compositions include lipid nanoparticles (LNPs), liposomes (eg, lipid vesicles), and lipoplexes. For example, the nanoparticulate composition may be a liposome having a lipid bilayer with a diameter of 500 nm or less.

Nanoparticle-based compositions include, for example, lipid nanoparticles (LNPs), liposomes, and lipoplexes. In some embodiments, the nanoparticulate compositions are vesicles containing one or more lipid bilayers. In certain embodiments, the nanoparticulate composition comprises two or more concentric bilayers separated by aqueous compartments. Lipid bilayers may be functionalized and/or cross-linked with each other. Lipid bilayers may contain one or more ligands, proteins or channels.

In some embodiments, the implementation of the composition based on nanoparticles according to the present invention contain at least one compound of formula (I), (III), (IV), (V) or (VI). For example, the nanoparticulate composition may contain one or more of compounds 1-147 or one or more of compounds 1-342. Compositions based on nanoparticles may also contain a number of other components. For example, the nanoparticulate composition may contain one or more other lipids in addition to the lipid of formula (I), (III), (IV), (V) or (VI), such as (i) at least one phospholipid, ( ii) at least one structural lipid, (iii) at least one PEG lipid, or (iv) any combination thereof. Inclusion of a structural lipid may be optional, for example, if lipids of formula III are used in the compositions based on lipid nanoparticles according to the present invention.

In some embodiments, the nanoparticulate composition comprises a compound of formula (I) (eg, compounds 18, 25, 26, or 48). In some embodiments, the nanoparticulate composition comprises a compound of formula (I) (eg, compounds 18, 25, 26, or 48) and a phospholipid (eg, DSPC).

In some embodiments, the implementation of the composition based on nanoparticles contains a compound of formula (III) (for example, compound 236). In some embodiments, the nanoparticulate composition comprises a compound of formula (III) (eg, compound 236) and a phospholipid (eg, DOPE or DSPC).

In some embodiments, the nanoparticulate composition comprises a lipid composition consisting of, or essentially consisting of, a compound of formula (I) (eg, compounds 18, 25, 26, or 48). In some embodiments, the nanoparticulate composition comprises a lipid composition consisting of, or essentially consisting of, a compound of formula (I) (eg, compounds 18, 25, 26, or 48) and a phospholipid (eg, DSPC).

In some embodiments, the implementation of the composition based on nanoparticles contains a lipid composition consisting of a compound of formula (III) (for example, compound 236) or consisting essentially of it. In some embodiments, the nanoparticulate composition comprises a lipid composition consisting of, or essentially consisting of, a compound of formula (III) (eg, compound 236) and a phospholipid (eg, DOPE or DSPC).

In one embodiment, the lipid nanoparticle contains an ionizable lipid, a structural lipid, a phospholipid, and mRNA. In some embodiments, the LNP contains an ionizable lipid, a PEG-modified lipid, a sterol, and a structural lipid. In some embodiments, the LNP has a molar ratio of about 20-60% ionizable lipid: about 5-25% structural lipid: about 25-55% sterol: and about 0.5-15% PEG-modified lipid. In some embodiments, the LNP has a molar ratio of about 50% ionizable lipid, about 1.5% PEG-modified lipid, about 38.5% cholesterol, and about 10% structural lipid. In some embodiments, the LNP has a molar ratio of about 55% ionizable lipid, about 2.5% PEG lipid, about 32.5% cholesterol, and about 10% structural lipid. In some embodiments, the ionizable lipid is an ionizable lipid and the structural lipid is a neutral lipid and the sterol is cholesterol. In some embodiments, the LNP has a molar ratio of 50:38.5:10:1.5 corresponding to ionizable lipid: cholesterol: DSPC: PEG lipid. In some embodiments, the ionizable lipid is compound 18 or compound 236 and the PEG lipid is compound 428.

In some embodiments, the LNP has a molar ratio of 50:38.5:10:1.5, corresponding to compound 18:phospholipid:cholesterol:compound 428. In some embodiments, the LNP has a molar ratio of 50:38.5:10:1 ,5 corresponding to compound 18 : DSPC : cholesterol : compound 428.

In some embodiments, LNP has a molar ratio of 50:38.5:10:1.5 corresponding to compound 236:phospholipid:cholesterol:compound 428. In some embodiments, LNP has a molar ratio of 50:38.5:10:1 ,5 corresponding to compound 236: DSPC: cholesterol: compound 428.

In some embodiments, the LNP has a polydispersity index of less than 0.4. In some embodiments, the LNP has a net neutral charge at neutral pH. In some embodiments, the implementation of the LNP has an average diameter of 50-150 nm. In some embodiments, the implementation of the LNP has an average diameter of 80-100 nm.

As generally defined herein, the term "lipid" refers to a small molecule having hydrophobic or amphiphilic properties. Lipids can be natural or synthetic. Examples of lipid classes include, without limitation, fats, waxes, sterol-containing metabolites, vitamins, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, and polyketides, and prenol lipids. In some cases, the amphiphilic properties of some lipids lead to the formation of liposomes, vesicles or membranes in aqueous media.

In some embodiments, the lipid nanoparticle (LNP) may contain an ionizable lipid. As used herein, the term "ionizable lipid" has its usual meaning in the art and may refer to a lipid containing one or more charged moieties. In some embodiments, the ionizable lipid may be positively charged or negatively charged. The ionizable lipid may be positively charged, in which case it may be referred to as a "cationic lipid". In certain embodiments, the ionizable lipid molecule may contain an amino group and may be referred to as an ionizable amino lipid. As used herein, a "charged moiety" is a chemical moiety that carries a formal electronic charge, such as monovalent (+1 or -1), divalent (+2 or -2), trivalent (+3 or -3), and etc. The charged moiety can be anionic (ie negatively charged) or cationic (ie positively charged). Examples of positively charged moieties include amino groups (eg, primary, secondary and/or tertiary amines), ammonium groups, pyridinium group, guanidine groups, and imidazolium groups. In a specific embodiment, the charged fragments contain amino groups. Examples of negatively charged groups or precursors thereof include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like. The charge of a charged fragment may in some cases vary depending on environmental conditions, for example, as a result of changes in pH, the charge of the fragment may change and/or the fragment may become charged or uncharged. As a rule, the charge density of a molecule can be chosen arbitrarily.

It should be understood that the terms "charged" or "charged moiety" do not refer to "partial negative charge" or "partial positive charge" on the molecule. The terms "partial negative charge" and "partial positive charge" are given in their usual meaning in this field. "Partial negative charge" can occur when a functional group contains a bond that becomes polarized, so the electron density shifts to one atom forming the bond, creating a partial negative charge on the atom. Those skilled in the art will generally recognize bonds that can become polarized in this manner.

In some embodiments, the ionizable lipid is an ionizable amino lipid, sometimes referred to in the art as an "ionizable cationic lipid". In one embodiment, the ionizable amino lipid may have a positively charged hydrophilic head and a hydrophobic tail that are connected via a linker structure.

In addition to these, the ionizable lipid may also be a lipid containing a cyclic amino group.

In one embodiment, the ionizable lipid may be selected without limitation from the ionizable lipid described in International Application Publication Nos. WO 2013086354 and WO 2013116126; the contents of each of which are incorporated herein by reference in their entirety.

In yet another embodiment, the ionizable lipid can be selected without limitation from the formulas CLI-CLXXXXII of US patent No. 7404969; which is incorporated herein by reference in its entirety.

In one embodiment, the lipid may be a cleavable lipid, such as the lipids described in International Publication No. WO 2012170889, incorporated herein by reference in its entirety. In one embodiment, the lipid can be synthesized using methods known in the art and/or as described in International Application Publication No. WO 2013086354; the contents of which are incorporated herein by reference in their entirety.

The characteristics of the compositions based on nanoparticles can be obtained using a number of methods. For example, microscopy (eg, transmission electron microscopy or scanning electron microscopy) can be used to study the morphological characteristics and size distribution of the nanoparticle composition. Zeta potentials can be measured using dynamic light scattering or potentiometry (eg, potentiometric titration procedures). Dynamic light scattering can also be used to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure several characteristics of a nanoparticle composition such as particle size, polydispersity index and zeta potential.

In some embodiments, the nanoparticulate composition comprises a lipid composition consisting of, or essentially consisting of, a compound of formula (I) (eg, compounds 18, 25, 26, or 48). In some embodiments, the nanoparticulate composition comprises a lipid composition consisting of, or essentially consisting of, a compound of formula (I) (eg, compounds 18, 25, 26, or 48) and a phospholipid (eg, DSPC or MSPC).

The characteristics of the compositions based on nanoparticles can be obtained using a number of methods. For example, microscopy (eg, transmission electron microscopy or scanning electron microscopy) can be used to study the morphological characteristics and size distribution of the nanoparticle composition. Zeta potentials can be measured using dynamic light scattering or potentiometry (eg, potentiometric titration procedures). Dynamic light scattering can also be used to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure several characteristics of a nanoparticle composition such as particle size, polydispersity index and zeta potential.

The size of the nanoparticles may help counteract biological responses such as, but not limited to, inflammation, or may enhance the biological effect of the polynucleotide.

As used herein, "size" or "average size" in relation to compositions based on nanoparticles refers to the average diameter in the composition based on nanoparticles.

In one embodiment, a polynucleotide encoding a relaxin polypeptide is formulated into lipid nanoparticles having a diameter of from about 10 to about 100 nm, such as, without limitation, from about 10 to about 20 nm, from about 10 to about 30 nm, from about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, from about 20 to about 40 nm, from about 20 to about 50 nm, from about 20 to about 60 nm, from about 20 to about 70 nm, from about 20 to about 80 nm, from about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm , from about 30 to about 90 nm, from about 30 to about 100 nm, from about 40 to about 50 nm, from about 40 to about 60 nm, from about 40 to about 70 nm, from about 40 to about 80 nm, from about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm, about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, from about 60 to about 70 nm, from about 60 to about 80 nm, from about 60 to about 90 nm, from about 60 to about 100 nm, from about 70 to about 80 nm, from about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm, and/or about 90 to about 100 nm.

In one embodiment, the nanoparticles have a diameter ranging from about 10 to 500 nm. In one embodiment, the nanoparticle has a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm , more than 650 nm, more than 700 nm, more than 750 nm, more than 800 nm, more than 850 nm, more than 900 nm, more than 950 nm or more than 1000 nm.

In some embodiments, the largest size in the nanoparticle composition is 1 µm or less (e.g., 1 µm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm or less).

The nanoparticle-based composition can be relatively homogeneous. To indicate the uniformity of the composition based on nanoparticles, for example, the distribution of particle sizes in the composition based on nanoparticles, you can use the coefficient of polydispersity. A small (eg, less than 0.3) polydispersity coefficient usually indicates a narrow particle size distribution. The nanoparticle composition may have a polydispersity index of from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0 .08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20 , 0.21, 0.22, 0.23, 0.24 or 0.25. In some embodiments, the polydispersity index of the nanoparticulate composition disclosed herein may be from about 0.10 to about 0.20.

The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential may describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable because higher charge molecules may have undesirable interactions with cells, tissues and other elements in the body. In some embodiments, the zeta potential of the nanoparticle composition disclosed herein may be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about -10 mV to about +10 mV, approximately -10 mV to approximately +5 mV, approximately -10 mV to approximately 0 mV, approximately -10 mV to approximately -5 mV, approximately -5 mV to approximately +20 mV, approximately -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to approximately +15 mV, approximately 0 mV to approximately +10 mV, approximately 0 mV to approximately +5 mV, approximately +5 mV to approximately +20 mV, approximately +5 mV to approximately +15 mV, or from about +5 mV to about +10 mV.

In some embodiments, the zeta potential of the lipid nanoparticles can be from about 0 mV to about 100 mV, from about 0 mV to about 90 mV, from about 0 mV to about 80 mV, from about 0 mV to about 70 mV, from about 0 mV to about 60 mV, about 0 mV to about 50 mV, about 0 mV to about 40 mV, about 0 mV to about 30 mV, about 0 mV to about 20 mV, about 0 mV to about 10 mV , from about 10 mV to about 100 mV, from about 10 mV to about 90 mV, from about 10 mV to about 80 mV, from about 10 mV to about 70 mV, from about 10 mV to about 60 mV, from about 10 mV up to about 50 mV, from about 10 mV to about 40 mV, from about 10 mV to about 30 mV, from about 10 mV to about 20 mV, from about 20 mV to about 100 mV, from about 20 mV to about 90 mV, from about 20 mV to about 80 mV, from about 20 mV to about 70 mV, from about 20 mV to about 60 mV, from about 20 mV to about 50 mV, from about 20 mV to about 40 mV, from about 20 mV to about 30 mV, from about 30 mV to about 100 mV, from about 30 mV to about 90 mV, from about 30 mV to about 80 mV, from about 30 mV to about 70 mV, from about 30 mV to about 60 mV, from about 30 mV to about 50 mV, about 30 mV to about 40 mV, about 40 mV to about 100 mV, about 40 mV to about 90 mV, about 40 mV to about 80 mV, about 40 mV to about 70 mV, from about 40 mV to about 60 mV, and from about 40 mV to about 50 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be from about 10 mV to about 50 mV, from about 15 mV to about 45 mV, from about 20 mV to about 40 mV, and from about 25 mV to about 35 mV. In some embodiments, the zeta potential of the lipid nanoparticles may be about 10 mV, about 20 mV, about 30 mV, about 40 mV, about 50 mV, about 60 mV, about 70 mV, about 80 mV, about 90 mV, and about 100 mV. .

The term "encapsulation efficiency" of a polynucleotide describes the amount of polynucleotide encapsulated in or otherwise associated with the nanoparticulate composition after preparation relative to the amount originally intended. As used herein, "encapsulation" may refer to complete, substantial, or partial separation, confinement, surrounding, or packaging.

Desirably, the encapsulation efficiency is high (eg close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of polynucleotide in a solution containing a nanoparticulate composition before and after disintegration of the nanoparticle composition with one or more organic solvents or detergents.

Fluorescence can be used to measure the amount of free polynucleotide in solution. For the nanoparticulate compositions described herein, the polynucleotide encapsulation efficiency can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

The amount of a polynucleotide present in a pharmaceutical composition disclosed herein may depend on several factors such as the size of the polynucleotide, the desired purpose and/or use, or other properties of the nanoparticulate composition, as well as the properties of the polynucleotide.

For example, the amount of mRNA usable in a nanoparticle composition may depend on the size (expressed as length or molecular weight), sequence, and other characteristics of the mRNA. The relative amounts of polynucleotide in the nanoparticle composition can also vary.

The relative amounts of the lipid composition and the polynucleotide present in the lipid nanoparticle composition of the present invention can be optimized for efficiency and tolerability considerations. For compositions containing mRNA as a polynucleotide, the N:P ratio may serve as an applicable metric.

Because the N:P ratio in a nanoparticulate composition regulates both expression and tolerance, nanoparticulate compositions with low N:P ratios and strong expression are desirable. The N:P ratios vary depending on the ratio of lipids and RNA in the composition based on nanoparticles.

Generally, a lower N:P ratio is preferred. One or more of the RNAs, lipids, and amounts thereof may be selected to provide an N:P ratio of from about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6: 1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1 or 30:1. In certain embodiments, the N:P ratio may be from about 2:1 to about 8:1. In other embodiments, the N:P ratio is from about 5:1 to about 8:1. In certain embodiments, the N:P ratio is between 5:1 and 6:1. In one particular aspect, the N:P ratio is about 5.67:1.

In addition to the provided nanoparticle compositions, the present invention also provides methods for producing lipid nanoparticles that involve the encapsulation of a polynucleotide. Such a method involves using any of the pharmaceutical compositions disclosed herein and obtaining lipid nanoparticles in accordance with methods for producing lipid nanoparticles known in the art. See, for example, Wang et al. (2015) "Delivery of oligonucleotides with lipid nanoparticles". Adv. drug deliv. Rev. 87:68-80; Silva et al. (2015) "Delivery Systems for Biopharmaceuticals. Part I: Nanoparticles and Microparticles", Curr. Pharm. Technol. 16:940-954; Naseri et al. (2015) "Solid Lipid Nanoparticles and Nano structured Lipid Carriers: Structure, Preparation and Application", Adv. Pharm. Bull. 5:305-13; Silva et al. (2015) "Lipid nanoparticles for the delivery of biopharmaceuticals", Curr. Pharm. Biotechnol. 16:291-302, and the literary sources cited therein.

Other means of delivery

A. Liposomes, lipoplexes and lipid nanoparticles

In some embodiments, the compositions or formulations of the present invention comprise a delivery vehicle, such as a liposome, lipoplexes, lipid nanoparticle, or any combination thereof. The polynucleotides described herein (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide) can be formulated using one or more liposomes, lipoplexes, or lipid nanoparticles. Liposomes, lipoplexes, or lipid nanoparticles can be used to improve the efficiency of polynucleotide-driven protein production, since such formulations can increase the level of cell transfection with the polynucleotide and/or increase the level of translation of the encoded protein. Liposomes, lipoplexes or lipid nanoparticles can also be used to increase the stability of polynucleotides.

Liposomes are artificially produced vesicles which may consist primarily of a lipid bilayer and may be used as a delivery vehicle for the administration of pharmaceutical formulations. Liposomes can be of various sizes. A multilayer vesicle (MLV) may be several hundred nanometers in diameter and may contain a number of concentric bilayers separated by narrow aqueous compartments. A small unilamellar vesicle (SUV) may be less than 50 nm in diameter and a large unilamellar vesicle (LUV) may be 50-500 nm in diameter. The structure of the liposomes may contain, without limitation, opsonins or ligands to improve the attachment of liposomes to diseased tissue or to activate processes such as, but not limited to, endocytosis. Liposomes may have a low or high pH to improve the delivery of pharmaceutical formulations.

Formation of liposomes may depend on the entrapped pharmaceutical formulation and ingredients of the liposomes, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and its potential toxicity, any additional modes involved in the application and/or delivery of the vesicles, the optimum size, polydispersity, and timing. the suitability of the vesicles for the intended use, as well as batch-to-batch reproducibility and scale-up production of safe and effective liposome products, etc.

As a non-limiting example, liposomes, such as synthetic membrane vesicles, can be prepared using the methods, apparatus, and devices described in US Patent Application Publication Nos. US 30177633 20130183375, US 20130183373 and US 20130183372. In some embodiments, the polynucleotides described herein may be encapsulated in a liposome, and/or they may be contained in an aqueous core, which may then be encapsulated in a liposome, as described, for example, in publications international applications nos. WO 2012031046, WO 2012031043, WO 2012030901, WO 2012006378 and WO 2013086526; and in US Patent Application Publication Nos. US 20130189351, US 20130195969, and US 20130202684. Each of the references is incorporated herein by reference in its entirety.

In some embodiments, the polynucleotides described herein can be formulated in an oil-in-water cationic emulsion, where the emulsion particle contains an oil core and a cationic lipid that can interact with the polynucleotide to anchor the molecule in the emulsion particle. In some embodiments, the polynucleotides described herein can be formulated in a water-in-oil emulsion containing a continuous hydrophobic phase in which the hydrophilic phase is dispersed. Exemplary emulsions can be prepared using the methods described in International Application Publication Nos. WO 2012006380 and WO 201087791, each of which is incorporated herein by reference in its entirety.

In some embodiments, the polynucleotides described herein may be formulated in a lipid-polycation complex. Formation of a lipid-polycation complex can be achieved using the methods described, for example, in US Patent Application Publication No. US 20120178702. As a non-limiting example, a polycation can include a cationic peptide or polypeptide such as, but not limited to, polylysine, polyornithine and/or polyarginine and the cationic peptides described in International Application Publication No. WO 2012013326 or US Patent Application Publication No. US 20130142818. Each of the literature references is incorporated herein by reference in its entirety.

In some embodiments, the polynucleotides described herein may be formulated into a lipid nanoparticle (LNP), such as those described in International Application Publication Nos. WO 2013123523, WO 2012170930, WO 2011127255 and WO 2008103276; and US Patent Application Publication No. US 20130171646, each of which is incorporated herein by reference in its entirety.

Lipid nanoparticle formulations typically contain one or more lipids. In some embodiments, the implementation of the lipid is a cationic or ionizable lipid. In some embodiments, the nanoparticulate lipid formulations further comprise other components, including a phospholipid, a structural lipid, a quaternary amino compound, and a molecule capable of reducing particle aggregation, such as PEG or a PEG-modified lipid.

Cationic and ionizable lipids may include those described, for example, in International Application Publication Nos. WO 2015199952, WO 2015130584, WO 2015011633, and WO 2012040184, WO 2013126803, WO 2011153120, WO 201 1149733, WO 2011090965, WO 2011043913, WO 2011022460, WO 2012061259, WO 2012054365, WO 2012044638, WO 2010080724, WO 201021865, WO 2008103276 and WO 2013086373; US Pat. Nos. 7,893,302, 7,404,969, 8,283,333, and 8,466,122; as well as US Patent Application Publication Nos. US 20110224447, US 20120295832, US 20150315112, US 20100036115, US 20120202871, US 20130064894, US 20130129785, US 20130150625 , US 20130178541, US 20130123338 and US 20130225836, each of which is incorporated herein by links in their entirety. In some embodiments, the amount of cationic and ionizable lipids in the lipid composition ranges from about 0.01 mol% to about 99 mol%.

Exemplary ionizable lipids include, without limitation, any of compounds 1-147 disclosed herein: DLin-MC3-DMA (MC3), DLin-DMA, DLenDMA, DLin-D-DMA, DLin-K-DMA, DLin-M-C2 -DMA, DLin-K-DMA, DLin-KC2-DMA, DLin-KC3-DMA, DLin-KC4-DMA, DLin-C2K-DMA, DLin-MP-DMA, DODMA, 98N12-5, C12-200, DLin -C-DAP, DLin-DAC, DLinDAP, DLinAP, DLin-EG-DMA, DLin-2-DMAP, KL10, KL22, KL25, octyl-CLinDMA, octyl-CLinDMA (2R), octyl-CLinDMA (2S) and any their combination. Other exemplary ionizable lipids include: (13Z, 16Z)-N,N-dimethyl-3-nonyldocose-13,16-diene-1-amine (L608), (20Z,23Z)-N,N-dimethylnonacose-20,23 -diene-10-amine, (17Z,20Z)-N,N-dimethylhexacose-17,20-diene-9-amine, (16Z,19Z)-N5N-dimethylpentacose-16,19-diene-8-amine, ( 13Z,16Z)-N,N-dimethyldocose-13,16-dien-5-amine, (12Z,15Z)-N,N-dimethylgeneicose-12,15-dien-4-amine, (14Z,17Z)-N ,N-dimethyltricose-14,17-diene-6-amine, (15Z,18Z)-N,N-dimethyltetracose-15,18-diene-7-amine, (18Z,21Z)-N,N-dimethylheptacose-18 ,21-diene-10-amine, (15Z,18Z)-N,N-dimethyltetracose-15,18-diene-5-amine, (14Z,17Z)-N,N-dimethyltricose-14,17-diene-4 -amine, (19Z,22Z)-N,N-dimethyloctacose-19,22-diene-9-amine, (18Z,21Z)-N,N-dimethylheptacose-18,21-diene-8-amine, (17Z, 20Z)-N,N-dimethylhexacose-17,20-diene-7-amine, (16Z,19Z)-N,N-dimethylpentacose-16,19-diene-6-amine, (22Z,25Z)-N,N -dimethylhentriaconta-22,25-diene-10-amine, (21Z,24Z)-N,N-dimethyltriaconta-21,24-diene-9-amine, (18Z)-N,N-dimethylheptacose-18-ene-10 -amine, (17Z)-N,N-dimethylhexacose-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacose-19,22-diene-7-amine, N,N-dimethylheptacosan-10 -amine, (20Z,23Z)-N-ethyl-N-methylnonacose-20,23-dien-10-amine, 1-[(11Z,14Z)-1-nonyleucose-11,14-dien-1-yl] pyrrolidine, (20Z)-N,N-dimethylheptacose-20-en-10-amine, (15Z)-N,N-dimethylheptacose-15-en-10-amine, (14Z)-N,N-dimethylnonacose-14- en-10-amine, (17Z)-N,N-dimethylnonacose-17-en-10-amine, (24Z)-N,N-dimethyltritriacont-24-en-10-amine, (20Z)-N,N- dimethylnonacose-20-en-10-amine, (22Z)-N,N-dimethylgentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacose-16-en-8-amine, (12Z,15Z )-N,N-dimethyl-2-nonylgeneicosa-12,15-dien-1-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine, 1-[ (1S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan-10-amine, N,N- dimethyl-21-[(1S,2R)-2-octylcyclopropyl]geneicosan-10-amine, N,N-dimethyl-1-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl] methyl}cyclopropyl]nonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(1R,2S)-2- undecylcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3-{7-[(1S,2R)-2-octylcyclopropyl]heptyl}dodecan-1-amine, 1-[(1R,2S)-2-heptylcyclopropyl ]-N,N-dimethyloctadecan-9-amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6-amine, N,N-dimethyl-1-[(1S,2R) -2-octylcyclopropyl]pentadecan-8-amine, R-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, S-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, 1-{2-[(9Z,12Z) -octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}pyrrolidine, (2S)-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9.12 -dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy]propan-2-amine,

1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}azetidine,

(2S)-1-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2S)-1-( heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(nonyloxy)-3- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine,

N,N-dimethyl-1-[(9Z)-octadec-9-en-1-yloxy]-3-(octyloxy)propan-2-amine;

(2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)-octadeca-6,9,12-trien-1-yloxy]-3-(octyloxy)propan-2-amine, (2S) -1-[(11Z,14Z)-eicosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine, (2S)-1-(hexyloxy)- 3-[(11Z,14Z)-eicosa-11,14-dien-1-yloxy]-N,N-dimethylpropan-2-amine, 1-[(11Z,14Z)-eicosa-11,14-diene-1 -yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-N,N-dimethyl-3 -(octyloxy)propan-2-amine, (2S)-1-[(13Z,16Z)-docose-13,16-dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2- amine, (2S)-1-[(13Z)-docose-13-en-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, 1-[(13Z)-docose-13 -en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3 -(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(1-methyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy] propane-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy] propane-2-amine, N,N-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]octyl }oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2-octylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine and (11E,20Z,23Z)- N,N-dimethylnonacose-11,20,2-trien-10-amine; and any combination thereof.

Phospholipids include, without limitation, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidylglycerols, and phosphatidic acids. Phospholipids also include a phosphosphingolipid such as sphingomyelin. In some embodiments, the phospholipids are DLPC, DMPC, DOPC, DPPC, DSPC, DUPC, diester PC 18:0, DLnPC, DAPC, DHAPC, DOPE, 4ME-PE 16:0, DSPE, DLPE, DLnPE, DAPE, DHAPE , DOPG and any combination thereof. In some embodiments, the phospholipids are MPPC, MSPC, PMPC, PSPC, SMPC, SPPC, DHAPE, DOPG, and any combination thereof. In some embodiments, the amount of phospholipids (eg, DSPC) in the lipid composition ranges from about 1 mol% to about 20 mol%.

Structural lipids include sterols and lipids containing sterol moieties. In some embodiments, structural lipids include cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the implementation of the amount of structural lipids (eg, cholesterol) in the lipid composition is in the range from about 20 mol% to about 60 mol%.

PEG-modified lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (eg, PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1,2-diacyloxypropane-3-amines. Such lipids are also referred to as pegylated lipids. For example, the PEG lipid may be a PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid. In some embodiments, the PEG lipid is 1,2-dimyristoyl-sn-glycerol-methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG -DSPE), PEG-distearylglycerol (PEG-DSG), dipalmitoleyl-PEG, dioleyl-PEG, distearyl-PEG, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristyloxypropyl -3-amine (PEG-c-DMA). In some embodiments, the PEG fragment has a size of approximately 1000, 2000, 5000, 10000, 15000 or 20000 daltons. In some embodiments, the amount of PEG lipid in the lipid composition ranges from about 0.1 mol% to about 5 mol%.

In some embodiments, the LNP formulations described herein may further comprise a permeability enhancing molecule. Non-limiting examples of permeation enhancing molecules are described in US Patent Application Publication No. US 20050222064, incorporated herein by reference in its entirety.

Compositions based on LNP may additionally contain a phosphate conjugate. The phosphate conjugate can increase in vivo circulation time in the blood and/or increase the efficiency of targeted delivery of the nanoparticle. Phosphate conjugates can be prepared using the methods described, for example, in International Application Publication No. WO 2013033438 or US Patent Application Publication No. US 20130196948. US Patent Application Publication Nos. US 20130059360, US 20130196948, and US 20130072709. Each of the references is incorporated herein by reference in its entirety.

LNP-based formulations may contain a conjugate to enhance delivery of the nanoparticles of the present invention to a subject. In addition, the conjugate can inhibit the phagocytic clearance of nanoparticles in a subject. In some embodiments, the conjugate may be a "self" peptide constructed from the human CD47 membrane protein (e.g., "self" particles described in Rodriguez et al, Science 2013 339, 971-975, incorporated herein by reference in its entirety. completeness). As shown by Rodriguez et al., self-peptides delayed macrophage-mediated clearance of nanoparticles, which increased nanoparticle delivery.

LNP-based formulations may contain a carbohydrate carrier. As a non-limiting example, a carbohydrate carrier may include, but is not limited to, anhydride-modified phytoglycogen or glycogen-type material, phytoglycogenoctenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin (e.g., International Application Publication No. WO 2012109121, incorporated herein by reference in its entirety).

LNP formulations can be coated with a surfactant or polymer to improve particle delivery. In some embodiments, LNPs may be coated with a hydrophilic coating, such as, but not limited to, PEG-based coatings and/or coatings having a neutral surface charge, as described in U.S. Patent Application Publication No. US 20130183244, incorporated herein by reference in its entirety. completeness.

LNP-based formulations can be designed to modify particle surface properties to allow lipid nanoparticles to penetrate the mucosal barrier as described in US Pat.

LNPs designed for mucosal penetration may contain a polymeric material (ie a polymeric core) and/or a polymer-vitamin conjugate and/or a triblock copolymer. The polymeric material may include, without limitation, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.

LNPs designed for mucosal penetration may also contain surface modifying agents such as, but not limited to, polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as, e.g. dimethyldioctadecylammonium bromide), sugars or sugar derivatives (e.g. cyclodextrin), nucleic acids, polymers (e.g. heparin, polyethylene glycol and poloxamer), mucolytic agents (e.g. N-acetylcysteine, wormwood extract, bromelain, papain, clerodendrum extract, acetylcysteine, bromhexine, carbocysteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letostein, stepronin, thiopronin, gelsolin, thymosin β4, dornase alfa, neltenexin, erdosteine) and various DNases, including rhDNase.

In some embodiments, the mucosal permeable LNPs may be a hypotonic formulation containing a mucosal permeation enhancing coating. The formulation may be hypotonic to the epithelium to which it is delivered. Non-limiting examples of hypotonic formulations can be found, for example, in International Publication No. WO 2013110028, incorporated herein by reference in its entirety.

In some embodiments, a polynucleotide described herein is formulated as a lipoplex, such as, but not limited to, the AtuPLEX™ system, DACC system, DBTC system, and other siRNA lipoplex technologies from Silence Therapeutics (London, UK), STEMFECT™ from STEMGENT® ( Cambridge, MA) and a polyethyleneimine (PEI) or protamine based system for targeted and non-targeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788-9798; Strumberg et al. Int J Clin Pharmacol Ther 2012 50:76- 78; Santel et al., Gene Ther 2006 13:1222-1234; Santel et al., Gene Ther 2006 13:1360-1370; Gutbier et al., Pulm Pharmacol. Ther. 2010 23:334-344; Kaufmann et al. Microvasc Res 2010 80:286-293 Weide et al J Immunother 2009 32:498-507 Weide et al J Immunother 2008 31:180-188 Pascolo Expert Opin Biol Ther 4:1285- 1294; Fotin-Mleczek et al., 2011 J. Immunother. 34:1-15; Song et al.. Nature Biotechnol. 2005, 23:709-717; Peer et al., Proc Natl Acad Sci USA. 20076; 104:4095-4100; de Fougerolles, Hum Gene Ther. 2008 19:125-132; all of which are incorporated herein by reference in their entirety).

In some embodiments, the polynucleotides described herein are formulated as a solid lipid nanoparticle (SLN) that may be spherical and have an average diameter of 10-1000 nm. SLN has a solid core lipid matrix that can solubilize lipophilic molecules and can be stabilized with surfactants and/or emulsifiers. Exemplary SLNs may be as described in International Application Publication No. WO 2013105101, incorporated herein by reference in its entirety.

In some embodiments, the polynucleotides described herein can be formulated for controlled release and/or targeted delivery. As used herein, "controlled release" refers to the release profile of a pharmaceutical composition or compound that is consistent with a specific type of release that produces a therapeutic result. In one embodiment, the polynucleotides can be encapsulated in a delivery vehicle as described herein and/or known in the art for controlled release and/or targeted delivery. As used herein, the term "encapsulate" means to separate, surround, or package. Encapsulation, as it relates to the formulation of the compounds of the present invention, may be substantial, total or partial. The term "substantially encapsulated" means that at least more than 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.9%, or more than 99.999% of the pharmaceutical composition or compound according to the present invention can be separated, surrounded by a delivery vehicle or packaged in it. "Partial encapsulation" means that less than 10%, 10%, 20%, 30%, 40%, 50% or less of a pharmaceutical composition or compound of the present invention may be separated, surrounded by, or packaged in a delivery vehicle.

Encapsulation can advantageously be determined by measuring the loss or activity of a pharmaceutical composition or compound of the present invention using a fluorescent and/or electron microscope. For example, at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99, or more than 99, 99% of the pharmaceutical composition or compound of the present invention is encapsulated in the delivery vehicle.

In some embodiments, the polynucleotide controlled release formulation may comprise at least one controlled release coating (e.g., OPADRY®, EUDRAGIT RL®, EUDRAGIT RS®, and cellulose derivatives such as aqueous ethylcellulose dispersions (AQUACOAT® and SURELEASE®)) . In some embodiments, a controlled release polynucleotide formulation may comprise the polymer system described in U.S. Patent Application Publication No. US 20130130348, or the PEG and/or PEG-related polymer derivative described in U.S. Patent No. 8,404,222, and each of these documents is incorporated by links in their entirety.

In some embodiments, the polynucleotides described herein may be encapsulated in a therapeutic nanoparticle, referred to herein as a "therapeutic polynucleotide nanoparticle". Therapeutic nanoparticles can be formulated using the methods described, for example, in International Application Publication Nos. WO 2010005740, WO 2010030763, WO 2010005721, WO 2010005723 and WO 2012054923; and also in US Patent Application Publication Nos. US 20110262491, US 20100104645, US 20100087337, US 20100068285, US 20110274759, US 20100068286, US 20120288541, US 2012014079 0, US 20130123351 and US 20130230567 and US Pat. Nos. 8206747, 8293276, 8318208 and 8318211, each of which is incorporated herein by reference in its entirety.

In some embodiments, a therapeutic polynucleotide nanoparticle can be formulated to provide sustained release. As used herein, "sustained release" refers to a pharmaceutical composition or compound that is consistent with the release rate over a specific period of time. The time period may include, without limitation, hours, days, weeks, months, and years. As a non-limiting example, the sustained release polynucleotide nanoparticle described herein can be formulated as disclosed in International Application Publication No. WO 2010075072 and US Patent Application Publication Nos. of which incorporated herein by reference in its entirety.

In some embodiments, a therapeutic polynucleotide nanoparticle can be formulated to be specific for a target, such as the nanoparticles described in International Application Publication Nos. as well as in US Patent Application Publication Nos. US 20100069426, US 20120004293, and US 20100104655, each of which is incorporated herein by reference in its entirety.

LNP can be obtained using microfluidic mixers or micromixers. Exemplary microfluidic mixers may include, but are not limited to, a slotted inter-rod micromixer, including but not limited to mixers manufactured by Micro innova (Allerheiligen bei Wildon, Austria) and/or a stepped herringbone micromixer (SHM) (see Zhigaltsev et al., "Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and triglyceride cores using millisecond microfluidic mixing", Langmuir 28:3633-40 (2012); Belliveau et al., "Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA", Molecular Therapy-Nucleic Acids. 1:e37 (2012); Chen et al., "Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation", J. Am. Chem. Soc 134(16):6948-51 (2012), each of which is incorporated herein by reference in its entirety). Exemplary micromixers include slotted inter-rod microstructure mixer (SIMM-V2), or standard slotted counter-rod micromixer (SSIMM), or caterpillar (CPMM), or colliding jet (IJMM), from Institut fur Mikrotechnik Mainz GmbH, Mainz , Germany. In some embodiments, methods for producing LNP using SHM further include mixing at least two incoming streams, where mixing occurs through chaotic advection driven by microstructure (MICA). In accordance with this method, fluid flows flow through channels arranged in a "herringbone" pattern, which causes a vortex flow and swirling of fluids among themselves. The method may also include a fluid mixing surface, where the surface changes orientations during the fluid cycle. Methods for producing LNP using SHM include those disclosed in US Patent Application Publication Nos. US 20040262223 and US 20120276209, each of which is incorporated herein by reference in its entirety.

In some embodiments, the polynucleotides described herein can be formulated into lipid nanoparticles using microfluidic technology (see Whitesides, George M., "The Origins and the Future of Micro fluidics". Nature 442: 368-373 (2006) ; and Abraham et al., "Chaotic Mixer for Microchannels", Science 295: 647-651 (2002; each of which is incorporated herein by reference in its entirety). In some embodiments, polynucleotides can be formulated into lipid nanoparticles using a micromixer chip such as, but not limited to, chips from Harvard Apparatus (Holliston, MA) or Dolomite Microfluidics (Royston, UK). The micro-mixing chip can be used to rapidly mix two or more liquid streams using a split-and-recombine mechanism.

In some embodiments, the polynucleotides described herein can be formulated into lipid nanoparticles having a diameter of from about 1 nm to about 100 nm, such as, without limitation, from about 1 nm to about 20 nm, from about 1 nm to about 30 nm, about 1 nm to about 40 nm, about 1 nm to about 50 nm, about 1 nm to about 60 nm, about 1 nm to about 70 nm, about 1 nm to about 80 nm, from about 1 nm to about 90 nm, about 5 nm to about 100 nm, about 5 nm to about 10 nm, about 5 nm to about 20 nm, about 5 nm to about 30 nm, about 5 nm to about 40 nm, from about 5 nm to about 50 nm, from about 5 nm to about 60 nm, from about 5 nm to about 70 nm, from about 5 nm to about 80 nm, from about 5 nm to about 90 nm, from about 10 to about 20 nm, from about 10 to about 30 nm, from about 10 to about 40 nm, from about 10 to about 50 nm, from about 10 to about 60 nm, from about 10 to about 70 nm, from about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm , from about 20 to about 80 nm, from about 20 to about 90 nm, from about 20 to about 100 nm, from about 30 to about 40 nm, from about 30 to about 50 nm, from about 30 to about 60 nm, from about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 up to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm, about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm , about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm, and/or about 90 to about 100 nm .

In some embodiments, the implementation of lipid nanoparticles may have a diameter of from about 10 to 500 nm. In one embodiment, the lipid nanoparticle may have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater 600 nm, over 650 nm, over 700 nm, over 750 nm, over 800 nm, over 850 nm, over 900 nm, over 950 nm, or over 1000 nm.

In some embodiments, polynucleotides can be delivered with smaller LNPs. Such particles may have a diameter from less than 0.1 μm to 100 nm, such as, without limitation, less than 0.1 μm, less than 1.0 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 microns, less than 30 microns, less than 35 microns, less than 40 microns, less than 50 microns, less than 55 microns, less than 60 microns, less than 65 microns, less than 70 microns, less than 75 microns, less than 80 microns, less than 85 microns, less than 90 microns less than 95 microns, less than 100 microns, less than 125 microns, less than 150 microns, less than 175 microns, less than 200 microns, less than 225 microns, less than 250 microns, less than 275 microns, less than 300 microns, less than 325 microns, less than 350 microns, less than 375 microns, less than 400 microns, less than 425 microns, less than 450 microns, less than 475 microns, less than 500 microns, less than 525 microns, less than 550 microns, less than 575 microns, less than 600 microns, less than 625 microns, less than 650 microns, less than 675 microns , less than 700 microns, less than 725 microns, less than 750 microns, less than 775 microns, less than 800 microns, less than 825 microns, less than 850 microns, less than 875 microns, less than 900 microns, less than 925 microns, less than 950 microns or less than 975 microns.

The nanoparticles and microparticles described herein can be geometrically designed to modulate the macrophage and/or immune response. Geometrically designed particles may have various shapes, sizes and/or surface charges to include the polynucleotides described herein for targeted delivery, such as, but not limited to, delivery to the lungs (see, for example, International Application Publication No. WO 2013082111, incorporated herein by reference in its entirety). Geometrically designed particles may have other physical features, including, but not limited to, pores, angled processes, surface asymmetry and roughness, charge, which may alter interactions with cells and tissues.

In some embodiments, the nanoparticles described herein are "stealth nanoparticles" or target-specific "stealth nanoparticles" such as, without limitation, the nanoparticles described in U.S. Patent Application Publication No. US 20130172406, incorporated herein by links in their entirety. The stealth nanoparticles or target-specific stealth nanoparticles may comprise a polymer matrix which may contain two or more polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxy acids, polypropyl fumarates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly (orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polyesters, polyanhydrides, polyethers, polyurethanes, polymethacrylates, polyacrylates, polycyanoacrylates, or combinations thereof.

As a non-limiting example, modified mRNA can be formulated in PLGA-based microspheres by preparing PLGA-based microspheres with tunable release rates (e.g., for days and weeks) and encapsulating the modified mRNA in PLGA-based microspheres while maintaining the integrity of the modified mRNA. during the encapsulation process. EVAc are non-biodegradable, biocompatible polymers widely used in sustained-release implants in non-hospital applications (e.g., extended-release products such as Ocusert pilocarpine ophthalmic film for glaucoma or Progestasert sustained-release progesterone intrauterine device; transdermal delivery systems Testoderm, Duragesic and Selegiline; catheters). Poloxamer F-407 NF is a hydrophilic nonionic surfactant, which is a triblock copolymer of polyoxyethylene-polyoxypropylene-polyoxyethylene, having a low viscosity at temperatures below 5°C and forming a solid gel at temperatures above 15°C.

As a non-limiting example, the polynucleotides described herein can be formulated with the PEG-grafted PLL polymer compound described in US Pat. No. 6,177,274. As another non-limiting example, the polynucleotides described herein can be formulated with a block copolymer, such as a PLGA-PEG block copolymer (see, for example, US Patent Application Publication No. US 20120004293 and US Patent Nos. 8236330 and 8246968 ) or a PLGA-PEG-PLGA block copolymer (see, for example, US Pat. No. 6,004,573). Each of the references is incorporated herein by reference in its entirety.

In some embodiments, the polynucleotides described herein can be formulated with at least one amine-containing polymer, such as, without limitation, polylysine, polyethyleneimine, poly(amidoamine) dendrimers, amine-ester copolymers, or combinations thereof. Exemplary polyamine polymers and their use as delivery vehicles are described, for example, in US Pat. Nos. 8,460,696, 8,236,280, each of which is incorporated herein by reference in its entirety.

In some embodiments, the polynucleotides described herein can be formulated in a biodegradable cationic lipopolymer, a biodegradable polymer or biodegradable copolymer, a biodegradable polyester copolymer, a biodegradable polyester polymer, a linear biodegradable copolymer, PAGA, a biodegradable crosslinked cationic multiblock copolymer, or combinations thereof, described in, for example, US Pat. US Patent Application Publication Nos. US 20030073619, US 20040142474, US 20100004315, US 2012009145, and US 20130195920; as well as in the publications of international applications No. WO 2006063249 and WO 2013086322, each of which is incorporated into this document by reference in its entirety.

In some embodiments, the polynucleotides disclosed herein may be formulated into nanoparticles using a combination of polymers, lipids, and/or other biodegradable agents such as, but not limited to, calcium phosphate. The components can be combined into a core/shell, hybrid and/or layered configuration to allow for fine tuning of the nanoparticle for delivery (Wang et al., Nat Mater. 2006 5:791-796; Fuller et al., Biomaterials. 2008 29: 1526-1532; DeKoker et al., Adv Drug Deliv Rev. 2011 63:748-761; Endres et al., Biomaterials. 2011 32:7721-7731; Su et al., Mol Pharm. 2011 Jun 6; 8(3 ):774-87; incorporated herein by reference in their entirety). As a non-limiting example, a nanoparticle may contain a variety of polymers such as, but not limited to, hydrophilic-hydrophobic polymers (e.g., PEG-PLGA), hydrophobic polymers (e.g., PEG) and/or hydrophilic polymers (International Publication No. WO 20120225129 incorporated herein). document by reference in its entirety).

In the application of core/shell nanoparticles, additional attention has been focused on a high-throughput approach to the synthesis of cores and various shells from cationic cross-linked nanogel (Siegwart et al., Proc Natl Acad Sci USA. 2011 108:12996-13001; incorporated herein by reference in in its entirety). Complexation, delivery, and internalization of polymeric nanoparticles can be precisely controlled by changing the chemical composition of the components of both the core and shell of the nanoparticle. For example, core/shell nanoparticles can efficiently deliver siRNA to mouse hepatocytes after covalently attaching cholesterol to the nanoparticle.

In some embodiments, a hollow lipid core containing a PLGA intermediate layer and a neutral lipid outer layer containing PEG can be used to deliver the polynucleotides described herein. In some embodiments, the implementation of the lipid nanoparticles may contain a core with polynucleotides disclosed in this document, and a polymer shell, which is used to protect the polynucleotides in the core. The polymer shell can be any of the polymers described herein and known in the art, and the polymer shell can be used to protect the polynucleotides in the core.

Core/shell nanoparticles for use with the polynucleotides described herein are described in US Pat. No. 8,313,777 or International Publication No. WO 2013124867, and each of these documents is incorporated herein by reference in its entirety.

b. Conjugates

In some embodiments, the compositions or formulations of the present invention comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a relaxin polypeptide) covalently linked to a carrier or targeting group, or containing two coding regions that together provide for the formation of a fusion protein. (for example, bearing a targeting group and a relaxin protein or peptide) as a conjugate. The conjugate may be a peptide that selectively targets the nanoparticle to neurons in a tissue or body or facilitates penetration across the blood-brain barrier.

The conjugates include a naturally occurring substance such as a protein (eg, human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin); carbohydrate (eg dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid) or lipid. The ligand may also be a recombinant or synthetic molecule such as a synthetic polymer, eg a synthetic polyamino acid, an oligonucleotide (eg an aptamer). Examples of polyamino acids include polylysine (PLL) polyamino acid, poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, L-lactide-glycolide copolymer, divinyl ether-maleic anhydride copolymer, N-(2 -hydroxypropyl)methacrylamide (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers or polyphosphazene. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide polyamine, peptidomimetic polyamine, dendrimeric polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, polyamine quaternary salt, or alpha helical peptide.

In some embodiments, the implementation of the conjugate may function as a carrier for the polynucleotide disclosed in this document. The conjugate may contain a cationic polymer such as, but not limited to, polyamine, polylysine, polyalkyleneimine, and polyethyleneimine, onto which poly(ethylene glycol) may be grafted. Exemplary conjugates and their methods of preparation are described in US Patent No. 6,586,524 and US Patent Application Publication No. US 20130211249, and each of these documents is incorporated herein by reference in its entirety.

The conjugates may also include targeting groups, eg, a cell or tissue targeting agent, eg, a lectin, glycoprotein, lipid, or protein, eg, an antibody, that binds to a cell of the specified type, such as a kidney cell. A targeting group can be thyroidropin, melanotropin, lectin, glycoprotein, surfacttan protein A, mushroom carfact, polyvalent lactose, polyvalent galactose, n-acetylgalactosamine, n-acetylhlucosamin, polyvalent mannose, polyvalent polyaminophyses, glycosylasty glyc Who, transfer, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, RGD peptide, RGD peptide mimetic or aptamer.

Targeting groups can be proteins, such as glycoproteins, or peptides, such as molecules with a certain affinity for coligand, or antibodies, such as an antibody that binds to a specified cell type, such as a cancer cell, endothelial cell, or bone cell. Targeting groups may also include hormones and hormone receptors. They also include non-peptidic molecules such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, or aptamers. The ligand may be, for example, a lipopolysaccharide or a p38 MAP kinase activator.

The targeting group can be any ligand capable of targeting a particular receptor. Examples include, without limitation, folate, GalNAc, galactose, mannose, mannose-6P, aptamers, integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL receptor ligands. In particular embodiments, the targeting group is an aptamer. The aptamer may be unmodified or have any combination of the modifications disclosed herein. As a non-limiting example, the targeting group may be a glutathione receptor (GR)-binding conjugate for targeted delivery across the blood-central nervous system barrier as described, for example, in U.S. Patent Application Publication No. US 2013021661012 (incorporated herein by links in their entirety).

In some embodiments, the conjugate may be a synergistic biomolecule-polymer conjugate that is a sustained release system for greater therapeutic efficacy. Synergistic biomolecule-polymer conjugates may be those described in U.S. Patent Application Publication No. US 20130195799. In some embodiments, the conjugate may be an aptamer conjugate as described in International Patent Application Publication No. WO 2012040524. In some embodiments, the conjugate may be an amine-containing polymer conjugate as described in US Pat. No. 8,507,653. Each of the references is incorporated herein by reference in its entirety. In some embodiments, the implementation of the polynucleotide can be conjugated with SMARTT POLYMER TECHNOLOGY® (PHASERX®, Inc., Seattle, Washington).

In some embodiments, the polynucleotides described herein are covalently conjugated to a cell-penetrating polypeptide, which may also contain a signal sequence or a targeting sequence. Conjugates can be designed to have increased stability and/or increased cell transfection; and/or altered biodistribution (eg targeted to specific tissues or cell types).

In some embodiments, the polynucleotides described herein can be conjugated with a delivery enhancing agent. In some embodiments, the agent may be a monomer or polymer, such as a targeting monomer or a polymer having targeting units as described in International Application Publication No. WO 2011062965. In some embodiments, the agent may be a vehicle covalently linked to a polynucleotide as described , for example, in US Pat. by reference in its entirety.

Application methods

The polynucleotides, pharmaceutical compositions, and formulations described above are used in the preparation, manufacture, and therapeutic use for the treatment of heart failure and/or other disorders or conditions. In some embodiments, the polynucleotides, compositions, and compositions of the present invention are used to treat and/or prevent acute heart failure (AHF).

In some embodiments, the polynucleotides, pharmaceutical compositions, and formulations of the present invention are used in methods for increasing levels of relaxin proteins in a subject in need thereof. For example, in one aspect of the present invention, there is provided a method for alleviating the symptoms of HF in a subject, comprising administering to that subject a composition or composition comprising a polynucleotide encoding a therapeutic protein (eg, mRNA encoding a functional component of a relaxin polypeptide).

In some embodiments, administration to a subject of a composition or composition comprising a polynucleotide, pharmaceutical composition, or composition of the present invention results in an increase in the level of the relaxin protein in the cells to a level that is at least 10%, at least 15%, at least 20 %, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% higher than the level, observed before the introduction of the composition or composition.

In some embodiments, administration of a polynucleotide, pharmaceutical composition, or formulation of the present invention results in the expression of a relaxin protein in the subject's cells. In some embodiments, administration of a polynucleotide, pharmaceutical composition, or composition of the present invention results in an increase in the activity of the relaxin protein in the subject. For example, in some embodiments, the polynucleotides of the present invention are used in methods of administering to a subject a composition or formulation comprising an mRNA encoding a relaxin polypeptide, wherein the method results in an increase in the activity of the relaxin protein in at least some of the subject's cells.

In some embodiments, administering to a subject a composition or formulation comprising an mRNA encoding a relaxin polypeptide results in an increase in the activity of the relaxin protein in the subject's cells to a level of at least 10%, at least 15%, at least 20%, at least at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65 %, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% or more of the expected level of activity in a normal subject, for example, a person who does not have heart disease.

In some embodiments, administration of a polynucleotide, pharmaceutical composition, or formulation of the present invention results in expression of a relaxin protein in at least some of the subject's cells that persists for a period of time sufficient to allow significant metabolism to occur.

In some embodiments, expression of the encoded polypeptide is increased. In some embodiments, the polynucleotide increases expression levels of the relaxin protein in cells when introduced into these cells, for example, by at least 10%, at least 15%, at least 20%, at least 25%, at least 30% at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the expression level of the relaxin protein in the cells prior to the introduction of the polypeptide into the cells.

Other aspects of the present invention relate to the transplantation of cells containing polynucleotides in a mammalian subject. Administration of cells to mammalian subjects is known to those skilled in the art and includes, without limitation, local implantation (eg, local or subcutaneous administration), delivery to an organ or systemic injection (eg, intravenous injection or inhalation), and formulation of the cells in pharmaceutically acceptable carriers.

Compositions and formulations for use

Some aspects of the present invention are directed to compositions or formulations containing any of the polynucleotides disclosed above.

In some embodiments, the implementation of the composition or composition contains:

(i) a polynucleotide (e.g., RNA, e.g., mRNA) containing an optimized nucleotide sequence (e.g., ORF) encoding a relaxin polypeptide (e.g., a wild-type sequence, a functional fragment or variant thereof), wherein the polynucleotide contains at least one chemically modified nucleotide base , e.g., 5-methoxyuracil (e.g., where at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70 %, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the uracil bases are 5-methoxyuracil bases), and wherein the polynucleotide further comprises a miRNA binding site eg, a miKNA binding site that binds to miR-142 (eg, the binding site for miR-142-3p or miR-142-5p); and

(ii) a delivery vehicle containing an LNP containing, for example, a lipid of formula (I), such as any of compounds 1-147 (eg, compound 18, 25, 26, or 48).

In some embodiments, the content of uracil or thymine in the ORF relative to the theoretical minimum content of uracil or thymine in the nucleotide sequence encoding the relaxin polypeptide (% U _TM or % T _TM ) is from about 100% to about 150%.

In some embodiments, the polynucleotides, compositions, or formulations mentioned above are used to treat and/or prevent a disease or disorder, such as acute heart failure.

Forms of administration

The polynucleotides, pharmaceutical compositions, and formulations of the present invention described above may be administered via any route that results in a therapeutically effective result. These include, without limitation, enteral (into the intestines), enterogastric, epidural (into the dura mater), oral (by mouth), transdermal, epidural, intracerebral (into the cerebrum), intracerebroventricular (into the ventricles of the brain), dermal (applied to the skin ), intradermal (into the skin itself), subcutaneous (under the skin), intranasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intra-arterial (into an artery), intramuscular (into a muscle), intracardiac administration (in heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal injection (infusion or injection into the peritoneum), intravesical infusion, intravitreal injection (through the eye), intracavernous injection (into the pathological cavity), intracavitary (into the base penis), intravaginal, intrauterine, extra-amniotic, transdermal (diffusion through intact skin to achieve systemic distribution), transmucosal (diffusion through the mucous membrane), transvaginal, insufflation (blowing), sublingual, sublabial, enema, as part of eye drops (on the conjunctiva), as part of ear drops, intra-ear (into the ear or through the ear), transbuccal (in the direction behind the cheek), conjunctival, dermal, dental (into the tooth or teeth), electroosmotic, endocervical, endosinusial, endotracheal , extracorporeal administration, hemodialysis, infiltration, administration into the interstitial space, administration into the abdominal cavity, intraamniotic, intraarticular, intrabiliary, intrabronchial, intrabursal, intracartilaginous (into the cartilage), intracaudal (in the cauda equina), intracisternal (into the cerebellar-cerebral cistern), intracorneal (into the cornea), dental intracoronal, intracoronary injection (into the coronary arteries), injection into the cavernous bodies (into the expanding cells of the cavernous bodies of the penis), intradiscal (into the intervertebral disc), intraductal (into the duct of the gland), intraduodenal (into the duodenum ), intradural (into or under the dura mater), intraepidermal (into the epidermis), intraesophageal (into the esophagus), intragastric (into the stomach), intragingival (into the gums), ileum (into the distal part of the small intestine), intralesional (within the local focus or by injection directly into it), intraluminal (into the lumen of the tube), intralymphatic (into the lymph), intramedullary (into the bone marrow cavity), intrameningeal (into the meninges), intraocular (into the eye), intraovarian ( into the ovary), intrapericardial (into the pericardium), intrapleural (into the pleura), intraprostatic (into the prostate gland), intrapulmonary (into the lungs or their bronchi), intrasinus (into the paranasal or periorbital sinuses), intraspinal (into the spinal column), intrasynovial ( into the synovial cavity of the joint), intratendinous (into the tendon), intratesticular (into the testicle), intrathecal (into the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (into the chest), intratubular (into the tubules of the organ), intratumoral (into the tumor), intratympanic (into the middle ear), intravascular (into a vessel or vessels), intraventricular administration (into the ventricle), iontophoresis (by means of an electric current, due to which ions of soluble salts migrate into body tissues), irrigation (washing or rinsing open wounds or body cavities ), laryngeal (directly into the larynx), nasogastric administration (through the nose and into the stomach), occlusive dressing technique (introduction through a local route, the place of which is then covered with a bandage that isolates this area of the body), ophthalmic (into the outer part of the eye), oropharyngeal (directly into the mouth and throat), parenteral, percutaneous, periarticular, epidural, perineural, periodontal, rectal, respiratory (into the respiratory tract by oral or nasal inhalation to achieve a local or systemic effect), retrobulbar (behind the pons or behind the eyeball ), intramyocardial administration (with entry into the myocardium), administration into soft tissues, subarachnoid, subconjunctival, submucosal, local, transplacental (through the placenta or with distribution along it), transtracheal (through the wall of the trachea), transtympanal (with distribution in the tympanic cavity or through it), ureteral (into the ureter), urethral (into the urethra), vaginal insertion, sacral block, diagnostic insertion, nerve block, biliary perfusion, cardiac perfusion, photopheresis, or spinal insertion. In specific embodiments, the compositions can be administered via a route that allows them to pass through the blood-brain barrier, vascular barrier, or other epithelial barrier. In some embodiments, the route of administration formulation may contain at least one inactive ingredient.

The polynucleotides of the present invention (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide or a functional fragment or variant thereof) can be delivered naked to a cell. As used herein, "naked" refers to the delivery of polynucleotides that do not contain transfection aids. Naked polynucleotides can be delivered into a cell using routes of administration known in the art and described herein.

The polynucleotides of the present invention (eg, a polynucleotide containing a nucleotide sequence encoding a relaxin polypeptide or a functional fragment or variant thereof) can be formulated using the methods described herein. The compositions may contain polynucleotides, which may be modified and/or unmodified. The formulations may further comprise, without limitation, cell penetrating agents, a pharmaceutically acceptable carrier, a delivery vehicle, a biodegradable or biocompatible polymer, a solvent, and a sustained release depot drug delivery system. Composite polynucleotides can be delivered to a cell using routes of administration known in the art and described herein.

The pharmaceutical composition for parenteral administration may contain at least one inactive ingredient. Any of the inactive ingredients approved by the US Food and Drug Administration (FDA) or none of them may be used. A non-exhaustive list of inactive ingredients for use in parenteral pharmaceutical compositions includes hydrochloric acid, mannitol, nitrogen, sodium acetate, sodium chloride, and sodium hydroxide.

Injectable preparations, for example sterile injectable aqueous or oily suspensions, can be formulated according to the known art using suitable dispersing agents, wetting agents and/or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions and/or emulsions in non-toxic parenteral acceptable diluents and/or solvents, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be used are water, USP Ringer's solution, and isotonic sodium chloride solution. Sterile fixed oils have traditionally been used as the solvent or suspending medium. For this purpose any non-irritating fixed oil containing synthetic mono- or diglycerides can be used. Fatty acids such as oleic acid can be used in the preparation of injectables. The sterile composition may also contain adjuvants such as local anesthetics, preservatives and buffering agents.

Injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter and/or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

Injectable formulations may be intended for direct injection into a tissue, organ, and/or body site of a subject. As a non-limiting example, the composition can be directly injected into a tissue, organ, and/or body of a subject by intramyocardial injection at an ischemic site. (See, for example, Zangi et al. Nature Biotechnology 2013; the contents of which are incorporated herein by reference in their entirety).

In order to prolong the effect of the active ingredient, it is often desirable to delay the absorption of the active ingredient after subcutaneous or intramuscular injection. This can be achieved by using a liquid suspension of crystalline or amorphous material with poor water solubility. Thus, the rate of absorption of a drug depends on its rate of dissolution, which, in turn, may depend on the size of the crystals and the crystalline form. Alternatively, delayed absorption of a parenterally administered form of the drug is achieved by dissolving or suspending the drug in an oil vehicle. Injectable depot forms are prepared by forming microencapsulated drug matrices in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer and the nature of the particular polymer used, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoethers) and poly(anhydrides). Injectable depot formulations are prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.

Kits and devices

A. Sets

The present invention provides a number of kits for convenient and/or efficient use of the nucleotides of the present invention. Typically, kits contain a sufficient number and/or number of components to allow the user to perform multiple treatment sessions on the subject(s) and/or perform multiple experiments.

In one aspect, the present invention provides kits containing the molecules (polynucleotides) of the present invention.

Said kits may be designed to produce a protein and at the same time contain a first polynucleotide containing a translated site. The kit may further comprise packaging and instructions and/or a delivery device for forming a formulation composition. The delivery vehicle may include saline, buffered solution, lipidoid, or any delivery vehicle disclosed herein.

In some embodiments, the implementation of the buffer solution may include sodium chloride, calcium chloride, phosphate and/or EDTA. In another embodiment, the buffer solution may include, but is not limited to, saline, saline with 2 mM calcium, 5% sucrose, 5% sucrose with 2 mM calcium, 5% mannitol, 5% mannitol with 2 mM calcium, Ringer's lactate, sodium chloride, sodium chloride with 2 mM calcium and mannose (see, for example, US Patent Application Publication No. 20120258046; incorporated herein by reference in its entirety). In a further embodiment, the buffer solutions may be precipitated or may be lyophilized. The amount of each component can be varied to ensure consistent, reproducible buffer formulations with higher saline concentrations or simple buffers. The components can also be varied in order to increase the stability of the modified RNA in the buffer solution over a certain period of time and/or under different conditions. In one aspect, the present invention provides protein production kits comprising: a polynucleotide containing a translated site provided in an amount effective to produce a desired amount of protein encoded by the translated site when introduced into a target cell; a second polynucleotide containing an inhibitory nucleic acid provided in an amount effective to substantially inhibit the innate immune response in the cell; as well as packaging and instructions.

In one aspect, the present invention provides protein production kits comprising a polynucleotide comprising a translated region, wherein the polynucleotide has reduced degradation by cellular nuclease, as well as packaging and instructions.

In one aspect, the present invention provides protein production kits comprising a polynucleotide comprising a translated region, wherein the polynucleotide has reduced degradation by cellular nuclease, and a mammalian cell suitable for translation of the translated region of the first nucleic acid.

b. Devices

The present invention provides devices that may contain polynucleotides encoding polypeptides of interest. Such devices contain, in a stable formulation, the polynucleotide synthesis reagents in a formulation available for immediate delivery to a subject in need, such as a human patient.

Administration devices can be used to deliver the polynucleotides of the present invention according to the single, multiple, or split dose regimens provided herein. Such devices are presented, for example, in the publication of international application No. WO 2013151666, the contents of which are incorporated herein by reference in its entirety.

The use of methods and devices known from the prior art for repeated administration to cells, organs and tissues is envisaged, together with the methods and compositions disclosed herein as embodiments of the present invention. These include, for example, multi-needle methods and devices, hybrid devices that use, for example, tubes or catheters, and devices that use mechanisms controlled by heat, electricity, or radiation.

In accordance with the present invention, such multiple dose devices can be used to deliver the single, multiple, or divided doses contemplated herein. Such devices are presented, for example, in the publication of international application No. WO 2013151666, the contents of which are incorporated herein by reference in its entirety.

In some embodiments, the polynucleotide is administered subcutaneously or intramuscularly using at least 3 needles at three different, optionally adjacent, sites simultaneously or over a 60-minute period (e.g., administered at 4, 5, 6, 7, 8, 9, or 10 sites at the same time or within a 60-minute period).

With. Methods and devices using catheters and/or tubes

Methods and devices using catheters and lumens can be used to administer the polynucleotides of the present invention in single, multiple, or divided dose regimens. Such methods and devices are described in International Application Publication No. WO 2013151666, the contents of which are incorporated herein by reference in their entirety.

d. Electric Current Methods and Devices Electric current methods and devices can be used to deliver the polynucleotides of the present invention according to the single, multiple, or fractional dose regimens provided herein. Such methods and devices are described in International Application Publication No. WO 2013151666, the contents of which are incorporated herein by reference in their entirety.

Definitions

For easier understanding of the present invention, some terms are defined first. As used in this application, except as otherwise expressly provided herein, each of the following terms has the meanings set forth below. Throughout this application, additional definitions are set forth.

The present invention includes embodiments in which exactly one member of the group is present in, used in, or otherwise related to said product or method. The present invention includes embodiments in which more than one member or all members of a group are present in, used in, or otherwise related to said product or method.

In this description and the appended claims, the singular forms include the plural as well, unless the context clearly dictates otherwise. The singular forms, as well as the terms "one or more" and "at least one" can be used interchangeably herein. In some aspects, the singular form means "one". In other aspects, the singular form includes "two or more" or "several".

In addition, the expression "and/or" used in this document should be considered as a specific disclosure of each of the two specified features or components with or without the other. Thus, the expression "and/or" as used herein in a phrase such as "A and/or B" is intended to include "A and B", "A or B", "A" (separately), and "B" (separately). Likewise, the expression "and/or" used in a phrase such as "A, B and/or C" is intended to cover each of the following: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (separately); B (separately) and C (separately).

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by a person skilled in the art to which the present invention pertains. For example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide the skilled artisan with a general vocabulary of many of the terms used in the present invention.

Whatever aspects are described in this document by the wording "comprising", other similar aspects described by the expressions "consisting of" and/or "consisting in fact of" are also provided.

Units of measurement, prefixes and symbols are given in their International System of Units (SI) form. Numeric ranges include numbers that define the range. Where a range of values is specified, it is to be understood that each intermediate integer value and each fractional part thereof between the specified upper and lower limits of that range is also specifically disclosed along with each subrange between such values. The upper and lower limits of any range may be independently included in or excluded from the range, and each range in which one of the limits, neither or both of them is included is also covered by the present invention. Where a value is explicitly indicated, it is to be understood that values which denote approximately the same amount or amount as the value indicated are also within the scope of the present invention. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the present invention. Conversely, where various elements or groups of elements are disclosed individually, their combinations are also disclosed. In cases where any element of the present invention is disclosed as having multiple alternatives, this document also discloses examples of the present invention in which each alternative is excluded individually or in any combination with other alternatives; more than one element of the present invention may have such exceptions, and all combinations of elements having such exceptions are disclosed herein.

Nucleotides are designated by their common single letter codes. Unless otherwise indicated, nucleic acids are written from left to right in the 5'-3' direction. Nucleotide bases in this document are designated using their well-known one-letter symbols recommended by the IUPAC-IUB Commission on Biochemical Nomenclature. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil.

In this document, amino acids are designated either by their well-known three-letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Commission on Biochemical Nomenclature. Unless otherwise indicated, amino acid sequences are written from left to right in the direction from amino to carboxy terminus.

Approximately. The term "approximately" used in connection with a numerical value throughout the present description and claims means a range of accuracy familiar and acceptable to one skilled in the art, and such range of accuracy is ±10%.

Where ranges are specified, endpoints are included in them. In addition, unless otherwise indicated or otherwise obvious from the context and understood by a person skilled in the art, then values expressed as ranges can take on any specific values or subranges within the specified ranges in various embodiments of the present invention up to tenths of a unit of the lower range limit, unless the context clearly requires otherwise.

Introduction to combinations. As used herein, the term "administration in combination" or "combined administration" means that two or more agents are administered to a subject at the same time or over a specified interval such that there may be an overlap in the effects of each agent in a patient. In some embodiments, they are administered within about 60, 30, 15, 10, 5, or 1 minute of each other. In some embodiments, administration procedures are separated by a sufficiently short interval from each other in order to achieve a combined (eg, synergistic) effect.

amino acid replacement. The term "amino acid substitution" refers to the substitution of an amino acid residue present in the parent or reference sequence (eg, wild-type relaxin sequence) with a different amino acid residue. The amino acid can be replaced in the parent or reference sequence (eg, in the sequence of the wild-type relaxin polypeptide), for example, by chemical synthesis of peptides or by recombinant methods known in the art. Accordingly, reference to "substitution at position X" refers to the replacement of an amino acid present at position X with an alternative amino acid residue. In some aspects, substitution patterns can be described according to the AnY scheme, where A is a one-letter code corresponding to an amino acid naturally present or native at position n, and Y is a substituting amino acid residue. In other aspects, the substitution patterns can be described according to the An(YZ) scheme, where A is a one-letter code corresponding to the amino acid residue that replaces the amino acid naturally present or native at the X position, and Y and Z are alternative replacement amino acid residues.

In the context of the present invention, substitutions (even when referred to as amino acid substitutions) are carried out at the level of nucleic acids, ie. replacement of an amino acid residue with an alternative amino acid residue is carried out by replacing the codon encoding the first amino acid with the codon encoding the second amino acid.

Animal. As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (eg, a rodent, mouse, rat, rabbit, non-human ape, dog, cat, sheep, cattle, primate, or pig). In some embodiments, the animals include, without limitation, mammals, birds, reptiles, amphibians, fish, and worms. In some embodiments, the animal is a transgenic animal, a genetically engineered animal, or a clone.

Approximately. As used herein, the expression "about", used in relation to one or more values of interest, refers to a value similar to the specified reference value. In certain embodiments, the expression "about" refers to a range of values within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10 %, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in any direction (more or less) from the specified reference value, unless otherwise indicated or otherwise obvious from the context (except in cases where such a number would exceed 100% of the possible value).

Associate. As used herein with respect to a disease, the term "associated" means that the symptom, measure, characteristic, or condition in question is associated with the diagnosis, development, presence, or progression of that disease. An association may, but need not, imply a causal relationship to a disease.

When used with respect to two or more fragments, the expressions "associated", "conjugated", "connected", "attached" and "articulated" mean that the fragments are physically associated or connected to each other directly or with the help of one or more additional fragments that serve as a linker agent, to form a structure sufficiently stable that the fragments remain physically associated under the conditions under which the structure is used, eg under physiological conditions. "Association" does not have to be formed solely by the formation of direct covalent chemical bonds. It may also involve the formation of ionic or hydrogen bonds or bonding through hybridization with sufficient stability so that the "associated" objects remain physically associated.

Bifunctional. As used herein, the term "bifunctional" refers to any substance, molecule, or moiety capable of performing or retaining at least two functions. Functions can affect the same result or different results. The structures that provide the performance of functions can be the same or different. For example, the bifunctional modified RNAs of the present invention can encode the relaxin peptide (first function), while those nucleosides that form the coding RNA are themselves capable of increasing the half-life of the RNA (second function). In this example, delivery of bifunctional modified RNAs to a subject suffering from a protein deficiency will not only generate a peptide or protein molecule that can provide mitigation or treatment for the disease or condition, but will also maintain a population of modified RNAs in the subject's body for an extended period of time. period of time. In other aspects, the bifunctional modified mRNA may be a chimeric or hybrid molecule containing, for example, an RNA encoding a relaxin peptide (first function) and a second protein fused to or co-expressed with the first protein.

Biocompatible. As used herein, the term "biocompatible" means compatible with living cells, tissues, organs, or systems, presenting little to no risk of injury, intoxication, or rejection by the immune system.

Biodegradable. As used herein, the term "biodegradable" means the ability to be broken down into harmless products by living organisms.

biologically active. As used herein, the phrase "biologically active" refers to the characterization of any substance that has activity in a biological system and/or organism. For example, a substance that, when introduced into an organism, has a biological effect on that organism is considered to be biologically active. In specific embodiments, a polynucleotide of the present invention may be considered biologically active if at least a portion of the polynucleotide is biologically active or mimics an activity considered to be biologically significant.

Chimera. As used herein, a "chimera" is an object having two or more incompatible or non-homogeneous parts or regions. For example, a chimeric molecule may comprise a first moiety containing a relaxin polypeptide and a second moiety (e.g., genetically fused to the first moiety) containing a second relaxin protein (e.g., a protein with a pronounced enzymatic activity, an antigen-binding fragment, or a fragment capable of increasing the relaxin half-life in plasma, for example, the Fc region of an antibody).

Sequence optimization. The term "sequence optimization" refers to a process or series of processes by which nucleotide bases in a reference nucleic acid sequence are replaced with alternative nucleotide bases, resulting in a nucleic acid sequence with improved properties, such as improved protein expression or reduced immunogenicity.

Typically, the goal of sequence optimization is to obtain a synonymous nucleotide sequence that encodes the same polypeptide sequence that encodes a reference nucleotide sequence. Thus, the polypeptide encoded by the codon-optimized nucleotide sequence has no amino acid substitutions (as a result of codon optimization) compared to the polypeptide encoded by the reference nucleotide sequence.

Codon change. The expression "codon substitution" or "codon substitution" in relation to sequence optimization refers to the substitution of a codon present in a reference nucleic acid sequence with another codon. A codon can be changed in a reference nucleic acid sequence, for example, by chemical synthesis of peptides or by recombinant methods known in the art. Accordingly, references to "substitution" or "substitution" at a location in a nucleic acid sequence (e.g., mRNA) or at a region or subsequence of a nucleic acid sequence (e.g., mRNA) refer to the replacement of a codon at that location or region by an alternative codon.

As used herein, the expressions "coding region" and "coding region", as well as their grammatical variants, refer to an open reading frame (ORF) in a polynucleotide that, when expressed, results in a polypeptide or protein.

Compound. As used herein, the term "compound" is intended to include all stereoisomers and isotopes of the depicted structure. As used herein, the term "stereoisomer" means any geometric isomer (eg, cis and trans isomer), enantiomer, or diastereomer of a compound. The present invention encompasses any possible stereoisomers of the compounds described herein, including stereoisomerically pure forms (eg, geometrically pure, enantiomerically pure, or diastereomerically pure), as well as mixtures of enantiomers and stereoisomers, such as racemates. Mixtures of enantiomers and stereoisomers of compounds and methods for separating them into their constituent enantiomers or stereoisomers are well known. "Isotopes" refer to atoms having the same atomic number but different mass numbers due to the different number of neutrons in the nuclei. For example, isotopes of hydrogen include tritium and deuterium. In addition, the compound, salt or complex of the present invention can be obtained in combination with solvent or water molecules to form solvates and hydrates using standard methods.

Bringing into contact. Used in this document, the term "bringing into contact" means the establishment of a physical connection between two or more objects. For example, bringing a mammalian cell into contact with a nanoparticle composition means that a physical bond is created between the mammalian cell and the nanoparticle. Methods for bringing cells into contact with external objects both in vivo and ex vivo are well known in the field of biology. For example, bringing the nanoparticulate composition into contact with a mammalian cell located in the mammalian body may be via various routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and may involve the use of different amounts of the nanoparticle composition. Moreover, more than one mammalian cell can be contacted with the nanoparticle composition.

Conservative amino acid substitution. A "conservative amino acid substitution" is one in which an amino acid residue in a protein sequence is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art and include basic side chains (e.g. lysine, arginine or histidine), acidic side chains (e.g. aspartic acid or glutamic acid), uncharged polar side chains (e.g. glycine , asparagine, glutamine, serine, threonine, tyrosine, or cysteine), non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, or tryptophan), beta-branched side chains (eg, threonine, valine, isoleucine ) and aromatic side chains (eg tyrosine, phenylalanine, tryptophan or histidine). Thus, if an amino acid in a polypeptide is replaced by another amino acid from the same side chain family, then that amino acid substitution is considered conservative. In another aspect, the amino acid strand can be conservatively substituted with a structurally similar strand that differs in the order and/or composition of the side chain family members.

non-conservative amino acid substitution. Non-conservative amino acid substitutions include substitutions in which (i) a residue having an electropositive side chain (eg, Arg, His, or Lys) replaces or is substituted for an electronegative residue (eg, Glu or Asp), (ii) a hydrophilic residue (eg, Ser or Thr) replaces or is substituted for a hydrophobic residue (e.g., Ala, Leu, Ile, Phe, or Val), (iii) cysteine or proline replaces or is substituted for any other residue, or (iv) a residue having a bulky hydrophobic or aromatic side chain chain (eg, Val, His, He, or Trp) replaces or is replaced by a residue having a smaller side chain (eg, Ala or Ser) or no side chain (eg, Gly).

Other amino acid substitutions can be readily identified by those skilled in the art. For example, in the case of the amino acid alanine, a substitution with any of D-alanine, glycine, beta-alanine, L-cysteine, and D-cysteine may be chosen. In the case of lysine, the substituent may be any of D-lysine, arginine, D-arginine, homoarginine, methionine, D-methionine, ornithine, or D-ornithine. Typically, substitutions at functionally important sites that can be expected to induce changes in the properties of isolated polypeptides are substitutions in which (i) a polar residue, for example, series or threonine, replaces (or is replaced by) a hydrophobic residue, for example, leucine, isoleucine , phenylalanine or alanine; (ii) a cysteine residue replaces (or is replaced by) any other residue; (iii) a residue having an electropositive side chain, eg lysine, arginine or histidine, replaces (or is replaced by) a residue having an electronegative side chain, eg glutamic acid or aspartic acid; or (iv) a residue having a bulky side chain, eg phenylalanine, replaces (or is replaced by) a residue without such a side chain, eg glycine. The likelihood that one of the above non-conservative substitutions can change the functional properties of the protein also correlates with the position of the substitution relative to the functionally important regions of the protein; however, some non-conservative substitutions may, accordingly, have little or no effect on biological properties.

Conservative. As used herein, the term "conservative" refers to nucleotides or amino acid residues, respectively, of a polynucleotide sequence or a polypeptide sequence that occur unchanged at the same position in two or more compared sequences. Nucleotides or amino acids that are relatively conserved are more conserved among related sequences than nucleotides or amino acids that occur elsewhere in the sequences.

In some embodiments, two or more sequences are said to be "fully conserved" if they are 100% identical to each other. In some embodiments, two or more sequences are said to be "highly conserved" if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to each other. In some embodiments, two or more sequences are said to be "conservative" if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be "conservative" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, approximately 95% identical, approximately 98% identical, or approximately 99% identical to each other. Sequence conservation may refer to the entire length of a polynucleotide or polypeptide, or may refer to a portion, region, or feature thereof.

controlled release. Used in this document, the term "controlled release" refers to the release profile of a pharmaceutical composition or compound, which corresponds to a certain type of release, giving a therapeutic result.

Cyclic or cyclized. As used herein, the term "cyclic" refers to the presence of a continuous cycle. Cyclic molecules do not have to be circular, but only connected to form an intact chain of subunits. Cyclic molecules, such as the engineered RNA or mRNA of the present invention, may be single units or multimers, or contain one or more components of a higher order complex or structure.

Cytotoxic. As used herein, "cytotoxic" refers to killing or causing a damaging, toxic, or lethal effect on a cell (e.g., mammalian (e.g., human) cell), bacteria, virus, fungus, protozoan, parasite, prion, or a combination thereof. .

Delivery. As used in this document, the term "delivery" means the delivery of an object to its destination. For example, delivery of a polynucleotide to a subject may involve administering to the subject a nanoparticulate composition containing the polynucleotide (eg, via intravenous, intramuscular, intradermal, or subcutaneous routes). Administration of the nanoparticle composition to a mammal or into a mammalian cell may involve bringing one or more cells into contact with the nanoparticle composition.

delivery vehicle. As used herein, "delivery agent" refers to any substance that at least in part facilitates the delivery of a polynucleotide to target cells in vivo, in vitro, or ex vivo.

Destabilized. As used herein, the terms "destabilized", "destabilized", or "destabilized region" means a region or molecule that is less stable than the parent, wild-type, or native form of the same region or molecule.

diastereomer. Used in this document, the term "diastereomer" means stereoisomers that are not mirror images of each other and do not match when superimposed on each other.

Split. Used in this document, the term "split" means the division into smaller parts or components. When it comes to polypeptides or proteins, cleavage leads to the formation of peptides.

Distal. Used in this document, the term "distal" means located away from the center or away from the point or area of interest.

Domain. As used herein, the term "domain", when referring to polypeptides, refers to a polypeptide motif having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions).

Dosing regimen. As used herein, a "dosing regimen" or "dosing regimen" is an administration regimen or a physician-defined regimen for treatment, prophylaxis, or palliative care.

effective amount. As used herein, the term "effective amount" of an agent means that amount that is sufficient to provide beneficial or desired results, such as clinical results, and therefore the term "effective amount" depends on the context in which it is used. For example, with respect to administering an agent that treats a protein deficiency (e.g., relaxin deficiency), an effective amount of the agent is, for example, the amount of mRNA with which sufficient relaxin is expressed to reduce, alleviate, eliminate, or prevent the signs or symptoms associated with with relaxin deficiency, compared with the severity of symptoms observed without the introduction of the agent. The term "effective amount" may be used interchangeably with "effective dose", "therapeutically effective amount" or "therapeutically effective dose".

enantiomer. As used herein, the term "enantiomer" means each individual optically active form of a compound of the present invention having an optical purity or enantiomeric excess (determined using standard techniques in the art) of at least 80% (i.e., at least 90% of one enantiomer and not more than 10% of the other enantiomer), at least 90% or at least 98%.

Encapsulate. As used herein, the term "encapsulate" means to separate, surround, or package.

encapsulation efficiency. As used herein, "encapsulation efficiency" refers to the amount of polynucleotide that becomes part of a nanoparticulate composition relative to the original total amount of polynucleotide used in making the nanoparticle composition. For example, if 97 mg of a polynucleotide is encapsulated in a nanoparticulate composition out of a total of 100 mg of polynucleotide originally provided in the composition, then the encapsulation efficiency can be reported as 97%. As used herein, "encapsulation" may refer to complete, substantial, or partial separation, confinement, surrounding, or packaging.

Encoded protein cleavage signal. As used herein, "encoded protein cleavage signal" refers to a nucleotide sequence encoding a protein cleavage signal.

Constructed. As used herein, embodiments of the present invention are "designed" if they are designed in such a way that they have a feature or property, structural or chemical, in which they differ from the original molecule, wild-type molecule or native molecule.

Increased shipping. As used herein, the term "increased delivery" means delivering more (e.g., at least 1.5 times more, at least 2 times more, at least 3 times more, at least 4 times more) at least 5 times more, at least 6 times more, at least 7 times more, at least 8 times more, at least 9 times more, at least 10 times more) amount of polynucleotide nanoparticle into the target tissue of interest (eg, mammalian liver) compared to the level of delivery of the polynucleotide by the control nanoparticle (eg, containing MC3, KC2, or DLinDMA) into the target tissue of interest. The level of delivery of a nanoparticle to a particular tissue can be measured by comparing the amount of protein produced in a tissue with the weight of said tissue, comparing the amount of a polynucleotide in a tissue with the weight of said tissue, comparing the amount of protein produced in a tissue with the total amount of protein in said tissue, or comparing the amount polynucleotide in tissue with the total amount of polynucleotide in said tissue. It will be understood that increased delivery of the nanoparticle to the target tissue need not be determined in the body of the subject being treated, but may be determined under simulated conditions, such as in an animal model (eg, rat model).

Exosome. As used herein, an "exosome" is a vesicle secreted by mammalian cells or a complex involved in the degradation of RNA.

Expression. As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) the formation of an mRNA template on a DNA sequence (eg, by transcription); (2) processing of the mRNA transcript (eg, splicing, editing, 5' cap formation, and/or 3' end processing); (3) translation of an mRNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein.

ex vivo. As used herein, the term "ex vivo" refers to events occurring outside of an organism (eg, an animal, plant, or microorganism or cell or tissue thereof). Ex vivo events can take place in an environment that has undergone minimal changes compared to the natural environment (eg, in vivo).

Sign. As used herein, a "feature" refers to a characteristic, property, or distinctive element. When it comes to polypeptides, "features" are defined as the distinctive components of a molecule based on an amino acid sequence. Features of the polypeptides encoded by the polynucleotides of the present invention include surface features, local conformations, folds, loops, half-loops, domains, half-domains, sites, ends, or any combination thereof.

Compound. As used herein, a "composition" comprises at least a polynucleotide and one or more of a carrier, an excipient, and a delivery vehicle.

Fragment. "Fragment", as used in this document, refers to a part. For example, protein fragments may contain polypeptides obtained by cleavage of a full-length protein isolated from cultured cells. In some embodiments, the fragment is a subsequence of a full-length protein, where the N-terminal and/or C-terminal and/or internal subsequences have been deleted. In some preferred aspects of the present invention, the protein fragments of the present invention are functional fragments.

Functional. As used herein, a "functional" biological molecule is a biological molecule in the form in which it exhibits the property and/or activity with which it is characterized. Thus, a functional fragment of a polynucleotide of the present invention is a polynucleotide capable of expressing a functional relaxin fragment. As used herein, a functional relaxin fragment refers to a wild-type fragment of relaxin (i.e., a fragment of any of its naturally occurring isoforms) or a mutant form or variant thereof, where the fragment retains at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85 %, at least about 90%, or at least about 95% of the biological activity of the corresponding full-length protein.

Auxiliary lipid. As used herein, the term "helper lipid" refers to a compound or molecule containing a lipid moiety (for insertion into a lipid layer, such as a lipid bilayer) and a polar moiety (for interaction with saline on the surface of the lipid layer). Typically, the accessory lipid is a phospholipid. The function of the helper lipid is to "complement" the aminolipid and increase the fusogenicity of the bilayer and/or help ensure endosomal release of, for example, nucleic acid delivered to cells. Accessory lipids are also believed to be key structural components of the LNP surface.

Homology. As used herein, the term "homology" refers to a common relationship between polymer molecules, for example between nucleic acid molecules (eg DNA molecules and/or RNA molecules) and/or between polypeptide molecules. The term "homology" usually implies an evolutionary relationship between two molecules. Thus, two molecules that are homologous have a common evolutionary ancestor. In the context of the present invention, the term "homology" encompasses both identity and similarity.

In some embodiments, polymer molecules are considered "homologous" to each other if at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% of the monomers in a molecule are identical (exactly the same monomers) or similar (conservative substitutions). The term "homologous" necessarily refers to a comparison of at least two sequences (polynucleotide or polypeptide sequences).

Identity. As used herein, the term "identity" refers to the general conservation of monomers between polymer molecules, for example, between polynucleotide molecules (eg, DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of percent identity between two polynucleotide sequences can, for example, be done by aligning the two sequences for optimal comparison (e.g., one or both of the first and second nucleic acid sequences can be gapped for optimal alignment, and non-identical sequences can be ignored for comparison purposes). attention). In certain embodiments, the length of the sequence aligned for comparison is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100% of the length of the reference sequence. The nucleotides are then compared at the corresponding nucleotide positions. If a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity of two sequences is a function of the number of identical positions shared by the sequences, given the number of gaps and the length of each gap that must be entered to optimally align the two sequences. Sequence comparison and determination of percent identity between two sequences can be performed using a mathematical algorithm. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent.

Suitable software systems programs are available from various sources and are designed to align both protein and nucleotide sequences. One suitable program for determining percent sequence identity is bl2seq, part of the BLAST software package available from the US Government National Center for Biotechnology Information BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq performs a comparison between two sequences using the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, which are part of the EMBOSS bioinformatics package and are also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk/Tools/psa.

Sequence alignment procedures can be performed using methods known in the art such as MAFFT, Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, etc.

Each of the different regions in a single target polynucleotide or polypeptide sequence aligned with a reference polynucleotide or polypeptide sequence may have its own percent sequence identity. It should be noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 round down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 round up. side to 80.2. Also note that the length value will always be an integer.

In certain aspects, the percentage identity "% ID" of the first amino acid sequence (or nucleic acid sequence) with the second amino acid sequence (or nucleic acid sequence) is calculated as % ID=100×(Y/Z), where Y is the number of amino acid residues ( or nucleotide bases) counted as identical matches when aligning the first and second sequences (aligned by visual inspection or a special sequence alignment program), and Z is the total number of residues in the second sequence. If the length of the first sequence is greater than the length of the second sequence, then the percentage identity of the first sequence with the second sequence will be higher than the percentage identity of the second sequence with the first sequence.

One skilled in the art will appreciate that constructing a sequence alignment to calculate percent sequence identity is not limited to binary comparisons of two sequences based solely on raw sequence data. It should also be understood that sequence alignments can be constructed by integrating sequence data with data from heterogeneous sources such as structural data (eg, protein crystallographic structures), functional data (eg, mutation locations), or phylogenetic data. A suitable program that integrates heterogeneous data with multiple sequence alignment building is T-Coffee, available from www.tcoffee.org and alternatively available from eg EBI. It should also be understood that the final alignment used to calculate percent sequence identity can be checked either automatically or manually.

immune response. The term "immune response" refers to the action of, for example, lymphocytes, antigen-presenting cells, phagocytes, granulocytes, and soluble macromolecules produced by the aforementioned cells or the liver (including antibodies, cytokines, and components of the complement system) that results in selective damage, destruction, or removal from the human body of invasive pathogens, pathogen-infected cells or tissues, cancer cells or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues. In some instances, administration of a nanoparticle containing a lipid component and an encapsulated therapeutic agent may trigger an immune response that may be elicited by (i) the encapsulated therapeutic agent (e.g., mRNA), (ii) the expression product of such encapsulated therapeutic agent (e.g., a polypeptide encoded by mRNA), (iii) the lipid component of the nanoparticle, or (iv) a combination thereof.

inflammatory response. "Inflammatory response" refers to immune responses that involve specific and non-specific defense systems. The reaction of the specific defense system is a specific reaction of the immune system to an antigen. Examples of specific defense system responses include humoral responses. The non-specific defense system response is an inflammatory response mediated by leukocytes normally incapable of immunological memory formation, such as macrophages, eosinophils and neutrophils. In some aspects, the immune response includes the secretion of pro-inflammatory cytokines leading to increased levels of pro-inflammatory cytokines.

pro-inflammatory cytokines. The term "pro-inflammatory cytokine" refers to cytokines that are elevated during an inflammatory response. Examples of pro-inflammatory cytokines include interleukin-6 (IL-6), CXCL1 (chemokine ligand 1 (with C-X-C motif); also known as GROoc, interferon-γ (IFNγ), tumor necrosis factor α (TNFα), interferon- γ-inducible protein 10 (IP-10) or granulocyte colony stimulating factor (G-CSF) The term "pro-inflammatory cytokines" also includes other cytokines associated with inflammatory responses known in the art, such as interleukin-1 (IL-1) , interleukin-8 (IL-8), interleukin-12 (IL-12), interleukin-13 (IL-13), interferon-α (IFN-α), etc.

in vitro. As used herein, the term "in vitro" refers to events occurring in an artificial environment, such as in a test tube or reaction vessel, in a cell culture, in a petri dish, etc., but not in an organism (for example, in an animal, plant or microorganism).

in vivo. As used herein, the term "in vivo" refers to events occurring in an organism (eg, in an animal, plant or microorganism or its cell or tissue).

insertion and deletion variants. "Insertional variants", when referring to polypeptides, are variants with one or more inserted amino acids immediately adjacent to an amino acid at a particular position in the native or parent sequence. "Immediately adjacent" to an amino acid means attached to the functional alpha-carboxyl or alpha-amino group of the amino acid. "Deletion variants", when referring to polypeptides, are variants with one or more amino acids deleted from the native or original amino acid sequence. Deletion variants usually remove one or more amino acids in a particular region of the molecule.

Intact. As used herein, in relation to a polypeptide, the term "intact" means retaining the amino acid corresponding to the wild-type protein, for example, without mutation or substitution of the wild-type amino acid. At the same time, in relation to the nucleic acid, the term "intact" means the preservation of the nucleic base corresponding to the nucleic acid of the wild type, for example, without mutation or replacement of the nucleic base of the wild type.

Ionizable amino lipid. The term "ionizable amino lipid" includes those lipids that have one, two, three or more fatty acid or fatty alkyl chains and a pH-titratable amino head group (eg, an alkylamino or dialkylamino head group). An ionizable amino lipid is typically protonated (ie, positively charged) at a pH below the pKa of the amino head group and is essentially uncharged at a pH above the pKa. Such ionizable aminolipids include, without limitation, DLin-MC3-DMA (MC3) and (13Z, 165Z)-N,N-dimethyl-3-nonyldocose-13-16-diene-1-amine (L608).

Dedicated. As used herein, the term "isolated" refers to a substance or object that has been separated from at least some of the components with which it was associated (whether in nature or under experimental conditions). Isolated substances (eg, polynucleotides or polypeptides) may have different levels of purity relative to the substances from which they were isolated. The isolated substances and/or objects can be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more other components with which they were originally associated. In some embodiments, the isolated substances are greater than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97% pure. , about 98%, about 99%, or more than about 99%. As used herein, a substance is "pure" if it is substantially free of other components.

Actually isolated. By "actually isolated" is meant that the compound is actually separated from the environment in which it was formed or detected. Partial separation may include, for example, a composition enriched with a compound of the present invention. The actual separation may encompass compositions containing at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97% or at least about 99% by weight of a compound of the present invention or a salt thereof.

A polynucleotide, vector, polypeptide, cell, or any composition disclosed herein that is "isolated" is a polynucleotide, vector, polypeptide, cell, or composition that is in a form not found in nature. Isolated polynucleotides, vectors, polypeptides, or compositions include those that have been purified to the extent that they are no longer in the form in which they occur naturally. In some aspects, the isolated polynucleotide, vector, polypeptide, or composition is substantially pure.

Isomer. As used herein, the term "isomer" means any tautomer, stereoisomer, enantiomer or diastereomer of any compound of the present invention. It is understood that the compounds of the present invention may have one or more chiral centers and/or double bonds and therefore exist as stereoisomers such as double bond position isomers (i.e. geometric E/Z isomers) or diastereomers (i.e. , enantiomers (i.e. (+) or (-)) or cis/trans isomers). In accordance with the present invention, the chemical structures depicted herein, and therefore the compounds of the present invention, encompass all relevant stereoisomers, i.e. both stereoisomeric pure forms (for example, geometrically pure, enantiomerically pure, or diastereomerically pure), as well as mixtures of enantiomers and stereoisomers, such as racemates. Enantiomer and stereoisomer mixtures of the compounds of the present invention can generally be separated into their constituent enantiomers or stereoisomers by well-known methods such as chiral phase gas chromatography, chiral high performance liquid chromatography, crystallization of a compound as a chiral salt complex, or crystallization compounds in a chiral solvent. Enantiomers and stereoisomers can also be obtained from stereoisomeric or enantiomerically pure intermediates, reagents and catalysts using well known asymmetric synthesis methods.

Linker. As used herein, "linker" refers to a group of atoms, for example, 10-1000 atoms, and can be formed by such atoms or groups as, without limitation, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl group and an imino group. The linker can be attached to the nucleobase or sugar moiety in the modified nucleoside or nucleotide at the first end and to the payload, for example, a detectable or therapeutic agent, at the second end. The linker may be of sufficient length so that it does not interfere with its incorporation into the nucleic acid sequence. The linker can be used for any useful purpose, such as to form polynucleotide multimers (eg, by connecting two or more chimeric polynucleotide or IVT polynucleotide molecules) or polynucleotide conjugates, as well as to introduce the payload described herein. Examples of chemical groups that may be included in the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, and heterocyclyl groups, each of which may optionally be substituted as described in this document. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (eg, ethylene or propylene glycol monomer units, eg, diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof. Other examples include, but are not limited to, cleavable moieties in the linker, such as, for example, a disulfide bond (-S-S-) or azo bond (-N=N-), which can be cleaved by a reducing agent or photolysis. Non-limiting examples of a selectively cleavable bond include an amide bond, which can be cleaved, for example, using tris(2-carboxyethyl)phosphine (TCEP) or other reducing agents and/or photolysis, and an ester bond, which can be cleaved, for example, by acid or alkaline hydrolysis. .

Methods of administration. As used herein, "modes of administration" may include intravenous, intramuscular, intradermal, subcutaneous, or other means of delivering the composition to a subject. The route of administration can be chosen for targeted delivery (eg, specific delivery) to a specific site or body system.

Modified. As used herein, "modified" refers to an altered state or structure of a molecule of the present invention. Molecules can be modified in a variety of ways, including chemically, structurally and functionally. In some embodiments, the mRNA molecules of the present invention are modified by the introduction of non-natural nucleosides and/or nucleotides, for example, as it applies to natural ribonucleotides A, U, G, and C. Non-canonical nucleotides, such as cap structures, are not considered " modified", although they differ in chemical structure from ribonucleotides A, C, G, U.

Slime. As used herein, "mucus" refers to a natural substance that is viscous and contains mucin glycoproteins.

Composition based on nanoparticles. As used herein, a "nanoparticle-based composition" is a composition containing one or more lipids. Compositions based on nanoparticles, as a rule, have dimensions of the order of micrometers or less and may contain a lipid bilayer. Nanoparticle-based compositions include lipid nanoparticles (LNPs), liposomes (eg, lipid vesicles), and lipoplexes. For example, the nanoparticulate composition may be a liposome having a lipid bilayer with a diameter of 500 nm or less.

Natural. As used herein, "natural" means existing in nature without artificial assistance.

A vertebrate animal other than humans. As used herein, "non-human vertebrate" includes all vertebrates other than Homo sapiens, including wild and domesticated species. Examples of non-human vertebrates include, without limitation, mammals such as alpaca, banteng, bison, camel, cat, cattle, deer, dog, donkey, guyal, goat, guinea pig, horse, llama, mule, pig, rabbit, reindeer, sheep, Asian buffalo and yak.

Nucleic acid sequence. The terms "nucleic acid sequence", "nucleotide sequence" or "polynucleotide sequence" are used interchangeably and refer to a continuous nucleic acid sequence. The sequence may be single or double stranded DNA or RNA, such as mRNA.

The term "nucleic acid" in its broadest sense includes any compound and/or substance that contains a polymer of nucleotides. Such polymers are often referred to as polynucleotides. Exemplary nucleic acids or polynucleotides of the present invention include, without limitation, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), threoso nucleic acids (TNA), glycol nucleic acids (GNA), peptido nucleic acids (PNA), locked nucleic acids (LNA, including LNA having β-D-ribo configuration, α-LNA having α-L-ribo configuration (LNA diastereomer), 2'-amino-LNA having 2'-amino functionalization, and 2'-amino-α-LNA having a 2'-amino functionalization), ethylene bridged nucleic acids (ENA), cyclohexene nucleic acids (CeNA), or hybrids or combinations thereof.

The phrase "nucleotide sequence encoding" refers to a nucleic acid coding sequence (eg, an mRNA or DNA molecule) that encodes a polypeptide. The coding sequence may further comprise initiation and termination signals operably linked to regulatory elements, including a promoter and a polyadenylation signal, that are capable of directing expression in cells of the individual or mammal receiving the nucleic acid. The coding sequence may further comprise sequences that encode signal peptides.

Non-targeted. As used herein, "off-target" refers to any unintended effect on any one or more targets, genes, or cellular transcripts.

Open reading frame. As used herein, "open reading frame" or "ORF" refers to a sequence that does not contain a stop codon in the specified reading frame.

Functionally related. As used herein, the phrase "operably linked" refers to a functional connection between two or more molecules, constructs, transcripts, entities, fragments, and the like.

Optionally substituted. As used herein, a phrase of the form "optionally substituted X" (eg, optionally substituted alkyl) is equivalent to "X, where X is optionally substituted" (eg, "alkyl, where said alkyl is optionally substituted"). It is not meant that the feature "X" (eg, alkyl) is itself optional.

Part. As used herein, a "portion" or "section" of a polynucleotide is defined as any portion of a polynucleotide less than the entire length of the polynucleotide.

Patient. As used herein, "patient" refers to a subject who may be seeking or in need of treatment, is in need of treatment, is receiving treatment, will be receiving treatment, or is being treated by a qualified healthcare professional for a specific disease or condition.

Pharmaceutically acceptable. The phrase "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions and/or dosage forms that, based on careful medical evaluation, are suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic reaction, or other problems or complications according to a reasonable benefit/risk ratio.

Pharmaceutically acceptable excipients. The phrase "pharmaceutically acceptable excipient" as used herein refers to any ingredient other than the compounds described herein (for example, a carrier capable of suspending or dissolving the active compound) and having the properties that it is virtually non-toxic and does not cause inflammation in the patient's body. Excipients may include, for example, release agents, antioxidants, binders, coatings, compression aids, leavening agents, colorants (pigments), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, perfumes, glidants (anti-caking agents), lubricants, preservatives, printing inks, sorbents, suspending or dispersing agents, sweeteners and water of hydration. Illustrative excipients include, without limitation: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethyl cellulose, gelatin, hydroxypropyl cellulose,

Hydroxypropyl Methylcellulose, Lactose, Magnesium Stearate, Maltitol, Mannitol, Methionine, Methylcellulose, Methylparaben, Microcrystalline Cellulose, Polyethylene Glycol, Polyvinylpyrrolidone, Povidone, Pregelatinized Starch, Propylparaben, Retinyl Palmitate, Shellac, Silicon Dioxide, Sodium Carboxymethylcellulose, Sodium Citrate, Sodium Starch Glycolate, Sorbitol, Starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C and xylitol.

Pharmaceutically acceptable salts. The present invention also encompasses pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (eg, by reacting the free base group with an appropriate organic acid). Examples of pharmaceutically acceptable salts include, without limitation, mineral or organic acid salts with basic residues such as amines; alkali or organic salts with acidic residues such as carboxylic acid residues, and the like. Exemplary acid addition salts include acetate salts, acetic acid salts, adipate, alginate, ascorbate, aspartate, benzenesulfonate salts, benzenesulphonic acid salts, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentane propionate, digluconate, dodecyl sulfate , ethanesulfonate, fumarate , glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nor cotinate, nitrate, oleate, oxalate, palmitate , pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, etc. Exemplary alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as salts with non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine , trimethylamine, triethylamine, ethylamine, and the like. Pharmaceutically acceptable salts of the present invention include conventional non-toxic salts of the parent compound formed, for example, with non-toxic inorganic or organic acids. Pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound containing a basic or acidic moiety using standard chemical methods. Such salts can generally be prepared by reacting these compounds in their free acid or base form with a stoichiometric amount of an appropriate base or acid in water, or in an organic solvent, or in a mixture of both; typically non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile are used. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, ^17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, PH Stahl and CG Wermuth (eds.), Wiley-VCH, 2008, and Berge et al, Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which incorporated herein by reference in its entirety.

A pharmaceutically acceptable solvate. The term "pharmaceutically acceptable solvate" as used herein means a compound of the present invention wherein suitable solvent molecules are incorporated into the crystal lattice. A suitable solvent is physiologically tolerable at the dose administered. For example, solvates can be obtained by crystallization, recrystallization, or precipitation from a solution containing organic solvents, water, or mixtures thereof. Examples of suitable solvents are ethanol, water (e.g. mono-, di- and trihydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N'-dimethylformamide (DMF), N,N'-dimethylacetamide (DMAC) , 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. If the solvent is water, then the solvate is called a "hydrate".

Pharmacokinetic. As used herein, "pharmacokinetic" refers to any one or more properties of a molecule or compound as it relates to determining the fate of substances introduced into a living organism. Pharmacokinetics is subdivided into several areas of study covering the extent and rate of absorption, distribution, metabolism and excretion. They are commonly referred to as ADME, where: (A) absorption is the process by which a substance enters the circulatory system; (D) distribution is the distribution or dispersal of substances throughout the body fluids and tissues; (M) metabolism (or biotransformation) is the irreversible conversion of parent compounds to metabolite products; and (E) excretion (or elimination) refers to the elimination of a substance from the body. In rare cases, some drugs accumulate irreversibly in body tissues.

Physical and chemical. As used herein, "physico-chemical" means or refers to a physical and/or chemical property.

Polynucleotide. The term "polynucleotide" as used herein refers to polymers of nucleotides, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof, of any length. This term refers to the primary structure of a molecule. Thus, the term includes three-, two- and single-stranded deoxyribonucleic acid ("DNA"), as well as three-, double- and single-stranded ribonucleic acid ("RNA"). It also includes modified, eg, by alkylation and/or capping, and unmodified forms of the polynucleotide. More specifically, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, shRNA, siRNA and mRNA, spliced or unspliced, polynucleotide of any other type, which is an N- or C-glycoside of a purine or pyrimidine base, as well as other polymers containing non-nucleotide backbones, for example, polyamide (for example, "PNA" peptido nucleic acids) and polymorpholine polymers and other synthetic sequence-specific polymeric nucleic acids, provided that the polymers contain nucleic bases in a configuration that allows base pairing and base stacking as found in DNA and RNA. In specific aspects, the polynucleotide contains mRNA. In another aspect, the mRNA is a synthetic mRNA. In some aspects, the synthetic mRNA contains at least one non-natural nucleotide base. In some aspects, all nucleobases of a particular class have been replaced with non-natural nucleobases (eg, all uridine bases in a polynucleotide disclosed herein may be replaced with a non-natural nucleotide base, such as 5-methoxyuridine). In some aspects, the polynucleotide (eg, synthetic RNA or synthetic DNA) contains only natural nucleotide bases, i. A (adenosine), G (guanosine), C (cytidine) and T (thymidine) in the case of synthetic DNA or A, C, G and U (uridine) in the case of synthetic RNA.

One skilled in the art will appreciate that the T bases in the codon maps disclosed herein are present in DNA, while in the corresponding RNAs the T bases will be replaced by U bases. For example, in the nucleotide sequence of the codons disclosed herein in the form of DNA , for example, a vector or template for in vitro translation (IVT), its T bases will be transcribed as U found in its corresponding transcribed mRNA. In this regard, both codon-optimized DNA sequences (containing T) and their corresponding mRNA sequences (containing U) are considered to be codon-optimized nucleotide sequences of the present invention. One skilled in the art will also appreciate that by replacing one or more bases with non-natural bases, equivalent codon maps can be constructed. Thus, for example, the TTC codon (DNA map) will correspond to the UUC codon (RNA map), which in turn will correspond to the ΨΨC codon (RNA map in which U has been replaced by pseudouridine).

Standard base pairs A-T and G-C are formed under conditions that allow the formation of hydrogen bonds between N3-H and C4-hydroxy thymidine and N1 and C6-NH2 of adenosine, respectively, and between C2-oxy, N3 and C4-NH2 of cytidine and, respectively, C2- NH2, N'-H and C6-hydroxy guanosine. Thus, for example, guanosine (2-amino-6-hydroxy-9-β-D-ribofuranosylpurine) can be modified to form isoguanosine (2-hydroxy-6-amino-9-β-D-ribofuranosylpurine). This modification results in a nucleoside base that will no longer efficiently form a standard base pair with cytosine. However, modification of cytosine (1-β-D-ribofuranosyl-2-hydroxy-4-amino pyrimidine) to form isocytosine (1-β-D-ribofuranosyl-2-amino-4-oxypyrimidine) results in a modified nucleotide that will not effectively base pair with guanosine but will base pair with isoguanosine (US Pat. No. 5,681,702 to Collins et al.). Isocytosine is available from Sigma Chemical Co. (St. Louis, Missouri); isocytidine can be obtained using the method described in Switzer et al. (1993) Biochemistry 32:10489-10496 and references cited therein; 2'-deoxy-5-methylisocytidine can be obtained using the method according to Tor et al., 1993, J. Am. Chem. soc. 115:4461-4467 and references cited therein; and isoguanine nucleotides can be obtained using the method described in Switzer et al., 1993 supra, and Mantsch et al., 1993, Biochem. 14:5593-5601, or using the method described in US patent No. 5780610 issued by Collins et al. Other non-natural base pairs can be synthesized using the method described in Piccirilli et al., 1990, Nature 343:33-37 for the synthesis of 2,6-diaminopyrimidine and its complementary (1-methylpyrazolo-[4,3]pyrimidine-5 ,7-(4H,6H)-dione Other such modified nucleotide units are known to form unique base pairs, such as those described in Leach et al.(1992) J. Am. Chem. Soc. 114:3675- 3683 and Switzer et al., supra.

Polypeptide. The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may contain modified amino acids. The terms also cover a polymer of amino acids that has been modified naturally or through intervention; for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification such as conjugation with a labeling moiety. Also included in this definition are, for example, polypeptides containing one or more analogs of amino acids (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known from the level of technology.

The term used in this document refers to proteins, polypeptides and peptides of any size, structure or function. Polypeptides include products encoded by polynucleotides, natural polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing. The polypeptide may be a monomer or may be a multimolecular complex such as a dimer, trimer or tetramer. They may also include single or multi-chain polypeptides. Disulfide bonds are most commonly found in multi-chain polypeptides. The term "polypeptide" can also be applied to polymers of amino acids in which one or more amino acid residues are artificial chemical analogues of the corresponding naturally occurring amino acids. In some embodiments, the "peptide" may be less than or equal to 50 amino acids in length, such as about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

polypeptide variant. As used herein, the term "polypeptide variant" refers to molecules that differ in their amino acid sequence from the native or reference sequence. Amino acid sequence variants may have substitutions, deletions and/or insertions at certain positions in the amino acid sequence compared to the native or reference sequence. Variants typically share at least about 50% identity, at least about 60% identity, at least about 70% identity, at least about 80% identity, at least about 90% identity, at least about 95% identity , at least about 99% identity with the native or reference sequence. In some embodiments, they are at least about 80% or at least about 90% identical to the native or reference sequence.

The amount of polypeptide per drug unit (PUD). As used herein, the PUD or quantity of a product per drug unit is defined as a divided fraction of the total daily dose of a product (such as a polypeptide), typically 1 mg, pg, kg, etc., as measured in body fluid or tissue, usually defined as the concentration in the body fluid, such as pmol/ml, mmol/ml, etc., divided by the dose.

Warning. As used herein, the term "prevention" refers to the partial or complete delay of the onset of an infection, disease, disorder, and/or condition; partial or complete delay in the onset of one or more signs or symptoms, characteristics or clinical manifestations of a particular infection, disease, disorder and/or condition; partial or complete delay in the onset of one or more signs or symptoms, features or manifestations of a particular infection, disease, disorder and/or condition; partial or complete delay in the progression of an infection, a particular disease, disorder and/or condition; and/or to reduce the risk of developing a pathology associated with an infection, disease, disorder, and/or condition.

Proliferate. As used herein, the term "proliferate" means to grow, multiply, or increase, or cause rapid growth, reproduction, or increase. "Proliferative" means having the ability to proliferate. "Anti-proliferative" means having properties opposite or inconsistent with proliferative properties.

Prophylactic. As used herein, "prophylactic" refers to a therapeutic agent or course of action used to prevent the spread of a disease.

Prevention. As used in this document, "prevention" refers to measures taken to maintain health and prevent the spread of disease. "Immunoprophylaxis" refers to measures aimed at developing active or passive immunity to prevent the spread of a disease.

Protein cleavage site. As used herein, a "protein cleavage site" refers to a site at which the controlled cleavage of an amino acid chain can be performed by chemical, enzymatic, or photochemical methods.

protein cleavage signal. As used herein, a "protein cleavage signal" refers to at least one amino acid that marks or marks a polypeptide for cleavage.

Protein of interest. As used herein, the terms "proteins of interest" or "required proteins" include the proteins provided herein as well as fragments, mutants, variants, and modifications thereof.

Proximal. Used in this document, the term "proximal" means located closer to the center or to the point or area of interest.

pseudouridine. As used herein, pseudouridine (ψ) refers to the C-glycosidic isomer of the uridine nucleoside. A "pseudouridine analogue" is any modification, variant, isoform or derivative of pseudouridine. For example, pseudouridine analogs include, without limitation: 1-carboxymethylpseudouridine, 1-propynylpseudouridine, 1-taurinomethylpseudouridine, 1-taurinomethyl-4-thiopseudouridine, 1-methylpseudouridine (m ¹ ψ), 1-methyl-4-thiopseudouridine (m ¹ s ⁴ ψ ), 4-thio-1-methylpseudouridine, 3-methylpseudouridine (m ³ ψ), 2-thio-1-methylpseudouridine, 1-methyl-1-dezazapseudouridine, 2-thio-1-methyl-1-dezazapseudouridine, dihydropseudouridine, 2 -thiodihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thiouridine, 4-methoxypseudouridine, 4-methoxy-2-thiopseudouridine, N1-methylpseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acr ³ ψ) and 2'-0-methylpseudouridine (ψm).

Purified. As used herein, "purify", "refined", "purification" means to make virtually clean or free from unwanted components, material contamination, impurities or defects.

Reference nucleic acid sequence. The terms “reference nucleic acid sequence” or “reference nucleic acid” or “reference nucleotide sequence” or “reference sequence” refer to a parent nucleic acid sequence (e.g. RNA, e.g. mRNA sequence) that can be subjected to sequence optimization. . In some embodiments, the reference nucleic acid sequence is a wild-type nucleic acid sequence, fragment, or variant thereof. In some embodiments, the reference nucleic acid sequence is a nucleic acid sequence previously subjected to sequence optimization.

Salt. In some aspects, a pharmaceutical composition for intratumoral delivery disclosed herein contains salts of some of its lipid moieties. The term "salt" includes any anionic and cationic complex. Non-limiting examples of anions include inorganic and organic anions such as fluoride, chloride, bromide, iodide, oxalate (e.g. hemioxalate), phosphate, phosphonate, hydrogen phosphate, dihydrogen phosphate, oxide, carbonate, bicarbonate, nitrate, nitrite, nitride, bisulfite, sulfide, sulfite, bisulfate, sulfate, thiosulfate, hydrosulfate, borate, formate, acetate, benzoate, citrate, tartrate, lactate, acrylate, polyacrylate, fumarate, maleate, itaconate, glycolate, gluconate, malate, mandelate, tiglat, ascorbate, salicylate, polymethacrylate, perchlorate, chlorate, chlorite, hypochlorite, bromate, hypobromite, iodate, alkylsulfonate, arylsulfonate, arsenate, arsenite, chromate, dichromate, cyanide, cyanate, thiocyanate, hydroxide, peroxide, permanganate, and mixtures thereof.

Sample. As used herein, the term "sample" or "biological sample" refers to a subset of tissues, cells, or constituents (e.g., body fluids, including, but not limited to, blood, mucus, lymph fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). The sample may further include a homogenate, lysate, or extract, or a fraction or portion thereof, obtained from the whole organism or a subset of its tissues, cells, or constituent parts, including, without limitation, for example, from blood plasma, blood serum, cerebrospinal fluid, lymphatic fluid, sections of the outer skin, respiratory tract, intestines and genitourinary tract, tears, saliva, milk, blood cells, tumors, organs. Sample further refers to a medium, such as a nutrient broth or gel, which may contain cellular components such as proteins or a nucleic acid molecule.

signal sequence. As used herein, the phrases "signal sequence", "signal peptide", and "transit peptide" are used interchangeably and refer to a sequence that can direct the transport or localization of a protein to a specific organelle, cellular compartment, or its export to the extracellular space. The term encompasses both a polypeptide signal sequence and a nucleic acid sequence encoding a signal sequence. Thus, references to a signal sequence in relation to a nucleic acid actually refer to the nucleic acid sequence encoding the signal sequence of the polypeptide.

signal transmission path. "Signaling pathway" refers to the biochemical relationship between a variety of signaling molecules that play a role in transmitting a signal from one part of a cell to another part of the cell. As used herein, the phrase "cell surface receptor" includes, for example, molecules and complexes of molecules capable of receiving a signal and transmitting such a signal along the plasma membrane of a cell.

similarity. Used in this document, the term "similarity" refers to the general relationship between polymeric molecules, for example, between polynucleotide molecules (eg, DNA molecules and/or RNA molecules) and/or between polypeptide molecules. The percentage similarity of polymer molecules to each other can be calculated in the same manner as the percentage identity calculation, except that conservative substitutions are taken into account in the percentage similarity calculation, as is customary in the art.

Single standard dose. As used herein, a "single unit dose" is the dose of any therapeutic agent administered in a single dose/at a single point in time/by a single route/at a single point of contact, ie. within a single introduction event.

fractional dose. As used herein, a "fractional dose" is the result of dividing a single unit dose or total daily dose into two or more doses.

specific delivery. As used herein, the terms "specific delivery", "deliver specific" or "deliver specific" means delivering more (e.g., at least 1.5 times more, at least 2 times more, at least 3 at least 4 times more, at least 5 times more, at least 6 times more, at least 7 times more, at least 8 times more, at least 9 times more , at least 10 times greater) amount of polynucleotide nanoparticle in the target tissue of interest (for example, in the liver of a mammal), compared with non-target tissue (for example, the spleen of a mammal). The level of delivery of a nanoparticle to a particular tissue can be measured by comparing the amount of protein produced in a tissue with the weight of said tissue, comparing the amount of a polynucleotide in a tissue with the weight of said tissue, comparing the amount of protein produced in a tissue with the total amount of protein in said tissue, or comparing the amount polynucleotide in tissue with the total amount of polynucleotide in said tissue. For example, in the case of targeting the renal vessels, specific delivery of the polynucleotide occurs to the mammalian kidney, in contrast to the liver and spleen, if the kidney is delivered 1.5, 2 times, 3 times, 5 times, 10 times, 15 times, or 20 times more polynucleotide per 1 g of tissue compared to the amount delivered to the liver or spleen after systemic administration of the polynucleotide. It will be understood that the ability of a nanoparticle to specifically deliver to a target tissue need not be determined in the body of the subject being treated, and may be determined under simulated conditions, such as in an animal model (eg, rat model).

Stable. As used herein, "stable" refers to a compound that is sufficiently stable to withstand isolation from a reaction mixture to an applicable degree of purity, and in some cases capable of being formulated into an effective therapeutic agent.

stabilized. As used herein, the terms "stabilize", "stabilized", "stabilized region" mean to make or become stable.

Stereoisomer. As used herein, the term "stereoisomer" refers to all possible different isomeric as well as conformational forms that a compound (e.g., a compound of any formula described herein) may have, in particular all possible stereochemically and conformational isomeric forms, all diastereomers, enantiomers and/or conformers of the basic molecular structure. Some compounds of the present invention may exist in various tautomeric forms, all of which are included within the scope of the present invention.

Subject. By "subject" or "individual" or "animal" or "patient" or "mammal" is meant any subject, in particular a mammalian subject, for which diagnosis, prognosis or therapy is required. Mammalian subjects include, without limitation, humans, domestic animals, farm animals, zoo animals, sports animals, pets such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows; primates such as great apes, non-human apes, orangutans and chimpanzees; canids such as dogs and wolves; felines such as cats, lions and tigers; equines such as horses, donkeys and zebras; bears, animals kept for food such as cows, pigs and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; etc. In certain embodiments, the mammal is a human subject. In other embodiments, the subject is a human patient. In a specific embodiment, the subject is a human patient in need of treatment.

Actually. As used herein, the term "actually" refers to the qualitative state of manifestation of the characteristic or property of interest to its full or near full extent or extent. It will be appreciated by those skilled in the art of biology that the biological and chemical characteristics are rarely, if ever, fully formed and/or continue to manifest themselves to the end or to the achievement or avoidance of an absolute result. Therefore, the term "actually" is used in this document to cover the potential lack of completeness inherent in many biological and chemical characteristics.

Actually equal. The term used herein, as it relates to time differences between doses, means plus or minus 2%.

Actually simultaneous. As used herein, the term as it relates to multiple doses means within 2 seconds.

Suffering from. An individual "suffering from" a disease, disorder and/or condition has been diagnosed with or is exhibiting one or more signs or symptoms of the disease, disorder and/or condition.

exposed. An individual "susceptible" to a disease, disorder and/or condition has not been diagnosed and/or may not exhibit signs or symptoms of the disease, disorder and/or condition, but is predisposed to developing the disease or its signs or symptoms. In some embodiments, the individual affected by the disease, disorder, and/or condition (eg, cancer) may be characterized by one or more of the following: (1) a genetic mutation associated with the development of the disease, disorder, and/or condition; (2) genetic polymorphism associated with the development of the disease, disorder and/or condition; (3) increased and/or decreased expression and/or activity of a protein and/or nucleic acid associated with the disease, disorder and/or condition; (4) habits and/or lifestyle habits associated with the development of the disease, disorder and/or condition; (5) having a family history of the disease, disorder, and/or condition; and (6) exposure to and/or infection with a microorganism associated with the development of the disease, disorder, and/or condition. In some embodiments, an individual subject to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual subject to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.

Delayed release. Used in this document, the term "sustained release" refers to the release profile of a pharmaceutical composition or compound, which corresponds to the release rate over a specific period of time.

Synthetic. The term "synthetic" means manufactured, obtained and/or made by human hands. Synthesis of polynucleotides or other molecules according to the present invention may be chemical or enzymatic.

target cells. As used herein, "target cells" refers to any one or more cells of interest. The cells may be in vitro, in vivo, in situ, or in a tissue or organ of the body. The organism may be an animal, such as a mammal, a human, a subject, or a patient.

Target tissue. As used herein, "target tissue" refers to any one or more tissue types of interest, delivery of a polynucleotide to which will result in the desired biological and/or pharmacological effect. Examples of target tissues of interest include specific tissues, organs, and systems or groups thereof. In specific applications, the target tissue may be the kidney, lung, spleen, vascular endothelium in vessels (eg, intracoronary or intrafemoral injection), or tumor tissue (eg, intratumoral injection). "Non-target tissue" refers to any one or more tissue types in which the expression of the encoded protein does not result in the desired biological and/or pharmacological effect. In specific routes of application, non-target tissues may include the liver and spleen.

The presence of a therapeutic agent in a non-target tissue may result from: (i) leakage of a polynucleotide from the site of administration to a peripheral tissue or distant target tissue (eg, liver) via diffusion or through the bloodstream (eg, a polynucleotide designed to express a polypeptide in a particular tissue may reach the liver and the polypeptide can be expressed in the liver); or (ii) leakage of the polypeptide after administration of a polynucleotide encoding such a polypeptide into peripheral tissue or a distant non-target tissue (eg, liver) by diffusion or through the blood stream (eg, the polynucleotide may express the polypeptide in the target tissue and the polypeptide may diffuse into the peripheral tissue ).

targeting sequence. As used herein, the phrase "targeting sequence" refers to a sequence that can direct the transport or localization of a protein or polypeptide.

End. As used herein, the terms "ends" or "terminus" when referring to polypeptides refer to the terminal portion of a peptide or polypeptide. Such a terminus is not limited to the first or last site of a peptide or polypeptide, but may include additional amino acids at the terminus. The polypeptide molecules of the present invention can be characterized as having both an N-terminus (ending in an amino acid with a free amino group (NH ₂ )) and a C-terminus (ending in an amino acid with a free carboxyl group (COOH)). The proteins of the present invention in some cases consist of several polypeptide chains linked to each other by disulfide bonds or by non-covalent forces (multimers, oligomers). These types of proteins have several N- and C-termini. Alternatively, the ends of the polypeptides can be modified to begin or end with a non-polypeptide moiety, such as an organic conjugate, as appropriate.

Therapeutic agent. The term "therapeutic agent" refers to an agent that, when administered to a subject, has a therapeutic, diagnostic and/or prophylactic effect and/or produces the desired biological and/or pharmacological effect. For example, in some embodiments, the mRNA encoding the relaxin polypeptide may be a therapeutic agent. In other embodiments, the therapeutic agent may be a therapeutic protein.

A therapeutically effective amount. As used herein, the term "therapeutically effective amount" means the amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) which, when administered to a subject suffering from an infection, a disease , disorder and/or condition or subject to it, is sufficient to treat, improve signs or symptoms, diagnose, prevent and/or delay the onset of infection, disease, disorder and/or condition.

therapeutically effective result. As used herein, the term “therapeutically effective outcome” means an outcome that, in a subject suffering from or susceptible to an infection, disease, disorder and/or condition, is sufficient to treat, ameliorate signs or symptoms, diagnose, prevent and/or delay the onset of infections, diseases, disorders and/or conditions.

total daily dose. As used herein, "total daily dose" is the amount given or administered on a 24 hour period. The total daily dose may be administered as a single unit dose or as a divided dose.

transcription factor. As used herein, the term "transcription factor" refers to a DNA-binding protein that regulates the transcription of DNA into RNA, for example, by activating or repressing transcription. Some transcription factors regulate transcription in isolation, while others act in concert with other proteins. Some transcription factors can both activate and repress transcription under certain conditions. Typically, transcription factors bind to a specific target sequence or target sequences that have a high degree of similarity to a specific consensus sequence in the regulatory region of the target gene. Transcription factors can regulate the transcription of a target gene alone or in combination with other molecules.

Transcription. As used herein, the term "transcription" refers to methods for producing mRNA (eg, mRNA sequence or template mRNA) from DNA (eg, DNA template or DNA sequence).

Transfection. As used herein, "transfection" refers to the introduction of a polynucleotide into a cell in which the polypeptide encoded by the polynucleotide (eg, mRNA) is expressed or the polypeptide modulates cellular function (eg, siRNA, miRNA). As used herein, "expression" of a nucleic acid sequence refers to translation of a polynucleotide (eg, mRNA) into a polypeptide or protein and/or post-translational modification of the polypeptide or protein.

Carrying out treatment, treatment, therapy. As used herein, the terms "administering treatment" or "treatment" or "therapy" refer to the partial or complete alleviation, reduction in intensity, improvement, attenuation, delay in onset, inhibition of progression, reduction in the severity and/or reduction in the incidence of one or more signs, or symptoms, or characteristic features of a disease. For example, "treatment" of a heart disease may refer to alleviating the signs or symptoms associated with the disease, prolonging the life (survival) of patients, reducing the severity of the disease, preventing or delaying the onset of the disease, and so on. Treatment may be administered to a subject who is not showing symptoms of a disease, disorder, and/or condition and/or to a subject who is showing only early symptoms of a disease, disorder, and/or condition, in order to reduce the risk of developing a pathology associated with disease, disorder and/or condition.

Unmodified. As used herein, "unmodified" refers to any substance, compound, or molecule that has not been modified in some way. "Unmodified" may refer to, but does not always refer to, the wild-type or native form of the biomolecule. Molecules can undergo a number of modifications, in which each modified molecule can serve as an "unmodified" parent molecule for subsequent modification.

Uracil. Uracil is one of four nucleotide bases in an RNA nucleic acid and is represented by the letter U. Uracil can be attached to a ribose ring, or more specifically to ribofuranose, via a β-N ₁ -glycosidic bond to form a uridine nucleoside. The uridine nucleoside is also usually abbreviated according to the single letter code for its nucleobase, i.e. U. Thus, in the context of the present invention, if a monomer in a polynucleotide sequence is U, then that U is interchangeably "uracil" or "uridine".

uridine content. The terms "uridine content" or "uracil content" are interchangeable and refer to the amount of uracil or uridine present in a particular nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute (total number of uridine or uracil residues in a sequence) or relative (percentage of uridine or uracil relative to the total number of nucleotide bases in a nucleic acid sequence) value.

Uridine-modified sequence. The term "uridine-modified sequence" refers to a nucleic acid that has undergone sequence optimization (e.g., a synthetic mRNA sequence), with a different total or local uridine content (higher or lower uridine content), or with a different uridine base order (e.g., gradient distribution or clustering) compared to the uridine content and/or the order of the uridine bases in the candidate nucleic acid sequence. In the content of the present invention, the terms "uridine-modified sequence" and "uracil-modified sequence" are considered equivalent and interchangeable.

A "high uridine codon" is defined as a codon containing two or three uridine bases, a "low uridine codon" is defined as a codon containing one uridine base, and a "uridine free codon" is a codon without any uridine bases. grounds. In some embodiments, the uridine-modified sequence comprises high uridine codon substitutions with low uridine codons, substitutions of high uridine codons with non-uridine codons, substitutions of low uridine codons with high uridine codons, substitutions of low codons uridine with non-uridine codons, substitutions of non-uridine codons with low uridine codons, substitutions of non-uridine codons with high uridine codons, and combinations thereof. In some embodiments, a high uridine codon may be replaced with another high uridine codon. In some embodiments, the low uridine codon may be replaced with another low uridine codon. In some embodiments, a non-uridine codon may be replaced with another non-uridine codon. The uridine-modified sequence may be uridine-enriched or uridine-depleted.

Enriched with uridine. As used herein, the term "uridine-enriched" and its grammatical variants refer to the increase in uridine content (expressed as an absolute value or as a percentage) in a nucleic acid subjected to sequence optimization (e.g., in a synthetic mRNA sequence) compared to the content uridine in the corresponding candidate nucleic acid sequence. Enrichment in uridine can be achieved by replacing codons in the candidate nucleic acid sequence with synonymous codons containing fewer uridine nucleotide bases. Uridine enrichment can be global (ie, over the entire length of the candidate nucleic acid sequence) or local (ie, over a subsequence or region of the candidate nucleic acid sequence).

Depleted in uridine. As used herein, the term "uridine-poor" and its grammatical variants refer to the reduction in uridine content (expressed as an absolute value or as a percentage) in a sequence-optimized nucleic acid (e.g., in a synthetic mRNA sequence) compared to uridine in the corresponding candidate nucleic acid sequence. Uridine depletion can be achieved by replacing codons in the candidate nucleic acid sequence with synonymous codons containing fewer uridine nucleotide bases. Uridine depletion can be global (ie, over the entire length of the candidate nucleic acid sequence) or local (ie, over a subsequence or region of the candidate nucleic acid sequence).

Option. The term "variant" as used in the present invention refers to both naturally occurring variants (e.g., polymorphisms, isoforms, etc.) and artificial variants in which at least one amino acid residue in the native or parent sequence (e.g., in the wild-type sequence) was deleted and another amino acid was inserted at the same position in its place. Such variants may be described as "substitutional variants". Substitutions can be single, in which only one amino acid is replaced in the molecule, or they can be multiple, in which two or more amino acids are replaced in the same molecule. If amino acids are inserted or deleted, the resulting variant will be the "insertion variant" or "deletion variant" respectively.

Equivalents and Scope of the Invention

Those skilled in the art will recognize, or be able to determine, by carrying out only routine experimentation, the presence of many equivalents of the specific embodiments in accordance with the present invention described herein. The scope of the present invention is not meant to be limited by the above description, but rather as set forth in the appended claims.

In the claims, singular forms may mean one or more than one, unless otherwise indicated or otherwise evident from the context. A claim or description that contains "or" between one or more members of a group is deemed to be satisfied if one, more than one, or all of the members of the group are present in, used in, or otherwise related to said product or method, unless stated to the contrary or otherwise is not clear from the context. The present invention includes embodiments in which exactly one member of the group is present in, used in, or otherwise related to said product or method. The present invention includes embodiments in which more than one member or all members of a group are present in, used in, or otherwise related to said product or method.

It should also be noted that the term "comprising" is meant to be open-ended and allows the inclusion of additional elements or steps, but does not require it. Where the term "comprising" is used in this document, the term "consisting of" is also covered and disclosed accordingly.

Where ranges are specified, endpoints are included in them. In addition, it should be understood that unless otherwise indicated or otherwise obvious from the context and understood by a person skilled in the art, values expressed as ranges can take on any specific values or subranges within the indicated ranges in various embodiments of the present invention up to tenths fractions of one of the lower limit of the range, unless the context clearly requires otherwise.

In addition, it should be understood that any particular embodiment of the present invention that is within the prior art may be expressly excluded from any one or more claims. Since such embodiments appear to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not explicitly stated herein. Any particular embodiment of the compositions of the present invention (e.g., any nucleic acid or protein encoded by it; any method of preparation; any method of use, etc.) may be excluded from any one or more claims for any reason, regardless of whether whether it is related to the existence of the prior art or not.

All cited sources, such as literature, publications, databases, database records, and prior art materials cited in this document, are incorporated into this application by reference, even if not expressly indicated when citing. In the event of a conflict between statements in the cited source and this application, the statement in this application will take precedence.

Section and table titles are not meant to be limiting.

EXAMPLES

Example 1 Production of Polynucleotides

In accordance with the present invention, the production of polynucleotides and/or parts or regions thereof can be performed using the methods set forth in international application WO 2014/152027 entitled "Manufacturing Methods for Production of RNA Transcripts", the contents of which are incorporated herein by reference throughout its completeness.

Purification methods may include those set forth in international applications WO 2014/152030 and WO 2014/152031, each of which is incorporated herein by reference in its entirety.

Methods for detecting and characterizing polynucleotides can be carried out as set forth in WO 2014/144039, which is incorporated herein by reference in its entirety.

The characterization of the polynucleotides of the present invention can be performed by a procedure selected from the group consisting of polynucleotide mapping, reverse transcriptase sequencing, charge distribution analysis, and detection of RNA contaminants, where the characterization includes sequencing of the RNA transcript, determination of the purity of the RNA transcript or determining the charge heterogeneity of the RNA transcript. Such methods are set forth, for example, in WO 2014/144711 and WO 2014/144767, the contents of each of which are incorporated herein by reference in their entirety.

Example 2 Synthesis of Chimeric Polynucleotides

Introduction

In accordance with the present invention, two sections or two parts of a chimeric polynucleotide can be connected or ligated using a triphosphate chemical method.

In accordance with this method, the first section or the first part of 100 nucleotides or less is synthesized chemically with 5'-monophosphate and terminal 3'-des-OH or blocked OH. If the region is longer than 80 nucleotides, then it can be synthesized as two strands for ligation.

If the first region or first portion is synthesized as a positionally unmodified region or portion by in vitro transcription (IVT), then the 5'-monophosphate conversion must then occur followed by capping of the 3' end.

The protecting groups for the monophosphate may be selected from any of the protecting groups known in the art.

The second region or second portion of the chimeric polynucleotide can be synthesized using chemical synthesis or IVT methods. IVT methods may include the use of an RNA polymerase that may use a cap-modified primer. Alternatively, a cap no longer than 130 nucleotides in length can be chemically synthesized and attached to a region or portion obtained by IVT.

It should be noted that in ligation methods, ligation with T4 DNA ligase followed by DNase treatment should avoid linkage of fragments.

It is not necessary that all of the chimeric polynucleotide produced have a sugar phosphate backbone. If one of the regions or one of the parts encodes a polypeptide, then it is preferred that such region or part contains a sugar phosphate backbone.

Ligation is then carried out using any of the known click chemistry, orthogonal click chemistry, Solulink, or other bioconjugation chemistries known to those skilled in the art.

Synthesis path

The chimeric polynucleotide is produced using a number of parent segments. Such segments include:

(a) a capped and protected 5' segment containing a normal 3'-OH (segment 1);

(b) a 5'-triphosphorylated segment, which may contain a polypeptide coding region and contains a normal 3'-OH (segm. 2);

(c) A 5'-monophosphorylated segment for the 3'-end of the chimeric polynucleotide (eg tail) containing cordycepin or not containing 3'-OH (segm. 3).

After synthesis (chemically or by IVT), segment 3 (segm. 3) is treated with cordycepin and then with pyrophosphatase to form 5'-monophosphate.

Segment 2 (segm. 2) is then ligated with segment. 3 using DNA ligase. The ligated polynucleotide is then purified and treated with pyrophosphatase to remove the diphosphate. Processed construction segm.2-segm. 3 is then cleared, and segm. 1 is ligated to the 5' end. You can carry out the stage of additional purification of the chimeric polynucleotide.

In cases where the chimeric polynucleotide encodes a polypeptide, the ligated or fused segments can be represented as follows: 5'-UTR (segment 1), open reading frame or ORF (segment 2), and 3'-UTR + poly-A ( segment 3).

Recovery rates at each stage can be up to 90-95%.

Example 3 PCR to obtain cDNA

PCR procedures for cDNA preparation were performed using 2x KAPA HIFI™ hot start PCR mix from Kapa Biosystems (Woburn, Massachusetts). This system contains 12.5 µl of 2x KAPA premix; 0.75 µl forward primer (10 µM); 0.75 µl reverse primer (10 µM); 100 ng cDNA template, and diluted with dH ₂ O to 25.0 µl. Reaction conditions are as follows: 95°C for 5 min and 25 cycles at 98°C for 20 s, then 58°C for 15 s, then 72°C for 45 s, then 72°C for 5 min , then 4°C until complete.

Reaction products were purified using the PURELINK™ PCR Micro PCR Purification Kit from Invitrogen (Carlsbad, CA) according to the manufacturer's instructions (up to 5 μg). Larger scale reactions require purification with a product with greater capability. After purification, the cDNA is quantified with NANODROP™ and analyzed by agarose gel electrophoresis to confirm that the cDNA is of the expected size. The cDNA is then submitted for analysis by sequencing before proceeding to the in vitro transcription reaction.

Example 4 In Vitro Transcription (IVT)

As a result of the in vitro transcription reaction, polynucleotides containing uniformly modified polynucleotides are formed. Such uniformly modified polynucleotides may comprise a portion or portion of the polynucleotides of the present invention. The feed mixture of triphosphorylated nucleotides (NTPs) is prepared in situ using natural and non-natural NTPs.

A typical in vitro transcription reaction mixture is as follows:

The crude mixture obtained by IVT can be stored at 4° C. overnight for purification the next day. 1 unit The RNase-free DNase is then used to cleave the original template. After 15 minutes incubation at 37° C., mRNA was purified using the MEGACLEAR™ kit from Ambion (Austin, TX) according to the manufacturer's instructions. Up to 500 µg of RNA can be purified with this kit. After purification, the RNA is quantified with NanoDrop and analyzed by agarose gel electrophoresis to confirm that the RNA is of the correct size and that no degradation of the RNA has occurred.

Example 5 Enzymatic Capping

Polynucleotide capping is carried out as follows, where the mixture contains: 60 μg - 180 μg of RNA obtained by IVT and up to 72 μl of dH ₂ O. The mixture is incubated at 65°C for 5 minutes to denature the RNA, and then immediately transferred on ice.

The protocol then involves mixing 10x capping buffer (0.5 M Tris-HCl (pH 8.0), 60 mM KCl, 12.5 mM MgCl ₂ ) (10.0 μl); 20 mM GTP (5.0 µl); 20 mM S-adenosylmethionine (2.5 µl); RNase inhibitor (100 units); 2'-O-methyltransferase (400 units); vaccinia virus capping enzyme (guanylyltransferase) (40 units); dH ₂ O (up to 28 µl); and incubation at 37°C for 30 minutes for 60 μg of RNA or up to 2 hours for 180 μg of RNA.

The polynucleotide is then purified using the MEGACLEAR™ kit from Ambion (Austin, TX) according to the manufacturer's instructions. After purification, the RNA is quantified with NANODROP™ (ThermoFisher, Waltham, MA) and analyzed by agarose gel electrophoresis to confirm that the RNA is of the correct size and that no degradation of the RNA has occurred. The RNA product can also be sequenced by performing reverse transcription PCR to generate cDNA for sequencing.

Example 6 Poly-A tail addition reaction

Without poly-T in the cDNA, a poly-A tail addition reaction should be carried out before purification of the final product. This is done by mixing the capped RNA obtained by IVT (100 µl); RNase inhibitor (20 units); 10x tailing buffer (0.5 M Tris-HCl (pH 8.0), 2.5 M NaCl, 100 mM MgCl ₂ ) (12.0 μl); 20 mM ATP (6.0 µl); poly-A-polymerase (20 units); to 123.5 µl dH ₂ O and incubation at 37°C for 30 min. If the poly-A tail is already present in the transcript, then one can skip the tail attachment reaction and proceed directly to purification with the MEGACLEAR™ kit from Ambion (Austin, TX) (up to 500 µg). The poly-A polymerase is preferably a recombinant yeast-expressed enzyme.

It should be understood that the processivity or integrity of the poly-A tail addition reaction may not always result in the formation of a poly-A tail of the exact size. Therefore, poly-A tails are about 40-200 nucleotides long, e.g., about 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, 110, 150-165, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164 or 165, are within the scope of this inventions.

Example 7 Natural 5' Caps and 5' Cap Analogs

5' capping of polynucleotides can be performed simultaneously during an in vitro transcription reaction using the following chemical analogs of RNA caps to form a 5' guanosine cap structure according to the manufacturer's protocols: 3'-O-Me-m7G(5')ppp( 5')G [cap ARCA]; G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). 5'-capping of the modified RNA can be performed after transcription with the vaccinia virus capping enzyme to form "cap 0": m7G(5')ppp(5')G (New England BioLabs, Ipswich, Massachusetts). Cap structure 1 can be formed using both the vaccinia virus capping enzyme and 2'-O-methyltransferase to form m7G(5')ppp(5')G-2'-O-methyl. Cap 2 can be formed from cap 1 followed by 2'-O-methylation of the third nucleotide from the 5' end with 2'-O methyltransferase. Cap 3 can be formed from cap 2 followed by 2'-O-methylation of the fourth nucleotide from the 5' end with 2'-O methyltransferase. The enzymes are preferably obtained from a recombinant source.

When transfected with mammalian cells, the modified mRNAs are stable for 12-18 hours or more than 18 hours, eg 24, 36, 48, 60, 72 or more than 72 hours.

Example 8 Capping Assays

A. Protein expression analysis

Polynucleotides encoding polypeptides containing any of the caps set forth herein can be transfected into cells at equal concentrations. The amount of protein secreted into the culture medium can be analyzed by ELISA at 6, 12, 24 and 36 hours after transfection. Synthetic polynucleotides providing higher levels of protein secretion into the medium will correspond to synthetic polynucleotides with a more translationally competent cap structure.

B. Synthesis Purity Analysis

Polynucleotides encoding polypeptides containing any of the caps set forth herein can be compared for purity by urea denaturing agarose gel electrophoresis or HPLC analysis. Polynucleotides with a single continuous band on electrophoresis correspond to a higher purity product than polynucleotides with multiple bands or discontinuous bands. Synthetic polynucleotides with a single peak in HPLC will also correspond to a higher purity product. A higher efficiency capping reaction will produce a purer group of polynucleotides.

C. Cytokine analysis

Polynucleotides encoding polypeptides containing any of the caps set forth herein can be introduced into cells by transfection at several concentrations. The amount of pro-inflammatory cytokines such as TNF-alpha and IFN-beta secreted into the culture medium can be analyzed by ELISA at 6, 12, 24 and 36 hours after transfection. Polynucleotides leading to the secretion of pro-inflammatory cytokines into the environment at higher levels will correspond to polynucleotides containing an immunoactivating cap structure.

D. Efficiency of the capping reaction

Polynucleotides encoding polypeptides containing any of the caps set forth herein can be analyzed for the efficiency of the capping reaction by LC-MS after nuclease treatment. Treatment of capped polynucleotides with nucleases will result in a mixture of free nucleotides and capped nucleotides with a 5'-5-triphosphate cap structure, detectable by LC-MS. The amount of capped product in the LC-MS spectra can be expressed as a percentage of the total number of polynucleotides in the reaction and will correspond to the efficiency of the capping reaction. For a cap structure with a higher efficiency of the capping reaction, LC-MS will detect the presence of a higher amount of capped product.

Example 9 Agarose Gel Electrophoresis of Modified RNA or RT-PCR Products

Single polynucleotides (200-400 ng in a 20 µl volume) or reverse transcription PCR products (200-400 ng) are loaded per well into a non-denaturing 1.2% agarose E-Gel (Invitrogen, Carlsbad, CA) and run for 12 -15 minutes according to the manufacturer's protocol.

Example 10 Modified RNA Quantification with NanoDrop and UV Spectroscopy Data

Modified polynucleotides in TE buffer (1 μl) are used to read absorbance in the UV region of the spectrum using NanoDrop to quantify the yield of each polynucleotide from chemical synthesis or in vitro transcription reaction.

Example 11 Compilation of modified mRNAs using lipidoids

The polynucleotides are formulated for in vitro experiments by mixing the polynucleotides with a lipidoid in a predetermined ratio prior to addition to cells. In vivo formulation may require the addition of additional ingredients to facilitate circulation throughout the body. To test the ability of such lipidoids to form particles suitable for in vivo functioning, the standard formulation method used to formulate siRNA lipidoids can be used as a starting point. After particle formation, a polynucleotide is added which is allowed to integrate with the complex. Encapsulation efficiency is determined using standard dye exclusion assays.

Example 12 Formation of Functional Relaxin Protein from mRNA Encoding Relaxin

mRNA variants encoding relaxin were synthesized as described in examples 1-11 in order to obtain constructs that would have a longer blood half-life. Wild-type relaxin consists of two peptides: chain A and chain B and contains 53 amino acids. A light chain (kappa) variable portion (VLk) of a human IgG immunoglobulin targeting human serum albumin of 108 amino acids was synthesized and added to wild-type relaxin A chain (FIG. 1).

Three independent transfection studies were performed in EXP1293f cells and cAMP assays in CHO-K1 cells expressing RXFP1 (FIG. 2). In vitro activity confirmation assays demonstrated that the mRNA encoding VLk-hRLN2 produces a functional relaxin protein. Interestingly, the VLk fusion protein was found to be less active (about 50%) in vitro compared to wild-type relaxin. All tested mRNAs produced VLk-hRLN2 proteins with similar specific activities.

Also, in an in vivo interpubic ligament elongation (ILE) assay in mice, it was shown that a functional protein is formed from the VLk-hRLN2 fusion protein. Estradiol-primed female CD1 mice were given a single IV bolus dose (0.5 mg/kg) of the VLk-hRLN2 fusion protein. Twenty-four hours later, the mice were dissected and the interpubic ligaments were measured. As shown in FIG. 6, the interpubic ligament measurement score was significantly higher for all tested variants compared to the negative control group.

Example 13 In vivo studies of mRNA encoding relaxin: rats with spontaneous hypertension

Rats with spontaneous hypertension were used to investigate the effects of the VLk-hRLN2 construct in vivo. Rats were initially implanted with telemetry devices. Blood was collected to determine baseline levels of circulating relaxin. Throughout the study, heart rate and blood pressure were continuously monitored (systolic and diastolic arterial blood pressure was measured for 10 seconds every 10 minutes). Rats were divided into four groups (N=8 rats per group): mo5U-construct 1, mo5U-wild type, m1Ψ-Luc and rhRLN2. The first three groups received three IV infusions seven days apart. The fourth group, rhRLN2, were implanted with subcutaneous pumps and administered rhRLN2 over a 14 day infusion period at a constant rate. Blood was collected from all rats before infusion and then at 6 hours, 12 hours, one day, two days, four days, and six days after infusion (in the case of groups given IV administration, the next "pre-dose" measurement was taken at seventh day prior to IV dose).

In spontaneously hypertensive rats given IV injections, the mRNA encoding VLk-hRLN2 has been shown to produce a functional protein with sustained activity. The heart rate data shown in FIG. 3A demonstrate that the relaxin-VLk fusion protein was less potent compared to wild-type relaxin in vivo. Data shown are averaged over daytime and nighttime periods (mean +/- SD), with animal handling periods excluded (N=8 rats per group). Data on heart rate in rats fluctuate from lows (day) to highs (night). The diastolic blood pressure data (FIG. 3B) also demonstrated that the VLk fusion protein had robust in vivo activity. Although the active compound was less potent, the longer half-life may provide a beneficial therapeutic effect.

In spontaneously hypertensive rats, levels of circulating relaxin protein were also measured (FIG. 4). WKY rats were given a single bolus injection of 0.5 mg/kg of RNA encoding VLk fusion protein construct 1 (SEQ ID NO: 5) in nanoparticles containing compound 18. Blood plasma samples were ELISA tested for human RLN2 protein; it was found that in the rat model, blood levels of the VLk fusion protein were higher than wild-type relaxin levels (FIG. 7).

Example 14 In vivo studies of mRNA encoding relaxin: cynomolgus macaques

The levels of circulating relaxin protein in cynomolgus monkeys were also studied. Two groups of cynomolgus monkeys (N=5 previously naive male monkeys per group) were tested using IV infusion or subcutaneous injections. The IV administration group was given 0.5 mg/kg of mRNA encoding relaxin-2 (VLk fusion protein, construct 1, RNA of SEQ ID NO: 1) in lipid nanoparticles containing Compound 18 by a one-hour infusion of one once every two weeks for four weeks. The dose concentration was 0.1 mg/ml in a volume of 5 ml/kg. The subcutaneous administration group received mRNA encoding relaxin-2 (VLk fusion protein, RNA of SEQ ID NO: 1) in lipid nanoparticles containing Compound 18 co-formulated with a corticosteroid. The dose volume was 0.5 ml/kg and the dose concentration was 1.0 mg/ml.

Circulating relaxin levels were found to exceed target concentrations in cynomolgus monkeys given IV injections for up to six days post-infusion (FIG. 5). Of note, all subjects returned to baseline after 14 days. However, repeated dosing has been shown to result in poor protein pharmacokinetics (FIG. 9).

An additional study also examined the effects of repeated IV dosing using two different lipid nanoparticle formulations in cynomolgus monkeys. In this study, RNA under SEQ ID NO: 1 was formulated in two different kinds of lipid nanoparticles, one containing compound 18 and the other containing compound 403. Subjects were given 0.5 mg/kg of each of the formulations once every two weeks for four weeks. Blood plasma samples were then analyzed by ELISA against human relaxin-2 and the results are shown in FIG. 10. In addition, circulating mRNA levels for the RNA of SEQ ID NO: 5 were found to be similar after the first, second, and third doses, as demonstrated by bDNA analysis using blood plasma from the study described above (Fig. 11 ).

Example 15 In vivo studies of mRNA encoding relaxin: mice

Mice received IV injections of mRNA encoding relaxin-2 (coding for a fusion protein with VLk under SEQ ID NO: 2), and the concentration of circulating relaxin was measured at various time points after the infusion. The mRNA encoding relaxin-2 (VLk fusion protein, construct 1) was found to express relaxin at concentrations above the target concentration for up to eight days (FIG. 8).

Sequences

The underline indicates the signal sequence

The foregoing description of specific embodiments so completely discloses the general nature of the present invention that others, using knowledge within the competence in this field, can easily modify and/or adapt such specific embodiments for various applications without undue experimentation, without departing from the general idea. of the present invention. Therefore, such adaptations and modifications are intended to be within the definition and range of equivalents of the disclosed embodiments based on the ideas and principles presented herein. It should be understood that the language or terminology in this document is for purposes of description and not limitation, and therefore the terminology or language in this description should be interpreted by the skilled person in light of these ideas and principles. The breadth and scope of the present invention should not be limited by any of the illustrative embodiments described above, but should only be determined in accordance with the following claims and their equivalents.

All publications, patent applications, patents and other references mentioned in this document are incorporated by reference in their entirety. In the event of conflict, the present description, including definitions, shall prevail.

--->

SEQUENCE LIST

<110> ModernaTX, Inc.

<120> POLYNUCLEOTIDES ENCODING RELAXIN

<130> M1378.70064WO00

<140> Not yet assigned

<141> 2017-05-18

<150> US 62/338,470

<151> 2016-05-18

<160> 589

<170> PatentIn version 3.5

<210> 1

<211> 185

<212> PROTEIN

<213> Homo sapiens

<400> 1

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 2

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 2

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agacaactct acagtgcatt ggctaataaa tgttgccatg ttggttgtac caaaagatct 540

cttgctagat tttgc 555

<210> 3

<211> 117

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 3

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Gly Asp Phe Ile Gln Thr Val Ser Leu Gly

65 70 75 80

Ile Ser Pro Asp Gly Gly Lys Ala Leu Arg Thr Gly Ser Cys Phe Thr

85 90 95

Arg Glu Phe Leu Gly Ala Leu Ser Lys Leu Cys His Pro Ser Ser Thr

100 105 110

Lys Ile Gln Lys Pro

115

<210> 4

<211> 351

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 4

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca ggtgatttta ttcaaacagt ctcactggga 240

atctcaccgg acggagggaa agcactgaga acaggaagct gcttcacccg agagttcctt 300

ggtgcccttt ccaaattgtg ccatccttca tcaacaaaga tacagaaacc a 351

<210> 5

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 5

augccccgcc uguucuucuu ccaccuccuu ggcgugugcc uccuccucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accuggucca agcgcucccu cucccaggag 180

gacgccccac agaccccgcg ccccgucgcc gagaucgucc ccuccuucau caacaaggac 240

accgagacga ucaacaugau guccgaguuc gucgccaacc ugccgcagga gcucaagcuc 300

acccucccg agaugcagcc cgcccucccg cagcuccagc agcacguccc cguccucaag 360

gacuccuccc uccucuucga ggaguucaag aagcucaucc gcaaccgcca guccgaggcc 420

gccgacucca gccccuccga gcugaaguac cucggccucg acacccacuc ccgcaagaag 480

cgccagcucu acuccgcccu cgccaacaag ugcugccacg ucggcugcac caagcggucc 540

cuggcccgcu ucugcgggagg cggcggcucu ggcgguggug gauccggcgg cgguggcagc 600

gacauccaga ugacccaguc cccauccagc cugagcgccu ccgucggcga ccgcgucacc 660

aucaccugcc gcgccucccg ccccaucggc accaugcucu ccugguacca gcagaagccc 720

ggcaaggccc cgaagcuccu cauccucgcc uucucccgcc uccaguccgg cgucccguca 780

agguucuccg gcucgggcuc cgguaccgac uucacccuca ccaucuccuc gcuccagcca 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg ucgagaucaa gcgc 924

<210> 6

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 6

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 7

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 7

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 8

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 8

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 9

<211> 173

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 9

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

50 55 60

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

65 70 75 80

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

85 90 95

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

100 105 110

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

130 135 140

Gly Gly Gly Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys

145 150 155 160

His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 10

<211> 173

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 10

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

50 55 60

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

65 70 75 80

Gly Gly Gly Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser

85 90 95

Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu

100 105 110

Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

130 135 140

Gly Gly Gly Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys

145 150 155 160

His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 11

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 11

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 12

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 12

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 13

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 13

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 14

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 14

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 15

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 15

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 16

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 16

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 17

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 17

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 18

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 18

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 19

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 19

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 20

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 20

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 21

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 21

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 22

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 22

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 23

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 23

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 24

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 24

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 25

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 25

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 26

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 26

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 27

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 27

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 28

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 28

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 29

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 29

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 30

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 30

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 31

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 31

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 32

<211> 92

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 32

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Asn Gly Ser Thr Asn Asp Ser Asn Gly

50 55 60

Ser Thr Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

65 70 75 80

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

85 90

<210> 33

<211> 92

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 33

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Asn Gly Ser Thr Asn Thr Ser Asn Gly

50 55 60

Asp Thr Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

65 70 75 80

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

85 90

<210> 34

<211> 92

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 34

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Asn Gly Lys Thr Asn Thr Ser Asn Gly

50 55 60

Asp Thr Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

65 70 75 80

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

85 90

<210> 35

<211> 97

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 35

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asn Ser Gly Ser Thr Ser Ser Gly

50 55 60

Asn Ser Gly Ser Gly Asn Ser Gly Ser Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys

<210> 36

<211> 97

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 36

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asn Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Asn Ser Gly Ser Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys

<210> 37

<211> 97

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 37

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asn Ser Gly Ser Asp Thr Gly Ser

50 55 60

Gly Asn Ser Lys Ser Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys

<210> 38

<211> 97

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 38

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asn Ser Gly Ser Asp Thr Ser Gly

50 55 60

Lys Asn Ser Gly Asp Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys

<210> 39

<211> 97

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 39

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys

<210> 40

<211> 107

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 40

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Ser Gly Ser Thr Asn Asp Ser Asn Gly

50 55 60

Ser Thr Gly Thr Gly Ser Asp Gly Ser Thr Asn Gly Ser Asp Gly Ser

65 70 75 80

Thr Gly Gly Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val

85 90 95

Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

100 105

<210> 41

<211> 127

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 41

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asn Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Ser Thr Asn Ser Gly Ser Asp Thr Ser Ser Gly Asn Ser Gly Ser

65 70 75 80

Gly Asn Ser Gly Ser Lys Gly Thr Gly Ser Asp Gly Ser Thr Asn Gly

85 90 95

Ser Asn Gly Ser Thr Gly Gly Gln Leu Tyr Ser Ala Leu Ala Asn Lys

100 105 110

Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

115 120 125

<210> 42

<211> 447

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 42

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Met Val Arg Ser Val Glu Cys Pro

195 200 205

Pro Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu Phe Pro

210 215 220

Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr

225 230 235 240

Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Gln Phe Asn

245 250 255

Trp Tyr Val Asp Gly Met Glu Val His Asn Ala Lys Thr Lys Pro Arg

260 265 270

Glu Glu Gln Phe Asn Ser Thr Phe Arg Val Val Ser Val Leu Thr Val

275 280 285

Val His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Ala Val Ser

290 295 300

Asn Lys Gly Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys

305 310 315 320

Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu

325 330 335

Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe

340 345 350

Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu

355 360 365

Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser Asp Gly Ser Phe

370 375 380

Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly

385 390 395 400

Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr

405 410 415

Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Gly Lys Pro Ile Pro

420 425 430

Asn Pro Leu Leu Gly Leu Asp Ser Thr His His His His His His

435 440 445

<210> 43

<211> 328

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 43

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp

305 310 315 320

Ser Thr His His His His His His

325

<210> 44

<211> 97

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 44

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Ser Gly Gly Gly Ser Gly Ser Ser Ser

50 55 60

Gly Ser Ser Gly Ser Gly Gly Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys

<210> 45

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 45

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 46

<211> 178

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 46

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Lys Arg

35 40 45

Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala Glu

50 55 60

Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met Met

65 70 75 80

Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser

85 90 95

Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val Leu

100 105 110

Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn

115 120 125

Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu

130 135 140

Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu

145 150 155 160

Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg

165 170 175

Phe Cys

<210> 47

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 47

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Glu Pro Lys Ser Ser Asp

35 40 45

Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly

50 55 60

Ser Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile

65 70 75 80

Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

85 90 95

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

100 105 110

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

115 120 125

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

130 135 140

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

145 150 155 160

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

165 170 175

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

180 185 190

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

195 200 205

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

210 215 220

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

225 230 235 240

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

245 250 255

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

260 265 270

Gly Lys Arg Lys Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 48

<211> 166

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 48

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Gly Gly Gly Gly Ser Gly

35 40 45

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

50 55 60

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Phe Gln Ser

65 70 75 80

Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu

85 90 95

Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Leu

130 135 140

Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg

145 150 155 160

Ser Leu Ala Arg Phe Cys

165

<210> 49

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 49

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 50

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 50

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 51

<211> 178

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 51

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Lys Arg

35 40 45

Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala Glu

50 55 60

Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met Met

65 70 75 80

Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser

85 90 95

Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val Leu

100 105 110

Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn

115 120 125

Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu

130 135 140

Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu

145 150 155 160

Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg

165 170 175

Phe Cys

<210> 52

<211> 186

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 52

Met Ser Ser Arg Leu Leu Leu Gln Leu Leu Gly Phe Trp Leu Phe Leu

1 5 10 15

Ser Gln Pro Cys Arg Ala Arg Val Ser Glu Glu Trp Met Asp Gln Val

20 25 30

Ile Gln Val Cys Gly Arg Gly Tyr Ala Arg Ala Trp Ile Glu Val Cys

35 40 45

Gly Pro Ser Val Gly Arg Leu Ala Leu Ser Gln Glu Glu Pro Ala Pro

50 55 60

Leu Ala Arg Gln Ala Thr Ala Glu Val Val Pro Ser Phe Ile Asn Lys

65 70 75 80

Asp Ala Glu Pro Phe Asp Met Thr Leu Lys Cys Leu Pro Asn Leu Ser

85 90 95

Glu Glu Arg Lys Ala Ala Leu Ser Glu Gly Arg Ala Pro Phe Pro Glu

100 105 110

Leu Gln Gln His Ala Pro Ala Leu Ser Asp Ser Val Val Arg Leu Glu

115 120 125

Gly Phe Lys Lys Thr Phe His Asn Gln Leu Gly Glu Ala Glu Asp Gly

130 135 140

Gly Pro Pro Glu Leu Lys Tyr Leu Gly Ser Asp Ala Gln Ser Arg Lys

145 150 155 160

Lys Arg Gln Ser Gly Ala Leu Leu Ser Glu Gln Cys Cys His Ile Gly

165 170 175

Cys Thr Arg Arg Ser Ile Ala Lys Leu Cys

180 185

<210> 53

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 53

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 54

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 54

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 55

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 55

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 56

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 56

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 57

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 57

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 58

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 58

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 59

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 59

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 60

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 60

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 61

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 61

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 62

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 62

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 63

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 63

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 64

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 64

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 65

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 65

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 66

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 66

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 67

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 67

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 68

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 68

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 69

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 69

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 70

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 70

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 71

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 71

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 72

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 72

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 73

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 73

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 74

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 74

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 75

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 75

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 76

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 76

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 77

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 77

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 78

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 78

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 79

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 79

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 80

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 80

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 81

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 81

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 82

<211> 170

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 82

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Gly Gly

35 40 45

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

50 55 60

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

65 70 75 80

Ser Phe Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser

85 90 95

Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly

145 150 155 160

Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

165 170

<210> 83

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 83

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Glu Pro Lys Ser Ser Asp

35 40 45

Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly

50 55 60

Ser Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile

65 70 75 80

Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

85 90 95

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

100 105 110

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

115 120 125

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

130 135 140

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

145 150 155 160

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

165 170 175

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

180 185 190

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

195 200 205

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

210 215 220

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

225 230 235 240

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

245 250 255

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

260 265 270

Gly Lys Arg Lys Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 84

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 84

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 85

<211> 177

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 85

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

50 55 60

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

65 70 75 80

Gly Gly Ser Gly Gly Gly Gly Ser Phe Gln Ser Ser Ser Ser Lys Ala

85 90 95

Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp

100 105 110

Thr Pro Ile Leu Pro Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

130 135 140

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Leu Tyr Ser Ala Leu Ala

145 150 155 160

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

165 170 175

Cys

<210> 86

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 86

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 87

<211> 412

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 87

Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

1 5 10 15

Ala Asp Ser Trp Met Glu Glu Val Ile Lys Leu Cys Gly Arg Glu Leu

20 25 30

Val Arg Ala Gln Ile Ala Ile Cys Gly Met Ser Thr Trp Ser Glu Pro

35 40 45

Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu

50 55 60

Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

65 70 75 80

Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp

85 90 95

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

100 105 110

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

115 120 125

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

130 135 140

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

145 150 155 160

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

165 170 175

Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn

180 185 190

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

195 200 205

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

210 215 220

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

225 230 235 240

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

245 250 255

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

260 265 270

Ser Leu Ser Pro Gly Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp

275 280 285

Ala Pro Gln Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile

290 295 300

Asn Lys Asp Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn

305 310 315 320

Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu

325 330 335

Pro Gln Leu Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu

340 345 350

Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala

355 360 365

Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser

370 375 380

Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His

385 390 395 400

Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe Cys

405 410

<210> 88

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 88

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 89

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 89

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 90

<211> 306

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 90

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu

50 55 60

Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Phe

65 70 75 80

Thr Phe Asn Ser Ser Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys

85 90 95

Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Asp Arg Thr Tyr

100 105 110

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser

115 120 125

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr

130 135 140

Ala Val Tyr Tyr Cys Thr Thr Asp Pro Arg Tyr His Tyr Asn Gly

145 150 155 160

Leu Ala Val Arg Gly Gln Gly Thr Thr Val Thr Val Ser Ser Lys Arg

165 170 175

Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala Glu

180 185 190

Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met Met

195 200 205

Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser

210 215 220

Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val Leu

225 230 235 240

Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn

245 250 255

Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu

260 265 270

Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu

275 280 285

Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg

290 295 300

Phe Cys

305

<210> 91

<211> 306

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 91

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu

50 55 60

Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe

65 70 75 80

Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys

85 90 95

Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr

100 105 110

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser

115 120 125

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr

130 135 140

Ala Val Tyr Tyr Cys Thr Lys Asp Pro Arg Tyr His Tyr Thr Gly

145 150 155 160

Leu Ala Val Arg Gly Gln Gly Thr Thr Val Thr Val Ser Ser Lys Arg

165 170 175

Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala Glu

180 185 190

Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met Met

195 200 205

Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu Ser

210 215 220

Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val Leu

225 230 235 240

Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg Asn

245 250 255

Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr Leu

260 265 270

Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala Leu

275 280 285

Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg

290 295 300

Phe Cys

305

<210> 92

<211> 177

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 92

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Asn Ser Gly Asp Gly Asn Ser Gly Phe Gln Ser Ser Ser Ser Ser Lys

65 70 75 80

Ala Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser

85 90 95

Asp Thr Pro Ile Leu Pro Gln Phe Gln Ser Ser Ser Ser Lys Ala Pro

100 105 110

Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr

115 120 125

Pro Ile Leu Pro Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser

130 135 140

Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

145 150 155 160

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

165 170 175

Cys

<210> 93

<211> 147

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 93

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Gly Gly Gly Ser Phe Gln Ser Ser Ser Ser

50 55 60

Lys Ala Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro

65 70 75 80

Ser Asp Thr Pro Ile Leu Pro Gln Phe Gln Ser Ser Ser Ser Ser Lys Ala

85 90 95

Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp

100 105 110

Thr Pro Ile Leu Pro Gln Gly Gly Gly Gly Ser Gln Leu Tyr Ser Ala

115 120 125

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

130 135 140

Arg Phe Cys

145

<210> 94

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 94

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 95

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 95

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 96

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 96

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 97

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 97

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 98

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 98

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 99

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 99

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 100

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 100

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 101

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 101

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 102

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 102

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 103

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 103

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 104

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 104

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 105

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 105

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 106

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 106

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 107

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 107

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 108

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 108

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 109

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 109

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 110

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 110

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 111

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 111

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 112

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 112

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 113

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 113

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

50 55 60

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

85 90 95

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

100 105 110

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

115 120 125

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

130 135 140

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

145 150 155 160

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

165 170 175

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

180 185 190

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

195 200 205

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

210 215 220

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

225 230 235 240

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

245 250 255

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

260 265 270

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 114

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 114

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 115

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 115

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 116

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 116

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 117

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 117

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 118

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 118

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 119

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 119

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 120

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 120

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 121

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 121

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 122

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 122

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 123

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 123

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 124

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 124

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 125

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 125

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 126

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 126

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 127

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 127

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 128

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 128

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 129

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 129

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 130

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 130

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 131

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 131

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 132

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 132

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 133

<211> 419

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 133

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

50 55 60

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

65 70 75 80

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

85 90 95

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

100 105 110

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

115 120 125

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

130 135 140

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

145 150 155 160

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

165 170 175

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

180 185 190

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

195 200 205

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

210 215 220

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

225 230 235 240

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

245 250 255

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

260 265 270

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Ser Thr Trp Ser Lys

275 280 285

Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro Arg Pro Val Ala

290 295 300

Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu Thr Ile Asn Met

305 310 315 320

Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu Lys Leu Thr Leu

325 330 335

Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln His Val Pro Val

340 345 350

Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys Lys Leu Ile Arg

355 360 365

Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser Glu Leu Lys Tyr

370 375 380

Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln Leu Tyr Ser Ala

385 390 395 400

Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala

405 410 415

Arg Phe Cys

<210> 134

<211> 411

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 134

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser Gly Asn Ser Gly

100 105 110

Asp Gly Asn Ser Gly Gly Ser Ser Gly Gly Gly Ser Gly Ser Ser Ser

115 120 125

Gly Ser Ser Gly Ser Gly Gly Ser Gly Gly Ser Thr Asp Ser Gly Ser

130 135 140

Asp Thr Ser Ser Gly Asn Ser Gly Asp Gly Asn Ser Gly Gly Ser Ser

145 150 155 160

Gly Gly Gly Ser Gly Ser Ser Ser Gly Ser Ser Gly Ser Gly Gly Ser

165 170 175

Gly Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

180 185 190

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

195 200 205

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

210 215 220

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

225 230 235 240

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

245 250 255

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

260 265 270

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

275 280 285

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

290 295 300

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

305 310 315 320

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

325 330 335

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

340 345 350

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

355 360 365

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

370 375 380

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

385 390 395 400

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys

405 410

<210> 135

<211> 331

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 135

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

100 105 110

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

115 120 125

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

130 135 140

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

145 150 155 160

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

165 170 175

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

180 185 190

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

195 200 205

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

210 215 220

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

225 230 235 240

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

245 250 255

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

260 265 270

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

275 280 285

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

290 295 300

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

305 310 315 320

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys

325 330

<210> 136

<211> 351

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 136

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser Gly Asn Ser Gly

100 105 110

Asp Gly Asn Ser Gly Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

115 120 125

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

130 135 140

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

145 150 155 160

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

165 170 175

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

180 185 190

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

195 200 205

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

210 215 220

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

225 230 235 240

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

245 250 255

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

260 265 270

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

275 280 285

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

290 295 300

Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln

305 310 315 320

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

325 330 335

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys

340 345 350

<210> 137

<211> 439

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 137

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Ser Thr Asp Ser Gly Ser

180 185 190

Asp Thr Ser Ser Gly Asn Ser Gly Asp Gly Asn Ser Gly Glu Pro Lys

195 200 205

Ser Ser Asp Lys Thr His Thr Ser Pro Ser Pro Ala Pro Glu Leu

210 215 220

Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr

225 230 235 240

Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp Val

245 250 255

Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val

260 265 270

Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser

275 280 285

Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu

290 295 300

Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala

305 310 315 320

Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro

325 330 335

Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln

340 345 350

Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala

355 360 365

Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr

370 375 380

Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu

385 390 395 400

Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser

405 410 415

Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser

420 425 430

Leu Ser Pro Gly Lys Arg Lys

435

<210> 138

<211> 439

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 138

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

165 170 175

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

180 185 190

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

195 200 205

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

210 215 220

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

225 230 235 240

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

245 250 255

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

260 265 270

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

275 280 285

Pro Arg Glu Pro Gln Val Tyr Thr Lys Pro Ser Arg Asp Glu Leu

290 295 300

Thr Lys Asn Gln Val Ser Leu Ser Cys Leu Val Lys Gly Phe Tyr Pro

305 310 315 320

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

325 330 335

Tyr Lys Thr Thr Val Pro Val Leu Asp Ser Asp Gly Ser Phe Arg Leu

340 345 350

Ala Ser Tyr Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

355 360 365

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

370 375 380

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Gly Ser Thr Asp Ser

385 390 395 400

Gly Ser Asp Thr Ser Ser Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln

405 410 415

Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys

420 425 430

Arg Ser Leu Ala Arg Phe Cys

435

<210> 139

<211> 326

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 139

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly

165 170 175

Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser

180 185 190

Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp

195 200 205

Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser

210 215 220

Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu

225 230 235 240

Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr

245 250 255

Cys Thr Lys Asp Pro Pro Arg Tyr His Tyr Thr Gly Leu Ala Val Arg

260 265 270

Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Ser Thr Asp Ser Gly

275 280 285

Ser Asp Thr Ser Ser Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln Leu

290 295 300

Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg

305 310 315 320

Ser Leu Ala Arg Phe Cys

325

<210> 140

<211> 439

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 140

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser Pro Pro Ser Pro

165 170 175

Ala Pro Glu Leu Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys

180 185 190

Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val

195 200 205

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

210 215 220

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

225 230 235 240

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

245 250 255

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

260 265 270

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

275 280 285

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Ser Arg Asp Glu Leu

290 295 300

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

305 310 315 320

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

325 330 335

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

340 345 350

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

355 360 365

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

370 375 380

Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys Gly Ser Thr Asp Ser

385 390 395 400

Gly Ser Asp Thr Ser Ser Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln

405 410 415

Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys

420 425 430

Arg Ser Leu Ala Arg Phe Cys

435

<210> 141

<211> 439

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 141

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Ser Thr Asp Ser Gly Ser

180 185 190

Asp Thr Ser Ser Gly Asn Ser Gly Asp Gly Asn Ser Gly Glu Pro Lys

195 200 205

Ser Ser Asp Lys Thr His Thr Ser Pro Ser Pro Ala Pro Glu Leu

210 215 220

Leu Gly Gly Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr

225 230 235 240

Leu Tyr Ile Thr Arg Glu Pro Glu Val Thr Cys Val Val Val Asp Val

245 250 255

Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val

260 265 270

Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser

275 280 285

Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu

290 295 300

Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala

305 310 315 320

Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro

325 330 335

Gln Val Tyr Thr Lys Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln

340 345 350

Val Ser Leu Ser Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala

355 360 365

Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr

370 375 380

Val Pro Val Leu Asp Ser Asp Gly Ser Phe Arg Leu Ala Ser Tyr Leu

385 390 395 400

Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser

405 410 415

Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser

420 425 430

Leu Ser Pro Gly Lys Arg Lys

435

<210> 142

<211> 326

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 142

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Ser Thr Asp Ser Gly Ser

180 185 190

Asp Thr Ser Ser Gly Asn Ser Gly Asp Gly Asn Ser Gly Glu Val Gln

195 200 205

Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg

210 215 220

Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser

225 230 235 240

Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala Ile

245 250 255

Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg

260 265 270

Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met

275 280 285

Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Thr Lys Asp

290 295 300

Pro Pro Arg Tyr His Tyr Thr Gly Leu Ala Val Arg Gly Gln Gly Thr

305 310 315 320

Thr Val Thr Val Ser Ser

325

<210> 143

<211> 439

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 143

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Asn Ser Gly Asp Gly Asn Ser Gly Glu Pro Lys Ser Ser Asp Lys

65 70 75 80

Thr His Thr Ser Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser

85 90 95

Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr

100 105 110

Arg Glu Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp

115 120 125

Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn

130 135 140

Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val

145 150 155 160

Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu

165 170 175

Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys

180 185 190

Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr

195 200 205

Lys Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Ser

210 215 220

Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu

225 230 235 240

Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Val Pro Val Leu

245 250 255

Asp Ser Asp Gly Ser Phe Arg Leu Ala Ser Tyr Leu Thr Val Asp Lys

260 265 270

Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu

275 280 285

Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

290 295 300

Lys Arg Lys Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln Thr Pro

305 310 315 320

Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp Thr Glu

325 330 335

Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln Glu Leu

340 345 350

Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu Gln Gln

355 360 365

His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu Phe Lys

370 375 380

Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser Pro Ser

385 390 395 400

Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys Arg Gln

405 410 415

Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys Thr Lys

420 425 430

Arg Ser Leu Ala Arg Phe Cys

435

<210> 144

<211> 238

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 144

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser Gly Asn Ser Gly

100 105 110

Asp Gly Asn Ser Gly Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu

115 120 125

Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe

130 135 140

Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys

145 150 155 160

Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr

165 170 175

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser

180 185 190

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr

195 200 205

Ala Val Tyr Tyr Cys Thr Lys Asp Pro Arg Tyr His Tyr Thr Gly

210 215 220

Leu Ala Val Arg Gly Gln Gly Thr Thr Val Thr Val Ser Ser

225 230 235

<210> 145

<211> 351

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 145

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser

50 55 60

Gly Asn Ser Gly Asp Gly Asn Ser Gly Gln Leu Tyr Ser Ala Leu Ala

65 70 75 80

Asn Lys Cys Cys His Val Gly Cys Thr Lys Arg Ser Leu Ala Arg Phe

85 90 95

Cys Gly Ser Thr Asp Ser Gly Ser Asp Thr Ser Ser Gly Asn Ser Gly

100 105 110

Asp Gly Asn Ser Gly Glu Pro Lys Ser Ser Asp Lys Thr His Thr Ser

115 120 125

Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val Phe Leu

130 135 140

Phe Pro Pro Lys Pro Lys Asp Thr Leu Tyr Ile Thr Arg Glu Pro Glu

145 150 155 160

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys

165 170 175

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

180 185 190

Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu

195 200 205

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

210 215 220

Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

225 230 235 240

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Lys Pro Pro Ser

245 250 255

Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Leu Val Lys

260 265 270

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

275 280 285

Pro Glu Asn Asn Tyr Lys Thr Thr Val Pro Val Leu Asp Ser Asp Gly

290 295 300

Ser Phe Arg Leu Ala Ser Tyr Leu Thr Val Asp Lys Ser Arg Trp Gln

305 310 315 320

Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

325 330 335

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Lys

340 345 350

<210> 146

<211> 185

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 146

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys

180 185

<210> 147

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 147

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 148

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 148

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 149

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 149

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 150

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 150

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 151

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 151

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 152

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 152

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 153

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 153

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 154

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 154

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 155

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 155

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 156

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 156

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 157

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 157

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 158

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 158

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 159

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 159

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 160

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 160

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 161

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 161

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 162

<211> 308

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 162

Met Pro Arg Leu Phe Phe Phe His Leu Leu Gly Val Cys Leu Leu Leu

1 5 10 15

Asn Gln Phe Ser Arg Ala Val Ala Asp Ser Trp Met Glu Glu Val Ile

20 25 30

Lys Leu Cys Gly Arg Glu Leu Val Arg Ala Gln Ile Ala Ile Cys Gly

35 40 45

Met Ser Thr Trp Ser Lys Arg Ser Leu Ser Gln Glu Asp Ala Pro Gln

50 55 60

Thr Pro Arg Pro Val Ala Glu Ile Val Pro Ser Phe Ile Asn Lys Asp

65 70 75 80

Thr Glu Thr Ile Asn Met Met Ser Glu Phe Val Ala Asn Leu Pro Gln

85 90 95

Glu Leu Lys Leu Thr Leu Ser Glu Met Gln Pro Ala Leu Pro Gln Leu

100 105 110

Gln Gln His Val Pro Val Leu Lys Asp Ser Ser Leu Leu Phe Glu Glu

115 120 125

Phe Lys Lys Leu Ile Arg Asn Arg Gln Ser Glu Ala Ala Asp Ser Ser

130 135 140

Pro Ser Glu Leu Lys Tyr Leu Gly Leu Asp Thr His Ser Arg Lys Lys

145 150 155 160

Arg Gln Leu Tyr Ser Ala Leu Ala Asn Lys Cys Cys His Val Gly Cys

165 170 175

Thr Lys Arg Ser Leu Ala Arg Phe Cys Gly Gly Gly Gly Ser Gly Gly

180 185 190

Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro

195 200 205

Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg

210 215 220

Ala Ser Arg Pro Ile Gly Thr Met Leu Ser Trp Tyr Gln Gln Lys Pro

225 230 235 240

Gly Lys Ala Pro Lys Leu Leu Ile Leu Ala Phe Ser Arg Leu Gln Ser

245 250 255

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr

260 265 270

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

275 280 285

Ala Gln Ala Gly Thr His Pro Thr Thr Phe Gly Gln Gly Thr Lys Val

290 295 300

Glu Ile Lys Arg

305

<210> 163

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 163

atgccccgcc tgttcttctt ccacctcctt ggcgtgtgcc tcctcctcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtcca agcgctccct ctcccaggag 180

gacgccccac agaccccgcg ccccgtcgcc gagatcgtcc cctccttcat caacaaggac 240

accgagacga tcaacatgat gtccgagttc gtcgccaacc tgccgcagga gctcaagctc 300

accctctccg agatgcagcc cgccctcccg cagctccagc agcacgtccc cgtcctcaag 360

gactcctccc tcctcttcga ggagttcaag aagctcatcc gcaaccgcca gtccgaggcc 420

gccgactcca gcccctccga gctgaagtac ctcggcctcg acacccactc ccgcaagaag 480

cgccagctct actccgccct cgccaacaag tgctgccacg tcggctgcac caagcggtcc 540

ctggcccgct tctgcgggagg cggcggctct ggcggtggtg gatccggcgg cggtggcagc 600

gacatccaga tgacccagtc cccatccagc ctgagcgcct ccgtcggcga ccgcgtcacc 660

atcacctgcc gcgcctcccg ccccatcggc accatgctct cctggtacca gcagaagccc 720

ggcaaggccc cgaagctcct catcctcgcc ttctcccgcc tccagtccgg cgtcccgtca 780

aggttctccg gctcgggctc cggtaccgac ttcaccctca ccatctcctc gctccagcca 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tcgagatcaa gcgc 924

<210> 164

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 164

atgccgac tgttcttctt ccacctcctc ggcgtgtgcc tcctccttaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagca agcggagcct gagccaggag 180

gacgcccctc agaccccgcg gccagtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgagacaa tcaacatgat gagcgagttc gtggccaacc tgccccagga gctgaagctg 300

accctgagcg agatgcagcc cgccctgccg cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggagttcaag aagctgatcc ggaaccggca gagcgaggcc 420

gccgactcca gccccagcga actgaagtac ctgggcctgg acacccacag cgggaagaag 480

cggcagctgt acagcgccct ggccaacaag tgctgccacg tgggctgcac caagcgatcc 540

ctggcccggt tctgcggcgg cggaggcagc ggcggtggcg gaagcgggagg cggcggcagc 600

660

atcacctgcc gggccagccg gcccatcggc accatgctga gctggtacca gcagaagccc 720

ggcaaggccc cgaagctgct gatcctggcc ttctccaggc tgcagagcgg cgtgccgagc 780

cggttcagcg gctccggcag cggaaccgac ttcaccctga ccatctcaag cctgcagccg 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tggagatcaa gcgg 924

<210> 165

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 165

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agacaactct acagtgcatt ggctaataaa tgttgccatg ttggttgtac caaaagatct 540

cttgctagat tttgc 555

<210> 166

<211> 519

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 166

atgcctaggc tctttttctt ccacttgcta ggggtgtgct tgttgttaaa ccagtttagt 60

agagcggtcg ccgattcttg gatggaggaa gtgataaagc tctgtgggcg ggaattagtc 120

180

ggaggaggga gcggcgggagg aggctcaggc ggcggaggaa gtggtggcgg tggctcaggt 240

ggcggaggat ctgggggcgg cggaagcggc ggaggaggat ctgggggcgg tggaagtggc 300

ggaggtggggt ctggcggggg aggagtggc gggggcggtt ccgggggtgg aggcagcggga 360

ggcggtggct ccgggggggg tggttccggt ggtggcgggt caggaggagg ggggtcaggc 420

ggcggaggat ccggcggcgg cggctcccaa cttttattcgg ctctggctaa taaatgctgt 480

cacgtgggct gcaccaaacg ttcgcttgcg cggttttgt 519

<210> 167

<211> 519

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 167

atgcctcgac tgttttttctt tcacctccta ggagtctgct tacttctcaa ccagttcagt 60

agggcagtcg cggactcatg gatggaagag gttattaaat tatgtggccg tgaattggtg 120

cgtgcacaaa tagctatttg cggcatggggc ggtggcggct ctggtggcgg cggctctgga 180

gggggcggaa gtggtggagg aggtagtggc ggaggtggat cgggaggcgg aggatctgga 240

ggggggggct cctttcaaag ctcctcgagc aaagcgcccc ctcccagcct gcccagccct 300

agtaggctgc ccggtccgag cgacacgccc atcctgcccc agggtggcgg tggctctgggg 360

ggtggcggtt caggcgggagg tggttctggc ggaggcggat caggtggtgg gggatccggc 420

ggcggcggat ctggtggcgg ggggagtcag ctctactctg cgttggccaa taaatgctgc 480

catgttggtt gtacaaaaag atctttggct agattttgc 519

<210> 168

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 168

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatggag cccaagagca gcgacaagac ccacaccagc 180

ccccccagcc ccgcccccga gctgctgggc ggcagcagcg tgttcctgtt cccccccaag 240

cccaaggaca ccctgtacat caccagggag cccgaggtga cctgcgtggt ggtggacgtg 300

agccacgagg accccgaggt gaagttcaac tggtacgtgg acggcgtgga ggtgcacaac 360

gccaagacca agcccaggga ggagcagtac aacagcacct acagggtggt gagcgtgctg 420

accgtgctgc accaggactg gctgaacggc aaggagtaca agtgcaaggt gagcaacaag 480

gccctgcccg cccccatcga gaagaccatc agcaaggcca agggccagcc cagggagccc 540

caggtgtaca ccctgcccc cagcagggac gagctgacca agaaccaggt gagcctgacc 600

tgcctggtga agggcttcta ccccagcgac atcgccgtgg agtgggagag caacggccag 660

cccgagaaca actacaagac cacccccccc gtgctggaca gcgacggcag cttcttcctg 720

tacagcaagc tgaccgtgga caagagcagg tggcagcagg gcaacgtgtt cagctgcagc 780

gtgatgcacg aggccctgca caaccactac acccagaaga gcctgagcct gagccccggc 840

aagaggaaga gcacctggag caaaaggtct ctgagccagg aagatgctcc tcagacacct 900

agaccagtgg cagaaattgt gccatccttc atcaacaaag atacagaaac cataaatatg 960

atgtcagaat ttgttgctaa tttgccacag gagctgaagt taaccctgtc tgagatgcag 1020

ccagcattac cacagctaca acaacatgta cctgtattaa aagattccag tcttctcttt 1080

gaagaattta agaaacttat tcgcaataga caaagtgaag ccgcagacag cagtccttca 1140

gaattaaaat acttaggctt ggatactcat tctcgaaaaa agagacaact ctacagtgca 1200

ttggctaata aatgttgcca tgttggttgt accaaaagat ctcttgctag attttgc 1257

<210> 169

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 169

atgcccaggc tgttcttctt ccacctgctg ggagtgtgcc tcctgctgaa ccagttcagc 60

120

cgagcccaaa tcgccatctg cgggatgtcc acctggagca agagaagcct gtcccaggag 180

gatgcccccc aaacgcccag gcccgtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgagacca tcaacatgat gtccgagttc gtggccaacc tgccccagga gctgaagctg 300

accctgtccg agatgcagcc agccctcccc cagctgcagc agcacgtgcc cgtgttgaag 360

gacagcagcc tgctgttcga ggagttcaaa aagctgatac gcaacaggca gagcgaggcg 420

gccgacagct ccccgtcgga gctgaagtac ctggggctgg acacccacag ccggaagaag 480

cggcagctgt acagcgcact ggccaacaaa tgttgccacg tgggctgcac caagaggagc 540

ctggccaggt tctgc 555

<210> 170

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 170

atgcccaggc tgttcttctt ccacctcctg ggtgtgtgcc tgctgctgaa ccagtttagc 60

agggccgtgg ccgacagctg gatggaggag gtgatcaagc tgtgcggcag ggagctcgtg 120

cgagcgcaga tcgccatctg cggcatgagc acctggagta agaggagcct ctcccaggag 180

gacgcccccc agacgccacg cccggtggcg gagatcgtgc cctccttcat caacaaggac 240

acagagacca tcaacatgat gagcgagttt gtggccaacc tgccccagga acttaagctg 300

accctcagcg agatgcagcc ggcccttccc cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggagttcaaa aagctgatcc gcaataggca gagcgaggcc 420

gccgactcca gccccagcga gctgaagtat ctgggcctgg acacccacag caggaagaaa 480

cggcagctgt acagcgcgct ggcgaacaag tgctgccacg tgggctgcac caagaggtcg 540

ctcgccaggt tctgc 555

<210> 171

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 171

atgcccaggc tgttcttctt tcacctgctg ggcgtgtgtc tgctgctcaa ccagtttagc 60

120 cgcgccgtgg

agggcccaga tcgccatctg cggaatgtcc acctggagca agaggagcct gagccaggag 180

gacgccccac agactccgcg gccggttgcg gagatcgtgc cctccttcat caataaagat 240

accgagacca tcaacatgat gtccgagttc gtggccaacc tgccgcagga gctgaaactc 300

accctcagcg agatgcagcc cgcgctgccc cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgtttga agaattcaaa aaactgatcc ggaaccgaca gagcgaggcc 420

gccgactcca gccccagcga actgaagtac ctggggctgg acacccacag cgggaaaaag 480

cggcagctgt acagcgcact ggccaataag tgttgccacg tcggctgcac gaagcggtcc 540

cttgcccgct tctgc 555

<210> 172

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 172

atgccccgcc tgttcttctt tcacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

agggccgtgg ccgacagctg gatggaagag gtgatcaagc tctgcggcag ggaactggtg 120

agggcccaga tcgccatctg cggcatgtcc acctggtcca aaaggagcct cagccaggag 180

gacgcccccc agaccccccg gccagtggcc gagatcgtgc cctccttcat caacaaggac 240

accgagacta tcaacatgat gtccgagttc gtggccaacc tgccccagga gctgaagctg 300

accctgagcg aaatgcagcc cgcgctgccc cagctgcaac agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgtttga ggagttcaag aagctgatcc gcaacaggca gagcgaggcc 420

gccgactcca gccccagcga actgaaatat ctggggctgg acacccactc cgggaagaag 480

aggcagctgt acagcgccct ggccaacaaa tgctgccacg tggggtgcac gaagcggtcc 540

ctgcccgct tttgc 555

<210> 173

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 173

atgcccaggc tgttttttctt ccacctcctg ggcgtgtgcc tgctgctgaa tcagttttcc 60

120

cgggcccaga tagccatctg tggaatgagc acctggagca agcggagcct gtcccaggag 180

gacgcccccc agacaccccg gccggtggcc gaaatcgtcc ccagcttcat caacaaggac 240

accgagacca tcaacatgat gagcgagttc gtggccaacc tgccccagga gctgaagctg 300

360

gacagcagcc tcctgttcga ggagttcaag aagctcatca ggaaccggca gagcgaggcc 420

gctgacagct cacccagcga gctgaagtac ctgggcctgg acacccactc gaggaagaag 480

cggcagctgt acagcgcgct ggccaacaag tgttgccatg tgggctgtac caagaggagc 540

ctggccaggt tctgc 555

<210> 174

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 174

atgccccgac tgttcttttt ccacctgctg ggggtgtgcc tgctgctgaa ccagttttcg 60

agggcggtgg cggacagttg gatggaggag gtcatcaagc tctgcgggag ggagctcgtc 120

agggcccaga tcgccatctg cggcatgtcc acctggagca agcgttcgct gtcccaggag 180

gacgcccccc agaccccgag acccgtggcc gagatcgtgc ccagcttcat caacaaggat 240

accgaaacca tcaacatgat gagcgagttt gtggccaacc tcccgcagga gctcaagctc 300

acgctgagcg agatgcagcc ggccctgccc cagctgcagc agcatgtccc cgtcctgaag 360

gacagcagcc tgctgttcga ggagttcaag aaactgatcc ggaaccggca gagcgaggcc 420

gccgatagca gccccagcga gctgaagtac ctggggctgg acacccacag tcgcaagaag 480

cggcagctgt acagcgccct ggccaacaag tgttgccacg tcgggtgtac gaagcgctcc 540

ctggccagat tctgc 555

<210> 175

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 175

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

cgagccgtcg cagattcctg gatggaggag gtgatcaagc tgtgcggccg ggagctcgtg 120

agggcccaga tcgccatttg cggcatgtcc acctggagca agcggagcct gagccaggag 180

gacgcgccgc agactccccg gcccgtggcc gaaatcgtgc cctccttcat caataaggac 240

accgaaacca taaacatgat gagcgagttt gtggccaacc tgccacagga gctgaaactg 300

acgctgagcg agatgcagcc cgcgctgccc cagctgcagc agcatgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggaatttaag aagctaatcc ggaacaggca gagcgaggcc 420

gccgacagct ccccgagcga gctgaagtac ctcgggctgg acacccacag ccggaagaag 480

cggcaactgt acagcgccct ggcgaacaag tgctgccacg tgggctgtac caaaagaagc 540

ctcgcccgct tctgc 555

<210> 176

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 176

atgcctaggc tcttcttctt ccacctgctg ggcgtctgcc tgctgctgaa ccaattcagc 60

120

agggcccaaa tcgcgatctg cggcatgtcc acctggagca agcggagcct gtcgcaggaa 180

gatgcccccc agacccccag gccggtggcc gagatcgtcc ccagcttcat caacaaggat 240

accgagacca taaacatgat gagcgagttt gtggccaacc tcccccagga gctgaagctg 300

accctcagcg agatgcagcc cgccctgccg cagctgcaac agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga agagttcaag aagctgatcc ggaaccggca gagcgaggcc 420

gccgacagct ccccctccga gctgaagtac ctgggcctgg acacgcacag ccggaagaag 480

cggcagctgt acagcgcact ggccaacaag tgctgtcacg tcggctgcac caagcgtagc 540

ctggccagat tctgc 555

<210> 177

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 177

atgcccaggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctcaa ccagttcagc 60

agggccgtgg ccgacagctg gatggaggag gtgatcaaac tgtgcgggag ggagctggtg 120

agggcgcaga tcgccatctg cggcatgagc acctggagca agaggagcct cagccaggag 180

gacgcccccc agacccccag gcccgtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgaaacca tcaacatgat gagcgagttc gtggccaacc tgccccagga gctcaagctg 300

accctcagcg agatgcaacc cgccctgccc cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggagttcaag aagctgatcc gtaacaggca gagcgaggcc 420

gccgactcca gccccagcga gctgaagtac ctgggcctgg acacccactc cgggaagaag 480

aggcagctgt acagtgcgct ggccaacaaa tgttgccatg tgggctgcac caagcggagc 540

ctgcccgct tctgc 555

<210> 178

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 178

atgcccaggc tgttcttttt ccacctgctg ggggtctgcc tcctgctgaa ccagttctcc 60

agggcggtcg ccgacagctg gatggaagag gtcatcaagc tgtgcgggag ggagctggtc 120

agggcccaga tcgccatctg tggcatgtcc acctggagca agaggagcct gagccaggag 180

gacgcgccgc agacgccccg tcccgtggcg gagatagtgc cgagcttcat caacaaggac 240

accgagacta tcaacatgat gagcgagttc gtggccaacc tccctcagga gctgaagctg 300

accctgagcg agatgcagcc cgccctcccc cagctgcaac agcacgtgcc cgtgctgaag 360

gacagcagcc tcctgttcga ggagttcaag aagctgatcc ggaataggca gagcgaggcc 420

gccgatagct cgcccagcga gcttaagtac ctgggcctcg acacacacag caggaagaag 480

aggcagctgt acagcgccct ggccaacaag tgttgccacg tcggctgcac taagcggagc 540

ctcgctaggt tctgc 555

<210> 179

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 179

atgccccgac tgttcttctt ccatctgctg ggcgtgtgcc tcctgctgaa tcaattcagc 60

agggccgtgg ccgactcctg gatggaggag gtcatcaagc tgtgcggcag ggaactggtg 120

agggcgcaga tcgccatctg cggcatgtcc acttggagca agaggtcgct gtcgcaggag 180

gacgcccccc agaccccgag gcccgtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgagacca tcaatatgat gtccgagttc gtggccaacc tccctcagga gctgaagctg 300

accctgtccg agatgcagcc cgccctgccg cagcttcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggaattcaag aagctgatta ggaacaggca aagcgaggcc 420

gccgactcca gcccgagcga gctgaagtac ctgggcctcg acacccatag ccgcaagaag 480

cggcagctgt actcggccct ggcgaacaag tgctgccacg tgggctgcac caagcgcagc 540

ctggcgcgct tctgc 555

<210> 180

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 180

atgcccaggc tgttttttctt ccacctgctg ggggtctgcc tgctgctgaa ccagtttagc 60

agggccgtgg ccgacagctg gatggaggag gtgatcaagc tgtgcggcag ggagctggtg 120

cgggcccaga tcgccatctg cggcatgagc acctggagca agcggtccct gagccaggag 180

gacgcccccc agactccccg gccggtggcc gaaatcgtgc ccagcttcat caacaaggac 240

accgagacca tcaatatgat gtccgagttc gtggccaacc tgccccagga gctgaaactg 300

accctgagcg agatgcagcc cgccctgccc cagctgcagc agcatgtccc cgtgctgaag 360

gacagcagcc tgttgtttga ggagttcaaa aaactgatcc gaaacaggca gtcggaggcc 420

gctgacagct cgccaagcga gctgaagtat ctggggctgg acacccacag ccgcaagaag 480

aggcagctgt atagcgcgct ggccaacaag tgctgccacg tgggctgcac gaagaggtcc 540

ctggccaggt tctgc 555

<210> 181

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 181

atgcccaggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

agggccgtgg ccgacagctg gatggaggag gtgatcaagc tgtgcggccg ggagctcgtg 120

agggcccaga tcgcgatctg cggcatgagc acctggagca aaaggagtct gagccaggag 180

gacgcgccgc agacgcccag gcccgtcgcc gagatcgtgc cgtccttcat caacaaggac 240

accgagacca tcaatatgat gagcgagttc gtggccaacc tgccccagga gctcaagctg 300

accctgagcg agatgcagcc cgcgctgccc cagctgcagc agcacgtgcc cgtgctgaag 360

gactccagcc tgctgttcga ggagttcaag aaactgatca gaaacaggca gagcgaggcc 420

gccgactcca gcccctcaga gctgaagtac ctgggcctgg acacccacag caggaagaag 480

cgccagctct acagcgccct ggccaacaag tgctgccacg tcgggtgcac aaagaggagc 540

ctggccaggt tctgc 555

<210> 182

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 182

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tcctgctgaa ccagttcagc 60

agggccgtgg ccgacagctg gatggaggag gtgatcaagc tgtgcggcag ggagctggtg 120

agggcgcaga tcgccatctg cggcatgagc acctggagca agaggagcct gagccaggag 180

gacgccccgc aaaccccccg gccggtcgcg gagatagtgc ccagcttcat aaacaaggac 240

accgagacca tcaatatgat gagcgagttc gtggccaacc tgccccagga gctgaagctg 300

acgctgagcg agatgcagcc ggccctgccg cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tcctgttcga ggagttcaag aagctgatca ggaaccggca gagcgaggcc 420

gccgactcca gccccagcga gctgaagtac ctgggcctgg acacccatag caggaagaag 480

cgccagctgt acagcgccct ggctaacaag tgctgccacg tgggctgcac caagaggagc 540

ctggcccggt tctgc 555

<210> 183

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 183

atgccccggc tgttcttctt ccacctgctc ggcgtgtgcc tgctgctgaa ccaattcagc 60

cgggccgtcg ccgacagctg gatggaggag gtgatcaagc tgtgcggcag ggagctggtc 120

agggcccaga tcgccatctg tgggatgtcg acctggtcca agcgcagcct gagccaggag 180

gacgccccgc agaccccaag acccgtggcc gagatcgtgc ccagcttcat caacaaagat 240

accgagacca tcaacatgat gagcgagttc gtggccaacc tcccccagga gctgaagctg 300

accctcagcg agatgcagcc cgcgctgccc cagctgcagc agcacgtgcc cgtgctgaag 360

gacagctccc tgctgttcga ggagttcaag aagctgatcc ggaacaggca gtccgaggcc 420

gccgacagca gcccgagcga gctgaagtac ctggggctgg acacccacag caggaagaag 480

cggcagctgt acagcgccct ggccaacaag tgctgccacg tgggctgtac caaacgcagc 540

ctcgccaggt tctgc 555

<210> 184

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 184

atgcccaggc tgttcttctt ccacctgctg ggggtctgtc tcctgctgaa ccagttcagc 60

120

cgggcgcaga tcgccatctg cggcatgtca acctggtcca aaaggtccct cagccaggaa 180

gacgcccccc agacccccag gcccgtggcc gaaatcgtgc ccagctttat caacaaggac 240

accgagacca tcaacatgat gagcgagttt gtggccaacc tcccccagga gctgaagctg 300

accctgagcg agatgcagcc cgcgctgccc caactgcagc agcacgtgcc ggtgctgaag 360

gactcgagcc tgctgttcga ggagttcaag aagctcatca ggaacaggca gagcgaggcc 420

gccgattcga gccccagcga gctcaagtac ctggggctgg acactcacag cgggaagaag 480

cggcagctgt acagcgccct ggcgaacaag tgttgccacg tgggctgcac caagaggagc 540

ctggccaggt tctgt 555

<210> 185

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 185

atgcccaggc tgttcttttt ccacctcctg ggggtgtgtc tgctcctgaa ccagttcagc 60

agggccgtgg ccgattcctg gatggaggag gtcatcaagc tgtgtggaag ggagctggtg 120

agggcccaga tcgccatctg cgggatgtcc acctggagca agcggagcct gtcccaggag 180

gacgccccgc agacccccag gccggtggcg gagatcgtcc ccagcttcat caacaaggac 240

accgagacca tcaacatgat gagcgagttc gtggccaacc tgccccagga actgaagctc 300

accctgagtg agatgcagcc cgccctgccc cagctgcagc agcatgtgcc cgtgctgaag 360

gacagcagcc tgctcttcga ggagttcaag aagctgatca ggaacaggca gagcgaggcc 420

gccgacagct ccccctccga gctgaagtac cttggactgg acacccacag ccggaagaag 480

cggcaactgt actccgccct ggccaacaag tgctgccacg tgggctgtac gaagaggagc 540

ctggccaggt tctgc 555

<210> 186

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 186

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagca agcggagcct gagccaggag 180

gacgcccccc agaccccccg gcccgtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgagacca tcaacatgat gagcgagttc gtggccaacc tgccccagga gctgaagctg 300

accctgagcg agatgcagcc cgccctgccc cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggagttcaag aagctgatcc ggaaccggca gagcgaggcc 420

gccgacagca gccccagcga gctgaagtac ctgggcctgg acacccacag cgggaagaag 480

cggcagctgt acagcgccct ggccaacaag tgctgccacg tgggctgcac caagcggagc 540

ctggcccggt tctgc 555

<210> 187

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 187

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

120

agggcgcaga tcgcgatctg cgggatgagc acgtggagca agaggagcct gagccaggag 180

gacgcgccgc agacgccgag gccggtggcg gagatcgtgc cgagcttcat caacaaggac 240

acggagacga tcaacatgat gagcgagttc gtggcgaacc tgccgcagga gctgaagctg 300

acgctgagcg agatgcagcc ggcgctgccg cagctgcagc agcacgtgcc ggtgctgaag 360

gacagcagcc tgctgttcga ggagttcaag aagctgatca ggaacaggca gagcgaggcg 420

gcggacagca gcccgagcga gctgaagtac ctggggctgg acacgcacag caggaagaag 480

aggcagctgt acagcgcgct ggcgaacaag tgctgccacg tggggtgcac gaagaggagc 540

ctggcgaggt tctgc 555

<210> 188

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 188

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtcca agcgctccct ctcccaggag 180

gacgcccccc agaccccccg ccccgtcgcc gagatcgtcc cctccttcat caacaaggac 240

accgagacca tcaacatgat gtccgagttc gtcgccaacc tcccccagga gctcaagctc 300

accctctccg agatgcagcc cgccctcccc cagctccagc agcacgtccc cgtcctcaag 360

gactcctccc tcctcttcga ggagttcaag aagctcatcc gcaaccgcca gtccgaggcc 420

gccgactcct ccccctccga gctcaagtac ctcggcctcg acacccactc ccgcaagaag 480

cgccagctct actccgccct cgccaacaag tgctgccacg tcggctgcac caagcgctcc 540

ctcgcccgct tctgc 555

<210> 189

<211> 276

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 189

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttct 60

agggccgtgg ccgacagctg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtcc acctggagcg gctccaacgg ctctaccaac 180

gattctaatg gcagcacagg ctcccagctg tacagcgccc tggccaataa gtgctgtcac 240

gtgggctgca caaagaggtc cctggcccgc ttctgt 276

<210> 190

<211> 276

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 190

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttct 60

agggccgtgg ccgacagctg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtcc acctggagcg gctccaacgg ctctaccaac 180

acctctaatg gcgacacagg ctcccagctg tacagcgccc tggccaataa gtgctgtcac 240

gtgggctgca caaagaggtc cctggcccgc ttctgt 276

<210> 191

<211> 276

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 191

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttct 60

agggccgtgg ccgacagctg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtcc acctggagcg gctccaacgg caagaccaac 180

acctctaatg gcgacacagg ctcccagctg tacagcgccc tggccaataa gtgctgtcac 240

gtgggctgca caaagaggtc cctggcccgc ttctgt 276

<210> 192

<211> 291

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 192

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttcc 60

agggccgtgg ccgactcttg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtct acctggtctg gcagcacaaa ctccggctct 180

accagctccg gcaacagcgg ctccggcaat tctggcagcc agctgtacag cgccctggcc 240

aataagtgct gtcacgtggg ctgcacaaag aggtccctgg cccgcttctg t 291

<210> 193

<211> 291

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 193

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttcc 60

agggccgtgg ccgactcttg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgagc acctggtctg gcagcacaaa ctccggctct 180

gataccagct ccggcaacag cggctccggc aattctggcc agctgtacag cgccctggcc 240

aataagtgct gtcacgtggg ctgcacaaag aggtccctgg cccgcttctg t 291

<210> 194

<211> 291

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 194

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttct 60

agggccgtgg ccgacagctg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtcc acctggagcg gctccacaaa ctctggcagc 180

gataccggct ctggcaactc caagtctggc aatagcggcc agctgtactc cgccctggcc 240

aataagtgct gtcacgtggg ctgcacaaag aggagcctgg cccgcttctg t 291

<210> 195

<211> 291

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 195

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttct 60

agggccgtgg ccgacagctg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtcc acctggagcg gctccacaaa ctctggcagc 180

gacacctccg gcaagaactc tggcgatggc aatagcggcc agctgtactc cgccctggcc 240

aataagtgct gtcacgtggg atgcacaaag cggagcctgg cccgcttctg t 291

<210> 196

<211> 291

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 196

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagtttagc 60

agggccgtgg cagactcctg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtct acctggtctg gcagcacaga ctccggctct 180

gataccagct ccggcaacag cggcgatggc aattccggcc agctgtactc tgccctggcc 240

aataagtgct gtcacgtggg ctgcacaaag aggagcctgg cccgcttctg t 291

<210> 197

<211> 321

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 197

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttcc 60

agggccgtgg ccgactcttg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtct acctggagcg gcagctccgg ctctacaaac 180

gattccaatg gctctaccgg cacaggcagc gacggctcca ccaacggctc tgatggcagc 240

acaggaggac agctgtacag cgccctggcc aataagtgct gtcacgtggg atgcaccaag 300

aggtccctgg cccgcttctg t 321

<210> 198

<211> 381

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 198

atgccccggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagtttagc 60

agggccgtgg cagactcctg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgagc acctggtccg gctctacaaa cagcggctcc 180

gacaccagct ccggctccac aaattctggc agcgatacct ctagcggcaa ctccggctct 240

ggcaatagcg gctccaaggg caccggctct gatggcagca caaacggctc caatggctct 300

accggaggac agctgtactc tgccctggcc aataagtgct gtcacgtggg ctgcacaaag 360

aggtccctgg cccgcttctg t 381

<210> 199

<211> 1341

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 199

atgcccaggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttcc 60

cgcgccgtgg cagactcttg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtct acctggagca agcggtccct gtctcaggag 180

gacgcccctc agacacctag accagtggcc gagatcgtgc ccagcttcat caacaaggat 240

accgagacaa tcaatatgat gtccgagttc gtggccaatc tgcctcagga gctgaagctg 300

accctgtccg agatgcagcc agccctgcca cagctgcagc agcacgtgcc agtgctgaag 360

gatagctccc tgctgtttga ggagttcaag aagctgatcc ggaacagaca gtccgaggcc 420

gccgactcta gcccttctga gctgaagtac ctgggcctgg atacccacag caggaagaag 480

cgccagctgt attccgccct ggccaataag tgctgtcacg tgggctgcac aaagaggtcc 540

ctggcccgct tttgtggcgg cggcggctct ggaggaggag gcagcggcgg aggaggcagc 600

atggtgcggt ccgtggagtg cccaccttgt ccagcaccac cagtggcagg ccctagcgtg 660

tttctgttcc ctccaaagcc aaaggacacc ctgatgatct ctaggacccc cgaggtgaca 720

tgcgtggtgg tggacgtgag cccacgaggac cccgaggtgc agttcaactg gtacgtggat 780

ggcatggagg tgcacaatgc caagacaaag ccccgggagg agcagtttaa cagcaccttc 840

agagtggtgt ccgtgctgac agtggtgcac caggactggc tgaacggcaa ggagtataag 900

tgcgccgtgt ccaataaggg cctgccagca cctatcgaga agaccatctc taagacaaag 960

ggccagccta gggagccaca ggtgtacacc ctgccccctt cccgcgagga gatgaccaag 1020

aaccaggtgt ctctgacatg tctggtgaag ggcttttatc ccctctgacat cgccgtggag 1080

tgggagagca atggccagcc tgagaacaat tacaagacca caccacccat gctggactcc 1140

gatggcagct tcttcctgta ttctaagctg acagtggata agagccggtg gcagcaggggc 1200

aacgtgttca gctgttccgt gatgcacgag gccctgcaca atcactacac ccagaagtct 1260

ctgagcctgt cccccggcaa gggcaagcca atccccaatc ctctgctggg cctggatagc 1320

accaccacc accaccacca c 1341

<210> 200

<211> 984

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 200

atgcctaggc tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttttct 60

cgcgccgtgg cagacagctg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

cgcgcacaga tcgccatctg tggcatgagc acctggtcca agcggagcct gagccaggag 180

gacgcaccac agacacccag acctgtggcc gagatcgtgc cttcctttat caacaaggat 240

accgagacaa tcaatatgat gtctgagttc gtggccaatc tgccccagga gctgaagctg 300

accctgtccg agatgcagcc agccctgcca cagctgcagc agcacgtgcc tgtgctgaag 360

gatagctccc tgctgtttga ggagttcaag aagctgatcc ggaacagaca gtccgaggcc 420

gccgactcta gcccatctga gctgaagtac ctgggcctgg atacccacag caggaagaag 480

cgccagctgt attccgccct ggccaataag tgctgtcacg tgggctgcac aaagcggtcc 540

ctggccagat tttgtggcgg cggcggctct ggaggaggag gcagcggcgg aggaggctcc 600

660

atcacatgca gggccagccg gcccatcggc acaatgctga gctggtatca gcagaagcct 720

ggcaaggccc caaagctgct gatcctggcc ttctctaggc tgcagagcgg cgtgccctcc 780

cgctttagcg gctccggctc tggcaccgac ttcaccctga caatcagctc cctgcagcca 840

gaggattttg ccacctacta ttgtgcccag gccggcacac accccaccac attcggccag 900

ggcaccaagg tggagatcaa gaggggcaag ccaatcccca accctctgct gggcctggac 960

agcacacacc accaccacca ccac 984

<210> 201

<211> 291

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 201

atgcctcgac tgttcttttt ccacctgctg ggcgtgtgcc tgctgctgaa tcagtttagc 60

cgggccgtcg ccgatagttg gatggaggaa gtgatcaagc tgtgcggccg ggagctggtg 120

agagcacaga tcgccatctg tggcatgtcc acctggtctg gcagctccgg aggaggctct 180

ggctctagct ccggctctag cggcagcggc ggctccggcc agctgtacag cgctctggct 240

aataagtgtt gtcacgtcgg atgtactaaa cgaagtctgg ctagattttg c 291

<210> 202

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 202

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agacaactct acagtgcatt ggctaataaa tgttgccatg ttggttgtac caaaagatct 540

cttgctagat tttgc 555

<210> 203

<211> 534

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 203

atgggcgtga aagtgctgtt tgcgctgatt tgcattgcgg tggcggaagc ggactcatgg 60

atggaggaag ttattaaatt atgcggccgc gaattagttc gcgcgcagat tgccatttgc 120

ggcatgagca cctggagcaa aaggtctctg agcggaag atgctcctca gacacctaga 180

ccagtggcag aaattgtgcc atccttcatc aacaaagata cagaaaccat aaatatgatg 240

tcagaatttg ttgctaattt gccacaggag ctgaagttaa ccctgtctga gatgcagcca 300

gcattaccac agctacaaca acatgtacct gtattaaaag attccagtct tctctttgaa 360

gaatttaaga aacttattcg caatagacaa agtgaagccg cagacagcag tccttcagaa 420

ttaaaatact taggcttgga tactcattct cgaaaaaaga gacaactcta cagtgcattg 480

gctaataaat gttgccatgt tggttgtacc aaaagatctc ttgctagatt ttgc 534

<210> 204

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 204

atgggcgtga aagtgctgtt tgcgctgatt tgcattgcgg tggcggaagc ggactcatgg 60

atggaggaag ttattaaatt atgcggccgc gaattagttc gcgcgcagat tgccatttgc 120

ggcatggagc ccaagagcag cgacaagacc cacaccagcc cccccagccc cgcccccgag 180

ctgctgggcg gcagcagcgt gttcctgttc ccccccaagc ccaaggacac cctctacatc 240

accagggagc ccgaggtgac ctgcgtggtg gtggacgtga gccacgagga ccccgaggtg 300

aagttcaact ggtacgtgga cggcgtggag gtgcacaacg ccaagaccaa gcccagggag 360

gagcagtaca acagcaccta cagggtggtg agcgtgctga ccgtgctgca ccaggactgg 420

ctgaacggca aggagtacaa gtgcaaggtg agcaacaagg ccctgcccgc ccccatcgag 480

aagaccatca gcaaggccaa gggccagccc agggagcccc aggtgtacac cctgcccccc 540

agcagggacg agctgaccaa gaaccaggtg agcctgacct gcctggtgaa gggcttctac 600

660

accccccccg tgctggacag cgacggcagc ttcttcctgt acagcaagct gaccgtggac 720

aagagcaggt ggcagcaggg caacgtgttc agctgcagcg tgatgcacga ggccctgcac 780

aaccactaca cccagaagag cctgagcctg agccccggca aggaagag cacctggagc 840

aaaaggtctc tgagccagga agatgctcct cagacaccta gaccagtggc agaaattgtg 900

960

ttgccacagg agctgaagtt aaccctgtct gagatgcagc cagcattacc acagctacaa 1020

caacatgtac ctgtattaaa agattccagt cttctctttg aagaatttaa gaaacttatt 1080

1140

gatactcatt ctcgaaaaaa gagacaactc tacagtgcat tggctaataa atgttgccat 1200

gttggttgta ccaaaagatc tcttgctaga ttttgc 1236

<210> 205

<211> 498

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 205

atgggcgtga aagtgctgtt tgcgctgatt tgcattgcgg tggcggaagc ggactcatgg 60

atggaagagg ttattaaatt atgtggccgt gaattggtgc gtgcacaaat agctatttgc 120

ggcatgggcg gtggcggctc tggtggcggc ggctctggag ggggcggaag tggtggagga 180

ggtagtggcg gaggtggatc gggaggcgga ggatctggag gggggggctc ctttcaaagc 240

tcctcgagca aagcgccccc tcccagcctg cccagcccta gtaggctgcc cggtccgagc 300

gacacgccca tcctgcccca gggtggcggt ggctctgggg gtggcggttc aggcgggaggt 360

ggttctggcg gaggcggatc aggtggtggg ggatccggcg gcggcggatc tggtggcggg 420

gggagtcagc tctactctgc gttggccaat aaatgctgcc atgttggttg tacaaaaaga 480

tctttggcta gattttgc 498

<210> 206

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 206

atgggcgtga aggtgctgtt cgcactgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggcaga gagctggtga gagcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacaccag cccccccagc 180

cccgctcccg agctgctggg cggcagcagc gtgttcctgt tccccccccaa gcccaaggac 240

accctgtaca taaccagaga gccagaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccccgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagaca 360

aagccgag aggagcagta caacagcacc tacagagtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtat aagtgcaagg tgagcaacaa ggccctgccc 480

gcccccatcg agaagccat cagcaaggcc aagggccagc ccagagagcc ccaggtgtac 540

accctgcccc ccagcagaga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga catcgccgtg gagtgggaga gcaacggcca gcccgagaac 660

aactacaaga ccaccccccc cgtgctggac agcgacggca gcttcttcct gtacagcaag 720

ctgaccgtgg acaagagcag atggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaggccttac acaaccacta cacccagaag agcctaagcc tgagccccgg caagagaaag 840

aagagaagtc tgagccagga ggacgccccc cagaccccca gacccgtggc cgagatcgtg 900

ccctccttca ttaacaagga caccgagacc atcaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct gaccctgagc gaaatgcaac ccgccctgcc ccagctgcaa 1020

cagcacgtgc ccgtgctgaa ggacagcagc ctgctgttcg aggagttcaa aaagctgatc 1080

agaaacagac agagcgaggc cgccgactcc agccccagcg agctgaagta cctgggcctg 1140

gacacccaca gcagaaagaa gagacagctg tacagcgccc tggccaacaa gtgctgccac 1200

gtgggctgca ccaagagaag cctggccaga ttctgc 1236

<210> 207

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 207

atgggagtta aagtgctttt tgcgcttatt tgtattgcgg tcgcgggaggc tgactcatgg 60

atggaagagg tcattaagct ctgtggaagg gaactcgtta gagcccaaat agctatttgc 120

gggatgagta catggtccgg tgggggtggt tcgggtggag gtgggtcggg aggaggaggc 180

tccggtggag gcggcagtgg gggcggaggg tccggtgggg gtgggtctgg aggaggtggt 240

tcgtttcagt cttcatcttc caaagctcct cctccttcgc ttcccagccc tagcaggctt 300

ccaggtccat cagatactcc aatattgccc cagggagggg gtggatcagg aggaggaggg 360

agtggtgggg gaggatctgg tggaggtggt tccggaggag gaggaagcgg ggggggaggt 420

tcaggcggtg gtggaagcca actgtatagt gcgttggcta acaaatgttg tcatgtcgga 480

tgtactaaaa ggagcctcgc caggttttgc 510

<210> 208

<211> 534

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 208

atgggcgtga aagtgctgtt tgcgctgatt tgcattgcgg tggcggaagc ggactcatgg 60

atggaggaag ttattaaatt atgcggccgc gaattagttc gcgcgcagat tgccatttgc 120

ggcatgagca cctggagcaa aaggtctctg agcggaag atgctcctca gacacctaga 180

ccagtggcag aaattgtgcc atccttcatc aacaaagata cagaaaccat aaatatgatg 240

tcagaatttg ttgctaattt gccacaggag ctgaagttaa ccctgtctga gatgcagcca 300

gcattaccac agctacaaca acatgtacct gtattaaaag attccagtct tctctttgaa 360

gaatttaaga aacttattcg caatagacaa agtgaagccg cagacagcag tccttcagaa 420

ttaaaatact taggcttgga tactcattct cgaaaaaaga gacaactcta cagtgcattg 480

gctaataaat gttgccatgt tggttgtacc aaaagatctc ttgctagatt ttgc 534

<210> 209

<211> 558

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 209

atgagcagca gactgctgct gcagctgctg ggcttctggc tgttcctgag ccagccctgc 60

agagccagag tgagcgagga gtggatggac caggtgatcc aggtgtgcgg cagaggctac 120

gccagagcct ggatcgaggt gtgcggcccc agcgtgggca gactggccct gagccaggag 180

gagcccgccc ccctggccag acaggccacc gccgaggtgg tgcccagctt catcaacaag 240

gacgccgagc ccttcgacat gaccctgaag tgcctgccca acctgagcga ggagagaaag 300

gccgccctga gcgagggcag agcccccttc cccgagctgc agcagcacgc ccccgccctg 360

agcgacagcg tggtgagact ggagggcttc aagaagacct tccacaacca gctgggcgag 420

gccgaggacg gcggcccccc cgagctgaag tacctgggca gcgacgccca gagcagaaag 480

aagagacaga gcggcgccct gctgagcgag cagtgctgcc acatcggctg caccagaaga 540

agcatcgcca agctgtgc 558

<210> 210

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 210

atgggggtga aggtgctgtt cgccctcatc tgcatagcgg tggccgaggc cgactcttgg 60

atggaggagg tgatcaagct ctgcggcagg gagctcgtgc gtgcccagat cgcgatctgc 120

ggcatgagca cctggtcaga gccaaagagc agcgataaga cgcataccag ccctcccagc 180

cccgcccccg agctgctggg cgggagcagc gtgttcctct tcccacccaa gccaaaggac 240

accctctaca tcacccgcga gcccgaggtg acgtgcgttg tggtggacgt gtccccgag 300

gaccccgagg tcaagttcaa ctggtacgtg gacggcgtgg aagtccacaa cgccaagacc 360

aagcctcggg aggagcagta caacagcacc tacagggtgg tgagcgtcct gacagtcctg 420

caccaggact ggctgaatgg caaggaatac aagtgcaagg tgtcaaacaa ggccctgccc 480

gcccccatcg agaaaaccat cagcaaggcc aagggccagc cacgtgagcc ccaggtgtac 540

accctgcccc ccagcaggga cgagctcacc aagaaccagg tgagcctgac ctgcctggtg 600

aaaggtttct acccttctga catcgcggtt gagtgggaga gcaatggcca acccgagaac 660

aactacaaga caaccccgcc cgtgctggac tccgatggga gcttcttcct gtatagcaag 720

ctgaccgtgg acaagagccg ctggcagcag ggcaacgtgt tcagctgctc cgtcatgcac 780

gaggccctgc ataaccacta cacccaaaag agcctgtccc tgagccccgg caagcgcaag 840

aagaggtccc tgagccaaga agacgccccg cagacgccca ggcccgtggc cgagatcgtg 900

tgtcggaatt tgtggctaac 960

ctgccccaag agctgaaact gaccctgtcg gaaatgcagc ccgcgctgcc gcagctgcag 1020

cagcacgtgc cggtgctgaa ggatagcagc ttgctgttcg aggaattcaa gaagctcatc 1080

cgtaatcgac agagcgaggc ggccgattcc agccccagcg agctgaagta tctggggctg 1140

gatacccaca gccgcaagaa gcggcagctg tactctgctc tggccaataa gtgttgccac 1200

gtcggctgca ccaaacgcag cctggccagg ttctgc 1236

<210> 211

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 211

atgggcgtca aggtcctctt cgcccttatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct ttgcggccgg gagcttgtgc gcgcgcagat cgccatttgc 120

ggcatgagca cctggtccga accaaagagc tccgacaaga cccacacctc ccctccttcc 180

cccgcccccg agctgctggg cggcagcagc gtcttcctgt tcccgcccaa gcccaaggac 240

accctgtaca tcaccaggga gcccgaggtg acatgtgtcg tggtggacgt gtcacacgag 300

gaccccgagg tgaagttcaa ctggtacgtc gacggcgtgg aggtgcacaa cgcaaaaacc 360

aagccccggg aggaacagta caacagcacc taccgggtgg tcagcgtgct gaccgtgctc 420

catcaggact ggctgaacgg caaggagtac aaatgcaagg tcagcaacaa agccctgccc 480

gccccaatcg aaaagaccat ctccaaggcc aaggggcagc ccagggaacc ccaggtgtac 540

accctgcccc ccagcaggga cgagctcacc aagaaccagg tgagcctgac ctgcctggtg 600

aaggggttct accccagcga catcgccgtg gagtgggaaa gcaacggcca acccgaaaac 660

aactacaaga ccaccccgcc ggtgctggac tctgacggca gcttcttcct ctacagcaag 720

ctgaccgttg acaaatccag gtggcaacag ggcaacgtct tcagctgcag cgtgatgcat 780

gaagcgctgc acaaccatta cacgcagaaa agcctgtccc tgagccccgg caagaggaag 840

aaaaggagcc tgtccgga ggacgcccct cagaccccgc gacccgtggc cgagatcgtg 900

cctagcttca ttaacaagga caccgagacg atcaacatga tgagcgagtt cgtggccaat 960

ctgccccagg agctgaagct caccctcagc gagatgcagc ccgccctgcc ccagctgcag 1020

cagcacgtcc cggtcctgaa ggacagcagc ctgctgttcg aggagttcaa gaagctgatc 1080

aggaacaggc agagcgaggc cgccgactcc tccccctccg agctgaagta cctcggcctg 1140

gacacccact cggaagaa gcggcagctg tactcagccc tggccaacaa gtgctgccac 1200

gtgggctgca ccaagcggag cctggcccgg ttctgc 1236

<210> 212

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 212

atgggcgtga aggtgctgtt cgccctcatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaaact ctgcggcagg gagctcgtgc gcgcccagat cgccatctgc 120

gggatgtcca cctggagcga gcccaagagc tccgacaaaa cccacaccag cccgcccagc 180

ccagccccg agctgctggg cggcagcagc gtgttcctct tccctcccaa gcccaaggac 240

acgctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccctgaag tgaagtttaa ctggtatgtt gacggcgtgg aggtgcacaa cgcaaagacc 360

aagccccgcg aggagcagta caacagcacc taccgcgtcg tcagcgtgct gacagtcctc 420

caccaggatt ggctgaacgg caaggagtac aagtgcaagg tgtccaacaa ggccctgccc 480

gccccgatcg agaagaccat tagcaaggcc aagggccagc caagggagcc acaagtgtac 540

accctgccac cttccaggga cgagctgacc aagaatcagg tcagcctgac ctgcctggtt 600

aagggcttct acccaagcga catcgccgtt gagtgggaga gcaacggaca gcctgagaac 660

aactataaga ctacccctcc cgtgctggat tccgacggaa gcttcttcct gtacagcaag 720

ctgaccgtgg acaagagcag atggcagcag ggtaacgtgt ttttcctgctc cgtgatgcat 780

gaggccctgc acaaccacta cacccagaaa agcctcagcc tgagccccgg caaacgcaag 840

aagcggagcc tgtcgcaaga ggacgccccc cagaccccca ggcctgtggc cgagatcgtc 900

cccagcttca tcaacaagga caccgagact atcaacatga tgagcgaatt cgtggccaac 960

ctcccccagg aactgaagct gaccctgagc gagatgcagc ccgccctgcc ccagctgcag 1020

1080

1140

gacacccaca gccggaaaaa gcgccagctc tacagcgccc tggccaacaa gtgctgccac 1200

gtgggctgca ccaagcgttc cctggcccgg ttttgc 1236

<210> 213

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 213

atgggcgtga aggtcctctt cgccctcatc tgcatcgccg tggccgaggc cgactcctgg 60

atggaggagg tgataaagct ctgcggcagg gagctcgtgc gcgcccaaat cgccatctgc 120

gggatgagca cctggagcga gcccaagagc tccgacaaga cacacacctc cccgcccagc 180

cccgccccag agctgctggg cgggagcagc gtctttctgt tcccgcccaa gcccaaggac 240

accctgtaca tcacgcgcga gcccgaagtg acctgcgtgg tcgtggacgt gagccacgag 300

gaccctgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgctaagacc 360

aagccccggg aggagcagta caactcaacc tacagagtgg tgagcgtcct cacggtgctg 420

caccaggatt ggctgaatgg caaggagtat aaatgcaagg tgagcaacaa agcactgccc 480

gcccccatcg agaagacaat ctctaaggcc aagggccagc ccagggagcc ccaggtgtac 540

accctgcccc cctcaagaga cgagctgacc aagaatcagg tgtccctgac ctgcctcgtg 600

aagggcttct accccagcga tatcgctgtg gagtgggagt ccaacgggca gccggagaac 660

aactacaaga ccaccccacc cgtgctggac agcgacggga gctttttcct gtacagcaag 720

ctgaccgtcg acaagagcag atggcagcag ggcaacgtgt tcagctgcag cgtcatgcac 780

gaggccctgc acaaccacta cacacaaaag agcctgagcc tgtcgccagg caagcgaaag 840

aagagaagct tgagccagga ggacgccccc cagacccccc ggcccgtggc cgagatcgtg 900

cccagcttca tcaacaagga caccgagact attaacatga tgagcgagtt cgtggccaat 960

ctgccccagg agctcaaact taccctgtcc gagatgcagc ccgccctgcc ccagctgcag 1020

cagcacgtgc ccgtgctgaa ggacagttcc ctgctgttcg aggagttcaa aaagctgatc 1080

1140 cgcaacagac agagcgaggc cgccgatagc agcccctccg

gacacccaca gcaggaagaa gaggcagctg tacagcgccc tggccaataa gtgctgtcac 1200

gttggctgca ccaagcgcag cctcgcccgg ttttgc 1236

<210> 214

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 214

atgggcgtga aggtgctgtt cgccctcatc tgcattgccg tggccgaagc cgacagctgg 60

atggaagagg tcatcaagct ctgcggcagg gagctcgtga gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagtcc agcgacaaga cccacaccag cccgcccagc 180

cccgccccgg agcttcttgg gggcagcagc gtgttcctgt tcccacccaa gcccaaggac 240

accctgtaca tcacccggga acccgaggtg acctgcgtgg tcgttgacgt cagtcacgag 300

gatcccgaag tcaagtttaa ctggtatgtg gacggcgtgg aggtccacaa tgccaaaacc 360

aagccacggg aggaacagta taattccacc tacagggtgg tcagcgtgct caccgtgctc 420

caccaggact ggctcaacgg aaaggagtat aagtgcaagg tgagcaataa ggccctgcct 480

gcccccatcg agaagccat ctccaaggcg aaaggccagc cccggggagcc tcaggtctac 540

accctgcccc ccagccgcga cgagctcacc aagaaccagg tgagcctcac ctgcctggtg 600

aagggcttct accccagcga catcgccgtg gagtgggagt ccaacggaca gcccgagaac 660

aactacaaga ccaccccacc ggtcctggac agcgatggct ccttcttcct gtacagcaaa 720

ctgaccgtgg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtcatgcac 780

gaggcgctgc acaatcacta cacccagaaa tccctgagcc tgtcccccgg caagaggaag 840

aagaggagcc tgagccagga ggacgccccc cagacaccca ggcccgtggc cgagatcgtg 900

ccctccttca tcaacaagga taccgaaacc atcaacatga tgagcgagtt cgtagccaac 960

ctgccgcagg agctcaagct gaccctgagc gagatgcagc ccgccctgcc ccagctgcaa 1020

cagcacgtgc ccgtgctcaa ggacagcagc ctgctgttcg aggagttcaa aaagctgatc 1080

1140

gacacccact cccgcaagaa acggcagctt tattccgccc tggccaacaa gtgctgccac 1200

gtgggctgca ccaaaaggtc cctggccagg ttttgc 1236

<210> 215

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 215

atgggcgtga aagtgctctt tgccctcatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgataaagct ctgcgggcgg gagctcgtcc gggcccagat cgccatctgc 120

ggtatgagca cctggagcga gcccaagtcc agcgacaaga cccacacctc gccccccagc 180

ccggccccg agctgctggg gggaagcagc gtgttcctgt tcccgcccaa gcccaaggac 240

accctgtaca tcacacgaga gcccgaagtt acctgcgtcg tggtggacgt gagccacgag 300

gaccccgagg tgaagttcaa ttggtacgtg gacggagtgg aggtgcacaa tgcaaaaacc 360

aagccccgag aggagcagta caatagcacc tacagggtgg tgagcgtgct gactgtgctg 420

caccaggact ggctgaacgg gaaggagtac aagtgcaagg ttagcaacaa ggccctcccc 480

gccccaatcg agaagccat ctccaaggct aagggccagc ccagggagcc ccaggtctat 540

acactcccgc ccagcagaga tgagctcacc aagaaccagg tcagcctgac ctgtctggtg 600

aaaggcttct accccagcga cattgccgtg gagtgggagt ccaacggcca gcccgagaac 660

aactacaaga ccactccccc cgtactggat tccgacggca gcttcttcct gtacagcaag 720

ctcaccgtgg acaaatccag gtggcagcag ggcaacgtgt ttttcctgcag cgtaatgcat 780

gaggccctcc acaaccacta cacccagaaa agcctgagcc tgagccccgg gaagaggaag 840

aagaggagcc tgtccgga ggacgccccc cagaccccca ggcccgtggc cgagatcgtc 900

cccagcttca tcaataagga cacggagacg atcaacatga tgagcgaatt cgtggcaaac 960

ctcccccagg agctgaaact gacgctgagc gagatgcagc cagccctgcc tcagctgcag 1020

caacatgtgc ccgtgctgaa ggacagctcc ttgctgttcg aggaattcaa gaagctgatc 1080

1140

gacacccact cccgaaaaaa gcgtcagctg tacagcgccc tggcgaacaa atgctgccat 1200

gtcggctgta ccaagcggtc cctggcccgc ttctgc 1236

<210> 216

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 216

atgggggtga aggtcctctt cgcgttgatc tgcatcgccg tggccgaggc agatagctgg 60

atggaggagg ttatcaagct ctgtggtcgc gagctcgtgc gcgcccaaat cgccatctgc 120

ggcatgagca ccctggagcga gccgaaaagc agcgacaaga cacacacctc ccctccgagc 180

cccgctcccg agcttctggg tgggtcctca gtgtttctgt tcccgcccaa gccaaaggac 240

acgctgtaca tcaccagaga gcccgaagtg acttgcgtgg tggtcgacgt gtcccacgag 300

gaccctgaag tcaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagaca 360

aagccccggg aggaacagta caactccacc taccgggtgg tgtccgtgct caccgtgctc 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggctctgccc 480

gcccccatcg agaagacgat ctccaaggcc aaggggcaac ccagggaacc gcaggtctat 540

accctgcccc cctctcggga cgagctgacg aagaaccagg ttagcctcac ctgcctggtg 600

aagggcttct acccctccga catcgccgtc gagtgggaat ccaacgggca gcctgagaac 660

aattacaaga ccacccctcc cgtcctggac tccgacggca gcttctttct ctactccaag 720

ctcaccgtgg acaagtcgag gtggcagcag ggaaacgtgt tctcctgtag cgtgatgcac 780

gaggccctgc acaaccacta cacccagaaa agcctgagcc tcagccccgg gaagcggaaa 840

aagcgctccc tgtccgga ggacgccccc cagacacccc ggcccgtggc cgagatcgtc 900

ccttccttca tcaataaaga caccgagaca atcaacatga tgagcgagtt cgtggccaac 960

ctgccccagg aactgaagct gaccctctcg gagatgcagc ccgcgctgcc gcagctgcag 1020

1080

agaaatagac agagcgaggc cgccgatagc tccccaagcg agctcaagta cctcgggctg 1140

gacacgcaca gcagaaagaa gagacagctg tacagcgccc tggccaataa gtgctgccac 1200

gtcggctgca ccaagcggag cttggcgagg ttctgc 1236

<210> 217

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 217

atgggcgtaa aggtgctctt tgccctaatc tgcatcgccg tggccgaggc cgactcgtgg 60

atggaggagg tgatcaagct ctgcggccgg gagctcgtgc gcgcccagat cgccatctgc 120

gggatgagca cctggagcga gcccaaaagt tccgacaaga cccacaccag cccgcccagc 180

ccgcccccg agctgctggg agggagcagc gtgttcctgt tcccacccaa gcccaaggac 240

accctgtaca tcacccgcga gcccgaggtg acctgcgtgg tggtggacgt gtcccatgag 300

gatccgggagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaaaacc 360

aagcccaggg aggagcagta caattccacc tacagggtgg tgagcgtcct gacggtcctg 420

caccaagact ggctgaatgg caaggagtac aagtgcaagg tgagcaacaa ggccctgccc 480

gcgcctatcg agaagacgat cagcaaggcc aaaggccaac cgagggagcc ccaggtgtat 540

accctgcccc ccagcaggga cgagctcacc aagaatcaag tgtcactgac ctgcctggtg 600

aagggcttct acccctccga catcgctgtg gagtgggaga gcaacggcca gcccgaaaat 660

aactacaaga ccaccccgcc cgtgctggac agcgacggca gtttctttct gtacagcaag 720

ctgaccgtgg acaagtccag atggcagcag ggcaacgtgt tcagctgtag cgtcatgcac 780

gaggccctgc ataatcacta cacccagaaa agcctgtccc tgagcccagg gaagcggaag 840

aagcgatccc tcagccagga ggacgccccg cagaccccca gacccgttgc cgagatcgtg 900

ccctcattca tcaacaagga cacagagaca atcaacatga tgtccgaatt cgtggccaac 960

ctcccccagg agctcaagct gaccctcagc gagatgcagc ccgccctgcc ccagctgcag 1020

cagcatgtgc ccgtgctgaa ggactcgagc ctgctgttcg aagagttcaa gaagctgatc 1080

agaaatcgtc agtccgaggc cgccgacagc agccccagcg aactcaagta cctgggcctg 1140

gacacccaca gccgcaagaa gaggcagctg tacagcgccc tggccaacaa gtgctgccac 1200

gtgggttgca ccaagcgcag cttggccagg ttttgc 1236

<210> 218

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 218

atgggcgtga aggtgctgtt cgccctcatt tgtatcgccg tggccgaagc ggacagctgg 60

atggaggagg tgatcaaact atgcggcagg gagctcgtga gagctcagat tgccatctgc 120

ggcatgtcga cctggagcga gcccaagagc agcgacaaga cccacacctc cccgcccagc 180

ccgcccccg agctgctggg gggcagcagc gtgttcctgt ttccccccaa gcccaaggac 240

accctgtaca tcacccgaga gcccgaggtg acctgtgtgg tggtggacgt ttccccgag 300

gaccccgagg tcaagttcaa ctggtacgtg gatggcgtgg aggtgcacaa tgccaagact 360

aagccccgag aggagcagta caacagcacc tacagggtgg tcagcgtgct gaccgtcctg 420

caccaggact ggctgaacgg gaaggaatac aagtgcaagg taagcaacaa ggccctgcct 480

gcccccatcg agaagccat ttccaaggcc aagggccaac caagggagcc ccaggtgtac 540

accctgcccc ccagcagaga cgaactgacc aagaaccagg tgagcctgac ctgcctggtc 600

aaggggttct acccctccga catcgccgtg gagtgggagt ccaacggcca gcccgagaac 660

aactacaaga ccaccccgcc cgtcctcgat agcgacggga gcttcttcct gtactcaaag 720

ctgacagtgg acaagagcag gtggcagcag ggcaacgtgt tctcctgcag cgtgatgcac 780

gaagccctgc ataaccacta tacccagaag tccctgagcc tgagccccgg aaagcgcaaa 840

aagcgcagcc tgagccagga ggacgcccca caaaccccca ggcccgtggc cgagatcgtg 900

cccagcttca tcaacaagga cactgagacg atcaacatga tgtccgagtt tgtggccaac 960

ctgccccagg agctgaagct gaccctgtct gagatgcagc ccgccctgcc tcagctccag 1020

cagcacgtgc ccgtcctcaa ggacagcagc ctgctgttcg aggagtttaa gaagctgatc 1080

1140

gacacacata gccggaagaa gaggcagctc tacagcgccc tcgccaacaa atgctgccac 1200

gtgggctgca ccaagaggag cctggccaga ttctgt 1236

<210> 219

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 219

atgggcgtga aggtcctctt cgccctcatc tgcatcgccg tggccgaggc cgatagctgg 60

atggaggagg tcatcaagct ctgcgggcga gagctcgtga gagcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagtcc tcggacaaga cgcataccag cccgcccagc 180

cccgcccccg agctgctggg gggcagcagc gtgttcctgt tcccacccaa gcccaaggac 240

accctgtata tcacccggga acctgaggtg acatgcgtgg tggtggacgt aagccacgag 300

gacccagagg tgaagtttaa ctggtacgtg gacggggtgg aggtgcacaa tgccaagacc 360

aagcctaggg aggagcaata caactccacc taccgcgtgg tgagcgtgct gacggtcctg 420

caccaggact ggctgaacgg caaagagtac aagtgcaaag tgtccaacaa agccctgccc 480

gcccccatcg agaagccat ctccaaggcc aaggggcagc ccagagagcc ccaggtgtac 540

accctgcccc cctctagggga cgagctcacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct acccgtccga catcgccgtg gagtgggaga gcaacggcca acccgagaac 660

aactacaaga ccaccccgcc ggtgctcgac tccgacggca gcttcttcct ctacagcaag 720

ctaaccgtgg ataagagccg ctggcagcag ggcaacgtct tcagctgcag cgtcatgcac 780

gaggccctgc acaaccacta cacccagaaa agcctgtccc tgtcccccgg caagcggaag 840

aagagatcgc tgtcccagga ggacgccccc caaacgccca ggcccgtagc cgagatcgtg 900

cccagcttca tcaacaagga caccgagaca attaacatga tgagtgagtt tgtggccaat 960

ctcccccagg agctgaagct caccctgagc gagatgcagc ccgccctccc ccagctgcag 1020

cagcacgtgc ccgtgctgaa ggacagctcc ctcctgttcg aagagttcaa gaagctgatc 1080

aggaaccggc agagcgaggc cgccgactcc agccccagcg agctgaagta cctgggtctg 1140

gatacccact cggaagaa gcggcagctg tacagcgccc tggccaacaa gtgttgtcac 1200

gtcggttgca cgaaacggtc gctcgcccgg ttttgt 1236

<210> 220

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 220

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacaccag ccccccaagc 180

ccgctcccg agctgctggg cggcagcagc gtgttcctgt tccctcctaa acctaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccctgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aagccacggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgcct 480

gcgcccatcg agaggcat cagcaaggcc aaggggcagc ctagagaacc ccaggtgtac 540

accctgcctc ccagccggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga tattgctgtg gagtgggaga gcaacggcca gcctgagaac 660

aactacaaga ccacccctcc cgtgctggac agcgacggca gcttcttcct gtacagcaaa 720

ctgacagtgg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaagccctgc acaaccacta cacccagaaa agcctaagcc tgtcacccgg caagcggaag 840

aagcggtcct tgagccagga ggacgcgcct cagacccccc ggcctgtggc tgaaatcgtg 900

cccagcttca tcaacaaaga caccgagacg ataaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct caccttgagc gagatgcagc ccgctctgcc acaactccag 1020

cagcacgtgc ccgtccttaa ggacagcagc ctgcttttcg aggagttcaa gaagctgatc 1080

cggaaccggc agagcgaggc cgccgatagc tcccctagcg agctcaagta cctgggcctg 1140

gacacccaca gcagaaagaa gcgccagctg tatagcgccc tggccaacaa gtgctgccac 1200

gtgggatgca caaaaagaag cttggcccgg ttctgc 1236

<210> 221

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 221

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacacctc tcctccgtcc 180

cccgctcccg agctgctggg cggcagcagc gtgttcctgt tccctcccaa gcccaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccctgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aagccccggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgcca 480

gcccctatcg agaagccat cagcaaggcc aaggggcagc ccagggagcc acaggtgtac 540

accctgccgc ccagccggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga catcgctgtg gagtgggaga gcaacggcca gccggagaac 660

aactacaaga ccaccccacc cgtgctggac agcgacggca gcttcttcct gtacagcaag 720

ctcaccgtag acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaggccctac acaaccacta cacccagaaa agcctgagcc tatcccccgg caagcggaag 840

aagagatcgc tgagccagga ggacgccccc cagacccccc ggcccgtagc cgagatcgtg 900

cccagcttca tcaacaaaga cactgaaacg atcaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct cacactgagc gagatgcagc ccgctctgcc acagctccag 1020

cagcacgtgc ccgtcctgaa ggacagcagc ctgcttttcg aggagttcaa gaagctgatc 1080

1140

gacacccaca gccgcaagaa gcggcagctg tactccgccc tggccaacaa gtgctgccac 1200

gtggggtgca ccaaacgcag cctggcccgg ttctgc 1236

<210> 222

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 222

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacacctc cccacctagc 180

ccagccccg agctgctggg cggcagcagc gtgttcctgt tcccacccaa gcccaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccccgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aagccccggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgccc 480

gctcccatcg agaagccat cagcaaggcc aagggccagc ccagggagcc ccaggtgtac 540

accctgcctc ccagccggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga catcgctgtc gagtgggaga gcaacggaca gcccgagaac 660

aactacaaga ccacccctcc cgtgctggac agcgacggca gcttcttcct gtacagcaaa 720

ctgactgtgg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaggccttgc acaaccacta cacccagaaa agcctgtccc tgtcccccgg caagcggaag 840

aagcggtcac tgtccgga ggacgctccg cagacccccc ggccagtggc ggagatcgtg 900

cccagcttca tcaataagga taccgagaca attaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct gaccctgagc gagatgcagc ccgctctgcc gcagttacag 1020

1080

1140

gacacccaca gcagaaagaa aaggcagctg tactccgccc tggccaacaa gtgctgccac 1200

gtgggatgca ccaagagatc tctggcccgg ttctgc 1236

<210> 223

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 223

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacacctc acctccatcc 180

ccggcaccg agctgctggg cggcagcagc gtgttcctgt tccctcccaa gcccaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccccgaag tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aagccccggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgcct 480

gcgcctatcg agaggcat cagcaaggcc aagggccagc cacgggaacc ccaggtgtac 540

accctgcctc ccagccggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga tatcgctgtg gagtgggaga gcaacggcca acccgagaac 660

aactacaaga ccaccccacc cgtgctggac agcgacggca gcttcttcct gtacagcaaa 720

ctaaccgtgg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaagccctgc acaaccacta cacccagaaa agcctctccc tgagccccgg caagcggaag 840

aagcggtcct tgtcacagga ggacgccccc cagacccccc ggcccgtcgc tgagatcgtg 900

cccagcttca tcaacaaaga caccgaaaca attaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct gacactgagc gagatgcagc ccgctctgcc acaactgcag 1020

cagcacgtgc cagtgctcaa ggacagcagc ctcctgttcg aggagttcaa gaagctgatc 1080

1140

gacacccaca gccgcaaaaa gagacagctg tactccgccc tggccaacaa gtgctgccac 1200

gtgggatgca ccaaaagaag cctggcccgg ttctgc 1236

<210> 224

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 224

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacaccag ccccccttcc 180

cccgcccccg agctgctggg cggcagcagc gtgttcctgt tcccgcccaa gcccaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccccgaag tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aagccccggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgccc 480

gctcccatcg agaagccat cagcaaggcc aagggccagc caagagaacc ccaggtgtac 540

accctgcccc ccctcccggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga cattgccgtg gagtgggaga gcaacggcca gcccgagaac 660

aactacaaga ccaccccacc cgtgctggac agcgacggca gcttcttcct gtacagcaag 720

ctgactgtgg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaggccttgc acaaccacta cacccagaaa agcctgtccc ttagccccgg caagcggaag 840

aagaggagcc ttagcggga ggacgcccca cagacccccc ggcccgtggc tgaaatcgtg 900

cccagcttca tcaacaaaga cacagaaacc atcaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct caccctgagc gagatgcagc ccgcattgcc acagctccag 1020

cagcacgtgc ctgtgctgaa ggacagcagc ttgctctttg aggagttcaa gaagctgatc 1080

1140

gacacccaca gcagaaagaa gcggcagctg tactcagccc tggccaacaa gtgctgccac 1200

gtgggctgca caaagcggag cctggcccgg ttctgc 1236

<210> 225

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 225

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacaccag ccccccaagc 180

ccgcccccg agctgctggg cggcagcagc gtgttcctgt tcccgcccaa gccaaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gacccagaag tcaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aagccacggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgcct 480

gcacccatcg agaagccat cagcaaggcc aaggggcagc ctagagagcc ccaggtgtac 540

accctgccac ctagccggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga catcgctgtg gagtgggaga gcaacggcca gcctgagaac 660

aactacaaga ccaccccgcc cgtgctggac agcgacggca gcttcttcct gtacagcaag 720

ctcacggtag acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaagctctgc acaaccacta cacgcagaaa agcttgagcc tgtcacccgg caagcggaag 840

aagcggtccc tgtccgga ggacgcccct cagacccccc ggccagtagc ggagatcgtg 900

cccagcttca tcaacaagga tacagagact atcaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct gactctgagc gagatgcagc ccgcgctgcc tcaactgcag 1020

1080

1140

gacacccaca gcagaaagaa gcgacagttg tactccgccc tggccaacaa gtgctgccac 1200

gtgggttgca ccaagaggtc gctggcccgg ttctgc 1236

<210> 226

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 226

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacacctc accaccaagc 180

cctgcaccg agctgctggg cggcagcagc gtgttcctgt tccctcccaa gcccaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gacccagagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aaaccccgggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgccg 480

gcccctatcg agaagccat cagcaaggcc aagggccagc caagggaacc ccaggtgtac 540

accctgccac ccagccggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga catcgcagtg gagtgggaga gcaacggcca gcccgagaac 660

aactacaaga ccaccccacc cgtgctggac agcgacggca gcttcttcct gtacagcaag 720

ctgactgtcg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaggccttgc acaaccacta cacccagaaa agcctctctc tttctcccgg caagcggaag 840

aagaggagcc tgtccgga ggacgccccc caaactcccc ggcccgtcgc tgagatcgtg 900

cccagcttca tcaataaaga cacggagaca atcaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct gacactgagc gagatgcagc ccgcacttcc ccagctccag 1020

cagcacgtgc ccgtcctgaa ggacagcagc ttactcttcg aggagttcaa gaagctgatc 1080

1140

gacacccaca gcagaaagaa aagacagctg tattcagccc tggccaacaa gtgctgccac 1200

gtgggctgca caaagcggag cctcgcccgg ttctgc 1236

<210> 227

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 227

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacacctc ccctcccagt 180

cctgcccccg agctgctggg cggcagcagc gtgttcctgt tcccgcccaa gcccaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccctgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aagccccggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgccc 480

gccccaatcg agaagccat cagcaaggcc aagggccagc ctagggagcc gcaggtgtac 540

accctgccac cctctcggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga tatcgccgtc gagtgggaga gcaacggcca acctgagaac 660

aactacaaga ccacccctcc cgtgctggac agcgacggca gcttcttcct gtacagcaag 720

ctcaccgtgg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaagccctgc acaaccacta cacccagaaa agcttgagcc tcagtcccgg caagcggaag 840

aagcgatcct tgagccagga ggacgctcct cagacccccc ggcctgtggc ggagatcgtg 900

cccagcttca tcaacaaaga cactgaaacc attaacatga tgagcgagtt cgtggctaac 960

ttgccccagg agctgaagct gactctgagc gagatgcagc ccgctctccc gcagcttcag 1020

cagcacgtgc ccgtgttgaa ggacagcagc ctcctcttcg aggagttcaa gaagctgatc 1080

cggaaccggc agagcgaggc cgctgattct tcccctagcg aactgaaata cctgggcctg 1140

gacacccaca gcagaaagaa gaggcagctg tactctgccc tggccaacaa gtgctgccac 1200

gtgggctgca caaagaggag cctggcccgg ttctgc 1236

<210> 228

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 228

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacacctc ccctccgtcc 180

ccgctcccg agctgctggg cggcagcagc gtgttcctgt tccctcccaa gcccaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gacccagaag tcaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aagccccggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgcct 480

gctcctatcg agaagccat cagcaaggcc aagggccagc ctcgggaacc ccaggtgtac 540

accctgcccc ctagccggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga tattgccgtg gagtgggaga gcaacgggca gcccgagaac 660

aactacaaga ccaccccgcc cgtgctggac agcgacggca gcttcttcct gtacagcaag 720

cttaccgtcg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaagccctgc acaaccacta cacccagaaa agcctctccc tgtctcccgg caagcggaag 840

aagcgcagtc tctctcagga ggacgctcct cagacccccc ggcccgtcgc cgaaatcgtg 900

cccagcttca tcaacaaaga cactgaaacc ataaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagtt gactctgagc gagatgcagc ccgccctgcc acagctccag 1020

cagcacgtgc ccgtcctgaa ggacagcagc ctgttgttcg aggagttcaa gaagctgatc 1080

1140

gacacccaca gccggaagaa aaggcagtta tacagcgccc tggccaacaa gtgctgccac 1200

gtgggatgta ccaagaggag tctggcccgg ttctgc 1236

<210> 229

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 229

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacaccag tcccccctct 180

cccgcacccg agctgctggg cggcagcagc gtgttcctgt tccctcccaa gcccaaggac 240

accctgtaca tcacccggga gcccgaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccccgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 360

aagccccggg aggagcagta caacagcacc taccgggtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgccg 480

gcgccaatcg agaagccat cagcaaggcc aagggtcagc ccagggagcc ccaggtgtac 540

accctgcctc cctctcggga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga catcgctgtg gagtgggaga gcaacggcca gcccgagaac 660

aactacaaga ccacccctcc cgtgctggac agcgacggca gcttcttcct gtacagcaag 720

ctgacagtgg acaagagccg gtggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaggccttgc acaaccacta cacccagaaa agcctgagcc tctcccccgg caagcggaag 840

aagaggagcc tcagccagga ggacgctccc cagacccccc ggccagtggc cgaaatcgtg 900

cccagcttca tcaacaagga tacagagaca attaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct cacactgagc gagatgcagc ccgccctgcc acagttgcag 1020

cagcacgtgc ccgtactcaa ggacagcagc ctccttttcg aggagttcaa gaagctgatc 1080

1140

gacacccaca gcaggaaaaa gagacagctg tatagcgccc tggccaacaa gtgctgccac 1200

gtgggctgta ccaagcggag cttggcccgg ttctgc 1236

<210> 230

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 230

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcgg aggtggtggc tcaggcggcg ggggatccgg cggtggtggt 180

agcggcggag gcgggtctgg tggcggcggt tcagggggag ggggcagtgg gggaggaggc 240

tctttccaga gctcctcctc caaggcccca ccccctagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc caaggagggg gtggctccgg gggcggtgga 360

420

tcggggggtg ggggatcaca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 231

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 231

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcgg cggcgggggg tcagggggag gagggtccgg gggaggcgggg 180

agcggtggag gcggctccgg tggtgggggt tctggcggcg gtggcagtgg gggaggggga 240

tccttccaga gctcatcctc caaggctcct cccccgagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc caggggggcg gcggctcagg cgggggtggt 360

agtggcggag gaggatctgg agggggcgggg tcaggagggg gtggaagcgg ggggggtggc 420

tctggtggcg ggggctctca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 232

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 232

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

180

tccggcggag gtggaagtgg cggggggggt tcaggagggg gaggctctgg aggcggagga 240

agtttccaga gctcctcctc aaaggcgcct cccccaagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc caaggtggcg gtggtagcgg gggtggtggg 360

tcaggcggcg gcggatcggg tggcggaggg tctggtggag gtggggagcgg cgggggcggt 420

agcggcggtg gcggctccca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 233

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 233

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcgg tggcggcggga tctggcggtg gggggtcggg tgggggaggt 180

tccgggggag gcggttcagg gggcgggggc tcaggcggtg gtggaagtgg gggcggcggc 240

agtttccaga gctccagctc caaggccccg cctcccagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc cagggagggg gagggtcagg aggcggaggg 360

tccggggggtg gaggatcggg aggtggcggt agcggcgggg ggggcagcgg aggcggggga 420

tctggtggtg ggggttctca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 234

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 234

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcgg cggcggtggc agtgggggcg gagggtctgg tggtgggggc 180

tctggcgggg gggaagtgg agggggcggc

agcttccaga gctctagcag caaggcgcca cccccaagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc cagggcggcg gaggttctgg gggagggggt 360

tccggcgggg ggggcagcgg aggggggggt agcgggggtg gcgggagcgg aggaggggga 420

tccggtggcg gaggatccca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 235

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 235

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcgg tggagggggg tcagggggag ggggctccgg cgggggaggc 180

tcgggaggag gcggttcagg tgggggcggc tctggtggag gcggatccgg tggcgggggg 240

agcttccaga gcagctcgtc caaggcccct cccccaagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc cagggtgggg gaggaagcgg aggtggtggc 360

420

agcggggggtg gtggatccca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 236

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 236

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcgg gggtggtgga tcaggtggag gcggcagtgg cgggggcggt 180

240

tccttccaga gcagtagctc taaggcccca ccgcccagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc cagggtgggg gtggctccgg cggcggaggc 360

tctggggggcg gcgggggcgg agggggcgggg tcaggcgggg ggggctcagg gggaggtggg 420

tccggtggag gtggaagtca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 237

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 237

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcgg cggaggtgga tcaggcggcg gtgggtccgg gggtggcggg 180

tcaggggggcg gagggtccgg cggcggggga agcggtggcg gtggctccgg aggaggaggc 240

tctttccaga gctcctcatc taaggccccg ccgcccagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc cagggcggtg gaggcagtgg tgggggaggg 360

420

tctggtggcg gaggaagcca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 238

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 238

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcgg gggaggtgggg tcaggtggcg ggggatccgg cggagggggt 180

tcaggaggcg gcgggagcgg aggtggtggt tcgggtggag gggggagcgg tggcggagga

agcttccaga gctcctcctc taaggccccg ccccctagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc caggggggcg gtggaagcgg cgggggcggga 360

tctggggggtg ggggctctgg tgggggagggg agtggggggg gaggctcagg gggtggtggc 420

tctgggggcg gcggctcaca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 239

<211> 510

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 239

atgggcgtga aggtgctgtt cgccctgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggccgg gagctggtgc gggcccagat cgccatctgc 120

ggcatgagca cctggagcgg cggaggcggga agcggcgggg ggggcagtgg tggaggtggt 180

tctggtggcg ggggatctgg aggcggcggg tcaggcggtg ggggcagcgg aggagggggc 240

tctttccaga gctcctcatc taaggctcct cccccaagcc tgcccagccc cagccggctg 300

cccggcccca gcgacacccc catcctgccc cagggagggg gagggagtgg gggcggcggc 360

tctggggggtg gaggctcagg gggcggagga agcggagggg gtggtagcgg gggcgggggt 420

agtggggggg gtggctccca gctgtacagc gccctggcca acaagtgctg ccacgtggggc 480

tgcaccaagc ggagcctggc ccggttctgc 510

<210> 240

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 240

atgggcgtga aagtgctgtt tgcgctgatt tgcattgcgg tggcggaagc ggactcatgg 60

atggaggaag ttattaaatt atgcggccgc gaattagttc gcgcgcagat tgccatttgc 120

ggcatggagc ccaagagcag cgacaagacc cacaccagcc cccccagccc cgcccccgag 180

ctgctgggcg gcagcagcgt gttcctgttc ccccccaagc ccaaggacac cctctacatc 240

accagggagc ccgaggtgac ctgcgtggtg gtggacgtga gccacgagga ccccgaggtg 300

aagttcaact ggtacgtgga cggcgtggag gtgcacaacg ccaagaccaa gcccagggag 360

gagcagtaca acagcaccta cagggtggtg agcgtgctga ccgtgctgca ccaggactgg 420

ctgaacggca aggagtacaa gtgcaaggtg agcaacaagg ccctgcccgc ccccatcgag 480

aagaccatca gcaaggccaa gggccagccc agggagcccc aggtgtacac cctgcccccc 540

agcagggacg agctgaccaa gaaccaggtg agcctgacct gcctggtgaa gggcttctac 600

660

accccccccg tgctggacag cgacggcagc ttcttcctgt acagcaagct gaccgtggac 720

aagagcaggt ggcagcaggg caacgtgttc agctgcagcg tgatgcacga ggccctgcac 780

aaccactaca cccagaagag cctgagcctg agccccggca aggaagag cacctggagc 840

aaaaggtctc tgagccagga agatgctcct cagacaccta gaccagtggc agaaattgtg 900

960

ttgccacagg agctgaagtt aaccctgtct gagatgcagc cagcattacc acagctacaa 1020

caacatgtac ctgtattaaa agattccagt cttctctttg aagaatttaa gaaacttatt 1080

1140

gatactcatt ctcgaaaaaa gagacaactc tacagtgcat tggctaataa atgttgccat 1200

gttggttgta ccaaaagatc tcttgctaga ttttgc 1236

<210> 241

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 241

atgccgac tgttcttctt ccacctgctg ggcgtgtgcc tgttacttaa ccagttcagc 60

agagccgtgg ccgacagctg gatggaggag gtgatcaagc tgtgcggcag agagctggtg 120

agagcccaga tcgccatctg cggcatgtct acctggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagctgctgg gcggcagcag cgtgttcctg 240

ttccccccca agcccaagga caccctgtac atcaccagag agcccgaggt gacctgcgtg 300

gtggtggacg tgagccacga ggaccccgag gtgaagttca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac caagcccaga gaggagcagt acaacagcac ctacagagtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg ggaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc cgcccccatc gagaagacca tcagcaaggc caagggccag 540

cccagagagc cccaggtgta caccctgccc cccagccgag acgaactgac caagaatcag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggaa 660

agcaacggcc agcccgagaa caactacaag accaccccccc ccgtgctgga cagcgacggc 720

agcttcttcc tgtatagcaa gctgaccgtg gacaagtcaa gatggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gagcctgagc 840

ctgagccccg gcaagagaaa gaagagaagc ctgagccagg aggacgcccc ccagacacct 900

agacccgtgg ccgagatcgt gcccagcttt atcaacaagg acaccgagac catcaacatg 960

atgtccgagt tcgtggccaa cctgccccag gagctgaagc tgaccctgag cgagatgcag 1020

cccgccctgc cccagctgca gcagcacgtg ccagtgctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat cagaaacaga cagagcgagg ccgccgacag cagccccagc 1140

gagctgaagt acctgggcct ggacacccac agcagaaaga agagacaact gtacagcgcc 1200

ctggccaata agtgctgcca cgtgggctgc accaagagaa gcctggccag attctgc 1257

<210> 242

<211> 531

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 242

atgcctaggt tgtttttctt tcacttacta ggagtatgtt tactcctgaa tcaattttct 60

agggctgtcg cagatagttg gatggaggag gtaatcaaat tatgtggaag agagttagtt 120

cgtgctcaaa tagctatttg tggtatgtca acttggagcg gagggggcgg ctcgggcgga 180

gggggaagcg gagggggtgg ctcaggaggg ggcggttctg gtggcggcgg atcaggtggt 240

ggaggatcag gaggcggggg cagctttcag tcgtcgtcat ccaaagcgcc tccaccctca 300

ctgccctccc cctccagatt acctgggccc tccgataccc ccattttgcc acaagggggt 360

ggaggatccg gggggggagg cagtggtggt ggtggtagcg gtggtggggg ctccggtgga 420

ggcggaagtg gtgggggagg atccgggggg ggcggatcgc agctctattc cgctcttgcc 480

aataaatgtt gccacgtcgg ttgtacaaaa cggtccctgg ccagattctg c 531

<210> 243

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 243

atgccgac tgttcttctt ccacctgctg ggcgtgtgcc tgttacttaa ccagttcagc 60

agagccgtgg ccgacagctg gatggaggag gtgatcaagc tgtgcggcag agagctggtg 120

agagcccaga tcgccatctg cggcatgtct acctggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagctgctgg gcggcagcag cgtgttcctg 240

ttccccccca agcccaagga caccctgtac atcaccagag agcccgaggt gacctgcgtg 300

gtggtggacg tgagccacga ggaccccgag gtgaagttca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac caagcccaga gaggagcagt acaacagcac ctacagagtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg ggaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc cgcccccatc gagaagacca tcagcaaggc caagggccag 540

cccagagagc cccaggtgta caccctgccc cccagccgag acgaactgac caagaatcag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggaa 660

agcaacggcc agcccgagaa caactacaag accaccccccc ccgtgctgga cagcgacggc 720

agcttcttcc tgtatagcaa gctgaccgtg gacaagtcaa gatggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gagcctgagc 840

ctgagccccg gcaagagaaa gaagagaagc ctgagccagg aggacgcccc ccagacacct 900

agacccgtgg ccgagatcgt gcccagcttt atcaacaagg acaccgagac catcaacatg 960

atgtccgagt tcgtggccaa cctgccccag gagctgaagc tgaccctgag cgagatgcag 1020

cccgccctgc cccagctgca gcagcacgtg ccagtgctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat cagaaacaga cagagcgagg ccgccgacag cagccccagc 1140

gagctgaagt acctgggcct ggacacccac agcagaaaga agagacaact gtacagcgcc 1200

ctggccaata agtgctgcca cgtgggctgc accaagagaa gcctggccag attctgc 1257

<210> 244

<211> 1236

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 244

atgggcgtga aggtgctgtt cgcactgatc tgcatcgccg tggccgaggc cgacagctgg 60

atggaggagg tgatcaagct gtgcggcaga gagctggtga gagcccagat cgccatctgc 120

ggcatgagca cctggagcga gcccaagagc agcgacaaga cccacaccag cccccccagc 180

cccgctcccg agctgctggg cggcagcagc gtgttcctgt tccccccccaa gcccaaggac 240

accctgtaca taaccagaga gccagaggtg acctgcgtgg tggtggacgt gagccacgag 300

gaccccgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagaca 360

aagccgag aggagcagta caacagcacc tacagagtgg tgagcgtgct gaccgtgctg 420

caccaggact ggctgaacgg caaggagtat aagtgcaagg tgagcaacaa ggccctgccc 480

gcccccatcg agaagccat cagcaaggcc aagggccagc ccagagagcc ccaggtgtac 540

accctgcccc ccagcagaga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 600

aagggcttct accccagcga catcgccgtg gagtgggaga gcaacggcca gcccgagaac 660

aactacaaga ccaccccccc cgtgctggac agcgacggca gcttcttcct gtacagcaag 720

ctgaccgtgg acaagagcag atggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 780

gaggccttac acaaccacta cacccagaag agcctaagcc tgagccccgg caagagaaag 840

aagagaagtc tgagccagga ggacgccccc cagaccccca gacccgtggc cgagatcgtg 900

ccctccttca ttaacaagga caccgagacc atcaacatga tgagcgagtt cgtggccaac 960

ctgccccagg agctgaagct gaccctgagc gaaatgcaac ccgccctgcc ccagctgcaa 1020

cagcacgtgc ccgtgctgaa ggacagcagc ctgctgttcg aggagttcaa aaagctgatc 1080

agaaacagac agagcgaggc cgccgactcc agccccagcg agctgaagta cctgggcctg 1140

gacacccaca gcagaaagaa gagacagctg tacagcgccc tggccaacaa gtgctgccac 1200

gtgggctgca ccaagagaag cctggccaga ttctgc 1236

<210> 245

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 245

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagctgctgg gcggcagcag cgtgttcctg 240

ttccccccca agcccaagga caccctgtac atcaccaggg agcccgaggt gacctgcgtg 300

gtggtggacg tgagccacga ggaccccgag gtgaagttca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac caagcccagg gaggagcagt acaacagcac ctacagggtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc cgcccccatc gagaagacca tcagcaaggc caagggccag 540

cccagggagc cccaggtgta caccctgccc cccagcaggg acgagctgac caagaaccag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agcccgagaa caactacaag accaccccccc ccgtgctgga cagcgacggc 720

agcttcttcc tgtacagcaa gctgaccgtg gacaagagca ggtggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gagcctgagc 840

ctgagccccg gcaagaggaa gaaaaggtct ctgagccagg aagatgctcc tcagacacct 900

agaccagtgg cagaaattgt gccatccttc atcaacaaag atacagaaac cataaatatg 960

atgtcagaat ttgttgctaa tttgccacag gagctgaagt taaccctgtc tgagatgcag 1020

ccagcattac cacagctaca acaacatgta cctgtattaa aagattccag tcttctcttt 1080

gaagaattta agaaacttat tcgcaataga caaagtgaag ccgcagacag cagtccttca 1140

gaattaaaat acttaggctt ggatactcat tctcgaaaaa agagacaact ctacagtgca 1200

ttggctaata aatgttgcca tgttggttgt accaaaagat ctcttgctag attttgc 1257

<210> 246

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 246

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagctgctgg gcggcagcag cgtgttcctg 240

ttccccccca agcccaagga caccctgtac atcaccaggg agcccgaggt gacctgcgtg 300

gtggtggacg tgagccacga ggaccccgag gtgaagttca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac caagcccagg gaggagcagt acaacagcac ctacagggtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc cgcccccatc gagaagacca tcagcaaggc caagggccag 540

cccagggagc cccaggtgta caccctgccc cccagcaggg acgagctgac caagaaccag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agcccgagaa caactacaag accaccccccc ccgtgctgga cagcgacggc 720

agcttcttcc tgtacagcaa gctgaccgtg gacaagagca ggtggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gagcctgagc 840

ctgagccccg gcaagaggaa gaaaaggtct ctgagccagg aagatgctcc tcagacacct 900

agaccagtgg cagaaattgt gccatccttc atcaacaaag atacagaaac cataaatatg 960

atgtcagaat ttgttgctaa tttgccacag gagctgaagt taaccctgtc tgagatgcag 1020

ccagcattac cacagctaca acaacatgta cctgtattaa aagattccag tcttctcttt 1080

gaagaattta agaaacttat tcgcaataga caaagtgaag ccgcagacag cagtccttca 1140

gaattaaaat acttaggctt ggatactcat tctcgaaaaa agagacaact ctacagtgca 1200

ttggctaata aatgttgcca tgttggttgt accaaaagat ctcttgctag attttgc 1257

<210> 247

<211> 918

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 247

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg aggtgcagct gctggagagc 180

ggcggcggcc tggtgcagcc cggcggcagc ctgaggctga gctgcgtggc cagcggcttc 240

accttcaaca gcagcgccat gagctgggtg aggcaggccc ccggcaaggg cctggagtgg 300

gtgagcgcca tcagcggcag cggcgacagg acctactacg ccgacagcgt gaagggcagg 360

ttcaccatca gcagggacaa cagcaagaac accctgtacc tgcagatgaa cagcctgagg 420

gccgaggaca ccgccgtgta ctactgcacc accgaccccc ccaggtacca ctacaacggc 480

ctggccgtga ggggccaggg caccaccgtg accgtgagca gcaaaaggtc tctgagccag 540

gaagatgctc ctcagacacc tagaccagtg gcagaaattg tgccatcctt catcaacaaa 600

gatacagaaa ccataaatat gatgtcagaa tttgttgcta atttgccaca ggagctgaag 660

ttaaccctgt ctgagatgca gccagcatta ccacagctac aacaacatgt acctgtatta 720

aaagattcca gtcttctctt tgaagaattt aagaaactta ttcgcaaatag acaaagtgaa 780

gccgcagaca gcagtccttc agaattaaaa tacttaggct tggatactca ttctcgaaaa 840

aagagacaac tctacagtgc attggctaat aaatgttgcc atgttggttg taccaaaaga 900

tctcttgcta gattttgc 918

<210> 248

<211> 918

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 248

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg aggtgcagct gctggagagc 180

ggcggcggcc tggtgcagcc cggcggcagc ctgaggctga gctgcgccgc cagcggcttc 240

accttcagca gctacgccat gagctggggtg aggcaggccc ccggcaaggg cctggagtgg 300

gtgagcgcca tcagcggcag cggcggcagc acctactacg ccgacagcgt gaagggcagg 360

ttcaccatca gcagggacaa cagcaagaac accctgtacc tgcagatgaa cagcctgagg 420

gccgaggaca ccgccgtgta ctactgcacc aaggaccccc ccaggtacca ctacaccggc 480

ctggccgtga ggggccaggg caccaccgtg accgtgagca gcaaaaggtc tctgagccag 540

gaagatgctc ctcagacacc tagaccagtg gcagaaattg tgccatcctt catcaacaaa 600

gatacagaaa ccataaatat gatgtcagaa tttgttgcta atttgccaca ggagctgaag 660

ttaaccctgt ctgagatgca gccagcatta ccacagctac aacaacatgt acctgtatta 720

aaagattcca gtcttctctt tgaagaattt aagaaactta ttcgcaaatag acaaagtgaa 780

gccgcagaca gcagtccttc agaattaaaa tacttaggct tggatactca ttctcgaaaa 840

aagagacaac tctacagtgc attggctaat aaatgttgcc atgttggttg taccaaaaga 900

tctcttgcta gattttgc 918

<210> 249

<211> 531

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 249

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggtccg ggtcgaccga tagcggttcc 180

gacacttcct cgggaaactc cggggacggc aacagcggct tccagtcgag ctcctcaaag 240

gccccacctc cctcactgcc ctccccttct cggctccctg gaccgtccga tactccgatc 300

ctgccgcaat tccagtccag cagctccaag gcccctccac cgtcactgcc atccccgtcg 360

aggttgccgg gaccctcaga cacgcccatc ctgcctcagg gcagcaccga ctcgggatcc 420

gatacctcgt ccgggaactc cggcgacggg aactcgggac aactctacag tgcattggct 480

aataaatgtt gccatgttgg ttgtaccaaa agatctcttg ctagattttg c 531

<210> 250

<211> 441

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 250

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggtccg gaggaggagg gtccttccag 180

tcaagcagct ccaaggcccc tccaccaagc ctccctagcc cgtccaggct tccgggaccg 240

tcggatactc ccatcctgcc ccagttccag tcctcgtcgt ccaaggctcc ccctccatcc 300

ctgccctcac cctcacggct gccaggaccg tccgacaccc ctatcctgcc gcaaggcggt 360

ggagggtcac aactctacag tgcattggct aataaatgtt gccatgttgg ttgtaccaaa 420

agatctcttg ctagattttg c 441

<210> 251

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 251

atgccgagac tgttcttctt ccacctcctc ggcgtgtgcc tcctcctcaa ccagttctct 60

cgagccgtgg cggatagctg gatggaggag gtgatcaagc tctgtggccg tgagctcgtc 120

cgggcccaga tcgccatctg cggcatgtcc acctggtccg agcccaagtc ctccgacaag 180

acccacct cgccccccag ccctgccccc gagctcctgg gcggcagctc cgtcttcctg 240

ttcccgccca agccgaagga taccctgtac atcaccaggg agcccgaggt gacctgtgtc 300

gtggtggacg tgagccacga ggaccccgag gtgaagttta attggtacgt cgacggcgtg 360

gaggtgcaca acgccaagac caagcccagg gaggagcagt acaactccac ctaccgggtg 420

gtgagcgtgc tgacagtcct gcatcaggac tggctgaacg gcaaggaata caagtgcaag 480

gtgagcaaca aggccctgcc cgcccccatc gagaagacca tcagcaaggc caagggccaa 540

ccccgggaac cccaggtcta caccctgcct cccagcaggg atgagctgac caagaaccag 600

gttagcctga cctgcctggt caagggcttc tacccctccg acattgccgt ggagtgggag 660

agcaacggtc agccgagaa caactacaag accacccctc ccgtgctcga cagcgacggt 720

tccttcttcc tgtacagcaa gctgacggtg gacaagagcc gctggcagca gggcaacgtg 780

ttcagctgct ccgtgatgca cgaagccctg cacaaccact acacccagaa gtccctgagc 840

ctgtcacccg gcaagaggaa gaagcggagc ctgtcccagg aggatgcccc ccagacccct 900

agacctgtgg ccgaaattgt gccctccttt atcaacaagg acaccgaaac catcaatatg 960

atgtccgagt tcgtggccaa cctgccccag gagctgaaac tcaccctgag cgagatgcag 1020

cccgccctgc cccagctgca acagcacgtg cccgtgctga aggactcatc tctgctgttc 1080

gaggaattca agaagctgat caggaacagg cagagcgagg ccgccgacag cagtcccagc 1140

gagctgaaat acctgggcct ggacacccac tcccgcaaga agcggcagct gtacagcgcc 1200

ctggccaaca agtgctgcca cgtaggctgc accaaacgca gcctggcacg gttctgc 1257

<210> 252

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 252

atgccccgtc tcttcttctt ccacctcctc ggagtgtgcc tcctcctcaa ccagttcagc 60

agggccgtgg ccgactcctg gatggaggaa gtgatcaagc tctgcggcag ggagctcgtg 120

agggcccaaa tcgccatctg cggcatgagc acctggtccg agcccaagag ctccgacaag 180

actcacacca gccccccgag ccccgccccc gagctgctgg gcgggagcag cgtgtttctg 240

ttccctccca agcccaagga caccctgtac atcacccgcg agccggaagt gacctgcgtg 300

gtggtggacg tctccccga ggaccccgag gtgaaattca actggtacgt ggacggcgtg 360

gaagtgcaca atgcgaagac caagcccagg gaggagcagt acaacagcac ctacagggta 420

gtcagcgtgc tgaccgtgct gcatcaggac tggctgaatg gcaaggagta caagtgcaaa 480

gtgtccaata aggctctgcc cgcccccatc gagaagacca tcagcaaagc caagggacag 540

cccagagagc cccaggtgta caccctgccc ccgagcaggg acgagctgac caagaaccag 600

gtcagcctga cctgcctggt gaaggggttt taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agcccgagaa caactacaag acgacacccc cggtgctgga cagcgacggg 720

tctttcttcc tgtacagcaa gctgaccgtg gataaatcca gatggcagca gggcaacgtc 780

ttcagctgct ccgtgatgca tgaggccctg cacaaccact acacgcagaa gtcactgtcc 840

ctgagccccg gcaagaggaa gaagcggagc ctgagccagg aggacgcccc ccagaccccc 900

cggcccgtgg cggagatcgt gcctagcttc atcaacaagg acaccgagac tatcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tcaccctgtc cgaaatgcag 1020

ccggccctcc cgcagctgca gcagcacgta cccgtgctga aagattccag tctgctgttt 1080

gaggagttca agaagctgat caggaatcgg cagtccgagg ccgccgacag cagcccgtcc 1140

gagttgaagt acctcggcct ggatacccat tcgcggaaga agaggcaact gtactccgcc 1200

ctggccaaca agtgctgtca cgtggggtgc acaaagagaa gcctggcccg tttctgc 1257

<210> 253

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 253

atgcccaggc tgttcttctt ccacctcctc ggcgtgtgtc tcctcctcaa ccaatttagc 60

cgtgccgtgg cggacagctg gatggaggag gtgatcaagc tctgtggtag agagctcgtc 120

cgtgcccaga ttgccatctg tggcatgtcc acctggagcg agcccaagtc cagcgacaag 180

acccacacca gcccgcccag ccctgccccc gagctgctgg gcggcagcag cgtgttcctg 240

ttcccgccca agcccaagga cacactgtac ataacccggg agcccgaggt gacctgtgtg 300

gtggtcgacg tcagccacga ggaccccgag gtcaaattca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac taaaccccgg gaggaacaat acaactccac ctacagggtg 420

gtatccgtgc tgaccgtcct gcaccaggat tggctcaacg gcaaagagta taagtgcaaa 480

gtgtccaaca aggccctgcc cgcccccatc gagaagacga tcagcaaggc caagggccag 540

cccggggagc cccaggtcta cacgctgccc cccagcagag acgagcttac caagaaccag 600

gtttccctga cctgcctggt gaagggcttc tacccgagcg acattgccgt ggagtgggag 660

agcaacggcc agcccgagaa taactacaag accacgcccc ccgtgctcga ctccgacggc 720

agcttctttc tctactccaa gctgaccgtt gacaagagcc gctggcagca gggaaacgtg 780

ttcagctgca gcgtcatgca cgaggccctg cacaaccact acacgcagaa gtccctgagc 840

ctgtcccccg gcaaacgtaa gaagaggagc ctgagccagg aggacgcccc ccagaccccc 900

aggccagtgg ccgagatcgt cccctccttc ataaacaagg acaccgaaac catcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgaccctcag cgagatgcag 1020

cccgccctcc cccaactcca gcagcacgtg cccgtgctca aggacagcag cctgctgttt 1080

1140

gagctcaagt acctgggtct ggacacccat agcaggaaga agaggcagct gtacagtgcc 1200

ctggcgaaca agtgctgcca cgtgggctgc accaagagga gccttgccag gttctgc 1257

<210> 254

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 254

atgccgagac ttttcttctt ccacttgctc ggcgtgtgcc tcctccttaa ccaatttagc 60

agagccgtgg cagactcctg gatggaggag gtgatcaagc tctgcggcag ggagctcgtg 120

agggcgcaga tcgccatttg cggtatgtcc acatggagcg agcccaagag ctcagataag 180

acccacacca gccctcccag ccccgccccc gagctgctgg gcggcagcag cgtgttcctc 240

ttcccgccca aacccaagga caccctgtac atcaccaggg agcccgaggt gacctgcgtg 300

gtcgtcgacg tatcccacga ggaccccgag gtgaagttca actggtacgt ggacggggtg 360

gaggtgcata acgccaagac caagccccgg gaggagcagt acaacagcac ctaccgggtg 420

gtgtccgtgc tgacagtcct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtcagcaaca aagccctgcc cgcccccatc gagaagacca tctcaaaggc caaggggcag 540

ccccgcgagc cacaggtgta tacgctgccg cccagcagag acgagctgac caagaaccag 600

gtgagcctga cctgcctggt caagggcttc tatcccagcg acatcgccgt tgagtgggag 660

agcaacggcc agccgagaa caactataag accactccac ccgtcctgga cagcgatggg 720

agcttcttcc tgtactccaa gctgaccgtg gacaagagcc gctggcagca gggcaatgtg 780

ttcagctgct ccgtgatgca cgaggccctg cataaccatt acacccagaa gtcgctgagc 840

ctgagccctg gcaagaggaa gaaacgcagc ctgagccagg aggatgcccc gcagacccct 900

cggccggtgg ccgagatcgt gccttccttc atcaacaagg acaccgagac aatcaacatg 960

atgtccgagt tcgtagccaa tctgccccag gagctgaagc tgaccctctc cgagatgcag 1020

cccgccctgc cccagctgca gcaacacgtc ccggtgctca aggacagcag cctgctgttc 1080

1140

gagctgaagt acctgggcct cgacacacat agcaggaaga agcggcagct ctactccgcc 1200

ctcgccaata agtgctgtca cgtgggctgc accaagagaa gcctggccag attttgc 1257

<210> 255

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 255

atgccccggc tgttcttctt ccacctcctc ggcgtgtgcc tcctcctcaa tcagttctcc 60

agggccgtcg ccgactcctg gatggaggag gtgatcaagc tctgcgggcg cgagctcgtg 120

agagcccaga ttgccatctg cggcatgtcc acctggagcg agcccaagag cagcgacaag 180

acccacct cccctcccag ccccgcgccg gagctgctgg gcggcagcag cgtgtttctg 240

ttccctccca agcccaagga caccctgtac atcactaggg agcccgaggt gacctgcgtg 300

gtcgtggatg tgagccacga agatccagag gtgaagttca attggtacgt cgacggcgtg 360

gaggtgcaca atgccaagac caagcccagg gaggagcagt acaacagcac ctacagggtc 420

gtttccgtgc tcaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtcagcaaca aagccctacc cgcccccatc gagaagacaa tcagcaaagc caagggccag 540

cccagggagc cccaggtgta taccctccca ccctccaggg acgaactgac caagaatcag 600

gtcagcctga cctgccttgt caagggcttt taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc aacccgagaa caattacaag accaccccgc ccgtcctgga ctccgacggg 720

tccttcttcc tatacagcaa gctgaccgtg gacaagtcca gatggcagca agggaacgtg 780

ttctcctgct ccgtgatgca cgaggccctg cacaatcact acacgcagaa gagtctgagc 840

ctgagccccg ggaagcggaa gaagcgatcc ctgagccagg aggacgcccc gcagacaccc 900

cgccccgtgg ccgagattgt gcccagcttc atcaacaagg acaccgagac gatcaatatg 960

atgtccgagt tcgtggccaa cctgccacag gaactgaagc tgaccctgag cgaaatgcag 1020

cctgcgcttc cgcagctgca acaacatgtc cccgtgctga aggacagcag cctgctgttt 1080

gaggagttca agaagctgat aaggaaccgg cagagcgagg ccgccgacag cagccccagc 1140

gaactgaagt acctgggcct ggacacccac agcagaaaga agaggcaact gtatagcgca 1200

ctggctaata agtgctgtca cgtgggctgc accaaacgca gcctggccag gttctgc 1257

<210> 256

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 256

atgccgac tgttcttctt ccacctcctc ggggtgtgcc tcctcctcaa ccagttctcc 60

agggccgtgg ccgacagctg gatggaggag gtgatcaagc tctgcggcag agagctcgtc 120

agggcccaga tcgccatctg cggtatgagc acgtggagcg agcccaagag ctccgacaag 180

acccatacaa gccccccgag ccccgcgccc gaactcctgg ggggctccag cgtgtttctg 240

ttcccgccca agcccaaaga caccctgtac atcacccggg agcctgaggt gacctgcgtg 300

gtggtggacg tgtcccacga agaccctgag gtgaaattca actggtacgt ggacggcgtg 360

gaggtgcata acgccaagac caaaccgcgt gaggagcaat acaacagcac ctaccggggtg 420

gtgtcggtgc tgaccgtcct gcaccaggac tggctgaacg gcaaggagta caagtgtaag 480

gtgtccaaca aggctctccc cgcccccatc gagaagacca tctccaaggc caagggccag 540

ccccgcgagc cccaggtgta caccctcccg cccagccgcg acgagctgac caagaaccag 600

gtgtccctga cctgcttggt gaagggcttc taccccagcg acatcgccgt ggaatgggag 660

tccaacggcc agccggagaa caactacaag accactcccc ccgtcctgga cagcgacggc 720

tccttcttcc tgtacagcaa gctgaccgtc gacaagtccc gctggcagca ggggaacgtg 780

ttctcctgca gcgtgatgca cgaggccctg cacaaccact acactcagaa gtctctgtcc 840

cttagccccg gcaagcggaa gaagaggagc ctgagccagg aggacgcccc ccaaacgcct 900

cgccccgtgg ccgagattgt gcccagcttc atcaacaagg acaccgaaac catcaatatg 960

atgtccgagt tcgtggccaa cctgccccag gagctgaagc tgaccctgtc cgagatgcag 1020

cccgccctgc cccagctgca gcagcacgtg cccgtgctga aggacagcag cctgctgttc 1080

gaggagttta agaagctgat cagaaacaga caatccgagg cagccgactc ctcccccagc 1140

gagctgaaat acctgggcct ggacacccat tcccggaaga agcggcagct gtacagcgcc 1200

ctcgccaaca agtgctgcca cgtgggctgc accaagagaa gcctggccag gttctgc 1257

<210> 257

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 257

atgccccgcc tgttcttctt ccacctcctc ggcgtgtgtc tcctccttaa ccagttctcc 60

cgtgccgtgg ccgatagctg gatggaggag gtgatcaagc tctgcggccg agagctcgtg 120

agggcacaga tcgccatctg tggcatgtcc acctggagcg aacccaagag ctccgataag 180

acccacacca gccccccttc tcccgccccc gagctgctcg gcggcagctc ggtgttcctg 240

ttcccaccca aacccaagga caccctctac atcaccagag agcccgaggt aacctgtgtg 300

gtcgtggatg tgtcccacga ggaccccgag gtgaagttca actggtacgt ggacggggtg 360

gaggtgcaca acgccaagac caagccccgc gaggagcagt acaacagcac ctaccgcgtg 420

gtgagcgtgc tgacagtgct gcaccaggat tggctgaacg gcaaggagta caagtgcaag 480

gtgagcaata aggccctgcc cgcccccatc gagaagacca tcagcaaggc caaagggcag 540

cccagagaac cccaggtgta caccctgccc cccagccggg acgagctgac caagaaccaa 600

gtgagcctca cctgcctggt gaaggggttc taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agcccgagaa caactacaag accacgcctc ccgtgctgga ctccgacggg 720

agcttcttcc tgtacagcaa gctgaccgtg gacaagagcc gctggcaaca ggggaacgtg 780

tttagctgta gcgtcatgca cgaggccctg cacaatcact acacccagaa gtccctgagc 840

ctgtcccccg gcaagaggaa gaagcgttcc ctgagccagg aggacgcccc cggacaccc 900

aggccggtcg cagagatcgt gccctccttc atcaacaagg acaccgagac aatcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gaactgaagc tcaccctgtc cgagatgcag 1020

cccgccctgc cccagctaca gcagcacgta cccgtgctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat aaggaatcgc cagtccgagg ccgccgactc atcccctagc 1140

gagctgaagt acctcggtct ggacacccac agccgtaaga agaggcagct gtattccgcc 1200

ctggccaaca aatgctgcca tgtgggctgc accaagagaa gcctggcccg gttctgc 1257

<210> 258

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 258

atgccccggc ttttcttctt ccacttactc ggcgtgtgcc ttctccttaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagcg agcccaagag cagcgacaag 180

acccaccacca gtccaccgtc ccctgccccc gagttactgg gcggcagcag cgtgttcctg 240

ttcccaccaa agcccaagga caccctgtac atcacccggg agcccgaggt gacctgcgtg 300

gtggtggacg tgagccacga ggaccctgag gtcaagttca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac caagccccgg gaggagcagt acaacagcac ctaccgggtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc tgccccgatc gagaagacca tcagcaaggc caagggccag 540

cctcgcgagc ctcaggtgta caccctgcca ccaagccggg acgagctgac caagaaccag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agccagagaa caactacaag accacaccac ccgtgctgga cagcgacggc 720

agcttcttcc tgtacagcaa gctgacagtg gacaagagcc ggtggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaggcccta cacaaccact acacccagaa gtccctgtct 840

ctgtcacccg gcaagcggaa gaagagatcc ctgagccagg aggacgcccc gcagaccccc 900

cggccagtgg ccgagatcgt gcccagcttc atcaacaagg ataccgagac gatcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tcacactgag cgagatgcag 1020

cccgccctgc cgcaactcca gcagcacgtg ccagtgctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat cgggaaccgg cagagcgagg ccgctgacag ctctcctagc 1140

gaactgaagt acctgggcct ggacacccac agcaggaaga agcggcagct gtactcagcc 1200

ctggccaaca agtgctgcca cgtgggctgc actaagagaa gcctcgcccg gttctgc 1257

<210> 259

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 259

atgccgac tgttcttctt ccacctcctc ggcgtgtgcc tcctcctcaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagcg agcccaagag cagcgacaag 180

acccacct ccccgccgtc cccagctccc gagctgttag gaggcagcag cgtgttcctg 240

ttcccgccta agcccaagga caccctgtac atcacccggg agcccgaggt gacctgcgtg 300

gtggtggacg tgagccacga ggacccggag gtgaagttca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac caagccccgg gaggagcagt acaacagcac ctaccgggtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc tgcacctatc gagaagacca tcagcaaggc caagggccag 540

ccaagagagc ctcaggtgta caccctgcca cctagccggg acgagctgac caagaaccag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agcctgagaa caactacaag accactccac ccgtgctgga cagcgacggc 720

agcttcttcc tgtacagcaa gctcaccgtg gacaagagcc ggtggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaggctctg cacaaccact acacccagaa gagtctgtcg 840

ctgagccccg gcaagcggaa gaagagaagc ctgagccagg aggacgcccc gcagaccccc 900

cggccagtgg cagagatcgt gcccagcttc atcaacaagg ataccgagac aattaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgaccctgag cgagatgcag 1020

cccgcactgc ctcagttgca gcagcacgtg cctgtgctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat cgggaaccgg cagagcgagg ccgccgactc cagcccatct 1140

gaactgaagt acctgggcct ggacacccac agccgcaaga agcgccagct gtactctgcc 1200

ctggccaaca agtgctgcca cgtgggatgc acaaagcgtt ccctggcccg gttctgc 1257

<210> 260

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 260

atgccccggc ttttcttctt ccacctcctc ggcgtgtgcc tcctcctcaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagcg agcccaagag cagcgacaag 180

acccacacca gcccacctag cccggcaccc gagctcctgg gcggcagcag cgtgttcctg 240

ttccctccaa agcccaagga caccctgtac atcacccggg agcccgaggt gacctgcgtg 300

360

gaggtgcaca acgccaagac caagccccgg gaggagcagt acaacagcac ctaccgggtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc agcccctatc gagaagacca tcagcaaggc caagggccag 540

cctcgcgagc ctcaggtgta caccctgcct ccatcccggg acgagctgac caagaaccag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agccagagaa caactacaag accacccctc ccgtgctgga cagcgacggc 720

agcttcttcc tgtacagcaa gttgaccgtc gacaagagcc ggtggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaagcccta cacaaccact acacccagaa gtccctgagc 840

ttgagccccg gcaagcggaa gaagcgctcc ttgtcccagg aggacgcccc gcaaaccccc 900

cggccagtgg ccgagatcgt gcccagcttc atcaacaagg atacagagac aattaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tcacactgag cgagatgcag 1020

cccgctctgc cacagctcca gcagcacgtg cctgtgctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat cgggaaccgg cagagcgagg ccgccgactc ctccccaagc 1140

gagctcaagt acctgggcct ggacacccac agcagaaaga agaggcagct ctacagcgcc 1200

ctggccaaca agtgctgcca cgtgggctgt accaagagaa gcctggcccg gttctgc 1257

<210> 261

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 261

atgccgac tgttcttctt ccacttattg ggcgtgtgct tgcttctcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtccg agcccaagtc ctccgacaag 180

acccaccct ccccgccttc ccctgcaccc gagctcctcg gcggctcctc cgtcttcctc 240

ttccctccta agcccaagga caccctctac atcacccgcg agcccgaggt cacctgcgtc 300

gtcgtcgacg tctcccacga ggaccctgag gtgaagttca actggtacgt cgacggcgtc 360

gaggtccaca acgccaagac caagccccgc gaggagcagt acaactccac ctaccgcgtc 420

gtctccgtcc tcaccgtcct ccaccaggac tggctcaacg gcaaggagta caagtgcaag 480

gtgtccaaca aggccctgcc tgccccaatc gagaagacca tctccaaggc caagggccag 540

ccacgggaac ctcaggtcta caccctgcct cctagccgcg acgagctcac caagaaccag 600

gtgtccctca cctgcctcgt caagggcttc tacccttctg atatcgccgt cgagtgggag 660

tccaacggtc agcctgagaa caactacaag accacccctc ccgtcctcga ctccgacggc 720

tccttcttcc tgtactccaa gctgaccgtg gacaagtccc gctggcagca gggcaacgtc 780

ttctcctgct ccgtcatgca cgaggctctg cacaaccact acacccagaa gtccctgagc 840

ctgagccccg gcaagcgcaa gaagagaagc ctgtcacagg aggacgcccc ccagacccct 900

cgccctgtcg ccgagatcgt cccctccttc atcaataagg acacggagac aatcaacatg 960

atgtccgagt tcgtcgccaa cctgccgcag gagctgaagc tcaccctctc cgagatgcag 1020

cccgcccttc ctcagctcca gcagcacgtg cctgtcctga aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgatag ctcgccttcc 1140

gagctaaagt acctcggcct cgacacccac tcccggaaga agaggcagct gtatagcgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc accaagagga gcctggcccg cttctgc 1257

<210> 262

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 262

atgccccgtc tgttcttctt ccaccttctc ggcgtgtgcc tcctactcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtccg agcccaagtc ctccgacaag 180

acccacct cgcctcctag cccagccccc gagctcctcg gcggctcctc cgtcttcctc 240

ttcccaccga agcccaagga caccctctac atcacccgcg agcccgaggt cacctgcgtc 300

gtcgtcgacg tctcccacga ggacccagag gtgaagttca actggtacgt cgacggcgtc 360

gaggtccaca acgccaagac caagccccgc gaggagcagt acaactccac ctaccgcgtc 420

gtctccgtcc tcaccgtcct ccaccaggac tggctcaacg gcaaggagta caagtgcaag 480

gtgtccaaca aggccctgcc agccccaatc gagaagacca tctccaaggc caagggccaa 540

cctagagagc ctcaggtcta caccttgcct ccaagtcgcg acgagctcac caagaaccag 600

gtgtccctca cctgcctcgt caagggcttc tacccaagcg acatcgccgt cgagtgggag 660

tccaacggcc agcctgagaa caactacaag accacccccgc ccgtcctcga ctccgacggc 720

tccttcttcc tgtactccaa gctgaccgtc gacaagtccc gctggcagca gggcaacgtc 780

ttctcctgct ccgtcatgca cgaggctctg cacaaccact acacccagaa gtccctgagc 840

ctgagccccg gcaagcgcaa gaagagaagc ctcagccagg aggacgcccc ccagacccct 900

agaccggtcg ccgagatcgt cccctccttc atcaataagg acacagagac aatcaacatg 960

atgtccgagt tcgtcgccaa tctgcctcag gagcttaagc tcaccctctc cgagatgcag 1020

cccgctttgc ctcagctcca gcagcacgtg cctgtgctga aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgactc aagcccatcc 1140

gagctgaagt acctcggcct cgacacccac tcccggaaga agaggcagct ctactccgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc accaagcggt ccctcgcccg cttctgc 1257

<210> 263

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 263

atgccccggt tgttcttctt ccaccttttg ggcgtgtgcc ttctcttgaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtccg agcccaagtc ctccgacaag 180

acccacct ctcctccaag ccctgcgcc gagctcctcg gcggctcctc cgtcttcctc 240

ttcccaccaa agcccaagga caccctctac atcacccgcg agcccgaggt cacctgcgtc 300

gtcgtcgacg tctcccacga ggacccagag gtcaagttca actggtacgt cgacggcgtc 360

gaggtccaca acgccaagac caagccccgc gaggagcagt acaactccac ctaccgcgtc 420

gtctccgtcc tcaccgtcct ccaccaggac tggctcaacg gcaaggagta caagtgcaag 480

gtgtccaaca aggccctccc agccccaatc gagaagacca tctccaaggc caagggccaa 540

cctagagaac cacaggtcta cacactccct cctagccgcg acgagctcac caagaaccag 600

gtgtccctca cctgcctcgt caagggcttc tacccatccg atatcgccgt cgagtgggag 660

tccaacggac agccggagaa caactacaag accacacctc ccgtcctcga ctccgacggc 720

tccttcttcc tgtactccaa gctgaccgtg gacaagtccc gctggcagca gggcaacgtc 780

ttctcctgct ccgtcatgca cgaggccctg cacaaccact acacccagaa gtccctctcc 840

ctgagccccg gcaagcgcaa gaagagaagt cttagccagg aggacgcccc ccagacccct 900

agaccggtcg ccgagatcgt cccctccttc atcaacaagg atacagagac gatcaacatg 960

atgtccgagt tcgtcgccaa cctgccacag gagctgaagc tgacactctc cgagatgcag 1020

cccgccctgc ctcagctcca gcagcacgtg ccagtgctga aggactcctc attactcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgactc tagcccttcc 1140

gagctcaagt acctcggcct cgacacccac tcccggaaga agcggcagct gtacagcgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc accaagcggt cccttgcccg cttctgc 1257

<210> 264

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 264

atgccccggc tattcttctt ccacttactc ggcgtgtgcc tcctcttgaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagcg agcccaagag cagcgacaag 180

acccaccacca gccctccttc ccctgccccc gagttgctgg gaggcagcag cgtgttcctg 240

ttcccaccga agcccaagga caccctgtac atcacccggg agcccgaggt gacctgcgtg 300

gtggtggacg tgagccacga ggacccagag gtgaagttca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac caagccccgg gaggagcagt acaacagcac ctaccgggtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc agcccctatc gagaagacca tcagcaaggc caagggccag 540

cctagggagc cacaggtgta caccctgcca cctagccggg acgagctgac caagaaccag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agccggagaa caactacaag accaccccac ccgtgctgga cagcgacggc 720

agcttcttcc tgtacagcaa gctgacggtg gacaagagcc ggtggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaggctctg cacaaccact acacccagaa gagtttaagc 840

ttgtcacccg gcaagcggaa gaagcggtcc ctgagccagg aggacgcccc tcagaccccc 900

agacctgttg ccgagatcgt gcccagcttc atcaataagg ataccgaaac catcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgaccctgag cgagatgcag 1020

cccgccctgc ctcagttgca gcagcacgtg cctgtgctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat cgggaaccgg cagagcgagg ccgccgactc ctcccctagc 1140

gagctcaagt acctgggcct ggacacccac agcagaaaga agagacagct ctacagcgcc 1200

ctggccaaca agtgctgcca cgtgggttgc accaagcgca gcctggcccg gttctgc 1257

<210> 265

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 265

atgccccggt tattcttctt ccacctcctc ggcgtgtgcc tcttgctcaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagcg agcccaagag cagcgacaag 180

acccacct cccctcctag cccggcgcc gagctgctgg gaggcagcag cgtgttcctg 240

ttccctccta agcccaagga caccctgtac atcacccggg agcccgaggt gacctgcgtg 300

gtggtggacg tgagccacga ggacccagag gtgaagttca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac caagccccgg gaggagcagt acaacagcac ctaccgggtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc tgcccctatc gagaagacca tcagcaaggc caagggccag 540

ccacgcgagc ctcaggtgta caccctgcca cctagccggg acgagctgac caagaaccag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agcctgagaa caactacaag accacccctc ccgtgctgga cagcgacggc 720

agcttcttcc tgtacagcaa gctgacggtg gacaagagcc ggtggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaggctctg cacaaccact acacccagaa gtcactgagc 840

ctgtcacccg gcaagcggaa gaagagaagc ctgtcccagg aggacgcacc tcagaccccc 900

cggcctgtgg ccgagatcgt gcccagcttc atcaataagg ataccgaaac catcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgaccctgag cgagatgcag 1020

cccgctctgc ctcagcttca gcagcacgtg cctgtcctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat cgggaaccgg cagagcgagg ccgccgactc tagccctagc 1140

gaactcaagt acctgggcct ggacacccac agcagaaaga agcgccagct ctacagcgcc 1200

ctggccaaca agtgctgcca cgtgggatgc accaagcgaa gcctggcccg gttctgc 1257

<210> 266

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 266

atgccgac tcttcttctt ccaccttttg ggcgtgtgcc tcctcctcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtccg agcccaagtc ctccgacaag 180

acccacct ccccgcctag ccctgccccc gagctcctcg gcggctcctc cgtcttcctc 240

ttccctccaa agcccaagga caccctctac atcacccgcg agcccgaggt cacctgcgtc 300

gtcgtcgacg tctcccacga ggacccggag gtgaagttca actggtacgt cgacggcgtc 360

gaggtccaca acgccaagac caagccccgc gaggagcagt acaactccac ctaccgcgtc 420

gtctccgtcc tcaccgtcct ccaccaggac tggctcaacg gcaaggagta caagtgcaag 480

gtatccaaca aggccctgcc tgctcctatc gagaagacca tctccaaggc caagggccaa 540

cctagagagc cacaggtcta caccctgcct ccgtcccgcg acgagctcac caagaaccag 600

gtgtccctca cctgcctcgt caagggcttc taccctagcg acatcgccgt cgagtgggag 660

tccaacggcc agcctgagaa caactacaag accacccctc ccgtcctcga ctccgacggc 720

tccttcttcc tttactccaa gctgaccgtc gacaagtccc gctggcagca gggcaacgtc 780

ttctcctgct ccgtcatgca cgaggccctc cacaaccact acacccagaa gtccctctcg 840

ctctcccccg gcaagcgcaa gaagagatcc ctgtcgcagg aggacgcccc ccagacccct 900

agaccggtcg ccgagatcgt cccctccttc atcaataagg acacagaaac catcaacatg 960

atgtccgagt tcgtcgccaa cttgccacag gagctgaagc tcaccctctc cgagatgcag 1020

cccgccctcc cacagctcca gcagcacgtg cctgtcctca aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgatag ctcaccttcc 1140

gagctcaagt acctcggcct cgacacccac tccagaaaga agcggcagct gtactccgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc accaagagaa gcctcgcccg cttctgc 1257

<210> 267

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 267

atgccccgac tgttcttctt ccacttgctt ggcgtgtgcc tcctcttaaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtccg agcccaagtc ctccgacaag 180

acccacct ctccgccaag cccagctccc gagctcctcg gcggctcctc cgtcttcctc 240

ttccctccta agcccaagga caccctctac atcacccgcg agcccgaggt cacctgcgtc 300

gtcgtcgacg tctcccacga ggacccagag gtcaagttca actggtacgt cgacggcgtc 360

gaggtccaca acgccaagac caagccccgc gaggagcagt acaactccac ctaccgcgtc 420

gtctccgtcc tcaccgtcct ccaccaggac tggctcaacg gcaaggagta caagtgcaag 480

gtgtccaaca aggccctgcc tgcccctatc gagaagacca tctccaaggc caagggccag 540

cctagagagc ctcaggtcta caccctgcca ccttcgcgcg acgagctcac caagaaccag 600

gtgtccctca cctgcctcgt caagggcttc tacccatccg acatcgccgt cgagtgggag 660

tccaacggcc aacctgagaa caactacaag accaccccac ccgtcctcga ctccgacggc 720

tccttcttcc tgtactccaa gctgaccgtg gacaagtccc gctggcagca gggcaacgtc 780

ttctcctgct ccgtcatgca cgaagccctg cacaaccact acacccagaa gtccctcagc 840

ttgtcccccg gcaagcgcaa gaagcggtcc ctgtcccagg aggacgcccc ccagacccct 900

agacctgtcg ccgagatcgt cccctccttc atcaataagg ataccgagac tatcaacatg 960

atgtccgagt tcgtcgccaa cctcccacag gagctgaagc tcaccctctc cgagatgcag 1020

cccgctctgc cacagctcca gcagcacgtc cctgtgctca aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgactc cagccctagc 1140

gagctcaagt acctcggcct cgacacccac tccaggaaga agagacagct ctacagcgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc accaagagaa gcctggcccg cttctgc 1257

<210> 268

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 268

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagctgctgg gcggcagcag cgtgttcctg 240

ttccccccca agcccaagga caccctgtac atcacccggg agcccgaggt gacctgcgtg 300

gtggtggacg tgagccacga ggaccccgag gtgaagttca actggtacgt ggacggcgtg 360

gaggtgcaca acgccaagac caagccccgg gaggagcagt acaacagcac ctaccgggtg 420

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 480

gtgagcaaca aggccctgcc cgcccccatc gagaagacca tcagcaaggc caagggccag 540

ccccgggagc cccaggtgta caccctgccc cccagccggg acgagctgac caagaaccag 600

gtgagcctga cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 660

agcaacggcc agcccgagaa caactacaag accaccccccc ccgtgctgga cagcgacggc 720

agcttcttcc tgtacagcaa gctgaccgtg gacaagagcc ggtggcagca gggcaacgtg 780

ttcagctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gagcctgagc 840

ctgagccccg gcaagcggaa gaagcggagc ctgagccagg aggacgcccc ccagaccccc 900

cggcccgtgg ccgagatcgt gcccagcttc atcaacaagg acaccgagac catcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgaccctgag cgagatgcag 1020

cccgccctgc cccagctgca gcagcacgtg cccgtgctga aggacagcag cctgctgttc 1080

1140

gagctgaagt acctgggcct ggacacccac agccggaaga agcggcagct gtacagcgcc 1200

ctggccaaca agtgctgcca cgtgggctgc accaagcgga gcctggcccg gttctgc 1257

<210> 269

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 269

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

120

agggcgcaga tcgcgatctg cgggatgagc acgtggagcg agccgaagag cagcgacaag 180

acgcacacga gcccgccgag cccggcgccg gagctgctgg gggggagcag cgtgttcctg 240

ttcccgccga agccgaagga cacgctgtac atcacgaggg agccgggaggt gacgtgcgtg 300

gtggtggacg tgagccacga ggacccggag gtgaagttca actggtacgt ggacggggtg 360

gaggtgcaca acgcgaagac gaagccgagg gaggagcagt acaacagcac gtacagggtg 420

gtgagcgtgc tgacggtgct gcaccaggac tggctgaacg ggaaggagta caagtgcaag 480

gtgagcaaca aggcgctgcc ggcgccgatc gagaagacga tcagcaaggc gaaggggcag 540

ccgagggagc cgcaggtgta cacgctgccg ccgagcaggg acgagctgac gaagaaccag 600

gtgagcctga cgtgcctggt gaaggggttc tacccgagcg acatcgcggt ggagtgggag 660

agcaacgggc agccggagaa caactacaag acgacgccgc cggtgctgga cagcgacggg 720

agcttcttcc tgtacagcaa gctgacggtg gacaagagca ggtggcagca ggggaacgtg 780

ttcagctgca gcgtgatgca cgaggcgctg cacaaccact acacgcagaa gagcctgagc 840

ctgagcccgg ggaagaggaa gaagaggagc ctgagccagg aggacgcgcc gcagacgccg 900

aggccggtgg cggagatcgt gccgagcttc atcaacaagg acacggagac gatcaacatg 960

atgagcgagt tcgtggcgaa cctgccgcag gagctgaagc tgacgctgag cgagatgcag 1020

ccggcgctgc cgcagctgca gcagcacgtg ccggtgctga aggacagcag cctgctgttc 1080

1140

gagctgaagt acctggggct ggacacgcac agcaggaaga agaggcagct gtacagcgcg 1200

ctggcgaaca agtgctgcca cgtggggtgc acgaagagga gcctggcgag gttctgc 1257

<210> 270

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 270

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtccg agcccaagtc ctccgacaag 180

acccacct cccccccctc ccccgccccc gagctcctcg gcggctcctc cgtcttcctc 240

ttccccccca agcccaagga caccctctac atcacccgcg agcccgaggt cacctgcgtc 300

gtcgtcgacg tctcccacga ggaccccgag gtcaagttca actggtacgt cgacggcgtc 360

gaggtccaca acgccaagac caagccccgc gaggagcagt acaactccac ctaccgcgtc 420

gtctccgtcc tcaccgtcct ccaccaggac tggctcaacg gcaaggagta caagtgcaag 480

gtctccaaca aggccctccc cgcccccatc gagaagacca tctccaaggc caagggccag 540

ccccgcgagc cccaggtcta caccctcccc ccctcccgcg acgagctcac caagaaccag 600

gtctccctca cctgcctcgt caagggcttc tacccctccg acatcgccgt cgagtgggag 660

tccaacggcc agcccgagaa caactacaag accaccccccc ccgtcctcga ctccgacggc 720

tccttcttcc tctactccaa gctcaccgtc gacaagtccc gctggcagca gggcaacgtc 780

ttctcctgct ccgtcatgca cgaggccctc cacaaccact acacccagaa gtccctctcc 840

ctctcccccg gcaagcgcaa gaagcgctcc ctctcccagg aggacgcccc ccagaccccc 900

cgccccgtcg ccgagatcgt cccctccttc atcaacaagg acaccgagac catcaacatg 960

atgtccgagt tcgtcgccaa cctcccccag gagctcaagc tcaccctctc cgagatgcag 1020

cccgccctcc cccagctcca gcagcacgtc cccgtcctca aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgactc ctccccctcc 1140

gagctcaagt acctcggcct cgacacccac tcccgcaaga agcgccagct ctactccgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc accaagcgct ccctcgcccg cttctgc 1257

<210> 271

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 271

atgccccgcc tgttcttctt ccacctcctc ggcgtctgcc tcctcctcaa ccagttctcc 60

cgcgccgtgg cggacagctg gatggaggag gtgatcaagc tctgcggccg cgagctcgtg 120

cgcgcccaga tcgccatttg cggcatggag cccaaggct ccgacaagac ccacaccagc 180

ccgcccagcc ccgcccctga gctgctgggc ggatccagcg tcttcctgtt tccccccaag 240

cccaaggaca ccctgtacat cacaagggag cccgaggtca cctgcgtggt ggtggacgtc 300

agccacgagg accccgaggt gaaatttaac tggtacgtag acggcgtgga ggtgcacaac 360

gccaagacca agcccaggga ggagcagtac aacagcacct accgggtggt aagcgtcctg 420

accgtgctgc accaggactg gctgaacggc aaggagtata agtgcaaagt gagcaacaag 480

gccctgcccg cccccatcga gaagaccatc agcaaggcca aggggcagcc ccgggagcca 540

caggtgtaca ccctgcccc cagcagggac gagctgacca agaaccaggt gagtctcaca 600

tgcctggtta agggcttcta cccatccgac atcgccgtgg agtgggaaag caacggtcag 660

cccgagaaca actacaagac cacgcccccg gtgctggact ccgacggcag cttcttcctg 720

tactccaagc tcaccgtgga caagtccagg tggcagcagg ggaacgtgtt cagctgcagc 780

gtgatgcatg aggcactgca caaccactac acgcagaagt ccctgtctct gagcccaggc 840

aagcgcaaga gcacctggag caagaggtcc ctgagccaag aggacgcccc ccagaccccc 900

cggcctgtgg ccgagatcgt gcccagcttc atcaacaagg acaccgagac gatcaacatg 960

atgagcgaat ttgtggccaa tctgccccag gagctgaagc tcaccctctc cgaaatgcag 1020

cccgccctcc cccaactgca acaacacgtc cccgtgctga aggacagcag cctgctgttt 1080

gaggaattta agaagctcat cagaaacaga cagagcgagg ccgcggactc cagccccagc 1140

gagctgaagt acctgggcct ggacacccat agcaggaaga agcggcagct gtacagcgcc 1200

ctcgccaaca agtgctgcca cgtgggctgc accaagagaa gcctggccag gttctgc 1257

<210> 272

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 272

atgccccgac tcttcttctt ccacctcctc ggcgtgtgcc tcctcctcaa ccagttctct 60

cgagccgtgg ccgattcctg gatggaggag gtgatcaagc tctgcggcag agaactcgtg 120

agagcccaga tcgccatttg tgggatggag cccaaagca gcgacaagac ccatactagc 180

ccaccctccc ccgcccccga gctgctgggg ggcagcagcg tgttcctgtt tcccccgaag 240

cccaaggaca ccctgtacat cacccgggag cccgaggtga cctgcgtggt tgtcgacgtg 300

tcacacgaag accccgaggt gaagttcaac tggtacgtgg acggcgtcga ggtgcacaac 360

gccaagacca agcccaggga ggagcagtac aacagcacgt acagagtggt gtcagtcctg 420

accgtcctcc accaggattg gctcaacggc aaagagtaca agtgcaaggt gagcaacaag 480

gccctgcccg cccccatcga gaagacaatc tccaaggcca agggccagcc gagggagccc 540

caggtgtata ccctgcccc ctcaagggac gagctgacca agaatcaggt gtccctcaca 600

tgcctggtga aggggttcta ccccagcgac atcgccgtgg agtgggagag caacggacag 660

cccgagaaca actacaagac cacacccccc gtgctggaca gcgatggaag tttcttcctg 720

tatagcaaac tgaccgtgga caaatcacgg tggcagcagg gcaacgtgtt cagctgcagc 780

gtgatgcacg aagccctgca caaccactac acccagaagt cattatctct gagccccggc 840

aagagaaaga gcacgtggag caagaggagc ctctcccagg aggacgcccc ccagaccccc 900

cggcccgtgg ccgagatcgt gccctccttt attaacaagg acaccgagac aatcaacatg 960

atgtccgagt tcgtcgccaa tctgccccag gagctcaagc tcaccctgag cgagatgcag 1020

cccgctctgc cccagctgca gcaacacgtg cccgtgctga aggacagcag cctgctgttc 1080

1140

gagctgaagt acctggggct ggacacccac agccggaaga agcggcagct gtacagcgcc 1200

ctggccaaca agtgctgcca cgtggggtgc actaagcgga gcctggccag attttgc 1257

<210> 273

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 273

atgccgac tgttcttctt tcacctcctc ggcgtgtgtc ttttactcaa ccaatttagc 60

agagccgtgg ccgactcttg gatggaggag gtgatcaagc tctgtggccg cgagcttgtc 120

cgggcccaga tcgctatctg cggaatggag cccaagtcct ccgacaagac ccacacctcc 180

ccacccagtc ccgcccccga gctgctcggg ggcagcagcg tgttcctgtt ccctcctaag 240

cccaaggaca cgctgtacat caccagggag cccgaggtca cctgcgtggt ggtggacgtg 300

tcccatgagg accccgaggt gaagttcaac tggtacgtgg acggcgtgga ggttcacaac 360

gctaagacca agccccgcga ggaacagtac aacagcacct atcgggtcgt gtcagttctg 420

accgtcctcc accaggactg gctgaacggc aaggagtaca agtgcaaggt gagcaacaaa 480

gccctccccg ccccgatcga gaagaccatc agcaaggcca agggccagcc ccgagagccc 540

caggtgtaca cccttcccc cagcagggac gagctcacaa agaatcaggt gagcctgacc 600

tgcctggtga agggcttcta cccctccgac atcgcggtgg aatgggagag caacggccag 660

ccggagaaca actataagac aacaccccc gtgctggaca gcgacggcag cttcttcctc 720

tacagcaagc tgaccgtcga caagtccaga tggcagcagg gcaacgtgtt cagctgctcc 780

gtgatgcacg aagccctgca caatcactac actcagaaat ccctgtccct gagccccggc 840

aagcggaagt ccacctggag taagcggagt ctgagccagg aggacgcccc ccaaaccccc 900

cgacccgtgg ccgagatcgt gccctccttc atcaataagg acaccgagac tatcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgacgctgtc tgagatgcag 1020

cctgccctgc cccagctgca gcagcacgtg ccagtgctga aggacagcag cctgctgttc 1080

gaggagttta agaagctaat cagaaaccgc cagtccgagg ccgccgacag cagcccctcc 1140

gagctcaagt acctgggcct ggacacccat tcccgcaaga agaggcagct gtactcggcc 1200

ctggccaaca agtgctgtca cgtcggatgt accaagagaa gtctggccag gttctgc 1257

<210> 274

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 274

atgccgcggc ttttcttctt ccacctcctc ggcgtgtgcc tactccttaa ccaattctcc 60

cgagccgtcg ccgacagctg gatggaggag gtgatcaaac tctgcggcag ggagctcgtg 120

agggcccaga tagccatctg cggcatggaa cccaagtcca gcgacaagac ccacaccagc 180

ccgcccagcc ccgcccccga gctgctgggc ggctcaagcg tgttcctgtt cccgcccaag 240

cccaaggaca ccctgtacat caccagagag ccggaggtca cctgcgtggt ggtggacgtg 300

tctcacgagg accccgaagt caagttcaac tggtacgtgg atggcgtgga ggtgcacaat 360

gcaaagacca agccgagaga ggaacagtac aactcgacgt accgggtcgt gagcgtcctg 420

accgtgctgc accaggactg gctgaatggc aaggagtaca agtgcaaagt gtcgaataag 480

gccctgcccg cccccatcga gaagaccatc tccaaggcca agggccagcc cagagaaccg 540

caggtataca ccctgccccc ttcccgggac gagctgacca agaaccaggt gtctctcacg 600

tgcctggtga agggcttcta ccccagcgac atcgccgtgg agtgggagtc caatggtcag 660

cccgagaaca actataagac cacgccgccc gtgctggact cagacggctc cttcttcctc 720

tacagcaaac tgacggtgga caagagccgg tggcagcagg gcaacgtgtt ctcctgcagc 780

gtcatgcacg aggccctgca caaccactac actcagaagt ccctgagcct gagccccggg 840

aagcgaaagt ctacctggag caagcggagc ctgagccaag aggacgcccc ccaaacaccc 900

cggcccgtgg ccgagatagt gcctagcttc attaacaagg acaccgagac tatcaacatg 960

atgagcgagt tcgtggcgaa cctgccccag gagctgaagc tgaccctgtc cgagatgcag 1020

ccggccctgc ctcagctgca gcagcacgtg cccgtgctga aggacagcag cctgctgttt 1080

1140

gagctcaagt acctgggcct ggacacgcac agcaggaaga agaggcagct gtacagcgcc 1200

ctggccaaca agtgctgcca cgtcgggtgc accaagagga gcctggctag gttttgc 1257

<210> 275

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 275

atgccccgcc tgttcttctt ccacctcctt ggcgtgtgcc tcctcctaaa tcagttcagc 60

120

cgggcccaga tcgccatctg cggcatggag cccaagtcca gcgacaagac ccacacctcg 180

ccccccagcc ccgcccccga gctgctgggc gggagcagcg ttttcctgtt tccacctaag 240

cccaaggaca ctctgtacat caccagagag cccgaggtca catgcgtggt ggtggacgtg 300

agccacgagg accccgaggt gaagttcaac tggtacgtcg atggcgtcga ggtgcacaac 360

gccaagacca agcccaggga ggagcagtac aacagcacct acagagtggt gtccgtgctg 420

accgtgctgc accaggactg gctgaacgga aaggagtaca agtgcaaggt gagcaacaag 480

gccctgcccg cgccgatcga gaagaccata agcaaggcca agggccaacc gagggagccc 540

caggtgtaca ccctgccccc cagcagagac gagctgacca agaaccaggt gagcctgacc 600

tgcctggtca agggcttcta ccccagcgat atcgccgtgg aatgggagtc caacggacag 660

ccggagaaca actacaagac cacgcccccc gtgctcgaca gcgacgggtc cttcttcctg 720

tactcgaagc tgaccgtgga caagagccgc tggcagcagg gcaacgtgtt cagctgctcc 780

gtgatgcatg aggccctgca caaccactat acgcagaagt cgctcagcct gagccccggc 840

aagcgaaaga gcacctggag caagcgaagc cttagccagg aggatgcccc ccagacaccc 900

cggccagtgg ctgagatcgt ccccagcttc atcaacaaag acactgagac aattaatatg 960

atgagcgagt tcgtggccaa tctgccccag gagctcaagc tgaccctcag cgagatgcag 1020

cccgctctgc cccagctgca acagcacgtt cccgtgctga aggacagctc tctgctgttc 1080

gaggagttca agaagctgat caggaaccga cagagcgagg ccgccgactc cagcccctcg 1140

gagctcaaat acctcggcct cgacacccac agcaggaaga agaggcagct gtacagcgcc 1200

ctggccaaca agtgctgcca cgtcggctgc accaagaggt cactcgccag gttctgc 1257

<210> 276

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 276

atgcccaggc tgttcttctt ccacctcctc ggcgtgtgcc tcctcctcaa tcagttcagc 60

agagccgtgg ccgatagctg gatggaggag gtcattaagc tctgcggcag agagctcgtg 120

cgagcccaga tcgccatctg cggcatggag cccaagagca gcgataagac ccatacctct 180

cctcccagcc ccgcccccga gctgctgggc ggctcctccg tgttcctgtt ccctcccaag 240

cccaaagaca ccctgtacat caccagagaa cccgaggtga cctgtgtcgt ggtggacgtg 300

agccacgagg acccgggaggt gaagttcaat tggtacgtgg atggtgtcga ggtgcacaac 360

gccaagacga agcccaggga ggagcagtat aacagcactt atcgcgtggt cagcgtgctg 420

accgtcctgc accaagactg gctgaacggt aaggagtata agtgcaaggt cagcaacaaa 480

gccctgcccg ctcccatcga gaagacgatc agcaaggcca agggccagcc cagggagccc 540

caggtgtaca ctctgccccc cagcagagac gagctgacca agaatcaggt gagcctgacc 600

tgcctggtga aggggttcta ccccagcgac atcgccgtcg agtgggagag caacggccag 660

cccgagaaca actataagac cacacccccg gtgctggact ccgacggaag cttcttcctg 720

tactccaagc tcacagttga caagagcaga tggcagcagg gcaatgtgtt cagctgcagc 780

gtgatgcacg aggccctcca caaccactac acccagaaat ccctcagcct gagccccggc 840

aagaggaagt cgacctggag caagaggagc ctgtcccagg aggacgcccc ccaaacgccc 900

cggccggtgg ccgagatcgt ccccagcttc atcaacaagg acaccgagac tataaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctcaagc tgaccctgag cgagatgcag 1020

cccgcactgc cccaactgca gcagcacgtg cccgtgctga aggacagcag cctcctgttc 1080

gaggagttca agaagctgat caggaacagg cagagcgagg ccgccgacag cagccccagc 1140

gagctgaagt acctgggact ggacacccac agccggaaga agcgccagct ctacagcgcc 1200

ctggccaaca agtgctgcca tgtggggtgc accaagcggt ccctggcccg gttctgc 1257

<210> 277

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 277

atgccccgac tgttcttctt ccacctcctc ggcgtgtgtc tcttgcttaa tcagttcagc 60

cgcgccgtcg ccgactcctg gatggaggaa gtgatcaagc tctgtggccg ggagctcgtg 120

cgggctcaga ttgcaatctg cgggatggag cccaagtcgt ccgacaagac ccacaccagc 180

ccgccctcgc ccgcccccga gctgcttggc ggcagcagcg tgttcctgtt tccccccaag 240

cccaaggaca ccctgtacat cacccgggaa cccgaggtga cctgcgtcgt ggtggacgtg 300

tcccacgagg accccgaggt caagttcaac tggtacgtgg acggcgtgga ggtgcacaat 360

gccaagacca agcccaggga ggagcaatac aactccacct atcgggtggt gagcgtgctg 420

accgtgctgc accaggactg gctgaacggc aaggagtaca agtgcaaggt gtcaaacaag 480

gcgctgccg cccccatcga gaagacaatc tccaaggcca agggccagcc ccgggagccc 540

caggtgtaca ccctgcccc cagccgggac gagctgacca agaaccaggt tagccttaca 600

tgcctggtca agggcttcta cccctccgac atcgccgtgg agtgggagtc caacggccag 660

cccgagaaca actacaagac cacacccccc gtgctggact ccgacggctc cttcttcctt 720

tactctaagc tgaccgtgga caagagccgc tggcaacagg gcaatgtctt ctcctgctcc 780

gtgatgcacg aggccctgca caatcactac acccagaagt ccctgagcct gtcccctgga 840

aagcggaagt ccacctggag caagaggagc ctgtcccagg aggatgcccc tcagaccccc 900

aggcccgtgg ccgagatcgt gccttcattt attaacaagg acaccgagac gatcaacatg 960

atgtccgagt ttgtggccaa cctgccccag gagctgaagc tcaccctcag cgaaatgcag 1020

cccgccctgc cccagctgca gcagcacgtg cccgtgctga aggactcctc gctgctcttt 1080

1140

gagctgaagt acctgggcct ggacacccac agccggaaga agcgtcagct gtacagcgcc 1200

ctggccaaca aatgttgtca cgtgggctgc actaagagga gcctggccag attttgt 1257

<210> 278

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 278

atgccccggt tattcttctt ccacttgctt ggcgtgtgcc tcctcctcaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatggag cccaagagca gcgacaagac ccacacctcc 180

ccaccatccc ctgcccccga gctgctggga ggcagcagcg tgttcctgtt cccacctaag 240

cccaaggaca ccctgtacat cacccgggag cccgaggtga cctgcgtggt ggtggacgtg 300

agccacgagg accctgaggt gaagttcaac tggtacgtgg acggcgtgga ggtgcacaac 360

gccaagacca agccccggga ggagcagtac aacagcacct accgggtggt gagcgtgctg 420

accgtgctgc accaggactg gctgaacggc aaggagtaca agtgcaaggt gagcaacaag 480

gccctgcctg cccctatcga gaagaccatc agcaaggcca agggccagcc tcgggagcca 540

caggtgtaca ccctgcctcc ttcccgggac gagctgacca agaaccaggt gagcctgacc 600

tgcctggtga agggcttcta ccccagcgac atcgccgtgg agtgggagag caacggtcag 660

cctgagaaca actacaagac cactccaccc gtgctggaca gcgacggcag cttcttcctg 720

tacagcaagc ttaccgtcga caagagccgg tggcagcagg gcaacgtgtt cagctgcagc 780

gtgatgcacg aagccctgca caaccactac acccagaaga gtctgtcact gagccccggc 840

aagaggaagt ccacctggtc aaagcggagc ctgagccagg aggacgctcc tcaaaccccc 900

cggccagtgg ccgagatcgt gcccagcttc atcaataagg acacagagac aatcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgacgctcag cgagatgcag 1020

cccgccctcc ctcaactaca gcagcacgtg ccggtgctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat cgggaaccgg cagagcgagg ccgctgacag ctccccttcc 1140

gagcttaagt acctgggcct ggacacccac agccggaaga agaggcagct gtacagtgcc 1200

ctggccaaca agtgctgcca cgtgggctgc actaagaggt cactggcccg gttctgc 1257

<210> 279

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 279

atgccccggc ttttcttctt ccacttactc ggcgtgtgcc ttctccttaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatggag cccaagagca gcgacaagac ccacaccagc 180

cctcctagtc ctgcgcccga gctgcttggc ggcagcagcg tgttcctgtt cccaccgaag 240

cccaaggaca ccctgtacat cacccgggag cccgaggtga cctgcgtggt ggtggacgtg 300

agccacgagg acccgggaggt gaagttcaac tggtacgtgg acggcgtgga ggtgcacaac 360

gccaagacca agccccggga ggagcagtac aacagcacct accgggtggt gagcgtgctg 420

accgtgctgc accaggactg gctgaacggc aaggagtaca agtgcaaggt gagcaacaag 480

gccctgcctg ccccaatcga gaagaccatc agcaaggcca agggccaacc acgagagccg 540

caggtgtaca ccctgcctcc tagccgggac gagctgacca agaaccaggt gagcctgacc 600

tgcctggtga agggcttcta ccccagcgac atcgccgtgg agtgggagag caacggtcag 660

cctgagaaca actacaagac cacacctccc gtgctggaca gcgacggcag cttcttcctg 720

tacagcaagc tgacagttga caagagccgg tggcagcagg gcaacgtgtt cagctgcagc 780

gtgatgcacg aggccctgca caaccactac acccagaaga gtctgtctct gtcccctggc 840

aagaggaagt ccacctggtc caagaggtcc ctgagccagg aggacgcccc gcagaccccc 900

cggcctgtgg ctgagatcgt gcccagcttc atcaataagg ataccgagac aatcaacatg 960

atgagcgagt tcgtggccaa tttgccacag gagctgaagc tgacgctgag cgagatgcag 1020

cccgccctgc cgcagctcca gcaacacgtg cctgtcctga aggacagcag cctgctgttc 1080

gaggagttca agaagctgat cgggaaccgg cagagcgagg ccgccgactc ttctccgtcc 1140

gaactgaagt acctgggcct ggacacccac agccggaaga agcggcagct ctactccgcc 1200

ctggccaaca agtgctgcca cgtgggatgc accaagcgaa gcctggcccg gttctgc 1257

<210> 280

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 280

atgccccggt tattcttctt ccacttatta ggcgtgtgct tactcctcaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatggag cccaagagca gcgacaagac ccacaccagc 180

ccctcctagcc ctgcccccga gctgctggga ggcagcagcg tgttcctgtt ccctccgaag 240

cccaaggaca ccctgtacat cacccgggag cccgaggtga cctgcgtggt ggtggacgtg 300

agccacgagg accctgaggt gaagttcaac tggtacgtgg acggcgtgga ggtgcacaac 360

gccaagacca agccccggga ggagcagtac aacagcacct accgggtggt gagcgtgctg 420

accgtgctgc accaggactg gctgaacggc aaggagtaca agtgcaaggt gagcaacaag 480

gccctgccag ctcctatcga gaagaccatc agcaaggcca agggccagcc tagagagcct 540

caggtgtaca ccctgccgcc aagccgggac gagctgacca agaaccaggt gagcctgacc 600

tgcctggtga agggcttcta ccccagcgac atcgccgtgg agtgggagag caacggacag 660

cctgagaaca actacaagac caccccaccc gtgctggaca gcgacggcag cttcttcctg 720

tacagcaagc tcaccgtgga caagagccgg tggcagcagg gcaacgtgtt cagctgcagc 780

gtgatgcacg aagccctgca caaccactac acccagaagt ccctatctct gagccccggc 840

aagagaaagt ccacctggag caagagaagt ctgagccagg aggacgctcc acagaccccc 900

cggccagtgg ccgagatcgt gcccagcttc atcaacaagg atacagaaac cattaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgacactgag cgagatgcag 1020

cccgctctgc ctcagcttca gcagcacgtg cctgtgctga aggacagcag cctgctgttc 1080

1140

gaactcaagt acctgggcct ggacacccac agccggaaga agcggcagct gtatagcgcc 1200

ctggccaaca agtgctgcca cgtgggctgc acaaagcgta gcctggcccg gttctgc 1257

<210> 281

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 281

atgccccggc ttttcttctt ccacctcctt ggcgtgtgcc tcctccttaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatggag cccaagtcct ccgacaagac ccacaccagc 180

ccgccaagcc cagcccccga gctcctcggc ggctcctccg tcttcctctt ccctccaaag 240

cccaaggaca ccctctacat cacccgcgag cccgaggtca cctgcgtcgt cgtcgacgtc 300

tcccacgagg acccagaggt taagttcaac tggtacgtcg acggcgtcga ggtccacaac 360

gccaagacca agccccgcga ggagcagtac aactccacct accgcgtcgt ctccgtcctc 420

accgtcctcc accaggactg gctcaacggc aaggagtaca agtgcaaggt gtccaacaag 480

gccctgcctg ccccaatcga gaagaccatc tccaaggcca agggccagcc tcgggagcct 540

caggtctaca ccctgccacc tagtcgcgac gagctcacca agaaccaggt gtccctcacc 600

tgcctcgtca agggcttcta ccctagcgac atcgccgtcg agtgggagtc caacggccag 660

ccagagaaca actacaagac cacccctccc gtcctcgact ccgacggctc cttcttcctg 720

tactccaagc tcactgtgga caagtcccgc tggcagcagg gcaacgtctt ctcctgctcc 780

gtcatgcacg aagctctcca caaccactac acccagaagt ccctctcact gagccccggc 840

aagcgcaagt ccacctggtc caagcggagc ctctcgcagg aggacgcccc ccagacacca 900

cgccctgtcg ccgagatcgt cccctccttc atcaataagg acacggagac gatcaacatg 960

atgtccgagt tcgtcgccaa cctgccacag gagctgaagc tgaccctctc cgagatgcag 1020

cccgccctgc cgcagctcca gcagcacgtg ccagtgctga aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgctgactc aagcccttca 1140

gagcttaagt acctcggcct cgacacccac tcccgcaaga agcgccagct gtacagcgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc acaaagcgaa gcctggcccg cttctgc 1257

<210> 282

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 282

atgcccaggc tgttcttctt ccacctcctt ggcgtgtgcc tcttactcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatggag cccaagtcct ccgacaagac ccacacctct 180

ccaccgagcc cagcccccga gctcctcggc ggctcctccg tcttcctctt ccctcctaag 240

cccaaggaca ccctctacat cacccgcgag cccgaggtca cctgcgtcgt cgtcgacgtc 300

tcccacgagg acccagaggt gaagttcaac tggtacgtcg acggcgtcga ggtccacaac 360

gccaagacca agccccgcga ggagcagtac aactccacct accgcgtcgt ctccgtcctc 420

accgtcctcc accaggactg gctcaacggc aaggagtaca agtgcaaggt gtccaacaag 480

gccctgcctg cccctatcga gaagaccatc tccaaggcca agggccagcc acgggagcca 540

caggtctaca cactgcctcc gagccgcgac gagctcacca agaaccaggt gtccctcacc 600

tgcctcgtca agggcttcta ccctagcgac atcgccgtcg agtgggagtc caacggccag 660

ccggagaaca actacaagac caccccgccc gtcctcgact ccgacggctc cttcttcctg 720

tactccaagc tgacagtgga caagtcccgc tggcagcagg gcaacgtctt ctcctgctcc 780

gtcatgcacg aggctctgca caaccactac acccagaagt ccctcagcct gtctcccggc 840

aagcgcaagt ccacctggtc caagaggagc ttgtcccagg aggacgcccc ccagactcca 900

cgccctgtcg ccgagatcgt cccctccttc atcaataagg acacagagac gatcaacatg 960

atgtccgagt tcgtcgccaa ccttcctcag gagctgaagc tgaccctctc cgagatgcag 1020

cccgccctgc cgcagctcca gcagcacgtg ccagtgctca aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgacag tagcccttcc 1140

gagctcaagt acctcggcct cgacacccac tcccgcaaga agcgccagct gtattcagcc 1200

ctcgccaaca agtgctgcca cgtcggctgc acgaagcgga gcctggcccg cttctgc 1257

<210> 283

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 283

atgcccaggt tgttcttctt ccaccttttg ggcgtgtgcc tccttctcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatggag cccaagtcct ccgacaagac ccacacctct 180

cctccgagtc cagcaccga gctcctcggc ggctcctccg tcttcctctt cccgcctaag 240

cccaaggaca ccctctacat cacccgcgag cccgaggtca cctgcgtcgt cgtcgacgtc 300

tcccacgagg acccagaggt caagttcaac tggtacgtcg acggcgtcga ggtccacaac 360

gccaagacca agccccgcga ggagcagtac aactccacct accgcgtcgt ctccgtcctc 420

accgtcctcc accaggactg gctcaacggc aaggagtaca agtgcaaggt gtccaacaag 480

gcccttcctg cccctatcga gaagaccatc tccaaggcca agggccagcc acgggagcct 540

caggtctaca ccctgcctcc tagccgcgac gagctcacca agaaccaggt gtccctcacc 600

tgcctcgtca agggcttcta ccctagcgac atcgccgtcg agtgggagtc caacggtcag 660

cctgagaaca actacaagac caccccaccc gtcctcgact ccgacggctc cttcttcctt 720

tactccaagc tgaccgtgga caagtcccgc tggcagcagg gcaacgtctt ctcctgctcc 780

gtcatgcacg aggccctgca caaccactac acccagaagt ccctctctct gagccccggc 840

aagcgcaagt ccacctggtc caagagatct ctcagccagg aggacgcccc ccagacccca 900

cgcccagtcg ccgagatcgt cccctccttc atcaacaagg ataccgaaac catcaacatg 960

atgtccgagt tcgtcgccaa cctgccacag gagctgaagc tcacactctc cgagatgcag 1020

cccgcgctcc cacagctcca gcagcacgtg cctgtgctga aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgactc cagtcctagc 1140

gaactgaagt acctcggcct cgacacccac tcccgcaaga agcgccagct gtacagcgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc acaaagcgca gcctggcccg cttctgc 1257

<210> 284

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 284

atgccccggc ttttcttctt ccacctactc ggcgtgtgcc ttctccttaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatggag cccaagagca gcgacaagac ccacacctct 180

cgccgagcc cagctcccga gctcctgggc ggcagcagcg tgttcctgtt cccaccaaag 240

cccaaggaca ccctgtacat cacccgggag cccgaggtga cctgcgtggt ggtggacgtg 300

agccacgagg acccgggaggt gaagttcaac tggtacgtgg acggcgtgga ggtgcacaac 360

gccaagacca agccccggga ggagcagtac aacagcacct accgggtggt gagcgtgctg 420

accgtgctgc accaggactg gctgaacggc aaggagtaca agtgcaaggt gagcaacaag 480

gccctgcctg cccctatcga gaagaccatc agcaaggcca agggccagcc gcgggagcct 540

caggtgtaca ccctgcctcc ttctcgggac gagctgacca agaaccaggt gagcctgacc 600

tgcctggtga agggcttcta ccccagcgac atcgccgtgg agtgggagag caacggccag 660

cctgagaaca actacaagac cacccctccc gtgctggaca gcgacggcag cttcttcctg 720

tacagcaagt taaccgtgga caagagccgg tggcagcagg gcaacgtgtt cagctgcagc 780

gtgatgcacg aggcactgca caaccactac acccagaaga gtctgagtct cagccccggc 840

aagcggaagt caacctggag caagcgaagc ctgtcccagg aggacgcccc tcagaccccc 900

cggcctgtgg cggagatcgt gcccagcttc atcaacaagg ataccgagac aataaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgactctgag cgagatgcag 1020

cccgccctgc cacaattgca gcagcacgtg cctgtgctga aggacagcag cctgctgttc 1080

1140

gaacttaagt acctgggcct ggacacccac agccggaaga agcggcagct gtactccgcc 1200

ctggccaaca agtgctgcca cgtgggctgt accaagagga gcctggcccg gttctgc 1257

<210> 285

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 285

atgccccggc ttttcttctt ccacttgctc ggcgtgtgcc tacttctcaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatggag cccaagagca gcgacaagac ccacacctct 180

cctcctagcc ctgcccccga gctcctgggc ggcagcagcg tgttcctgtt cccacctaag 240

cccaaggaca ccctgtacat cacccgggag cccgaggtga cctgcgtggt ggtggacgtg 300

agccacgagg acccagaagt gaagttcaac tggtacgtgg acggcgtgga ggtgcacaac 360

gccaagacca agccccggga ggagcagtac aacagcacct accgggtggt gagcgtgctg 420

accgtgctgc accaggactg gctgaacggc aaggagtaca agtgcaaggt gagcaacaag 480

gccctgccag cccctatcga gaagaccatc agcaaggcca agggacagcc aagagagcct 540

caggtgtaca ccctgccacc tagccgggac gagctgacca agaaccaggt gagcctgacc 600

tgcctggtga agggcttcta ccccagcgac atcgccgtgg agtgggagag caacggccag 660

cctgagaaca actacaagac caccccaccc gtgctggaca gcgacggcag cttcttcctg 720

tacagcaagc tcacagtgga caagagccgg tggcagcagg gcaacgtgtt cagctgcagc 780

gtgatgcacg aggccctcca caaccactac acacagaagt ccctgagcct tagccccggc 840

aagagaaaga gcacctggtc caagagaagt ctgtcccagg aggacgcccc tcagaccccc 900

cggccagtgg ctgagatcgt gcccagcttc atcaacaagg atacagagac tatcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgaccctgag cgagatgcag 1020

cccgcccttc cacaactgca gcagcacgtg ccagtgctga aggacagcag cctgctgttc 1080

1140

gaactcaagt acctgggcct ggacacccac agccggaaga agcggcagct gtacagtgcc 1200

ctggccaaca agtgctgcca cgtgggatgc accaagcgga gcctggcccg gttctgc 1257

<210> 286

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 286

atgccccggc ttttcttctt ccacctcttg ggcgtgtgcc tcttgctcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatggag cccaagtcct ccgacaagac ccacaccagc 180

ccaccttcac cggcccccga gctcctcggc ggctcctccg tcttcctctt cccacctaag 240

cccaaggaca ccctctacat cacccgcgag cccgaggtca cctgcgtcgt cgtcgacgtc 300

tcccacgagg acccagaggt gaagttcaac tggtacgtcg acggcgtcga ggtccacaac 360

gccaagacca agccccgcga ggagcagtac aactccacct accgcgtcgt ctccgtcctc 420

accgtcctcc accaggactg gctcaacggc aaggagtaca agtgcaaggt ttccaacaag 480

gccctcccag ccccaatcga gaagaccatc tccaaggcca agggccagcc tcgagagcca 540

caggtctaca ccctgccacc ttcccgcgac gagctcacca agaaccaggt gtccctcacc 600

tgcctcgtca agggcttcta cccttccgac atcgccgtcg agtgggagtc caacggacaa 660

ccagagaaca actacaagac caccccgccc gtcctcgact ccgacggctc cttcttcctg 720

tactccaagc tgaccgtgga caagtcccgc tggcagcagg gcaacgtctt ctcctgctcc 780

gtcatgcacg aggccctgca caaccactac acccagaagt ccctctcact ctcccccggc 840

aagcgcaagt ccacctggtc caagagatcc ctgtcccagg aggacgcccc ccagacacca 900

cgtcctgtcg ccgagatcgt cccctccttc atcaacaagg atacagaaac catcaacatg 960

atgtccgagt tcgtcgccaa ccttcctcag gagctgaagc tcaccctctc cgagatgcag 1020

cccgccttgc cacagctcca gcagcacgtt cctgtgctca aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgactc cagccctagc 1140

gagctaaagt acctcggcct cgacacccac tcccgcaaga agcgccagct ctattccgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc acaaagagaa gcctcgcccg cttctgc 1257

<210> 287

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 287

atgccgac tcttcttctt ccaccttctc ggcgtgtgcc tccttctcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatggag cccaagtcct ccgacaagac ccacaccagc 180

ccacctagcc cagcccccga gctcctcggc ggctcctccg tcttcctctt ccctccgaag 240

cccaaggaca ccctctacat cacccgcgag cccgaggtca cctgcgtcgt cgtcgacgtc 300

tcccacgagg acccagaggt gaagttcaac tggtacgtcg acggcgtcga ggtccacaac 360

gccaagacca agccccgcga ggagcagtac aactccacct accgcgtcgt ctccgtcctc 420

accgtcctcc accaggactg gctcaacggc aaggagtaca agtgcaaggt gtccaacaag 480

gccctgcctg ccccaatcga gaagaccatc tccaaggcca agggccagcc tagagagcct 540

caggtctaca ccctgcctcc aagccgcgac gagctcacca agaaccaggt ttccctcacc 600

tgcctcgtca agggcttcta cccttctgac atcgccgtcg agtgggagtc caacggccag 660

ccagagaaca actacaagac cacccctccc gtcctcgact ccgacggctc cttcttcctg 720

tactccaagc tgaccgtgga caagtcccgc tggcagcagg gcaacgtctt ctcctgctcc 780

gtcatgcacg aggccctcca caaccactac acccagaagt ccctctccct ctcacccggc 840

aagcgcaagt ccacctggtc caagcggtcc ctgtcccagg aggacgcccc ccagacccct 900

cggccggtcg ccgagatcgt cccctccttc atcaacaagg ataccgagac gatcaacatg 960

atgtccgagt tcgtcgccaa tctcccacag gagctgaagc ttaccctctc cgagatgcag 1020

cccgccctgc cgcagctcca gcagcacgtg cctgtcctca aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgattc ctctccttcc 1140

gagctcaagt acctcggcct cgacacccac tcccgcaaga agcgccagct gtattccgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc acgaagagga gcctggcccg cttctgc 1257

<210> 288

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 288

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatggag cccaagagca gcgacaagac ccacaccagc 180

ccccccagcc ccgcccccga gctgctgggc ggcagcagcg tgttcctgtt cccccccaag 240

cccaaggaca ccctgtacat cacccgggag cccgaggtga cctgcgtggt ggtggacgtg 300

agccacgagg accccgaggt gaagttcaac tggtacgtgg acggcgtgga ggtgcacaac 360

gccaagacca agccccggga ggagcagtac aacagcacct accgggtggt gagcgtgctg 420

accgtgctgc accaggactg gctgaacggc aaggagtaca agtgcaaggt gagcaacaag 480

gccctgcccg cccccatcga gaagaccatc agcaaggcca agggccagcc ccgggagccc 540

caggtgtaca ccctgcccc cagccgggac gagctgacca agaaccaggt gagcctgacc 600

tgcctggtga agggcttcta ccccagcgac atcgccgtgg agtgggagag caacggccag 660

cccgagaaca actacaagac cacccccccc gtgctggaca gcgacggcag cttcttcctg 720

tacagcaagc tgaccgtgga caagagccgg tggcagcagg gcaacgtgtt cagctgcagc 780

gtgatgcacg aggccctgca caaccactac acccagaaga gcctgagcct gagccccggc 840

aagcggaaga gcacctggag caagcggagc ctgagccagg aggacgcccc ccagaccccc 900

cggcccgtgg ccgagatcgt gcccagcttc atcaacaagg acaccgagac catcaacatg 960

atgagcgagt tcgtggccaa cctgccccag gagctgaagc tgaccctgag cgagatgcag 1020

cccgccctgc cccagctgca gcagcacgtg cccgtgctga aggacagcag cctgctgttc 1080

1140

gagctgaagt acctgggcct ggacacccac agccggaaga agcggcagct gtacagcgcc 1200

ctggccaaca agtgctgcca cgtgggctgc accaagcgga gcctggcccg gttctgc 1257

<210> 289

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 289

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

120

agggcgcaga tcgcgatctg cgggatggag ccgaagagca gcgacaagac gcacacgagc 180

ccgccgagcc cggcgccgga gctgctgggg gggagcagcg tgttcctgtt cccgccgaag 240

ccgaaggaca cgctgtacat cacgagggag ccggaggtga cgtgcgtggt ggtggacgtg 300

agccacgagg acccgggaggt gaagttcaac tggtacgtgg acggggtgga ggtgcacaac 360

gcgaagacga agccgaggga ggagcagtac aacagcacgt acagggtggt gagcgtgctg 420

acggtgctgc accaggactg gctgaacggg aaggagtaca agtgcaaggt gagcaacaag 480

gcgctgccgg cgccgatcga gaagacgatc agcaaggcga aggggcagcc gagggagccg 540

caggtgtaca cgctgccgcc gagcagggac gagctgacga agaaccaggt gagcctgacg 600

tgcctggtga aggggttcta cccgagcgac atcgcggtgg agtgggagag caacgggcag 660

ccggagaaca actacaagac gacgccgccg gtgctggaca gcgacgggag cttcttcctg 720

tacagcaagc tgacggtgga caagagcagg tggcagcagg ggaacgtgtt cagctgcagc 780

gtgatgcacg aggcgctgca caaccactac acgcagaaga gcctgagcct gagcccgggg 840

aagaggaaga gcacgtggag caagaggagc ctgagccagg aggacgcgcc gcagacgccg 900

aggccggtgg cggagatcgt gccgagcttc atcaacaagg acacggagac gatcaacatg 960

atgagcgagt tcgtggcgaa cctgccgcag gagctgaagc tgacgctgag cgagatgcag 1020

ccggcgctgc cgcagctgca gcagcacgtg ccggtgctga aggacagcag cctgctgttc 1080

1140

gagctgaagt acctggggct ggacacgcac agcaggaaga agaggcagct gtacagcgcg 1200

ctggcgaaca agtgctgcca cgtggggtgc acgaagagga gcctggcgag gttctgc 1257

<210> 290

<211> 1257

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 290

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatggag cccaagtcct ccgacaagac ccacacctcc 180

cccccctccc cgcccccga gctcctcggc ggctcctccg tcttcctctt cccccccaag 240

cccaaggaca ccctctacat cacccgcgag cccgaggtca cctgcgtcgt cgtcgacgtc 300

tcccacgagg accccgaggt caagttcaac tggtacgtcg acggcgtcga ggtccacaac 360

gccaagacca agccccgcga ggagcagtac aactccacct accgcgtcgt ctccgtcctc 420

accgtcctcc accaggactg gctcaacggc aaggagtaca agtgcaaggt ctccaacaag 480

gccctccccg cccccatcga gaagaccatc tccaaggcca agggccagcc ccgcgagccc 540

caggtctaca ccctcccccc ctcccgcgac gagctcacca agaaccaggt ctccctcacc 600

tgcctcgtca agggcttcta cccctccgac atcgccgtcg agtgggagtc caacggccag 660

cccgagaaca actacaagac cacccccccc gtcctcgact ccgacggctc cttcttcctc 720

tactccaagc tcaccgtcga caagtcccgc tggcagcagg gcaacgtctt ctcctgctcc 780

gtcatgcacg aggccctcca caaccactac acccagaagt ccctctccct ctcccccggc 840

aagcgcaagt ccacctggtc caagcgctcc ctctcccagg aggacgcccc ccagaccccc 900

cgccccgtcg ccgagatcgt cccctccttc atcaacaagg acaccgagac catcaacatg 960

atgtccgagt tcgtcgccaa cctcccccag gagctcaagc tcaccctctc cgagatgcag 1020

cccgccctcc cccagctcca gcagcacgtc cccgtcctca aggactcctc cctcctcttc 1080

gaggagttca agaagctcat ccgcaaccgc cagtccgagg ccgccgactc ctccccctcc 1140

gagctcaagt acctcggcct cgacacccac tcccgcaaga agcgccagct ctactccgcc 1200

ctcgccaaca agtgctgcca cgtcggctgc accaagcgct ccctcgcccg cttctgc 1257

<210> 291

<211> 1233

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 291

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg gcagcacaga ctccggctct 180

gataccagct ccggcaacag cggcgatggc aattccggcc aactctacag tgcattggct 240

aataaatgtt gccatgttgg ttgtaccaaa agatctcttg ctagattttg cggcagcaca 300

gactccggct ctgataccag ctccggcaac agcggcgatg gcaattccgg cggcagctcc 360

ggaggaggct ctggctctag ctccggctct agcggcagcg gcggctccgg cggcagcaca 420

gactccggct ctgataccag ctccggcaac agcggcgatg gcaattccgg cggcagctcc 480

ggaggaggct ctggctctag ctccggctct agcggcagcg gcggctccgg cgagcccaag 540

agcagcgaca agacccacac cagccccccc agccccgccc ccgagctgct gggcggcagc 600

agcgtgttcc tgttcccccc caagcccaag gacaccctgt acatcaccag ggagcccgag 660

gtgacctgcg tggtggtgga cgtgagccac gaggaccccg aggtgaagtt caactggtac 720

gtggacggcg tggaggtgca caacgccaag accaagccca gggaggagca gtacaacagc 780

acctacaggg tggtgagcgt gctgaccgtg ctgcaccagg actggctgaa cggcaaggag 840

tacaagtgca aggtgagcaa caaggccctg cccgccccca tcgagaagac catcagcaag 900

gccaagggcc agcccaggga gccccaggtg tacaccctgc cccccagcag ggacgagctg 960

accaagaacc aggtgagcct gacctgcctg gtgaagggct tctaccccag cgacatcgcc 1020

1080

gacagcgacg gcagcttctt cctgtacagc aagctgaccg tggacaagag caggtggcag 1140

cagggcaacg tgttcagctg cagcgtgatg cacgaggccc tgcacaacca ctacacccag 1200

aagagcctga gcctgagccc cggcaagagg aag 1233

<210> 292

<211> 993

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 292

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg gcagcacaga ctccggctct 180

gataccagct ccggcaacag cggcgatggc aattccggcc aactctacag tgcattggct 240

aataaatgtt gccatgttgg ttgtaccaaa agatctcttg ctagattttg cgagcccaag 300

agcagcgaca agacccacac cagccccccc agccccgccc ccgagctgct gggcggcagc 360

agcgtgttcc tgttcccccc caagcccaag gacaccctgt acatcaccag ggagcccgag 420

gtgacctgcg tggtggtgga cgtgagccac gaggaccccg aggtgaagtt caactggtac 480

gtggacggcg tggaggtgca caacgccaag accaagccca gggaggagca gtacaacagc 540

acctacaggg tggtgagcgt gctgaccgtg ctgcaccagg actggctgaa cggcaaggag 600

tacaagtgca aggtgagcaa caaggccctg cccgccccca tcgagaagac catcagcaag 660

gccaagggcc agcccaggga gccccaggtg tacaccctgc cccccagcag ggacgagctg 720

accaagaacc aggtgagcct gacctgcctg gtgaagggct tctaccccag cgacatcgcc 780

840

gacagcgacg gcagcttctt cctgtacagc aagctgaccg tggacaagag caggtggcag 900

cagggcaacg tgttcagctg cagcgtgatg cacgaggccc tgcacaacca ctacacccag 960

aagagcctga gcctgagccc cggcaagagg aag 993

<210> 293

<211> 1053

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 293

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg gcagcacaga ctccggctct 180

gataccagct ccggcaacag cggcgatggc aattccggcc aactctacag tgcattggct 240

aataaatgtt gccatgttgg ttgtaccaaa agatctcttg ctagattttg cggcagcaca 300

gactccggct ctgataccag ctccggcaac agcggcgatg gcaattccgg cgagcccaag 360

agcagcgaca agacccacac cagccccccc agccccgccc ccgagctgct gggcggcagc 420

agcgtgttcc tgttcccccc caagcccaag gacaccctgt acatcaccag ggagcccgag 480

gtgacctgcg tggtggtgga cgtgagccac gaggaccccg aggtgaagtt caactggtac 540

gtggacggcg tggaggtgca caacgccaag accaagccca gggaggagca gtacaacagc 600

acctacaggg tggtgagcgt gctgaccgtg ctgcaccagg actggctgaa cggcaaggag 660

tacaagtgca aggtgagcaa caaggccctg cccgccccca tcgagaagac catcagcaag 720

gccaagggcc agcccaggga gccccaggtg tacaccctgc cccccagcag ggacgagctg 780

accaagaacc aggtgagcct gacctgcctg gtgaagggct tctaccccag cgacatcgcc 840

gtggagtggg agagcaacgg ccagcccgag aacaactaca agaccacccc ccccgtgctg 900

gacagcgacg gcagcttctt cctgtacagc aagctgaccg tggacaagag caggtggcag 960

cagggcaacg tgttcagctg cagcgtgatg cacgaggccc tgcacaacca ctacacccag 1020

aagagcctga gcctgagccc cggcaagagg aag 1053

<210> 294

<211> 1317

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 294

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agacaactct acagtgcatt ggctaataaa tgttgccatg ttggttgtac caaaagatct 540

cttgctagat tttgcggcag cacagactcc ggctctgata ccagctccgg caacagcggc 600

gatggcaatt ccggcgagcc caagagcagc gacaagaccc acaccagccc ccccagcccc 660

gcccccgagc tgctgggcgg cagcagcgtg ttcctgttcc cccccaagcc caaggacacc 720

ctgtacatca ccagggagcc cgaggtgacc tgcgtggtgg tggacgtgag ccacgaggac 780

cccgaggtga agttcaactg gtacgtggac ggcgtggagg tgcacaacgc caagaccaag 840

cccagggagg agcagtacaa cagcacctac agggtggtga gcgtgctgac cgtgctgcac 900

caggactggc tgaacggcaa ggagtacaag tgcaaggtga gcaacaaggc cctgcccgcc 960

cccatcgaga agaccatcag caaggccaag ggccagccca gggagcccca ggtgtacacc 1020

ctgcccccca gcagggacga gctgaccaag aaccaggtga gcctgacctg cctggtgaag 1080

ggcttctacc ccagcgacat cgccgtggag tgggagca acggccagcc cgagaacaac 1140

tacaagacca ccccccccgt gctggacagc gacggcagct tcttcctgta cagcaagctg 1200

1260

gccctgcaca accactacac ccagaagagc ctgagcctga gccccggcaa gaggaag 1317

<210> 295

<211> 1317

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 295

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agagagccca agagcagcga caagacccac accagccccc ccagccccgc ccccgagctg 540

ctgggcggca gcagcgtgtt cctgttcccc cccaagccca aggacaccct gtacatcacc 600

agggacccg aggtgacctg cgtggtggtg gacgtgagcc acgaggaccc cgaggtgaag 660

ttcaactggt acgtggacgg cgtggaggtg cacaacgcca agaccaagcc cagggaggag 720

cagtacaaca gcacctacag ggtggtgagc gtgctgaccg tgctgcacca ggactggctg 780

aacggcaagg agtacaagtg caaggtgagc aacaaggccc tgcccgcccc catcgagaag 840

accatcagca aggccaaggg ccagcccagg gagccccagg tgtacaccaa gccccccagc 900

agggacgagc tgaccaagaa ccaggtgagc ctgtcctgcc tggtgaaggg cttctacccc 960

agcgacatcg ccgtggagtg ggagagcaac ggccagcccg agaacaacta caagaccacc 1020

gtccccgtgc tggacagcga cggcagcttc cgcctggcca gctatctgac cgtggacaag 1080

agcaggtggc agcagggcaa cgtgttcagc tgcagcgtga tgcacgaggc cctgcacaac 1140

cactacaccc agaagagcct gagcctgagc cccggcaaga ggaagggcag cacagactcc 1200

ggctctgata ccagctccgg caacagcggc gatggcaatt ccggccaact ctacagtgca 1260

ttggctaata aatgttgcca tgttggttgt accaaaagat ctcttgctag attttgc 1317

<210> 296

<211> 978

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 296

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agagaggtgc agctgctgga gagcggcggc ggcctggtgc agcccggcgg cagcctgagg 540

ctgagctgcg ccgccagcgg cttcaccttc agcagctacg ccatgagctg ggtgaggcag 600

660

tacgccgaca gcgtgaaggg caggttcacc atcagcaggg acaacagcaa gaacaccctg 720

tacctgcaga tgaacagcct gagggccgag gacaccgccg tgtactactg caccaaggac 780

ccccccaggt accactacac cggcctggcc gtgaggggcc agggcaccac cgtgaccgtg 840

agcagcggca gcacagactc cggctctgat accagctccg gcaacagcgg cgatggcaat 900

tccggccaac tctacagtgc attggctaat aaatgttgcc atgttggttg taccaaaaga 960

tctcttgcta gattttgc 978

<210> 297

<211> 1317

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 297

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agagagccca agagcagcga caagacccac accagccccc ccagccccgc ccccgagctg 540

ctgggcggca gcagcgtgtt cctgttcccc cccaagccca aggacaccct gtacatcacc 600

agggacccg aggtgacctg cgtggtggtg gacgtgagcc acgaggaccc cgaggtgaag 660

ttcaactggt acgtggacgg cgtggaggtg cacaacgcca agaccaagcc cagggaggag 720

cagtacaaca gcacctacag ggtggtgagc gtgctgaccg tgctgcacca ggactggctg 780

aacggcaagg agtacaagtg caaggtgagc aacaaggccc tgcccgcccc catcgagaag 840

accatcagca aggccaaggg ccagcccagg gagccccagg tgtacaccct gccccccagc 900

agggacgagc tgaccaagaa ccaggtgagc ctgacctgcc tggtgaaggg cttctacccc 960

agcgacatcg ccgtggagtg ggagagcaac ggccagcccg agaacaacta caagaccacc 1020

ccccccgtgc tggacagcga cggcagcttc ttcctgtaca gcaagctgac cgtggacaag 1080

agcaggtggc agcagggcaa cgtgttcagc tgcagcgtga tgcacgaggc cctgcacaac 1140

cactacaccc agaagagcct gagcctgagc cccggcaaga ggaagggcag cacagactcc 1200

ggctctgata ccagctccgg caacagcggc gatggcaatt ccggccaact ctacagtgca 1260

ttggctaata aatgttgcca tgttggttgt accaaaagat ctcttgctag attttgc 1317

<210> 298

<211> 1317

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 298

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agacaactct acagtgcatt ggctaataaa tgttgccatg ttggttgtac caaaagatct 540

cttgctagat tttgcggcag cacagactcc ggctctgata ccagctccgg caacagcggc 600

gatggcaatt ccggcgagcc caagagcagc gacaagaccc acaccagccc ccccagcccc 660

gcccccgagc tgctgggcgg cagcagcgtg ttcctgttcc cccccaagcc caaggacacc 720

ctgtacatca ccagggagcc cgaggtgacc tgcgtggtgg tggacgtgag ccacgaggac 780

cccgaggtga agttcaactg gtacgtggac ggcgtggagg tgcacaacgc caagaccaag 840

cccagggagg agcagtacaa cagcacctac agggtggtga gcgtgctgac cgtgctgcac 900

caggactggc tgaacggcaa ggagtacaag tgcaaggtga gcaacaaggc cctgcccgcc 960

cccatcgaga agaccatcag caaggccaag ggccagccca gggagcccca ggtgtacacc 1020

aagcccccca gcagggacga gctgaccaag aaccaggtga gcctgtcctg cctggtgaag 1080

ggcttctacc ccagcgacat cgccgtggag tgggagca acggccagcc cgagaacaac 1140

tacaagacca ccgtccccgt gctggacagc gacggcagct tccgcctggc cagctatctg 1200

1260

gccctgcaca accactacac ccagaagagc ctgagcctga gccccggcaa gaggaag 1317

<210> 299

<211> 978

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 299

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agacaactct acagtgcatt ggctaataaa tgttgccatg ttggttgtac caaaagatct 540

cttgctagat tttgcggcag cacagactcc ggctctgata ccagctccgg caacagcggc 600

gatggcaatt ccggcgaggt gcagctgctg gagagcggcg gcggcctggt gcagcccggc 660

ggcagcctga ggctgagctg cgccgccagc ggcttcacct tcagcagcta cgccatgagc 720

tgggtgaggc aggccccgg caagggcctg gagtgggtga gcgccatcag cggcagcggc 780

ggcagcacct actacgccga cagcgtgaag ggcaggttca ccatcagcag ggacaacagc 840

aagaacaccc tgtacctgca gatgaacagc ctgaggggccg aggacaccgc cgtgtactac 900

tgcaccaagg acccccccag gtaccactac accggcctgg ccgtgagggg cggggcacc 960

accgtgaccg tgagcagc 978

<210> 300

<211> 1317

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 300

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg gcagcacaga ctccggctct 180

gataccagct ccggcaacag cggcgatggc aattccggcg agcccaagag cagcgacaag 240

acccacacca gcccccccag ccccgccccc gagctgctgg gcggcagcag cgtgttcctg 300

360

gtggtggacg tgagccacga ggaccccgag gtgaagttca actggtacgt ggacggcgtg 420

gaggtgcaca acgccaagac caagcccagg gaggagcagt acaacagcac ctacagggtg 480

gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 540

gtgagcaaca aggccctgcc cgcccccatc gagaagacca tcagcaaggc caagggccag 600

660

gtgagcctgt cctgcctggt gaagggcttc taccccagcg acatcgccgt ggagtgggag 720

agcaacggcc agcccgagaa caactacaag accaccgtcc ccgtgctgga cagcgacggc 780

agcttccgcc tggccagcta tctgaccgtg gacaagagca ggtggcagca gggcaacgtg 840

ttcagctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gagcctgagc 900

ctgagccccg gcaagaggaa gaaaaggtct ctgagccagg aagatgctcc tcagacacct 960

agaccagtgg cagaaattgt gccatccttc atcaacaaag atacagaaac cataaatatg 1020

1080

ccagcattac cacagctaca acaacatgta cctgtattaa aagattccag tcttctcttt 1140

gaagaattta agaaacttat tcgcaataga caaagtgaag ccgcagacag cagtccttca 1200

gaattaaaat acttaggctt ggatactcat tctcgaaaaa agagacaact ctacagtgca 1260

ttggctaata aatgttgcca tgttggttgt accaaaagat ctcttgctag attttgc 1317

<210> 301

<211> 714

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 301

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg gcagcacaga ctccggctct 180

gataccagct ccggcaacag cggcgatggc aattccggcc aactctacag tgcattggct 240

aataaatgtt gccatgttgg ttgtaccaaa agatctcttg ctagattttg cggcagcaca 300

gactccggct ctgataccag ctccggcaac agcggcgatg gcaattccgg cgaggtgcag 360

ctgctggaga gcggcggcgg cctggtgcag cccggcggca gcctgaggct gagctgcgcc 420

gccagcggct tcaccttcag cagctacgcc atgagctggg tgaggcaggc ccccggcaag 480

ggcctggagt gggtgagcgc catcagcggc agcggcggca gcacctacta cgccgacagc 540

gtgaagggca ggttcaccat cagcagggac aacagcaaga acaccctgta cctgcagatg 600

aacagcctga gggccgagga caccgccgtg tactactgca ccaaggaccc ccccaggtac 660

cactacaccg gcctggccgt gaggggccag ggcaccaccg tgaccgtgag cagc 714

<210> 302

<211> 1053

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 302

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagcg gcagcacaga ctccggctct 180

gataccagct ccggcaacag cggcgatggc aattccggcc aactctacag tgcattggct 240

aataaatgtt gccatgttgg ttgtaccaaa agatctcttg ctagattttg cggcagcaca 300

gactccggct ctgataccag ctccggcaac agcggcgatg gcaattccgg cgagcccaag 360

agcagcgaca agacccacac cagccccccc agccccgccc ccgagctgct gggcggcagc 420

agcgtgttcc tgttcccccc caagcccaag gacaccctgt acatcaccag ggagcccgag 480

gtgacctgcg tggtggtgga cgtgagccac gaggaccccg aggtgaagtt caactggtac 540

gtggacggcg tggaggtgca caacgccaag accaagccca gggaggagca gtacaacagc 600

acctacaggg tggtgagcgt gctgaccgtg ctgcaccagg actggctgaa cggcaaggag 660

tacaagtgca aggtgagcaa caaggccctg cccgccccca tcgagaagac catcagcaag 720

gccaagggcc agcccaggga gccccaggtg tacaccaagc cccccagcag ggacgagctg 780

accaagaacc aggtgagcct gtcctgcctg gtgaagggct tctaccccag cgacatcgcc 840

gtggagtggg agagcaacgg ccagcccgag aacaactaca agaccaccgt ccccgtgctg 900

gacagcgacg gcagcttccg cctggccagc tatctgaccg tggacaagag caggtggcag 960

cagggcaacg tgttcagctg cagcgtgatg cacgaggccc tgcacaacca ctacacccag 1020

aagagcctga gcctgagccc cggcaagagg aag 1053

<210> 303

<211> 555

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 303

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tcctgctgaa ccagttcagc 60

agggccgtgg ccgacagctg gatggaggag gtgatcaagc tgtgcggcag ggagctggtg 120

agggcgcaga tcgccatctg cggcatgagc acctggagca agaggagcct gagccaggag 180

gacgccccgc aaaccccccg gccggtcgcg gagatagtgc ccagcttcat aaacaaggac 240

accgagacca tcaatatgat gagcgagttc gtggccaacc tgccccagga gctgaagctg 300

acgctgagcg agatgcagcc ggccctgccg cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tcctgttcga ggagttcaag aagctgatca ggaaccggca gagcgaggcc 420

gccgactcca gccccagcga gctgaagtac ctgggcctgg acacccatag caggaagaag 480

cgccagctgt acagcgccct ggctaacaag tgctgccacg tgggctgcac caagaggagc 540

ctggcccggt tctgc 555

<210> 304

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 304

atgccccgcc tcttcttctt ccacctcctc ggcgtgtgcc tcctactcaa ccagtttagc 60

agggccgtgg ccgatagctg gatggaggag gtgatcaagc tctgcggcag agagctcgtg 120

cgggcccaga tcgccatctg cggcatgagc acctggagca agaggagcct gagccaggag 180

gacgccccac aaaccccgcg ccccgtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgaaacca tcaacatgat gagcgagttt gtcgccaacc tgccccagga gctcaagctg 300

accctgagcg agatgcagcc cgccctgcct cagctgcagc agcacgtgcc agtgctgaaa 360

gactccagcc tgctctttga agagttcaag aagctgatca ggaacagaca gagcgaggcc 420

gctgacagca gcccctcaga gctgaagtac ctggggctgg atacccatag ccgcaagaag 480

cggcagctgt actccgccct cgccaacaag tgctgccacg tgggctgcac caagcggagc 540

ctcgcccgat tctgtggcgg cggagggtcc ggcggcggcg gcagcggtgg aggcgggagc 600

gacatccaga tgacccagag ccccagcagc ctgtccgcca gtgtgggcga tagagtcacc 660

atcacgtgca gggcctccag gcccatcggc accatgctga gctggtacca gcagaagccc 720

ggcaaggcgc ccaagctgct gatcctggcc ttcagcaggc tgcagtccgg ggtgcccagc 780

cggttctccg gctccggcag cggcaccgac tttaccctga ccatcagcag cctgcagcct 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac gttcggtcag 900

ggcactaagg tggagatcaa gcgg 924

<210> 305

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 305

atgccccgcc tcttcttctt ccacctcctc ggcgtgtgcc tcctactcaa ccagtttagc 60

agggccgtgg ccgatagctg gatggaggag gtgatcaagc tctgcggcag agagctcgtg 120

cgggcccaga tcgccatctg cggcatgagc acctggagca agaggagcct gagccaggag 180

gacgccccac aaaccccgcg ccccgtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgaaacca tcaacatgat gagcgagttt gtcgccaacc tgccccagga gctcaagctg 300

accctgagcg agatgcagcc cgccctgcct cagctgcagc agcacgtgcc agtgctgaaa 360

gactccagcc tgctctttga agagttcaag aagctgatca ggaacagaca gagcgaggcc 420

gctgacagca gcccctcaga gctgaagtac ctggggctgg atacccatag ccgcaagaag 480

cggcagctgt actccgccct cgccaacaag tgctgccacg tgggctgcac caagcggagc 540

ctcgcccgat tctgtggcgg cggagggtcc ggcggcggcg gcagcggtgg aggcgggagc 600

gacatccaga tgacccagag ccccagcagc ctgtccgcca gtgtgggcga tagagtcacc 660

atcacgtgca gggcctccag gcccatcggc accatgctga gctggtacca gcagaagccc 720

ggcaaggcgc ccaagctgct gatcctggcc ttcagcaggc tgcagtccgg ggtgcccagc 780

cggttctccg gctccggcag cggcaccgac tttaccctga ccatcagcag cctgcagcct 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac gttcggtcag 900

ggcactaagg tggagatcaa gcgg 924

<210> 306

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 306

atgccccggc tgttcttctt ccacctactc ggcgtctgcc tcctcctaaa ccagttttcc 60

120 cgcgccgtgg

agggcccaga tcgcgatttg cggcatgtcc acctggagca agaggagcct cagccaggag 180

gacgcgcccc aaaccccgag gcccgtggcc gagatcgtgc cgagctttat caacaaggac 240

accgaaacca tcaacatgat gtccgagttt gtggctaatc tgccccagga gctcaagctc 300

acactgtccg agatgcagcc cgccctgccc caactgcagc agcacgtccc cgtgctcaag 360

gacagcagcc tcctcttcga ggaattcaag aagctcatcc gcaaccggca gagcgaggcc 420

gccgacagca gcccctcaga gctgaagtac ctgggcctcg acacccacag ccggaagaag 480

aggcagctgt actccgccct ggccaacaaa tgctgccatg tgggctgcac aaagaggagc 540

ctggcccggt tttgcgggagg tggtgggagc ggcggtggcg gttcaggcgg cggcggttcc 600

660

atcacctgcc gcgccagccg acccatcggc accatgctgt cctggtacca gcagaagccg 720

gggaaggccc caaagctgct gattctggcc tttagccggc tgcagagcgg ggtgcccagc 780

agattcagcg gctcggggag cgggaccgac tttacgctga ccatcagctc cctgcagccc 840

gaggatttcg caacgtacta ctgtgcccag gccggcaccc accccactac tttcggccag 900

ggcaccaagg tggagatcaa gcgt 924

<210> 307

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 307

atgcccaggc tgttcttctt ccacctcctc ggcgtgtgtc tcctcctcaa ccagttcagc 60

agagccgtcg ccgattcttg gatggaggag gtgatcaagt tgtgcggccg ggagctcgtg 120

agggctcaga tcgccatctg cggcatgtca acctggagca agcggtcgct gagccaggag 180

gacgcccctc agaccccgag gcccgtggcc gagatcgtgc ctagcttcat caacaaggac 240

accgagacaa tcaacatgat gagcgagttt gtggcgaatc tgccccagga gctgaagctc 300

accctcagcg agatgcagcc cgccctgccc cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggagtttaag aagctgatcc ggaacaggca gagcgaggcc 420

gccgacagca gcccctctga actgaagtat ctcgggctgg acacccacag cgggaagaag 480

cgccagctgt actccgccct ggccaacaaa tgctgccacg tggggtgcac caaacggagc 540

ctggcccggt tctgtggcgg cggcggctcc ggcggcggtg ggtctggagg cggcggctcg 600

gatatccaga tgacccagag ccccagcagc ctgtccgcct ccgtgggcga cagggtgacc 660

atcacctgcc gggcctctag gcccatcggg accatgctca gctggtacca gcagaaacca 720

ggcaaggccc ctaagctgct gatcctggca ttcagccgcc tgcagagcgg cgtcccctcc 780

aggttcagcg gcagcggtag cggaacggac ttcaccctca ccattagctc cctccagccc 840

gaggacttcg ccacctacta ctgtgcacag gccggtaccc accccacgac cttcggccag 900

ggcacaaagg tggagatcaa gcgg 924

<210> 308

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 308

atgcctaggc tgttcttctt ccacctcctc ggcgtgtgtc tcctcctcaa ccagttcagc 60

cgggccgtgg ccgactcctg gatggaggag gtgatcaagc tctgcggcag agagctcgtc 120

cgagcccaga tagccatctg cggcatgagc acctggagca agaggagcct gagtcaggag 180

gacgcccctc agacaccccg gcccgtggct gagatcgtgc ccagcttcat taacaaagac 240

accgaaacca tcaacatgat gtccgagttc gtggccaatc tgccacagga gctcaagctg 300

accctgagcg agatgcagcc cgccctgccc cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctctttga ggagttcaag aagctgatcc gcaaccgaca gagcgaggct 420

gccgatagca gcccttccga actcaaatac ctgggcctgg acacacacag cgggaagaag 480

cggcagctgt acagcgccct ggctaacaag tgttgccacg tagggtgcac caaacgcagc 540

ctggccagat tctgcggcgg cggcggctcc ggcgggaggcg gatcaggcgg cggcggcagc 600

gatatccaga tgactcagag ccccagctcc ctgagcgcct ccgttgggga ccgggtgacc 660

atcacctgca gagcgagccg ccccatcggc accatgctct cctggtacca acagaagcca 720

ggcaaggccc cgaagctgct gattctcgcc ttcagcaggc tgcaaagcgg cgtgcccagc 780

aggttctccg gctccggcag cggcacagac ttcaccctga ccatcagctc cctgcagccg 840

gaggacttcg ccacctacta ttgtgcccag gccggcaccc accccaccac cttcggccaa 900

ggcacaaagg tggaaatcaa gagg 924

<210> 309

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 309

atgccgac tcttcttctt ccatctactc ggtgtgtgtc tcctcctcaa tcagtttagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagca agagatccct gtcgcaggag 180

gacgcgccac agactcctcg gcccgtggcc gagatcgtgc ccagctttat caacaaggac 240

accgaaacca tcaacatgat gagcgagttc gtggcaaatc tgccccagga gctgaagctg 300

accctgagcg agatgcagcc tgccttgcct cagctgcagc agcatgtgcc cgtgctcaaa 360

gatagcagcc tgctgttcga ggagttcaag aaactgatcc ggaaccggca gagcgaggcc 420

gccgactcca gcccctctga gctgaagtac ctggggctgg acacgcactc cgggaagaag 480

agacagctct atagcgccct ggccaacaag tgctgtcatg tgggatgcac caagagaagc 540

600

660

atcacgtgcc gcgccagccg gcccatcggc acaatgctgt cctggtacca gcagaagccc 720

gggaaggcgc ccaagctgct gatcctggcg ttctcccggc tgcagtccgg cgtgcccagc 780

aggttcagcg gctcaggctc cggtaccgac ttcaccctga ctataagcag cctgcagccg 840

gaggattttg ccacctacta ctgcgcccag gccggcaccc acccaaccac cttcggccag 900

ggcaccaagg tggagatcaa gcgg 924

<210> 310

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 310

atgcccaggc tgttcttctt ccacctcctc ggcgtgtgcc tcctcctcaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagca agcggagcct gagccaggag 180

gacgccccgc agactccgcg gccagtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgaaacca tcaacatgat gagcgagttc gtggccaacc tgccccagga gctgaagctg 300

accctgagcg agatgcagcc cgctctgccg cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggagttcaag aagctgatcc ggaaccggca gagcgaggcc 420

gcagattctt ctcctagcga gctcaagtac ctgggcctgg acacccacag ccggaagaag 480

cggcagctgt acagcgccct ggccaacaag tgctgccacg tgggctgcac caagaggtca 540

ctggcccggt tctgcggcgg cggtggatct ggcggaggag gctcgggagg cggcggcagc 600

660

atcacctgcc gggccagccg gcccatcggc accatgctga gctggtacca gcagaagccc 720

ggcaaggccc cgaagctgct gatcctggcc ttctctaggc tgcagagcgg cgtgccgagc 780

cggttctcgg gcagcggctc cggcaccgac ttcaccctga ctatctcgag cctccagccg 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tggagatcaa gcgg 924

<210> 311

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 311

atgcccaggc tgttcttctt ccacctcctc ggcgtgtgcc tcctcctaaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagca agcggagcct gagccaggag 180

gacgcccctc agacgccacg gccggtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgagacaa tcaacatgat gagcgagttc gtggccaacc tgccccagga gctgaagctg 300

accctgagcg agatgcagcc cgccctgccg cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggagttcaag aagctgatcc ggaaccggca gagcgaggcc 420

gccgactcca gccccagcga attgaagtac ctgggcctgg acacccacag cgggaagaag 480

cggcagctgt acagcgccct ggccaacaag tgctgccacg tgggctgcac caagaggagt 540

ctggcccggt tctgcggcgg aggcggaagc ggtggaggcg gctctggcgg cggtggctcg 600

660

atcacctgcc gggccagccg gcccatcggc accatgctga gctggtacca gcagaagccc 720

ggcaaggccc cgaagctgct gatcctggcc ttcagcaggc tgcagagcgg cgtgccgagc 780

cggttcagcg gtagcggctc cggcaccgac ttcaccctga caatcagctc gctgcagcca 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tggagatcaa gcgg 924

<210> 312

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 312

atgccgac tgttcttctt ccacctcttg ggcgtgtgcc tcctcctcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtcca agcgctccct ctcccaggag 180

gacgctccgc agaccccgcg ccccgtcgcc gagatcgtcc cctccttcat caacaaggac 240

accgagacga tcaacatgat gtccgagttc gtcgccaacc tcccacagga gctcaagctc 300

accctctccg agatgcagcc cgccctgccg cagctccagc agcacgtccc cgtcctcaag 360

gactcctccc tcctcttcga ggagttcaag aagctcatcc gcaaccgcca gtccgaggcc 420

gcggacagca gcccgtccga gctgaagtac ctcggcctcg acacccactc cgcaagaag 480

cgccagctct actccgccct cgccaacaag tgctgccacg tcggctgcac caagaggagc 540

ctggcccgct tctgcggcgg aggcggcagc ggcggcggtg gatccggtgg cggcggaagc 600

660

atcacctgcc gcgcctcccg ccccatcggc accatgctct cctggtacca gcagaagccc 720

ggcaaggccc ctaagctcct catcctcgcc ttctcccgcc tccagtccgg cgtgccgagc 780

cggttctccg gaagcggctc gggcaccgac ttcaccctca ccatctcctc actccagccg 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tcgagatcaa gcgc 924

<210> 313

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 313

atgccgac tgttcttctt ccacctcctc ggcgtgtgcc tcctcctcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtcca agcgctccct ctcccaggag 180

gacgccccgc agacgccgcg ccccgtcgcc gagatcgtcc cctccttcat caacaaggac 240

accgagacaa tcaacatgat gtccgagttc gtcgccaacc tgccgcagga gctcaagctc 300

accctctccg agatgcagcc cgccctgccg caactccagc agcacgtccc cgtcctcaag 360

gactcctccc tcctcttcga ggagttcaag aagctcatcc gcaaccgcca gtccgaggcc 420

gccgactcca gcccctccga gctgaagtac ctcggcctcg acacccactc ccgcaagaag 480

cgccagctct actccgccct cgccaacaag tgctgccacg tcggctgcac caagcggagc 540

ctggcccgct tctgcggcgg tggcggaagc ggaggcggag gcagcggcgg aggtggctcc 600

660

atcacctgcc gcgcctcccg ccccatcggc accatgctct cctggtacca gcagaagccc 720

ggcaaggccc cgaagctcct catcctcgcc ttctcccgcc tccagtccgg cgtgccgtcc 780

cggttcagcg gctccggcag cggaaccgac ttcaccctga cgatcagctc cctgcagcct 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tcgagatcaa gcgc 924

<210> 314

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 314

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

120

cgggcccaga tcgccatctg cggcatgagc acctggagca agcggagcct gagccaggag 180

gacgcacccc agaccccg gcccgtggcc gagatcgtgc ccagcttcat caacaaggac 240

accgagacca tcaacatgat gagcgagttc gtggccaacc tgccccagga gctgaagctg 300

accctgagcg agatgcagcc cgccctgccc cagctgcagc agcacgtgcc cgtgctgaag 360

gacagcagcc tgctgttcga ggagttcaag aagctgatcc ggaaccggca gagcgaggcc 420

gccgacagca gccccagcga gctgaagtac ctgggcctgg acacccacag cgggaagaag 480

cggcagctgt acagcgccct ggccaacaag tgctgccacg tgggctgcac caagcggagc 540

ctggcccggt tctgcggcgg cggcggcagc ggcggcggcg gcagcggcgg cggcggcagc 600

660

atcacctgcc gggccagccg gcccatcggc accatgctga gctggtacca gcagaagccc 720

ggcaaggccc ccaagctgct gatcctggcc ttcagccggc tgcagagcgg cgtgcccagc 780

cggttcagcg gcagcggcag cggcaccgac ttcaccctga ccatcagcag cctgcagccc 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tggagatcaa gcgg 924

<210> 315

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 315

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

120

agggcgcaga tcgcgatctg cgggatgagc acgtggagca agaggagcct gagccaggag 180

gacgcgccgc agacgccgag gccggtggcg gagatcgtgc cgagcttcat caacaaggac 240

acggagacga tcaacatgat gagcgagttc gtggcgaacc tgccgcagga gctgaagctg 300

acgctgagcg agatgcagcc ggcgctgccg cagctgcagc agcacgtgcc ggtgctgaag 360

gacagcagcc tgctgttcga ggagttcaag aagctgatca ggaacaggca gagcgaggcg 420

gcggacagca gcccgagcga gctgaagtac ctggggctgg acacgcacag caggaagaag 480

aggcagctgt acagcgcgct ggcgaacaag tgctgccacg tggggtgcac gaagaggagc 540

ctggcgaggt tctgcggagg cggtgggagc ggtggcggag ggagcggcgg aggcgggagc 600

gacatccaga tgacgcagag cccgagcagc ctgagcgcga gcgtggggga cagggtgacg 660

atcacgtgca gggcgagcag gccgatcggg acgatgctga gctggtacca gcagaagccg 720

gggaaggcgc cgaagctgct gatcctggcg ttcagcaggc tgcagagcgg ggtgccgagc 780

aggttcagcg ggagcgggag cgggacggac ttcacgctga cgatcagcag cctgcagccg 840

gaggacttcg cgacgtacta ctgcgcgcag gcggggacgc acccgacgac gttcgggcag 900

gggacgaagg tggagatcaa gagg 924

<210> 316

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 316

atgccccggc tgttcttctt ccacctgctg ggcgtgtgcc tgctgctgaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtcca agcgctccct ctcccaggag 180

gacgcacccc agacaccccg ccccgtcgcc gagatcgtcc cctccttcat caacaaggac 240

accgagacca tcaacatgat gtccgagttc gtcgccaacc tcccccagga gctcaagctc 300

accctctccg agatgcagcc cgccctcccc cagctccagc agcacgtccc cgtcctcaag 360

gactcctccc tcctcttcga ggagttcaag aagctcatcc gcaaccgcca gtccgaggcc 420

gccgactcct ccccctccga gctcaagtac ctcggcctcg acacccactc ccgcaagaag 480

cgccagctct actccgccct cgccaacaag tgctgccacg tcggctgcac caagcgctcc 540

ctcgcccgct tctgcggcgg cggcggctcc ggcggcggcg gctccggcgg cggcggctcc 600

gacatccaga tgacccagtc cccctcctcc ctctccgcct ccgtcggcga ccgcgtcacc 660

atcacctgcc gcgcctcccg ccccatcggc accatgctct cctggtacca gcagaagccc 720

ggcaaggccc ccaagctcct catcctcgcc ttctcccgcc tccagtccgg cgtcccctcc 780

cgcttctccg gctccggctc cggcaccgac ttcaccctca ccatctcctc cctccagccc 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tcgagatcaa gcgc 924

<210> 317

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 317

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agacaactct acagtgcatt ggctaataaa tgttgccatg ttggttgtac caaaagatct 540

cttgctagat tttgcggtgg cggaggcagc ggaggtggtg gcagcggcgg aggtggcagc 600

gacatccaga tgacccagag ccccagcagc ctgagcgcca gcgtgggcga cagggtgacc 660

atcacctgca gggccagcag gcccatcggc accatgctga gctggtacca gcagaagccc 720

ggcaaggccc ccaagctgct gatcctggcc ttcagcaggc tgcagagcgg cgtgcccagc 780

aggttcagcg gcagcggcag cggcaccgac ttcaccctga ccatcagcag cctgcagccc 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tggagatcaa gagg 924

<210> 318

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 318

atgcctcgcc tgtttttttt ccacctgcta ggagtctgtt tactactgaa ccaattttcc 60

agagcagtcg cggactcatg gatggaggaa gttattaaat tatgcggccg cgaattagtt 120

cgcgcgcaga ttgccatttg cggcatgagc acctggagca aaaggtctct gagccaggaa 180

gatgctcctc agacacctag accagtggca gaaattgtgc catccttcat caacaaagat 240

acagaaacca taaatatgat gtcagaattt gttgctaatt tgccacagga gctgaagtta 300

accctgtctg agatgcagcc agcattacca cagctacaac aacatgtacc tgtattaaaa 360

gattccagtc ttctctttga agaatttaag aaacttattc gcaatagaca aagtgaagcc 420

gcagacagca gtccttcaga attaaaatac ttaggcttgg atactcattc tcgaaaaaag 480

agacaactct acagtgcatt ggctaataaa tgttgccatg ttggttgtac caaaagatct 540

cttgctagat tttgcggtgg cggaggcagc ggaggtggtg gcagcggcgg aggtggcagc 600

gacatccaga tgacccagag ccccagcagc ctgagcgcca gcgtgggcga cagggtgacc 660

atcacctgca gggccagcag gcccatcggc accatgctga gctggtacca gcagaagccc 720

ggcaaggccc ccaagctgct gatcctggcc ttcagcaggc tgcagagcgg cgtgcccagc 780

aggttcagcg gcagcggcag cggcaccgac ttcaccctga ccatcagcag cctgcagccc 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tggagatcaa gagg 924

<210> 319

<211> 924

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 319

atgccccgcc tgttcttctt ccacctcctt ggcgtgtgcc tcctcctcaa ccagttcagc 60

cgggccgtgg ccgacagctg gatggaggag gtcatcaagc tctgcggccg cgagctcgtc 120

cgcgcccaga tcgccatctg cggcatgtcc acctggtcca agcgctccct ctcccaggag 180

gacgccccac agaccccgcg ccccgtcgcc gagatcgtcc cctccttcat caacaaggac 240

accgagacga tcaacatgat gtccgagttc gtcgccaacc tgccgcagga gctcaagctc 300

accctctccg agatgcagcc cgccctcccg cagctccagc agcacgtccc cgtcctcaag 360

gactcctccc tcctcttcga ggagttcaag aagctcatcc gcaaccgcca gtccgaggcc 420

gccgactcca gcccctccga gctgaagtac ctcggcctcg acacccactc ccgcaagaag 480

cgccagctct actccgccct cgccaacaag tgctgccacg tcggctgcac caagcggtcc 540

ctggcccgct tctgcgggagg cggcggctct ggcggtggtg gatccggcgg cggtggcagc 600

gacatccaga tgacccagtc cccatccagc ctgagcgcct ccgtcggcga ccgcgtcacc 660

atcacctgcc gcgcctcccg ccccatcggc accatgctct cctggtacca gcagaagccc 720

ggcaaggccc cgaagctcct catcctcgcc ttctcccgcc tccagtccgg cgtcccgtca 780

aggttctccg gctcgggctc cggtaccgac ttcaccctca ccatctcctc gctccagcca 840

gaggacttcg ccacctacta ctgcgcccag gccggcaccc accccaccac cttcggccag 900

ggcaccaagg tcgagatcaa gcgc 924

<210> 320

<211> 92

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 320

tcaagctttt ggaccctcgt acagaagcta atacgactca ctatagggaa ataagagaga 60

aaagaaggt aagaagaaat ataaagcca cc 92

<210> 321

<211> 164

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 321

tgataatagt ccataaagta ggaaacacta cagctggagc ctcggtggcc atgcttcttg 60

ccccttgggc ctccccccag ccctcctcc ccttcctgca cccgtacccc ccgcattatt 120

actcacggta cgagtggtct ttgaataaag tctgagtggg cggc 164

<210> 322

<211> 119

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 322

tgataatagg ctggagcctc ggtggccatg cttcttgccc cttgggcctc cccccagccc 60

ctcctcccct tcctgcaccc gtacccccgt ggtctttgaa taaagtctga gtgggcggc 119

<210> 323

<211> 141

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 323

tgataatagg ctggagcctc ggtggccatg cttcttgccc cttgggcctc cccccagccc 60

ctcctcccct tcctgcaccc gtaccccccg cattattact cacggtacga gtggtctttg 120

aataaagtct gagtgggcgg c 141

<210> 324

<211> 142

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 324

tgataatagg ctggagcctc ggtggccatg cttcttgccc cttgggcctc cccccagccc 60

ctcctcccct tcctgcaccc gtaccccctc cataaagtag gaaacactac agtggtcttt 120

gaataaagtc tgagtgggcg gc 142

<210> 325

<211> 829

<212> DNA

<213> Homo sapiens

<400> 325

gtcccgacct ccaggagaga ccaggcccag gatgcctcgc ctgttttttt tccacctgct 60

aggagtctgt ttactactga accaattttc cagagcagtc gcggactcat ggatggagga 120

agttattaaa ttatgcggcc gcgaattagt tcgcgcgcag attgccattt gcggcatgag 180

cacctggagc aaaaggtctc tgagccagga agatgctcct cagacaccta gaccagtggc 240

agaaattgtg ccatccttca tcaacaaaga tacagaaacc ataaatatga tgtcagaatt 300

tgttgctaat ttgccacagg agctgaagtt aaccctgtct gagatgcagc cagcattacc 360

acagctacaa caacatgtac ctgtattaaa agattccagt cttctctttg aagaatttaa 420

gaaacttatt cgcaatagac aaagtgaagc cgcagacagc agtccttcag aattaaaata 480

cttaggcttg gatactcatt ctcgaaaaaa gagacaactc tacagtgcat tggctaataa 540

atgttgccat gttggttgta ccaaaagatc tcttgctaga ttttgctgag atgaagctaa 600

ttgtgcacat ctcgtataat attcacacat attcttaatg acatttcact gatgcttcta 660

tcaggtccca tcaattctta gaatatctaa gaatctttgt tagatattag gtcccatcaa 720

ttcttagaat atctaaacat ctttgttgat gtttagattt ttttatttga tgtgtaagaa 780

aatgttcttt gtgtgattaa atgacacatt ttttgctga aaaaaaaaa 829

<210> 326

<211> 930

<212> DNA

<213> Homo sapiens

<400> 326

gtcccgacct ccaggagaga ccaggcccag gatgcctcgc ctgttttttt tccacctgct 60

aggagtctgt ttactactga accaattttc cagagcagtc gcggactcat ggatggagga 120

agttattaaa ttatgcggcc gcgaattagt tcgcgcgcag attgccattt gcggcatgag 180

cacctggagc aaaaggtctc tgagccagga agatgctcct cagacaccta gaccagtggc 240

aggtgatttt attcaaacag tctcactggg aatctcaccg gacggaggga aagcactgag 300

aacaggaagc tgcttcaccc gagagttcct tggtgccctt tccaaattgt gccatccttc 360

atcaacaaag atacagaaac cataaatatg atgtcagaat ttgttgctaa tttgccacag 420

gagctgaagt taaccctgtc tgagatgcag ccagcattac cacagctaca acaacatgta 480

cctgtattaa aagattccag tcttctcttt gaagaattta agaaacttat tcgcaataga 540

caaagtgaag ccgcagacag cagtccttca gaattaaaat acttaggctt ggatactcat 600

tctcgaaaaa agagacaact ctacagtgca ttggctaata aatgttgcca tgttggttgt 660

accaaaagat ctcttgctag attttgctga gatgaagcta attgtgcaca tctcgtataa 720

tattcacaca tattcttaat gacatttcac tgatgcttct atcaggtccc atcaattctt 780

agaatatcta agaatctttg ttagatatta ggtcccatca attcttagaa tatctaaaca 840

tctttgttga tgtttagatt tttttatttg atgtgtaaga aaatgttctt tgtgtgatta 900

aatgacacat ttttttgctg aaaaaaaaaa 930

<210> 327

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 327

augcccagac uguucuucuu ccaccuccuc ggcgugugcc uccuccuuaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc uaugcggccg ggagcucgug 120

cgggcccaga ucgccaucug cggcaugagc accuggagca agcggagccu gagccaggag 180

gacgccccuc agaccccgcg gccaguggcc gagaucgugc ccagcuucau caacaaggac 240

accgagacaa ucaacaugau gagcgaguuc guggccaacc ugccccagga gcugaagcug 300

acccugagcg agaugcagcc cgccugccg cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaguucaag aagcugaucc ggaaccggca gagcgaggcc 420

gccgacucca gccccagcga acugaaguac cugggccugg acacccacag cgggaagaag 480

cggcagcugu acagcgcccu ggccaacaag ugcugccacg ugggcugcac caagcgaucc 540

600

gacauccaga ugacccagag cccaagcucc cuguccgcca gcgugggcga ccgggugacc 660

aucaccugcc gggccagccg gcccaucggc accaugcuga gcugguacca gcagaagccc 720

ggcaaggccc cgaagcugcu gauccuggcc uucuccaggc ugcagagcgg cgugccgagc 780

840 cgguucagcg gcuccggcag cggaaccgac

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg uggagaucaa gcgg 924

<210> 328

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 328

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agacaacucu acagugcauu ggcuaauaaa uguugccaug uugguuguac caaaagaucu 540

cuugcuagau uuugc 555

<210> 329

<211> 519

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 329

60

agagcggucg ccgauucuug gauggaggaa gugauaaagc ucugugggcg ggaauuaguc 120

cgcgcacaaa uugccauaug cggaaugggu gggggcggua guggcggagg agguuccggg 180

ggaggaggga gcggcgggagg aggcucaggc ggcggaggaa gugguggcgg uggcucaggu 240

ggcgggaggau cuggggggcgg cggaagcggc ggaggaggau cuggggggcgg uggaaguggc 300

ggaggugggu cuggcgggg agggaguggc gggggcgguu ccgggggugg aggcagcggga 360

ggcgguggcu ccgggggggg ugguuccggu gguggcgggu caggaggagg ggggucaggc 420

ggcgggaggau ccggcggcgg cggcucccaa cuuuauucgg cucuggcuaa uaaaugcugu 480

cacgugggcu gcaccaaacg uucgcuugcg cgguuuugu 519

<210> 330

<211> 519

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 330

augccucgac uguuuuucuu ucaccuccua ggagucugcu uacuucucaa ccaguucagu 60

agggcagucg cggacucaug gauggaagag guuauuaaau uauguggccg ugaauuggug 120

cgugcacaaa uagcuauuug cggcaugggc gguggcggcu cugguggcgg cggcucugga 180

gggggcggaa gugguggagg agguaguggc ggagguggau cgggaggcgg aggaucugga 240

ggggggggcu ccuuucaaag cucucgagc aaagcgcccc cucccagccu gcccagcccu 300

aguaggcugc ccgguccgag cgacacgccc auccugcccc aggguggcgg uggcucuggg 360

gguggcgguu caggcgggagg ugguucuggc ggaggcggau cagguggugg gggauccggc 420

ggcggcggau cugguggcgg ggggagucag cucuacucug cguuggccaa uaaaugcugc 480

cauguugguu guacaaaaag aucuuuggcu agauuuugc 519

<210> 331

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 331

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcauggag cccaaggca gcgacaagac ccacaccagc 180

ccccccagcc ccgcccccga gcugcugggc ggcagcagcg uguuccuguu cccccccaag 240

cccaaggaca cccuguacau caccagggag cccgagguga ccugcguggu gguggacgug 300

agccacgagg accccgaggu gaaguucaac ugguacgugg acggcgugga ggugcacaac 360

gccaagacca agcccaggga ggagcaguac aacagcaccu acaggguggu gagcgugcug 420

accgugcugc accggacug gcugaacggc aaggaguaca agugcaaggu gagcaacaag 480

gcccugcccg cccccaucga gaagaccauc agcaaggcca agggccagcc cagggagccc 540

cagguguaca cccugccccc cagcagggac gagcugacca agaaccaggu gagccugacc 600

ugccgguga agggcuucua ccccagcgac aucgccgugg agugggagag caacggccag 660

cccgagaaca acuacagac cacccccccc gugcuggaca gcgacggcag cuucuuccug 720

uacagcaagc ugaccgugga caagagcagg uggcagcagg gcaacguguu cagcugcagc 780

gugaugcacg aggccugca caaccacuac acccagaaga gccugagccu gagccccggc 840

aagaggaaga gcaccuggag caaaaggucu cugagccagg aagaugcucc ucagacaccu 900

agaccagugg cagaaauugu gccauccuuc aucaacaaag auacagaaac cauaaauuug 960

augucagaau uuguugcuaa uuugccacag

1080

gaagaauuua agaaacuuau ucgcaauaga caaagugaag ccgcagacag caguccuuca 1140

gaauuaaaau acuuaggcuu ggauacucau ucucgaaaaa agagacaacu cuacagugca 1200

uuggcuaua aauguugcca uguugguugu accaaaagau cucuugcuag auuuugc 1257

<210> 332

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 332

augcccaggc uguucuucuu ccaccugcug ggagugugcc uccugcugaa ccaguucagc

cgcgccgugg ccgacagcug gauggaggag gugaucaagc ugugcgggag ggagcugguc

cgagcccaaa ucgccaucug cgggaugucc accuggagca agagaagccu gucccaggag 180

gaugcccccc aaacgcccag gcccguggcc gagaucgugc ccagcuucau caacaaggac 240

accgagacca ucaacaugau guccgaguuc guggccaacc ugccccagga gcugaagcug 300

acccuguccg agaugcagcc agcccucccc cagcugcagc agcacgugcc cguguugaag 360

gacagcagcc ugcuguucga ggaguucaaa aagcugauac gcaacaggca gagcgaggcg 420

gccgacagcu ccccgucgga gcugaaguac cuggggcugg acacccacag ccggaagaag 480

cggcagcugu acagcgcacu ggccaacaaa uguugccacg ugggcugcac caagaggagc 540

cuggccaggu ucugc 555

<210> 333

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 333

60

agggccgugg ccgacagcug gauggaggag gugaucaagc ugugcggcag ggagcucgug 120

cgagcgcaga ucgccaucug cggcaugagc accuggagua agaggagccu cucccaggag 180

gacgcccccc agacgccacg cccgguggcg gagaucgugc ccuccuucau caacaaggac 240

acagagacca ucaacaugau gagcgaguuu guggccaacc ugccccagga acuuaagcug 300

acccucagcg agaugcagcc ggcccuuccc cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaguucaaa aagcugaucc gcaauaggca gagcgaggcc 420

gccgacucca gccccagcga gcugaaguau cugggccugg acacccacag caggaagaaa 480

cggcagcugu acagcgcgcu ggcgaacaag ugcugccacg ugggcugcac caagaggucg 540

cucgccaggu ucugc 555

<210> 334

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 334

60

cgcgccgugg ccgacagcug gauggaggag gucauaaagc ugugcgggag ggaacuggug 120

agggcccaga ucgccaucug cggaaugucc accuggagca agaggagccu gagccaggag 180

gacgccccac agacuccgcg gccgguugcg gagaucgugc ccuccuucau cauaaagau 240

accgagacca ucaacaugau guccgaguuc guggccaacc ugccgcagga gcugaaacuc 300

acccucagcg agaugcagcc cgcgcugccc cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguuuga agaauucaaa aaacugaucc ggaaccgaca gagcgaggcc 420

gccgacucca gccccagcga acugaaguac cuggggcugg acacccacag cgggaaaaag 480

cggcagcugu acagcgcacu ggccaauaag uguugccacg ucggcugcac gaagcggucc 540

cuugcccgcu ucugc 555

<210> 335

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 335

augccccgcc uguucuucuu ucaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

agggccgugg ccgacagcug gauggaagag gugaucaagc ucugcggcag ggaacuggug 120

agggcccaga ucgccaucug cggcaugucc accuggucca aaaggagccu cagccaggag 180

gacgcccccc agaccccccg gccaguggcc gagaucgugc ccuccuucau caacaaggac 240

accgagacua ucaacaugau guccgaguuc guggccaacc ugccccagga gcugaagcug 300

acccugagcg aaaugcagcc cgcgcugccc cagcugcaac agcacgugcc cgugcugaag 360

gacagcagcc ugcuguuuga ggaguucaag aagcugaucc gcaacaggca gagcgaggcc 420

gccgacucca gccccagcga acugaaauau cuggggcugg acacccacuc cgggaagaag 480

aggcagcugu acagcgcccu ggccaacaaa ugcugccacg uggggugcac gaagcggucc 540

cuggcccgcu uuugc 555

<210> 336

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 336

augcccaggc uguuuuucuu ccaccuccug ggcgugugcc ugcugcugaa ucaguuuucc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc uguguggccg ggagcugguu 120

cgggcccaga uagccaucug uggaaugagc accuggagca agcggagccu gucccaggag 180

gacgcccccc agacaccccg gccgguggcc gaaaucgucc ccagcuucau caacaaggac 240

accgagacca ucaacaugau gagcgaguuc guggccaacc ugccccagga gcugaagcug 300

acgcugagcg agaugcagcc ugccugccc cagcugcaac

gacagcagcc uccuguucga ggaguucaag aagcucauca ggaaccggca gagcgaggcc 420

gcugacagcu cacccagcga gcugaaguac cugggccugg acacccacuc gaggaagaag 480

cggcagcugu acagcgcgcu ggccaacaag uguugccaug ugggcuguac caagaggagc 540

cuggccaggu ucugc 555

<210> 337

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 337

augccccgac uguucuuuuu ccaccugcug ggggugugcc ugcugcugaa ccaguuuucg 60

agggcggugg cggacaguug gauggaggag gucaucaagc ucugcgggag ggagcucguc 120

agggcccaga ucgccaucug cggcaugucc accuggagca agcguucgcu gucccaggag 180

gacgcccccc agaccccgag acccguggcc gagaucgugc ccagcuucau caacaaggau 240

accgaaacca ucaacaugau gagcgaguuu guggccaacc ucccgcagga gcucaagcuc 300

acgcugagcg agaugcagcc ggccugccc cagcugcagc agcauguccc cguccugaag 360

gacagcagcc ugcuguucga ggaguucaag aaacugaucc ggaaccggca gagcgaggcc 420

gccgauagca gccccagcga gcugaaguac cuggggcugg acacccacag ucgcaagaag 480

cggcagcugu acagcgcccu ggccaacaag uguugccacg ucggguguac gaagcgcucc 540

cuggccagau ucugc 555

<210> 338

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 338

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

cgagccgucg cagauuccug gauggaggag gugaucaagc ugugcggccg ggagcucgug 120

agggcccaga ucgccauuug cggcaugucc accuggagca agcggagccu gagccaggag 180

gacgcgccgc agacuccccg gcccguggcc gaaaucgugc ccuccuucau cauaaggac 240

accgaaacca uaaacaugau gagcgaguuu guggccaacc ugccacagga gcugaaacug 300

acgcugagcg agaugcagcc cgcgcugccc cagcugcagc agcaugugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaauuuaag aagcuaaucc ggaacaggca gagcgaggcc 420

gccgacagcu ccccgagcga gcugaaguac cucgggcugg acacccacag ccggaagaag 480

cggcaacugu acagcgcccu ggcgaacaag ugcugccacg ugggcuguac caaaagaagc 540

ucugc 555

<210> 339

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 339

augccuagc ucuucuucuu ccaccugcug ggcgucugcc ugcugcugaa ccaauucagc 60

120

agggcccaaa ucgcgaucug cggcaugucc accuggagca agcggagccu gucgcaggaa 180

gaugcccccc agacccccag gccgguggcc gagaucgucc ccagcuucau caacaaggau 240

accgagacca uaaacaugau gagcgaguuu guggccaacc ucccccagga gcugaagcug 300

acccucagcg agaugcagcc cgcccugccg cagcugcaac agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga agaguucaag aagcugaucc ggaaccggca gagcgaggcc 420

gccgacagcu cccccuccga gcugaaguac cugggccugg acacgcacag ccggaagaag 480

cggcagcugu acagcgcacu ggccaacaag ugcugucacg ucggcugcac caagcguagc 540

cuggccagau ucugc 555

<210> 340

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 340

augcccaggc uguucuucuu ccaccugcug ggcgugugcc ugcugcucaa ccaguucagc 60

agggccgugg ccgacagcug gauggaggag gugaucaaac ugugcgggag ggagcuggug 120

agggcgcaga ucgccaucug cggcaugagc accuggagca agaggagccu cagccaggag 180

240

accgaaacca ucaacaugau gagcgaguuc guggccaacc ugccccagga gcucaagcug 300

acccucagcg agaugcaacc cgcccugccc cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaguucaag aagcugaucc guaacaggca gagcgaggcc 420

gccgacucca gccccagcga gcugaaguac cugggccugg acacccacuc cgggaagaag 480

aggcagcugu acagugcgcu ggccaacaaa uguugccaug ugggcugcac caagcggagc 540

cuggccgcu ucugc 555

<210> 341

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 341

augcccaggc uguucuuuuu ccaccugcug ggggucugcc uccugcugaa ccaguucucc 60

agggcggucg ccgacagcug gauggaagag gucaucaagc ugugcgggag ggagcugguc 120

agggcccaga ucgccaucug uggcaugucc accuggagca agaggagccu gagccaggag 180

gacgcgccgc agacgccccg ucccguggcg gagauagugc cgagcuucau caacaaggac 240

accgagacua ucaacaugau gagcgaguuc guggccaacc ucccucagga gcugaagcug 300

acccugagcg agaugcagcc cgcccucccc cagcugcaac agcacgugcc cgugcugaag 360

gacagcagcc uccuguucga ggaguucaag aagcugaucc ggaauaggca gagcgaggcc 420

gccgauagcu cgcccagcga gcuuaaguac cugggccucg acacacacag caggaagaag 480

aggcagcugu acagcgcccu ggccaacaag uguugccacg ucggcugcac uaagcggagc 540

cucgcuaggu ucugc 555

<210> 342

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 342

augccccgac uguucuucuu ccaucugcug ggcgugugcc uccugcugaa ucaauucagc

agggccgugg ccgacuccug gauggaggag gucaucaagc ugugcggcag ggaacuggug 120

agggcgcaga ucgccaucug cggcaugucc acuuggagca agaggucgcu gucgcaggag 180

gacgcccccc agaccccgag gcccguggcc gagaucgugc ccagcuucau caacaaggac 240

accgagacca ucaauauugau guccgaguuc guggccaacc ucccucagga gcugaagcug 300

acccuguccg agaugcagcc cgcccugccg cagcuucagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaauucaag aagcugauua ggaacaggca aagcgaggcc 420

gccgacucca gcccgagcga gcugaaguac cugggccucg acacccauag ccgcaagaag 480

cggcagcugu acucggcccu ggcgaacaag ugcugccacg ugggcugcac caagcgcagc 540

cuggcgcgcu ucugc 555

<210> 343

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 343

augcccaggc uguuuuucuu ccaccugcug ggggucugcc ugcugcugaa ccaguuuagc 60

agggccgugg ccgacagcug gauggaggag gugaucaagc ugugcggcag ggagcuggug 120

cgggcccaga ucgccaucug cggcaugagc accuggagca agcggucccu gagccaggag 180

gacgcccccc agacuccccg gccgguggcc gaaaucgugc ccagcuucau caacaaggac 240

accgagacca ucaauauugau guccgaguuc guggccaacc ugccccagga gcugaaacug 300

accugagcg agaugcagcc cgccugccc cagcugcagc agcauguccc cgugcugaag 360

gacagcagcc uguuguuuga ggaguucaaa aaacugaucc gaaacaggca gucggaggcc 420

gcugacagcu cgccaagcga gcugaaguau cuggggcugg acacccacag ccgcaagaag 480

aggcagcugu auagcgcgcu ggccaacaag ugcugccacg ugggcugcac gaagaggucc 540

cuggccaggu ucugc 555

<210> 344

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 344

augcccaggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc

agggccgugg ccgacagcug gauggaggag gugaucaagc ugugcggccg ggagcucgug 120

agggcccaga ucgcgaucug cggcaugagc accuggagca aaaggagucu gagccaggag 180

gacgcgccgc agacgcccag gcccgucgcc gagaucgugc cguccuucau caacaaggac 240

accgagacca ucaauauugau gagcgaguuc guggccaacc ugccccagga gcucaagcug 300

acccugagcg agaugcagcc cgcgcugccc cagcugcagc agcacgugcc cgugcugaag 360

gacuccagcc ugcuguucga ggaguucaag aaacugauca gaaacaggca gagcgaggcc 420

gccgacucca gccccucaga gcugaaguac cugggccugg acacccacag caggaagaag 480

cgccagcucu acagcgcccu ggccaacaag ugcugccacg ucgggugcac aaagaggagc 540

cuggccaggu ucugc 555

<210> 345

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 345

augccccggc uguucuucuu ccaccugcug ggcgugugcc uccugcugaa ccaguucagc 60

agggccgugg ccgacagcug gauggaggag gugaucaagc ugugcggcag ggagcuggug 120

agggcgcaga ucgccaucug cggcaugagc accuggagca agaggagccu gagccaggag 180

240

accgagacca ucaauauugau gagcgaguuc guggccaacc ugccccagga gcugaagcug 300

acgcugagcg agaugcagcc ggcccugccg cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc uccuguucga ggaguucaag aagcugauca ggaaccggca gagcgaggcc 420

gccgacucca gccccagcga gcugaaguac cugggccugg acacccauag caggaagaag 480

cgccagcugu acagcgcccu ggcuaacaag ugcugccacg ugggcugcac caagaggagc 540

cuggccggu ucugc 555

<210> 346

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 346

augccccggc uguucuucuu ccaccugcuc ggcgugugcc ugcugcugaa ccaauucagc 60

cgggccgucg ccgacagcug gauggaggag gugaucaagc ugugcggcag ggagcugguc 120

agggcccaga ucgccaucug ugggaugucg accuggucca agcgcagccu gagccaggag 180

gacgccccgc agaccccaag acccguggcc gagaucgugc ccagcuucau caacaaagau 240

accgagacca ucaacaugau gagcgaguuc guggccaacc ucccccagga gcugaagcug 300

acccucagcg agaugcagcc cgcgcugccc cagcugcagc agcacgugcc cgugcugaag 360

gacagcuccc ugcuguucga ggaguucaag aagcugaucc ggaacaggca guccgaggcc 420

gccgacagca gcccgagcga gcugaaguac cuggggcugg acacccacag caggaagaag 480

cggcagcugu acagcgcccu ggccaacaag ugcugccacg ugggcuguac caaacgcagc 540

cucgccaggu ucugc 555

<210> 347

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 347

augcccaggc uguucuucuu ccaccugcug ggggucuguc uccugcugaa ccaguucagc

cgggccgugg ccgacuccug gauggaggag gugaucaagc ugugcgggcg ggagcuggug

cgggcgcaga ucgccaucug cggcauguca accuggucca aaaggucccu cagccaggaa 180

240

accgacca uccaacaugau gagcgaguuu guggccaacc ucccccagga gcugaagcug 300

acccugagcg agaugcagcc cgcgcugccc caacugcagc agcacgugcc ggugcugaag 360

gacucgagcc ugcuguucga ggaguucaag aagcucauca ggaacaggca gagcgaggcc 420

gccgauucga gccccagcga gcucaaguac cuggggcugg acacucacag cgggaagaag 480

cggcagcugu acagcgcccu ggcgaacaag uguugccacg ugggcugcac caagaggagc 540

cuggccaggu ucugu 555

<210> 348

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 348

augcccaggc uguucuuuuu ccaccuccug gggguguguc ugcuccugaa ccaguucagc 60

agggccgugg ccgauuccug gauggaggag gucaucaagc uguguggaag ggagcuggug 120

agggcccaga ucgccaucug cgggaugucc accuggagca agcggagccu gucccaggag 180

gacgccccgc agacccccag gccgguggcg gagaucgucc ccagcuucau caacaaggac 240

accgagacca ucaacaugau gagcgaguuc guggccaacc ugcccgga acugaagcuc 300

accugagug agaugcagcc cgccugccc cagcugcagc agcaugugcc cgugcugaag 360

gacagcagcc ugcucuucga ggaguucaag aagcugauca ggaacaggca gagcgaggcc 420

gccgacagcu cccccuccga gcugaaguac cuuggacugg acacccacag cgggaagaag 480

cggcaacugu acuccgcccu ggccaacaag ugcugccacg ugggcuguac gaagaggagc 540

cuggccaggu ucugc 555

<210> 349

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 349

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ugugcggccg ggagcuggug 120

cgggcccaga ucgccaucug cggcaugagc accuggagca agcggagccu gagccaggag 180

gacgcccccc agaccccccg gcccguggcc gagaucgugc ccagcuucau caacaaggac 240

accgagacca ucaacaugau gagcgaguuc guggccaacc ugccccagga gcugaagcug 300

acccugagcg agaugcagcc cgccugccc cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaguucaag aagcugaucc ggaaccggca gagcgaggcc 420

gccgacagca gccccagcga gcugaaguac cugggccugg acacccacag cgggaagaag 480

cggcagcugu acagcgcccu ggccaacaag ugcugccacg ugggcugcac caagcggagc 540

cuggccggu ucugc 555

<210> 350

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 350

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

120

agggcgcaga ucgcgaucug cgggaugagc acguggagca agaggagccu gagccaggag 180

gacgcgccgc agacgccgag gccgguggcg gagaucgugc cgagcuucau caacaaggac 240

acggagacga ucaacaugau gagcgaguuc guggcgaacc ugccgcagga gcugaagcug 300

acgcugagcg agaugcagcc ggcgcugccg cagcugcagc agcacgugcc ggugcugaag 360

gacagcagcc ugcuguucga ggaguucaag aagcugauca ggaacaggca gagcgaggcg 420

gcggacagca gcccgagcga gcugaaguac cuggggcugg acacgcacag caggaagaag 480

aggcagcugu acagcgcgcu ggcgaacaag ugcugccacg uggggugcac gaagaggagc 540

cuggcgaggu ucugc 555

<210> 351

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 351

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accuggucca agcgcucccu cucccaggag 180

gacgcccccc agaccccccg ccccgucgcc gagaucgucc ccuccuucau caacaaggac 240

accgagacca ucaacaugau guccgaguuc gucgccaacc ucccccagga gcucaagcuc 300

acccuccg agaugcagcc cgcccucccc cagcuccagc agcacguccc cguccucaag 360

gacuccuccc uccucuucga ggaguucaag aagcucaucc gcaaccgcca guccgaggcc 420

gccgacuccu cccccuccga gcucaaguac cucggccucg acacccacuc ccgcaagaag 480

cgccagcucu acuccgcccu cgccaacaag ugcugccacg ucggcugcac caagcgcucc 540

ucugc 555

<210> 352

<211> 276

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 352

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuucu 60

agggccgugg ccgacagcug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucc accuggagcg gcuccaacgg cucuaccaac 180

gauucuaaug gcagcacagg cucccagcug uacagcgccc uggccaauaa gugcugucac 240

gugggcugca caaagagguc ccuggcccgc uucugu 276

<210> 353

<211> 276

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 353

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuucu 60

agggccgugg ccgacagcug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucc accuggagcg gcuccaacgg cucuaccaac 180

accucuaaug gcgacacagg cucccagcug uacagcgccc uggccaauaa gugcugucac 240

gugggcugca caaagagguc ccuggcccgc uucugu 276

<210> 354

<211> 276

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 354

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuucu 60

agggccgugg ccgacagcug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucc accuggagcg gcuccaacgg caagaccaac 180

accucuaaug gcgacacagg cucccagcug uacagcgccc uggccaauaa gugcugucac 240

gugggcugca caaagagguc ccuggcccgc uucugu 276

<210> 355

<211> 291

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 355

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuucc 60

agggccgugg ccgacucuug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucu accuggucug gcagcacaaa cuccggcucu 180

accagcuccg gcaacagcgg cuccggcaau ucuggcagcc agcuguacag cgcccuggcc 240

aauaagugcu gucacguggg cugcacaaag aggucccugg cccgcuucug u 291

<210> 356

<211> 291

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 356

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuucc 60

agggccgugg ccgacucuug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugagc accuggucug gcagcacaaa cuccggcucu 180

gauaccagcu ccggcaacag cggcuccggc aauucuggcc agcuguaacag cgcccuggcc 240

aauaagugcu gucacguggg cugcacaaag aggucccugg cccgcuucug u 291

<210> 357

<211> 291

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 357

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuucu 60

agggccgugg ccgacagcug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucc accuggagcg gcuccacaaa cucuggcagc 180

gauaccggcu cuggcaacuc caagucuggc aauagcggcc agcuguacuc cgcccuggcc 240

aauaagugcu gucacguggg cugcacaaag aggagccugg cccgcuucug u 291

<210> 358

<211> 291

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 358

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuucu 60

agggccgugg ccgacagcug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucc accuggagcg gcuccacaaa cucuggcagc 180

gacaccuccg gcaagaacuc uggcgauggc aauagcggcc agcuguacuc cgcccuggcc 240

aauaagugcu gucacguggg augcacaaag cggagccugg cccgcuucug u 291

<210> 359

<211> 291

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 359

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuagc 60

agggccgugg cagacuccug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucu accuggucug gcagcacaga cuccggcucu 180

gauaccagcu ccggcaacag cggcgauggc aauuccggcc agcuguacuc ugcccuggcc 240

aauaagugcu gucacguggg cugcacaaag aggagccugg cccgcuucug u 291

<210> 360

<211> 321

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 360

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuucc 60

agggccgugg ccgacucuug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucu accuggagcg gcagcuccgg cucuacaaac 180

gauuccaaug gcucuaccgg cacaggcagc gacggcucca ccaacggcuc ugauggcagc 240

acaggaggac agcuguacag cgccggggcc aauaagugcu gucacguggg augcaccaag 300

aggucccugg cccgcuucug u 321

<210> 361

<211> 381

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 361

augccccggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuagc 60

agggccgugg cagacuccug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugagc accugguccg gcucuacaaa cagcggcucc 180

gacaccagcu ccggcuccac aaauucuggc agcgauaccu cuagcggcaa cuccggcucu 240

ggcaauagcg gcuccaaggg caccggcucu gauggcagca caaacggcuc caauggcucu 300

accggaggac agcuguacuc ugccggcc aauaagugcu gucacguggg cugcacaaag 360

aggucccugg cccgcuucug u 381

<210> 362

<211> 1341

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 362

augcccaggc uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ccaguuuucc 60

cgcgccgugg cagacucuug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucu accuggagca agcggucccu gucucaggag 180

240

accgagacaa ucaauauugau guccgaguuc guggccaauc ugccucagga gcugaagcug 300

acccuguccg agaugcagcc agccugcca cagcugcagc agcacgugcc agugcugaag 360

gauagcuccc ugcuguuuga ggaguucaag aagcugaucc ggaacagaca guccgaggcc 420

gccgacucua gcccuucuga gcugaaguac cugggccugg auacccacag caggaagaag 480

cgccagcugu auuccgcccu ggccaauaag ugcugucacg ugggcugcac aaagaggucc 540

cuggcccgcu uuuguggcgg cggcggcucu ggaggaggag gcagcggcgg aggaggcagc 600

660

uuucuguucc cuccaaagcc aaaggacacc cugaugaucu cuaggacccc cgaggugaca 720

ugcguggugg uggacgugag cccgaggac cccgaggugc aguucaacug guacguggau 780

ggcauggagg ugcacaaugc caagacaaag ccccgggagg agcaguuuaa cagcaccuuc 840

agaguggugu ccgugcugac aguggugcac caggacuggc ugaacggcaa ggaguauaag 900

ugcgccgugu ccaauaaggg ccugccagca ccuaucgaga agaccaucuc uaagacaaag 960

ggccagccua gggagccaca gguguacacc cugcccccuu cccgcgagga gaugaccaag 1020

aaccaggugu cucugacaug ucggugaag ggcuuuuauc ccucugacau cgccguggag 1080

ugggaggca auggccagcc ugagaacaau uacaagacca caccacccau gcuggacucc 1140

gauggcagcu ucuuccugua uucuaagcug acaguggaua agagccggug gcagcagggc 1200

1260

cugagccugu cccccggcaa gggcaagcca auccccaauc cucugcuggg ccuggauagc 1320

accaccacc accaccacca c 1341

<210> 363

<211> 984

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 363

60

cgcgccgugg cagacagcug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

cgcgcacaga ucgccaucug uggcaugagc accuggucca agcggagccu gagccaggag 180

gacgcaccac agacacccag accuguggcc gagaucgugc cuuccuuuau caacaaggau 240

accgagacaa ucaauauugau gucugaguuc guggccaauc ugccccagga gcugaagcug 300

acccuguccg agaugcagcc agccugcca cagcugcagc agcacgugcc ugugcugaag 360

gauagcuccc ugcuguuuga ggaguucaag aagcugaucc ggaacagaca guccgaggcc 420

gccgacucua gcccaucuga gcugaaguac cugggccugg auacccacag caggaagaag 480

cgccagcugu auuccgcccu ggccaauaag ugcugucacg ugggcugcac aaagcggucc 540

cuggccagau uuuguggcgg cggcggcucu ggaggaggag gcagcggcgg aggaggcucc 600

gacauccaga ugacccagag cccuuccucu cuguccgccu cugugggcga ucgggugacc 660

aucacaugca gggccagccg gcccaucggc acaaugcuga gcugguauca gcagaagccu 720

ggcaaggccc caaagcugcu gauccuggcc uucucuaggc ugcagagcgg cgugcccucc 780

cgcuuuagcg gcuccggcuc uggcaccgac uucacccuga caaucagcuc ccugcagcca 840

gaggauuuug ccaccuacua uugugcccag gccggcacac accccaccac auucggccag 900

ggcaccaagg uggagaucaa gaggggcaag ccaaucccca acccucugcu gggccuggac 960

agcacacacc accaccacca ccac 984

<210> 364

<211> 291

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 364

augccucgac uguucuuuuu ccaccugcug ggcgugugcc ugcugcugaa ucaguuuuagc 60

cgggccgucg ccgauaguug gauggaggaa gugaucaagc ugugcggccg ggagcuggug 120

agagcacaga ucgccaucug uggcaugucc accuggucug gcagcuccgg aggaggcucu 180

ggcucuagcu ccggcucuag cggcagcggc ggcuccggcc agcuguacag cgcucuggcu 240

aauaaguguu gucacgucgg auguacuaaa cgaagucugg cuagauuuug c 291

<210> 365

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 365

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agacaacucu acagugcauu ggcuaauaaa uguugccaug uugguuguac caaaagaucu 540

cuugcuagau uuugc 555

<210> 366

<211> 534

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 366

augggcguga aagugcuguu ugcgcugauu ugcauugcgg uggcggaagc ggacucaugg 60

auggaggaag uuauuaaauu augcggccgc gaauuaguuc gcgcgcagau ugccauuugc 120

ggcaugagca ccuggagcaa aaggucucug agccaggaag augcuccuca gacaccuaga 180

ccaguggcag aaauugugcc auccuucauc aacaaagaua cagaaaccau aaauuugaug 240

ucagaauuug uugcuaauuu gccacaggag cugaaguuaa cccugucuga gaugcagcca 300

360

gaauuuaaga aacuuauucg caauagacaa agugaagccg cagacagcag uccuucagaa 420

uuaaaauacu uaggcuugga uacucauucu cgaaaaaaga gacaacucua cagugcauug 480

gcuaauaaau guugccaugu ugguuguacc aaaagaucuc uugcuagauu uugc 534

<210> 367

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 367

augggcguga aagugcuguu ugcgcugauu ugcauugcgg uggcggaagc ggacucaugg 60

auggaggaag uuauuaaauu augcggccgc gaauuaguuc gcgcgcagau ugccauuugc 120

ggcauggagc ccaagagcag cgacaagacc cacaccagcc cccccagccc cgcccccgag 180

cugcugggcg gcagcagcgu guuccuguuc ccccccaagc ccaaggacac ccucuacauc 240

accagggagc ccgaggugac cugcguggug guggacguga gccacgagga ccccgaggug 300

aaguucaacu gguacgugga cggcguggag gugcacaacg ccaagaccaa gcccagggag 360

gagcaguaca acagcaccua caggguggug agcgugcuga ccgugcugca ccaggacugg 420

cugaacggca aggaguacaa gugcaaggug agcaacaagg cccugcccgc ccccaucgag 480

aagaccauca gcaaggccaa gggccagccc agggagcccc agguguacac ccugcccccc 540

agcagggacg agcugaccaa gaaccaggug agccugaccu gccuggugaa gggcuucuac 600

cccagcgaca ucgccgugga gugggagagc aacggccagc ccgagaacaa cuacaagaca 660

accccccccg ugcuggacag cgacggcagc uucuuccugu acagcaagcu gaccguggac 720

aagagcaggu ggcagcaggg caacguguuc agcugcagcg ugaugcacga ggcccugcac 780

840

aaaaggucuc ugagccagga agaugcuccu cagacaccua gaccaguggc agaaauugug 900

ccauccuuca ucaacaaaga uacagaaacc auaaauauga ugucagaauu uguugcuaau 960

uugccacagg agcugaaguu aacccugucu gagaugcagc cagcauuacc acagcuacaa 1020

1080

1140

gauacucauu cucgaaaaaa gagacaacuc uacagugcau uggcuaauaa auguugccau 1200

guugguugua ccaaaagauc ucuugcuaga uuuugc 1236

<210> 368

<211> 498

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 368

augggcguga aagugcuguu ugcgcugauu ugcauugcgg uggcggaagc ggacucaugg 60

auggaagagg uuauuaaauu auguggccgu gaauuggugc gugcacaaau agcuauuugc 120

ggcaugggcg guggcggcuc ugguggcggc ggcucuggag ggggcggaag ugguggagga 180

gguaguggcg gagguggauc gggaggcgga ggaucuggag gggggggcuc cuuucaaagc 240

uccucgagca aagcgccccc ucccagccug cccagcccua guaggcugcc cgguccgagc 300

gacacgccca uccugcccca ggguggcggu ggcucugggg guggcgguuc aggcggaggu 360

gguucuggcg gaggcggauc agguggggg ggauccggcg gcggcggauc ugguggcggg 420

gggagucagc ucuacucugc guuggccaau aaaugcugcc auguugguug uacaaaaaga 480

ucuuuggcua gauuuugc 498

<210> 369

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 369

augggcguga aggugcuguu cgcacugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggcaga gagcugguga gagcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccag cccccccagc 180

cccgcuccg agcugcuggg cggcagcagc guguuccugu ucccccccaa gcccaaggac 240

acccuguaca uaaccagaga gccagaggug accugcgugg ugguggacgu gagccacgag 300

gaccccgagg ugaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagaca 360

aagccgag aggagcagua caacagcacc uacagagugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguau aagugcaagg ugagcaacaa ggcccugccc 480

gcccccaucg agaagaccau cagcaaggcc aagggccagc ccagagagcc ccagguguac 540

acccugcccc ccagcagaga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga caucgccgug gagugggaga gcaacggcca gcccgagaac 660

aacuacaaga ccaccccccc cgugcuggac agcgacggca gcuucuuccu guacagcaag 720

cugaccgugg acaaagcag auggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaggccuuac acaaccacua cacccagaag agccuaagcc ugagccccgg caagagaaag 840

aagagaaguc ugagcgga ggacgccccc cagaccccca gacccguggc cgagaucgug 900

cccuccuuca uuaacaagga caccgagacc aucaacauga ugagcgaguu cguggccaac 960

1020

1080

agaaacagac agagcgaggc cgccgacucc agccccagcg agcugaagua ccugggccug 1140

gacacccaca gcagaaagaa gagacagcug uacagcgccc uggccaacaa gugcugccac 1200

gugggcugca ccaagagaag ccuggccaga uucugc 1236

<210> 370

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 370

augggaguua aagugcuuuu ugcgcuuauu uguauugcgg ucgcgggaggc ugacucaugg 60

auggaagagg ucauuaagcu cuguggaagg gaacucguua gagcccaaau agcuauuugc 120

gggaugagua caugguccgg uggggguggu ucgggguggag gugggucggg aggaggaggc 180

uccgguggag gcggcaggg gggcggaggg uccggugggg gugggucugg aggagguggu 240

ucguuucagu cuucaucuuc caaagcuccu ccuccuucgc uucccagccc uagcaggcuu 300

ccagguccau cagauacucc aauauugccc cagggagggg guggaucagg aggaggaggg 360

agggugggg gaggaucugg uggagguggu uccggaggag gaggaagcgg ggggggaggu 420

ucaggcggug guggaagcca acuguauagu gcguuggcua acaaauguug ucaugucgga 480

uguacuaaaa ggagccucgc cagguuuugc 510

<210> 371

<211> 534

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 371

augggcguga aagugcuguu ugcgcugauu ugcauugcgg uggcggaagc ggacucaugg 60

auggaggaag uuauuaaauu augcggccgc gaauuaguuc gcgcgcagau ugccauuugc 120

ggcaugagca ccuggagcaa aaggucucug agccaggaag augcuccuca gacaccuaga 180

ccaguggcag aaauugugcc auccuucauc aacaaagaua cagaaaccau aaauuugaug 240

ucagaauuug uugcuaauuu gccacaggag cugaaguuaa cccugucuga gaugcagcca 300

360

gaauuuaaga aacuuauucg caauagacaa agugaagccg cagacagcag uccuucagaa 420

uuaaaauacu uaggcuugga uacucauucu cgaaaaaaga gacaacucua cagugcauug 480

gcuaauaaau guugccaugu ugguuguacc aaaagaucuc uugcuagauu uugc 534

<210> 372

<211> 558

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 372

augagcagca gacugcugcu gcagcugcug ggcuucuggc

agagccagag ugagcgagga guggauggac caggugaucc aggugugcgg cagaggcuac 120

gccagagccu ggaucgaggu gugcggcccc agcgugggca gacuggcccu gagccaggag 180

gagcccgccc cccuggccag acaggccacc gccgaggugg ugcccagcuu caucaacaag 240

gacgccgagc ccuucgacau gacccugaag ugccugccca accugagcga ggagagaaag 300

gccgcccuga gcgagggcag agcccccuuc cccgagcugc agcagcacgc ccccgcccug 360

agcgacagcg uggugagacu ggagggcuuc aagaagaccu uccacaacca gcugggcgag 420

gccgaggacg gcggcccccc cgagcugaag uaccugggca gcgacgccca gagcagaaag 480

aagagacaga gcggcgcccu gcugagcgag cagugcugcc acaucggcug caccagaaga 540

agcaucgcca agcugugc 558

<210> 373

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 373

aggggguga aggugcuguu cgcccucauc ugcauagcgg uggccgaggc cgacucuugg 60

aggaggagg ugaucaagcu cugcggcagg gagcucgugc gugcccagau cgcgaucugc 120

ggcaugagca ccuggucaga gccaaagagc agcgauaaga cgcauaccag cccucccagc 180

cccgcccccg agcugcuggg cgggagcagc guguuccucu ucccacccaa gccaaaggac 240

acccucuaca ucacccgcga gcccgaggug acgugcguug ugguggacgu gucccacgag 300

gaccccgagg ucaaguucaa cugguacgug gacggcgugg aaguccacaa cgccaagacc 360

aagccucgggg aggagcagua caacagcacc uacagggugg ugagcguccu gacaguccug 420

caccaggacu ggcugaaugg caaggaauac aagugcaagg ugucaaacaa ggcccugccc 480

gcccccaucg agaaaaccau cagcaaggcc aagggccagc cacgugagcc ccagguguac 540

acccugcccc ccagcaggga cgagcucacc aagaaccagg ugagccugac cugccuggug 600

aaagguuucu acccuucuga caucgcgguu gagugggaga gcaauggcca acccgagaac 660

aacuacaaga caaccccgcc cgugcuggac uccgauggga gcuucuuccu guauagcaag 720

cugaccgugg acaagagccg cuggcagcag ggcaacgugu ucagcugcuc cgucaugcac 780

gaggcccugc auaaccacua cacccaaaag agccuguccc ugagccccgg caagcgcaag 840

aagagguccc ugagccaaga agacgccccg cagacgccca ggcccguggc cgagaucgug 900

cccagcuuca ucaacaagga uaccgagaca aucaacauga ugucggaauu uguggcuaac 960

1020

1080

1140

gauacccaca gccgcaagaa gcggcagcug uacucugcuc uggccaauaa guguugccac 1200

gucggcugca ccaaacgcag ccuggccagg uucugc 1236

<210> 374

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 374

augggcguca agguccucuu cgcccuuauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu uugcggccgg gagcuugugc gcgcgcagau cgccauuugc 120

ggcaugagca ccugguccga acccaaagagc uccgacaaga cccacaccuc cccuccuucc 180

cccgcccccg agcugcuggg cggcagcagc gucuuccugu ucccgcccaa gcccaaggac 240

acccuguaca ucaccaggga gcccgaggug acaugugucg ugguggacgu gucacacgag 300

gaccccgagg ugaaguucaa cugguacguc gacggcgugg aggugcacaa cgcaaaaacc 360

aagccccgggg aggaacagua caacagcacc uaccgggugg ucagcgugcu gaccgugcuc 420

caucaggacu ggcugaacgg caaggaguac aaaugcaagg ucagcaacaa agcccugccc 480

gccccaaucg aaaagaccau cuccaaggcc aaggggcagc ccagggaacc ccagguguac 540

acccugcccc ccagcaggga cgagcucacc aagaaccagg ugagccugac cugccuggug 600

aagggguucu accccagcga caucgccgug gagugggaaa gcaacggcca acccgaaaac 660

aacuacaaga ccaccccgcc ggugcuggac ucugacggca gcuucuuccu cuacagcaag 720

cugaccguug acaaauccag guggcaacag ggcaacgucu ucagcugcag cgugaugcau 780

gaagcgcugc acaaccauua cacgcagaaa agccuguccc ugagccccgg caagaggaag 840

aaaaggagcc ugucccagga ggacgccccu cagaccccgc gacccguggc cgagaucgug 900

ccuagcuuca uuaacaagga caccgagacg aucaacauga ugagcgaguu cguggccaau 960

1020 cugccccagg agcugaagcu cacccucagc

1080

aggaacaggc agagcgaggc cgccgacucc ucccccuccg agcugaagua ccucggccug 1140

gacacccacu cggaagaa gcggcagcug uacucagccc uggccaacaa gugcugccac 1200

gugggcugca ccaagcggag ccuggcccgg uucugc 1236

<210> 375

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 375

augggcguga aggugcuguu cgcccucauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaaacu cugcggcagg gagcucgugc gcgcccagau cgccaucugc 120

gggaugucca ccuggagcga gcccaagagc uccgacaaaa cccacaccag cccgcccagc 180

ccagcccccg agcugcuggg cggcagcagc guguuccucu ucccucccaa gcccaaggac 240

acgcuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gacccugaag ugaaguuuaa cugguauguu gacggcgugg aggugcacaa cgcaaagacc 360

aagccccgcg aggagcagua caacagcacc uaccgcgucg ucagcgugcu gacaguccuc 420

caccaggauu ggcugaacgg caaggaguac aagugcaagg uguccaacaa ggcccugccc 480

gccccgaucg agaagaccau uagcaaggcc aagggccagc caagggagcc acaaguguac 540

acccugccac cuuccaggga cgagcugacc aagaaucagg ucagccugac cugccugguu 600

aagggcuucu acccaagcga caucgccguu gagugggaga gcaacggaca gccugagaac 660

aacuauaaga cuaccccucc cgugcuggau uccgacggaa gcuucuuccu guacagcaag 720

cugaccgugg acaagagcag auggcagcag gguaacgugu uuuccugcuc cgugaugcau 780

gaggcccugc acaaccacua cacccagaaa agccucagcc ugagccccgg caaacgcaag 840

aagcggagcc ugucgcaaga ggacgccccc cagaccccca ggccuguggc cgagaucguc 900

cccagcuuca ucaacaagga caccgagacu aucaacauga ugagcgaauu cguggccaac 960

1020

1080

1140

gacacccaca gccggaaaaa gcgccagcuc uacagcgccc uggccaacaa gugcugccac 1200

gugggcugca ccaagcguuc ccuggcccgg uuuugc 1236

<210> 376

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 376

augggcguga agguccucuu cgcccucauc ugcaucgccg uggccgaggc cgacuccugg 60

auggaggagg ugauaaagcu cugcggcagg gagcucgugc gcgcccaaau cgccaucugc 120

gggaugagca ccuggagcga gcccaagagc uccgacaaga cacacaccuc cccgcccagc 180

cccgccccag agcugcuggg cgggagcagc gucuuucugu ucccgcccaa gcccaaggac 240

acccuguaca ucacgcgcga gcccgaagug accugcgugg ucguggacgu gagccacgag 300

gacccugagg ugaaguucaa cugguacgug gacggcgugg aggugcacaa cgcuaagacc 360

aagccccgggg aggagcagua caacucaacc uacagagugg ugagcguccu cacggugcug 420

caccaggauu ggcugaaugg caaggaguau aaaugcaagg ugagcaacaa agcacugccc 480

gcccccaucg agaagacaau cucuaaggcc aagggccagc ccagggagcc ccagguguac 540

acccugcccc ccucaagaga cgagcugacc aagaaucagg ugucccugac cugccucgug 600

aagggcuucu accccagcga uaucgcugug gagugggagu ccaacgggca gccggagaac 660

aacuacaaga ccaccccacc cgugcuggac agcgacggga gcuuuuuccu guacagcaag 720

cugaccgucg acaagagcag auggcagcag ggcaacgugu ucagcugcag cgucaugcac 780

gaggcccugc acaaccacua cacacaaaag agccugagcc ugucgccagg caagcgaaag 840

aagagaagcu ugagcgga ggacgccccc cagacccccc ggcccguggc cgagaucgug 900

cccagcuuca ucaacaagga caccgagacu auuaacauga ugagcgaguu cguggccaau 960

cugccccagg agcucaaacu uacccugucc gagaugcagc ccgcccugcc ccagcugcag 1020

cagcacgugc ccgugcugaa ggacaguucc cugcuguucg aggaguucaa aaagcugauc 1080

1140

gacacccaca gcaggaagaa gaggcagcug uacagcgccc uggccaauaa gugcugucac 1200

guuggcugca ccaagcgcag ccucgcccgg uuuugc 1236

<210> 377

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 377

augggcguga aggugcuguu cgcccucauc ugcauugccg uggccgaagc cgacagcugg 60

auggaagagg ucaucaagcu cugcggcagg gagcucguga gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagucc agcgacaaga cccacaccag cccgcccagc 180

cccgccccgg agcuucuugg gggcagcagc guguuccugu ucccacccaa gcccaaggac 240

acccuguaca ucacccggga acccgaggug accugcgugg ucguugacgu cagucacgag 300

gaucccgaag ucaaguuuaa cugguaugug gacggcgugg agguccacaa ugccaaaacc 360

aagccacgggg aggaacagua uaauuccacc uacagggugg ucagcgugcu caccgugcuc 420

caccaggacu ggcucaacgg aaaggaguau aagugcaagg ugagcaauaa ggcccugccu 480

gcccccaucg agaagaccau cuccaaggcg aaaggccagc cccgggagcc ucaggucuac 540

acccugcccc ccagccgcga cgagcucacc aagaaccagg ugagccucac cugccuggug 600

aagggcuucu accccagcga caucgccgug gagugggagu ccaacggaca gcccgagaac 660

aacuacaaga ccaccccacc gguccuggac agcgauggcu ccuucuuccu guacagcaaa 720

cugaccgugg acaagagccg guggcagcag ggcaacgugu ucagcugcag cgucaugcac 780

gaggcgcugc acaaucacua cacccagaaa ucccugagcc ugucccccgg caagaggaag 840

aagaggagcc ugagccagga ggacgccccc cagacaccca ggcccguggc cgagaucgug 900

cccuccuuca ucaacaagga uaccgaaacc aucaacauga ugagcgaguu cguagccaac 960

1020

1080

1140

gacacccacu cccgcaagaa acggcagcuu uauuccgccc uggccaacaa gugcugccac 1200

gugggcugca ccaaaagguc ccuggccagg uuuugc 1236

<210> 378

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 378

augggcguga aagugcucuu ugcccucauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugauaaagcu cugcgggcgg gagcucgucc gggcccagau cgccaucugc 120

gguaugagca ccuggagcga gcccaagucc agcgacaaga cccacaccuc gccccccagc 180

ccggcccccg agcugcuggg gggaagcagc guguuccugu ucccgcccaa gcccaaggac 240

acccuguaca ucacacgaga gcccgaaguu accugcgucg ugguggacgu gagccacgag 300

gaccccgagg ugaaguucaa uugguacgug gacggagugg aggugcacaa ugcaaaaacc 360

aagccccgag aggagcagua caauagcacc uacagggugg ugagcgugcu gacugugcug 420

caccaggacu ggcugaacgg gaaggaguac aagugcaagg uuagcaacaa ggcccucccc 480

gccccaaucg agaagaccau cuccaaggcu aagggccagc ccagggagcc ccaggucuau 540

acacucccgc ccagcagaga ugagcucacc aagaaccagg ucagccugac cugucuggug 600

aaaggcuucu accccagcga cauugccgug gagugggagu ccaacggcca gcccgagaac 660

aacuacaaga ccacuccccc cguacuggau uccgacggca gcuucuuccu guacagcaag 720

cucaccgugg acaaauccag guggcagcag ggcaacgugu uuuccugcag cguaaugcau 780

gaggcccucc acaaccacua cacccagaaa agccugagcc ugagccccgg gaagaggaag 840

aagaggagcc ugucccagga ggacgccccc cagaccccca ggcccguggc cgagaucguc 900

960

cucccccagg agcugaaacu gacgcugagc gagaugcagc cagcccugcc ucagcugcag 1020

1080

1140

gacacccacu cccgaaaaaa gcgucagcug uacagcgccc uggcgaacaa augcugccau 1200

gucggcugua ccaagcgguc ccuggcccgc uucugc 1236

<210> 379

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 379

aggggguga agguccucuu cgcguugauc ugcaucgccg uggccgaggc agauagcugg 60

auggaggagg uuaucaagcu cuguggucgc gagcucgugc gcgcccaaau cgccaucugc 120

ggcaugagca ccuggagcga gccgaaaagc agcgacaaga cacacaccuc cccuccgagc 180

cccgcuccg agcuucuggg uggguccuca guguuucugu ucccgcccaa gccaaaggac 240

acgcuguaca ucaccagaga gcccgaagug acuugcgugg uggucgacgu guccacgag 300

gacccugaag ucaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagaca 360

aagccccgggg aggaacagua caacuccacc uaccgggugg uguccgugcu caccgugcuc 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcucugccc 480

gcccccaucg agaagacgau cuccaaggcc aaggggcaac ccagggaacc gcaggucuau 540

acccugcccc ccucucggga cgagcugacg aagaaccagg uuagccucac cugccuggug 600

aagggcuucu accccuccga caucgccguc gagugggaau ccaacgggca gccugagaac 660

aauuacaaga ccaccccucc cguccuggac uccgacggca gcuucuuucu cuacuccaag 720

cucaccgugg acaagucgag guggcagcag ggaaacgugu ucuccuguag cgugaugcac 780

gaggcccugc acaaccacua cacccagaaa agccugagcc ucagccccgg gaagcggaaa 840

aagcgcuccc ugucccagga ggacgccccc cagacacccc ggcccguggc cgagaucguc 900

ccuuccuuca ucaauaaaga caccgagaca aucaacauga ugagcgaguu cguggccaac 960

cugccccagg aacugaagcu gacccucucg gagaugcagc ccgcgcugcc gcagcugcag 1020

1080

agaaauagac agagcgaggc cgccgauagc uccccaagcg agcucaagua ccucgggcug 1140

gacacgcaca gcagaaagaa gagacagcug uacagcgccc uggccaauaa gugcugccac 1200

gucggcugca ccaagcggag cuuggcgagg uucugc 1236

<210> 380

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 380

augggcguaa aggugcucuu ugcccuaauc ugcaucgccg uggccgaggc cgacucgugg 60

auggaggagg ugaucaagcu cugcggccgg gagcucgugc gcgcccagau cgccaucugc 120

gggaugagca ccuggagcga gcccaaaagu uccgacaaga cccacaccag cccgcccagc 180

ccgcccccg agcugcuggg agggagcagc guguuccugu ucccacccaa gcccaaggac 240

acccuguaca ucacccgcga gcccgaggug accugcgugg ugguggacgu gucccaugag 300

gaucgggagg ugaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaaaacc 360

aagcccaggg aggagcagua caauuccacc uacagggugg ugagcguccu gacgguccug 420

caccaagacu ggcugaaugg caaggaguac aagugcaagg ugagcaacaa ggcccugccc 480

gcgccuaucg agaagacgau cagcaaggcc aaaggccaac cgagggagcc ccagguguau 540

acccugcccc ccagcaggga cgagcucacc aagaaucaag ugucacugac cugccuggug 600

aagggcuucu accccuccga caucgcugug gagugggaga gcaacggcca gcccgaaaau 660

aacuacaaga ccaccccgcc cgugcuggac agcgacggca guuucuuucu guacagcaag 720

cugaccgugg acaaguccag auggcagcag ggcaacgugu ucagcuguag cgucaugcac 780

gaggcccugc auaaucacua cacccagaaa agccuguccc ugagcccagg gaagcggaag 840

aagcgauccc ucagccagga ggacgccccg cagaccccca gacccguugc cgagaucgug 900

cccucauuca ucaacaagga cacagagaca aucaacauga uguccgaauu cguggccaac 960

cucccccagg agcucaagcu gacccucagc gagaugcagc ccgcccugcc ccagcugcag 1020

1080

agaaaucguc aguccgaggc cgccgacagc agccccagcg aacucaagua ccugggccug 1140

gacacccaca gccgcaagaa gaggcagcug uacagcgccc uggccaacaa gugcugccac 1200

guggguugca ccaagcgcag cuuggccagg uuuugc 1236

<210> 381

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 381

augggcguga aggugcuguu cgcccucauu uguaucgccg uggccgaagc ggacagcugg 60

auggaggagg ugaucaaacu augcggcagg gagcucguga gagcucagau ugccaucugc 120

ggcaugucga ccuggagcga gcccaagagc agcgacaaga cccacaccuc cccgcccagc 180

cccgcccccg agcugcuggg gggcagcagc guguuccugu uuccccccaa gcccaaggac 240

acccuguaca ucacccgaga gcccgaggug accugugugg ugguggacgu uucccgag 300

gaccccgagg ucaaguucaa cugguacgug gauggcgugg aggugcacaa ugccaagacu 360

aagccccgag aggagcagua caacagcacc uacagggugg ucagcgugcu gaccguccug 420

caccaggacu ggcugaacgg gaaggaauac aagugcaagg uaagcaacaa ggcccugccu 480

gcccccaucg agaagaccau uuccaaggcc aagggccaac caagggagcc ccagguguac 540

acccugcccc ccagcagaga cgaacugacc aagaaccagg ugagccugac cugccugguc 600

aagggguucu accccuccga caucgccgug gagugggagu ccaacggcca gcccgagaac 660

aacuacaaga ccaccccgcc cguccucgau agcgacggga gcuucuuccu guacucaaag 720

cugacagugg acaagagcag guggcagcag ggcaacgugu ucuccugcag cgugaugcac 780

gaagcccugc auaaccacua uacccagaag ucccugagcc ugagccccgg aaagcgcaaa 840

aagcgcagcc ugagccagga ggacgcccca caaaccccca ggcccguggc cgagaucgug 900

960

cugccccagg agcugaagcu gacccugucu gagaugcagc ccgcccugcc ucagcuccag 1020

1080

1140

gacacacaua gccggaagaa gaggcagcuc uacagcgccc ucgccaacaa augcugccac 1200

gugggcugca ccaagaggag ccuggccaga uucugu 1236

<210> 382

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 382

augggcguga agguccucuu cgcccucauc ugcaucgccg uggccgaggc cgauagcugg 60

auggaggagg ucaucaagcu cugcgggcga gagcucguga gagcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagucc ucggacaaga cgcauaccag cccgcccagc 180

cccgcccccg agcugcuggg gggcagcagc guguuccugu ucccacccaa gcccaaggac 240

acccuguaua ucacccggga accugaggug acaugcgugg ugguggacgu aagccacgag 300

gacccagagg ugaaguuuaa cugguacgug gacggggugg aggugcacaa ugccaagacc 360

aagccuaggg aggagcaaua caacuccacc uaccgcgugg ugagcgugcu gacgguccug 420

caccaggacu ggcugaacgg caaagaguac aagugcaaag uguccaacaa agcccugccc 480

gcccccaucg agaagaccau cuccaaggcc aaggggcagc ccagagagcc ccagguguac 540

acccugcccc ccucuaggga cgagcucacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu acccguccga caucgccgug gagugggaga gcaacggcca acccgagaac 660

aacuacaaga ccaccccgcc ggugcucgac uccgacggca gcuucuuccu cuacagcaag 720

cuaaccgugg auaaggccg cuggcagcag ggcaacgucu ucagcugcag cgucaugcac 780

gaggcccugc acaaccacua cacccagaaa agccuguccc ugucccccgg caagcggaag 840

aagagaucgc ugucccagga ggacgcccccc caaacgccca ggcccguagc cgagaucgug 900

cccagcuuca ucaacaagga caccgagaca auuaacauga ugagugaguu uguggccaau 960

1020

1080

aggaaccggc agagcgaggc cgccgacucc agccccagcg agcugaagua ccugggucug 1140

gauacccacu cggaagaa gcggcagcug uacagcgccc uggccaacaa guguugucac 1200

gucgguugca cgaaacgguc gcucgcccgg uuuugu 1236

<210> 383

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 383

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccag ccccccaagc 180

cccgcuccg agcugcuggg cggcagcagc guguuccugu ucccuccuaa accuaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gacccugagg ugaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aagccacggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugccu 480

gcgcccaucg agaagaccau cagcaaggcc aaggggcagc cuagagaacc ccagguguac 540

acccugccuc ccagccggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga uauugcugug gagugggaga gcaacggcca gccugagaac 660

aacuacaaga ccaccccucc cgugcuggac agcgacggca gcuucuuccu guacagcaaa 720

cugacagugg acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaagcccugc acaaccacua cacccagaaa agccuaagcc ugucacccgg caagcggaag 840

aagcgguccu ugagccagga ggacgcgccu cagacccccc ggccuguggc ugaaaucgug 900

cccagcuuca ucaacaaaga caccgagacg auaaacauga ugagcgaguu cguggccaac 960

cugccccagg agcugaagcu caccuugagc gagaugcagc ccgcucugcc acaacuccag 1020

1080

1140

gacacccaca gcagaaagaa gcgccagcug uauagcgccc uggccaacaa gugcugccac 1200

gugggaugca caaaaagaag cuuggcccgg uucugc 1236

<210> 384

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 384

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccuc uccuccgucc 180

cccgcuccg agcugcuggg cggcagcagc guguuccugu ucccucccaa gcccaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gacccugagg ugaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aagccccgggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugcca 480

gccccuaucg agaagaccau cagcaaggcc aaggggcagc ccagggagcc acagguguac 540

acccugccgc ccagccggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga caucgcugug gagugggaga gcaacggcca gccggagaac 660

aacuacaaga ccaccccacc cgugcuggac agcgacggca gcuucuuccu guacagcaag 720

cucaccguag acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaggcccuac acaaccacua cacccagaaa agccugagcc uaucccccgg caagcggaag 840

aagagaucgc ugagccagga ggacgccccc cagacccccc ggcccguagc cgagaucgug 900

cccagcuuca ucaacaaaga cacugaaacg aucaacauga ugagcgaguu cguggccaac 960

cugccccagg agcugaagcu cacacugagc gagaugcagc ccgcucugcc acagcuccag 1020

1080

1140

gacacccaca gccgcaagaa gcggcagcug uucccgccc uggccaacaa gugcugccac 1200

guggggugca ccaaacgcag ccuggcccgg uucugc 1236

<210> 385

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 385

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccuc cccaccuagc 180

ccagccccg agcugcuggg cggcagcagc guguuccugu ucccacccaa gcccaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gaccccgagg ucaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aagccccgggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugccc 480

gcucccaucg agaagaccau cagcaaggcc aagggccagc ccagggagcc ccagguguac 540

acccugccuc ccagccggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga caucgcuguc gagugggaga gcaacggaca gcccgagaac 660

aacuacaaga ccaccccucc cgugcuggac agcgacggca gcuucuuccu guacagcaaa 720

cugacugugg acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaggccuugc acaaccacua cacccagaaa agccuguccc ugucccccgg caagcggaag 840

aagcggucac ugucccagga ggacgcuccg cagacccccc ggccaguggc ggagaucgug 900

cccagcuuca ucaauaagga uaccgagaca auuaacauga ugagcgaguu cguggccaac 960

cugccccagg agcugaagcu gacccugagc gagaugcagc ccgcucugcc gcaguuacag 1020

1080

1140

gacacccaca gcagaaagaa aaggcagcug uucccgccc uggccaacaa gugcugccac 1200

gugggaugca ccaagagauc ucuggcccgg uucugc 1236

<210> 386

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 386

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccuc accuccaucc 180

ccggcaccg agcugcuggg cggcagcagc guguuccugu ucccucccaa gcccaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gaccccgaag ugaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aagccccgggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugccu 480

gcgccuaucg agaagaccau cagcaaggcc aagggccagc cacgggaacc ccagguguac 540

acccugccuc ccagccggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga uaucgcugug gagugggaga gcaacggcca acccgagaac 660

aacuacaaga ccaccccacc cgugcuggac agcgacggca gcuucuuccu guacagcaaa 720

cuaaccgugg acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaagcccugc acaaccacua cacccagaaa agccucuccc ugagccccgg caagcggaag 840

aagcgguccu ugucacagga ggacgccccc cagacccccc ggcccgucgc ugagaucgug 900

cccagcuuca ucaacaaaga caccgaaaca auuaacauga ugagcgaguu cguggccaac 960

cugccccagg agcugaagcu gacacugagc gagaugcagc ccgcucugcc acaacugcag 1020

cagcacgugc cagugcucaa ggacagcagc cuccuguucg aggaguucaa gaagcugauc 1080

1140

gacacccaca gccgcaaaaa gagacagcug uucccgccc uggccaacaa gugcugccac 1200

gugggaugca ccaaaagaag ccuggcccgg uucugc 1236

<210> 387

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 387

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccag ccccccuucc 180

cccgcccccg agcugcuggg cggcagcagc guguuccugu ucccgcccaa gcccaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gaccccgaag ugaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aagccccgggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugccc 480

gcucccaucg agaagaccau cagcaaggcc aagggccagc caagagaacc ccagguguac 540

acccugcccc ccucccggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga cauugccgug gagugggaga gcaacggcca gcccgagaac 660

aacuacaaga ccaccccacc cgugcuggac agcgacggca gcuucuuccu guacagcaag 720

cugacugugg acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaggccuugc acaaccacua cacccagaaa agccuguccc uuagccccgg caagcggaag 840

aagaggagcc uuagccagga ggacgcccca cagacccccc ggcccguggc ugaaaucgug 900

cccagcuuca ucaacaaaga cacagaaacc aucaacauga ugagcgaguu cguggccaac 960

cugccccagg agcugaagcu cacccugagc gagaugcagc ccgcauugcc acagcuccag 1020

1080

1140

gacacccaca gcagaaagaa gcggcagcug uacucagccc uggccaacaa gugcugccac 1200

gugggcugca caaagcggag ccuggcccgg uucugc 1236

<210> 388

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 388

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccag ccccccaagc 180

cccgcccccg agcugcuggg cggcagcagc guguuccugu ucccgcccaa gccaaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gacccagaag ucaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aagccacggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugccu 480

gcacccaucg agaagaccau cagcaaggcc aaggggcagc cuagagagcc ccagguguac 540

acccugccac cuagccggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga caucgcugug gagugggaga gcaacggcca gccugagaac 660

aacuacaaga ccaccccgcc cgugcuggac agcgacggca gcuucuuccu guacagcaag 720

cucacgguag acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaagcucugc acaaccacua cacgcagaaa agcuugagcc ugucacccgg caagcggaag 840

aagcgguccc ugucccagga ggacgccccu cagacccccc ggccaguagc ggagaucgug 900

cccagcuuca ucaacaagga uacagagacu aucaacauga ugagcgaguu cguggccaac 960

cugccccagg agcugaagcu gacucugagc gagaugcagc ccgcgcugcc ucaacugcag 1020

1080

cggaaccggc agagcgaggc cgcagacagc ucacccagcg aauugaagua ccugggccug 1140

gacacccaca gcagaaagaa gcgacaguug uucccgccc uggccaacaa gugcugccac 1200

guggguugca ccaagagguc gcuggcccgg uucugc 1236

<210> 389

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 389

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccuc accaccaagc 180

ccugcacccg agcugcuggg cggcagcagc guguuccugu ucccucccaa gcccaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gacccagagg ucaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aaaccccgggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugccg 480

gccccuaucg agaagaccau cagcaaggcc aagggccagc caagggaacc ccagguguac 540

acccugccac ccagccggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga caucgcagug gagugggaga gcaacggcca gcccgagaac 660

aacuacaaga ccaccccacc cgugcuggac agcgacggca gcuucuuccu guacagcaag 720

cugacugucg acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaggccuugc acaaccacua cacccagaaa agccucucuc uuucucccgg caagcggaag 840

aagaggagcc ugucccagga ggacgccccc caaacucccc ggcccgucgc ugagaucgug 900

cccagcuuca ucaauaaaga cacggagaca aucaacauga ugagcgaguu cguggccaac 960

1020

1080

1140

gacacccaca gcagaaagaa aagacagcug uauucagccc uggccaacaa gugcugccac 1200

gugggcugca caaagcggag ccucgcccgg uucugc 1236

<210> 390

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 390

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccuc cccucccagu 180

ccugcccccg agcugcuggg cggcagcagc guguuccugu ucccgcccaa gcccaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gacccugagg ugaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aagccccgggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugccc 480

gccccaaucg agaagaccau cagcaaggcc aagggccagc cuagggagcc gcagguguac 540

acccugccac ccucucggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga uaucgccguc gagugggaga gcaacggcca accugagaac 660

aacuacaaga ccaccccucc cgugcuggac agcgacggca gcuucuuccu guacagcaag 720

cucaccgugg acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaagcccugc acaaccacua cacccagaaa agcuugagcc ucagucccgg caagcggaag 840

aagcgauccu ugagccagga ggacgcuccu cagacccccc ggccuguggc ggagaucgug 900

cccagcuuca ucaacaaaga cacugaaacc auuaacauga ugagcgaguu cguggcuaac 960

uugccccagg agcugaagcu gacucugagc gagaugcagc ccgcucuccc gcagcuucag 1020

1080

1140

gacacccaca gcagaaagaa gaggcagcug uacucugccc uggccaacaa gugcugccac 1200

gugggcugca caaagaggag ccuggcccgg uucugc 1236

<210> 391

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 391

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccuc cccuccgucc 180

cccgcuccg agcugcuggg cggcagcagc guguuccugu ucccucccaa gcccaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gacccagaag ucaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aagccccgggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugccu 480

gcuccuaucg agaagaccau cagcaaggcc aagggccagc cucgggaacc ccagguguac 540

acccugcccc cuagccggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga uauugccgug gagugggaga gcaacgggca gcccgagaac 660

aacuacaaga ccaccccgcc cgugcuggac agcgacggca gcuucuuccu guacagcaag 720

cuuaccgucg acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaagcccugc acaaccacua cacccagaaa agccucuccc ugucucccgg caagcggaag 840

aagcgcaguc ucucucagga ggacgcuccu cagacccccc ggcccgucgc cgaaaucgug 900

cccagcuuca ucaacaaaga cacugaaacc auaaacauga ugagcgaguu cguggccaac 960

cugccccagg agcugaaguu gacucugagc gagaugcagc ccgcccugcc acagcuccag 1020

1080

1140

gacacccaca gccggaagaa aaggcaguua uacagcgccc uggccaacaa gugcugccac 1200

gugggaugua ccaagaggag ucuggcccgg uucugc 1236

<210> 392

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 392

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccag uccccccucu 180

cccgcacccg agcugcuggg cggcagcagc guguuccugu ucccucccaa gcccaaggac 240

acccuguaca ucacccggga gcccgaggug accugcgugg ugguggacgu gagccacgag 300

gaccccgagg ucaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagacc 360

aagccccgggg aggagcagua caacagcacc uaccgggugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguac aagugcaagg ugagcaacaa ggcccugccg 480

gcgccaaucg agaagaccau cagcaaggcc aagggucagc ccagggagcc ccagguguac 540

acccugccuc ccucucggga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga caucgcugug gagugggaga gcaacggcca gcccgagaac 660

aacuacaaga ccaccccucc cgugcuggac agcgacggca gcuucuuccu guacagcaag 720

cugacagugg acaagagccg guggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaggccuugc acaaccacua cacccagaaa agccugagcc ucucccccgg caagcggaag 840

aagaggagcc ucagccagga ggacgcuccc cagacccccc ggccaguggc cgaaaucgug 900

cccagcuuca ucaacaagga uacagagaca auuaacauga ugagcgaguu cguggccaac 960

cugccccagg agcugaagcu cacacugagc gagaugcagc ccgcccugcc acaguugcag 1020

1080

1140

gacacccaca gcaggaaaaa gagacagcug uauagcgccc uggccaacaa gugcugccac 1200

gugggcugua ccaagcggag cuuggcccgg uucugc 1236

<210> 393

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 393

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg aggugguggc ucaggcggcg ggggauccgg cggugguggu 180

agcggcggag gcgggucugg uggcggcggu ucagggggag ggggcagugg gggaggaggc 240

ucuuuccaga gcuccuccuc caaggcccca cccccuagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc caaggagggg guggcuccgg gggcggugga 360

ucgggggag gcggcucagg uggcgggggu ucgggggggg gcggaucugg cggaggaggg 420

ucggggggug ggggaucaca gcuguaacagc gcccuggcca acaagugcug ccacgugggc 480

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 394

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 394

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg cggcgggggg ucagggggag gaggguccgg gggaggcgggg 180

agcgguggag gcggcuccgg uggugggggu ucuggcggcg guggcagugg gggaggggga 240

uccuuccaga gcucauccuc caaggcuccu cccccgagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc caggggggcg gcggcucagg cggggguggu 360

aguggcggag gaggaucugg agggggcggg ucaggagggg guggaagcgg gggggguggc 420

ucgguggcg ggggcucuca gcuguaacagc gcccuggcca acaagugcug ccacgugggc 480

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 395

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 395

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg aggggugga ucuggggggg gcggcagcgg ugggggcggg

uccggcggag guggaagugg cgggggggggu ucaggagggg gaggcucugg aggcggagga 240

aguuuccaga gcuccuccuc aaaggcgccu cccccaagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc caagguggcg gugguagcgg ggguggggg 360

ucaggcggcg gcgggaucggg uggcggaggg ucugguggag gugggagcgg cggggcggu 420

agcggcggug gcggcuccca gcuguaacagc gcccuggcca acaagugcug ccacgugggc 480

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 396

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 396

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg uggcggcgga ucuggcggug gggggucgggg ugggggaggu 180

uccgggggag gcgguucagg gggcgggggc ucaggcggug guggaagugg gggcggcggc 240

aguuuccaga gcuccagcuc caaggccccg ccucccagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc cagggagggg gagggucagg aggcggaggg 360

uccgggggug gaggaucggg agguggcggu agcggcgggg ggggcagcgg aggcggggga 420

ucgguggug gggguucuca gcuguaacagc gcccuggcca acaagugcug cccgugggc 480

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 397

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 397

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg cggcgguggc aguggggggcg gagggucugg uggugggggc 180

ucuggcgggg gaggaagugg agggggcggc ucuggaggug gaggcucagg ugggggggg 240

agcuuccaga gcucuagcag caaggcgcca cccccaagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc cagggcggcg gagguucugg gggagggggu 360

uccggcgggg ggggcagcgg aggggggggu agcgggggug gcgggagcgg aggaggggga 420

uccgguggcg gaggauccca gcuguaacagc gcccuggcca acaagugcug ccacgugggc 480

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 398

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 398

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg uggagggggg ucagggggag ggggcuccgg cgggggaggc 180

ucgggaggag gcgguucagg ugggggcggc ucgguggag gcggauccgg uggcgggggg 240

agcuuccaga gcagcucguc caaggccccu cccccaagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc cagggugggg gaggaagcgg aggugguggc 360

uccggggggcg guggcagugg cggagggggu ucgggggggg gcgggucgggg uggaggugga 420

agcgggggug guggauccca gcuguaacagc gcccuggcca acaagugcug cccgugggc 480

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 399

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 399

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg ggguggugga ucagguggag gcggcagugg cgggggcggu 180

ucugggggag gagggucggg agggggggga ucugguggug gcggaagugg cggcggugga 240

uccuuccaga gcaguagcuc uaaggcccca ccgcccagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc cagggugggg guggcuccgg cggcggaggc 360

ucugggggcg gcgggagcgg agggggcggg ucaggcgggg ggggcucagg gggagguggg 420

uccgguggag guggaaguca gcuguaacagc gcccuggcca acaagugcug ccacgugggc 480

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 400

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 400

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg cggaggugga ucaggcggcg guggguccgg ggguggcggg 180

ucagggggcg gaggguccgg cggcggggga agcgguggcg guggcuccgg aggaggaggc 240

ucuuuccaga gcuccucauc uaaggccccg ccgcccagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc cagggcggug gaggcagugg ugggggaggg 360

aguggaggcg gggggagugg gggcgggggu ucggguggug gagguagcgg gggcggcggga 420

ucgguggcg gaggaagcca gcuguaacagc gcccuggcca acaagugcug cccgugggc 480

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 401

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 401

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg gggagguggg ucagguggcg ggggauccgg cggagggggu 180

ucaggaggcg gcgggagcgg aggugguggu ucggguggag gggggagcgg uggcggagga 240

agcuuccaga gcuccuccuc uaaggccccg cccccuagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc caggggggcg guggaagcgg cgggggcggga 360

ucugggggug ggggcucugg ugggggggg aguggggggg gaggcucagg gggugguggc 420

ucugggggcg gcggcucaca gcuguaacagc gcccuggcca acaagugcug ccacgugggc 480

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 402

<211> 510

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 402

agggcguga aggugcuguu cgccugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggccgg gagcuggugc gggcccagau cgccaucugc 120

ggcaugagca ccuggagcgg cggaggcggga agcggcgggg ggggcagugg uggagguggu 180

ucugguggcg ggggaucugg aggcggcggg ucaggcggug ggggcagcgg aggagggggc 240

ucuuuccaga gcuccucauc uaaggcuccu cccccaagcc ugcccagccc cagccggcug 300

cccggcccca gcgacacccc cauccugccc cagggagggg gagggagugg gggcggcggc 360

ucgggggug gaggcucagg gggcggagga agcggagggg gugguagcgg gggcgggggu 420

aguggggggg

ugcaccaagc ggagccuggc ccgguucugc 510

<210> 403

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 403

augggcguga aagugcuguu ugcgcugauu ugcauugcgg uggcggaagc ggacucaugg 60

auggaggaag uuauuaaauu augcggccgc gaauuaguuc gcgcgcagau ugccauuugc 120

ggcauggagc ccaagagcag cgacaagacc cacaccagcc cccccagccc cgcccccgag 180

cugcugggcg gcagcagcgu guuccuguuc ccccccaagc ccaaggacac ccucuacauc 240

accagggagc ccgaggugac cugcguggug guggacguga gccacgagga ccccgaggug 300

aaguucaacu gguacgugga cggcguggag gugcacaacg ccaagaccaa gcccagggag 360

gagcaguaca acagcaccua caggguggug agcgugcuga ccgugcugca ccaggacugg 420

cugaacggca aggaguacaa gugcaaggug agcaacaagg cccugcccgc ccccaucgag 480

aagaccauca gcaaggccaa gggccagccc agggagcccc agguguacac ccugcccccc 540

agcagggacg agcugaccaa gaaccaggug agccugaccu gccuggugaa gggcuucuac 600

cccagcgaca ucgccgugga gugggagagc aacggccagc ccgagaacaa cuacaagaca 660

accccccccg ugcuggacag cgacggcagc uucuuccugu acagcaagcu gaccguggac 720

aagagcaggu ggcagcaggg caacguguuc agcugcagcg ugaugcacga ggcccugcac 780

840

aaaaggucuc ugagccagga agaugcuccu cagacaccua gaccaguggc agaaauugug 900

ccauccuuca ucaacaaaga uacagaaacc auaaauauga ugucagaauu uguugcuaau 960

uugccacagg agcugaaguu aacccugucu gagaugcagc cagcauuacc acagcuacaa 1020

1080

1140

gauacucauu cucgaaaaaa gagacaacuc uacagugcau uggcuaauaa auguugccau 1200

guugguugua ccaaaagauc ucuugcuaga uuuugc 1236

<210> 404

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 404

augcccagac uguucuucuu ccaccugcug ggcgugugcc uguuacuuaa ccaguucagc 60

agagccgugg ccgacagcug gauggaggag gugaucaagc ugugcggcag agagcuggug 120

agagcccaga ucgccaucug cggcaugucu accuggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagcugcugg gcggcagcag cguguuccug 240

uuccccccca agcccaagga cacccuguac aucaccagag agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggaccccgag gugaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagcccaga gaggagcagu acaacagcac cuacagagug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg ggaaggagua caagugcaag 480

gugagcaaca aggccugcc cgccccccauc gagaagacca ucagcaaggc caagggccag 540

cccagagagc cccaggugua cacccugccc cccagccgag acgaacugac caagaaucag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggaa 660

agcaacggcc agcccgagaa caacuacaag accaccccccc ccgugcugga cagcgacggc 720

agcuucuucc uguauagcaa gcugaccgug gacaagucaa gauggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaggcccug cacaaccacu acacccagaa gagccugagc 840

cugagccccg gcaagagaaa gaagagaagc cugagccagg aggacgcccc cggacaccu 900

agacccgugg ccgagaucgu gccagcuuu aucaacaagg acaccgagac caucaacaug 960

auguccgagu ucguggccaa ccugccccag gagcugaagc

cccgcccugc cccagcugca gcagcacgug ccagugcuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau cagaaacaga cagagcgagg ccgccgacag cagccccagc 1140

gagcugaagu accugggccu ggacacccac agcagaaaga agagacaacu guacagcgcc 1200

cuggccaaua agugcugcca cgugggcugc accaagagaa gccuggccag auucugc 1257

<210> 405

<211> 531

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 405

60

agggcugucg cagauaguug gauggaggag guaaucaaau uauguggaag agaguuaguu 120

cgugcucaaa uagcuauuug ugguauguca acuuggagcg gagggggcgg cucgggcggga 180

gggggaagcg gagggggugg cucaggaggg ggcgguucug guggcggcgg aucagguggu 240

ggaggaucag gaggcgggggg cagcuuucag ucgucgucau ccaaagcgcc uccacccuca 300

cugcccuccc ccuccagauu accugggccc uccgauaccc ccauuuugcc acaagggggu 360

ggaggauccg gggggggagg cagugguggu ggugguagcg gugguggggg cuccggugga 420

ggcggaagug gugggggagg auccgggggg ggcggaucgc agcucuauuc cgcucuugcc 480

aauaaauguu gccacgucgg uuguacaaaa cggucccugg cggauucug c 531

<210> 406

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 406

augcccagac uguucuucuu ccaccugcug ggcgugugcc uguuacuuaa ccaguucagc 60

agagccgugg ccgacagcug gauggaggag gugaucaagc ugugcggcag agagcuggug 120

agagcccaga ucgccaucug cggcaugucu accuggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagcugcugg gcggcagcag cguguuccug 240

uuccccccca agcccaagga cacccuguac aucaccagag agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggaccccgag gugaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagcccaga gaggagcagu acaacagcac cuacagagug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg ggaaggagua caagugcaag 480

gugagcaaca aggccugcc cgccccccauc gagaagacca ucagcaaggc caagggccag 540

cccagagagc cccaggugua cacccugccc cccagccgag acgaacugac caagaaucag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggaa 660

agcaacggcc agcccgagaa caacuacaag accaccccccc ccgugcugga cagcgacggc 720

agcuucuucc uguauagcaa gcugaccgug gacaagucaa gauggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaggcccug cacaaccacu acacccagaa gagccugagc 840

cugagccccg gcaagagaaa gaagagaagc cugagccagg aggacgcccc cggacaccu 900

agacccgugg ccgagaucgu gccagcuuu aucaacaagg acaccgagac caucaacaug 960

auguccgagu ucguggccaa ccugccccag gagcugaagc

cccgcccugc cccagcugca gcagcacgug ccagugcuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau cagaaacaga cagagcgagg ccgccgacag cagccccagc 1140

gagcugaagu accugggccu ggacacccac agcagaaaga agagacaacu guacagcgcc 1200

cuggccaaua agugcugcca cgugggcugc accaagagaa gccuggccag auucugc 1257

<210> 407

<211> 1236

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 407

augggcguga aggugcuguu cgcacugauc ugcaucgccg uggccgaggc cgacagcugg 60

auggaggagg ugaucaagcu gugcggcaga gagcugguga gagcccagau cgccaucugc 120

ggcaugagca ccuggagcga gcccaagagc agcgacaaga cccacaccag cccccccagc 180

cccgcuccg agcugcuggg cggcagcagc guguuccugu ucccccccaa gcccaaggac 240

acccuguaca uaaccagaga gccagaggug accugcgugg ugguggacgu gagccacgag 300

gaccccgagg ugaaguucaa cugguacgug gacggcgugg aggugcacaa cgccaagaca 360

aagccgag aggagcagua caacagcacc uacagagugg ugagcgugcu gaccgugcug 420

caccaggacu ggcugaacgg caaggaguau aagugcaagg ugagcaacaa ggcccugccc 480

gcccccaucg agaagaccau cagcaaggcc aagggccagc ccagagagcc ccagguguac 540

acccugcccc ccagcagaga cgagcugacc aagaaccagg ugagccugac cugccuggug 600

aagggcuucu accccagcga caucgccgug gagugggaga gcaacggcca gcccgagaac 660

aacuacaaga ccaccccccc cgugcuggac agcgacggca gcuucuuccu guacagcaag 720

cugaccgugg acaaagcag auggcagcag ggcaacgugu ucagcugcag cgugaugcac 780

gaggccuuac acaaccacua cacccagaag agccuaagcc ugagccccgg caagagaaag 840

aagagaaguc ugagcgga ggacgccccc cagaccccca gacccguggc cgagaucgug 900

cccuccuuca uuaacaagga caccgagacc aucaacauga ugagcgaguu cguggccaac 960

1020

1080

agaaacagac agagcgaggc cgccgacucc agccccagcg agcugaagua ccugggccug 1140

gacacccaca gcagaaagaa gagacagcug uacagcgccc uggccaacaa gugcugccac 1200

gugggcugca ccaagagaag ccuggccaga uucugc 1236

<210> 408

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 408

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagcugcugg gcggcagcag cguguuccug 240

uuccccccca agcccaagga cacccuguac aucaccaggg agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggaccccgag gugaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagcccagg gaggagcagu acaacagcac cuacagggug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gugagcaaca aggccugcc cgccccccauc gagaagacca ucagcaaggc caagggccag 540

cccagggagc cccaggugua cacccugccc cccagcaggg acgagcugac caagaaccag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agcccgagaa caacuacaag accaccccccc ccgugcugga cagcgacggc 720

agcuucuucc uguacagcaa gcugaccgug gacaaagca gguggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaggcccug cacaaccacu acacccagaa gagccugagc 840

cugagccccg gcaagaggaa gaaaaggucu cugagccagg aagaugcucc ucagacaccu 900

agaccagugg cagaaauugu gccauccuuc aucaacaaag auacagaaac cauaaauuug 960

augucagaau uuguugcuaa uuugccacag

1080

gaagaauuua agaaacuuau ucgcaauaga caaagugaag ccgcagacag caguccuuca 1140

gaauuaaaau acuuaggcuu ggauacucau ucucgaaaaa agagacaacu cuacagugca 1200

uuggcuaua aauguugcca uguugguugu accaaaagau cucuugcuag auuuugc 1257

<210> 409

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 409

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagcugcugg gcggcagcag cguguuccug 240

uuccccccca agcccaagga cacccuguac aucaccaggg agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggaccccgag gugaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagcccagg gaggagcagu acaacagcac cuacagggug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gugagcaaca aggccugcc cgccccccauc gagaagacca ucagcaaggc caagggccag 540

cccagggagc cccaggugua cacccugccc cccagcaggg acgagcugac caagaaccag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agcccgagaa caacuacaag accaccccccc ccgugcugga cagcgacggc 720

agcuucuucc uguacagcaa gcugaccgug gacaaagca gguggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaggcccug cacaaccacu acacccagaa gagccugagc 840

cugagccccg gcaagaggaa gaaaaggucu cugagccagg aagaugcucc ucagacaccu 900

agaccagugg cagaaauugu gccauccuuc aucaacaaag auacagaaac cauaaauuug 960

augucagaau uuguugcuaa uuugccacag

1080

gaagaauuua agaaacuuau ucgcaauaga caaagugaag ccgcagacag caguccuuca 1140

gaauuaaaau acuuaggcuu ggauacucau ucucgaaaaa agagacaacu cuacagugca 1200

uuggcuaua aauguugcca uguugguugu accaaaagau cucuugcuag auuuugc 1257

<210> 410

<211> 918

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 410

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg aggugcagcu gcuggagagc 180

ggcggcggcc uggugcagcc cggcggcagc cugaggcuga gcugcguggc cagcggcuuc 240

accuucaaca gcagcgccau gagcugggug aggcaggccc ccggcaaggg ccuggagugg 300

gugagcgcca ucagcggcag cggcgacagg accuacuacg ccgacagcgu gaagggcagg 360

uucaccauca gcagggacaa cagcaagaac acccuguacc ugcagaugaa cagccugagg 420

gccgaggaca ccgccgugua cuacugcacc accgaccccc ccagguacca cuacaacggc 480

cuggccguga ggggccaggg caccaccgug accgugagca gcaaaagguc ucugagccag 540

gaagaugcuc cucagacacc uagaccagug gcagaaauug ugccauccuu caucaacaaa 600

660 gauacagaaa ccauaaauau gaugucagaa uuuguugcua auuugccaca

uuaacccugu cugagaugca gccagcauua ccacagcuac aacaacaugu accuguauua 720

aaagauucca gucuucucuu ugaagaauuu aagaaacuua uucgcaauag acaaagugaa 780

gccgcagaca gcaguccuuc agaauuaaaa uacuuaggcu uggauacuca uucucgaaaa 840

aagagacaac ucuacagugc auuggcuaau aaauguugcc auguugguug uaccaaaaga 900

ucucuugcua gauuuugc 918

<210> 411

<211> 918

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 411

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg aggugcagcu gcuggagagc 180

ggcggcggcc uggugcagcc cggcggcagc cugaggcuga gcugcgccgc cagcggcuuc 240

accuucagca gcuacgccau gagcugggug aggcaggccc ccggcaaggg ccuggagugg 300

gugagcgcca ucagcggcag cggcggcagc accuacuacg ccgacagcgu gaagggcagg 360

uucaccauca gcagggacaa cagcaagaac acccuguacc ugcagaugaa cagccugagg 420

gccgaggaca ccgccgugua cuacugcacc aaggaccccc ccagguacca cuacaccggc 480

cuggccguga ggggcgggg caccaccgug accgugagca gcaaaagguc ucugagccag 540

gaagaugcuc cucagacacc uagaccagug gcagaaauug ugccauccuu caucaacaaa 600

660 gauacagaaa ccauaaauau gaugucagaa uuuguugcua auuugccaca

uuaacccugu cugagaugca gccagcauua ccacagcuac aacaacaugu accuguauua 720

aaagauucca gucuucucuu ugaagaauuu aagaaacuua uucgcaauag acaaagugaa 780

gccgcagaca gcaguccuuc agaauuaaaa uacuuaggcu uggauacuca uucucgaaaa 840

aagagacaac ucuacagugc auuggcuaau aaauguugcc auguugguug uaccaaaaga 900

ucucuugcua gauuuugc 918

<210> 412

<211> 531

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 412

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accugguccg ggucgaccga uagcgguucc 180

gacacuuccu ccggaaacuc cggggacggc aacagcggcu uccagucgag cuccucaaag 240

gccccaccuc ccucacugcc cuccccuucu cggcucccug gaccguccga uacuccgauc 300

cugccgcaau uccaguccag cagcuccaag gccccuccac cgucacugcc auccccgucg 360

agguugccgg gacccucaga cacgcccauc cugccucagg gcagcaccga cucgggaucc 420

gauaccucgu ccgggaacuc cggcgacggg aacucgggac aacucuacag ugcauuggcu 480

c 531

<210> 413

<211> 441

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 413

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accugguccg gaggaggagg guccuuccag 180

ucaagcagcu ccaaggcccc uccaccaagc cucccuagcc cguccaggcu uccgggaccg 240

ucggauacuc ccauccugcc ccaguuccag uccucgucgu ccaaggcucc cccuccaucc 300

cugcccucac ccucacggcu gccaggaccg uccgacaccc cuauccugcc gcaaggcggu 360

ggagggucac aacucuacag ugcauuggcu aauaaauguu gccauguugg uuguaccaaa 420

agaucucuug cuagauuuug c 441

<210> 414

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 414

augccgagac uguucuucuu ccaccuccuc ggcgugugcc uccuccucaa ccaguucucu 60

cgagccgugg cggauagcug gauggaggag gugaucaagc ucuguggccg ugagcucguc 120

cgggcccaga ucgccaucug cggcaugucc accugguccg agcccaaguc cuccgacaag 180

acccacaccu cgccccccag cccugccccc gagcuccugg gcggcagcuc cgucuuccug 240

uucccgccca agccgaagga uacccuguac aucaccaggg agcccgaggu gaccuguguc 300

gugguggacg ugagccacga ggaccccgag gugaaguuua auugguacgu cgacggcgug 360

gaggugcaca acgccaagac caagcccagg gaggagcagu acaacuccac cuaccgggug 420

gugagcgugc ugacaguccu gcaucaggac uggcugaacg gcaaggaaua caagugcaag 480

gugagcaaca aggccugcc cgccccccauc gagaagacca ucagcaaggc caagggccaa 540

ccccgggaac ccggucua cacccugccu cccagcaggg augagcugac caagaaccag 600

guuagccuga ccugccuggu caagggcuuc uaccccuccg acauugccgu ggagugggag 660

agcaacgguc agccgagaa caacuacaag accacccccuc ccgugcucga cagcgacggu 720

uccuucuucc uguacagcaa gcugacggug gacaagagcc gcuggcagca gggcaacgug 780

uucagcugcu ccgugaugca cgaagcccug cacaaccacu acacccagaa gucccugagc 840

cugucacccg gcaagaggaa gaagcggagc cugucccagg aggaugcccc ccagaccccu 900

agaccugugg ccgaaauugu gcccuccuuu aucaacaagg acaccgaaac caucaauaug 960

1020

cccgcccugc cccagcugca acagcacgug cccgugcuga aggacucauc ucugcuguuc 1080

gaggaauuca agaagcugau caggaacagg cagagcgagg ccgccgacag cagucccagc 1140

gagcugaaau accugggccu ggacacccac ucccgcaaga agcggcagcu guacagcgcc 1200

cuggccaaca agugcugcca cguaggcugc accaaacgca gccuggcacg guucugc 1257

<210> 415

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 415

augccccguc ucuucuucuu ccaccuccuc ggagugugcc uccuccucaa ccaguucagc 60

agggccgugg ccgacuccug gauggaggaa gugaucaagc ucugcggcag ggagcucgug 120

agggcccaaa ucgccaucug cggcaugagc accugguccg agcccaagag cuccgacaag 180

acucacacca gccccccgag ccccgccccc gagcugcugg gcgggagcag cguguuucug 240

uucccuccca agcccaagga cacccuguac aucacccgcg agccggaagu gaccugcgug 300

gugguggacg ucucccga ggaccccgag gugaaauuca acugguacgu ggacggcgug 360

gaagugcaca augcgaagac caagcccagg gaggagcagu acaacagcac cuacagggua 420

gucagcgugc ugaccgcu gcaucaggac uggcugaaug gcaaggagua caagugcaaa 480

guguccaaua aggcucugcc cgcccccauc gagaagacca ucagcaaagc caagggacag 540

cccagagagc cccaggugua cacccugccc cggagcaggg acgagcugac caagaaccag 600

gucagccuga ccugccuggu gaagggguuu uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agcccgagaa caacuacaag acgacacccc cggugcugga cagcgacggg 720

ucuuucuucc uguacagcaa gcugaccgug gauaaaucca gauggcagca gggcaacguc 780

uucagcugcu ccgugaugca ugaggcccug cacaaccacu acacgcagaa gucacugucc 840

cugagccccg gcaagaggaa gaagcggagc cugagccagg aggacgcccc ccagaccccc 900

cggcccgugg cggagaucgu gccuagcuuc aucaacaagg acaccgagac uaucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ucacccuguc cgaaaugcag 1020

ccggcccucc cgcagcugca gcagcacgua cccgugcuga aagauuccag ucugcuguuu 1080

gaggaguuca agaagcugau caggaaucgg caguccgagg ccgccgacag cagcccgucc 1140

gaguugaagu accucggccu ggauacccau ucgcggaaga agaggcaacu guacuccgcc 1200

cuggccaaca agugcuguca cguggggugc acaaagagaa gccuggcccg uuucugc 1257

<210> 416

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 416

augcccaggc uguucuucuu ccaccuccuc ggcguguguc uccuccucaa ccaauuuagc 60

cgugccgugg cggacagcug gauggaggag gugaucaagc ucugugguag agagcucguc 120

cgugcccaga uugccaucug uggcaugucc accuggagcg agcccaaguc cagcgacaag 180

acccacacca gcccgcccag cccugccccc gagcugcugg gcggcagcag cguguuccug 240

uucccgccca agcccaagga cacacuguac auaacccggg agcccgaggu gaccugugug 300

guggucgacg ucagccga ggaccccgag gucaaauuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac uaaaccccgg gaggaacaau acaacuccac cuacagggug 420

guauccgugc ugaccguccu gcaccaggau uggcucaacg gcaaagagua uaagugcaaa 480

guguccaaca aggcccugcc cgcccccauc gagaagacga ucagcaaggc caagggccag 540

600

guuucccuga ccugccuggu gaagggcuuc uacccgagcg acauugccgu ggagugggag 660

agcaacggcc agcccgagaa uaacuacaag accacgcccc ccgugcucga cuccgacggc 720

agcuucuuuc ucuacuccaa gcugaccguu gacaagagcc gcuggcagca gggaaacgug 780

uucagcugca gcgucaugca cgaggcccug cacaaccacu acacgcagaa gucccugagc 840

cugucccccg gcaaacguaa gaagaggagc cugagccagg aggacgcccc ccagaccccc 900

aggccagugg ccgagaucgu ccccuccuuc auaaacaagg acaccgaaac caucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacccucag cgagaugcag 1020

cccgcccucc cccaacucca gcagcacgug cccgugcuca aggacagcag ccugcuguuu 1080

gaggaguuca agaaacugau ccgcaacaga cagagcgagg ccgccgacag cagccccagc 1140

gagcucaagu accugggucu ggacacccau agcaggaaga agaggcagcu guacagugcc 1200

cuggcgaaca agugcugcca cgugggcugc accaagagga gccuugccag guucugc 1257

<210> 417

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 417

augccgagac uuuucuucuu ccacuugcuc ggcgugugcc uccuccuuaa ccaauuuagc

agagccgugg cagacuccug gauggaggag gugaucaagc ucugcggcag ggagcucgug 120

agggcgcaga ucgccauuug cgguaugucc acauggagcg agcccaagag cucagauaag 180

acccacacca gcccucccag ccccgccccc gagcugcugg gcggcagcag cguguuccuc 240

uucccgccca aacccaagga cacccuguac aucaccaggg agcccgaggu gaccugcgug 300

gucgucgacg uaucccga ggaccccgag gugaaguuca acugguacgu ggacggggug 360

gaggugcaua acgccaagac caagccccgg gaggagcagu acaacagcac cuaccgggug 420

guguccgugc ugacaguccu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gucagcaaca aagcccugcc cgcccccauc gagaagacca ucucaaaggc caaggggcag 540

cccgcgagc cacaggugua uacgcugccg cccagcagag acgagcugac caagaaccag 600

gugagccuga ccugccuggu caagggcuuc uaucccagcg acaucgccgu ugagugggag 660

720

agcuucuucc uguacuccaa gcugaccgug gacaagagcc gcuggcagca gggcaaugug 780

uucagcugcu ccgugaugca cgaggcccug cauaaccauu acacccagaa gucgcugagc 840

cugagcccug gcaagaggaa gaaacgcagc cugagccagg aggaugcccc gcagaccccu 900

cggccggugg ccgagaucgu gccuuccuuc aucaacaagg acaccgagac aaucaacaug 960

1020

cccgcccugc cccagcugca gcaacacguc ccggugcuca aggacagcag ccugcuguuc 1080

1140

gagcugaagu accugggccu cgacacacau agcaggaaga agcggcagcu cuacuccgcc 1200

cucgccaaua agugcuguca cgugggcugc accaagagaa gccuggccag auuuugc 1257

<210> 418

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 418

augccccggc uguucuucuu ccaccuccuc ggcgugugcc uccuccucaa ucaguucucc 60

agggccgucg ccgacuccug gauggaggag gugaucaagc ucugcgggcg cgagcucgug 120

agagcccaga uugccaucug cggcaugucc accuggagcg agcccaagag cagcgacaag 180

acccacaccu ccccucccag ccccgcgccg gagcugcugg gcggcagcag cguguuucug 240

uucccuccca agcccaagga cacccuguac aucacuaggg agcccgaggu gaccugcgug 300

gucguggaug ugagccacga agauccagag gugaaguuca auugguacgu cgacggcgug 360

gaggugcaca augccaagac caagcccagg gaggagcagu acaacagcac cuacaggguc 420

guuuccgugc ucaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gucagcaaca aagcccuacc cgcccccauc gagaagacaa ucagcaaagc caagggccag 540

cccagggagc cccaggugua uacccuccca cccuccaggg acgaacugac caagaaucag 600

gucagccuga ccugccuugu caagggcuuu uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc aacccgagaa caauuacaag accacccccgc ccguccugga cucgacggg 720

uccuucuucc uauacagcaa gcugaccgug gacaagucca gauggcagca agggaacgug 780

uucuccugcu ccgugaugca cgaggcccug cacaaucacu acacgcagaa gagucugagc 840

cugagccccg ggaagcggaa gaagcgaucc cugagccagg aggacgcccc gcagacaccc 900

cgccccgugg ccgagauugu gcccagcuuc aucaacaagg acaccgagac gaucaauaug 960

auguccgagu ucguggccaa ccugccacag gaacugaagc

1080

gaggaguuca agaagcugau aaggaaccgg cagagcgagg ccgccgacag cagccccagc 1140

gaacugaagu accugggccu ggacacccac agcagaaaga agaggcaacu guauagcgca 1200

cuggcuaaua agugcuguca cgugggcugc accaaacgca gccuggccag guucugc 1257

<210> 419

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 419

augcccagac uguucuucuu ccaccuccuc ggggugugcc uccuccucaa ccaguucucc 60

agggccgugg ccgacagcug gauggaggag gugaucaagc ucugcggcag agagcucguc 120

agggcccaga ucgccaucug cgguaugagc acguggagcg agcccaagag cuccgacaag 180

acccauacaa gccccccgag ccccgcgccc gaacuccugg ggggcuccag cguguuucug 240

uucccgccca agcccaaaga cacccuguac aucacccggg agccugaggu gaccugcgug 300

gugguggacg ugucccga agacccugag gugaaauuca acugguacgu ggacggcgug 360

gaggugcaua acgccaagac caaaccgcgu gaggagcaau acaacagcac cuaccgggug 420

gugucggugc ugaccguccu gcaccaggac uggcugaacg gcaaggagua caaguguaag 480

guguccaaca aggcucuccc cgcccccauc gagaagacca ucuccaaggc caagggccag 540

ccccgcgagc cccaggugua cacccucccg cccagccgcg acgagcugac caagaaccag 600

gugucccuga ccugcuuggu gaagggcuuc uaccccagcg acaucgccgu ggaaugggag 660

uccaacggcc agccggagaa caacuacaag accacuccccc ccguccuggga cagcgacggc 720

uccuucuucc uguacagcaa gcugaccguc gacaaguccc gcuggcagca ggggaacgug 780

uucuccugca gcgugaugca cgaggcccug cacaaccacu acacucagaa gucucugucc 840

cuuagccccg gcaagcggaa gaagaggagc cugagccagg aggacgcccc ccaaacgccu 900

cgccccgugg ccgagauugu gcccagcuuc aucaacaagg acaccgaaac caucaauaug 960

auguccgagu ucguggccaa ccugccccag gagcugaagc ugacccuguc cgagaugcag 1020

cccgcccugc cccagcugca gcagcacgug cccgugcuga aggacagcag ccugcuguuc 1080

gaggaguuua agaagcugau cagaaacaga caauccgagg cagccgacuc cucccccagc 1140

gagcugaaau accugggccu ggacacccau ucccggaaga agcggcagcu guacagcgcc 1200

cucgccaaca agugcugcca cgugggcugc accaagagaa gccuggccag guucugc 1257

<210> 420

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 420

augccccgcc uguucuucuu ccaccuccuc ggcguguguc uccuccuuaa ccaguucucc 60

cgugccgugg ccgauagcug gauggaggag gugaucaagc ucugcggccg agagcucgug 120

agggcacaga ucgccaucug uggcaugucc accuggagcg aacccaagag cuccgauaag 180

acccacacca gcccccccuuc ucccgccccc gagcugcucg gcggcagcuc gguguuccug 240

uucccaccca aacccaagga cacccucuac aucaccagag agcccgaggu aaccugugug 300

gucguggaug ugucccga ggaccccgag gugaaguuca acugguacgu ggacggggug 360

gaggugcaca acgccaagac caagccccgc gaggagcagu acaacagcac cuaccgcgug 420

gugagcgugc ugacagugcu gcaccaggau uggcugaacg gcaaggagua caagugcaag 480

gugagcaaua aggcccugcc cgcccccauc gagaagacca ucagcaaggc caaagggcag 540

cccagagaac cccaggugua cacccugccc cccagccggg acgagcugac caagaaccaa 600

gugagccuca ccugccuggu gaagggguuc uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agcccgagaa caacuacaag accacgccuc ccgugcugga cucgacggg 720

agcuucuucc uguacagcaa gcugaccgug gacaagagcc gcuggcaaca ggggaacgug 780

uuuagcugua gcgucaugca cgaggcccug cacaaucacu acacccagaa gucccugagc 840

cugucccccg gcaagaggaa gaagcguucc cugagccagg aggacgcccc ccagacccc 900

aggccggucg cagagaucgu gcccuccuuc aucaacaagg acaccgagac aaucaacaug 960

augagcgagu ucguggccaa ccugccccag gaacugaagc ucacccuguc cgagaugcag 1020

cccgcccugc cccagcuaca gcagcacgua cccgugcuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau aaggaaucgc caguccgagg ccgccgacuc auccccuagc 1140

gagcugaagu accucggucu ggacacccac agccguaaga agaggcagcu guauuccgcc 1200

cuggccaaca aaugcugcca ugugggcugc accaagagaa gccuggcccg guucugc 1257

<210> 421

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 421

augccccggc uuuucuucuu ccacuuacuc ggcgugugcc uucuccuuaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ucugcggccg ggagcucgug 120

cgggcccaga ucgccaucug cggcaugagc accuggagcg agcccaagag cagcgacaag 180

acccaccacca guccaccguc ccgccccc gaguuacugg gcggcagcag cguguuccug 240

uucccaccaa agcccaagga cacccuguac aucacccggg agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggacccugag gucaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagccccgg gaggagcagu acaacagcac cuaccgggug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gugagcaaca aggccugcc ugccccgauc gagaagacca ucagcaaggc caagggccag 540

ccucgcgagc cucaggugua cacccugcca ccaagccggg acgagcugac caagaaccag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agccagagaa caacuacaag accacaccac ccgugcugga cagcgacggc 720

agcuucuucc uguacagcaa gcugacagug gacaagagcc gguggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaggcccua cacaaccacu acacccagaa gucccugucu 840

cugucacccg gcaagcggaa gaagagaucc cugagccagg aggacgcccc gcagaccccc 900

cggccagugg ccgagaucgu gcccagcuuc aucaacaagg auaccgagac gaucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ucacacugag cgagaugcag 1020

cccgcccugc cgcaacucca gcagcacgug ccagugcuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau cgggaaccgg cagagcgagg ccgcugacag cucuccuagc 1140

gaacugaagu accugggccu ggacacccac agcaggaaga agcggcagcu guacucagcc 1200

cuggccaaca agugcugcca cgugggcugc acuaagagaa gccucgcccg guucugc 1257

<210> 422

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 422

augcccagac uguucuucuu ccaccuccuc ggcgugugcc uccuccucaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc uaugcggccg ggagcucgug 120

cgggcccaga ucgccaucug cggcaugagc accuggagcg agcccaagag cagcgacaag 180

acccacaccu ccccgccguc cccagcuccc gagcuguuag gaggcagcag cguguuccug 240

uucccgccua agcccaagga cacccuguac aucacccggg agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggacccggag gugaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagccccgg gaggagcagu acaacagcac cuaccgggug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gugagcaaca aggccugcc ugcaccuauc gagaagacca ucagcaaggc caagggccag 540

ccaagagagc cucaggugua cacccugcca ccuagccggg acgagcugac caagaaccag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agccugagaa caacuacaag accacuccac ccgugcugga cagcgacggc 720

agcuucuucc uguacagcaa gcucaccgug gacaagagcc gguggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaggcucug cacaaccacu acacccagaa gagucugucg 840

cugagccccg gcaagcggaa gaagagaagc cugagccagg aggacgcccc gcagaccccc 900

cggccagugg cagagaucgu gcccagcuuc aucaacaagg auaccgagac aauuaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacccugag cgagaugcag 1020

1080

gaggaguuca agaagcugau cgggaaccgg cagagcgagg ccgccgacuc cagcccaucu 1140

gaacugaagu accugggccu ggacacccac agccgcaaga agcgccagcu guacucugcc 1200

cuggccaaca agugcugcca cgugggaugc acaaagcguu cccuggcccg guucugc 1257

<210> 423

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 423

augccccggc uuuucuucuu ccaccuccuc ggcgugugcc uccuccucaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc uuugcggccg ggagcucgug 120

cgggcccaga ucgccaucug cggcaugagc accuggagcg agcccaagag cagcgacaag 180

acccacacca gcccaccuag cccggcaccc gagcuccugg gcggcagcag cguguuccug 240

uucccuccaa agcccaagga cacccuguac aucacccggg agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggacccugag gugaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagccccgg gaggagcagu acaacagcac cuaccgggug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gugagcaaca aggccugcc agccccuauc gagaagacca ucagcaaggc caagggccag 540

ccucgcgagc cucaggugua cacccugccu ccaucccggg acgagcugac caagaaccag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agccagagaa caacuacaag accacccccuc ccgugcugga cagcgacggc 720

agcuucuucc uguacagcaa guugaccguc gacaagagcc gguggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaagcccua cacaaccacu acacccagaa gucccugagc 840

uugagccccg gcaagcggaa gaagcgcucc uugucccagg aggacgcccc gcaaaccccc 900

cggccagugg ccgagaucgu gccgcuuc aucaacaagg auacagagac aauuaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ucacacugag cgagaugcag 1020

ccgcucugc cacagcucca gcagcacgug ccugugcuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau cgggaaccgg cagagcgagg ccgccgacuc cuccccaagc 1140

gagcucaagu accugggccu ggacacccac agcagaaaga agaggcagcu cuacagcgcc 1200

cuggccaaca agugcugcca cgugggcugu accaagagaa gccuggcccg guucugc 1257

<210> 424

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 424

augcccagac uguucuucuu ccacuuauug ggcgugugcu ugcuucucaa ccaguucagc

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accugguccg agcccaaguc cuccgacaag 180

acccacaccu ccccgccuuc ccugcaccc gagcuccucg gcggcuccuc cgucuuccuc 240

uucccuccua agcccaagga cacccucuac aucacccgcg agcccgaggu caccugcguc 300

gucgucgacg ucucccga ggacccugag gugaaguuca acugguacgu cgacggcguc 360

gagguccaca acgccaagac caagccccgc gaggagcagu acaacuccac cuaccgcguc 420

gucuccgucc ucaccguccu ccaccaggac uggcucaacg gcaaggagua caagugcaag 480

guguccaaca aggccugcc ugccccaauc gagaagacca ucuccaaggc caagggccag 540

ccacgggaac cucaggucua cacccugccu ccuagccgcg acgagcucac caagaaccag 600

gugucccuca ccugccucgu caagggcuuc uacccuucug auaucgccgu cgagugggag 660

uccaacgguc agccugagaa caacuacaag accacccccuc ccguccucga cuccgacggc 720

uccuucuucc uguacuccaa gcugaccgug gacaaguccc gcuggcagca gggcaacguc 780

uucuccugcu ccgucaugca cgaggcucug cacaaccacu acacccagaa gucccugagc 840

cugagccccg gcaagcgcaa gaagagaagc cugucacagg aggacgcccc ccagaccccu 900

cgcccugucg ccgagaucgu ccccuccuuc aucaauaagg acacggagac aaucaacaug 960

auguccgagu ucgucgccaa ccugccgcag gagcugaagc ucacccucuc cgagaugcag 1020

cccgcccuuc cucagcucca gcagcacgug ccuguccuga aggacuccuc ccuccucuuc 1080

gaggaguuca agaagcucau ccgcaaccgc caguccgagg ccgccgauag cucgccuucc 1140

gagcuaaagu accucggccu cgacacccac ucccggaaga agaggcagcu guauagcgcc 1200

cucgccaaca agugcugcca cgucggcugc accaagagga gccuggcccg cuucugc 1257

<210> 425

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 425

augccccguc uguucuucuu ccaccuucuc ggcgugugcc uccuacucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accugguccg agcccaaguc cuccgacaag 180

acccacaccu cgccuccuag cccagccccc gagcuccucg gcggcuccuc cgucuuccuc 240

uucccaccga agcccaagga cacccucuac aucacccgcg agcccgaggu caccugcguc 300

gucgucgacg ucucccga ggacccagag gugaaguuca acugguacgu cgacggcguc 360

gagguccaca acgccaagac caagccccgc gaggagcagu acaacuccac cuaccgcguc 420

gucuccgucc ucaccguccu ccaccaggac uggcucaacg gcaaggagua caagugcaag 480

guguccaaca aggccugcc agccccaauc gagaagacca ucuccaaggc caagggccaa 540

ccuagagagc cucaggucua caccuugccu ccaagucgcg acgagcucac caagaaccag 600

gugucccuca ccugccucgu caagggcuuc uacccaagcg acaucgccgu cgagugggag 660

uccaacggcc agccugagaa caacuacaag accacccccgc ccguccucga cuccgacggc 720

uccuucuucc uguacuccaa gcugaccguc gacaaguccc gcuggcagca gggcaacguc 780

uucuccugcu ccgucaugca cgaggcucug cacaaccacu acacccagaa gucccugagc 840

cugagccccg gcaagcgcaa gaagagaagc cucagccagg aggacgcccc ccagaccccu 900

agaccggucg ccgagaucgu ccccuccuuc aucaauaagg acacagagac aaucaacaug 960

auguccgagu ucgucgccaa ucugccucag gagcuuaagc ucacccucuc cgagaugcag 1020

1080

gaggaguuca agaagcucau ccgcaaccgc caguccgagg ccgccgacuc aagcccaucc 1140

gagcugaagu accucggccu cgacacccac ucccggaaga agaggcagcu cuacuccgcc 1200

cucgccaaca agugcugcca cgucggcugc accaagcggu cccucgcccg cuucugc 1257

<210> 426

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 426

augccccggu uguucuucuu ccaccuuuug ggcgugugcc uucucuugaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accugguccg agcccaaguc cuccgacaag 180

acccacaccu cuccuccaag cccugcgccc gagcuccucg gcggcuccuc cgucuuccuc 240

uucccaccaa agcccaagga cacccucuac aucacccgcg agcccgaggu caccugcguc 300

gucgucgacg ucucccga ggacccagag gucaaguuca acugguacgu cgacggcguc 360

gagguccaca acgccaagac caagccccgc gaggagcagu acaacuccac cuaccgcguc 420

gucuccgucc ucaccguccu ccaccaggac uggcucaacg gcaaggagua caagugcaag 480

guguccaaca aggcccccc agccccaauc gagaagacca ucuccaaggc caagggccaa 540

ccuagagaac cacaggucua cacacucccu ccuagccgcg acgagcucac caagaaccag 600

gugucccuca ccugccucgu caagggcuuc uacccauccg auaucgccgu cgagugggag 660

uccaacggac agccggagaa caacuacaag accacaccuc ccguccucga cuccgacggc 720

uccuucuucc uguacuccaa gcugaccgug gacaaguccc gcuggcagca gggcaacguc 780

uucuccugcu ccgucaugca cgaggcccug cacaaccacu acacccagaa gucccucucc 840

cugagccccg gcaagcgcaa gaagagaagu cuuagccagg aggacgcccc ccagaccccu 900

agaccggucg ccgagaucgu ccccuccuuc aucaacaagg auacagagac gaucaacaug 960

auguccgagu ucgucgccaa ccugccacag gagcugaagc ugacacucuc cgagaugcag 1020

cccgcccugc cucagcucca gcagcacgug ccagugcuga aggacuccuc auuacucuuc 1080

gaggaguuca agaagcucau ccgcaaccgc caguccgagg ccgccgacuc uagcccuucc 1140

gagcucaagu accucggccu cgacacccac ucccggaaga agcggcagcu guacagcgcc 1200

cucgccaaca agugcugcca cgucggcugc accaagcggu cccuugcccg cuucugc 1257

<210> 427

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 427

augccccggc uauucuucuu ccacuuacuc ggcgugugcc uccucuugaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc uuugcggccg ggagcuugug 120

cgggcccaga ucgccaucug cggcaugagc accuggagcg agcccaagag cagcgacaag 180

acccacacca gcccuccuuc cccugccccc gaguugcugg gaggcagcag cguguuccug 240

uucccaccga agcccaagga cacccuguac aucacccggg agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggacccagag gugaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagccccgg gaggagcagu acaacagcac cuaccgggug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gugagcaaca aggccugcc agccccuauc gagaagacca ucagcaaggc caagggccag 540

ccuagggagc cacaggugua cacccugcca ccuagccggg acgagcugac caagaaccag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agccggagaa caacuacaag accaccccac ccgugcugga cagcgacggc 720

agcuucuucc uguacagcaa gcugacggug gacaagagcc gguggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaggcucug cacaaccacu acacccagaa gaguuuaagc 840

uugucacccg gcaagcggaa gaagcggucc cugagccagg aggacgcccc ucagaccccc 900

agaccuguug ccgagaucgu gccagcuuc aucaauaagg auaccgaaac caucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacccugag cgagaugcag 1020

cccgcccugc cucaguugca gcagcacgug ccugugcuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau cgggaaccgg cagagcgagg ccgccgacuc cuccccuagc 1140

gagcucaagu accugggccu ggacacccac agcagaaaga agagacagcu cuacagcgcc 1200

cuggccaaca agugcugcca cguggguugc accaagcgca gccuggcccg guucugc 1257

<210> 428

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 428

augccccggu uauucuucuu ccaccuccuc ggcgugugcc ucuugcucaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ucugcggccg ggaguuggug 120

cgggcccaga ucgccaucug cggcaugagc accuggagcg agcccaagag cagcgacaag 180

acccacaccu ccccuccuag cccggcgcc gagcugcugg gaggcagcag cguguuccug 240

uuccccuccua agcccaagga cacccuguac aucacccggg agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggacccagag gugaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagccccgg gaggagcagu acaacagcac cuaccgggug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gugagcaaca aggccugcc ugccccuauc gagaagacca ucagcaaggc caagggccag 540

ccacgcgagc cucaggugua cacccugcca ccuagccggg acgagcugac caagaaccag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agccugagaa caacuacaag accacccccuc ccgugcugga cagcgacggc 720

agcuucuucc uguacagcaa gcugacggug gacaagagcc gguggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaggcucug cacaaccacu acacccagaa gucacugagc 840

cugucacccg gcaagcggaa gaagagaagc cugucccagg aggacgcacc ucagaccccc 900

cggccugugg ccgagaucgu gccagcuuc aucaauaagg auaccgaaac caucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacccugag cgagaugcag 1020

cccgcucugc cucagcuuca gcagcacgug ccuguccuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau cgggaaccgg cagagcgagg ccgccgacuc uagcccuagc 1140

gaacucaagu accugggccu ggacacccac agcagaaaga agcgccagcu cuacagcgcc 1200

cuggccaaca agugcugcca cgugggaugc accaagcgaa gccuggcccg guucugc 1257

<210> 429

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 429

augcccagac ucuucuucuu ccaccuuuug ggcgugugcc uccuccucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accugguccg agcccaaguc cuccgacaag 180

acccacaccu ccccgccuag ccgccccc gagcuccucg gcggcuccuc cgucuuccuc 240

uucccuccaa agcccaagga cacccucuac aucacccgcg agcccgaggu caccugcguc 300

gucgucgacg ucucccga ggacccggag gugaaguuca acugguacgu cgacggcguc 360

gagguccaca acgccaagac caagccccgc gaggagcagu acaacuccac cuaccgcguc 420

gucuccgucc ucaccguccu ccaccaggac uggcucaacg gcaaggagua caagugcaag 480

guauccaaca aggccugcc ugcuccuauc gagaagacca ucuccaaggc caagggccaa 540

ccuagagagc cacaggucua cacccugccu ccgucccgcg acgagcucac caagaaccag 600

gugucccuca ccugccucgu caagggcuuc uacccuagcg acaucgccgu cgagugggag 660

uccaacggcc agccugagaa caacuacaag accacccccuc ccguccucga cuccgacggc 720

uccuucuucc uuuacuccaa gcugaccguc gacaaguccc gcuggcagca gggcaacguc 780

uucuccugcu ccgucaugca cgaggcccuc cacaaccacu acacccagaa gucccucucg 840

cucucccccg gcaagcgcaa gaagagaucc cugucgcagg aggacgcccc ccagaccccu 900

agaccggucg ccgagaucgu ccccuccuuc aucaauaagg acacagaaac caucaacaug 960

auguccgagu ucgucgccaa cuugccacag gagcugaagc ucacccucuc cgagaugcag 1020

cccgcccucc cacagcucca gcagcacgug ccuguccuca aggacuccuc ccuccucuuc 1080

gaggaguuca agaagcucau ccgcaaccgc caguccgagg ccgccgauag cucaccuucc 1140

gagcucaagu accucggccu cgacacccac uccagaaaga agcggcagcu guacuccgcc 1200

cucgccaaca agugcugcca cgucggcugc accaagagaa gccucgcccg cuucugc 1257

<210> 430

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 430

augccccgac uguucuucuu ccacuugcuu ggcgugugcc uccucuuaaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accugguccg agcccaaguc cuccgacaag 180

acccacaccu cuccgccaag cccagcuccc gagcuccucg gcggcuccuc cgucuuccuc 240

uucccuccua agcccaagga cacccucuac aucacccgcg agcccgaggu caccugcguc 300

gucgucgacg ucucccga ggacccagag gucaaguuca acugguacgu cgacggcguc 360

gagguccaca acgccaagac caagccccgc gaggagcagu acaacuccac cuaccgcguc 420

gucuccgucc ucaccguccu ccaccaggac uggcucaacg gcaaggagua caagugcaag 480

guguccaaca aggccugcc ugccccuauc gagaagacca ucuccaaggc caagggccag 540

ccuagagagc cucaggucua cacccugcca ccuucgcgcg acgagcucac caagaaccag600

gugucccuca ccugccucgu caagggcuuc uacccauccg acaucgccgu cgagugggag 660

uccaacggcc aaccugagaa caacuacaag accaccccac ccguccucga cuccgacggc 720

uccuucuucc uguacuccaa gcugaccgug gacaaguccc gcuggcagca gggcaacguc 780

840

uugucccccg gcaagcgcaa gaagcggucc cugucccagg aggacgcccc ccagaccccu 900

agaccugucg ccgagaucgu ccccuccuuc aucaauaagg auaccgagac uaucaacaug 960

auguccgagu ucgucgccaa ccucccacag gagcugaagc ucacccucuc cgagaugcag 1020

cccgcucugc cacagcucca gcagcacguc ccugugcuca aggacuccuc ccuccucuuc 1080

1140

gagcucaagu accucggccu cgacacccac uccaggaaga agagacagcu cuacagcgcc 1200

cucgccaaca agugcugcca cgucggcugc accaagagaa gccuggcccg cuucugc 1257

<210> 431

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 431

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ugugcggccg ggagcuggug 120

cgggcccaga ucgccaucug cggcaugagc accuggagcg agcccaagag cagcgacaag 180

acccacacca gcccccccag ccccgccccc gagcugcugg gcggcagcag cguguuccug 240

uuccccccca agcccaagga cacccuguac aucacccggg agcccgaggu gaccugcgug 300

gugguggacg ugagccacga ggaccccgag gugaaguuca acugguacgu ggacggcgug 360

gaggugcaca acgccaagac caagccccgg gaggagcagu acaacagcac cuaccgggug 420

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 480

gugagcaaca aggccugcc cgccccccauc gagaagacca ucagcaaggc caagggccag 540

cccggggagc cccaggugua cacccugccc cccagccggg acgagcugac caagaaccag 600

gugagccuga ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggag 660

agcaacggcc agcccgagaa caacuacaag accaccccccc ccgugcugga cagcgacggc 720

agcuucuucc uguacagcaa gcugaccgug gacaagagcc gguggcagca gggcaacgug 780

uucagcugca gcgugaugca cgaggcccug cacaaccacu acacccagaa gagccugagc 840

cugagccccg gcaagcggaa gaagcggagc cugagccagg aggacgcccc ccagaccccc 900

cggcccgugg ccgagaucgu gcccagcuuc aucaacaagg acaccgagac caucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacccugag cgagaugcag 1020

cccgcccugc cccagcugca gcagcacgug cccgugcuga aggacagcag ccugcuguuc 1080

1140

gagcugaagu accugggccu ggacacccac agccggaaga agcggcagcu guacagcgcc 1200

cuggccaaca agugcugcca cgugggcugc accaagcgga gccuggcccg guucugc 1257

<210> 432

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 432

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

120

agggcgcaga ucgcgaucug cgggaugagc acguggagcg agccgaagag cagcgacaag 180

acgcacacga gcccgccgag cccggcgccg gagcugcugg gggggagcag cguguuccug 240

uucccgccga agccgaagga cacgcuguac aucacgaggg agccggaggu gacgugcgug 300

gugguggacg ugagccacga ggacccggag gugaaguuca acugguacgu ggacggggug 360

gaggugcaca acgcgaagac gaagccgagg gaggagcagu acaacagcac guacagggug 420

gugagcgugc ugacggugcu gcaccaggac uggcugaacg ggaaggagua caagugcaag 480

gugagcaaca aggcgcugcc ggcgccgauc gagaagacga ucagcaaggc gaaggggcag 540

ccgagggagc cgcaggugua cacgcugccg ccgagcaggg acgagcugac gaagaaccag 600

gugagccuga cgugccuggu gaagggguuc uacccgagcg acaucgcggu ggagugggag 660

agcaacgggc agccggagaa caacuacaag acgacgccgc cggugcugga cagcgacggg 720

agcuucuucc uguacagcaa gcugacggug gacaaagca gguggcagca ggggaacgug 780

uucagcugca gcgugaugca cgaggcgcug cacaaccacu acacgcagaa gagccugagc 840

cugagcccgg ggaagaggaa gaagaggagc cugagccagg aggacgcgcc gcagacgccg 900

aggccggugg cggagaucgu gccgagcuuc aucaacaagg acacggagac gaucaacaug 960

augagcgagu ucguggcgaa ccugccgcag gagcugaagc

ccggcgcugc cgcagcugca gcagcacgug ccggugcuga aggacagcag cgcuguuc 1080

gaggaguuca agaagcugau caggaacagg cagagcgagg cggcggacag cagcccgagc 1140

gagcugaagu accuggggcu ggacacgcac agcaggaaga agaggcagcu guacagcgcg 1200

cuggcgaaca agugcugcca cguggggugc acgaagagga gccuggcgag guucugc 1257

<210> 433

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 433

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accugguccg agcccaaguc cuccgacaag 180

acccacaccu ccccccccuc ccccgccccc gagcuccucg gcggcuccuc cgucuuccuc 240

uuccccccca agcccaagga cacccucuac aucacccgcg agcccgaggu caccugcguc 300

gucgucgacg ucucccga ggaccccgag gucaaguuca acugguacgu cgacggcguc 360

gagguccaca acgccaagac caagccccgc gaggagcagu acaacuccac cuaccgcguc 420

gucuccgucc ucaccguccu ccaccaggac uggcucaacg gcaaggagua caagugcaag 480

gucuccaaca aggccccc cgcccccauc gagaagacca ucuccaaggc caagggccag 540

ccccgcgagc cccaggucu cacccucccc cccucccgcg acgagcucac caagaaccag 600

gucucccuca ccugccucgu caagggcuuc uaccccuccg acaucgccgu cgagugggag 660

uccaacggcc agcccgagaa caacuacaag accaccccccc ccguccucga cuccgacggc 720

uccuucuucc ucuacuccaa gcucaccguc gacaaguccc gcuggcagca gggcaacguc 780

uucuccugcu ccgucaugca cgaggcccuc cacaaccacu acacccagaa gucccucucc 840

cucucccccg gcaagcgcaa gaagcgcucc cucucccagg aggacgcccc ccagaccccc 900

cgccccgucg ccgagaucgu ccccuccuuc aucaacaagg acaccgagac caucaacaug 960

auguccgagu ucgucgccaa ccucccccag gagcucaagc ucacccucuc cgagaugcag 1020

cccgcccucc cccagcucca gcagcacguc cccguccuca aggacuccuc ccuccucuuc 1080

gaggaguuca agaagcucau ccgcaaccgc caguccgagg ccgccgacuc cucccccucc 1140

gagcucaagu accucggccu cgacacccac ucccgcaaga agcgccagcu cuacuccgcc 1200

cucgccaaca agugcugcca cgucggcugc accaagcgcu cccucgcccg cuucugc 1257

<210> 434

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 434

augccccgcc uguucuucuu ccaccuccuc ggcgucugcc uccuccucaa ccaguucucc 60

cgcgccgugg cggacagcug gauggaggag gugaucaagc ucugcggccg cgagcucgug 120

cgcgcccaga ucgccauuug cggcauggag cccaaggcu ccgacaagac ccacaccagc 180

ccgcccagcc ccgccccuga gcugcugggc ggauccagcg ucuuccuguu uccccccaag 240

cccaaggaca cccuguacau cacaagggag cccgagguca ccugcguggu gguggacguc 300

agccacgagg accccgaggu gaaauuuaac ugguacguag acggcgugga ggugcacaac 360

gccaagacca agcccaggga ggagcaguac aacagcaccu accggguggu aagcguccug 420

accgugcugc accggacug gcugaacggc aaggaguaua agugcaaagu gagcaacaag 480

gcccugcccg cccccaucga gaagaccauc agcaaggcca aggggcagcc ccgggagcca 540

cagguguaca cccugcccc cagcagggac gagcugacca agaaccaggu gagucucaca 600

ugccugguua agggcuucua cccauccgac aucgccgugg agugggaaag caacggucag 660

cccgagaaca acuacagac cacgcccccg gugcuggacu ccgacggcag cuucuuccug 720

uacuccaagc ucaccgugga caaguccagg uggcagcagg ggaacguguu cagcugcagc 780

gugaugcaug aggcugca caaccacuac acgcagaagu cccugucucu gagcccaggc 840

aagcgcaaga gcaccuggag caagaggucc cugagccaag aggacgcccc ccagaccccc 900

cggccugugg ccgagaucgu gccagcuuc aucaacaagg acaccgagac gaucaacaug 960

augagcgaau uuguggccaa ucugccccag gagcugaagc ucacccucuc cgaaaugcag 1020

cccgcccucc cccaacugca acaacacguc cccgugcuga aggacagcag ccugcuguuu 1080

gaggaauuua agaagcucau cagaaacaga cagagcgagg ccgcggacuc cagccccagc 1140

gagcugaagu accugggccu ggacacccau agcaggaaga agcggcagcu guacagcgcc 1200

cucgccaaca agugcugcca cgugggcugc accaagagaa gccuggccag guucugc 1257

<210> 435

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 435

augccccgac ucuucuucuu ccaccuccuc ggcgugugcc uccuccucaa ccaguucucu 60

cgagccgugg ccgauuccug gauggaggag gugaucaagc ucugcggcag agaacucgug 120

agagcccaga ucgccauuug ugggauggag cccaaggca gcgacaagac ccauacuagc 180

ccacccuccc ccgcccccga gcugcugggg ggcagcagcg uguuccuguu ucccccgaag 240

cccaaggaca cccuguacau cacccgggag cccgagguga ccugcguggu ugucgacgug 300

ucacacgaag accccgaggu gaaguucaac ugguacgugg acggcgucga ggugcacaac 360

gccaagacca agcccaggga ggagcaguac aacagcacgu acagaguggu gucaguccug 420

accguccucc accaggauug gcucaacggc aaagaguaca agugcaaggu gagcaacaag 480

gcccugcccg cccccaucga gaagacaauc uccaaggcca agggccagcc gagggagccc 540

cagguguaua cccugccccc cucaagggac gagcugacca agaaucaggu gucccucaca 600

ugccugguga agggguucua ccccagcgac aucgccgugg agugggagag caacggacag 660

cccgagaaca acuacaagac cacacccccc gugcuggaca gcgauggaag uuucuuccug 720

uauagcaaac ugaccgugga caaaucacgg uggcagcagg gcaacguguu cagcugcagc 780

gugaugcacg aagccugca caaccacuac acccagaagu cauuaucucu gagccccggc 840

aagagaaaga gcacguggag caagaggagc cucucccagg aggacgcccc ccagaccccc 900

cggcccgugg ccgagaucgu gcccuccuuu auuaacaagg acaccgagac aaucaacaug 960

auguccgagu ucgucgccaa ucugccccag gagcucaagc ucacccugag cgagaugcag 1020

cccgcucugc cccagcugca gcaacacgug cccgugcuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau ccgcaaccgg caaagcgagg ccgcugacag cucgcccagc 1140

gagcugaagu accuggggcu ggacacccac agccggaaga agcggcagcu guacagcgcc 1200

cuggccaaca agugcugcca cguggggugc acuaagcgga gccuggccag auuuugc 1257

<210> 436

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 436

augcccagac uguucuucuu ucaccuccuc ggcguguguc uuuuacucaa ccaauuuagc 60

agagccgugg ccgacucuug gauggaggag gugaucaagc ucuguggccg cgagcuuguc 120

cgggcccaga ucgcuaucug cggaauggag cccaaguccu ccgacaagac ccacaccucc 180

ccacccaguc ccgcccccga gcugcucgggg ggcagcagcg uguuccuguu cccuccuaag 240

cccaaggaca cgcuguacau caccagggag cccgagguca ccugcguggu gguggacgug 300

ucccaugagg accccgaggu gaaguucaac ugguacgugg acggcgugga gguucacaac 360

gcuaagacca agccccgcga ggaacaguac aacagcaccu aucgggucgu gucaguucug 420

accguccucc accaggacug gcugaacggc aaggaguaca agugcaaggu gagcaacaaa 480

gcccuccccg ccccgaucga gaagaccauc agcaaggcca agggccagcc ccgagagccc 540

cagguguaca cccuuccccc cagcaggac gagcucacaa agaaucaggu gagccugacc 600

ugccugguga agggcuucua ccccuccgac aucgcggugg aaugggagag caacggccag 660

ccggagaaca acuauaagac aacaccccc gugcuggaca gcgacggcag cuucuuccuc 720

uacagcaagc ugaccgucga caaguccaga uggcagcagg gcaacguguu cagcugcucc 780

gugaugcacg aagccugca caaucacuac acucagaaau cccugucccu gagccccggc 840

aagcggaagu ccaccuggag uaagcggagu cugagccagg aggacgcccc ccaaaccccc 900

cgacccgugg ccgagaucgu gcccuccuuc aucaauaagg acaccgagac uaucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacgcuguc ugagaugcag 1020

ccugcccugc cccagcugca gcagcacgug ccagugcuga aggacagcag ccugcuguuc 1080

1140 gaggaguuua agaagcuaau cagaaaccgc caguccgagg

gagcucaagu accugggccu ggacacccau ucccgcaaga agaggcagcu guacucggcc 1200

cuggccaaca agugcuguca cgucggaugu accaagagaa gucuggccag guucugc 1257

<210> 437

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 437

augccgcggc uuuucuucuu ccaccuccuc ggcgugugcc uacuccuuaa ccaauucucc 60

cgagccgucg ccgacagcug gauggaggag gugaucaaac ucugcggcag ggagcucgug 120

agggcccaga uagccaucug cggcauggaa cccaagucca gcgacaagac ccacaccagc 180

ccgcccagcc ccgccccga gcugcugggc ggcucaagcg uguuccuguu cccgcccaag 240

cccaaggaca cccuguacau caccagagag ccggagguca ccugcguggu gguggacgug 300

ucucacgagg accccgaagu caaguucaac ugguacgugg auggcgugga ggugcacaau 360

gcaaagacca agccgagaga ggaacaguac aacucgacgu accgggucgu gagcguccug 420

accgugcugc accggacug gcugaauggc aaggaguaca agugcaaagu gucgaauaag 480

gcccugcccg cccccaucga gaagaccauc uccaaggcca agggccagcc cagagaaccg 540

cagguauaca cccugccccc uucccgggac gagcugacca agaaccaggu gucucucacg 600

ugccugguga agggcuucua ccccagcgac aucgccgugg agugggaguc caauggucag 660

cccgagaaca acuauaagac cacgccgccc gugcuggacu cagacggcuc cuucuuccuc 720

uacagcaaac ugacggugga caagagccgg uggcagcagg gcaacguguu cuccugcagc 780

gucaugcacg aggccugca caaccacuac acucagaagu cccugagccu gagcccgggg 840

aagcgaaagu cuaccuggag caagcggagc cugagccaag aggacgcccc ccaaacaccc 900

cggcccgugg ccgagauagu gccuagcuuc auuaacaagg acaccgagac uaucaacaug 960

augagcgagu ucguggcgaa ccugccccag gagcugaagc ugacccuguc cgagaugcag 1020

ccggcccugc cucagcugca gcagcacgug cccgugcuga aggacagcag ccugcuguuu 1080

gaggaguuca agaagcugau ccgcaaccgc caaagcgaag ccgccgacuc cagcccuagc 1140

gagcucaagu accugggccu ggacacgcac agcaggaaga agaggcagcu guacagcgcc 1200

1257

<210> 438

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 438

augccccgcc uguucuucuu ccaccuccuu ggcgugugcc uccuccuaaa ucaguucagc 60

120 cgcgccgugg ccgacagcug gauggaggag gugaucaagc

cgggcccaga ucgccaucug cggcauggag cccaagucca gcgacaagac ccacaccucg 180

ccccccagcc ccgcccccga gcugcugggc gggagcagcg uuuuccuguu uccaccuaag 240

300

agccacgagg accccgaggu gaaguucaac ugguacgucg auggcgucga ggugcacaac 360

gccaagacca agcccaggga ggagcaguac aacagcaccu acagaguggu guccgugcug 420

accgugcugc accggacug gcugaacgga aaggaguaca agugcaaggu gagcaacaag 480

gcccugcccg cgccgaucga gaagaccaua agcaaggcca agggccaacc gagggagccc 540

cagguguaca cccugccccc cagcagagac gagcugacca agaaccaggu gagccugacc 600

ugccugguca agggcuucua ccccagcgau aucgccgugg aaugggaguc caacggacag 660

ccggagaaca acuacagac cacgcccccc gugcucgaca gcgacggguc cuucuuccug 720

uacucgaagc ugaccgugga caagagccgc uggcagcagg gcaacguguu cagcugcucc 780

gugaugcaug aggccugca caaccacuau acgcagaagu cgcucagccu gagccccggc 840

aagcgaaaga gcaccuggag caagcgaagc cuuagccagg aggaugcccc ccagacaccc 900

cggccagugg cugagaucgu ccccagcuuc aucaacaaag aacacugagac aauuuaauug 960

augagcgagu ucguggccaa ucugccccag gagcucaagc ugacccucag cgagaugcag 1020

cccgcucugc cccagcugca acagcacguu cccgugcuga aggacagcuc ucugcuguuc 1080

gaggaguuca agaagcugau caggaaccga cagagcgagg ccgccgacuc cagccccucg 1140

gagcucaaau accucggccu cgacacccac agcaggaaga agaggcagcu guacagcgcc 1200

cuggccaaca agugcugcca cgucggcugc accaagaggu cacucgccag guucugc 1257

<210> 439

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 439

augcccaggc uguucuucuu ccaccuccuc ggcgugugcc uccuccucaa ucaguucagc 60

agagccgugg ccgauagcug gauggaggag gucauuaagc ucugcggcag agagcucgug 120

cgagcccaga ucgccaucug cggcauggag cccaaggca gcgauaagac ccauaccucu 180

ccucccagcc ccgcccccga gcugcugggc ggcuccuccg uguuccuguu cccucccaag 240

cccaaagaca cccuguacau caccagagaa cccgagguga ccugugucgu gguggacgug 300

agccacgagg acccggaggu gaaguucaau ugguacgugg auggugucga ggugcacaac 360

gccaagacga agcccaggga ggagcaguau aacagcacuu aucgcguggu cagcgugcug 420

accguccugc acccaagacug gcugaacggu aaggaguaua agugcaaggu cagcaacaaa 480

gcccugcccg cucccaucga gaagacgauc agcaaggcca agggccagcc cagggagccc 540

cagguguaca cucugccccc cagcagagac gagcugacca agaaucaggu gagccugacc 600

ugccgguga agggguucua ccccagcgac aucgccgucg agugggagag caacggccag 660

cccgagaaca acuauaagac cacacccccg gugcuggacu ccgacggaag cuucuuccug 720

uacuccaagc ucacaguuga caagagcaga uggcagcagg gcaauguguguu cagcugcagc 780

gugaugcacg aggcccucca caaccacuac acccagaaau cccucagccu gagccccggc 840

aagaggaagu cgaccuggag caagaggagc cugucccagg aggacgcccc ccaaacgccc 900

cggccggugg ccgagaucgu ccccagcuuc aucaacaagg acaccgagac uauaaacaug 960

augagcgagu ucguggccaa ccugccccag gagcucaagc ugacccugag cgagaugcag 1020

1080

gaggaguuca agaagcugau caggaacagg cagagcgagg ccgccgacag cagccccagc 1140

gagcugaagu accugggacu ggacacccac agccggaaga agcgccagcu cuacagcgcc 1200

cuggccaaca agugcugcca ugggggugc accaagcggu cccuggccg guucugc 1257

<210> 440

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 440

60

cgcgccgucg ccgacuccug gauggaggaa gugaucaagc ucuguggccg ggagcucgug 120

cgggcucaga uugcaaucug cgggauggag cccaagucgu ccgacaagac ccacaccagc 180

ccgcccucgc ccgcccccga gcugcuuggc ggcagcagcg uguuccuguu uccccccaag 240

cccaaggaca cccuguacau cacccgggaa cccgagguga ccugcgucgu gguggacgug 300

ucccgagg accccgaggu caaguucaac ugguacgugg acggcgugga ggugcacaau 360

gccaagacca agcccaggga ggagcaauac aacuccaccu aucggguggu gagcgugcug 420

accgugcugc accggacug gcugaacggc aaggaguaca agugcaaggu gucaaacaag 480

gcgcugccg cccccaucga gaagacaauc uccaaggcca agggccagcc ccgggagccc 540

cagguguaca cccugcccc cagccgggac gagcugacca agaaccaggu uagccuuaca 600

ugcgguca agggcuucua ccccuccgac aucgccgugg agugggaguc caacggccag 660

cccgagaaca acuacaagac cacacccccc gugcuggacu ccgacggcuc cuucuuccuu 720

uacucuaagc ugaccgugga caagagccgc uggcaacagg gcaaugucuu cuccugcucc 780

gugaugcacg aggccugca caaucacuac acccagaagu cccugagccu guccicugga 840

aagcggaagu ccaccuggag caagaggagc cugucccagg aggaugcccc ucagaccccc 900

aggcccgugg ccgagaucgu gccuucauuu auuaacaagg acaccgagac gaucaacaug 960

auguccgagu uuguggccaa ccugccccag gagcugaagc ucacccucag cgaaaugcag 1020

cccgcccugc cccagcugca gcagcacgug cccgugcuga aggacuccuc gcugcucuuu 1080

1140

gagcugaagu accugggccu ggacacccac agccggaaga agcgucagcu guacagcgcc 1200

cuggccaaca aauguuguca cgugggcugc acuaagagga gccuggccag auuuugu 1257

<210> 441

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 441

augccccggu uauucuucuu ccacuugcuu ggcgugugcc uccuccucaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc uaugcggccg ggagcucgug 120

cgggcccaga ucgccaucug cggcauggag cccaaggca gcgacaagac ccacaccucc 180

ccaccauccc cugcccccga gcugcuggga ggcagcagcg uguuccuguu cccaccuaag 240

cccaaggaca cccuguacau cacccgggag cccgagguga ccugcguggu gguggacgug 300

agccacgagg acccugaggu gaaguucaac ugguacgugg acggcgugga ggugcacaac 360

gccaagacca agccccggga ggagcaguac aacagcaccu accggguggu gagcgugcug 420

accgugcugc accggacug gcugaacggc aaggaguaca agugcaaggu gagcaacaag 480

gccugccug ccccuaucga gaagaccauc agcaaggcca agggccagcc ucgggagcca 540

cagguguaca cccugccucc uucccgggac gagcugacca agaaccaggu gagccugacc 600

ugccugguga agggcuucua ccccagcgac aucgccgugg agugggagag caacggucag 660

ccugagaaca acuacagac cacuccaccc gugcuggaca gcgacggcag cuucuuccug 720

uacagcaagc uuaccgucga caagagccgg uggcagcagg gcaacguguu cagcugcagc 780

gugaugcacg aagccugca caaccacuac acccagaaga gucugucacu gagccccggc 840

aagaggaagu ccaccugguc aaagcggagc cugagccagg aggacgcucc ucaaaccccc 900

cggccagugg ccgagaucgu gccgcuuc aucaauaagg aacacagagac aaucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacgcucag cgagaugcag 1020

cccgcccucc cucaacuaca gcagcacgug ccggugcuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau cgggaaccgg cagagcgagg ccgcugacag cuccccuucc 1140

gagcuuaagu accugggccu ggacacccac agccggaaga agaggcagcu guacagugcc 1200

cuggccaaca agugcugcca cgugggcugc acuaagaggu cacuggcccg guucugc 1257

<210> 442

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 442

augccccggc uuuucuucuu ccacuuacuc ggcgugugcc uucuccuuaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ucugcggccg ggagcucgug 120

cgggcccaga ucgccaucug cggcauggag cccaaggca gcgacaagac ccacaccagc 180

ccuccuaguc cugcgcccga gcugcuuggc ggcagcagcg uguuccuguu cccaccgaag 240

cccaaggaca cccuguacau cacccgggag cccgagguga ccugcguggu gguggacgug 300

agccacgagg acccggaggu gaaguucaac ugguacgugg acggcgugga ggugcacaac 360

gccaagacca agccccggga ggagcaguac aacagcaccu accggguggu gagcgugcug 420

accgugcugc accggacug gcugaacggc aaggaguaca agugcaaggu gagcaacaag 480

gcccugccug ccccaaucga gaagaccauc agcaaggcca agggccaacc acgagagccg 540

cagguguaca cccugccucc uagccgggac gagcugacca agaaccaggu gagccugacc 600

ugccugguga agggcuucua ccccagcgac aucgccgugg agugggagag caacggucag 660

ccugagaaca acuacaagac cacaccuccc gugcuggaca gcgacggcag cuucuuccug 720

uacagcaagc ugacaguuga caagagccgg uggcagcagg gcaacguguu cagcugcagc 780

gugaugcacg aggccugca caaccacuac acccagaaga gucugucucu guccccuggc 840

aagaggaagu ccaccugguc caagaggucc cugagccagg aggacgcccc gcagaccccc 900

cggccugugg cugagaucgu gcccagcuuc aucaauaagg auaccgagac aaucaacaug 960

augagcgagu ucguggccaa uuugccacag gagcugaagc ugacgcugag cgagaugcag 1020

cccgcccugc cgcagcucca gcaacacgug ccuguccuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau cgggaaccgg cagagcgagg cgccgacuc uucuccgucc 1140

gaacugaagu accugggccu ggacacccac agcgggaaga agcggcagcu cuacuccgcc 1200

cuggccaaca agugcugcca cgugggaugc accaagcgaa gccuggcccg guucugc 1257

<210> 443

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 443

augccccggu uauucuucuu ccacuuauua ggcgugugcu uacuccucaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ucugcggccg ggaguuggug 120

cgggcccaga ucgccaucug cggcauggag cccaaggca gcgacaagac ccacaccagc 180

ccuccuagcc cugcccccga gcugcuggga ggcagcagcg uguuccuguu cccuccgaag 240

cccaaggaca cccuguacau cacccgggag cccgagguga ccugcguggu gguggacgug 300

agccacgagg acccugaggu gaaguucaac ugguacgugg acggcgugga ggugcacaac 360

gccaagacca agccccggga ggagcaguac aacagcaccu accggguggu gagcgugcug 420

accgugcugc accggacug gcugaacggc aaggaguaca agugcaaggu gagcaacaag 480

gccugccag cuccuacga gaagaccauc agcaaggcca agggccagcc uagagagccu 540

cagguguaca cccugccgcc aagccgggac gagcugacca agaaccaggu gagccugacc 600

ugccugguga agggcuucua ccccagcgac aucgccgugg agugggagag caacggacag 660

ccugagaaca acuacagac caccccaccc gugcuggaca gcgacggcag cuucuuccug 720

uacagcaagc ucaccgugga caagagccgg uggcagcagg gcaacguguu cagcugcagc 780

gugaugcacg aagccugca caaccacuac acccagaagu cccuaucucu gagccccggc 840

aagagaaagu ccaccuggag caagagaagu cugagccagg aggacgcucc acagaccccc 900

cggccagugg ccgagaucgu gccagcuuc aucaacaagg auacagaaac cauuaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacacugag cgagaugcag 1020

ccgcucugc cucagcuuca gcagcacgug ccugugcuga aggacagcag ccugcuguuc 1080

1140

gaacucaagu accugggccu ggacacccac agccggaaga agcggcagcu guauagcgcc 1200

cuggccaaca agugcugcca cgugggcugc acaaagcgua gccuggcccg guucugc 1257

<210> 444

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 444

augccccggc uuuucuucuu ccaccuccuu ggcgugugcc uccuccuuaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcauggag cccaaguccu ccgacaagac ccacaccagc 180

ccgccaagcc cagcccccga gcuccucggc ggcuccuccg ucuuccucuu cccuccaaag 240

cccaaggaca cccucuacau cacccgcgag cccgagguca ccugcgucgu cgucgacguc 300

ucccgagg acccagaggu uaaguucaac ugguacgucg acggcgucga gguccacaac 360

gccaagacca agccccgcga ggagcaguac aacuccaccu accgcgucgu cuccguccuc 420

accguccucc accaggacug gcucaacggc aaggaguaca agugcaaggu guccaacaag 480

gcccugccug ccccaaucga gaagaccauc uccaaggcca agggccagcc ucgggagccu 540

caggucuaca cccugccacc uagucgcgac gagcucacca agaaccaggu gucccucacc 600

ugccucguca agggcuucua cccuagcgac aucgccgucg agugggaguc caacggccag 660

ccagagaaca acuacagac caccccuccc guccucgacu ccgacggcuc cuucuuccug 720

uacuccaagc ucacugugga caagucccgc uggcagcagg gcaacgucuu cuccugcucc 780

gucaugcacg aagcucucca caaccacuac acccagaagu cccucucacu gagccccggc 840

aagcgcaagu ccaccugguc caagcggagc cucucgcagg aggacgcccc ccagacacca 900

cgcccugucg ccgagaucgu ccccuccuuc aucaauaagg acacggagac gaucaacaug 960

auguccgagu ucgucgccaa ccugccacag gagcugaagc ugacccucuc cgagaugcag 1020

cccgcccugc cgcagcucca gcagcacgug ccagugcuga aggacuccuc ccuccucuuc 1080

gaggaguuca agaagcucau ccgcaaccgc caguccgagg ccgcugacuc aagcccuuca 1140

gagcuuaagu accucggccu cgacacccac ucccgcaaga agcgccagcu guacagcgcc 1200

cucgccaaca agugcugcca cgucggcugc acaaagcgaa gccuggcccg cuucugc 1257

<210> 445

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 445

augcccaggc uguucuucuu ccaccuccuu ggcgugugcc ucuuacucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcauggag cccaaguccu ccgacaagac ccacaccucu 180

ccaccgagcc cagcccccga gcuccucggc ggcuccuccg ucuuccucuu cccuccuaag 240

cccaaggaca cccucuacau cacccgcgag cccgagguca ccugcgucgu cgucgacguc 300

ucccgagg acccagaggu gaaguucaac ugguacgucg acggcgucga gguccacaac 360

gccaagacca agccccgcga ggagcaguac aacuccaccu accgcgucgu cuccguccuc 420

accguccucc accaggacug gcucaacggc aaggaguaca agugcaaggu guccaacaag 480

gccugccug ccccuaucga gaagaccauc uccaaggcca agggccagcc acgggagcca 540

caggucuaca cacugccucc gagccgcgac gagcucacca agaaccaggu gucccucacc 600

ugccucguca agggcuucua cccuagcgac aucgccgucg agugggaguc caacggccag 660

ccggagaaca acuacagac caccccgccc guccucgacu ccgacggcuc cuucuuccug 720

uacuccaagc ugacagga caagucccgc uggcagcagg gcaacgucuu cuccugcucc 780

gucaugcacg aggcucugca caaccacuac acccagaagu cccucagccu gucucccggc 840

aagcgcaagu ccaccugguc caagaggagc uugucccagg aggacgcccc ccagacucca 900

cgcccugucg ccgagaucgu ccccuccuuc aucaauaagg acacagagac gaucaacaug 960

auguccgagu ucgucgccaa ccuuccucag gagcugaagc ugacccucuc cgagaugcag 1020

cccgcccugc cgcagcucca gcagcacgug ccagugcuca aggacuccuc ccuccucuuc 1080

gaggaguuca agaagcucau ccgcaaccgc caguccgagg ccgccgacag uagcccuucc 1140

gagcucaagu accucggccu cgacacccac ucccgcaaga agcgccagcu guauucagcc 1200

cucgccaaca agugcugcca cgucggcugc acgaagcgga gccuggcccg cuucugc 1257

<210> 446

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 446

augcccaggu uguucuucuu ccaccuuuug ggcgugugcc uccuucucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcauggag cccaaguccu ccgacaagac ccacaccucu 180

ccuccgaguc cagcacccga gcuccucggc ggcuccuccg ucuuccucuu cccgccuaag 240

cccaaggaca cccucuacau cacccgcgag cccgagguca ccugcgucgu cgucgacguc 300

ucccgagg acccagaggu caaguucaac ugguacgucg acggcgucga gguccacaac 360

gccaagacca agccccgcga ggagcaguac aacuccaccu accgcgucgu cuccguccuc 420

accguccucc accaggacug gcucaacggc aaggaguaca agugcaaggu guccaacaag 480

gcccuuccug ccccuaucga gaagaccauc uccaaggcca agggccagcc acgggagccu 540

caggucuaca cccugccucc uagccgcgac gagcucacca agaaccaggu gucccucacc 600

ugccucguca agggcuucua cccuagcgac aucgccgucg agugggaguc caacggucag 660

ccugagaaca acuacaagac caccccaccc guccucgacu ccgacggcuc cuucuuccuu 720

uacuccaagc ugaccgugga caagucccgc uggcagcagg gcaacgucuu cuccugcucc 780

gucaugcacg aggccugca caaccacuac acccagaagu cccucucucu gagccccggc 840

aagcgcaagu ccaccugguc caagagaucu cucagccagg aggacgcccc ccagacccca 900

cgcccagucg ccgagaucgu ccccuccuuc aucaacaagg auaccgaaac caucaacaug 960

auguccgagu ucgucgccaa ccugccacag gagcugaagc ucacacucuc cgagaugcag 1020

ccgcgcucc cacagcucca gcagcacgug ccugugcuga aggacuccuc ccuccucuuc 1080

1140

gaacugaagu accucggccu cgacacccac ucccgcaaga agcgccagcu guacagcgcc 1200

cucgccaaca agugcugcca cgucggcugc acaaagcgca gccuggcccg cuucugc 1257

<210> 447

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 447

augccccggc uuuucuucuu ccaccuacuc ggcgugugcc uucuccuuaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ucugcggccg ggagcuugug 120

cgggcccaga ucgccaucug cggcauggag cccaaggca gcgacaagac cccaccucu 180

ccgccgagcc cagcucccga gcuccugggc ggcagcagcg uguuccuguu cccaccaaag 240

cccaaggaca cccuguacau cacccgggag cccgagguga ccugcguggu gguggacgug 300

agccacgagg acccggaggu gaaguucaac ugguacgugg acggcgugga ggugcacaac 360

gccaagacca agccccggga ggagcaguac aacagcaccu accggguggu gagcgugcug 420

accgugcugc accggacug gcugaacggc aaggaguaca agugcaaggu gagcaacaag 480

gccugccug ccccuaucga gaagaccauc agcaaggcca agggccagcc gcgggagccu 540

cagguguaca cccugccucc uucucgggac gagcugacca agaaccaggu gagccugacc 600

ugccgguga agggcuucua ccccagcgac aucgccgugg agugggagag caacggccag 660

ccugagaaca acuacagac caccccuccc gugcuggaca gcgacggcag cuucuuccug 720

uacagcaagu uaaccgugga caagagccgg uggcagcagg gcaacguguu cagcugcagc 780

gugaugcacg aggcacugca caaccacuac acccagaaga gucugagucu cagccccggc 840

aagcggaagu caaccuggag caagcgaagc cugucccagg aggacgcccc ucagaccccc 900

cggccugugg cggagaucgu gcccagcuuc aucaacaagg auaccgagac aauaaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacucugag cgagaugcag 1020

ccgcccugc cacaauugca gcagcacgug ccugugcuga aggacagcag ccugcuguuc 1080

gaggaguuca agaagcugau cgggaaccgg cagagcgagg ccgccgacag uagcccuagc 1140

gaacuuaagu accugggccu ggacacccac agccggaaga agcggcagcu guacuccgcc 1200

cuggccaaca agugcugcca cgugggcugu accaagagga gccuggcccg guucugc 1257

<210> 448

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 448

augccccggc uuuucuucuu ccacuugcuc ggcgugugcc uacuucucaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ucugcggccg ggagcucgug 120

cgggcccaga ucgccaucug cggcauggag cccaaggca gcgacaagac cccaccucu 180

ccuccuagcc cugcccccga gcuccugggc ggcagcagcg uguuccuguu cccaccuaag 240

cccaaggaca cccuguacau cacccgggag cccgagguga ccugcguggu gguggacgug 300

agccacgagg acccagaagu gaaguucaac ugguacgugg acggcgugga ggugcacaac 360

gccaagacca agccccggga ggagcaguac aacagcaccu accggguggu gagcgugcug 420

accgugcugc accggacug gcugaacggc aaggaguaca agugcaaggu gagcaacaag 480

gccugccag ccccuaucga gaagaccauc agcaaggcca agggacagcc aagagagccu 540

cagguguaca cccugccacc uagccgggac gagcugacca agaaccaggu gagccugacc 600

ugccgguga agggcuucua ccccagcgac aucgccgugg agugggagag caacggccag 660

ccugagaaca acuacagac caccccaccc gugcuggaca gcgacggcag cuucuuccug 720

uacagcaagc ucacagugga caagagccgg uggcagcagg gcaacguguu cagcugcagc 780

gugaugcacg aggcccucca caaccacuac acacagaagu cccugagccu uagccccggc 840

aagagaaaga gcaccugguc caagagaagu cugucccagg aggacgcccc ucagaccccc 900

cggccagugg cugagaucgu gcccagcuuc aucaacaagg auacagagac uaucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacccugag cgagaugcag 1020

cccgcccuuc cacaacugca gcagcacgug ccagugcuga aggacagcag ccugcuguuc 1080

1140

gaacucaagu accugggccu ggacacccac agccggaaga agcggcagcu guacagugcc 1200

cuggccaaca agugcugcca cgugggaugc accaagcgga gccuggcccg guucugc 1257

<210> 449

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 449

augccccggc uuuucuucuu ccaccucuug ggcgugugcc ucuugcucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcauggag cccaaguccu ccgacaagac ccacaccagc 180

ccaccuucac cggcccccga gcuccucggc ggcuccuccg ucuuccucuu cccaccuaag 240

cccaaggaca cccucuacau cacccgcgag cccgagguca ccugcgucgu cgucgacguc 300

ucccgagg acccagaggu gaaguucaac ugguacgucg acggcgucga gguccacaac 360

gccaagacca agccccgcga ggagcaguac aacuccaccu accgcgucgu cuccguccuc 420

accguccucc accaggacug gcucaacggc aaggaguaca agugcaaggu uuccaacaag 480

gcccucccag ccccaaucga gaagaccauc uccaaggcca agggccagcc ucgagagcca 540

caggucuaca cccugccacc uucccgcgac gagcucacca agaaccaggu gucccucacc 600

ugccucguca agggcuucua cccuuccgac aucgccgucg agugggaguc caacggacaa 660

ccagagaaca acuacagac caccccgccc guccucgacu ccgacggcuc cuucuuccug 720

uacuccaagc ugaccgugga caagucccgc uggcagcagg gcaacgucuu cuccugcucc 780

gucaugcacg aggccugca caaccacuac acccagaagu cccucucacu cucccccggc 840

aagcgcaagu ccaccugguc caagagaucc cugucccagg aggacgcccc ccagacacca 900

cguccugucg ccgagaucgu ccccuccuuc aucaacaagg auacagaaac caucaacaug 960

auguccgagu ucgucgccaa ccuuccucag gagcugaagc ucacccucuc cgagaugcag 1020

cccgccuugc cacagcucca gcagcacguu ccugugcuca aggacuccuc ccuccucuuc 1080

1140

gagcuaaagu accucggccu cgacacccac ucccgcaaga agcgccagcu cuauuccgcc 1200

cucgccaaca agugcugcca cgucggcugc acaaagagaa gccucgcccg cuucugc 1257

<210> 450

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 450

augcccagac ucuucuucuu ccaccuucuc ggcgugugcc uccuucucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcauggag cccaaguccu ccgacaagac ccacaccagc 180

ccaccuagcc cagcccccga gcuccucggc ggcuccuccg ucuuccucuu cccuccgaag 240

cccaaggaca cccucuacau cacccgcgag cccgagguca ccugcgucgu cgucgacguc 300

ucccgagg acccagaggu gaaguucaac ugguacgucg acggcgucga gguccacaac 360

gccaagacca agccccgcga ggagcaguac aacuccaccu accgcgucgu cuccguccuc 420

accguccucc accaggacug gcucaacggc aaggaguaca agugcaaggu guccaacaag 480

gcccugccug ccccaaucga gaagaccauc uccaaggcca agggccagcc uagagagccu 540

caggucuaca cccugccucc aagccgcgac gagcucacca agaaccaggu uucccucacc 600

ugccucguca agggcuucua cccuucugac aucgccgucg agugggaguc caacggccag 660

ccagagaaca acuacagac caccccuccc guccucgacu ccgacggcuc cuucuuccug 720

uacuccaagc ugaccgugga caagucccgc uggcagcagg gcaacgucuu cuccugcucc 780

gucaugcacg aggcccucca caaccacuac acccagaagu cccucucccu cucacccggc 840

aagcgcaagu ccaccgguc caagcggucc cugucccagg aggacgcccc ccagaccccu 900

cggccggucg ccgagaucgu ccccuccuuc aucaacaagg auaccgagac gaucaacaug 960

1020

ccgcccugc cgcagcucca gcagcacgug ccuguccuca aggacuccuc ccuccucuuc 1080

gaggaguuca agaagcucau ccgcaaccgc caguccgagg ccgccgauuc cucuccuucc 1140

gagcucaagu accucggccu cgacacccac ucccgcaaga agcgccagcu guauuccgcc 1200

cucgccaaca agugcugcca cgucggcugc acgaagagga gccuggcccg cuucugc 1257

<210> 451

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 451

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ugugcggccg ggagcuggug 120

cgggcccaga ucgccaucug cggcauggag cccaaggca gcgacaagac ccacaccagc 180

ccccccagcc ccgcccccga gcugcugggc ggcagcagcg uguuccuguu cccccccaag 240

cccaaggaca cccuguacau cacccgggag cccgagguga ccugcguggu gguggacgug 300

agccacgagg accccgaggu gaaguucaac ugguacgugg acggcgugga ggugcacaac 360

gccaagacca agccccggga ggagcaguac aacagcaccu accggguggu gagcgugcug 420

accgugcugc accggacug gcugaacggc aaggaguaca agugcaaggu gagcaacaag 480

gcccugcccg cccccaucga gaagaccauc agcaaggcca agggccagcc ccgggagccc 540

cagguguaca cccugccccc cagccgggac gagcugacca agaaccaggu gagccugacc 600

ugccgguga agggcuucua ccccagcgac aucgccgugg agugggagag caacggccag 660

cccgagaaca acuacagac cacccccccc gugcuggaca gcgacggcag cuucuuccug 720

uacagcaagc ugaccgugga caagagccgg uggcagcagg gcaacguguu cagcugcagc 780

gugaugcacg aggccugca caaccacuac acccagaaga gccugagccu gagccccggc 840

aagcggaaga gcaccuggag caagcggagc cugagccagg aggacgcccc ccagaccccc 900

cggcccgugg ccgagaucgu gcccagcuuc aucaacaagg acaccgagac caucaacaug 960

augagcgagu ucguggccaa ccugccccag gagcugaagc ugacccugag cgagaugcag 1020

cccgcccugc cccagcugca gcagcacgug cccgugcuga aggacagcag ccugcuguuc 1080

1140

gagcugaagu accugggccu ggacacccac agccggaaga agcggcagcu guacagcgcc 1200

cuggccaaca agugcugcca cgugggcugc accaagcgga gccuggcccg guucugc 1257

<210> 452

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 452

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

120

agggcgcaga ucgcgaucug cgggauggag ccgaagagca gcgacaagac gcacacgagc 180

ccgccgagcc cggcgccgga gcugcugggg gggagcagcg uguuccuguu cccgccgaag 240

ccgaaggaca cgcuguacau cacgagggag ccggagguga cgugcguggu gguggacgug 300

agccacgagg acccggaggu gaaguucaac ugguacgugg acggggugga ggugcacaac 360

gcgaagacga agccgaggga ggagcaguac aacagcacgu acaggguggu gagcgugcug 420

acggugcugc accaggacug gcugaacggg aaggaguaca agugcaaggu gagcaacaag 480

gcgcugccgg cgccgaucga gaagacgauc agcaaggcga aggggcagcc gagggagccg 540

cagguguaca cgcugccgcc gagcagggac gagcugacga agaaccaggu gagccugacg 600

ugccugguga aggggguucua cccgagcgac aucgcggugg agugggagag caacgggcag 660

ccggagaaca acuacagac gacgccgccg gugcuggaca gcgacggggag cuucuuccug 720

uacagcaagc ugacggugga caagagcagg uggcagcagg ggaacguguu cagcugcagc 780

gugaugcacg aggcgcugca caaccacuac acgcagaaga gccugagccu gagcccgggg 840

aagaggaaga gcacguggag caagaggagc cugagccagg aggacgcgcc gcagacgccg 900

aggccggugg cggagaucgu gccgagcuuc aucaacaagg acacggagac gaucaacaug 960

augagcgagu ucguggcgaa ccugccgcag gagcugaagc

ccggcgcugc cgcagcugca gcagcacgug ccggugcuga aggacagcag cgcuguuc 1080

gaggaguuca agaagcugau caggaacagg cagagcgagg cggcggacag cagcccgagc 1140

gagcugaagu accuggggcu ggacacgcac agcaggaaga agaggcagcu guacagcgcg 1200

cuggcgaaca agugcugcca cguggggugc acgaagagga gccuggcgag guucugc 1257

<210> 453

<211> 1257

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 453

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcauggag cccaaguccu ccgacaagac ccacaccucc 180

ccccccuccc ccgcccccga gcuccucggc ggcuccuccg ucuuccucuu cccccccaag 240

cccaaggaca cccucuacau cacccgcgag cccgagguca ccugcgucgu cgucgacguc 300

ucccgagg accccgaggu caaguucaac ugguacgucg acggcgucga gguccacaac 360

gccaagacca agccccgcga ggagcaguac aacuccaccu accgcgucgu cuccguccuc 420

accguccucc accaggacug gcucaacggc aaggaguaca agugcaaggu cuccaacaag 480

gcccuccccg cccccaucga gaagaccauc uccaaggcca agggccagcc ccgcgagccc 540

caggucuaca cccucccccc cucccgcgac gagcucacca agaaccaggu cucccucacc 600

ugccucguca agggcuucua ccccuccgac aucgccgucg agugggaguc caacggccag 660

cccgagaaca acuacagac cacccccccc guccucgacu cgacggcuc cuucuuccuc 720

uacuccaagc ucaccgucga caagucccgc uggcagcagg gcaacgucuu cuccugcucc 780

gucaugcacg aggcccucca caaccacuac acccagaagu cccucucccu cucccccggc 840

aagcgcaagu ccaccugguc caagcgcucc cucucccagg aggacgcccc ccagaccccc 900

cgccccgucg ccgagaucgu ccccuccuuc aucaacaagg acaccgagac caucaacaug 960

auguccgagu ucgucgccaa ccucccccag gagcucaagc ucacccucuc cgagaugcag 1020

cccgcccucc cccagcucca gcagcacguc cccguccuca aggacuccuc ccuccucuuc 1080

gaggaguuca agaagcucau ccgcaaccgc caguccgagg ccgccgacuc cucccccucc 1140

gagcucaagu accucggccu cgacacccac ucccgcaaga agcgccagcu cuacuccgcc 1200

cucgccaaca agugcugcca cgucggcugc accaagcgcu cccucgcccg cuucugc 1257

<210> 454

<211> 1233

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 454

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg gcagcacaga cuccggcucu 180

gauaccagcu ccggcaacag cggcgauggc aauuccggcc aacucuacag ugcauuggcu 240

aauaaauguu gccauguugg uuguaccaaa agaucucuug cuagauuuug cggcagcaca 300

gacuccggcu cugauaccag cuccggcaac agcggcgaug gcaauuccgg cggcagcucc 360

ggaggaggcu cuggcucuag cuccggcucu agcggcagcg gcggcuccgg cggcagcaca 420

gacuccggcu cugauaccag cuccggcaac agcggcgaug gcaauuccgg cggcagcucc 480

ggaggaggcu cuggcucuag cuccggcucu agcggcagcg gcggcuccgg cgagcccaag 540

agcagcgaca agacccacac cagccccccc agccccgccc ccgagcugcu gggcggcagc 600

agcguguucc uguuccccc caagcccaag gacacccugu acaucaccag ggagcccgag 660

gugaccugcg ugguggugga cgugagccac gaggaccccg aggugaaguu caacugguac 720

guggacggcg uggaggugca caacgccaag accaagccca gggaggagca guacaacagc 780

accuacaggg uggugagcgu gcugaccgug cugcaccagg acuggcugaa cggcaaggag 840

uacaagugca aggugagcaa caaggcccug cccgccccca ucgagaagac caucagcaag 900

gccaagggcc agcccaggga gccccaggug uacacccugc cccccagcag ggacgagcug 960

accaagaacc aggugagccu gaccugccug gugaagggcu ucuaccccag cgacaucgcc 1020

1080

1140

cagggcaacg uguucagcug cagcgugaug cacgaggccc ugcacaacca cuacacccag 1200

aagagccuga gccugagccc cggcaagagg aag 1233

<210> 455

<211> 993

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 455

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg gcagcacaga cuccggcucu 180

gauaccagcu ccggcaacag cggcgauggc aauuccggcc aacucuacag ugcauuggcu 240

aauaaauguu gccauguugg uuguaccaaa agaucucuug cuagauuuug cgagcccaag 300

agcagcgaca agacccacac cagccccccc agccccgccc ccgagcugcu gggcggcagc 360

agcguguucc uguuccccc caagcccaag gacacccugu acaucaccag ggagcccgag 420

gugaccugcg ugguggugga cgugagccac gaggaccccg aggugaaguu caacugguac 480

guggacggcg uggaggugca caacgccaag accaagccca gggaggagca guacaacagc 540

accuacaggg uggugagcgu gcugaccgug cugcaccagg acuggcugaa cggcaaggag 600

uacaagugca aggugagcaa caaggcccug cccgccccca ucgagaagac caucagcaag 660

gccaagggcc agcccaggga gccccaggug uacacccugc cccccagcag ggacgagcug 720

accaagaacc aggugagccu gaccugccug gugaagggcu ucuaccccag cgacaucgcc 780

guggaguggg agagcaacgg ccagcccgag aacaacuaca agaccacccc ccccgugcug 840

gacagcgacg gcagcuucuu ccuguaacagc aagcugaccg uggacaagag cagguggcag 900

cagggcaacg uguucagcug cagcgugaug cacgaggccc ugcacaacca cuacacccag 960

aagagccuga gccugagccc cggcaagagg aag 993

<210> 456

<211> 1053

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 456

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg gcagcacaga cuccggcucu 180

gauaccagcu ccggcaacag cggcgauggc aauuccggcc aacucuacag ugcauuggcu 240

aauaaauguu gccauguugg uuguaccaaa agaucucuug cuagauuuug cggcagcaca 300

gacuccggcu cugauaccag cuccggcaac agcggcgaug gcaauuccgg cgagcccaag 360

agcagcgaca agacccacac cagccccccc agccccgccc ccgagcugcu gggcggcagc 420

agcguguucc uguuccccc caagcccaag gacacccugu acaucaccag ggagcccgag 480

gugaccugcg ugguggugga cgugagccac gaggaccccg aggugaaguu caacugguac 540

guggacggcg uggaggugca caacgccaag accaagccca gggaggagca guacaacagc 600

accuacaggg uggugagcgu gcugaccgug cugcaccagg acuggcugaa cggcaaggag 660

uacaagugca aggugagcaa caaggcccug cccgccccca ucgagaagac caucagcaag 720

gccaagggcc agcccaggga gccccaggug uacacccugc cccccagcag ggacgagcug 780

accaagaacc aggugagccu gaccugccug gugaagggcu ucuaccccag cgacaucgcc 840

guggaguggg agagcaacgg ccagcccgag aacaacuaca agaccacccc ccccgugcug 900

gacagcgacg gcagcuucuu ccuguaacagc aagcugaccg uggacaagag cagguggcag 960

cagggcaacg uguucagcug cagcgugaug cacgaggccc ugcacaacca cuacacccag 1020

aagagccuga gccugagccc cggcaagagg aag 1053

<210> 457

<211> 1317

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 457

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agacaacucu acagugcauu ggcuaauaaa uguugccaug uugguuguac caaaagaucu 540

cuugcuagau uuugcggcag cacagacucc ggcucugaua ccagcuccgg caacagcggc 600

gauggcaauu ccggcgagcc caagagcagc gacaagaccc acaccagccc ccccagcccc 660

gcccccgagc ugcgggcgg cagcagcgug uuccuguucc cccccaagcc caaggacacc 720

cuguaacauca ccagggagcc cgaggugacc ugcguggugg uggacgugag ccacgaggac 780

cccgagguga aguucaacug guacguggac ggcguggagg ugcacaacgc caagaccaag 840

cccagggagg agcaguacaa cagcaccuac agggugguga gcgugcugac cgugcugcac 900

caggacuggc ugaacggcaa ggaguacaag ugcaagguga gcaacaaggc ccugcccgcc 960

cccaucgaga agaccaucag caaggccaag ggccagccca gggagcccca gguguacacc 1020

cugcccccca gcagggacga gcugaccaag aaccagguga gccugaccug ccuggugaag 1080

ggcuucuacc ccagcgacau cgccguggag ugggagagca acggccagcc cgagaacaac 1140

uacaagacca ccccccccgu gcuggacagc gacggcagcu ucuuccugua cagcaagcug 1200

accguggaca agagcaggug gcagcagggc aacguguuca gcugcagcgu gaugcacgag 1260

gcccugcaca accacuacac ccagaagagc cugagccuga gccccggcaa gaggaag 1317

<210> 458

<211> 1317

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 458

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agagagccca agagcagcga caagacccac accagccccc ccagccccgc ccccgagcug 540

cugggcggca gcagcguguu ccuguucccc cccaagccca aggacacccu guacaucacc 600

agggacccg aggugaccug cgugguggug gacgugagcc acgaggaccc cgaggugaag 660

uucaacuggu acguggacgg cguggaggug cacaacgcca agaccaagcc cagggaggag 720

caguacaaca gcaccuacag gguggugagc gugcugaccg ugcugcacca ggacuggcug 780

840

accaucagca aggccaaggg ccagcccagg gagccccagg uguacaccaa gccccccagc 900

agggacgagc ugaccaagaa ccaggugagc cuguccugcc uggugaaggg cuucuacccc 960

agcgacaucg ccguggagug ggagagcaac ggccagcccg agaacaacua caagaccacc 1020

1080

1140

cacuacaccc agaagagccu gagccugagc cccggcaaga ggaagggcag cacagacucc 1200

ggcucugaua ccagcuccgg caacagcggc gauggcaauu ccggccaacu cuacagugca 1260

1317

<210> 459

<211> 978

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 459

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agagaggugc agcugcugga gagcggcggc ggccuggugc agcccggcgg cagccugagg 540

600

gcccccggca agggcugga gugggugagc gccaucagcg gcagcggcgg cagcaccuac 660

uacgccgaca gcgugaaggg cagguucacc aucagcaggg acaacagcaa gaacacccug 720

uaccucaga ugaacagccu gagggccgag gacaccgccg uguacuacug caccaaggac 780

ccccccaggu accacuacac cggccuggcc gugaggggcc agggcaccac cgugaccgug 840

agcagcggca gcacagacuc cggcucugau accagcuccg gcaacagcgg cgauggcaau 900

uccggccaac ucuacagugc auuggcuaau aaauguugcc auguugguug uaccaaaaga 960

ucucuugcua gauuuugc 978

<210> 460

<211> 1317

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 460

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agagagccca agagcagcga caagacccac accagccccc ccagccccgc ccccgagcug 540

cugggcggca gcagcguguu ccuguucccc cccaagccca aggacacccu guacaucacc 600

agggacccg aggugaccug cgugguggug gacgugagcc acgaggaccc cgaggugaag 660

uucaacuggu acguggacgg cguggaggug cacaacgcca agaccaagcc cagggaggag 720

caguacaaca gcaccuacag gguggugagc gugcugaccg ugcugcacca ggacuggcug 780

840

accaucagca aggccaaggg ccagcccagg gagccccagg uguacacccu gccccccagc 900

aggacgagc ugaccaagaa ccaggugagc cugaccugcc uggugaaggg cuucuacccc 960

agcgacaucg ccguggagug ggagagcaac ggccagcccg agaacaacua caagaccacc 1020

ccccccgugc uggacagcga cggcagcuuc uuccuguaca gcaagcugac cguggacaag 1080

1140

cacuacaccc agaagagccu gagccugagc cccggcaaga ggaagggcag cacagacucc 1200

ggcucugaua ccagcuccgg caacagcggc gauggcaauu ccggccaacu cuacagugca 1260

1317

<210> 461

<211> 1317

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 461

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agacaacucu acagugcauu ggcuaauaaa uguugccaug uugguuguac caaaagaucu 540

cuugcuagau uuugcggcag cacagacucc ggcucugaua ccagcuccgg caacagcggc 600

gauggcaauu ccggcgagcc caagagcagc gacaagaccc acaccagccc ccccagcccc 660

gcccccgagc ugcgggcgg cagcagcgug uuccuguucc cccccaagcc caaggacacc 720

cuguaacauca ccagggagcc cgaggugacc ugcguggugg uggacgugag ccacgaggac 780

cccgagguga aguucaacug guacguggac ggcguggagg ugcacaacgc caagaccaag 840

cccagggagg agcaguacaa cagcaccuac agggugguga gcgugcugac cgugcugcac 900

caggacuggc ugaacggcaa ggaguacaag ugcaagguga gcaacaaggc ccugcccgcc 960

cccaucgaga agaccaucag caaggccaag ggccagccca gggagcccca gguguacacc 1020

aagcccccca gcagggacga gcugaccaag aaccagguga gccuguccug ccuggugaag 1080

ggcuucuacc ccagcgacau cgccguggag ugggagagca acggccagcc cgagaacaac 1140

uacaagacca ccguccccgu gcuggacagc gacggcagcu uccgccuggc cagcuaucug 1200

accguggaca agagcaggug gcagcagggc aacguguuca gcugcagcgu gaugcacgag 1260

gcccugcaca accacuacac ccagaagagc cugagccuga gccccggcaa gaggaag 1317

<210> 462

<211> 978

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 462

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agacaacucu acagugcauu ggcuaauaaa uguugccaug uugguuguac caaaagaucu 540

cuugcuagau uuugcggcag cacagacucc ggcucugaua ccagcuccgg caacagcggc 600

gauggcaauu ccggcgaggu gcagcugcug gagagcggcg gcggccuggu gcagcccggc 660

ggcagccuga ggcugagcug cgccgccagc ggcuucaccu ucagcagcua cgccaugagc 720

ugggugaggc aggccccgg caagggccug gaguggguga gcgccaucag cggcagcggc 780

ggcagcaccu acuacgccga cagcgugaag ggcagguuca ccaucagcag ggacaacagc 840

aagaacaccc uguaccugca gaugaacagc cugaggggccg aggacaccgc cguguacuac 900

ugcaccaagg acccccccag guaccacuac accggccugg ccgugagggg cggggcacc 960

accgugaccg ugagcagc 978

<210> 463

<211> 1317

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 463

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg gcagcacaga cuccggcucu 180

gauaccagcu ccggcaacag cggcgauggc aauuccggcg agcccaagag cagcgacaag 240

acccacacca gcccccccag ccccgccccc gagcugcugg gcggcagcag cguguuccug 300

uuccccccca agcccaagga cacccuguac aucaccaggg agcccgaggu gaccugcgug 360

gugguggacg ugagccacga ggaccccgag gugaaguuca acugguacgu ggacggcgug 420

gaggugcaca acgccaagac caagcccagg gaggagcagu acaacagcac cuacagggug 480

gugagcgugc ugaccgugcu gcaccaggac uggcugaacg gcaaggagua caagugcaag 540

gugagcaaca aggccugcc cgccccccauc gagaagacca ucagcaaggc caagggccag 600

cccagggagc cccaggugua caccaagccc cccagcaggg acgagcugac caagaaccag 660

gugagccugu ccugccuggu gaagggcuuc uaccccagcg acaucgccgu ggagugggag 720

agcaacggcc agcccgagaa caacuacaag accaccgucc ccgugcugga cagcgacggc 780

agcuuccgcc uggccagcua ucugaccgug gacaaagca gguggcagca gggcaacgug 840

uucagcugca gcgugaugca cgaggcccug cacaaccacu acacccagaa gagccugagc 900

cugagccccg gcaagaggaa gaaaaggucu cugagccagg aagaugcucc ucagacaccu 960

agaccagugg cagaaauugu gccauccuuc aucaacaaag auacagaaac cauaaauuug 1020

1080

1140

gaagaauuua agaaacuuau ucgcaauaga caaagugaag ccgcagacag caguccuuca 1200

gaauuaaaau acuuaggcuu ggauacucau ucucgaaaaa agagacaacu cuacagugca 1260

1317

<210> 464

<211> 714

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 464

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg gcagcacaga cuccggcucu 180

gauaccagcu ccggcaacag cggcgauggc aauuccggcc aacucuacag ugcauuggcu 240

aauaaauguu gccauguugg uuguaccaaa agaucucuug cuagauuuug cggcagcaca 300

gacuccggcu cugauaccag cuccggcaac agcggcgaug gcaauuccgg cgaggugcag 360

cugcuggaga gcggcggcgg ccuggugcag cccggcggca gccugaggcu gagcugcgcc 420

gccagcggcu ucaccuucag cagcuacgcc augagcuggg ugaggcaggc ccccggcaag 480

ggccuggagu gggugagcgc caucagcggc agcggcggca gcaccuacua cgccgacagc 540

gugaagggca gguucaccau cagcagggac aacagcaaga acacccugua ccugcagaug 600

aacagccuga gggccgagga caccgccgug uacuacugca ccaaggaccc ccccagguac 660

cacuacaccg gccuggccgu gaggggccag ggcaccaccg ugaccgugag cagc 714

<210> 465

<211> 1053

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 465

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagcg gcagcacaga cuccggcucu 180

gauaccagcu ccggcaacag cggcgauggc aauuccggcc aacucuacag ugcauuggcu 240

aauaaauguu gccauguugg uuguaccaaa agaucucuug cuagauuuug cggcagcaca 300

gacuccggcu cugauaccag cuccggcaac agcggcgaug gcaauuccgg cgagcccaag 360

agcagcgaca agacccacac cagccccccc agccccgccc ccgagcugcu gggcggcagc 420

agcguguucc uguuccccc caagcccaag gacacccugu acaucaccag ggagcccgag 480

gugaccugcg ugguggugga cgugagccac gaggaccccg aggugaaguu caacugguac 540

guggacggcg uggaggugca caacgccaag accaagccca gggaggagca guacaacagc 600

accuacaggg uggugagcgu gcugaccgug cugcaccagg acuggcugaa cggcaaggag 660

uacaagugca aggugagcaa caaggcccug cccgccccca ucgagaagac caucagcaag 720

gccaagggcc agcccaggga gccccaggug uacaccaagc cccccagcag ggacgagcug 780

accaagaacc aggugagccu guccugccug gugaagggcu ucuaccccag cgacaucgcc 840

guggaguggg agagcaacgg ccagcccgag aacaacuaca agaccaccgu ccccgugcug 900

gacagcgacg gcagcuuccg ccuggccagc uaucugaccg uggacaagag cagguggcag 960

cagggcaacg uguucagcug cagcgugaug cacgaggccc ugcacaacca cuacacccag 1020

aagagccuga gccugagccc cggcaagagg aag 1053

<210> 466

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 466

augccccggc uguucuucuu ccaccugcug ggcgugugcc uccugcugaa ccaguucagc 60

agggccgugg ccgacagcug gauggaggag gugaucaagc ugugcggcag ggagcuggug 120

agggcgcaga ucgccaucug cggcaugagc accuggagca agaggagccu gagccaggag 180

240

accgagacca ucaauauugau gagcgaguuc guggccaacc ugccccagga gcugaagcug 300

acgcugagcg agaugcagcc ggcccugccg cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc uccuguucga ggaguucaag aagcugauca ggaaccggca gagcgaggcc 420

gccgacucca gccccagcga gcugaaguac cugggccugg acacccauag caggaagaag 480

cgccagcugu acagcgcccu ggcuaacaag ugcugccacg ugggcugcac caagaggagc 540

cuggccggu ucugc 555

<210> 467

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 467

augccccgcc uccuucuucuu ccaccuccuc ggcgugugcc uccuacucaa ccaguuuagc 60

agggccgugg ccgauagcug gauggaggag gugaucaagc ucugcggcag agagcucgug 120

cgggcccaga ucgccaucug cggcaugagc accuggagca agaggagccu gagccaggag 180

240

accgaaacca ucaacaugau gagcgaguuu gucgccaacc ugccccagga gcucaagcug 300

acccugagcg agaugcagcc cgcccugccu cagcugcagc agcacgugcc agugcugaaa 360

gacuccagcc ugcucuuuga agaguucaag aagcugauca ggaacagaca gagcgaggcc 420

gcugacagca gccccucaga gcugaaguac cuggggcugg auacccauag ccgcaagaag 480

cggcagcugu acuccgcccu cgccaacaag ugcugccacg ugggcugcac caagcggagc 540

cucgccgau ucuguggcgg cggagggucc ggcggcggcg gcagcggugg aggcgggagc 600

gacauccaga ugacccagag ccccagcagc cuguccgcca gugugggcga uagagucacc 660

aucacgugca gggccuccag gcccaucggc accaugcuga gcugguacca gcagaagccc 720

ggcaaggcgc ccaagcugcu gauccuggcc uucagcaggc ugcaguccgg ggugcccagc 780

cgguucuccg gcuccggcag cggcaccgac uuuacccuga ccaucagcag ccugcagccu 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac guucggucag 900

ggcacuaagg uggagaucaa gcgg 924

<210> 468

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 468

augccccgcc uccuucuucuu ccaccuccuc ggcgugugcc uccuacucaa ccaguuuagc 60

agggccgugg ccgauagcug gauggaggag gugaucaagc ucugcggcag agagcucgug 120

cgggcccaga ucgccaucug cggcaugagc accuggagca agaggagccu gagccaggag 180

240

accgaaacca ucaacaugau gagcgaguuu gucgccaacc ugccccagga gcucaagcug 300

acccugagcg agaugcagcc cgcccugccu cagcugcagc agcacgugcc agugcugaaa 360

gacuccagcc ugcucuuuga agaguucaag aagcugauca ggaacagaca gagcgaggcc 420

gcugacagca gccccucaga gcugaaguac cuggggcugg auacccauag ccgcaagaag 480

cggcagcugu acuccgcccu cgccaacaag ugcugccacg ugggcugcac caagcggagc 540

cucgccgau ucuguggcgg cggagggucc ggcggcggcg gcagcggugg aggcgggagc 600

gacauccaga ugacccagag ccccagcagc cuguccgcca gugugggcga uagagucacc 660

aucacgugca gggccuccag gcccaucggc accaugcuga gcugguacca gcagaagccc 720

ggcaaggcgc ccaagcugcu gauccuggcc uucagcaggc ugcaguccgg ggugcccagc 780

cgguucuccg gcuccggcag cggcaccgac uuuacccuga ccaucagcag ccugcagccu 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac guucggucag 900

ggcacuaagg uggagaucaa gcgg 924

<210> 469

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 469

augccccggc uguucuucuu ccaccuacuc ggcgucugcc uccucuaaa ccaguuuucc 60

cgcgccgugg ccgacuccug gauggaggag gugaucaagc ucugcggcag agagcucgug 120

agggcccaga ucgcgauuug cggcaugucc accuggagca agaggagccu cagccaggag 180

gacgcgcccc aaaccccgag gcccguggcc gagaucgugc cgagcuuuau caacaaggac 240

accgaaacca ucaacaugau guccgaguuu guggcuaauc ugccccagga gcucaagcuc 300

acacuguccg agaugcagcc cgcccugccc caacugcagc agcacguccc cgugcucaag 360

gacagcagcc uccucuucga ggaauucaag aagcucaucc gcaaccggca gagcgaggcc 420

gccgacagca gccccucaga gcugaaguac cugggccucg acacccacag cgggaagaag 480

aggcagcugu acuccgcccu ggccaacaaa ugcugccaug ugggcugcac aaagaggagc 540

cuggcccggu uuugcgggagg uggugggagc ggcgguggcg guucaggcgg cggcgguucc 600

gacauccaga ugacccagag ccccagcagc cuguccgcuu ccgugggcga ccgugugacc 660

aucaccugcc gcgccagccg acccaucggc accaugcugu ccugguacca gcagaagccg 720

gggaaggccc caaagcugcu gauucuggcc uuuagccggc ugcagagcgg ggugcccagc 780

agauucagcg gcucggggag cgggaccgac uuuacgcuga ccaucagcuc ccugcagccc 840

gaggauuucg caacguacua cugugcccag gccggcaccc accccacuac uuucggccag 900

ggcaccaagg uggagaucaa gcgu 924

<210> 470

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 470

augcccaggc uguucuucuu ccaccuccuc ggcguguguc uccuccucaa ccaguucagc 60

agagccgucg ccgauucuug gauggaggag gugaucaagu ugugcggccg ggagcucgug 120

agggcucaga ucgccaucug cggcauguca accuggagca agcggucgcu gagccaggag 180

gacgccccuc agaccccgag gcccguggcc gagaucgugc cuagcuucau caacaaggac 240

accgagacaa ucaacaugau gagcgaguuu guggcgaauc ugccccagga gcugaagcuc 300

acccucagcg agaugcagcc cgcccugccc cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaguuuaag aagcugaucc ggaacaggca gagcgaggcc 420

gccgacagca gccccucuga acugaaguau cucgggcugg acacccacag cgggaagaag 480

cgccagcugu acuccgcccu ggccaacaaa ugcugccacg uggggugcac caaacggagc 540

cuggcccggu ucuguggcgg cggcggcucc ggcggcggug ggucugggagg cggcggcucg 600

gauauccaga ugacccagag ccccagcagc cuguccgccu ccgugggcga cagggugacc 660

aucaccugcc gggccucuag gcccaucggg accaugcuca gcugguacca gcagaaacca 720

ggcaaggccc cuaagcugcu gauccuggca uucagccgcc ugcagagcgg cguccccucc 780

840

gaggacuucg ccaccuacua cugugcacag gccgguaccc accccacgac cuucggccag 900

ggcacaaagg uggagaucaa gcgg 924

<210> 471

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 471

augccuagc uguucuucuu ccaccuccuc ggcguguguc uccuccucaa ccaguucagc 60

cgggccgugg ccgacuccug gauggaggag gugaucaagc ucugcggcag agagcucguc 120

cgagcccaga uagccaucug cggcaugagc accuggagca agaggagccu gagucaggag 180

gacgccccuc agacaccccg gcccguggcu gagaucgugc ccagcuucau uaacaaagac 240

accgaaacca ucaacaugau guccgaguuc guggccaauc ugccacagga gcucaagcug 300

acccugagcg agaugcagcc cgccugccc cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcucuuuga ggaguucaag aagcugaucc gcaaccgaca gagcgaggcu 420

gccgauagca gcccuuccga acucaaauac cugggccugg acacacacag cgggaagaag 480

cggcagcugu acagcgcccu ggcuaacaag uguugccacg uagggugcac caaacgcagc 540

cuggccagau ucugcggcgg cggcggcucc ggcgggaggcg gaucaggcgg cggcggcagc 600

gauauccaga ugacucagag ccccagcucc cugagcgccu ccguugggga ccgggugacc 660

aucaccugca gagcgagccg ccccaucggc accaugcucu ccugguacca acagaagcca 720

ggcaaggccc cgaagcugcu gauucuccgcc uucagcaggc ugcaaagcgg cgugcccagc 780

agguucuccg gcuccggcag cggcacagac uucacccuga ccaucagcuc ccugcagccg 840

gaggacuucg ccaccuacua uugugcccag gccggcaccc accccaccac cuucggccaa 900

ggcacaaagg uggaaaucaa gagg 924

<210> 472

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 472

augcccagac ucuucuucuu ccaucuacuc gguguguguc uccuccucaa ucaguuuagc 60

cgggccguug ccgacagcug gauggaggag gucaucaagc ucugcggcag ggagcucgug

cgggcccaga ucgccaucug cggcaugagc accuggagca agagaucccu gucgcaggag 180

240

accgaaacca ucaacaugau gagcgaguuc guggcaaauc ugccccagga gcugaagcug 300

agcaugugcc cgugcucaaa 360

gauagcagcc ugcuguucga ggaguucaag aaacugaucc ggaaccggca gagcgaggcc 420

gccgacucca gccccucuga gcugaaguac cuggggcugg acacgcacuc cgggaagaag 480

agacagcucu auagcgcccu ggccaacaag ugcugucaug ugggaugcac caagagaagc 540

cucgcccgcu ucugcgggagg cggaggcagc ggcgguggcg guagcgggagg cggcgggucc 600

gacauacaga ugacccagag ccccuccucc cugagugccu ccgucggcga ccgggugacc 660

aucacgugcc gcgccagccg gcccaucggc acaaugcugu ccugguacca gcagaagccc 720

gggaaggcgc ccaagcugcu gauccuggcg uucucccggc ugcaguccgg cgugcccagc 780

agguucagcg gcucaggcuc cgguaccgac uucacccuga cuauaagcag ccugcagccg 840

gaggauuuug ccaccuacua cugcgcccag gccggcaccc acccaaccac cuucggccag 900

ggcaccaagg uggagaucaa gcgg 924

<210> 473

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 473

augcccaggc uguucuucuu ccaccuccuc ggcgugugcc uccuccucaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ucugcggccg ggagcucgug 120

cgggcccaga ucgccaucug cggcaugagc accuggagca agcggagccu gagccaggag 180

gacgccccgc agacuccgcg gccaguggcc gagaucgugc ccagcuucau caacaaggac 240

accgaaacca ucaacaugau gagcgaguuc guggccaacc ugccccagga gcugaagcug 300

acccugagcg agaugcagcc cgcucugccg cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaguucaag aagcugaucc ggaaccggca gagcgaggcc 420

gcagauucuu cuccuagcga gcucaaguac cugggccugg acacccacag ccggaagaag 480

cggcagcugu acagcgcccu ggccaacaag ugcugccacg ugggcugcac caagagguca 540

cuggcccggu ucugcggcgg cgguggaucu ggcgggaggag gcucgggagg cggcggcagc 600

gacauccaga ugacccagag cccaagcucc cuguccgcca gcgugggcga ccgggugacc 660

aucaccugcc gggccagccg gcccaucggc accaugcuga gcugguacca gcagaagccc 720

ggcaaggccc cgaagcugcu gauccuggcc uucucuaggc ugcagagcgg cgugccgagc 780

cgguucucgg gcagcggcuc cggcaccgac uucacccuga cuaucucgag ccuccagccg 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg uggagaucaa gcgg 924

<210> 474

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 474

augcccaggc uguucuucuu ccaccuccuc ggcgugugcc uccuccuaaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ucugcggccg ggagcucgug 120

cgggcccaga ucgccaucug cggcaugagc accuggagca agcggagccu gagccaggag 180

240

accgagacaa ucaacaugau gagcgaguuc guggccaacc ugccccagga gcugaagcug 300

acccugagcg agaugcagcc cgccugccg cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaguucaag aagcugaucc ggaaccggca gagcgaggcc 420

gccgacucca gccccagcga auugaaguac cugggccugg acacccacag cgggaagaag 480

cggcagcugu acagcgcccu ggccaacaag ugcugccacg ugggcugcac caagaggagu 540

cuggccggu ucugcggcgg aggcggaagc gguggaggcg gcucuggcgg cgguggcucg 600

gacauccaga ugaccagag cccguccucc cuguccgcca gcgugggcga ccgggugacc 660

aucaccugcc gggccagccg gcccaucggc accaugcuga gcugguacca gcagaagccc 720

ggcaaggccc cgaagcugcu gauccuggcc uucagcaggc ugcagagcgg cgugccgagc 780

cgguucagcg guagcggcuc cggcaccgac uucacccuga caaucagcuc gcugcagcca 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg uggagaucaa gcgg 924

<210> 475

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 475

augcccagac uguucuucuu ccaccucuug ggcgugugcc uccuccucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accuggucca agcgcucccu cucccaggag 180

gacgcuccgc agaccccgcg ccccgucgcc gagaucgucc ccuccuucau caacaaggac 240

accgagacga ucaacaugau guccgaguuc gucgccaacc ucccacagga gcucaagcuc 300

acccucccg agaugcagcc cgcccugccg cagcuccagc agcacguccc cguccucaag 360

gacuccuccc uccucuucga ggaguucaag aagcucaucc gcaaccgcca guccgaggcc 420

gcggacagca gcccguccga gcugaaguac cucggccucg acacccacuc ccgcaagaag 480

cgccagcucu acuccgcccu cgccaacaag ugcugccacg ucggcugcac caagaggagc 540

cuggccgcu ucugcggcgg aggcggcagc ggcggcggug gauccggugg cggcggaagc 600

gacauccaga ugacccagag cccgagcagc cugagcgccu ccgucggcga ccgcgucacc 660

aucaccugcc gcgccucccg ccccaucggc accaugcucu ccugguacca gcagaagccc 720

ggcaaggccc cuaagcuccu cauccucgcc uucucccgcc uccaguccgg cgugccgagc 780

cgguucuccg gaagcggcuc gggcaccgac uucacccuca ccaucuccuc acuccagccg 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg ucgagaucaa gcgc 924

<210> 476

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 476

augcccagac uguucuucuu ccaccuccuc ggcgugugcc uccuccucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accuggucca agcgcucccu cucccaggag 180

gacgccccgc agacgccgcg ccccgucgcc gagaucgucc ccuccuucau caacaaggac 240

accgagacaa ucaacaugau guccgaguuc gucgccaacc ugccgcagga gcucaagcuc 300

acccucccg agaugcagcc cgcccugccg caacuccagc agcacguccc cguccucaag 360

gacuccuccc uccucuucga ggaguucaag aagcucaucc gcaaccgcca guccgaggcc 420

gccgacucca gccccuccga gcugaaguac cucggccucg acacccacuc ccgcaagaag 480

cgccagcucu acuccgcccu cgccaacaag ugcugccacg ucggcugcac caagcggagc 540

cuggccgcu ucugcggcgg uggcggaagc ggaggcggag gcagcggcgg agguggcucc 600

660

aucaccugcc gcgccucccg ccccaucggc accaugcucu ccugguacca gcagaagccc 720

ggcaaggccc cgaagcuccu cauccucgcc uucucccgcc uccaguccgg cgugccgucc 780

cgguucagcg gcuccggcag cggaaccgac uucacccuga cgaucagcuc ccugcagccu 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg ucgagaucaa gcgc 924

<210> 477

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 477

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

cgggccgugg ccgacagcug gauggaggag gugaucaagc ugugcggccg ggagcuggug 120

cgggcccaga ucgccaucug cggcaugagc accuggagca agcggagccu gagccaggag 180

240

accgagacca ucaacaugau gagcgaguuc guggccaacc ugccccagga gcugaagcug 300

acccugagcg agaugcagcc cgccugccc cagcugcagc agcacgugcc cgugcugaag 360

gacagcagcc ugcuguucga ggaguucaag aagcugaucc ggaaccggca gagcgaggcc 420

gccgacagca gccccagcga gcugaaguac cugggccugg acacccacag cgggaagaag 480

cggcagcugu acagcgcccu ggccaacaag ugcugccacg ugggcugcac caagcggagc 540

cuggccggu ucugcggcgg cggcggcagc ggcggcggcg gcagcggcgg cggcggcagc 600

gacauccaga ugacccagag ccccagcagc cugagcgcca gcgugggcga ccgggugacc 660

aucaccugcc gggccagccg gcccaucggc accaugcuga gcugguacca gcagaagccc 720

ggcaaggccc ccaagcugcu gauccuggcc uucagccggc ugcagagcgg cgugcccagc 780

cgguucagcg gcagcggcag cggcaccgac

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg uggagaucaa gcgg 924

<210> 478

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 478

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

120

agggcgcaga ucgcgaucug cgggaugagc acguggagca agaggagccu gagccaggag 180

gacgcgccgc agacgccgag gccgguggcg gagaucgugc cgagcuucau caacaaggac 240

acggagacga ucaacaugau gagcgaguuc guggcgaacc ugccgcagga gcugaagcug 300

acgcugagcg agaugcagcc ggcgcugccg cagcugcagc agcacgugcc ggugcugaag 360

gacagcagcc ugcuguucga ggaguucaag aagcugauca ggaacaggca gagcgaggcg 420

gcggacagca gcccgagcga gcugaaguac cuggggcugg acacgcacag caggaagaag 480

aggcagcugu acagcgcgcu ggcgaacaag ugcugccacg uggggugcac gaagaggagc 540

cuggcgaggu ucugcgggagg cggugggagc gguggcggag ggagcggcgg aggcgggagc 600

gacauccaga ugacgcagag cccgagcagc cugagcgcga gcguggggga cagggugacg 660

aucacgugca gggcgagcag gccgaucggg acgaugcuga gcugguacca gcagaagccg 720

gggaaggcgc cgaagcugcu gauccuggcg uucagcaggc ugcagagcgg ggugccgagc 780

840

gaggacuucg cgacguacua cugcgcgcag gcggggacgc acccgacgac guucgggcag 900

gggacgaagg uggagaucaa gagg 924

<210> 479

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 479

augccccggc uguucuucuu ccaccugcug ggcgugugcc ugcugcugaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accuggucca agcgcucccu cucccaggag 180

gacgcacccc agacaccccg ccccgucgcc gagaucgucc ccuccuucau caacaaggac 240

accgagacca ucaacaugau guccgaguuc gucgccaacc ucccccagga gcucaagcuc 300

acccuccg agaugcagcc cgcccucccc cagcuccagc agcacguccc cguccucaag 360

gacuccuccc uccucuucga ggaguucaag aagcucaucc gcaaccgcca guccgaggcc 420

gccgacuccu cccccuccga gcucaaguac cucggccucg acacccacuc ccgcaagaag 480

cgccagcucu acuccgcccu cgccaacaag ugcugccacg ucggcugcac caagcgcucc 540

cucgcccgcu ucugcggcgg cggcggcucc ggcggcggcg gcuccggcgg cggcggcucc 600

gacauccaga ugacccaguc ccccuccucc cucuccgccu ccgucggcga ccgcgucacc 660

aucaccugcc gcgccucccg ccccaucggc accaugcucu ccugguacca gcagaagccc 720

ggcaaggccc ccaagcuccu cauccucgcc uucucccgcc uccaguccgg cguccccucc 780

cgcuucuccg gcuccggcuc cggcaccgac uucacccuca ccaucuccuc ccuccagccc 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg ucgagaucaa gcgc 924

<210> 480

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 480

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agacaacucu acagugcauu ggcuaauaaa uguugccaug uugguuguac caaaagaucu 540

cuugcuagau uuugcggugg cggaggcagc ggagguggug gcagcggcgg agguggcagc 600

gacauccaga ugacccagag ccccagcagc cugagcgcca gcgugggcga cagggugacc 660

aucaccugca gggccagcag gcccaucggc accaugcuga gcugguacca gcagaagccc 720

ggcaaggccc ccaagcugcu gauccuggcc uucagcaggc ugcagagcgg cgugcccagc 780

agguucagcg gcagcggcag cggcaccgac uucacccuga ccaucagcag ccugcagccc 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg uggagaucaa gagg 924

<210> 481

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 481

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agacaacucu acagugcauu ggcuaauaaa uguugccaug uugguuguac caaaagaucu 540

cuugcuagau uuugcggugg cggaggcagc ggagguggug gcagcggcgg agguggcagc 600

gacauccaga ugacccagag ccccagcagc cugagcgcca gcgugggcga cagggugacc 660

aucaccugca gggccagcag gcccaucggc accaugcuga gcugguacca gcagaagccc 720

ggcaaggccc ccaagcugcu gauccuggcc uucagcaggc ugcagagcgg cgugcccagc 780

agguucagcg gcagcggcag cggcaccgac uucacccuga ccaucagcag ccugcagccc 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg uggagaucaa gagg 924

<210> 482

<211> 924

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 482

augccccgcc uguucuucuu ccaccuccuu ggcgugugcc uccuccucaa ccaguucagc 60

cgggccgugg cgacagcug gauggaggag gucaucaagc ucugcggccg cgagcucguc 120

cgcgcccaga ucgccaucug cggcaugucc accuggucca agcgcucccu cucccaggag 180

gacgccccac agaccccgcg ccccgucgcc gagaucgucc ccuccuucau caacaaggac 240

accgagacga ucaacaugau guccgaguuc gucgccaacc ugccgcagga gcucaagcuc 300

acccucccg agaugcagcc cgcccucccg cagcuccagc agcacguccc cguccucaag 360

gacuccuccc uccucuucga ggaguucaag aagcucaucc gcaaccgcca guccgaggcc 420

gccgacucca gccccuccga gcugaaguac cucggccucg acacccacuc ccgcaagaag 480

cgccagcucu acuccgcccu cgccaacaag ugcugccacg ucggcugcac caagcggucc 540

cuggcccgcu ucugcgggagg cggcggcucu ggcgguggug gauccggcgg cgguggcagc 600

gacauccaga ugacccaguc cccauccagc cugagcgccu ccgucggcga ccgcgucacc 660

aucaccugcc gcgccucccg ccccaucggc accaugcucu ccugguacca gcagaagccc 720

ggcaaggccc cgaagcuccu cauccucgcc uucucccgcc uccaguccgg cgucccguca 780

agguucuccg gcucgggcuc cgguaccgac uucacccuca ccaucuccuc gcuccagcca 840

gaggacuucg ccaccuacua cugcgcccag gccggcaccc accccaccac cuucggccag 900

ggcaccaagg ucgagaucaa gcgc 924

<210> 483

<211> 92

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 483

ucaagcuuuu ggacccucgu acagaagcua auacgacuca cuauagggaa auaagagaga 60

aaagaagagu aagaagaaau auaaagcca cc 92

<210> 484

<211> 164

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 484

ugauaauagu ccauaaagua ggaaacacua cagcuggagc cucgguggcc augcuucuug 60

120

acucacggua cgagggucu uugaauaaag ucugaguggg cggc 164

<210> 485

<211> 119

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 485

ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guacccccgu ggucuuugaa uaaagucuga gugggcggc 119

<210> 486

<211> 141

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 486

ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guaccccccg cauuauuacu cacgguacga guggucuuug 120

aauaaagucu gaguggggcgg c 141

<210> 487

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 487

ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guacccccuc cauaaaguag gaaacacuac agggucuuu 120

gaauaaaguc ugaggugggcg gc 142

<210> 488

<211> 829

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 488

gucccgaccu ccaggagaga ccaggcccag gaugccucgc cuguuuuuuu uccaccugcu 60

aggagucugu uuacuacuga accaauuuuc cagagcaguc gcggacucau ggauggagga 120

uuaugcggcc gcgaauuagu ucgcgcgcag auugccauuu gcggcaugag 180

caccuggagc aaaaggucuc ugagccagga agaugcuccu cagacaccua gaccaguggc 240

agaaauugug ccauccuuca ucaacaaaga uacagaaacc auaaauuuga ugucagaauu 300

uguugcuaau uugccacagg agcugaaguu aacccugucu gagaugcagc cagcauuacc 360

420

480

cuuaggcuug gauacucauu cucgaaaaaa gagacaacuc uacagugcau uggcuaauaa 540

600

uugugcacau cucguauaau auucacacau auucuuaaug

ucagguccca ucaauucuua gaauaucuaa gaaucuuugu uagauauuag gucccaucaa 720

780

829

<210> 489

<211> 555

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 489

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca gaaauugugc cauccuucau caacaaagau 240

acagaaacca uaaauauugau gucagaauuu guugcuaauu ugccacagga gcugaaguua 300

acccugucug agaugcagcc agcauuacca cagcuacaac aacauguacc uguauuaaaa 360

gauuccaguc uucucuuuga agaauuuaag aaacuuauuc gcaauagaca aagugaagcc 420

gcagacagca guccuucaga auuaaaauac uuaggcuugg auacucauuc ucgaaaaaag 480

agacaacucu acagugcauu ggcuaauaaa uguugccaug uugguuguac caaaagaucu 540

cuugcuagau uuugc 555

<210> 490

<211> 930

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 490

gucccgaccu ccaggagaga ccaggcccag gaugccucgc cuguuuuuuu uccaccugcu 60

aggagucugu uuacuacuga accaauuuuc cagagcaguc gcggacucau ggauggagga 120

uuaugcggcc gcgaauuagu ucgcgcgcag auugccauuu gcggcaugag 180

caccuggagc aaaaggucuc ugagccagga agaugcuccu cagacaccua gaccaguggc 240

aggugauuuu auucaaacag ucucacuggg aaucucaccg gacggaggga aagcacugag 300

aacaggaagc ugcuucaccc gagaguuccu uggugcccuu uccaaauugu gccauccuuc 360

augucagaau uuguugcuaa uuugccacag 420

gagcugaagu uaacccuguc ugagaugcag ccagcauuac cacagcuaca acaacaugua 480

540

caaagugaag ccgcagacag caguccuuca gaauuaaaau acuuaggcuu ggauacucau 600

ucucgaaaaa agagacaacu cuacagugca uuggcuaaua aauguugcca uguugguugu 660

accaaaagau cucuugcuag auuuugcuga gaugaagcua auugugcaca ucucguauaa 720

uauucacaca uauucuuaau gacauuucac ugaugcuucu aucagguccc aucaauucuu 780

agaauaucua agaaucuuug uuagauauua ggucccauca auucuuagaa uaucuaaaca 840

ucuuuguuga uguuuagauu uuuuuauuug auguguaaga aaauguucuu ugugugauua 900

aaugacacau uuuuuugcug 930

<210> 491

<211> 351

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 491

augccucgcc uguuuuuuuu ccaccugcua ggagucuguu uacuacugaa ccaauuuucc 60

agagcagucg cggacucaug gauggaggaa guuauuaaau uaugcggccg cgaauuaguu 120

cgcgcgcaga uugccauuug cggcaugagc accuggagca aaaggucucu gagccaggaa 180

gaugcuccuc agacaccuag accaguggca ggugauuuua uucaaacagu cucacuggga 240

aucucaccgg acggagggaa agcacugaga acaggaagcu gcuucacccg agaguuccuu 300

ggugcccuuu ccaaauugug ccauccuuca ucaacaaaga uacagaaacc a 351

<210> 492

<211> 9

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 492

ccrccaugg 9

<210> 493

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 493

ugauaauagg cuggagccuc gguggccuag cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guacccccuc cauaaaguag gaaacacuac agggucuuu 120

gaauaaaguc ugaggugggcg gc 142

<210> 494

<211> 141

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 494

ugauaauagg cuggagccuc gguggccuag cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guaccccccg cauuauuacu cacgguacga guggucuuug 120

aauaaagucu gagugggcgg c 141

<210> 495

<211> 164

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 495

ugauaauagu ccauaaagua ggaaacacua cagcuggagc cucgguggcc uagcuucuug 60

120

acucacggua cgagggucu uugaauaaag ucugaguggg cggc 164

<210> 496

<211> 188

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 496

ugauaauagu ccauaaagua ggaaacacua cagcuggagc cucgguggcc uagcuucuug 60

ccccuugggc cuccauaaag uaggaaacac uacauccccc cagccccucc uccccuuccu 120

gcacccguac ccccuccaua aaguaggaaa cacuacagug gucuuugaau aaagucugag 180

uggcggc 188

<210> 497

<211> 140

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 497

ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guacccccag uagugcuuuc uacuuuaugg uggucuuuga 120

auaaagucug aggggcggc 140

<210> 498

<211> 181

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 498

ugauaauaga guagugcuuu cuacuuuaug gcuggagccu cgguggccau gcuucuugcc 60

ccuugggcca guagugcuuu cuacuuuaug uccccccagc cccucucccc uuccugcacc 120

180

c 181

<210> 499

<211> 184

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 499

ugauaauaga guagugcuuu cuacuuuaug gcuggagccu cgguggccau gcuucuugcc 60

ccuugggccu ccauaaagua ggaaacacua caucccccca gcccccuccuc cccuuccugc 120

acccguaccc ccaguagugc uuucuacuuu auggggucu uugaauaaag ucugaguggg 180

cggc 184

<210> 500

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 500

ugauaauagu ccauaaagua ggaaacacua cagcuggagc cucgguggcc uagcuucuug 60

120

gaauaaaguc ugaggugggcg gc 142

<210> 501

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 501

ugauaauagg cuggagccuc gguggcucca uaaaguagga aacacuacac uagcuucuug 60

120

gaauaaaguc ugaggugggcg gc 142

<210> 502

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 502

ugauaauagg cuggagccuc gguggccuag cuucuugccc cuugggccuc cauaaaguag 60

120

gaauaaaguc ugaggugggcg gc 142

<210> 503

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 503

ugauaauagg cuggagccuc gguggccuag cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guacccccac cccuaucaca auuagcauua agggucuuu 120

gaauaaaguc ugaggugggcg gc 142

<210> 504

<211> 188

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 504

ugauaauaga ccccuaucac aauuagcauu aagcuggagc cucgguggcc uagcuucuug 60

ccccuugggc caccccuauc acaauuagca uuaauccccc cagccccucc uccccuuccu 120

180

uggcggc 188

<210> 505

<211> 188

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 505

ugauaauaga ccccuaucac aauuagcauu aagcuggagc cucgguggcc uagcuucuug 60

ccccuugggc cuccauaaag uaggaaacac uacauccccc cagccccucc uccccuuccu 120

180

uggcggc 188

<210> 506

<400> 506

000

<210> 507

<400> 507

000

<210> 508

<400> 508

000

<210> 509

<400> 509

000

<210> 510

<400> 510

000

<210> 511

<400> 511

000

<210> 512

<400> 512

000

<210> 513

<400> 513

000

<210> 514

<400> 514

000

<210> 515

<400> 515

000

<210> 516

<400> 516

000

<210> 517

<400> 517

000

<210> 518

<400> 518

000

<210> 519

<400> 519

000

<210> 520

<400> 520

000

<210> 521

<400> 521

000

<210> 522

<400> 522

000

<210> 523

<400> 523

000

<210> 524

<400> 524

000

<210> 525

<400> 525

000

<210> 526

<400> 526

000

<210> 527

<400> 527

000

<210> 528

<400> 528

000

<210> 529

<400> 529

000

<210> 530

<400> 530

000

<210> 531

<400> 531

000

<210> 532

<400> 532

000

<210> 533

<400> 533

000

<210> 534

<400> 534

000

<210> 535

<400> 535

000

<210> 536

<400> 536

000

<210> 537

<400> 537

000

<210> 538

<400> 538

000

<210> 539

<211> 87

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 539

gacagugcag ucacccauaa aguagaaagc acuacuaaca gcacugggagg guguaguguu 60

uccuacuuua uggaugagug uacugug 87

<210> 540

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 540

uguaguguuu ccuacuuuau gga 23

<210> 541

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 541

uccauaaagu aggaaacacu aca 23

<210> 542

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 542

cauaaaguag aaagcacuac u 21

<210> 543

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 543

aguagugcuu ucuacuuuau g 21

<210> 544

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 544

attgggcacc cgtaaggg 18

<210> 545

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 545

gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccacc 47

<210> 546

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 546

gggagaucag agagaaaaga agaguaagaa gaaauauaag agccacc 47

<210> 547

<211> 145

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 547

ggaauaaaag ucucaacaca acauauacaa aacaaacgaa ucucaagcaa ucaagcauuc 60

uacuucuauu gcagcaauuu aaaucauuuc uuuuaaagca aaagcaauuu ucugaaaauu 120

uucaccauuu acgaacgaua gcaac 145

<210> 548

<211> 42

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 548

gggagacaag cuuggcauuc cgguacuguu gguaaagcca cc 42

<210> 549

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 549

gggagaucag agagaaaaga agaguaagaa gaaauauaag agccacc 47

<210> 550

<211> 145

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 550

ggaauaaaag ucucaacaca acauauacaa aacaaacgaa ucucaagcaa ucaagcauuc 60

uacuucuauu gcagcaauuu aaaucauuuc uuuuaaagca aaagcaauuu ucugaaaauu 120

uucaccauuu acgaacgaua gcaac 145

<210> 551

<211> 42

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 551

gggagacaag cuuggcauuc cgguacuguu gguaaagcca cc 42

<210> 552

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 552

gggaauuaac agagaaaaga agaguaagaa gaaauauaag agccacc 47

<210> 553

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 553

gggaaauuag acagaaaaga agaguaagaa gaaauauaag agccacc 47

<210> 554

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 554

gggaaauaag agaguaaaga acaguaagaa gaaauauaag agccacc 47

<210> 555

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 555

gggaaaaaag agagaaaaga agacuaagaa gaaauauaag agccacc 47

<210> 556

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 556

gggaaauaag agagaaaaga agaguaagaa gauauauaag agccacc 47

<210> 557

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 557

gggaaauaag agacaaaaca agaguaagaa gaaauauaag agccacc 47

<210> 558

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 558

gggaaauuag agaguaaaga acaguaagua gaauuaaaag agccacc 47

<210> 559

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 559

gggaaauaag agagaauaga agaguaagaa gaaauauaag agccacc 47

<210> 560

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 560

gggaaauaag agagaaaaga agaguaagaa gaaaauuaag agccacc 47

<210> 561

<211> 47

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 561

gggaaauaag agagaaaaga agaguaagaa gaaauuuaag agccacc 47

<210> 562

<211> 92

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 562

ucaagcuuuu ggacccucgu acagaagcua auacgacuca cuauagggaa auaagagaga 60

aaagaagagu aagaagaaau auaaagcca cc 92

<210> 563

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 563

ugauaauagu ccauaaagua ggaaacacua cagcuggagc cucgguggcc augcuucuug 60

120

gaauaaaguc ugaggugggcg gc 142

<210> 564

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 564

ugauaauagg cuggagccuc gguggcucca uaaaguagga aacacuacac augcuucuug 60

120

gaauaaaguc ugaggugggcg gc 142

<210> 565

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 565

ugauaauagg cuggagccuc gguggccaug cuucuugccc cuuccauaaa guaggaaaca 60

cuacaugggc cuccccccag ccccuccucc ccuuccugca cccguacccc cguggucuuu 120

gaauaaaguc ugaggugggcg gc 142

<210> 566

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 566

ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagucc 60

auaaaguagg aaacacuaca ccccuccucc ccuuccugca cccguacccc cguggucuuu 120

gaauaaaguc ugaggugggcg gc 142

<210> 567

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 567

ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu ucuccauaaa guaggaaaca cuacacugca cccguacccc cguggucuuu 120

gaauaaaguc ugaggugggcg gc 142

<210> 568

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 568

ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guacccccuc cauaaaguag gaaacacuac agggucuuu 120

gaauaaaguc ugaggugggcg gc 142

<210> 569

<211> 142

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 569

ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guacccccgu ggucuuugaa uaaaguucca uaaaguagga 120

aacacuacac ugagugggcg gc 142

<210> 570

<211> 371

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 570

gcgccugccc accugccacc gacugcugga acccagccag ugggaggcc uggcccacca 60

gaguccugcu cccucacucc ucgccccgcc cccuguccca gagucccacc ugggggcucu 120

cuccacccuu cucagaguuc caguuucaac cagaguucca accaaugggc uccauccucu 180

ggauucuggc caaugaaaua ucucccuggc aggguccucu ucuuuuccca gagcuccacc 240

ccaaccagga gcucuaguua aggagagcu cccagcacac ucggagcuug ugcuuugucu 300

ccacgcaaag cgauaaauaa aagcauuggu ggccuuuggu cuuugaauaa agccugagua 360

ggaagucuag a 371

<210> 571

<211> 568

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 571

gccccugccg cucccacccc cacccaucug ggccccgggu ucaagagaga gcggggucug 60

aucucgugua gccauauaga guuugcuucu gagugucugc uuuguuuagu agaggugggc 120

aggaggagcu gaggggcugg ggcuggggug uugaaguugg cuuugcaugc ccagcgaugc 180

gccucccugu gggaugucau cacccuggga accgggagug gcccuuggcu cacuguguuc 240

ugcaugguuu ggaucugaau uaauuguccu uucuucuaaa ucccaaccga acuucuucca 300

accuccaaac uggcuguaac cccaaaucca agccauuaac uacaccugac aguagcaauu 360

gucugauuaa ucacuggccc cuugaagaca gcagaauguc ccuuugcaau gaggaggaga 420

ucgggcugg gcgggccagc uggggaagca uuugacuauc uggaacuugu gugugccucc 480

ucagguaugg cagugacuca ccugguuuua auaaaacaac cugcaacauc ucauggucuu 540

ugaauaaagc cugaguagga agucuaga 568

<210> 572

<211> 289

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 572

acacacucca ccuccagcac gcgacuucuc aggacgacga aucuucucaa ugggggggcg 60

gcugagcucc agccaccccg cagucacuuu cuuuguaaca acuuccguug cugccaucgu 120

180

uucgaaacaa agcccugugg aagaaaaugg aaaacuugaa gaagcauuaa agucauucug 240

uuaagcugcg uaaauggucu uugaauaaag ccugaguagg aagucuaga 289

<210> 573

<211> 379

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 573

caucacauuu aaaagcaucu cagccuacca ugagaauaag agaaagaaaa ugaagaucaa

aagcuuauuc aucuguuuuu cuuuuucguu gguguaaagc caacacccug ucuaaaaaac 120

180

gaaucuaaua gagugguaca gcacuguuau uuuucaaaga uguguugcua uccugaaaau 240

ucuguagguu cuguggaagu uccaguguuc ucucuuauuc cacuucggua gaggauuucu 300

360

ccugaguagg aagucuaga 379

<210> 574

<211> 118

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 574

gcugccuucu gcggggcuug ccuucuggcc augcccuucu ucucucccuu gcaccuguac 60

cucuuggucu uugaauaaag ccugaguagg aaggcggccg cucgagcaug caucuaga 118

<210> 575

<211> 908

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 575

gccaagcccu ccccauccca uguauuuauc ucuauuuaau auuuaugucu auuuaagccu 60

cauauuuaaa gacagggaag agcagaacgg agccccaggc cucugugucc uucccugcau 120

uucugaguuu cauucuccug ccuguagcag ugagaaaaag cuccuguccu cccauccccu 180

ggacugggag guagauaggu aaauaccaag uauuuauuac uaugacugcu ccccagcccu 240

ggcucugcaa ugggcacugg gaugagccgc ugugagcccc ugguccugag gguccccacc 300

ugggacccuu gagaguauca ggucucccac gugggagaca agaaaucccu guuuaauauu 360

uaaacagcag uguuccccau cuggguccuu gcaccccuca cucuggccuc agccgacugc 420

acagcggccc cugcauccc uuggcuguga ggcccugga caagcagagg uggccagagc 480

ugggaggcau ggcccgggg ucccgaau uugcugggga aucucguuuu ucuucuuaag 540

acuuuuggga caugguuuga cucccgaaca ucaccgacgc gucuccuguu uuucugggug 600

660

gcaggugccu ggacauuugc cuugcuggac ggggacuggg gaugugggag ggagcagaca 720

ggaggaauca ugucaggccu gugugugaaa ggaagcucca cugucacccu ccaccucuuc 780

accccccacu caccaguguc cccuccacug ucacauugua acugaacuuc aggauaauaa 840

aguguuugcc uccauggucu uugaauaaag ccugaguagg aaggcggccg cucgagcaug 900

caucuaga 908

<210> 576

<211> 835

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 576

acucaaucua aauuaaaaaa gaaagaaauu ugaaaaaacu uucucuuugc cauuucuucu 60

ucuucuuuuu uaacugaaag cugaauccuu ccauuucuuc ugcacaucua cuugcuuaaa 120

180

cuccuucccc cgcuccccca aaaauuugaa uuuuuuuuuc aacacucuua caccuguuau 240

ggaaaauguc aaccuuugua agaaaaccaa aauaaaaauu gaaaaauaaa aaccauaaac 300

360

ccaaagguuu aaacuaccuc aaaacacuuu cccaugagug ugauccacau uguuaggugc 420

ugaccuagac agagaugaac ugagguccuu guuuuguuuu guucauaaua caaaggugcu 480

aauuaauagu auuucagaua cuugaagaau guugauggug cuagaagaau uugagaagaa 540

auacuccugu auugaguugu aucguguggu guauuuuuua aaaaauuuga uuuagcauuc 600

auauuuucca ucuuauuccc aauuaaaagu

720

uuguuucuug ggcaagcaga aaaauuuaau uguaccuauu uuguauaugu gagauguuua 780

aauaaauugu gaaaaaaaug aaauaaagca uguuugguuu uccaaaagaa cauau 835

<210> 577

<211> 297

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 577

cgccgccgcc cgggccccgc agucgagggu cgugagccca ccccguccau ggugcuaagc 60

gggcccgggu cccacacggc cagcaccgcu gcucacucgg acgacgcccu gggccugcac 120

cucuccagcu cccuccacgg gguccccgua gccccggccc ccgcccagcc ccaggucucc 180

ccaggcccuc cgcaggcugc ccggccuccc ucccccugca gccaucccaa ggcuccugac 240

cuaccuggcc ccugagcucu ggagcaagcc cugacccaau aaaggcuuug aacccau 297

<210> 578

<211> 602

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 578

ggggcuagag cccucuccgc acagcgugga gacggggcaa ggaggggggu uauuaggauu 60

ggugguuuug uuuugcuuug uuuaaagccg ugggaaaaug gcacaacuuu accucugugg 120

gagaugcaac acugagagcc aagggguggg aguugggaua auuuuuauau aaaagaaguu 180

uuuccacuuu gaauugcuaa aaguggcauu uuuccuaugu gcagucacuc cucucauuuc 240

uaaaauaggg acguggccag gcacgguggc ucaugccugu aaucccagca cuuugggagg 300

ccgaggcagg cggcucacga ggucaggaga ucgagacuau ccuggcuaac acgguaaaac 360

ccugucucua cuaaaaguac aaaaaauuag cugggcgugg uggugggcac cuguaguccc 420

agcuacucgg gaggcugagg caggagaaag gcaugaaucc aagaggcaga gcuugcagug 480

agcugagauc acgccauugc acuccagccu gggcaacagu guuaagacuc ugucucaaau 540

auaaauaaau aaauaaauaa auaaauaaau aaauaaaaau aaagcgagau guugcccuca 600

aa 602

<210> 579

<211> 785

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 579

ggcccugccc cgucggacug cccccagaaa gccuccugcc cccugccagu gaaguccuuc 60

agugagcccc uccccagcca gcccuucccu ggccccgccg gauguauaaa uguaaaaaaug 120

aaggaauuac auuuuauaug ugagcgagca agccggcaag cgagcacagu auuauuucuc 180

cauccccucc cugccugcuc cuuggcaccc ccaugcugcc uucagggaga caggcaggga 240

gggcuugggg cugcaccucc uacccuccca ccagaacgca ccccacuggg agagcuggug 300

gugcagccuu ccccucccug uauaagacac uuugccaagg cucuccccuc ucgccccauc 360

ccugcuugcc cgcucccaca gcuuccugag ggcuaauucu gggaagggag aguucuuugc 420

ugccccuguc uggaagacgu ggcucugggu gagguaggcg ggaaaggaug gaguguuuua 480

guucuugggg gaggccaccc caaaccccag ccccaacucc aggggcaccu augagauggc 540

caugcucaac cccccuccca gacaggcccu cccugucucc agggccccca cggagguucc 600

cagggcugga gacuuccucu gguaaacauu ccuccagccu ccccuccccu ggggacgcca 660

aggagggggg ccacacccag gaagggaaag cgggcagccc cguuuugggg acgugaacgu 720

780

auugu 785

<210> 580

<211> 3001

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 580

auauuaagga ucaagcuguu agcuaauaau gccaccucug caguuuuggg aacaggcaaa 60

uaaaguauca guauacaugg ugauguacau cuguagcaaa gcucuuggag aaaaugaaga 120

cugaagaaag caaagcaaaa acuguauaga gagauuuuuc aaaagcagua aucccucaau 180

uuuaaaaaag gauugaaaau ucuaaauguc uuucugugca uauuuuuuguguuaggaauc 240

aaaaguauuu uauaaaagga gaaagaacag ccucauuuua gauguagucc uguuggauuuu 300

uuuaugccuc cucaguaacc agaaauguuu uaaaaaacua aguguuuagg auuucaagac 360

aacauuauac auggcucuga aauauucugac acaauguaaa cauugcaggc accugcauuu 420

uauguuuuuu uuuucaacaa augugacuaa uuugaaacuu uuaugaacuu cugagcuguc 480

cccuugcaau ucaaccgcag uuugaauuaa ucauaucaaa ucaguuuuaa uuuuuuaaau 540

uguacuucag agucuauauu ucaagggcac auuuucucac uacuauuuua auacauuaaa 600

ggacuaaaua aucuuucaga gaugcuggaa acaaaucauu ugcuuuauau guuucauuag 660

aauaccaaug aaacauacaa cuugaaaauu aguaauagua uuuuugaaga ucccauuucu 720

aauuggagau cucuuuaauu ucgaucaacu uauaaugugu aguacuauau uaagugcacu 780

ugaguggaau ucaacauuug acuauaaaa ugaguucauc auguuggcaa gugauguggc 840

aauuaucucu ggugacaaaa gaguaaaauc aaauauuucu gccuguuaca aauaucaagg 900

aagaccugcu acuaugaaau agaugacauu aaucugucuu cacuguuuau aauacggaug 960

gauuuuuuuu caaaucagug uguguuuuga ggucuuaugu aauugaugac auuugagaga 1020

1080

1140

gugaaugugu gaugaauacu cagauuauuu gucucucuau auaauuaguu ugguacuaag 1200

uuucucaaaa aauuauuaac acaugaaaga caaucucuaa accagaaaaa gaaguaguac 1260

1320

1380

gugugugucgu uuguguguua aagcagaaaa gacuuuuuua aaaguuuuaa gugauaaaug 1440

caauuuguua auugaucuua gaucacuagu aaacucaggg cugaauuaua ccauguauau 1500

ucuauuagaa gaaaguaaac accaucuuua uuccugcccu uuuucuucuc ucaaaguagu 1560

uguaguuaua ucuagaaaga agcaauuuug auuucuugaa aagguaguuc cugcacucag 1620

uuuaaacuaa aaauaaucau acuuggauuu uauuuauuuu ugucauagua aaaauuuuaa 1680

uuuauauaua uuuuuauuua guauuaucuu auucuuugcu auuugccaau ccuuugucau 1740

1800

1860

1920

cuauuucauu auuccucuuu uuccaauaag ucauacaauu gguagauaug acuuauuuua 1980

2040

uguaccuuau agucugucac caaaaaaaaa aaauuaucug uagguaguga aaugcuaaug 2100

2160

aguuuguguu uaaauuacuc aucuaagcaa aaaauguaua uaaaucccau uacuggguau 2220

2280

agcacuauuc acaauagcaa agacuuggaa ccaacccaaa uguccaucaa ugauagacuu 2340

gauuaagaaa augugcacau auacaccaug gaauacuaug cagccauaaa aaaggaugag 2400

uucauguccu uuguagggac auggauaaag cuggaaacca ucauucugag caaacuauug 2460

caaggacaga aaaccaaaca cugcauguuc ucacucauag gugggaauug aacaugaga 2520

2580

ggggagggau agcauuagga gauauaccua auguaaauga ugaguuaaug ggugcagcac 2640

accaacaugg cacauguaua cauauguagc aaaccugcac guugugcaca uguacccuag 2700

2760

cugaaauaaa ugugaucuuu cccauuaaaa aaauaaagaa auuuuggggu aaaaaaacac 2820

aauauauugu auucuugaaa 2880

gugauaacua auugagguaa ugcacauauu aauuagaaag auuuugucau uccacaaugu 2940

3000

a 3001

<210> 581

<211> 1037

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 581

cccacccugc acgccggcac caaacccugu ccucccaccc cuccccuc aucacuaaac 60

agaguaaaau gugaugcgaa uuuucccgac caaccugauu cgcuagauuu uuuuuaagga 120

aaagcuugga aagccaggac acaacgcugc ugccugcuuu gugcaggguc cuccggggcu 180

cagcccuag uuggcaucac cugcgcaggg cccucugggg cucagcccug agcuaguguc 240

accugcacag ggcccucuga ggcucagccc ugagcuggcg ucaccugugc agggcccucu 300

ggggcucagc ccugagcugg ccucaccugg guuccccacc cggggcucuc cugcccugcc 360

cuccucccg cccucccucc ugccugcgca gcuccuuccc uaggcaccuc ugugcugcau 420

cccaccagcc ugagcaagac gcccucucgg ggccugugcc gcacuagccu cccucuccuc 480

uguccccaua gcugguuuuu cccaccaauc cucaccuaac aguuacuuua caauuaaacu 540

caaagcaagc ucuucuccuc agcuuggggc agccauuggc cucugucucg uuuugggaaa 600

ccaaggucag gaggccguug cagacauaaa ucucggcgac ucggccccgu cuccugggg 660

uccugcuggu gaccggccug gaccuuggcc cuacagcccu ggaggccgcu gcugaccagc 720

acugaccccg accucagaga guacucgcag gggcgcuggc ugcacucaag acccucgaga 780

uuaacggugc uaaccccguc ugcuccuccc ucccgcagag acuggggccu ggacuggaca 840

ugagagcccc uuggugccac agagggcugu gucuuacuag aaacaacgca aaccucuccu 900

uccucagaau agugaugugu ucgacguuuu aucaaaggcc cccuuucuau guucauguua 960

1020

agguuuucac uccucuc 1037

<210> 582

<211> 577

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 582

agaggccugc cuccagggcu ggacugaggc cugagcgcuc cugccgcaga gcuggccgcg 60

120

gggguggauu uugguuuuu uccccuccuc cacucucccc cacccccucc ccgcccuuuu 180

uuuuuuuuuu uuuuaaacug guauuuuauc uuugauucuc cuucagcccu caccccuggu 240

ucucaucuuu cuugaucaac aucuuuucuu gccucugucc ccuucucuca ucucuuagcu 300

ccccuccaac cuggggggca guggugugga gaagccacag gccugagauu ucaucugcuc 360

uccuuccugg agccgagg agggcagcag aagggggugg ugucuccaac cccccagcac 420

ugaggaagaa cggggcucuu cucauuucac cccucccuuu cuccccugcc cccaggacug 480

ggccacuucu ggguggggca guggguccca gauuggcuca cacugagaau guaagaacua 540

caaacaaaau uucuauuaaa uuaaauuuugugucucc 577

<210> 583

<211> 2212

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 583

cucccuccau cccaaccugg cucccuccca cccaaccaac uuucccccca acccggaaac 60

agacaagcaa cccaaacuga acccccucaa aagccaaaaa augggagaca auuucacaug 120

180

ccaaccgaac augaccaaaa accaaaagug cauucaaccu uaccaaaaaa aaaaaaaaaa 240

aaagaauaaa uaaauaacuu uuuaaaaaag gaagcuuggu ccacuugcuu gaagacccau 300

gcggggguaa gucccuuucu gcccguuggg cuuaugaaac cccaaugcug cccuuucugc 360

uccuuucucc acaccccccu uggggccucc ccuccacucc uucccaaauc ugucucccca 420

gaagacacag gaaacaaugu auugucugcc cagcaaucaa aggcaaugcu caaacaccca 480

aguggccccc acccucagcc cgcuccugcc cgcccagcac ccccaggccc ugggggaccu 540

gggguucuca gacugccaaa gaagccuugc caucuggcgc ucccauggcu cuugcaacau 600

cuccccuucg uuuuugaggg ggucaugccg ggggagccac cagccccuca cuggguucgg 660

aggagaguca ggaagggcca cgacaaagca gaaacaucgg auuuggggaa cgcgugucaa 720

ucccuugugc cgcagggcug ggcggggagag acuguucugu uccuugugua acuguguugc 780

ugaaagacua ccucguucuu gucuugaugu gucaccgggg caacugccug ggggcgggga 840

ugggggcagg guggaagcgg cuccccauuu uauaccaaag gugcuacauc uaugugaugg 900

guggggggg gagggaauca cuggugcuau agaaauugag augccccccc aggccagcaa 960

1020

1080

1140

uucucaggcc ucugcucucc gaccucucuc cucugaaacc cuccuccaca gcugcagccc 1200

1260

uucccaaagc acaaagcagu uuuucccccu agggguggga ggaagcaaaa gacucuguac 1320

1380

1440

gggggagggg uagacauggg gaaggggcuu uggggugaug ggcuugccuu ccauuccugc 1500

1560

cccuucuuau accgcaaacc uuucuacuuc cucuuucauu uucuauucuu gcaauuuccu 1620

ugcaccuuuu ccaaauccuc uucuccccug caauaccaua caggcaaucc acgugcacaa 1680

cacacacaca cacucuucac aucugggguu guccaaaccu cauacccacu ccccuucaag 1740

cccauccacu cuccaccccc uggaugcccu gcacuuggug gcggugggau gcucauggau 1800

acugggaggg ugagggggagu ggaacccgug aggaggaccu gggggccucu ccuugaacug 1860

acaugaaggg ucaucuggcc ucugcucccu ucucacccac gcugaccucc ugccgaagga 1920

gcaacgcaac aggagagggg ucugcugagc cuggcgaggg ucugggagg accaggagga 1980

aggcgugcuc ccugcucgcu guccuggccc ugggggagug agggacag acaccuggga 2040

gagcuguggg gaaggcacuc gcaccgugcu cuugggaagg aaggagaccu ggcccugcuc 2100

accacggacu gggugccucg accuccugaa uccccagaac acaacccccc ugggcugggg 2160

uggucgggg aaccaucgug ccccgccuc ccgccuacuc cuuuuuaagc uu 2212

<210> 584

<211> 729

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 584

uuggccaggc cugacccucu uggaccuuuc uucuuugccg acaaccacug cccagcagcc 60

ucgggaccu cgggguccca gggaacccag uccagccucc uggcuguuga cuucccauug 120

cucuuggagc caccaaucaa agagauucaa agagauuccu gcaggccaga ggcggaacac 180

accuuuaugg cuggggcucu ccgugguguu cuggacccag ccccuggaga caccauucac 240

uuuuacugcu uuguagugac ucgugcucuc caaccugucu uccugaaaaa ccaaggcccc 300

cuucccccac cucuuccaug gggugagacu ugagcagaac aggggcuucc ccaaguugcc 360

cagaaagacu gucuggguga gaagccaugg cgagcuuc ucccaggcac agguguugca 420

ccagggacuu cugcuucaag uuuuggggua aagacaccug gaucagacuc caagggcugc 480

ccugagucug ggacuucugc cuccauggcu ggucaugaga gcaaaccgua gucccugga 540

gacagcgacu ccagagaacc ucuugggaga cagaagaggc aucugugcac agcucgaucu 600

ucuacuugcc ugugggggagg ggagugacag guccacacac cacacugggu cacccugucc 660

uggaugccuc ugaagagg gacagaccgu cagaaacugg agaguuucua uuaaagguca 720

uuuaaacca 729

<210> 585

<211> 847

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 585

uccuccggga ccccagcccu caggauuccu gaugcuccaa ggcgacugau gggcgcugga 60

ugaaguggca cagucagcuu cccuggggggc ugggugucaug uugggcuccu ggggcggggg 120

cacggccugg cauuucacgc auugcugcca ccccaggucc accugucucc acuuucacag 180

ccuccaaguc uguggcucuu cccuucuguc cuccgagggg cuugccuucu cucgugucca 240

gugaggugcu cagugaucgg cuuaacuuag agaagcccgc ccccuccccu ucuccgucug 300

ucccaagagg gucugcucug agccugcguu ccuagguggc ucggccucag cugccugggu 360

uguggccgcc cuagcauccu guaugcccac agcuacugga auccccgcug cugcuccggg 420

ccaagcuucu gguugauuaa ugagggcaug gggugguccc ucaagaccuu ccccuaccuu 480

uuguggaacc agugaugccu caaagacagu guccccucca cagcugggug ccaggggcag 540

gggauccuca guauagccgg ugaacccuga uaccaggagc cugggccucc cugaaccccu 600

ggcuuccagc caucucaucg ccagccuccu ccuggaccuc uuggccccca gccccuuccc 660

cacacagccc cagaaggguc ccagagcuga ccccacucca ggaccuaggc ccagccccuc 720

agccucaucu ggagccccug aagaccaguc ccacccaccu uucuggccuc aucugacacu 780

gcuccgcauc cugcugugug uccuguucca uguuccgguu ccauccaaau acacuuucug 840

gaacaaa 847

<210> 586

<211> 110

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 586

gcuggagccu cgguggccau gcuucuugcc ccuugggccu ccccccagcc ccuccucccc 60

uuccugcacc cguacccccg uggucuuuga auaaagucug agugggcggc 110

<210> 587

<211> 119

<212> RNA

<213> Artificial sequence

<220>

<223> Synthetic polynucleotide

<400> 587

ugauaauagg cuggagccuc gguggccuag cuucuugccc cuugggccuc cccccagccc 60

cuccuccccu uccugcaccc guacccccgu ggucuuugaa uaaagucuga gugggcggc 119

<210> 588

<211> 5

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 588

Gly Gly Gly Gly Ser

15

<210> 589

<211> 15

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic polypeptide

<400> 589

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<---

Claims (11)

1. A composition for enhancing relaxin activity comprising an mRNA polynucleotide formulated in an ionizable lipid nanoparticle, wherein the mRNA polynucleotide contains an open reading frame encoding a relaxin-based fusion protein comprising the amino acid sequence set forth in SEQ ID NO: 1 and an immunoglobulin fragment (Ig), where the ionizable lipid nanoparticle contains an ionizable lipid, which is compound 18, having the structure

2. The composition of claim 1, wherein the Ig fragment is a variable chain fragment. 3. The composition according to claim 1, wherein the Ig fragment is a chain constant fragment. 4. The composition of claim 1 wherein the Ig fragment is a variable light chain fragment. 5. The composition of claim 4, wherein the light chain variable fragment contains an IgG VLκ region. 6. The composition of claim 1, wherein the relaxin-based fusion protein contains an amino acid sequence that is identical to SEQ ID NO: 6. 7. The composition of claim 1, wherein the composition is a unit dosage form with a dosage of 25-400 μg of the mRNA polynucleotide to provide a dose of up to 2 mg/kg in a human subject. 8. The composition of claim. 1, where the open reading frame is codon-optimized. 9. The composition of claim. 1, where the mRNA contains at least one chemical modification. 10. The composition according to claim 9, where the chemical modification is selected from pseudouridine, 1-methylpseudouridine, 1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-dezazapseudouridine, 2- TIO-1-methylpseevodouurine, 2-type-5-Azauridine, 2-tyidhydigropseevrodin, 2-tyidhydigodridine, 2-typse herdin, 4-methox-2-tyopseuridine, 4-methoxypsypseuridine, 4-type 1-methylpseevodumin, 4-Tiopseuridine, 4-Tiopseuridine 5-azauridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine and 2'-O-methyluridine.

Images