RU2795180C2 - Therapeutic and diagnostic methods for mast cell-mediated inflammatory diseases - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: following are presented: a method for treating patients with a mast cell-mediated inflammatory disease, methods for determining whether patients with a mast cell-mediated inflammatory disease may respond to therapy, for example, therapy comprising an agent selected from the group consisting of a tryptase antagonist, an Fc-epsilon receptor (FcεR), an IgE+ depleting B cell antibody, a mast cell or basophil depleting antibody, a protease-activated receptor 2 (PAR2) antagonist, an IgE antagonist, and combinations thereof, methods of selecting therapy for a patient with a mast cell-mediated inflammatory disease. Also the following are indicated: a method for monitoring the response of a patient with an inflammatory disease mediated by mast cells, a kit for identifying a patient with an inflammatory disease mediated by mast cells, the use of a tryptase antagonist for the manufacture of a drug for the treatment of a patient with an inflammatory disease, and methods for treating a patient with asthma.

EFFECT: invention makes it possible to create new effective therapeutic and diagnostic methods for the treatment of inflammatory diseases mediated by mast cells.

143 cl, 1 tbl, 4 dwg, 5 ex

Description

This application claims priority over U.S. Provisional Application No. 62/628564, filed February 9, 2018, which is incorporated herein by reference in its entirety.

SEQUENCE LIST

This application contains a sequence listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The specified ASCII copy created on February 4, 2019 is named 50474-161WO2_Sequence_Listing_2.4.19_ST25 and is 47,396 bytes in size.

FIELD OF TECHNOLOGY

This invention relates to therapeutic and diagnostic methods for inflammatory diseases mediated by mast cells, including asthma.

BACKGROUND OF THE INVENTION

Asthma is canonically described as an allergic inflammatory disease of the airways that is clinically characterized by episodic reversible airway obstruction. The therapeutic rationale for targeting mediators of allergic inflammation in asthma is supported by the clinical efficacy achieved by drugs against type 2 cytokines, such as anti-IL-5. These studies validated the therapeutic strategy of targeting the type 2 pathway to provide significant improvement in clinical outcomes, especially in subjects selected based on type 2 biomarkers. Despite these advances, there remains considerable interest in discovering and developing new treatments for asthma that are more effective in asthma with high levels of type 2 biomarkers, as well as in patients with asthma with low levels of type 2 biomarkers, for whom, as currently developed treatments are expected to provide less improvement in clinical outcomes.

Airway smooth muscle mast cell infiltration is a defining pathophysiological feature of asthma. IgE/FcεRl-dependent and IgE/FcεRI-independent mechanisms stimulate the release of asthma-associated soluble mast cell mediators. Demonstrating the therapeutic importance of targeting mast cells, XOLAIR® (omalizumab), an anti-IgE monoclonal antibody, is effective in relieving asthma exacerbations.

There remains a need in the art for improved therapeutic and diagnostic approaches to asthma and other mast cell-mediated inflammatory diseases.

SUMMARY OF THE INVENTION

The present invention relates, inter alia, to methods for treating patients with a mast cell-mediated inflammatory disease, methods for determining whether patients with a mast cell-mediated inflammatory disease may respond to therapy (e.g., therapy comprising a selected agent from the group consisting of tryptase antagonist, Fc epsilon receptor (FcεR) antagonist, IgE ⁺ B-cell depleting antibody, mast cell or basophil depleting antibody, protease-activated receptor 2 (PAR2) antagonist, IgE antagonist, and combinations thereof), methods of selecting therapy for a patient with an inflammatory disease mediated by mast cells, methods for assessing the response of a patient with an inflammatory disease mediated by mast cells, and methods for monitoring the response of a patient with an inflammatory disease mediated by mast cells.

In one aspect, the invention relates to a method of treating a patient with a mast cell-mediated inflammatory disease that has been identified as having (i) a genotype containing a number of active tryptase alleles that is equal to or greater than a reference number of active tryptase alleles; or (ii) a tryptase expression level in a sample from a patient that is equal to or greater than a reference tryptase level, the method comprising administering to a patient with a mast cell-mediated inflammatory disease a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist , an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a protease-activated receptor 2 (PAR2) antagonist, and combinations thereof.

In another aspect, the invention relates to a method for determining whether a patient with a mast cell-mediated inflammatory disease may respond to a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, an antibody a mast cell-depleting or basophil-depleting, protease-activated receptor 2 (PAR2) antagonist, and combinations thereof, the method comprising: (a) determining, in a sample from a patient with a mast cell-mediated inflammatory disease, the number of active tryptase alleles in the patient; and (b) identifying a patient having a likelihood of responding to a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and their combinations, based on the number of active tryptase alleles in the patient, wherein the number of active tryptase alleles equal to or greater than the reference number of active tryptase alleles indicates that the patient has an increased likelihood of responding to therapy.

In another aspect, the invention relates to a method for determining whether a patient with a mast cell-mediated inflammatory disease may respond to a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, an antibody , a mast cell- or basophil-depleting, protease-activated receptor 2 (PAR2) antagonist, and combinations thereof, the method comprising: (a) determining the level of tryptase expression in a sample from a patient with a mast cell-mediated inflammatory disease; and (b) identifying a patient having a likelihood of responding to a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and their combinations, based on the level of expression of tryptase in the sample from the patient, and the level of expression of tryptase in the sample equal to or greater than the reference level of tryptase indicates that the patient has an increased likelihood of responding to therapy.

In some embodiments of any of the preceding aspects, the method further comprises administering the therapy to the patient.

In some embodiments of any of the preceding aspects, the patient has been identified as having a type 2 biomarker level in a patient sample that is below a reference type 2 biomarker level. In some embodiments, the agent is administered to the patient as monotherapy.

In some embodiments of any of the preceding aspects, the patient has been identified as having a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a level 2 biomarker. In some embodiments, the method further comprises administering the _TH 2 pathway inhibitor to the patient.

In another aspect, the invention relates to a method of treating a patient with a mast cell-mediated inflammatory disease that has been identified as having (i) a genotype containing an amount of active tryptase alleles that is below a reference number of active tryptase alleles; or (ii) a tryptase expression level in a sample from a patient that is below a reference tryptase level, the method comprising administering a therapy comprising an IgE antagonist or an Fc epsilon receptor (FcεR) antagonist to a patient with a mast cell mediated inflammatory disease.

In another aspect, the invention relates to a method for determining whether a patient with a mast cell-mediated inflammatory disease may respond to therapy comprising an IgE antagonist or an FcεR antagonist, the method comprising: (a) determining in a sample from a patient with an inflammatory disease mediated by mast cells, the number of active tryptase alleles in the patient; and (b) identifying a patient having a likelihood of responding to therapy comprising an IgE antagonist or an FcεR antagonist based on the number of active tryptase alleles in the patient, wherein the number of active tryptase alleles is lower than the reference number of active tryptase alleles, indicating that the patient has an increased likelihood of response. for therapy.

In another aspect, the invention relates to a method for determining whether a patient with a mast cell-mediated inflammatory disease may respond to therapy comprising an IgE antagonist or an FcεR antagonist, the method comprising: (a) determining the expression level of tryptase in a sample from a patient with an inflammatory mast cell mediated disease; and (b) identifying a patient having a likelihood of responding to therapy comprising an IgE antagonist or an FcεR antagonist based on a tryptase expression level in the patient sample, wherein the tryptase expression level in the patient sample is below a reference tryptase level, indicating that the patient has an elevated likelihood of responding to therapy.

In some embodiments of any of the preceding aspects, the method further comprises administering the therapy to the patient.

In some embodiments of any of the preceding aspects, the patient has been identified as having a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a level 2 biomarker. In some embodiments, the method further comprises administering to the patient an additional inhibitor of the T _H 2 pathway.

In another aspect, the invention relates to a method for selecting therapy for a patient with a mast cell-selected inflammatory disease, the method comprising: (a) determining, in a sample from a patient with a mast cell-mediated inflammatory disease, the number of active tryptase alleles in the patient; And

(b) a choice for the patient: (i) a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell depleting antibody, or a basophil, a protease-activated receptor 2 antagonist ( PAR2), and combinations thereof, if the number of active tryptase alleles in the patient is equal to or higher than the reference number of active tryptase alleles, or (ii) therapy including an IgE antagonist or FcεR antagonist, if the number of active tryptase alleles in the patient is below the reference number of active tryptase alleles.

In another aspect, the invention relates to a method for selecting therapy for a patient with a mast cell-selected inflammatory disease, the method comprising: (a) determining the level of tryptase expression in a sample from a patient with a mast cell-selected inflammatory disease; and (b) selecting for the patient: (i) a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a protease-activated receptor 2 antagonist (PAR2), and combinations thereof, if the tryptase expression level in the patient sample is equal to or higher than the tryptase reference level, or (ii) therapy including an IgE antagonist or FcεR antagonist, if the tryptase expression level in the patient sample is below the tryptase reference level.

In some embodiments of any of the preceding aspects, the method further comprises administering the therapy selected in accordance with (b) to the patient.

In some embodiments of any of the preceding aspects, the patient has been identified as having a type 2 biomarker level in a patient sample that is below a reference type 2 biomarker level. In some embodiments, the agent is administered to the patient as monotherapy.

In some embodiments of any of the preceding aspects, the patient has been identified as having a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a type 2 biomarker, and the method further comprises selecting a combination therapy comprising a T _H 2 pathway inhibitor In some embodiments, the method further comprises administering the _TH 2 pathway inhibitor (or additional _TH 2 pathway inhibitor) to the patient.

In another aspect, the invention relates to a method for evaluating the response of a patient with a mast cell-mediated inflammatory disease to treatment with a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells. cells or basophils, a protease-activated receptor 2 (PAR2) antagonist, and combinations thereof, wherein the method comprises: (a) determining the expression level of tryptase in a sample from a patient with a mast cell-mediated inflammatory disease during or after administration of therapy comprising an agent, selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and combinations thereof, in a patient; and (b) maintaining, adjusting, or discontinuing treatment based on comparison of tryptase expression level in the sample to a reference tryptase level, wherein a change in tryptase expression level in the patient sample compared to the reference level is indicative of a response to therapy. In some embodiments, the change is an increase in tryptase expression and treatment is continued. In some embodiments, the change is a decrease in tryptase expression and the treatment is adjusted or stopped.

In another aspect, the invention relates to a method for controlling the response of a patient with a mast cell-mediated inflammatory disease that is being treated with a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells. a cell or basophil, a protease-activated receptor 2 (PAR2) antagonist, and combinations thereof, wherein the method comprises: (a) determining the expression level of tryptase in a patient sample during or after administration of therapy comprising an agent selected from the group consisting of a tryptase antagonist , an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and combinations thereof, in a patient; and (b) comparing the expression level of tryptase in the sample from the patient with a reference level of tryptase, thereby monitoring the response of the patient being treated with the therapy. In some embodiments, the change is an increase in tryptase and treatment is continued. In some embodiments, the change is a decrease in tryptase expression and the treatment is adjusted or stopped.

In another aspect, the invention provides an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and a combination thereof, for use in a method of treating a patient. with an inflammatory disease mediated by mast cells, in which (i) it was determined that the patient's genotype contains a number of active tryptase alleles that is equal to or higher than the reference number of active tryptase alleles; or (ii) the sample from the patient was determined to have a tryptase expression level equal to or greater than the tryptase reference level. In some embodiments, a patient has been determined to have a type 2 biomarker level in a patient sample that is below a reference level of a type 2 biomarker and the agent is intended for use as monotherapy. In some embodiments, the patient has been identified as having a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the agent is for use in combination with a T _H 2 pathway inhibitor. In some embodiments, implementation a tryptase antagonist is an anti-tryptase antibody, for example any anti-tryptase antibody described herein. In some embodiments, the IgE antagonist is an anti-IgE antibody. for example, any of the anti-IgE antibodies described herein.

In another aspect, the invention relates to an agent selected from an IgE antagonist or an FcεR antagonist for use in a method of treating a patient with a mast cell-mediated inflammatory disease, wherein (i) the patient's genotype is determined to contain an amount of active tryptase alleles below a reference number of active alleles. tryptase; or (ii) the sample from the patient has been determined to have a tryptase expression level that is below the tryptase reference level. In some embodiments, the patient has been determined to have a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the IgE antagonist or FcεR antagonist is intended for use in combination with an additional inhibitor of the T _H pathway 2.

In another aspect, the invention provides the use of an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and a combination thereof, in the manufacture of a medicament for the treatment of a patient with an inflammatory disease mediated by mast cells, in which (i) it was determined that the patient's genotype contains a number of active tryptase alleles that is equal to or greater than the reference number of active tryptase alleles; or (ii) the patient sample was determined to have a tryptase expression level equal to or greater than the tryptase reference level. In some embodiments, a patient has been determined to have a type 2 biomarker level in a patient sample that is below a reference level of a type 2 biomarker, and the agent is intended for use as monotherapy. In some embodiments, the patient has been identified as having a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the agent is for use in combination with a T _H 2 pathway inhibitor. In some embodiments, implementation a tryptase antagonist is an anti-tryptase antibody, for example any anti-tryptase antibody described herein. In some embodiments, the IgE antagonist is an anti-IgE antibody. for example, any of the anti-IgE antibodies described herein. In some embodiments, the tryptase antagonist should be administered in combination with an IgE antagonist. In some embodiments, the agent is a tryptase antagonist and the drug is formulated to be administered with an IgE antagonist.

In another aspect, the invention provides the use of an IgE antagonist or an FcεR antagonist in the manufacture of a medicament for the treatment of a patient with a mast cell-mediated inflammatory disease, wherein (i) the patient's genotype has been determined to contain a number of active tryptase alleles that is below a reference number of active tryptase alleles. ; or (ii) the sample from the patient has been determined to have a tryptase expression level that is below the tryptase reference level. In some embodiments, the patient has been determined to have a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the IgE antagonist or FcεR antagonist is intended for use in combination with an additional inhibitor of the T _H pathway 2.

In some embodiments of any of the preceding aspects, the number of active tryptase alleles is determined by sequencing the TPSAB1 and TPSB2 loci of the patient's genome. In some embodiments, the sequencing is Sanger sequencing or massively parallel sequencing. In some embodiments, the TPSAB1 locus is sequenced using a method comprising (i) amplifying a nucleic acid from a subject in the presence of a first forward primer containing the nucleotide sequence 5'-CTG GTG TGC AAG GTG AAT GG-3' (SEQ ID NO: 31) and a first reverse primer containing the nucleotide sequence 5'-AGG TCC AGC ACT CAG GAG GA 3' (SEQ ID NO: 32) to form a TPSAB1 amplicon; and (ii) sequencing the TPSAS1B amplicon in some embodiments, sequencing the TPSAB1 amplicon includes using the first forward primer and first reverse primer. In some embodiments, the TPSB2 locus is sequenced using a method comprising (i) amplifying a nucleic acid from a subject in the presence of a second forward primer containing the nucleotide sequence 5'-GCA GGT GAG CCT GAG AGT CC-3' (SEQ ID NO: 33), and a second reverse primer containing the nucleotide sequence 5'-GGG ACC TTC AC C TGC TTC AG-3' (SEQ ID NO: 34) to obtain a TPSB2 amplicon and (ii) sequencing the TPSB2 amplicon. In some embodiments, sequencing the TPSB2 amplicon comprises using a second forward primer and a reverse sequencing primer containing the 5'-CAG CCA GTG ACC CAG CAC-3' nucleotide sequence (SEQ ID NO: 35).

In some embodiments of any of the preceding aspects, the number of active tryptase alleles is determined by the formula: 4 is the sum of the number of alleles of α-tryptase and frameshift βIII-tryptase (βIII ^FS ) in the patient's genotype In some embodiments, alpha-tryptase is determined by detecting SNP c733 G>A in TPSAB1 containing the nucleotide sequence

CTGCAGGCGGGCGTGGTCAGCTGGG[G/A]CGAGGGCTGTGCCCAGCCCAACCGG (SEQ ID NO: 36), where the presence of A at c733> indicates alpha-tryptase. In some embodiments, beta-III ^FS -tryptase is determined by detecting the c980_981insC mutation in TPSB2 containing the nucleotide sequence CACACGGTCACCCTGCCCCCTGCCTCAGAGACCTTCCCCCCC (SEQ ID NO: 37).

In some embodiments of any of the preceding aspects, a reference number of active tryptase alleles is determined in a group of patients with a mast cell-mediated inflammatory disease. In some embodiments, the reference number of active tryptase alleles is 3.

In some embodiments of any of the preceding aspects, the number of active tryptase alleles in a patient is 3 or 4.

In some embodiments of any of the preceding aspects, the number of active tryptase alleles in a patient is 0, 1, or 2.

In some embodiments of any of the preceding aspects, the tryptase is beta-I-tryptase, beta-II-tryptase, beta-III-tryptase, alpha-I-tryptase, or a combination thereof.

In some embodiments of any of the preceding aspects, the tryptase expression level is a protein expression level. In some embodiments, the tryptase protein expression level is an active tryptase expression level. In some embodiments, the expression level of the tryptase protein is the expression level of total tryptase. In some embodiments, the level of protein expression is measured using immunoassay, enzyme immunoassay (ELISA), Western blot, or mass spectrometry. In some embodiments, the tryptase expression level is an mRNA expression level. In some embodiments, the level of mRNA expression is measured using a polymerase chain reaction (PCR) method or a microarray chip. In some embodiments, the PCR method is qPCR.

In some embodiments of any of the preceding aspects, the reference level of tryptase is a level determined in a group of individuals with an inflammatory disease mediated by mast cells. In some embodiments, the implementation of the reference level of tryptase is the median level.

In some embodiments of any of the preceding aspects, the patient sample is selected from the group consisting of a blood sample, a tissue sample, a sputum sample, a bronchial lavage sample, a mucosal fluid (MLF) sample, a bronchosorption sample, and a nasosorption sample. In some embodiments, the blood sample is a whole blood sample, a serum sample, a plasma sample, or a combination thereof. In some embodiments, the blood sample is a serum sample or a plasma sample.

In some embodiments of any of the preceding aspects, the agent is a tryptase antagonist. In some embodiments, the tryptase antagonist is an alpha tryptase antagonist or a beta tryptase antagonist. In some embodiments, the tryptase antagonist is a beta-tryptase antagonist. In some embodiments, the beta-tryptase antagonist is an anti-beta-tryptase antibody, or an antigen-binding fragment thereof. In some embodiments, the antibody contains the following six hypervariable regions (HVRs): (a) HVR-H1 containing the amino acid sequence DYGMV (SEQ ID NO: 1); (b) HVR-H2 containing the amino acid sequence FISSGSSTVYYADTMKG (SEQ ID NO: 2); (c) HVR-H3 containing the amino acid sequence RNYDDWYFDV (SEQ ID NO: 3); (d) HVR-L1 containing the amino acid sequence SASSSVTYMY (SEQ ID NO: 4); (e) HVR-L2 containing the amino acid sequence RTSDLAS (SEQ ID: 5); and (f) HVR-L3 containing the amino acid sequence QHYHSYPLT (SEQ ID NO: 6). In some embodiments, the antibody comprises (a) a heavy chain variable domain (VH) comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 7; (b) a light chain variable domain (VL) comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 8; or (c) a VH domain as in (a) and a VL domain as in (b). In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 7. In some embodiments, the VL domain contains the amino acid sequence of SEQ ID NO: 8. In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 7, and the VL domain contains the amino acid sequence of SEQ ID NO: 7 NO: 8. In some embodiments, the antibody comprises (a) a heavy chain comprising the amino acid sequence of SEQ ID NO: 9 and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the antibody comprises (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 11; and (b) a light chain containing the amino acid sequence of SEQ ID NO: 10. In some embodiments, the antibody comprises the following six HVRs: (a) an HVR-H1 containing the amino acid sequence of GYAIT ( SEQ ID NO: 12); (b) HVR-H2 containing the amino acid sequence GISSAATTFYSSWAKS (SEQ ID NO: 13); (c) HVR-H3 containing the amino acid sequence DPRGYGAALDRLDL (SEQ ID NO: 14); (d) HVR-L1 containing the amino acid sequence QSIKSVYNNRLG (SEQ ID NO: 15); (e) HVR-L2 containing the amino acid sequence ETSILTS (SEQ ID: 16); and (f) HVR-L3 containing the amino acid sequence AGGFDRSGDTT (SEQ ID NO: 17). In some embodiments, the antibody comprises (a) a heavy chain variable domain (VH) comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 18; (b) a light chain variable domain (VL) comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 19; or (c) a VH domain as in (a) and a VL domain as in (b). In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 18. In some embodiments, the VL domain contains the amino acid sequence of SEQ ID NO: 19. In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 18 and the VL domain contains the amino acid the sequence of SEQ ID NO: 19. In some embodiments, the antibody comprises (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 20, and (b) a light chain containing the amino acid sequence of SEQ ID NO: 21. In some embodiments, the antibody comprises (a) a heavy chain comprising the amino acid sequence of SEQ ID NO: 22; and (b) a light chain comprising the amino acid sequence of SEQ ID NO: 21. In some embodiments, the therapy further comprises an IgE antagonist.

In some embodiments of any of the preceding aspects, the agent is an FcεR antagonist. In some embodiments, the FcεR antagonist is a Bruton's tyrosine kinase (BTK) inhibitor. In some embodiments, the BTK inhibitor is GDC-0853, acalabrutinib, GS-4059, spebrutinib, BGB-3111, or HM71224. In some embodiments, the agent is an IgE ⁺ depleting B cell antibody. In some embodiments, the IgE ⁺ depleting B cell antibody is an antibody against the M1 domain.

In some embodiments of any of the preceding aspects, the agent is a mast cell or basophil depleting antibody.

In some embodiments of any of the preceding aspects, the agent is a PAR2 antagonist.

In some embodiments of any of the aspects described herein, the therapy or combination comprises a tryptase antagonist (e.g., an anti-tryptase antibody, including any of the anti-tryptase antibodies described herein) and an IgE antagonist (e.g., an anti-IgE antibody, including any from the anti-IgE antibodies described herein, eg omalizumab (eg XOLAIR®)).

In some embodiments of any of the aspects described herein, the agent is an IgE antagonist. In some embodiments, the IgE antagonist is an anti-IgE antibody. In some embodiments, the anti-IgE antibody is an IgE blocking antibody and/or an IgE depleting antibody. In some embodiments, the anti-IgE antibody comprises the following six HVRs: (a) HVR-H1 containing the amino acid sequence GYSWN (SEQ ID NO: 40); (b) HVR-H2 containing the amino acid sequence SITYDGSTNYNPSVKG (SEQ ID NO: 41); (c) HVR-H3 containing the amino acid sequence GSHYFGHWHFAV (SEQ ID NO: 42); (d) HVR-L1 containing the amino acid sequence RASQSVDYDGDSYMN (SEQ ID NO: 43); (e) HVR-L2 containing the amino acid sequence AASYLES (SEQ ID: 44); and (f) HVR-L3 containing the amino acid sequence QQSHEDPYT (SEQ ID NO: 45). In some embodiments, the anti-IgE antibody comprises (a) a heavy chain variable domain (VH) comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 38; (b) a light chain variable domain (VL) comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 39; or (c) a VH domain as in (a) and a VL domain as in (b). In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 38. In some embodiments, the VL domain contains the amino acid sequence of SEQ ID NO: 39. In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 38 and the VL domain contains the amino acid the sequence of SEQ ID NO: 39. In some embodiments, the anti-IgE antibody is omalizumab (XOLAIR®) or XmAb7195. In some embodiments, the anti-IgE antibody is omalizumab (XOLAIR®).

In some embodiments of any of the preceding aspects, the type 2 biomarker is a _TH 2 cell-associated cytokine, periostin, eosinophil count, eosinophil profile, FeNO, or IgE. In some embodiments, the cytokine associated with the _TH 2 cell is IL-13, IL-4, IL-9, or IL-5. In some embodiments, the T _H 2 pathway inhibitor inhibits any target selected from interleukin-2 inducible T cell kinase (ITK), Bruton's tyrosine kinase (BTK), Janus kinase 1 (JAK1) (e.g., ruxolitinib, tofacitinib, oclacitinib, baricitinib, filgotinib, gandotinib, lestaurtinib, momelotinib, pacrinitib, upadacitinib, pefitinib, and fedratinib), GATA binding protein 3 (GATA3), IL-9 (eg, MEDI-528), IL-5 (eg, mepolizumab, CAS No. 196078-29 -2; resilizumab), IL-13 (e.g., IMA-026, IMA-638 (also called anrukinzumab, INN #910649-32-0; QAX-576; IL-4/IL-13 decoy) tralokinumab (also called CAT-354, CAS No. 1044515-88-9); AER-001, ABT-308 (also called humanized antibody 13C5.5)), IL-4 (e.g. AER-001, traps for IL-4/IL-13 ), OX40L, TSLP, IL-25, IL-33 and IgE (eg XOLAIR®, QGE-031 and MEDI-4212); and receptors, e.g.: IL-9 receptor, IL-5 receptor (e.g. MEDI-563 (benilizumab, CAS No. 1044511-01-4)), IL-4 receptor alpha (e.g. AMG-317, AIR-645), IL-13 receptor alpha-1 (eg R-1671) and IL-13 receptor alpha-2, OX40, TSLP-R, IL-7R-alpha (co-receptor for TSLP), IL-17RB (receptor for IL-25) , ST2 (IL-33 receptor), CCR3, CCR4, CRTH2 (eg, AMG-853, AP768, AP-761, MLN6095, AST129968), FcεRI, Fc£RII/CD23 (IgE receptor), Flap (eg, GSK2190915), Syk kinase (R-343, PF3526299); CCR4 (AMG-761), TLR9 (QAX-935) and a multicytokine inhibitor of CCR3, IL-5, IL-3 and GM-CSF (eg TPI ASM8).

In some embodiments of any of the preceding aspects, the method further comprises administering an additional therapeutic agent to the patient. In some embodiments, the additional therapeutic agent is selected from the group consisting of a corticosteroid, an IL-33 axis binding antagonist, a TRPA1 antagonist, a bronchodilator or drug to control asthma symptoms, an immunomodulator, a tyrosine kinase inhibitor, and a phosphodiesterase inhibitor. In some embodiments, the additional therapeutic agent is a corticosteroid. In some embodiments, the corticosteroid is an inhaled corticosteroid.

In some embodiments of any of the preceding aspects, the mast cell-mediated inflammatory disease is selected from the group consisting of asthma, atopic dermatitis, chronic spontaneous urticaria (CSU), systemic anaphylaxis, mastocytosis, chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis ( IPF) and eosinophilic esophagitis. In some embodiments, the mast cell mediated inflammatory disease is asthma. In some embodiments, asthma is moderate to severe. In some embodiments, asthma is not controlled by corticosteroids. In some embodiments, the asthma is high T _H 2 asthma or low T _H 2 asthma.

In another aspect, the invention relates to a kit for identifying a patient with a mast cell-mediated inflammatory disease that is likely to respond to therapy comprising an agent selected from the group of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a protease-activated receptor 2 (PAR2) antagonist, and combinations thereof, wherein the kit contains: (a) reagents for determining the number of active tryptase alleles in a patient or for determining the level of expression of tryptase in a sample from a patient; and optionally (b) instructions for use of reagents to identify a patient with a mast cell-mediated inflammatory disease that is likely to respond to therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE depleting antibody ⁺ B α-cells, mast cell or basophil depleting antibody, PAR2 antagonist, and combinations thereof. In some embodiments, the agent is a tryptase antagonist and the therapy further comprises an IgE antagonist. In some embodiments, the therapy comprises a tryptase antagonist and an IgE antagonist.

In another aspect, the invention relates to a kit for identifying a patient with a mast cell-mediated inflammatory disease that is likely to respond to therapy comprising an IgE antagonist or an FcεR antagonist, the kit comprising: (a) reagents for determining the number of active tryptase alleles in a patient or for determining the level of expression of tryptase in the sample from the patient; and optionally (b) instructions for using reagents to identify a patient with a mast cell-mediated inflammatory disease that is likely to respond to therapy comprising an IgE antagonist or an FcεR antagonist.

In some embodiments of any of the preceding aspects, the kit further comprises reagents for determining the level of a type 2 biomarker in a patient sample.

In another aspect, the invention provides an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and a combination thereof, for use in a method of treating a patient. with an inflammatory disease mediated by mast cells, in which (i) it was determined that the patient's genotype contains a number of active tryptase alleles that is equal to or higher than the reference number of active tryptase alleles; or (ii) the patient sample was determined to have a tryptase expression level equal to or greater than the tryptase reference level. In some embodiments, a patient has been determined to have a type 2 biomarker level in a patient sample that is below a reference level of a type 2 biomarker, and the agent is intended for use as monotherapy. In some embodiments, the patient has been identified as having a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the agent is for use in combination with a _TH 2 pathway inhibitor.

In another aspect, the invention relates to an agent selected from an IgE antagonist or an FcεR antagonist for use in a method of treating a patient with a mast cell-mediated inflammatory disease, wherein (i) the patient's genotype is determined to contain an amount of active tryptase alleles below a reference number of active alleles. tryptase; or (ii) the sample from the patient has been determined to have a tryptase expression level that is below the tryptase reference level. In some embodiments, the patient has been determined to have a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the IgE antagonist or FcεR antagonist is intended for use in combination with an additional inhibitor of the T _H pathway 2.

In another aspect, the invention provides the use of an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and a combination thereof, in the manufacture of a medicament for the treatment of a patient with an inflammatory disease mediated by mast cells, in which (i) it was determined that the patient's genotype contains a number of active tryptase alleles that is equal to or greater than the reference number of active tryptase alleles; or (ii) the patient sample was determined to have a tryptase expression level equal to or greater than the tryptase reference level. In some embodiments, a patient has been determined to have a type 2 biomarker level in a patient sample that is below a reference level of a type 2 biomarker, and the agent is intended for use as monotherapy. In some embodiments, the patient has been identified as having a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the agent is for use in combination with a _TH 2 pathway inhibitor.

In another aspect, the invention provides the use of an IgE antagonist or an FcεR antagonist in the manufacture of a medicament for the treatment of a patient with a mast cell-mediated inflammatory disease, wherein (i) the patient's genotype has been determined to contain a number of active tryptase alleles that is below a reference number of active tryptase alleles. ; or (ii) the sample from the patient has been determined to have a tryptase expression level that is below the tryptase reference level. In some embodiments, the patient has been determined to have a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the IgE antagonist or FcεR antagonist is intended for use in combination with an additional inhibitor of the T _H pathway 2.

BRIEF DESCRIPTION OF GRAPHICS

On FIG. 1 is a graph showing the number of active tryptase alleles for patients with moderate or severe asthma. The number of active tryptase alleles is plotted on a bar graph for subjects with moderate or severe asthma from BOBCAT, EXTRA and MILLY.

On FIG. 2A and 2B are a series of graphs showing that total peripheral blood tryptase protein is associated with tryptase copy number in moderate or severe asthma. Analysis of the amount of protein derived from a specific gene (pQTL) was performed for total plasma tryptase from the BOBCAT study (FIG. 2A) and total serum tryptase from the MILLY study (FIG. 2B). The fitting straight line (95% CI) is shown in gray. The p-value of r ² from the linear regression is noted on the graphs, r ² is the linear regression determination coefficient, which takes a value from 0 to 1; increasing values indicate the proportion of variance described by the independent variable.

On FIG. 3 is a series of graphs demonstrating the efficacy of treating _FEV1 in asthma from anti-IgE antibody (omalizumab (XOLAIR®)) therapy based on copy number of active tryptases. Percent change in FEV ₁ from baseline was assessed in subjects from the EXTRA study based on the number of active tryptase alleles (left panel, 1 or 2; right panel, 3 or 4).

On FIG. 4A-4C are a series of graphs demonstrating that type 2 asthma biomarkers do not correlate with the number of active tryptase alleles in moderate or severe asthma. Serum levels of the type 2 biomarker periostin (Fig. 4A), exhaled nitric oxide (FeNO) fraction (Fig. 4B), and blood eosinophil counts (Fig. 4C) were assessed in relation to the amount of active tryptase in a cohort with moderate or severe asthma from BOBCAT, EXTRA, and MILLY.

DETAILED DESCRIPTION OF THE INVENTION

I. Definitions

The term "about" as used herein refers to the usual error range for the corresponding value and is well known to one of skill in the art. As used herein, the use of "about" in relation to a value or parameter includes (and describes) embodiments that refer directly to that value or parameter per se.

The terms "biomarker" and "marker" are used interchangeably herein to refer to a DNA, RNA, protein, carbohydrate, or glycolipid-based molecular marker whose expression or presence in a subject or patient sample can be detected by standard methods (or the methods described herein). ) and are useful, for example, for identifying, for example, the likelihood of susceptibility or sensitivity of a mammal being treated, or for monitoring a subject's response to treatment. Expression of such a biomarker can be defined as higher or lower in a sample obtained from a patient who has an increased or decreased likelihood of responding to therapy compared to a reference level (including, for example, the average expression level of the biomarker in samples from a group/population of patients (eg, patients with asthma), the level of the biomarker in samples from a group/population of control individuals (eg, healthy individuals), or the level in a sample previously obtained from an individual at a previous time). In specific embodiments, the biomarker, as described herein, is the number of active tryptase alleles or the level of tryptase expression.

As used herein, the term "tryptase" refers to any native tryptase from any vertebrate source, including mammals such as primates (eg, humans) and rodents (eg, mice and rats), unless otherwise indicated. Tryptase is also known in the art as mast cell tryptase, mast cell protease II, skin tryptase, lung tryptase, pituitary tryptase, mast cell neutral proteinase, and mast cell serine proteinase II. The term "tryptase" includes alpha tryptase (encoded in humans by TPSAB1), beta tryptase (encoded in humans by TPSAB1 and TPSB2; see below), delta tryptase (encoded in humans by TPSD1), gamma tryptase (encoded in humans by TPSG1) and epsilon tryptase (encoded in humans by PRSS22). Alpha (α)-, beta (β)- and gamma (γ)-tryptase proteins are soluble, while epsilon (ε)-tryptase proteins are attached to the membrane. Beta and gamma tryptase are both active serine proteases, although they have different specificities. The alpha and delta (δ) tryptase proteins are largely inactive proteases because they have critical residues that differ from typical active serine proteases. An exemplary full-length alpha-tryptase protein sequence can be found under NCBI GenBank accession number ACZ98910.1. Illustrative full length gamma tryptase protein sequences can be found under Uniprot Accession Q9NRR2 or GenBank Accession Q9NRR2.3, AAF03695.1, NP_036599.3, or AAF76457.1. Illustrative full-length delta-tryptase protein sequences can be found under Uniprot Accession Q9BZJ3 or GenBank Accession NP_036349.1. Several tryptase genes are clustered on the human chromosome 16p13.3. The term encompasses "full length" unprocessed tryptase, as well as any form of tryptase resulting from processing in a cell. Beta tryptase is the main tryptase expressed in mast cells, while alpha tryptase is the main tryptase expressed in basophils. Alpha-tryptase and beta-tryptase typically contain a leader sequence of approximately 30 amino acids and a catalytic sequence of approximately 245 amino acids (see, e.g., Schwartz, Immunol. Allergy Clin. N. Am. 26:451-463, 2006) .

As used herein, the term "beta-tryptase" refers to any native beta-tryptase from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats), unless otherwise noted. . Beta-tryptase is a serine protease that is the main component of mast cell secretory granules. As used herein, the term encompasses beta-1-tryptase (encoded by the TPSAB1 gene, which also encodes for alpha-1 tryptase), beta-2-tryptase (encoded by the TPSB2 gene), and beta-3-tryptase (also encoded by the TPSB2 gene). An exemplary human beta-1-tryptase sequence is shown in SEQ ID NO: 23 (see also GenBank accession number NP_003285.2). An exemplary human beta-2-tryptase sequence is shown in SEQ ID NO: 24 (see also GenBank accession number AAD13876.1). An exemplary human beta-3-tryptase sequence is shown in SEQ ID NO: 25 (see also GenBank accession number NP_077078.5). The term beta-tryptase encompasses "full-length" full-length beta-tryptase as well as beta-tryptase resulting from post-translational modifications, including proteolytic processing. It is assumed that full-length beta-tryptase is processed in two proteolytic steps. First, autocatalytic intermolecular cleavage at R ^-3 occurs, especially at acidic pH and in the presence of a polyanion (eg heparin or dextran sulfate). The remaining prodipeptide is then removed (probably by dipeptidyl peptidase I). For full-length human beta-1-tryptase, with reference to SEQ ID NO: 23 below, the underlined amino acid residues that correspond to the native leader sequence and the amino acid residues in bold and gray that correspond to the prodomain are cleaved to form the mature protein (see ., e.g., Sakai et al. J. Clin. Invest. 97:988-995, 1996)

Mature enzymatically active beta-tryptase is typically a homotetramer or heterotetramer, although an active monomer has been reported (see, for example, Fukuoka et al. J. Immunol. 176:3165, 2006). The beta-tryptase tetramer subunits are held together by hydrophobic and polar interactions between the subunits and are stabilized by polyanions (particularly heparin and dextran sulfate). The term "tryptase" may refer to tryptase tetramer or tryptase monomer. Illustrative sequences for mature human beta-1, beta-2 and beta-3 tryptase are shown in SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28, respectively. The active site of each subunit faces the central pore of the tetramer, which measures approximately 50×30 angstroms (see, for example, Pereira et al. Nature 392:306-311, 1998). The size of the central pore tends to limit access to active sites by inhibitors. Exemplary substrates for beta-tryptase include, but are not limited to, PAR2, C3, fibrinogen, fibronectin, and kininogen.

The terms "oligonucleotide" and "polynucleotide" are used interchangeably and refer to a molecule consisting of two or more deoxyribonucleotides or ribonucleotides, preferably more than three. Its exact size will depend on many factors, which in turn depend on the final function or use of the oligonucleotide. The oligonucleotide can be obtained synthetically or by cloning. Chimeras of deoxyribonucleotides and ribonucleotides may also be within the scope of this invention.

The term "genotype" refers to a description of the alleles of a gene contained in an individual or sample. In the context of this invention, no distinction is made between the genotype of the individual and the genotype of the sample obtained from the individual. While typically the genotype is determined from a sample of diploid cells, the genotype can be determined from a sample of haploid cells such as a sperm cell.

The position of a nucleotide in the genome at which more than one sequence is possible in a population is referred to herein as a "polymorphism" or "polymorphic site". A polymorphic site may be, for example, a nucleotide sequence of two or more nucleotides, an inserted nucleotide or nucleotide sequence, a deleted nucleotide or nucleotide sequence, or a microsatellite. A polymorphic site that is two or more nucleotides long can be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more, 20 or more, 30 or more, 50 or more, 75 or more, 100 or more, 500 or more, or about 1000 nucleotides in length, where all or some of the nucleotide sequences differ within the region.

The term "single nucleotide polymorphism" or "SNP" refers to a single base change in a DNA sequence that results in genetic variation. Single nucleotide polymorphisms can occur in any region of a gene. In some cases, polymorphism can lead to a change in the protein sequence. Altering the sequence of a protein may or may not affect the function of the protein.

When two, three, or four alternative nucleotide sequences are present in a polymorphic site, each nucleotide sequence is referred to as a "polymorphic variant" or "nucleic acid variant". Each possible variant in the DNA sequence is referred to as an "allele". Typically, the first allelic form identified is arbitrarily designated as the control form, and other allelic forms are designated as alternative or variant alleles.

The term "number of active tryptase alleles" refers to the number of active tryptase alleles in a subject's genotype. In some embodiments, the number of active tryptase alleles can be determined by accounting for TPSAB1 and TPSB2 inactivating mutations. Since each diploid subject will have two copies of each of TPSAB1 and TPSB2, the number of active tryptase alleles can be determined by formula 4 - the sum of the number of frameshifted alpha-tryptase and beta-III-tryptase (beta-III ^FS ) alleles in the subject's genotype. In some embodiments, the number of active tryptase alleles in a subject is an integer in the range of 0 to 4 (eg, 0, 1, 2, 3, or 4).

The term "reference number of active tryptase alleles" refers to the number of active tryptase alleles against which another number of active tryptase alleles is compared, for example, for diagnostic, predictive, prognostic and/or therapeutic purposes. The number of reference active tryptase alleles may be determined in a reference sample, a reference population, and/or may be a predetermined value (e.g., a threshold value that has previously been determined to significantly (e.g., statistically significant) separate a first subset of individuals from a second subset of individuals (e.g., , in terms of response to therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an FcεR antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist, and combinations thereof)) In some embodiments, the reference number of active tryptase alleles is a predetermined value. like asthma). In some embodiments, the number of active tryptase alleles is determined from the overall distribution of values in the particular disease being studied or in a given population. In some embodiments, the reference number of active tryptase alleles is an integer in the range of 0 to 4 (eg, 0, 1, 2, 3, or 4). In specific embodiments, the reference number of active tryptase alleles is 3.

The terms "level", "expression level" or "expression level" are used interchangeably and generally refer to the amount of a polynucleotide or amino acid product or protein in a biological sample. "Expression" generally refers to the process by which information encoded by genes is converted into structures present and functioning in the cell. Therefore, according to the invention, "expression" of a gene may refer to transcription into a polynucleotide, translation into a protein, or even post-translational modification of the protein. Fragments of a transcribed polynucleotide, a translated protein, or a post-translationally modified protein should also be considered expressed, whether they originate from a transcript obtained by alternative splicing or a degraded transcript, or from post-translational processing of the protein, for example, by proteolysis. "Expressed genes" include those that are transcribed into a polynucleotide as mRNA and then translated into protein, as well as those that are transcribed into RNA but not translated into protein (eg, ribosomal RNAs are also carried).

In certain embodiments, the term "reference level" in this document refers to a predetermined value. One skilled in the art will appreciate that the reference level is predetermined and set to meet requirements, for example, in terms of specificity and/or sensitivity. These requirements may vary, for example, from regulator to regulator. It may be, for example, that the sensitivity or specificity of the assay, respectively, should be set to certain limits, for example, 80%, 90% or 95%. These requirements can also be defined in terms of positive or negative predictive values. However, based on the ideas presented in this invention, it will always be possible to achieve a reference level that meets these requirements. In one embodiment, the reference level is determined in healthy individuals. The reference value, in one embodiment, has been pre-determined for the particular disease the patient is suffering from (eg, an inflammatory disease mediated by mast cells, such as asthma). In some embodiments, the implementation of the reference level can be set to any percentage, for example, from 25% to 75% of the total distribution of values in the study of a particular disease. In other embodiments, the reference level may be set, for example, to the median, tertiles, quartiles, or quintiles, as determined from the overall distribution of values in the particular disease being studied or in a given population. In one embodiment, the reference level is set equal to the median value, as determined from the overall distribution of values for the particular disease under investigation. In one embodiment, the reference level may depend on the gender of the patient, for example, men and women may have different reference levels.

In some embodiments, the term "at reference level" refers to the level of a marker (eg, tryptase) that is the same as the level detected using the methods described herein from a reference sample.

In some embodiments, the term "increase" or "above" refers to a level equal to the reference level, or to an overall increase of 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%. 70%, 80%, 85%, 90%, 95%, 100% or more of a marker (eg, tryptase) level detected using the methods described herein compared to the level from a reference sample.

In certain embodiments, the term "reduction" or "below" in this document refers to a level below a reference level or an overall reduction of 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of a marker (e.g. tryptase) level detected using the methods described herein compared to the level from the reference sample.

A "disorder" or "disease" is any pathological condition that would benefit from treatment or diagnosis by the method of the invention. The term encompasses chronic and acute disorders or diseases, including those pathological conditions that increase the susceptibility of a mammal to the disorder in question. Examples of diseases to be treated include inflammatory diseases mediated by mast cells such as asthma.

“Mast cell-mediated inflammatory disease” refers to diseases or disorders that are at least partially mediated by mast cells, such as asthma (e.g., allergic asthma), urticaria (e.g., chronic spontaneous urticaria (CSU) or chronic idiopathic urticaria (CIU) ), eczema, pruritus, allergy, atopic allergy, anaphylaxis, anaphylactic shock, allergic bronchopulmonary aspergillosis, allergic rhinitis, allergic conjunctivitis, and autoimmune disorders including rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis, pancreatitis, psoriasis, plaque psoria az, teardrop psoriasis, inverse psoriasis, pustular psoriasis, erythrodermic psoriasis, paraneoplastic autoimmune diseases, autoimmune hepatitis, bullous pemphigoid, myasthenia gravis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, celiac disease, thyroiditis (eg, Graves' disease), Sjögren's syndrome, Guillain's disease Barre, Raynaud's phenomenon, Addison's disease, liver disease (eg, primary biliary cirrhosis, primary sclerosing cholangitis, non-alcoholic fatty liver disease, and non-alcoholic steatohepatitis), and diabetes (eg, type I diabetes).

In some embodiments, the asthma is chronic persistent severe asthma with severe worsening symptoms (attacks or exacerbations) that can be life threatening. In some embodiments, the asthma is atopic (also known as allergic) asthma, non-allergic asthma (eg, often caused by a respiratory viral infection (eg, influenza, parainfluenza, rhinovirus, human metapneemovirus, and respiratory syncytial virus), or an inhaled irritant (eg, air pollutants). , smog, diesel particles, volatile chemicals and gases indoors or outdoors, or even cold, dry air).

In some embodiments, the asthma is episodic or exercise-induced asthma due to acute or chronic primary or secondary exposure to "smoke" (typically cigarettes, cigars, or pipes), inhalation, or "vapour" (tobacco, marijuana, or other similar substances) , or asthma caused by recent use of aspirin or related non-steroidal anti-inflammatory drugs (NSAIDs). In some embodiments, asthma is mild or corticosteroid-untreated asthma, newly diagnosed and untreated asthma, or not previously requiring chronic use of inhaled topical or systemic steroids to control symptoms (cough, wheezing, dyspnea/dyspnea, or chest pain). In some embodiments, the asthma is chronic, corticosteroid-resistant asthma, corticosteroid-refractory asthma, asthma not controlled by corticosteroids or other drugs to control chronic asthma.

In some embodiments, the asthma is moderate to severe asthma. In certain embodiments, the asthma is high T _H 2 asthma. In some embodiments, the asthma is severe asthma. In some embodiments, the asthma is atopic asthma, allergic asthma, non-allergic asthma (e.g., due to infection and/or respiratory syncytial virus (RSV)), exercise-induced asthma, aspirin-responsive/aspirin-induced asthma, mild asthma, moderate or severe asthma, corticosteroid-untreated asthma, chronic asthma, corticosteroid-resistant asthma, corticosteroid-refractory asthma, newly diagnosed and untreated asthma, smoking-induced asthma, asthma not controlled by corticosteroids. In some embodiments, the asthma is eosinophilic asthma. In some embodiments, the asthma is allergic asthma. In some embodiments, the individual has been determined to be positive for eosinophilic inflammation (EIP). See WO 2015/061441. In some embodiments, the asthma is high periostin asthma (eg, in which the periostin level is at least any of about 20 ng/mL, 25 ng/mL, or 50 ng/mL serum). In some embodiments, the asthma is asthma with high eosinophils (eg, at least any of about 150, 200, 250, 300, 350, 400 eosinophils/mL of blood). In some embodiments, the individual has been determined to be eosinophilic inflammation (EIN) negative. See WO 2015/061441. In some embodiments, the asthma is low periostin asthma (eg, less than about 20 ng/ml serum periostin). In some embodiments, the asthma is asthma with a low eosinophil level (eg, less than about 150 eosinophils/µl of blood or less than about 100 eosinophils/µl of blood).

As used herein, the term "high T _H 2 asthma" refers to asthma that exhibits high levels of one or more T _H 2 cell-associated cytokines, such as IL-13, IL-4, IL-9, or IL- 5, or which exhibits inflammation associated with the cytokine T _H 2. In some embodiments, the term "high T _H 2 asthma" can be used interchangeably with eosinophil high asthma, type 2 T-helper lymphocyte high asthma. , type 2 asthma, or _TH2 -induced asthma. In some embodiments, the asthma patient was determined to be eosinophilic inflammation (EIP) positive. See, for example, International Patent Application Publication No. WO 2015/061441, which is incorporated herein by reference in its entirety. In certain embodiments, the individual has been found to have elevated levels of at least one of the eosinophilic profile genes compared to a control or reference level. See WO 2015/061441. In certain embodiments, high T _H 2 asthma is high periostin asthma. In some embodiments, the individual has a high serum periostin level. In certain embodiments, the individual is an individual eighteen years of age or older. In certain embodiments, an elevated serum periostin level has been determined in the individual compared to a control or reference level. In some embodiments, the implementation of the control or reference level is the median level of periostin in the population. In certain embodiments, 20 ng/ml or more of serum periostin has been determined in an individual. In certain embodiments, 25 ng/ml or more of serum periostin has been determined in the individual. In certain embodiments, 50 ng/ml or more of serum periostin has been determined in an individual. In certain embodiments, the reference or reference serum periostin level is 20 ng/mL, 25 ng/mL, or 50 ng/mL. In some embodiments, the asthma is eosinophil high asthma. In some embodiments, an increased number of eosinophils has been determined in an individual compared to a control or reference level. In some embodiments, the implementation of the control or reference level is the median level of the population. In certain embodiments, 150 or more eosinophils/µl of blood have been detected in an individual. In certain embodiments, 200 or more eosinophils/µl of blood have been detected in an individual. In certain embodiments, 250 or more eosinophils/µl of blood have been detected in an individual. In certain embodiments, 300 or more eosinophils/µl of blood have been detected in an individual. In certain embodiments, 350 or more eosinophils/µl of blood have been detected in an individual. In certain embodiments, 400 or more eosinophils/µl of blood have been detected in an individual. In certain embodiments, 450 or more eosinophils/µl of blood have been detected in an individual. In certain embodiments, 500 or more eosinophils/µl of blood have been detected in an individual. In certain preferred embodiments, 300 or more eosinophils/µl of blood have been detected in an individual. In certain embodiments, the eosinophils are peripheral blood eosinophils. In certain embodiments, the eosinophils are sputum eosinophils. In certain embodiments, the individual exhibits an elevated level of FeNO (fraction of nitric oxide in exhaled air) and/or an increased level of IgE. For example, in some instances, an individual exhibits FeNO levels above about 250 parts per billion (ppb), above about 275 ppb, above about 300 ppb, above about 325 ppb, above about 325 ppb, or above. about 350 parts / billion. In some cases, an individual has an IgE level above 50 IU/ml. For a review of high T _H 2 asthma, see, for example, Fajt et al. J. Allergy Clin. Immunol. 135(2):299-310, 2015.

As used herein, the term "low _TH 2 asthma" or "low _TH 2 asthma" refers to asthma that exhibits low levels of one or more T _H 2 cell-associated cytokines, e.g., IL-13, IL -4, IL-9, or IL-5, or exhibits inflammation that is not associated with the cytokine T _H 2. In some embodiments, the term "low T _H 2 asthma" can be used interchangeably with asthma with low eosinophils. In some embodiments, the asthma patient has been determined to be eosinophilic inflammation (EIN) negative. See for example WO 2015/061441. In certain embodiments, low T _H 2 asthma is low periostin asthma. In certain embodiments, the individual is an individual eighteen years of age or older. In certain embodiments, the subject has a reduced serum periostin level compared to a control or reference level. In some embodiments, the implementation of the control or reference level is the median level of periostin in the population. In certain embodiments, less than 20 ng/mL of serum periostin has been detected in an individual. In some embodiments, the asthma is low eosinophil asthma. In some embodiments, the individual has a reduced eosinophil count compared to a control or reference level. In some embodiments, the implementation of the control or reference level is the median level of the population. In certain embodiments, the individual has less than 150 eosinophils/BMc of blood. In certain embodiments, the individual has less than 100 eosinophils/BMc of blood. In certain embodiments, the individual has less than 300 eosinophils/BMc of blood.

As used herein, the term “type 2 biomarker” refers to a biomarker that is associated with T _H 2 inflammation. Non-limiting examples of type 2 biomarkers include a T _H 2 cell-associated cytokine (e.g. , IL-9 or IL-5), periostin, eosinophil count, eosinophil profile, FeNO or IgE.

The term "administering" means administering the composition to a patient (eg, a patient suffering from a mast cell mediated inflammatory disease such as asthma). The compositions used in the methods described herein may be administered, for example, parenterally, intraperitoneally, intramuscularly, intravenously, intradermally, transdermally, intraarterially, intralesionally, intracranially, intraarticularly, intraprostate, intrapleurally, intratracheally, intrathecally, intranasally, intravaginally, rectally, topically, intratumorally, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, intraocularly, intrabitally, orally, topically, transdermally, intravitreally, periocularly, into the conjunctival cavity, into the subtenon space, intracameral, subretinally, retrobulbar, intracanal, by inhalation, injections , implantation, infusion, continuous infusion, localized perfusion directly into target cells, by catheter, by lavage, in creams or in lipid formulations. Parenteral administration includes intramuscular, intravenous, intraarterial, intraperitoneal or subcutaneous administration. The compositions used in the methods described herein can also be administered systemically or locally. The route of administration may vary depending on various factors (eg, the compound or composition to be administered, the severity of the condition, disease, or disorder being treated).

The terms "therapeutic agent" or "agent" refers to any agent that is used to treat a disease, such as an inflammatory disease mediated by mast cells, such as asthma. The therapeutic agent may be, for example, a polypeptide(s) (for example, an antibody, immunoadhesin or peptibody), an aptamer, a small molecule that can bind to a protein, or a nucleic acid molecule that can bind to a nucleic acid molecule encoding a target (for example , siRNA) and the like.

The terms "inhibitors" and "antagonists", used interchangeably herein, refer to compounds or agents that inhibit or reduce the biological activity of the molecule to which they bind. Inhibitors include antibodies, synthetic or native sequence peptides, immunoadhesins, and small molecule inhibitors that bind, for example, to striptase or IgE. In some embodiments, the inhibitor (eg, antibody) inhibits the activity of the antigen by at least 10% in the presence of the inhibitor compared to the activity in the absence of the inhibitor. In some embodiments, the inhibitor inhibits the activity by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100%.

As used herein, the term "tryptase antagonist" refers to compounds or agents that inhibit or reduce the biological activity of a tryptase (e.g., alpha-tryptase (e.g., alpha-I-tryptase) or beta-tryptase (e.g., beta-I-tryptase, beta-II-tryptase, or beta-III-tryptase)). In some embodiments, the tryptase antagonist is an anti-tryptase antibody or a small molecule inhibitor.

The terms "anti-tryptase antibody" and "antibody that binds to tryptase" and "antibody that specifically binds tryptase" refer to an antibody that is capable of binding tryptase with sufficient affinity such that the antibody can be used as a diagnostic and/or therapeutic tryptase targeting agent. In one embodiment, the degree of binding of an anti-tryptase antibody to an unrelated non-tryptase protein is less than about 10% of the binding of the antibody to tryptase, as measured, for example, by radioimmunoassay (RIA). In certain embodiments, the antibody that is bound by the striptase has a dissociation constant (Kd) ≤ 1 μM, ≤ 100 nM, ≤ 10 nM, ≤ 1 nM, ≤ 0.1 nM, ≤ 0.01 nM, or ≤ 0.001 nM (e.g. , 10 ^-8 M or less, for example, from 10 ^-8 M to 10 ^-13 M, for example, from 10 ^-9 M to 10 ^-13 M). In certain embodiments, the anti-tryptase antibody binds to a tryptase epitope that is conserved across tryptase species. Exemplary anti-tryptase antibodies are described herein and in US Provisional Application No. 62/457222 and International Patent Publication No. WO 2018/148585, which are incorporated herein by reference in their entirety.

The term “FcεRI” refers to any native FcεRI (also known in the art as high affinity IgE receptor or FCER1) from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats) unless otherwise noted. FcεRI is a tetrameric receptor complex that binds the heavy chain Fc protein ε IgE. FcεRI consists of one α chain, one β chain and two γ chains. The amino acid sequence of an exemplary human FcεRIα polypeptide is given under UniProt Accession P12319. The amino acid sequence of an exemplary human FcεRIβ polypeptide is given under UniProt accession number Q01362. The amino acid sequence of an exemplary human FcεRIγ polypeptide is given under UniProt accession number P30273.

The term "FcεRII" refers to any naturally occurring FcεRII (also known in the art as CD23, FCER2, or low affinity IgE receptor) from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats), unless otherwise noted. The term encompasses "full length" full length FcεRII as well as any form of FcεRII resulting from cellular processing. The term also encompasses naturally occurring FcεRII variants, such as splice variants or allelic variants. The amino acid sequence of an exemplary human FcεRII polypeptide is given under UniProt Accession P06734.

As used herein, the term "Fc epsilon receptor (FcεR) antagonist" refers to compounds or agents that inhibit or reduce the biological activity of an FcεR (eg, FcεRI or FcεRII). An FcεR antagonist can inhibit the activity of an FcεR or a nucleic acid (eg, a gene or mRNA transcribed from a gene) or a polypeptide that is involved in FcεR signal transduction. For example, in some embodiments, the FcεR antagonist inhibits tyrosine protein kinase Lyn (Lyn), Bruton's tyrosine kinase (BTK), tyrosine protein kinase Fyn (Fyn), spleen-associated tyrosine kinase (Syk), T cell activation linker (LAT), protein -2, growth factor receptor-associated (Grb2), son of sevenless (Sos), Ras, Raf-1, mitogen-activated protein kinase 1 (MEK), mitogen-activated protein kinase 1 (ERK), cytosolic phospholipase A2 ( cPLA2), arachidonate-5-lipoxygenase (5-LO), arachidonate-5-lipoxygenase-activating protein (FLAP), guanine nucleotide exchange factor VAV (Vav), Rac, mitogen-activated protein kinase kinase-3, mitogen-activated protein kinase-7 activated protein kinase, p38 MAP kinase (p38), c-Jun-N-terminal kinase (JNK), protein-2 associated with protein-2, which is associated with the growth factor receptor (Gab2), phosphatidylinositol-4,5-bisphosphate -3-kinase (PI3K), phospholipase C gamma (PLCγ), protein kinase C (PKC), 3-phosphoinositide-dependent protein kinase 1 (PDK1), RAC serine/threonine protein kinase (ACT), histamine, heparin, interleukin (IL) -3, IL-4, IL-13, IL-5, granulocyte-macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor-alpha (TNF-α), leukotrienes (eg, LTC4, LTD4, and LTE4), and prostaglandins ( e.g. PDG2). In some embodiments, the FcεR antagonist is a BTK inhibitor, such as GDC-0853, acalabrutinib, GS-4059, spebrutinib, BGB-3111, or HM71224.

A "B cell" is a lymphocyte that matures in the bone marrow and includes naive B cells, memory B cells, or effector B cells (plasma cells). As used herein, a B cell may be normal or non-cancerous.

The term "antibody that depletes IgE ⁺ B cells" refers to an antibody that can reduce the number of IgE ⁺ B cells in a subject and/or interfere with one or more IgE ⁺ B cell functions. "IgE ⁺ B cell" refers to a B cell that expresses the membrane form of the B cell receptor for IgE. In some embodiments, the IgE ⁺ B cell is an IgE-switched B cell or a memory B cell. Human membrane IgE contains a 52 amino acid extracellular segment called the M1 prime segment (also known as M1', me.1, or CemX), which is not expressed in secreted anti-IgE antibodies. In some embodiments, the IgE ⁺ B cell depleting antibody is an anti-M1' antibody (eg, kilizumab). In some embodiments, the anti-M1' antibody is any of the anti-M1' antibodies described in International Patent Application Publication No. WO 2008/116149.

A "mast cell" is a type of granulocyte immune cell. Mast cells are commonly found in mucosal and epithelial tissues throughout the body. Mast cells contain cytoplasmic granules that store inflammatory mediators, including tryptase (especially beta-tryptase), histamine, heparin, and cytokines. Mast cells can be activated by antigen/IgE/FcεRI cross-linking, which can lead to degranulation and release of inflammatory mediators. The mast cell may be a mucosal mast cell or a connective tissue mast cell. See, for example, Krystel-Whittemore et al. front. Immunol. 6:620, 2015.

"Basophil" is a type of granulocyte immune cell. Basophils are usually present in the peripheral blood. Basophils can be activated by antigen/IgE/FcεRI crosslinking to release molecules such as histamines, tryptase (especially alpha-tryptase), leukotrienes, and cytokines. See, for example, Siracusa et al. J. Allergy Clin. Immunol. 132(4)789-801, 2013.

The term "mast cell or basophil depleting antibody" refers to an antibody that can reduce the number or biological activity of mast cells or basophils in a subject and/or interfere with one or more mast cell or basophil functions. In some embodiments, the antibody is a mast cell depleting antibody. In other embodiments, the antibody is a basophil-depleting antibody. In yet other embodiments, the antibody depletes mast cells and basophils. In some embodiments, the mast cell or basophil depleting antibody is an anti-Siglec8 antibody.

The term "protease-activated receptor 2 (PAR2)" refers to any native PAR2 (also known in the art as F2R-like trypsin receptor-1 (F2RL1) or G protein-coupled receptor 11 (GPR11)) from any source related to to vertebrates, including mammals such as primates (eg humans) and rodents (eg mice and rats), unless otherwise noted. The term encompasses "full-length" unprocessed PAR2 as well as any form of PAR2 resulting from cellular processing. The term also encompasses naturally occurring PAR2s, such as splice variants or allelic variants. The nucleic acid sequence of an exemplary human PAR2 is listed in RefSeq under accession number NM_005252. The amino acid sequence of an exemplary protein encoded by human PAR2 is listed in UniProt under accession number P55085.

The term "PAR2 antagonist" refers to a molecule that reduces, blocks, inhibits, abolishes or interferes with the biological activity or signal transduction of PAR2. Typically, PAR2 is activated by proteolytic cleavage of its N-terminus, which unmasks the bound peptide ligand that binds and activates the transmembrane receptor domain. Exemplary PAR2 antagonists include small molecule inhibitors (eg, K-12940, K-14585, GB83, GB88, AZ3451, and AZ8838), soluble receptors, siRNAs, and anti-PAR2 antibodies (eg, MAB3949 and Fab3949). See, for example, Cheng et al. Nature 545:112-115, 2017; Kanke et al. Br. J Pharmacol. 158(1):361-371, 2009; and Lohman et al. FASEB J. 26(7):2877-2887, 2012.

The term "IgE antagonist" refers to a molecule that reduces, blocks, inhibits, reverses or interferes with the biological activity of IgE. Such antagonists include, but are not limited to, anti-IgE antibodies, IgE receptors, anti-IgE receptor antibodies, anti-IgE antibody variants, IgE receptor ligands, and fragments thereof. In some embodiments, the IgE antagonist is capable of disrupting or blocking the interaction between IgE (eg, human IgE) and a high affinity FcεRI receptor, eg, on mast cells or basophils.

"Anti-IgE antibody" includes any antibody that specifically binds to IgE in a manner that does not cross-link when the IgE is bound to a high affinity receptor on mast cells and basophils. Exemplary anti-IgE antibodies include rhuMabE25 (E25, omalizumab (XOLAIR®)), E26, E27, as well as CGP-5101 (Hu-901), anti-HA (hemagglutinin), ligelizumab, and talizumab. The amino acid sequences of the heavy and light chain variable domains of humanized anti-IgE antibodies E25, E26 and E27 are described, for example, in US Pat. No. 6,172,213 and WO 99/01556. The CGP-5101 antibody (Hu-901) is described in Corne et al. J. Clin. Invest. 99(5): 879-887, 1997; W092/17207; and Deposit Nos. in ATCC BRL-10706, BRL-11130, BRL-11131, BRL-11132 and BRL-11133. An antibody to HA is described in US No. 60/444229, WO 2004/070011, and WO 2004/070010.

In the context of this document, the term "interleukin-33 (IL-33)" refers to any native IL-33 from any source related to vertebrates, including mammals such as primates (for example, humans) and rodents (for example, mice and rats) , unless otherwise specified. IL-33 is also referred to in the art as external endothelial venule nuclear factor (NF-HEV; see e.g. Baekkevold et al. Am. J. Pathol. 163(1): 69-79, 2003), DVS27, C9orf26 , and member 11 of the interleukin-1 family (IL-1F11). The term encompasses "full length" unprocessed IL-33 as well as any form of IL-33 resulting from cellular processing. Human full length full length IL-33 contains 270 amino acids (AA) and may also be referred to as IL-33 _1-270 . Processed forms of human IL-33 include, for example, IL-33 _95-270 , IL-33 _99-270 , IL-33 _109-270 , IL-33 _112-270 , IL-33 _1-178 , and IL-33 _{179 -270} (Lefrangais et al. Proc. Natl. Acad. Sci. 109(5): 1673-1678, 2012 and Martin, Semin. Immunol. 25: 449-457, 2013). In _some embodiments _, processed forms of human IL _- 33, e.g. elastase and cathepsin G, may have increased biological activity compared to full-length IL-33. The term also encompasses natural variants of IL-33, e.g., splice variants (e.g., constitutively active spIL-33 splice variant lacking exon 3, Hong et al. J. Biol. Chem. 286(22): 20078-20086 , 2011) or allelic variants. IL-33 may be present in the cell (eg, in the nucleus) or in the form of a secreted cytokine. The full-length IL-33 protein contains a helix-turn-helix DNA-binding motif, including a nuclear localization sequence (human IL-33 AK 1-75), which contains a chromatin-binding motif (human IL-33 AK 40-58). Forms of IL-33 that are processed and secreted lack these N-terminal motifs. The amino acid sequence of exemplary human IL-33 can be found, for example, under UniProt accession number 095760.

By "IL-33 axis" is meant a nucleic acid (eg, a gene or mRNA transcribed from a gene) or a polypeptide that is involved in IL-33 signal transduction. For example, the IL-33 axis may include an IL-33 ligand, a receptor (eg, ST2 and/or IL-IRAcP), adapter molecules (eg, MyD88), or proteins that bind to receptor molecules and/or adapter molecules (eg, kinases , such as interleukin-1 receptor-associated kinase-1 (IRAK1) and interleukin-1 receptor-associated kinase-4 (IRAK4), or ubiquitin E3 ligases, such as TNF receptor-associated factor-6 (TRAF6) ).

"An antagonist that binds the IL-33 axis" refers to a molecule that inhibits the interaction of an IL-33 axis binding partner with one or more of its binding partners. In the context of this document, an antagonist that binds the IL-33 axis includes antagonists that bind IL-33, antagonists that bind ST2, and antagonists that bind IL-IRAcP. Exemplary IL-33 axis binding antagonists include anti-IL-33 antibodies and antigen-binding fragments thereof (e.g. anti-IL-33 antibodies such as ANB-020 (AnaptysBio Inc.) or any of the antibodies described in EP 1725261, US 8187596 , WO 2011/031600, WO 2014/164959, WO 2015/099175, WO 2015/106080 or WO 2016/077381, each of which is incorporated herein by reference in its entirety); polypeptides that bind IL-33 and/or its receptor (ST2 and/or IL-IRAcP) and block ligand-receptor interaction (eg, ST2-Fc proteins; immunoadhesins, peptides and soluble ST2 or derivatives thereof); anti-IL-33 receptor antibodies (e.g. anti-ST2 antibodies, e.g. AMG-282 (Amgen) or STLM15 (Janssen) or any of the anti-ST2 antibodies described in WO 2013/173761 or WO 2013/165894, each of which is included in herein by reference in its entirety, or ST2-Fc proteins such as those described in WO 2013/173761; WO 2013/165894 or WO 2014/152195, each of which is incorporated herein by reference in its entirety) ; and IL-33 receptor antagonists, such as small molecule inhibitors, aptamers that bind IL-33, and nucleic acids that hybridize under stringent conditions to IL-33 axis nucleic acid sequences (e.g., short interfering RNAs (siRNAs) or short palindromic RNAs). repeats arranged in regular groups (CRISPR-RNA or sgRNA)).

The term “ST2 binding antagonist” refers to a molecule that inhibits the interaction of ST2 with IL-33, IL-IRAcP and/or a second ST2 molecule. An ST2 binding antagonist may be a protein, such as "ST2-Fc protein", which includes an IL-33 binding domain (e.g., all or part of the ST2 protein or IL-IRAcP) and a multimerizing domain (e.g., the Fc portion immunoglobulin, e.g., an IgG Fc domain selected from the IgG1, IgG2, IgG3, and IgG4 isotypes, as well as any allotype within each isotype group) that are attached to each other directly or indirectly via a linker (e.g., a serine-glycine (SG) linker, glycine-glycine (GG) linker or a variant thereof (e.g. SGG, GGS, SGS or GSG linker)) and includes, but is not limited to, ST2-Fc proteins and their variants described in WO 2013/173761, WO 2013/165894 and WO 2014/152195, each of which is incorporated herein by reference in its entirety.

" _TH 2 pathway inhibitor" or " _{TH 2} inhibitor" is an agent that inhibits the TH ₂ pathway. ), Bruton's tyrosine kinase (BTK), Janus kinase 1 (JAK1) (e.g., ruxolitinib, tofacitinib, oclacitinib, baricitinib, filgotinib, gandotinib, lestaurtinib, momelotinib, pacrinitib, upadacitinib, pefitinib, and fedratinib), GATA-binding protein 3 (GATA3 ), IL-9 (eg, MEDI-528), IL-5 (eg, mepolizumab, CAS No. 196078-29-2; resilizumab), IL-13 (eg, IMA-026, IMA-638 (also called anrukinzumab, INN #910649-32-0; QAX-576; IL-4/IL-13 Trap), tralokinumab (also called CAT-354, CAS #1044515-88-9); AER-001, ABT-308 (also called humanized 13C5.5 antibody)), IL-4 (e.g. AER-001, IL-4/IL-13 traps), OX40L, TSLP, IL-25, IL-33 and IgE (e.g. XOLAIR®, QGE- 031 and MEDI-4212); and receptors, e.g.: IL-9 receptor, IL-5 receptor (e.g. MEDI-563 (benilizumab, CAS No. 1044511-01-4)), IL-4 receptor alpha (e.g. AMG-317, AIR-645), IL-13 receptor alpha-1 (eg R-1671) and IL-13 receptor alpha-2, OX40, TSLP-R, IL-7R-alpha (co-receptor for TSLP), IL-17RB (receptor for IL-25) , ST2 (IL-33 receptor), CCR3, CCR4, CRTH2 (eg AMG-853, AP768, AP-761, MLN6095, AST129968), FcεRI, FcεRII/CD23 (IgE receptor), Flap (eg GSK2190915) , Syk kinase (R-343, PF3526299); CCR4 (AMG-761), TLR9 (QAX-935) and a multicytokine inhibitor of CCR3, IL-5, IL-3 and GM-CSF (eg TPI ASM8). Examples of inhibitors of the above targets are disclosed, for example, in WO 2008/086395; W02006/085938; US 7615213; US 7501121; W02006/085938; W02007/080174; US 7807788; WO2005/007699; W02007/036745; WO2009/009775; WO2007/082068; WO2010/073119; W02007/045477; WO2008/134724; US 2009/0047277; and WO 2008/127271.

The terms "patient" or "subject" refer to any individual animal, more specifically a mammal (including non-human animals such as, for example, cats, dogs, horses, rabbits, cows, pigs, sheep, zoo animals, and non-human primates). from a person) that require diagnosis or treatment. Even more specifically, in this document, the patient is a human.

The term "small molecule" refers to an organic molecule having a molecular weight of 50 daltons to 2500 daltons.

The term “effective amount” refers to the amount of a drug or therapeutic agent (e.g., a tryptase antagonist, an FcεR antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, an IgE antagonist, or a combination thereof (e.g. , a tryptase antagonist and an IgE antagonist)), effective for treating a disease or disorder (eg, an inflammatory disease mediated by mast cells, eg, asthma) in a subject or patient, such as a mammal, eg, a human.

In the context of this document, the term "therapy" or "treatment" refers to clinical intervention in an attempt to change the natural course of a disease in an individual or cell being treated, and can be carried out for prevention or in the course of the clinical manifestation of pathology. Desirable effects of treatment include prevention of the onset or recurrence of the disease, relief of symptoms, reduction of any direct or indirect pathological consequences of the disease, reduction in the rate of disease progression, improvement or mitigation of the disease state, and remission or improvement in prognosis. Those in need of treatment may include those who already have the disorder, as well as those who are at risk of the disease or who need to be prevented from having the disease. A patient can be successfully "treated" for asthma if, for example, after receiving asthma therapy, the patient has a marked and/or measurable reduction or absence of one or more of the following: recurrent airflow obstruction syndrome, cough, shortness of breath, chest tightness, symptoms symptoms that come on or get worse at night, symptoms that are triggered by cold air, exercise, or exposure to allergens.

A patient's "response" or "responsiveness" of a patient to a treatment or therapy, e.g., a therapy comprising a tryptase antagonist, an FcεR antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, an IgE antagonist, or a combination thereof (eg, tryptase antagonist and IgE antagonist) refers to the clinical or therapeutic benefit that a patient with or at risk of developing asthma obtains from or as a result of treatment. One skilled in the art can easily determine if a patient is susceptible. For example, a patient with asthma who is responding to therapy including a tryptase antagonist, an FcεR antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, an IgE antagonist, or a combination thereof (e.g., a tryptase antagonist and an IgE antagonist) may show observable and/or measurable reduction in or absence of one or more asthma symptoms, e.g. air, exercise or exposure to allergens. In some embodiments, the response may be an improvement in lung function, such as an improvement in FEV _{of 1} %.

The terms "sample" and "biological sample" are used interchangeably to refer to any biological sample obtained from an individual, including bodily fluids, body tissues (for example, lung samples), nasal samples (including nasal swabs or nasal polyps), sputum, nasosorption samples , bronchosorption samples, cells or other sources. Body fluids include, for example, bronchial lavage fluid (BAL), mucosal fluid (MLF; including, for example, nasal MLF or bronchial MLF), lymph, serum, fresh whole blood, frozen whole blood, plasma (including fresh or frozen), serum (including fresh or frozen), peripheral blood mononuclear cells, urine, saliva, semen, synovial fluid and cerebrospinal fluid. Methods for obtaining tissue and biological fluid biopsies from mammals are well known in the art.

The term "antibody" is used herein in its broadest sense and includes various antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, as long as they exhibit necessary antigen-binding activity.

An "affinity matured" antibody is an antibody with one or more changes in one or more HVRs and/or framework regions that result in an improvement in the affinity of the antibody for an antigen compared to a parent antibody that does not have the change(s). Preferred affinity matured antibodies will have nanomolar or even picomolar affinity for the target antigen. Affinity matured antibodies are prepared by methods known in the art. For example, Marks et al. Bio/Technology 10:779-783, 1992 describes affinity maturation by shuffling the VH and VL domains. HVR random mutagenesis and/or framework residues are described in: Barbas et al. Proc. Natl. Acad. sci. USA 91:3809-3813, 1994; Schieret al. Gene 169:147-155, 1995; Yelton et al. J. Immunol. 155:1994-2004, 1995; Jackson et al. J. Immunol. 154(7):3310-3319, 1995; and Hawkins et al. J. Mol. Biol. 226:889-896, 1992.

As used herein, a “human acceptor framework” is a framework that contains the amino acid sequence of a light chain variable domain (VL) framework or a heavy chain variable domain (VH) framework that is derived from a human immunoglobulin framework or consensus framework. human, as defined below. A human acceptor framework "derived from" a human immunoglobulin framework or human consensus framework may contain the same amino acid sequence as indicated or may contain alterations in the amino acid sequence. In some embodiments, the number of amino acid changes is 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, or 2 or less. In some embodiments, the human VL acceptor framework sequence is identical to the human immunoglobulin VL framework sequence or the human consensus framework sequence.

The term "affinity" refers to the strength of the overall overall non-covalent interactions between a single binding site of a molecule (eg, antibody) and its binding partner (eg, antigen). Unless otherwise indicated, the term "binding affinity" as used herein refers to the actual binding affinity, which reflects a 1:1 interaction between members of a binding pair (eg, antibody and antigen). The affinity of a molecule X for its partner Y can usually be represented by a dissociation constant (K _d ). Affinity can be measured using methods generally accepted in the art, including those described herein. Specific illustrative and typical embodiments of the invention relating to the measurement of binding affinity are described below.

"An antibody that binds to the same epitope" as a reference antibody refers to an antibody that binds to an overlapping set of amino acid residues of an antigen compared to a reference antibody, or blocks the binding of a reference antibody to its antigen in a competitive assay by 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. In some embodiments, the set of amino acid residues to which the antibody binds may fully overlap or partially overlap with the set of amino acid residues to which the reference antibody binds. In some embodiments, an antibody that binds to the same epitope as a reference antibody blocks reference antibody from binding to its antigen in a competition assay by 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more, and vice versa, the reference antibody blocks binding of the antibody to its antigen in the competitive assay by 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. This paper provides an illustrative competitive analysis.

"Antibody fragments" include a portion of an intact antibody, preferably the antigen-binding or variable region of an intact antibody. Examples of antibody fragments include Fab-, Fab'-, F(ab') ₂ - and Fv fragments; dimers; linear antibodies (see US patent No. 5641870, example 2; Zapata et al. Protein Eng. 8(10):1057-1062, 1995); single chain antibody molecules; and multispecific antibodies formed from antibody fragments.

Cleavage of antibodies with papain produces two identical antigen-binding fragments, called "Fab" fragments, and a residual "Fc" fragment, the name of which reflects its ability to easily crystallize. The Fab fragment consists of the entire L chain together with the H chain variable region domain (VH) and the first constant domain of one heavy chain (C _H 1). Treatment of the antibody with pepsin allows the isolation of a single large F(ab') ₂ fragment, which approximately corresponds to two Fab fragments with bivalent antigen-binding activity, connected by a disulfide bond, and retaining the ability to cross-link the antigen. Fab' fragments differ from Fab fragments in that they have several additional residues at the carboxyl end of the C _H 1 domain, including one or more cysteines from the antibody hinge region. As used herein, Fab'-SH is the designation for Fab' in which the cysteine(s) residue(s) of the constant domains bear a free thiol group. F(ab') ₂ antibody fragments were originally generated as pairs of Fab' fragments that are linked together by hinge cysteines. Other chemistries of antibody fragments are also known.

In the context of this document, the term "Fc region" is used to refer to the C-terminal region of the heavy chain of an immunoglobulin, which contains at least part of the constant region. The term includes native sequence Fc regions and variants of Fc regions. In one embodiment, the human IgG heavy chain Fc region ranges from Cys226 or Pro230 to the carboxyl terminus of the heavy chain. However, the Fc region may or may not contain a C-terminal lysine (Lys447). Unless otherwise indicated, the amino acid residue numbering of the Fc region or constant region follows the EU numbering system, also referred to as the EU index, as described in Kabat et al. Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991.

"Fv" consists of a dimer of one heavy chain variable region domain and one light chain variable region domain tightly linked through non-covalent bonds. When these two domains are folded, six hypervariable loops (3 loops on each H- and L-chain) protrude outward, the amino acid residues of which are involved in antigen binding and give the antibody specificity for antigen binding. At the same time, even one variable domain (or half of the Fv containing only three antigen-specific Hs) has the ability to recognize and bind an antigen, although often with a lower affinity than the entire binding site.

"Single chain Fv", also abbreviated as "sFv" or "scFv", are antibody fragments that contain the VH and VL domains of antibodies linked in a single polypeptide chain. Preferably, the sFv polypeptide also contains a polypeptide linker between the VH and VL domains, allowing the sFv to form the structure required for antigen binding. For a review of sFv, see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315, 1994.

The term "diabodies" refers to small antibody fragments obtained by constructing sFv fragments (see previous paragraph) with short linkers (about 5-10 residues) between the VH and VL domains, thereby achieving interchain rather than intrachain pairing of V domains. , leading to the formation of a bivalent fragment, i.e. a fragment carrying two antigen-binding sites. Bispecific antibodies are heterodimers of two "crossover" sFv fragments, in which the VH and VL domains of the two antibodies are present on different polypeptide chains. Diabodies are described in more detail, for example, in EP 404097; WO 93/11161; and Hollinger et al. Proc. Natl. Acad. sci. USA 90:6444-6448, 1993.

A "blocking" antibody or "antagonistic" antibody is an antibody that inhibits or reduces the biological activity of the antigen it binds. Some blocking antibodies or antagonistic antibodies largely or completely inhibit the biological activity of the antigen. For example, with respect to anti-tryptase antibodies, in some embodiments, the activity may be a tryptase enzymatic activity, such as a protease activity. In other cases, the activity may be a tryptase-mediated stimulation of bronchial smooth muscle cell proliferation and/or collagen contraction. In other cases, the activity may be histamine release by mast cells (eg, histamine release triggered by IgE and/or histamine release triggered by tryptase). In some embodiments, the antibody can inhibit the biological activity of the antigen it binds by at least about 1%, about 5%, about 10%, about 20%, about 25%, about 30%, about 35%, about 40%. about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97 %, about 98%, about 99% or about 100%.

The "class" of an antibody refers to the type of constant domain or constant region contained in its heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and some of these can be further subdivided into subclasses (isotypes), such as IgG ₁ , IgG ₂ , IgG ₃ , IgG ₄ , IgA ₁ , and IgA ₂ . The heavy chain constant domains that correspond to different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively.

The "effector functions" of an antibody refer to that biological activity associated with the Fc region (eg, native Fc region sequence or Fc region amino acid sequence variant) of the antibody, and vary depending on the isotype of the antibody. Examples of antibody effector functions include: C1q binding and complement dependent cytotoxicity; binding to the Fc receptor; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; decreased expression of cell surface receptors (eg B cell receptor) and activation of B cells.

"Antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig bound to Fc receptors (FcRs) present on certain cytotoxic cells (e.g., natural killer (NK) cells, neutrophils, and macrophages), allows these cytotoxic effector cells to specifically bind to an antigen-bearing target cell and subsequently destroy the target cell with cytotoxins. Antibodies "alert" cytotoxic cells and are absolutely necessary for such destruction. The primary cells for mediating ADCC, NK cells, only express FcγRIII, while monocytes express FcγRI, FcγRII, and FcγRIII. FcR expression on hematopoietic cells is shown in Table 3 on page 464 in Ravetch et al. Appy. Rev. Immunol. 9:457-492, 1991. To evaluate ADCC activity of a molecule of interest, the in vitro ADCC assay described in US Pat. No. 5,500,362 or 5,821,337 can be performed. killer (NK) cells. Alternatively or in addition, the ADCC activity of a molecule of interest can be assessed in vivo, eg in an animal model, eg as described in Clynes et al. Proc. Natl. Acad. sci. USA 95:652-656, 1998.

The terms "Fc receptor" or "FcR" describe a receptor that binds to the Fc region of an antibody. Preferred FcR is a native human FcR sequence. In addition, a preferred FcR is one that binds an IgG antibody (gamma receptor) and includes receptors of the FcγRI, FcγRII and FcγRIII subclasses, including allelic variants and alternatively spliced forms of these receptors. FcγRII receptors include FcγRIIA ("activating receptor") and FcγRIIB ("inhibitory receptor"), which contain similar amino acid sequences that differ predominantly in cytoplasmic domains. The FcγRIIA activating receptor contains an immunoreceptor tyrosine activating motif (ITAM) in its cytoplasmic domain. The inhibitory receptor FcγRIIB contains an immunoreceptor tyrosine inhibitory motif (ITIM) in its cytoplasmic domain (see review by M. in Daeron, Annu. Rev. Immunol. 15:203-234, 1997). For an overview of FcR, see Ravetch et al. Appy. Rev. Immunol. 9:457-492, 1991; Capel et al. Immunomethods 4:25-34, 1994; and de Haas et al. J. Lab. Clin. Med. 126:330-41, 1995. Other FcRs, including those that will be identified in the future, are included in the term "FcR" in this document. The term also includes the neonatal receptor, FcRn, responsible for the transfer of maternal IgG to the fetus (see, for example, Guyer et al. J. Immunol. 117:587, 1976; and Kim et al. J. Immunol. 24:249, 1994 ).

"Human effector cells" are leukocytes that express one or more FcRs and perform effector functions. Preferably, such cells express at least FcγRIII and perform the ADCC effector function. Examples of human leukocytes that mediate ADCC include peripheral blood mononuclear cells PBMCs, natural killer (NK) cells, monocytes, cytotoxic T cells, and neutrophils; with PBMCs and NK cells being preferred. Effector cells can be isolated from a native source, such as blood.

"Complement dependent cytotoxicity" or "CSC" refers to the lysis of a target cell in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (C1q) to antibodies (of the appropriate subclass) that are bound to their recognized antigen. To evaluate complement activation, a CDC assay can be performed, for example, as described in Gazzano-Santoro et al. J. Immunol. Methods 202:163, 1996.

от любого атома антитела. В некоторых вариантах осуществления эпитоп содержит аминокислоты, которые находятся в пределах

или

от любого атома антитела. Аминокислотные остатки антитела, которые связываются с антигеном (то есть паратопом), могут быть определены, например, путем определения кристаллической структуры антитела в комплексе с антигеном или путем осуществления обмена водород/дейтерий.An "epitope" is the portion of an antigen to which an antibody selectively binds. For a polypeptide antigen, a linear epitope may be a peptide portion of approximately 4-15 (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, amino acid residues. A non-linear conformational epitope may comprise polypeptide sequence residues located at close proximity in the three-dimensional (3D) structure of the protein.In some embodiments, the epitope contains amino acids that are within 4 angstroms

from any atom of the antibody. In some embodiments, the epitope contains amino acids that are within

or

from any atom of the antibody. The amino acid residues of an antibody that bind to an antigen (ie, paratope) can be determined, for example, by determining the crystal structure of the antibody complexed with the antigen, or by performing a hydrogen/deuterium exchange.

The terms "full antibody", "intact antibody", and "complete antibody" are used interchangeably herein to refer to an antibody having a structure substantially similar to that of a native antibody, or containing heavy chains that contain an Fc region, as defined in this document.

A "human antibody" is an antibody that has an amino acid sequence that matches that of a human-produced antibody and/or has been generated using any human antibody technology. Specifically excluded from this definition of a human antibody is a humanized antibody containing antigen-binding residues of non-human origin.

A "human consensus framework" is a framework that contains the most frequently occurring amino acid residues when selecting human immunoglobulin VL or VH framework sequences. Typically, the VL or VH sequences of a human immunoglobulin are selected from a subgroup of variable domain sequences. Typically, a subgroup of sequences is a subgroup as classified by Kabat et al. Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91-3242, Bethesda MD, vols. 1-3, 1991. In one embodiment, for VL, the subgroup is a kappa III or kappa IV subgroup according to Kabat et al. higher. In one embodiment for VH, the subgroup is subgroup III according to Kabat et al. higher.

"Humanized" forms of non-human species (eg, rodents) antibodies are chimeric antibodies that contain a minimal sequence derived from a non-human immunoglobulin. In most cases, humanized antibodies are human immunoglobulins (recipient antibody) in which the hypervariable region residues of the recipient are replaced by hypervariable region residues of a non-human species (donor antibody) such as a mouse, rat, rabbit, or non-human primate having the desired specificity, affinity and activity of the antibody. In some cases, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. In addition, humanized antibodies may contain residues that are not present in the recipient antibody or in the donor antibody. These modifications are made to further improve the performance of the antibody. In general, a humanized antibody will contain substantially all of at least one, and usually two, variable domains, wherein all or substantially all of the hypervariable loops correspond to such non-human immunoglobulin regions and all or substantially all of the FRs correspond to such human immunoglobulin sequence regions. The humanized antibody will also optionally comprise at least a portion of an immunoglobulin constant region (Fc), typically from a human immunoglobulin. For more information, see Jones et al. Nature 321:522-525, 1986; Riechmann et al. Nature 332:323-329, 1988; and Presta, Curr. Op.Struct. Biol. 2:593-596, 1992.

An "immunoconjugate" is an antibody conjugated to one or more heterologous molecules, including, but not limited to, a cytotoxic agent.

The term "isolated" when used to describe the various antibodies described herein refers to an antibody that has been identified and isolated and/or isolated from a cell or cell culture in which it is expressed. Environmental contaminants are substances that can typically interfere with the diagnostic or therapeutic use of the polypeptide and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In some embodiments, the antibody is purified to greater than 95% or 99% purity as determined, for example, by electrophoresis (e.g., sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), isoelectric focusing (IEF), capillary electrophoresis). ) or by chromatography (for example, ion exchange or reverse phase HPLC). For a review of methods for assessing the purity of antibodies, see, for example, Flatman et al. J Chromatogr. B 848:79-87, 2007. In preferred embodiments, the antibody will be purified (1) to a degree sufficient to obtain at least 15 residues on the N-terminal or internal amino acid sequence by using a rotary cup sequencer or (2) to homogeneity obtained by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or preferably silver staining. An isolated antibody includes antibodies produced in situ within recombinant cells, since at least one component from the polypeptide's natural environment will be missing. At the same time, the selected polypeptide, as a rule, will be obtained using at least one stage of purification.

In the context of this document, the term "monoclonal antibody" refers to an antibody derived from a population of substantially homogeneous antibodies, i.e., the individual antibodies that make up the population are identical and/or bind a single epitope on the antigen, with the exception of possible variant antibodies, for example containing mutations of natural origin or arising during the preparation of the preparation of monoclonal antibodies, while such variants are generally present in a small amount. Unlike polyclonal antibody preparations, which typically contain different antibodies against different determinants (epitopes), each monoclonal antibody in a monoclonal antibody preparation is directed against a single antigen determinant. Thus, the term "monoclonal" indicates the characterization of an antibody derived from a substantially homogeneous population of antibodies and should not be construed as requiring the antibody to be produced in any particular manner. For example, monoclonal antibodies for use in the present invention may be prepared by a variety of methods including, but not limited to, the hybridoma method, recombinant DNA methods, phage display methods, and methods using transgenic animals containing wholly or partially human immunoglobulin loci, such methods and other illustrative methods for obtaining monoclonal antibodies are described in this document. In certain embodiments, the term "monoclonal antibody" embraces bispecific antibodies.

The term "bivalent antibody" refers to an antibody that has two binding sites for an antigen. The bivalent antibody can be, without limitation, IgG format or F(ab') ₂ format.

The term "multispecific antibody" is used in its broadest sense and encompasses an antibody that binds to two or more determinants or epitopes on the same antigen, or two or more determinants or epitopes on more than one antigen. Such multispecific antibodies include, but are not limited to, full length antibodies, antibodies having two or more VL and VH domains, antibody fragments such as Fab, Fv, dsFv, scFv, diabodies, bispecific diabodies and tribodies, antibody fragments that covalently or non-covalently connected. The term "polyepitope specificity" refers to the ability to specifically bind to two or more different epitopes on the same or different targets. In certain embodiments, the multispecific antibody is a bispecific antibody. "Double specificity" or "bispecificity" refers to the ability to specifically bind to two different epitopes on the same or different targets. However, unlike bispecific antibodies, dual specific antibodies have two antigen-binding arms that are identical in amino acid sequence and each Fab arm is capable of recognizing two antigens. Dual specificity allows antibodies to interact with high affinity with two different antigens as a single Fab or IgG molecule. In one embodiment, the multispecific antibody binds to each epitope with an affinity of 5 μM to 0.001 pM, 3 μM to 0.001 pM, 1 μM to 0.001 pM, 0.5 μM to 0.001 pM, or 0.1 μM up to 0.001 pM. The term "monospecific" refers to the ability to bind only one epitope.

"Naked antibody" refers to an antibody that is not conjugated to a heterologous moiety (eg, a cytotoxic moiety) or a radioactive label. The naked antibody may be present in the pharmaceutical composition.

With regard to the binding of an antibody to a target molecule, the term "binds" or "binding" or "specific binding" or "specifically binds" or is "specific to" a particular polypeptide or epitope on a particular target polypeptide means a binding that is measurably different from a non-specific interaction. Specific binding can be measured, for example, by determining the binding of a molecule compared to the binding of a control molecule. For example, specific binding may be determined by competition with a control molecule that is similar to the target, such as in an excess of unlabeled target. In this case, binding is considered specific if binding of the labeled target to the probe is competitively inhibited by an excess of unlabeled target. The term "specific binding" or "specifically binds to" or is "specific to" a particular polypeptide or epitope on a particular target polypeptide, as used herein, can be illustrated, for example, by a molecule having an IMT Target Code or lower, alternatively 10 ^-5 M or less alternatively 10 ^-6 M or less alternatively 10 ^-7 M or less alternatively 10 ^-8 M or less alternatively 10 ^-9 M or less alternatively 10 ^-10 M or less alternatively 10 ^{- 11} M or less, alternatively 10 ^-12 M or less, or K _D ranging from 10 ^-4 M to 10 ^-8 M, or from 10 ^-8 M to 10 ^-10 M, or from 10 ^-7 M to 10 ^{- 9} M. As will be appreciated by one of skill in the art, affinity and K _D values are inversely related. High affinity for an antigen is measured by a low K _D value. In one embodiment, the term "specific binding" refers to binding in which a molecule binds to a particular polypeptide or epitope on a particular polypeptide without significant binding to any other polypeptide or polypeptide epitope.

The term "variable" refers to the fact that among antibodies, some segments of the variable domains vary greatly in sequence. The variable or "V" domain mediates antigen binding and determines the specificity of a particular antibody for its particular antigen. At the same time, the variability is unevenly distributed over the 110-amino acid region of the variable domains. In fact, V regions are composed of relatively invariant fragments called framework regions (FRs) of 15-30 amino acids separated by shorter regions of extreme variability called "hypervariable regions" that are 9-12 amino acids long. "hypervariable region" or "HVR" as used herein refers to the amino acid residues of an antibody that are responsible for antigen binding. The hypervariable region typically contains amino acid residues from, for example, about residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in VL, and about residues 26-35 (H1) , 49-65 (H2) and 95-102 (H3) in VH (in one embodiment, H1 consists of about 31-35 residues); Kabat et al. above) and/or these residues from the "hypervariable loop" (e.g., 26-32 (L1), 50-52 (L2), and 91-96 (L3) in VL, and 26-32 (H1), 53-55 (H2), and 96-101 (H3) in VH, Chothia et al J Mol Biol 196:901-917, 1987. Each of the native heavy and light chain variable domains contains four FRs predominantly adopting the beta- leaf, connected by three hypervariable regions that form loops connecting the beta sheet structure, and in some cases forming part of the beta sheet structure. antigen-binding site of antibodies (see Kabat et al. supra).

Accordingly, the sequences of HVR and FR, as a rule, are located in the following order in VH (or VL): FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4. The constant domains are not directly involved in the binding of the antibody to the antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity (ADCC).

The terms "Kabat variable residue numbering" or "Kabat numbering of amino acid positions" and variations thereof refer to the numbering system used for heavy chain variable domains or light chain variable domains in the formulation of antibodies in Kabat et al. higher. When using this numbering system, the actual linear amino acid sequence may contain fewer or more amino acids, corresponding to a shortening or insertion in the FR or HVR of the variable domain. For example, a heavy chain variable domain may include a single amino acid insertion (residue 52a according to Kabat) after residue 52 in H2 and inserted amino acid residues (e.g., residues 82a, 82b and 82c, etc. according to Kabat) after the FR amino acid residue 82 of the heavy chain. Kabat residue numbering can be determined for a given antibody by aligning homologous regions of the antibody sequence with a "standard" Kabat numbered sequence.

The Kabat numbering system is generally used to designate a residue in a variable domain (approximately light chain residues 1-107 and heavy chain residues 1-113) (eg Kabat et al. supra). The "EU numbering system" or "EU index" is generally used when referring to an amino acid residue in an immunoglobulin heavy chain constant region (eg, the EU index presented in Kabat et al. supra). "EU index according to Kabat" refers to the EU residue numbering of a human IgG1 antibody. Unless otherwise indicated, references to residue numbers in the variable domain of antibodies mean the numbering of residues according to the Kabat numbering system. Unless otherwise indicated, references herein to residue numbers in the constant domain of antibodies refer to residue numbering according to the EU numbering system (eg, see US Provisional Application No. 60/640323, figures for EU numbering).

"Percentage (%) amino acid sequence identity" with respect to the polypeptide sequences referred to herein is defined as the percentage of amino acid residues in a candidate sequence that are identical to amino acid residues in a comparison polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve maximum percent sequence identity, and without considering any conservative substitutions as part of sequence identity. Alignment to determine percent amino acid sequence identity can be performed in a variety of ways that are known to those skilled in the art, for example, using publicly available computer programs such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine the desired alignment parameters, including any algorithms necessary to achieve maximum alignment over the entire length of the compared sequences.

For the purposes of this document, however, % amino acid sequence identity values are obtained using the ALIGN-2 sequence comparison program. The ALIGN-2 sequence alignment software was developed by Genentech, Inc. and the source program was filed with the user documentation with the United States Copyright Office, Washington, DC 20559, where it is registered under US Copyright Registration Number TXU510087. The ALIGN-2 program is freely available from Genentech, Inc., South San Francisco, California. For use on a UNIX operating system, preferably a digital version of UNIX V4.0D, the ALIGN-2 program must be compiled. All sequence comparison parameters are set by the ALIGN-2 program and remain unchanged.

Where ALIGN-2 is used to compare amino acid sequences, the % amino acid sequence identity of a given amino acid sequence A to, c, or with respect to a given amino acid sequence B (which may alternatively be phrased as a given amino acid sequence A that has or contains a certain % amino acid sequence identity to, with or with respect to a given amino acid sequence B) is calculated as follows:

100 times the X/Y ratio

, where X is the number of amino acid residues evaluated by the ALIGN-2 sequence alignment program as identical matches in the program alignment of A and B, and where Y is the total number of amino acid residues in B. It should be understood that where the length of the amino acid sequence A does not equal length of amino acid sequence B, % Amino Acid Sequence Identity A to B will not be equal to % Amino Acid Sequence Identity B to A. Unless specifically noted otherwise, all % Amino Acid Sequence Identity values used herein are derived as described in the preceding paragraph c. using the computer program ALIGN-2.

By "massively parallel sequencing" or "massively parallel sequencing", also known in the art as "next generation sequencing" or "second generation sequencing", is meant any high throughput nucleic acid sequencing approach. These approaches typically involve the parallel sequencing of large numbers (eg, thousands, millions, or billions) of spatially separated, clonally amplified DNA templates or single DNA molecules. See, for example, Metzker, Nature Reviews Genetics 11: 31-36, 2010.

The term "package leaflet" is used to refer to the instructions that are usually included in commercial packages of therapeutic products for sale, containing information about the indications, uses, doses, intake, combination therapy, contraindications and / or warnings that relate to the use of such therapeutic products. .

The terms "pharmaceutical composition" and "pharmaceutical composition" are used interchangeably herein and refer to a preparation which is in such a form as to provide the biological activity of the active ingredient contained therein and which does not contain additional components that are unacceptably toxic to the subject. to which the composition is introduced. Such formulations are sterile.

A "sterile" pharmaceutical composition is aseptic or free from, or substantially free of, any living microorganisms and their spores.

A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical composition, other than the active ingredient, that is non-toxic to the subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.

A “kit” is any article (such as a package or container) containing at least one reagent, such as a probe, for determining the number of active tryptase alleles in a patient or for determining the level of expression of a biomarker (such as tryptase) as described herein. , and/or a drug for the treatment of an inflammatory disease mediated by mast cells, such as asthma. The product is preferably promoted, distributed or sold as a unit to carry out the methods of this invention.

II. Therapeutic methods and uses according to the invention

The present invention provides methods for treating a patient with a mast cell mediated inflammatory disease (eg, asthma). In some embodiments, the methods of the invention include administering therapy to a patient based on the presence and/or level of expression of a biomarker of the invention, such as tryptase (eg, the number of active tryptase alleles in the patient and/or the level of tryptase expression). In some embodiments, the methods include administering a therapy, e.g., a therapy comprising a tryptase antagonist, an Fc epsilon receptor (FcεR) antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a protease-activated receptor 2 antagonist ( PAR2), an IgE antagonist, or a combination thereof (eg, a tryptase antagonist and an IgE antagonist). In some embodiments, the therapy comprises a therapy directed to mast cells (eg, a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, and/or a PAR2 antagonist). In some embodiments, the therapy comprises a tryptase antagonist (e.g., an anti-tryptase antibody, e.g., any anti-tryptase antibody described herein or in WO 2018/148585) and an IgE antagonist (e.g., an anti-IgE antibody, e.g. omalizumab (XOLAIR®) ).

For example, the invention relates to a method of treating a patient with a mast cell-mediated inflammatory disease, which comprises administering to a patient with a mast cell-mediated inflammatory disease a mast cell-targeted therapy (e.g., a therapy comprising an agent selected from the group consisting of an antagonist tryptase, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), wherein (i) the patient's genotype has been determined to contain the amount active tryptase alleles, which is equal to or higher than the reference number of active tryptase alleles; or (ii) the sample from the patient was determined to have a tryptase expression level equal to or greater than the tryptase reference level. For example, in some embodiments, the patient's genotype has been determined to contain a number of active tryptase alleles that is equal to or greater than a reference number of active tryptase alleles. In other embodiments, a sample from a patient has been determined to have a tryptase expression level that is equal to or greater than a tryptase reference level.

In another aspect, the invention relates to a method of treating a patient with a mast cell-mediated inflammatory disease that has been identified as having (i) a genotype containing a number of active tryptase alleles that is equal to or greater than a reference number of active tryptase alleles; or (ii) a tryptase expression level in a patient sample that is equal to or greater than a tryptase reference level, the method comprising administering to a patient with a mast cell mediated inflammatory disease a mast cell-targeting therapy (e.g., a therapy comprising an agent selected from a group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and a combination thereof (e.g., a tryptase antagonist and an IgE antagonist)). For example, in some embodiments, the patient's genotype has been identified as containing a number of active tryptase alleles that is equal to or greater than a reference number of active tryptase alleles. In other embodiments, the patient has been identified to have a tryptase expression level in a patient sample that is equal to or greater than a tryptase reference level.

In another aspect, the invention relates to a method for treating a patient with a mast cell-mediated inflammatory disease, the method comprising: (a) obtaining a sample containing a nucleic acid from the patient; (b) performing genotyping of the sample and detecting the presence of a number of active tryptase alleles that is equal to or greater than a reference level of tryptase; (c) identifying a patient having an active tryptase allele count that is equal to or greater than a tryptase reference level as having an increased likelihood of benefiting from treatment with a therapy directed to mast cells (e.g., therapy comprising a tryptase antagonist, an IgE antagonist, an antibody , an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and a combination thereof (eg, a tryptase antagonist and an IgE antagonist)); and (d) administration of a mast cell-targeting therapy (e.g., a therapy comprising a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and a combination thereof (e.g., an antagonist tryptase and an IgE antagonist)) in a patient.

In another additional aspect, the invention provides a method for treating a patient with a mast cell-mediated inflammatory disease, the method comprising: (a) obtaining a sample containing a nucleic acid or protein from the patient; (b) performing an expression analysis and determining an expression level of tryptase that is equal to or greater than a reference level of tryptase; (c) identifying a patient having a tryptase expression level that is equal to or greater than a reference tryptase level as having an increased likelihood of benefiting from treatment with a therapy directed to mast cells (e.g., therapy including a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, mast cell or basophil depleting antibody, PAR2 antagonist, and combinations thereof (eg tryptase antagonist and IgE antagonist)); and (d) the use of a mast cell-targeting therapy (e.g., a therapy comprising a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and a combination thereof (e.g., an antagonist tryptase and an IgE antagonist)) in a patient. In some embodiments, the sample contains a protein and the expression assay is an ELISA or an immunoassay.

In some embodiments of any of the preceding methods, the patient has been identified as having a type 2 biomarker level in a patient sample that is below a reference type 2 biomarker level. In some embodiments, the agent is administered to the patient as monotherapy.

In some embodiments of any of the preceding methods, a patient has been identified as having a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a level 2 biomarker. In some embodiments, the method further comprises administering the _TH 2 pathway inhibitor to the patient.

In another aspect, the invention relates to a method of treating a patient with a mast cell mediated inflammatory disease which comprises administering to a patient with a mast cell mediated inflammatory disease a therapy comprising an IgE antagonist or an FcεR antagonist, wherein (i) the patient's genotype has been determined to comprise the number of active tryptase alleles, which is below the reference number of active tryptase alleles; or (ii) the sample from the patient has been determined to have a tryptase expression level that is below the tryptase reference level. For example, in some embodiments, the patient's genotype has been determined to contain a number of active tryptase alleles that is below a reference number of active tryptase alleles. In other embodiments, a sample from a patient has been determined to have a tryptase expression level that is below a reference tryptase level.

In another aspect, the invention relates to a method of treating a patient with a mast cell-mediated inflammatory disease that has been identified as having (i) a genotype containing a number of active tryptase alleles that is below a reference number of active tryptase alleles; or (ii) a tryptase expression level in a patient sample that is below a reference tryptase level, the method comprising administering a therapy comprising an IgE antagonist or an FcεR antagonist to a patient with a mast cell mediated inflammatory disease. For example, in some embodiments, the patient's genotype has been determined to contain a number of active tryptase alleles that is below a reference number of active tryptase alleles. In other embodiments, the patient has been identified to have a tryptase expression level in a patient sample that is below a reference tryptase level.

In another aspect, the invention relates to a method for treating a patient with a mast cell-mediated inflammatory disease, the method comprising: (a) obtaining a sample containing a nucleic acid from the patient; (b) performing genotyping of the sample and determining the presence of a number of active tryptase alleles that is below a reference level of tryptase; (c) identifying a patient having an active tryptase allele count that is below the tryptase reference level as having an increased likelihood of benefiting from treatment with an IgE antagonist or an FcεR antagonist; and (d) administering the IgE antagonist or FcεR antagonist to the patient.

In another additional aspect, the invention relates to a method for treating a patient with a mast cell-mediated inflammatory disease, the method comprising: (a) obtaining a sample containing a nucleic acid or protein from the patient; (b) performing an expression analysis and determining an expression level of tryptase that is below a reference level of tryptase; (c) identifying a patient with a tryptase expression level that is below the tryptase reference level as having an increased likelihood of benefiting from treatment with the IgE antagonist or FcεR antagonist; and (d) administering the IgE antagonist or FcεR antagonist to the patient. In some embodiments, the sample contains a protein and the expression assay is an ELISA or an immunoassay.

In some embodiments of any of the preceding methods, a patient has been identified as having a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a level 2 biomarker. In some embodiments, the method further comprises administering to the patient an additional inhibitor of the T _H 2 pathway.

In some embodiments of any of the preceding methods, the number of active tryptase alleles is determined by sequencing the TPSAB1 and TPSB2 loci of the patient's genome. Any suitable sequencing approach may be used, such as Sanger sequencing or massively parallel sequencing (eg, ILLUMINA®). In some embodiments, the TPSAB1 locus is sequenced using a method comprising (i) amplifying a nucleic acid from a subject in the presence of a first forward primer containing the nucleotide sequence 5'-CTG GTG TGC AAG GTG AAT GG-3' (SEQ ID NO: 31) and a first reverse primer containing the nucleotide sequence 5'-AGG TCC AGC ACT CAG GAG GA 3' (SEQ ID NO: 32) to obtain a TPSAB1 amplicon, and (ii) sequencing the TPSAB1 amplicon. In some embodiments, sequencing the TPSAB1 amplicon includes using a first forward primer and a first reverse primer. In some embodiments, the TPSB2 locus is sequenced using a method comprising (i) amplifying a nucleic acid from a subject in the presence of a second forward primer containing the nucleotide sequence 5'-GCA GGT GAG CCT GAG AGT CC-3' (SEQ ID NO: 33), and a second reverse primer containing the nucleotide sequence 5'-GGG ACC TTC ACC TGC TTC AG-3' (SEQ ID NO: 34) to obtain a TPSB2 amplicon, and (ii) sequencing the TPSB2 amplicon. In some embodiments, sequencing the TPSB2 amplicon comprises using a second forward primer and a reverse sequencing primer containing the 5'-CAG CCA GTG ACC CAG CAC-3' nucleotide sequence (SEQ ID NO: 35). In some embodiments, the number of active tryptase alleles can be determined by detecting the presence of any variation at the TPSAB1 and TPSB2 loci of the patient's genome. In some embodiments, the number of active tryptase alleles is determined by the formula: 4 is the sum of the number of alleles of alpha-tryptase and frameshift beta-III-tryptase (beta-III ^FS ) in the patient's genotype In some embodiments, alpha-tryptase is determined by detecting SNP c733 G>A in TPSAB1. In some embodiments, detection of the c733 G>A SNP in TPSAB1 includes detection of the patient's genotype with the polymorphism

moreover, the presence of A in SNP c733 G>A indicates alpha-tryptase. In some embodiments, beta-III ^FS -tryptase is determined by detecting the c980_981insC mutation in TPSB2. In some embodiments, detection of the c980_981insC mutation in TPSB2 includes detection of the nucleotide sequence

In some embodiments of any of the preceding methods, the number of active tryptase alleles in the patient is 3 or 4. In some embodiments, the number of active tryptase alleles is 3. In other embodiments, the number of active tryptase alleles is 4.

In other embodiments of any of the preceding methods, the number of active tryptase alleles in a patient is 0, 1, or 2. In some embodiments, the number of active tryptase alleles is 0. In some embodiments, the number of active tryptase alleles is 1. In other embodiments, the number of active tryptase alleles is tryptase is 2.

In some embodiments of any of the preceding methods, the reference number of active tryptase alleles may be determined in a reference sample, a reference population, and/or may be a predetermined value (e.g., a threshold that has previously been determined for a meaningful (e.g., statistically significant) division of the first subpopulations of individuals from a second subpopulation of individuals (e.g., in terms of response to therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an FcεR antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist))). In some embodiments, the reference number of active tryptase alleles is a predetermined value. In some embodiments, the reference number of active tryptase alleles is predetermined in inflammatory a mast cell mediated disease the patient is suffering from (eg, asthma). In certain embodiments, the number of active tryptase alleles is determined from the overall distribution of values in a mast cell-mediated inflammatory disease of interest (eg, asthma) or in a given population. In some embodiments, the reference number of active tryptase alleles is an integer in the range of 0 to 4 (eg, 0, 1, 2, 3, or 4). In specific embodiments, the reference number of active tryptase alleles is 3.

In any of the previous methods, the patient's genotype can be determined using any of the methods or assays described herein (for example, in Section IV of the Detailed Description of the Invention or in Example 1), or known in the art.

In some embodiments of any of the preceding aspects, the type 2 biomarker is a _TH 2 cell-associated cytokine, periostin, eosinophil count, eosinophil profile, FeNO, or IgE. In some embodiments, the cytokine associated with the _TH 2 cell is IL-13, IL-4, IL-9, or IL-5.

In some embodiments of any of the preceding methods, the expression level of the biomarker (eg, tryptase) is the expression level of the protein. For example, in some embodiments, the level of protein expression was measured using an immunoassay (eg, multiplex immunoassay), ELISA, Western blot, or mass spectrometry. See, for example, Section V for a detailed description of the invention. In some embodiments, the tryptase protein expression level is an active tryptase expression level. In other embodiments, the tryptase protein expression level is total tryptase expression level.

In other embodiments of any of the preceding methods, the level of expression of the biomarker (eg, tryptase) is the level of mRNA expression. For example, in some embodiments, the level of mRNA expression was measured using a PCR method (eg, qPCR) or a microarray chip. See, for example, Section V for a detailed description of the invention.

In any of the prior methods or uses, the level of expression of a biomarker of the invention (e.g., tryptase) in a patient sample can be changed to/from at least about 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80%, 90%, 100%, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times or more relative to the reference level of the biomarker. For example, in some embodiments, the expression level of a biomarker of the invention in a patient sample can be increased by/in at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80 %, 90%, 100%, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times or more relative to the reference biomarker level. In other embodiments, the expression level of a biomarker of the invention in a patient sample may be reduced by/in at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times or more relative to the reference level of the biomarker.

In some embodiments, the reference level may be set to any percentile between, for example, the 20th percentile and the 99th percentile (e.g., 20th, 25th, 30th, 35th, 40th, 45th th, 50th, 55th, 60th, 65th, 70th, 75th, 80th, 85th, 90th, 95th, or 99th percentile) of the overall level distribution expression of a biomarker (eg, tryptase), for example, in healthy subjects or in a group of patients with a disorder (eg, a mast cell-mediated inflammatory disease (eg, asthma)). In specific embodiments, the implementation of the reference level can be set to the 25th percentile of the overall distribution of values in the population of patients with asthma. In other specific embodiments, the implementation of the reference level can be set to the 50th percentile of the overall distribution of values in the population of patients with asthma. In other embodiments, the implementation of the reference level may be the median of the overall distribution of values in the population of patients with asthma.

Any suitable sample obtained from a patient can be used in any of the previous methods. For example, in some embodiments, the sample obtained from the patient is a blood sample (e.g., a whole blood sample, a serum sample, a plasma sample, or a combination thereof), a tissue sample, a sputum sample, a bronchial lavage sample, a mucosal fluid (MLF) sample , bronchosorption sample and nasosorption sample.

The invention also relates to mast cell therapy (e.g., an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and their a combination (e.g., a tryptase antagonist and an IgE antagonist)) for use in a method of treating a patient with a mast cell-mediated inflammatory disease, wherein (i) the patient's genotype has been determined to contain a number of active tryptase alleles that is equal to or greater than a reference number of active alleles tryptase; or (ii) the patient sample was determined to have a tryptase expression level equal to or greater than the tryptase reference level. In some embodiments, a patient has been determined to have a type 2 biomarker level in a patient sample that is below a reference level of a type 2 biomarker, and the agent is intended for use as monotherapy. In some embodiments, the patient has been identified as having a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the agent is for use in combination with a _TH 2 pathway inhibitor.

In another aspect, the invention relates to the use of a mast cell-targeting therapy (e.g., an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist , and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)) in the manufacture of a medicament for the treatment of a patient with a mast cell-mediated inflammatory disease, wherein (i) the patient's genotype has been determined to contain a number of active tryptase alleles that is equal to or greater than a reference number of active tryptase alleles; or (i) the sample from the patient has been determined to have a tryptase expression level that is equal to or greater than the tryptase reference level. In some embodiments, a patient has been determined to have a type 2 biomarker level in a patient sample that is below a reference level of a type 2 biomarker, and the agent is intended for use as monotherapy. In some embodiments, the patient has been identified as having a type 2 biomarker level in a patient sample that is equal to or greater than a reference type 2 biomarker level, and the agent is for use in combination with a _TH 2 pathway inhibitor.

In yet another aspect, the invention relates to an IgE antagonist or FcεR antagonist for use in a method of treating a patient with a mast cell-mediated inflammatory disease, wherein (i) the patient's genotype is determined to contain an amount of active tryptase alleles below a reference number of active tryptase alleles; or (ii) the sample from the patient has been determined to have a tryptase expression level that is below the tryptase reference level. In some embodiments, the patient has been determined to have a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a type 2 biomarker, and the IgE antagonist or FcεR antagonist is intended for use in combination with a T _H 2 pathway inhibitor .

In a further aspect, the invention provides the use of an IgE antagonist or an FcεR antagonist in the manufacture of a medicament for the treatment of a patient with a mast cell-mediated inflammatory disease, wherein (i) the patient's genotype has been determined to contain a number of active tryptase alleles that is below a reference number of active tryptase alleles. ; or (ii) the sample from the patient has been determined to have a tryptase expression level that is below the tryptase reference level. In some embodiments, the patient has been determined to have a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a type 2 biomarker, and the IgE antagonist or FcεR antagonist is intended for use in combination with a T _H 2 pathway inhibitor .

Any of the preceding methods or uses may involve administering a tryptase antagonist to a patient. The tryptase antagonist can be an alpha tryptase antagonist (eg, an alpha 1 tryptase antagonist) or a beta tryptase antagonist (eg, a beta 1 tryptase, a beta 2 tryptase, and/or a beta 3 tryptase antagonist). In some embodiments, the tryptase antagonist is an alpha tryptase antagonist and a beta tryptase antagonist. In some embodiments, the tryptase antagonist (eg, alpha-tryptase antagonist and/or beta-tryptase antagonist) is an anti-tryptase antibody (eg, anti-alpha-tryptase antibody and/or anti-beta-tryptase antibody). Any anti-tryptase antibody described in Section VII below may be used.

Any of the preceding methods or uses may involve administering an FcεR antagonist to a patient. In some embodiments, the FcεR antagonist inhibits FcεRIα, FcεRIβ, and/or FcεRIγ. In other embodiments, the FcεR antagonist inhibits FcεRII. In yet other embodiments, the FcεR antagonist inhibits a member of the FcεR signaling pathway. For example, in some embodiments, the FcεR antagonist inhibits tyrosine protein kinase Lyn (Lyn), Bruton's tyrosine kinase (BTK), tyrosine protein kinase Fyn (Fyn), spleen-associated tyrosine kinase (Syk), T cell activation linker (LAT), protein -2, growth factor receptor-associated (Grb2), son of sevenless (Sos), Ras, Raf-1, mitogen-activated protein kinase 1 (MEK), mitogen-activated protein kinase 1 (ERK), cytosolic phospholipase A2 ( cPLA2), arachidonate-5-lipoxygenase (5-LO), arachidonate-5-lipoxygenase-activating protein (FLAP), guanine nucleotide exchange factor VAV (Vav), Rac, mitogen-activated protein kinase kinase-3, mitogen-activated protein kinase-7 activated protein kinase, p38 MAP kinase (p38), c-Jun-N-terminal kinase (JNK), protein-2 associated with protein-2, which is associated with the growth factor receptor (Gab2), phosphatidylinositol-4,5-bisphosphate -3-kinase (PI3K), phospholipase C gamma (PLCγ), protein kinase C (PKC), 3-phosphoinositide-dependent protein kinase 1 (PDK1), RAC serine/threonine protein kinase (ACT), histamine, heparin, interleukin (IL) -3, IL-4, IL-13, IL-5, granulocyte-macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor-alpha (TNF-α), leukotrienes (eg, LTC4, LTD4, and LTE4), and prostaglandins ( e.g. PDG2). In some embodiments, the FcεR antagonist is a BTK inhibitor (eg, GDC-0853, acalabrutinib, GS-4059, spebrutinib, BGB-3111, or HM71224).

Any of the foregoing methods or uses may involve administering an IgE ⁺ B cell depleting agent (eg, an IgE ⁺ B cell depleting antibody) to a patient. In some embodiments, the IgE ⁺ depleting B cell antibody is an antibody against the M1 domain. Any suitable antibody against the M1' domain can be used, for example any antibody against the M1' domain described in International Patent Application Publication No. WO 2008/116149, which is incorporated herein by reference in its entirety. In some embodiments, the anti-M1' domain antibody is afucosylated. In some embodiments, the anti-M1' domain antibody is kilizumab or 47H4 (see, e.g., Brightbill et al. J. Clin. Invest. 120(6):2218-2229, 2010).

Any of the foregoing methods or uses may involve administering a mast cell or basophil depleting agent (eg, a mast cell or basophil depleting antibody) to a patient. In some embodiments, the antibody depletes mast cells. In other embodiments, the antibody depletes basophils. In yet other embodiments, the antibody depletes mast cells and basophils.

Any of the preceding methods or uses may involve administering a PAR2 antagonist to a patient. Exemplary PAR2 antagonists include small molecule inhibitors (e.g., K-12940, K-14585, FSLLRY-NH2 peptide (SEQ ID NO: 30), GB88, AZ3451, and AZ8838), soluble receptors, siRNAs, and anti-PAR2 antibodies (e.g., MAB3949 and Fab3949 ).

Any of the preceding methods or uses may involve administering an IgE antagonist to a patient. In some embodiments, the IgE antagonist is an anti-IgE antibody. Any suitable anti-IgE antibody may be used. For example, an anti-IgE antibody can be any anti-IgE antibody described in US Pat. No. 8,961,964, which is incorporated herein by reference in its entirety. Exemplary anti-IgE antibodies include omalizumab (XOLAIR®), E26, E27, CGP-5101 (Hu-901), HA, ligelizumab, and talizumab. In specific embodiments, the anti-IgE antibody is omalizumab (XOLAIR®).

The amino acid sequence of the variable (VH) domain of the omalizumab heavy chain (XOLAIR®) is as follows (the amino acid sequences of HVR-H1, -H2 and -H3 are underlined):

The amino acid sequence of the variable (VL) domain of the light chain of omalizumab (XOLAIR®) is as follows (the amino acid sequences of HVR-L1, -L2 and -L3 are underlined):

Accordingly, in some embodiments, the anti-IgE antibody comprises one, two, three, four, five, or all six of the following six HVRs: (a) an HVR-H1 containing the amino acid sequence GYSWN (SEQ ID NO: 40); (b) HVR-H2 containing the amino acid sequence SITYDGSTNYNPSVKG (SEQ ID NO: 41); (c) HVR-H3 containing the amino acid sequence GSHYFGHWHFAV (SEQ ID NO: 42); (d) HVR-L1 containing the amino acid sequence RASQSVDYDGDSYMN (SEQ ID NO: 43); (e) HVR-L2 containing the amino acid sequence AASYLES (SEQ ID: 44); and (f) HVR-L3 containing the amino acid sequence QQSHEDPYT (SEQ ID NO: 45). In some embodiments, the anti-IgE antibody comprises (a) a VH domain comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 38; (b) a VL domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 39; or (c) a VH domain as in (a) and a VL domain as in (b). In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 38. In some embodiments, the VL domain contains the amino acid sequence of SEQ ID NO: 39. In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 38 and the VL domain contains the amino acid the sequence of SEQ ID NO: 39. Any of the anti-IgE antibodies described herein can be used in combination with any anti-tryptase antibody described herein, for example, in Section VII below.

Any of the foregoing methods or uses may involve administering a T _H 2 pathway inhibitor to a patient. In some embodiments, the T _H 2 pathway inhibitor inhibits any of the targets selected from interleukin-2 inducible T cell kinase (ITK), Bruton's tyrosine kinase (BTK), Janus kinase 1 (JAK1) (e.g., ruxolitinib, tofacitinib, oclacitinib, baricitinib, filgotinib, gandotinib, lestaurtinib, momelotinib, pacrinitib, upadacitinib, pefitinib, and fedratinib), GATA binding protein 3 (GATA3), IL-9 (eg, MEDI-528), IL-5 (eg, mepolizumab, CAS No. 196078 -29-2; resilizumab), IL-13 (eg, IMA-026, IMA-638 (also called anrukinzumab, INN #910649-32-0; QAX-576; IL-4/IL-13 trap), tralokinumab (also called CAT-354, CAS No. 1044515-88-9); AER-001, ABT-308 (also called 13C5.5 humanized antibody)), IL-4 (e.g. AER-001, IL-4 traps/ IL-13), OX40L, TSLP, IL-25, IL-33 and IgE (eg XOLAIR®, QGE-031 and MEDI-4212); and receptors, e.g.: IL-9 receptor, IL-5 receptor (e.g. MEDI-563 (benilizumab, CAS No. 1044511-01-4)), IL-4 receptor alpha (e.g. AMG-317, AIR-645), IL-13 receptor alpha-1 (eg R-1671) and IL-13 receptor alpha-2, OX40, TSLP-R, IL-7R-alpha (co-receptor for TSLP), IL-17RB (receptor for IL-25) , ST2 (receptor for IL-33), CCR3, CCR4, CRTH2 (for example, AMG-853, AP768, AP-761, MLN6095, AST129968), FcεRI, Fc£RII/CD23 (receptor for IgE), Flap (for example, GSK2190915), Syk kinase (R-343, PF3526299); CCR4 (AMG-761), TLR9 (QAX-935) and a multicytokine inhibitor of CCR3, IL-5, IL-3 and GM-CSF (eg TPI ASM8).

Any of the preceding methods or uses may include administering an additional therapeutic agent to a patient. In some embodiments, the additional therapeutic agent is selected from the group consisting of a _TH 2 pathway inhibitor, a corticosteroid, an IL-33 axis binding antagonist, a TRPA1 antagonist, a bronchodilator or asthma symptom control drug, an immunomodulator, a tyrosine kinase inhibitor, and a phosphodiesterase inhibitor. Such combination therapies are described below.

In some embodiments, the additional therapeutic agent is an asthma therapy, as described below. Moderate asthma is currently being treated with a daily inhaled anti-inflammatory corticosteroid or mast cell inhibitor such as cromolyn sodium or nedocromil, plus an inhaled beta2-agonist as needed (3-4 times a day) to relieve asthma exacerbation during treatment, or asthma caused by allergens or exercise. Exemplary inhaled corticosteroids include QVAR®, PULMICORT®, SYMBICORT®, AEROBID®, FLOVENT®, FLONASE®, ADVAIR® and AZMACORT®. Additional treatments for asthma include long-acting bronchodilators (LAND). In certain embodiments, LAND is a long-acting beta-2 agonist (LABA), a leukotriene receptor antagonist (LTRA), a long-acting muscarinic antagonist (LAMA), theophylline, or oral corticosteroids (OCS). Exemplary LABDs include SYMBICORT®, ADVAIR®, BROVANA®, FORADIL®, PERFOROMIST™, and SEREVENT®.

In some embodiments, any of the preceding methods or uses further comprises administering a bronchodilator or drug to control asthma symptoms. In some embodiments, the bronchodilator or asthma control drug is a p2-adrenergic agonist, such as a short-acting p2-adrenergic agonist (SABA) (such as albuterol), or a long-acting p2-adrenergic agonist (LABA). In some embodiments, LABA is salmeterol, abeditherol, indacaterol, vilanterol, and/or formoterol (formoterol fumarate dehydrate). In some embodiments, the asthma drug is a leukotriene receptor antagonist (LTRA). In some embodiments, LTRA is montelukast, zafirlukast, and/or zileuton. In some embodiments, the bronchodilator or asthma control drug is a muscarinic antagonist, such as a long-acting (cholinergic) muscarinic acetylcholine receptor antagonist (LAMA). In some embodiments, LAMA is glycopyrronium. In some embodiments, the bronchodilator or asthma control drug is an ion channel agonist, such as a bitter taste receptor (such as TAS2R).

In some embodiments, any of the previous methods or uses further comprises administering a bronchodilator. In some embodiments, the bronchodilator is an inhaled bronchodilator. In some embodiments, the inhaled bronchodilator is a β2-adrenergic agonist. In some embodiments, the p2 adrenergic agonist is a short acting β2 adrenergic agonist (SABA). In some embodiments, SABA is bitolterol, fenoterol, isoproterenol, levalbuterol, metaproterenol, pirbuterol, procaterol, ritodrine, albuterol, and/or terbutaline. In some embodiments, the β2-adrenergic agonist is a long-acting β2-adrenergic agonist (LABA). In some embodiments, LABA is arformoterol, bambuterol, clenbuterol, formoterol, salmeterol, abeditherol, carmoterol, indacaterol, olodaterol, and/or vilanterol. In some embodiments, the inhaled bronchodilator is a muscarinic receptor antagonist. In some embodiments, the muscarinic receptor antagonist is a short acting muscarinic receptor antagonist (SAMA). In some embodiments, SAMA is ipratropium bromide. In some embodiments, the muscarinic receptor antagonist is a long acting muscarinic receptor antagonist (LAMA). In some embodiments, LAMA is tiotropium bromide, glycopyrronium bromide, umeclidinium bromide, aclidinium bromide, and/or revefenacin. In some embodiments, the inhaled bronchodilator is a SABA/SAMA combination. In some embodiments, the SABA/SAMA combination is albuterol/ipratropium. In some embodiments, the inhaled bronchodilator is a LABA/LAMA combination. In some embodiments, the LABA/LAMA combination is formoterol/aclidinium, formoterol/glycopyrronium, formoterol/tiotropium, indacaterol/glycopyrronium, indacaterol/tiotropium, olodaterol/tiotropium, salmeterol/tiotropin, and/or vilanterol/umeclidinium. In some embodiments, the inhaled bronchodilator is a bifunctional bronchodilator. In some embodiments, the bifunctional bronchodilator is a muscarinic antagonist/β2 agonist (MABA). In some embodiments, MABA is batefenterol, THRX 200495, AZD2115, LAS 190792, TEI3252, PF-3429281 and/or PF-4348235. In some embodiments, the inhaled bronchodilator is a TAS2R agonist. In some embodiments, the bronchodilator is a nebulized SABA. In some embodiments, the nebulized SABA is albuterol and/or levalbuterol. In some embodiments, the bronchodilator is nebulized LABA. In some embodiments, the nebulized LABA is aarformoterol and/or formoterol. In some embodiments, the bronchodilator is nebulized SAMA. In some embodiments, the nebulized SAMA is ipratropium. In some embodiments, the bronchodilator is nebulized LAMA. In some embodiments, the nebulized LAMA is glycopyrronium and/or revefenacin. In some embodiments, the bronchodilator is a combination of nebulized SABA/SAMA. In some embodiments, the nebulized SABA/SAMA combination is albuterol/ipratropium. In some embodiments, the bronchodilator is a leukotriene receptor antagonist (LTRA). In some embodiments, LTRA is montelukast, zafirlukast, and/or zileuton. In some embodiments, the bronchodilator is methylxanthine. In some embodiments, the methylxanthine is theophylline.

In some embodiments, any of the previous methods or uses further comprises administering an immunomodulator. In some embodiments, the method further comprises administering cromolyn. In some embodiments, the method further comprises administering methylxanthine. In some embodiments, the methylxanthine is theophylline or caffeine.

In some embodiments, any of the preceding methods or uses further comprises administering one or more corticosteroids, such as an inhaled corticosteroid (ICS) or an oral corticosteroid. Non-limiting exemplary corticosteroids include inhaled corticosteroids such as beclomethasone dipropionate, budesonide, ciclesonide, flunisolide, fluticasone propionate, fluticasone furoate, mometasone, and/or triamcinolone acetonide, and oral corticosteroids such as methylprednisolone, prednisolone, and prednisone. In some embodiments, the corticosteroid is an ICS. In some embodiments, the ICS is beclomethasone, budesonide, flunisolide, fluticasone furoate, fluticasone propionate, mometasone, ciclesonide, and/or triamcinolone. In some embodiments, the method further comprises administering a combination of ICS/LABA and/or LAMA. In some embodiments, the combination of ICS/Laba and/or Lama is a fluticasone propionate/salmeterol, Budesonide/Formoterol, Momethason/Formoterol, Fluticasone Furoate/Vilantherol, Fluticasone Propionate/Formoterol, Beklometazone/Formoterol, Furoisa Furois/Fluticason Furois UMCILIDIUM, Fluticasone Furoate/Vinsterol /umeclidinium, fluticasone/salmeterol/tiotropium, beclomethasone/formoterol/glycopyrronium, budesonide/formoterol/glycopyrronium, and/or budesonide/formoterol/tiotropium. In some embodiments, the method further comprises administering a nebulized corticosteroid. In some embodiments, the nebulized corticosteroid is budesonide. In some embodiments, the method further comprises administering an oral or intravenous corticosteroid. In some embodiments, the oral or intravenous corticosteroid is prednisone, prednisolone, methylprednisolone, and/or hydrocortisone.

In some embodiments, any of the preceding methods or uses further comprises administering one or more active ingredients selected from amino salicylate; steroid; biological preparation; thiopurine; methotrexate; a calcineurin inhibitor such as cyclosporine or tacrolimus; and an antibiotic. In some embodiments, the method includes administering the additional active ingredient in an oral or topical formulation. Examples of amino salicylates include 4-aminosalicylic acid, sulfasalazine, balsalazide, olsalazine, and mesalazine in forms such as Eudragit-S coated, pH dependent mesalamine, ethyl cellulose coated mesalamine, and controlled release multimatrix mesalamine. Examples of steroids include corticosteroids or glucocorticosteroids. Examples of corticosteroids include prednisone and hydrocortisone, or methylprednisolone or a second generation corticosteroid such as budesonide or azathioprine; for example, in forms such as hydrocortisone enema or hydrocortisone foam. Examples of biologics include etanercept; an antibody to tumor necrosis factor-alpha, such as infliximab, adalimumab, or certolizumab; an anti-IL-12 and IL-23 antibody such as ustekinumab; vedolizumab; etrolizumab and natalizumab. Examples of thiopurines include azathioprine, 6-mercaptopurine and thioguanine. Examples of antibiotics include vancomycin, rifaximin, metronidazole, trimethoprim, sulfamethoxazole, diaminodiphenylsulfone, and ciprofloxacin; and antiviral agents such as ganciclovir.

In some embodiments, any of the previous methods or uses further comprises administering an antifibrotic agent. In some embodiments, the antifibrotic agent inhibits transforming growth factor-beta (TGF-β) stimulated collagen synthesis, reduces extracellular matrix, and/or blocks fibroblast proliferation. In some embodiments, the antifibrotic agent is pirfenidone. In some embodiments, the antifibrotic agent is PBI-4050. In some embodiments, the antifibrotic agent is tipelukast.

In some embodiments, any of the preceding methods or uses further comprises administering a tyrosine kinase inhibitor. In some embodiments, the tyrosine kinase inhibitor inhibits a tyrosine kinase that mediates the production of one or more fibrogenic growth factors. In some embodiments, the fibrogenic growth factor is a platelet growth factor, a vascular endothelial growth factor, and/or a fibroblast growth factor. In some embodiments, the tyrosine kinase inhibitor is imatinib and/or nintedanib. In some embodiments, the tyrosine kinase inhibitor is nintedanib. In some embodiments, the method further comprises administering an antidiarrheal agent. In some embodiments, the antidiarrheal agent is loperamide.

In some embodiments, any of the previous methods or uses further comprises administering an antibody. In some embodiments, the antibody is an anti-interleukin (IL)-13 antibody. In some embodiments, the anti-IL-13 antibody is tralokinumab. In some embodiments, the antibody is an anti-IL-4/anti-IL-13 antibody. In some embodiments, the anti-IL-4/anti-IL-13 antibody is SAR 156597. In some embodiments, the antibody is an anti-connective tissue growth factor (CTGF) antibody. In some embodiments, the anti-CTGF antibody is FG-3019. In some embodiments, the antibody is an anti-lysyl oxidase-like-2 (LOXL2) antibody. In some embodiments, the anti-LOXL2 antibody is simtuzumab. In some embodiments, the antibody is an anti-αvβ6 integrin receptor antibody. In some embodiments, the anti-αvβ6 integrin receptor antibody is STX-100. In some embodiments, the antibody is a monoclonal antibody.

In some embodiments, any of the preceding methods or uses further comprises administering a lysophosphatidic acid-1 (LPA1) receptor antagonist. In some embodiments, the LPA1 receptor antagonist is BMS-986020. In some embodiments, the method further comprises administering a galectin-3 inhibitor. In some embodiments, the galectin-3 inhibitor is TD-139.

In some embodiments, any of the prior methods or uses further includes the use of palliative care. In some embodiments, palliative care includes one or more antibiotics, anxiolytics, corticosteroids, and opioids. In some embodiments, the antibiotic is a broad spectrum antibiotic. In some embodiments, the antibiotic is a penicillin, a β-lactamase inhibitor, and/or a cephalosporin. In some embodiments, the antibiotic is piperacillin/tazobactam, cefixime, ceftriaxone, and/or cefdinir. In some embodiments, the anxiolytic is alprazolam, buspiron, chlorpromazine, diazepam, midazolam, lorazepam, and/or promethazine. In some embodiments, the implementation of the corticosteroid is a glucocorticosteroid. In some embodiments, the glucocorticosteroid is prednisone, prednisolone, methylprednisolone, and/or hydrocortisone. In some embodiments, the opioid is morphine, codeine, dihydrocodeine, and/or diamorphine.

In some embodiments, any of the previous methods or uses further comprises administering an antibiotic. In some embodiments, the antibiotic is a macrolide. In some embodiments, the macrolide is azithromycin and/or clarithromycin. In some embodiments, the antibiotic is doxycycline. In some embodiments, the antibiotic is trimethoprim/sulfamethoxazole. In some embodiments, the antibiotic is a cephalosporin. In some embodiments, the cephalosporin is cefepime, cefixime, cefpodoxime, cefprozil, ceftazidime, and/or cefuroxime. In some embodiments, the antibiotic is a penicillin. In some embodiments, the antibiotic is amoxicillin, ampicillin, and/or pivampicillin. In some embodiments, the antibiotic is a penicillin/β-lactamase inhibitor combination. In some embodiments, the penicillin/β-lactamase inhibitor combination is amoxicillin/clavulanate and/or piperacillin/tazobactam. In some embodiments, the antibiotic is a fluoroquinolone. In some embodiments, the fluoroquinolone is ciprofloxacin, gemifloxacin, levofloxacin, moxifloxacin, and/or ofloxacin.

In some embodiments, any of the previous methods or uses further comprises administering a phosphodiesterase inhibitor. In some embodiments, the phosphodiesterase inhibitor is a type 5 phosphodiesterase inhibitor. In some embodiments, the phosphodiesterase inhibitor is avanafil, benzamidenafil, dazantafil, icariin, lomenafil, mirodenafil, sildenafil, tadalafil, udenafil, and/or vardenafil. In some embodiments, the PDE inhibitor is a PDE-4 inhibitor. In some embodiments, the PDE-4 inhibitor is roflumilast, cilomilast, tetomilast, and/or CHF6001. In some embodiments, the PDE inhibitor is a PDE-3/PDE-4 inhibitor. In some embodiments, the PDE-3/PDE-4 inhibitor is RPL-554.

In some embodiments, any of the preceding methods or uses further comprises administering a cytotoxic and/or immunosuppressive agent. In some embodiments, the cytotoxic and/or immunosuppressive agent is azathioprine, colchicine, cyclophosphamide, cyclosporine, methotrexate, penicillamine, and/or thalidomide. In some embodiments, the method further comprises administering an agent that restores depleted glutathione levels in the lungs. In some embodiments, the agent that restores depleted lung glutathione levels is N-acetylcysteine. In some embodiments, the method further comprises administering an anticoagulant. In some embodiments, the anticoagulant is warfarin, heparin, activated protein C, and/or an inhibitor of the tissue factor pathway.

In some embodiments, any of the preceding methods or uses further comprises administering an endothelin receptor antagonist. In some embodiments, the endothelin receptor antagonist is bosentan, makitentan and/or ambrisentan. In some embodiments, the method further comprises administering a TNF-α antagonist. In some embodiments, the TNF-α antagonist comprises one or more of etanercept, adalimumab, infliximab, certolizumab, and golimumab. In some embodiments, the method further comprises administering interferon gamma-1b.

In some embodiments, any of the previous methods or uses further comprises administering an interleukin (IL) inhibitor. In some embodiments, the IL inhibitor is an IL-5 inhibitor. In some embodiments, the IL-5 inhibitor is mepolizumab and/or benilizumab. In some embodiments, the IL inhibitor is an IL-17A inhibitor. In some embodiments, the IL-17A inhibitor is CNTO-6785.

In some embodiments, any of the preceding methods or uses further comprises administering a p38 mitogen-activated protein kinase (MAPK) inhibitor. In some embodiments, the p38 MAPK inhibitor is losmapimod and/or AZD-7624. In some embodiments, the method further comprises administering a CXCR2 antagonist. In some embodiments, the CXCR2 antagonist is danirixin.

In some embodiments, any of the previous methods or uses further comprises vaccination. In some embodiments, the vaccination is a pneumococcal and/or influenza vaccination. In some embodiments, the implementation of the vaccination is a vaccination against Streptococcus pneumoniae and/or influenza. In some embodiments, the implementation of the method further includes the use of antiviral therapy. In some embodiments, the antiviral therapy is oseltamivir, peramivir, and/or zanamivir.

In some embodiments, any of the preceding methods or uses further comprise preventing gastroesophageal reflux and/or repetitive microaspiration.

In some embodiments, any of the prior methods or uses further includes a ventilator support. In some embodiments, the ventilation support is mechanical ventilation. In some embodiments, the ventilatory support is non-invasive ventilation. In some embodiments, the ventilatory support is oxygen therapy. In some embodiments, the implementation of the method further includes pulmonary rehabilitation.

In some embodiments, any of the prior methods or uses further comprises lung transplantation. In some embodiments, the lung transplant is a single lung transplant. In some embodiments, the lung transplant is a bilateral lung transplant.

In some embodiments, any of the preceding methods or uses further comprises non-pharmacological intervention. In some embodiments, the non-pharmacological intervention is smoking cessation, a healthy diet, and/or regular exercise. In some embodiments, the implementation of the method further includes the use of pharmacological assistance for smoking cessation. In some embodiments, pharmacological assistance for smoking cessation is nicotine replacement therapy, bupropion, and/or varenicline. In some embodiments, the non-pharmacological intervention is pulmonary therapy. In some embodiments, the pulmonary therapy is pulmonary rehabilitation and/or oxygen therapy. In some embodiments, the non-pharmacological intervention is lung surgery. In some embodiments, the lung surgery is lung volume reduction surgery, single lung transplant, bilateral lung transplant, or bullectomy. In some embodiments, the non-pharmacological intervention is the use of a device. In some embodiments, the device is a lung volume reduction coil, a transbronchial stent, and/or a nasal breathing support system.

Combination therapy can provide "synergism" and confirms the "synergistic" effect, that is, the effect achieved when the active components used together produce a greater effect than the sum of the effects that lead to results when the compounds are used separately. A synergistic effect can be achieved when the active ingredients are: (1) co-formulated and administered or delivered simultaneously in a combined unit dosage formulation; (2) delivered in alternation, or in parallel, as separate formulations; or (3) using some other scheme. Combined administration includes co-administration using separate formulations or a single pharmaceutical formulation and sequential administration in any order, where preferably there is a period of time during which both (or all) active substances simultaneously exhibit their biological activities. When delivering interleaved therapy, a synergistic effect can be achieved when the compounds are administered or delivered sequentially, for example, by different injections in separate syringes. Typically, during alternating therapy, an effective dosage of each active ingredient is administered sequentially, i.e. sequentially, while in combination therapy, effective dosages of two or more active ingredients are administered together. When administered sequentially, the combination may be administered in two or more doses.

Such combination therapies noted above include combined administration (where two or more therapeutic agents are included in one or different formulations) and separate administration, in which case administration of an agent (e.g., tryptase antagonist, FcεR antagonist, IgE ⁺ B- depleting antibody). cell, mast cell or basophil depleting antibody, PAR2 antagonist, IgE antagonist, or combinations thereof (e.g., tryptase antagonist and IgE antagonist)) or pharmaceutical composition thereof may occur before, concurrently, and/or after administration of the additional therapeutic agent(s). In one embodiment, administering an agent (e.g., a tryptase antagonist, an FcεR antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, an IgE antagonist, or a combination thereof (e.g., a tryptase antagonist and an IgE antagonist)) or its pharmaceutical composition, and the introduction of additional therapeutic agent occurs within about one month; or within about one, two, or three weeks; or within one, two, three, four, five or six days; or for about 1, 2, 3, 4, 5, 6, 7, 8, or 9 hours; or within about 1,5,10, 20, 30, 40 or 50 minutes apart. For embodiments involving sequential administration, an agent (e.g., tryptase antagonist, Fc epsilon receptor (FcεR) antagonist, IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, protease-activated receptor 2 (PAR2) antagonist , an IgE antagonist, or a combination thereof (eg, a tryptase antagonist and an IgE antagonist)) may be administered before or after administration of the additional therapeutic agent(s).

In any of the preceding methods or uses, a therapy (e.g., a therapy comprising a tryptase antagonist, an FcεR antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, an IgE antagonist, or a combination thereof (e.g., a tryptase antagonist and an IgE antagonist)) and any additional therapeutic agent can be administered by any suitable route, including parenteral, intraperitoneal, intramuscular, intravenous, intradermal, transdermal, intraarterial, intralesional, intracranial, intraarticular, intraprostate, intrapleural, intratracheal, intrathecal, intranasal, intravaginally, rectally, topically, intratumorally, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, intraocularly, intrabitally, orally, topically, transdermally, intravitreally, periocularly, into the conjunctival cavity, into the subtenon space, intracameral, subretinally, retrobulbarno , intracanal, by inhalation, injection, implantation, infusion, continuous infusion, localized perfusion directly into target cells, by catheter, by lavage, in creams or in lipid formulations. The introduction can be systemic or local. In addition, the antagonist can be appropriately administered by pulsed infusion, for example, by reducing the dose of the antagonist.

Any therapeutic agent, e.g. tryptase antagonist, FcεR antagonist, IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, PAR2 antagonist, IgE antagonist, combination thereof (e.g. tryptase antagonist and IgE antagonist), any additional therapeutic the agent or pharmaceutical compositions thereof will be formulated, dosed and administered in a manner consistent with good medical practice. Such dosages are known in the art. Factors to be considered in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, site of delivery of the agent, route of administration, schedule of administration, and other factors known to physicians. Tryptase antagonist, FcεR antagonist, IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, PAR2 antagonist, IgE antagonist, or a pharmaceutical composition thereof is optional but may be formulated with one or more agents currently used for preventing or treating the disorder discussed herein. The effective amount of such other agents depends on the amount of antibody present in the formulation, the type of disorder or treatment, and other factors discussed above. They are generally used at the same dosages and routes of administration as described herein, or from about 1% to about 99% of the dosages described herein, or at any dosage and route empirically/clinically determined to be appropriate. .

As one example, to prevent or treat a disease, a suitable dosage of an antibody (e.g., anti-tryptase antibody, anti-IgE antibody (e.g., XOLAIR®), IgE ⁺ B cell depleting antibody (e.g., anti-M1' domain antibody (e.g., qilizumab)), mast cell or basophil depleting antibody, or anti-PAR2 antibody) (when used alone or in combination with one or more other additional therapeutic agents) will depend on the type of disease being treated, the type of antibody, the severity and course of the disease, whether the antibody is being administered for prophylactic or therapeutic purposes, prior therapy, the patient's medical history and antibody response, and the discretion of the treating physician. The antibody is easy to administer to a patient at a single time or over a series of treatments. Depending on the type and severity of the disease, 1 μg/kg to 15 mg/kg (e.g., 0.1 mg/kg to 10 mg/kg) antibodies may be the initial potential dose to administer to a patient, whether it be, for example, one or more separate injections or continuous infusion. One typical daily dose may range from about 1 μg/kg to 200 mg/kg or more, depending on the above factors. In the case of repeated administrations over several days or more, depending on the condition, the treatment is usually carried out until the desired degree of suppression of the symptoms of the disease is achieved. One exemplary dose of an antibody would be in the range of about 0.05 mg/kg to about 10 mg/kg. Thus, one or more doses of about 0.5 mg/kg, 2.0 mg/kg, 4.0 mg/kg, or 10 mg/kg (or any combination thereof) may be administered to the patient. Such doses can be administered intermittently, eg, every week, every two weeks, every three weeks, or every four weeks (eg, so that the patient receives from about two to about twenty or, for example, about six doses of the antibody). For example, the dose may be administered once a month. An initial higher loading dose may be administered followed by one or more lower doses. However, other dosage regimens may be useful. The effectiveness of such therapy is easy to control using traditional methods and methods of analysis. In some instances, a dose of about 50 mg/mL to about 200 mg/mL may be administered, e.g., about 50 mg/mL, about 60 mg/mL, about 70 mg/mL, about 80 mg/mL, about 90 mg/mL , about 100 mg/ml, about 110 mg/ml, about 120 mg/ml, about 130 mg/ml, about 140 mg/ml, about 150 mg/ml, about 160 mg/ml, about 170 mg/ml, about 180 mg/ml, about 190 mg/ml or about 200 mg/ml antibody. In some embodiments, the dosage of XOLAIR® (omalizumab) for patients with asthma may be determined based on pre-treatment body weight and IgE levels using approaches known in the art. XOLAIR® (omalizumab) can be administered by subcutaneous injection every four weeks at a dose of 300 or 150 mg per dose for the treatment of CIU.

In any of the preceding methods or uses, in some embodiments, the mast cell mediated inflammatory disease is selected from the group consisting of asthma, atopic dermatitis, urticaria (e.g., CSU or CIU), systemic anaphylaxis, mastocytosis, chronic obstructive pulmonary disease (COPD) , idiopathic pulmonary fibrosis (IPF) and eosinophilic esophagitis.

In some embodiments of any of the prior methods or uses, the mast cell mediated inflammatory disease is asthma. In some embodiments, the asthma is chronic persistent severe asthma with severe worsening symptoms (attacks or exacerbations) that can be life threatening. In some embodiments, the asthma is atopic (also known as allergic) asthma, non-allergic asthma (e.g., often caused by a respiratory viral infection (e.g., influenza, parainfluenza, rhinovirus, human metapneemovirus, and respiratory syncytial virus), or an inhaled irritant (e.g., air pollutants). , smog, diesel particles, volatile chemicals and gases indoors or outdoors, or even cold, dry air).

In some embodiments of any of the preceding methods or uses, the asthma is episodic or exercise-induced asthma due to acute or chronic primary or secondary exposure to "smoke" (typically cigarettes, cigars, or pipes), inhalation, or "vapour" (tobacco, marijuana or other similar substances), or asthma caused by recent use of aspirin or related NSAIDs. In some embodiments, asthma is mild or corticosteroid-untreated asthma, newly diagnosed and untreated asthma, or not previously requiring chronic use of inhaled topical or systemic steroids to control symptoms (cough, wheezing, dyspnea/dyspnea, or chest pain). In some embodiments, the asthma is chronic, corticosteroid-resistant asthma, corticosteroid-refractory asthma, or asthma not controlled by corticosteroids or other drugs to control chronic asthma.

In some embodiments of any of the preceding methods or uses, the asthma is moderate to severe asthma. In certain embodiments, the asthma is high T _H 2 asthma. In some embodiments, the asthma is severe asthma. In some embodiments, the asthma is atopic asthma, allergic asthma, non-allergic asthma (e.g., due to infection and/or respiratory syncytial virus (RSV)), exercise-induced asthma, aspirin-responsive/aspirin-induced asthma, mild asthma, moderate or severe asthma, corticosteroid-untreated asthma, chronic asthma, corticosteroid-resistant asthma, corticosteroid-refractory asthma, newly diagnosed and untreated asthma, smoking-induced asthma, asthma uncontrolled by corticosteroids. In some embodiments, the asthma is eosinophilic asthma. In some embodiments, the asthma is allergic asthma. In some embodiments, the individual has been determined to be positive for eosinophilic inflammation (EIP). See WO 2015/061441. In some embodiments, the asthma is high periostin asthma (eg, in which the periostin level is at least any of about 20 ng/mL, 25 ng/mL, or 50 ng/mL serum). In some embodiments, the asthma is asthma with high eosinophils (eg, at least any of about 150, 200, 250, 300, 350, 400 eosinophils/mL of blood). In certain embodiments, the asthma is low T _H 2 asthma. In some embodiments, the individual has been determined to be eosinophilic inflammation (EIN) negative. See WO2015/061441. In some embodiments, the asthma is low periostin asthma (eg, less than about 20 ng/ml serum periostin). In some embodiments, the asthma is asthma with low eosinophils (eg, less than about 150 eosinophils/BMc of blood or less than about 100 eosinophils/McB of blood).

For example, in specific embodiments of any of the preceding methods or uses, the asthma is moderate to severe asthma. In some embodiments, asthma is not controlled by corticosteroids. In some embodiments, the asthma is high T _H 2 asthma or low T _H 2 asthma. In specific embodiments, the asthma is high T _H 2 asthma.

III. Diagnostic Methods According to the Invention

The present invention relates to methods for determining whether patients with a mast cell mediated inflammatory disease (e.g., asthma) may respond to therapy (e.g., therapy comprising an agent selected from the group consisting of a tryptase antagonist, an Fc-epsilon- receptor (FcεR), IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, protease-activated receptor 2 (PAR2) antagonist, IgE antagonist, and combinations thereof (e.g. tryptase antagonist and IgE antagonist)), methods of choice of therapy for a patient with an inflammatory disease mediated by mast cells, methods for assessing the response of a patient with an inflammatory disease mediated by mast cells, and methods for monitoring the response of a patient with an inflammatory disease mediated by mast cells. In some embodiments, the therapy is a mast cell-targeting therapy (e.g., a therapy that includes a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, and/or a PAR2 antagonist). In some embodiments, the therapy comprises a tryptase antagonist (e.g., an anti-tryptase antibody, e.g., any anti-tryptase antibody described herein or in WO 2018/148585) and an IgE antagonist (e.g., an anti-IgE antibody, e.g. omalizumab (XOLAIR®) ).

The presence and/or level of expression of a biomarker of the invention (eg, the number of active tryptase and/or tryptase alleles) can be determined using any of the assays described herein, or using any method or assay known in the art. In some embodiments, the methods further comprise administering therapy to a patient, for example, as described in Section II of the Detailed Description of the Invention above. The methods can be carried out in various assay formats, including assays that determine genetic information (for example, DNA or RNA sequencing), gene or protein expression (for example, polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays), and biochemical assays that determine the corresponding activity, for example, as described below.

For example, in one aspect, the invention relates to a method for determining whether a patient with a mast cell-mediated inflammatory disease is responsive to a mast cell-targeted therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an antagonist IgE, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), the method comprising: (a) detecting in a sample from a patient with an inflammatory disease , mediated by mast cells, the number of active tryptase alleles in the patient; and (b) identifying a patient likely to respond to a mast cell therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), based on the number of active tryptase alleles in a patient, where a number of active tryptase alleles equal to or greater than the reference number of active tryptase alleles indicates that the patient has increased likelihood of response to therapy. In some embodiments, the method further comprises administering the therapy to the patient.

In another example, the invention relates to a method for determining whether a patient with a mast cell-mediated inflammatory disease may respond to a mast cell-targeted therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a protease-activated receptor 2 (PAR2) antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), the method comprising: (a) determining the level of tryptase expression in a sample from a patient with an inflammatory disease mediated by mast cells; and (b) identifying a patient likely to respond to a mast cell therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), based on the level of tryptase expression in a sample from the patient, wherein the level of tryptase expression in the sample equal to or greater than the tryptase reference level indicates that that the patient has an increased likelihood of responding to therapy. In some embodiments, the method further comprises administering therapy to a patient.

In some embodiments of any of the preceding methods, the patient has been identified as having a type 2 biomarker level in a patient sample that is below a reference type 2 biomarker level. In some embodiments, the agent is administered to the patient as monotherapy.

In some embodiments of any of the preceding methods, a patient has been identified as having a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a level 2 biomarker. In some embodiments, the method further comprises administering the _TH 2 pathway inhibitor to the patient.

In another aspect, the invention relates to a method for determining whether a patient with a mast cell-mediated inflammatory disease may respond to therapy comprising an IgE antagonist or an FcεR antagonist, which comprises (a) determining in a sample from a patient with a mast cell-mediated inflammatory disease, the number of active tryptase alleles in the patient; and (b) identifying a patient having a likelihood of responding to therapy comprising an IgE antagonist or an FcεR antagonist based on the number of active tryptase alleles of the patient, wherein the number of active tryptase alleles is lower than the reference number of active tryptase alleles, indicating that the patient has an increased likelihood of responding to therapy. In some embodiments, the method further comprises administering the therapy to the patient.

In another example, the invention relates to a method for determining whether a patient with a mast cell-mediated inflammatory disease may respond to therapy comprising an IgE antagonist or an FcεR antagonist, which comprises (a) determining the expression level of tryptase in a sample from a patient with a inflammatory disease mediated by mast cells; and (b) identifying a patient having a likelihood of responding to therapy comprising an IgE antagonist or an FcεR antagonist based on a tryptase expression level in the patient sample, wherein the tryptase expression level in the patient sample is below a reference tryptase level, indicating that the patient has an elevated likelihood of responding to therapy. In some embodiments, the method further comprises administering the therapy to the patient.

In some embodiments of any of the preceding methods, a patient has been identified as having a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a level 2 biomarker. In some embodiments, the method further comprises administering to the patient an additional inhibitor of the T _H 2 pathway.

In a further example, the invention relates to a method for selecting therapy for a patient with a mast cell-mediated inflammatory disease, which comprises (a) determining, in a sample from a patient with a mast cell-mediated inflammatory disease, the number of active tryptase alleles in the patient; and: (b) selecting for the patient: (i) a mast cell-targeting therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), if the number of active tryptase alleles in the patient is equal to or greater than the reference number of active tryptase alleles, and/or therapy including an IgE antagonist or an FcεR antagonist if the number of active tryptase alleles in the patient is below the reference number of active tryptase alleles. In some embodiments, the method further comprises administering the therapy selected according to (b) to the patient.

In yet another example, the invention relates to a method for selecting therapy for a patient with an inflammatory disease mediated by mast cells, which includes (a) determining the level of tryptase expression in a sample from a patient with an inflammatory disease mediated by mast cells; and (b) selecting for the patient: (i) a mast cell-targeting therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), if the tryptase expression level in the patient sample is equal to or higher than the tryptase reference level, or (ii) therapy including an IgE antagonist or an FcεR antagonist, if the expression level of tryptase in a sample from a patient is below the reference level of tryptase. In some embodiments, the method further comprises administering the therapy selected according to (b) to the patient.

In some embodiments of any of the preceding aspects, the patient has been identified as having a type 2 biomarker level in a patient sample that is below a reference type 2 biomarker level. In some embodiments, the agent is administered to the patient as monotherapy.

In some embodiments of any of the preceding aspects, the patient has been identified as having a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a type 2 biomarker, and the method further comprises selecting a combination therapy comprising a T _H 2 pathway inhibitor In some embodiments, the method further comprises administering the _TH 2 pathway inhibitor (or additional _TH 2 pathway inhibitor) to the patient.

The invention also relates to a method for evaluating the response of a patient with a mast cell-mediated inflammatory disease to treatment with a therapy directed at treating mast cells (for example, a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), wherein the method comprises: (a) determining the level of tryptase expression in a sample from a patient with a mast cell-mediated inflammatory disease , during or after the use of therapy directed to mast cells (for example, therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B-cells, an antibody that depletes mast cells or basophils, PAR2 antagonist, and combinations thereof (tryptase antagonist and IgE antagonist)), in a patient; and (b) maintaining, adjusting, or discontinuing treatment based on comparison of tryptase expression level in the sample to a reference tryptase level, wherein a change in tryptase expression level in the patient sample compared to the reference level is indicative of a response to therapy. In some embodiments, the change is an increase in tryptase expression and treatment is continued. In other embodiments, the change is a decrease in tryptase expression and the treatment is adjusted or stopped.

In another example, the invention relates to a method for controlling the response of a patient with a mast cell-mediated inflammatory disease who is being treated with a mast cell-targeting therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an antibody that depletes IgE ⁺ B cells, mast cell or basophil depleting antibody, PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), the method comprising: (a) determining the level of tryptase expression in a patient sample during or after administration mast cell-targeting therapy (e.g., therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and combinations thereof (eg tryptase antagonist and IgE antagonist) in a patient); and (b) comparing the expression level of tryptase in the sample from the patient with a reference level of tryptase, thereby monitoring the response of the patient being treated with the therapy. In some embodiments, the change is an increase in tryptase expression and treatment is continued. In other embodiments, the change is a decrease in tryptase expression and treatment is adjusted or discontinued.

In some embodiments of any of the preceding methods, the number of active tryptase alleles is determined by sequencing the TPSAB1 and TPSB2 loci of the patient's genome. Any suitable sequencing approach may be used, such as Sanger sequencing or massively parallel sequencing (eg, ILLUMINA®). In some embodiments, the TPSAB1 locus is sequenced using a method comprising (i) amplifying a nucleic acid from a subject in the presence of a first forward primer containing the nucleotide sequence 5'-CTG GTG TGC AAG GTG AAT GG-3' (SEQ ID NO: 31) and a first reverse primer containing the nucleotide sequence 5'AGG TCC AGC ACT CAG GAG GA-3' (SEQ ID NO: 32) to obtain a TPSAB1 amplicon, and (ii) sequencing the TPSAB1 amplicon. In some embodiments, sequencing the TPSAB1 amplicon includes using a first forward primer and a first reverse primer. In some embodiments, the TPSB2 locus is sequenced using a method comprising (i) amplifying a nucleic acid from a subject in the presence of a second forward primer containing the nucleotide sequence 5'-GCA GGT GAG CCT GAG AGT CC-3' (SEQ ID NO: 33), and a second reverse primer containing the nucleotide sequence 5-GGG ACC TTC ACC TGC TTC AG-3' (SEQ ID NO: 34) to obtain a TPSB2 amplicon, and (ii) sequencing the TPSB2 amplicon. In some embodiments, sequencing the TPSB2 amplicon comprises using a second forward primer and a reverse sequencing primer containing the 5'-CAG CCA GTG ACC CAG CAC-3' nucleotide sequence (SEQ ID NO: 35). In some embodiments, the number of active tryptase alleles can be determined by determining the presence of any variation at the TPSAB1 and TPSB2 loci of the patient's genome. In some embodiments, the number of active tryptase alleles is determined by the formula: 4 is the sum of the number of alleles of alpha-tryptase and frameshift beta-III-tryptase (beta-III ^FS ) in the patient's genotype In some embodiments, alpha-tryptase is determined by detecting SNP c733 G>C in TPSAB1. In some embodiments, detection of the c733 G>A SNP in TPSAB1 includes detection of the patient genotype with the polymorphism CTGCAGGCGGGCGTGGTCAGCTGGG[G/A]CGAGGGCTGTGCCCAGCCCAACCGG (SEQ ID NO: 36), wherein the presence of A in the c733 G>A SNP indicates alpha tryptase. In some embodiments, beta-III ^FS -tryptase is detected by detecting the c980_981insC mutation in TPSB2. In some embodiments, detection of the c980_981insC mutation in TPSB2 comprises detection of the nucleotide sequence CACACGGTCACCCTGCCCCCTGCCTCAGACCTTCCCCCCC (SEQ ID NO: 37). In some embodiments of any of the preceding methods, the number of active tryptase alleles in the patient is 3 or 4. In some embodiments, the number of active tryptase alleles is 3. In other embodiments, the number of active tryptase alleles is 4.

In other embodiments of any of the preceding methods, the number of active tryptase alleles in a patient is 0, 1, or 2. In some embodiments, the number of active tryptase alleles is 0. In some embodiments, the number of active tryptase alleles is 1. In other embodiments, the number of active tryptase alleles is tryptase is 2.

In some embodiments of any of the preceding methods, the reference number of active tryptase alleles may be determined in a reference sample, a reference population, and/or may be a predetermined value (e.g., a threshold that has previously been determined for a meaningful (e.g., statistically significant) division of the first subpopulations of individuals from a second subpopulation of individuals (e.g., in terms of response to therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an FcεR antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist))). In some embodiments, the reference number of active tryptase alleles is a predetermined value. In some embodiments, the reference number of active tryptase alleles is predetermined in inflammatory a mast cell mediated disease the patient is suffering from (eg, asthma). In certain embodiments, the number of active tryptase alleles is determined from the overall distribution of values in a mast cell-mediated inflammatory disease of interest (eg, asthma) or in a given population. In some embodiments, the reference number of active tryptase alleles is an integer in the range of 0 to 4 (eg, 0, 1, 2, 3, or 4). In specific embodiments, the reference number of active tryptase alleles is 3.

Any of the preceding methods may include determining the level of expression of one or more type 2 biomarkers. In some embodiments, the type 2 biomarker is a _TH 2 cell-associated cytokine, periostin, eosinophil count, eosinophil profile, FeNO, or IgE. In some embodiments, the cytokine associated with the _TH 2 cell is IL-13, IL-4, IL-9, or IL-5.

In any of the previous methods, the patient's genotype can be determined using any of the methods or assays described herein (for example, in Section IV of the Detailed Description of the Invention or in Example 1), or known in the art.

In some embodiments of any of the preceding methods, the level of expression of the biomarker is the level of protein expression. For example, in some embodiments, the level of protein expression is measured using an immunoassay (eg, multiplex immunoassay), ELISA, Western blot, or mass spectrometry. In some embodiments, the tryptase protein expression level is an active tryptase expression level. In other embodiments, the tryptase protein expression level is total tryptase expression level.

In other embodiments of any of the preceding methods, the level of expression of the biomarker is the level of mRNA expression. For example, in some embodiments, the level of mRNA expression is measured using a PCR method (eg, qPCR) or a microarray chip.

In some embodiments of any of the preceding methods, the reference biomarker level is a biomarker level determined in a group of individuals with asthma. For example, in some embodiments, the reference level is the median level.

Any suitable sample obtained from a patient can be used in any of the previous methods. For example, in some embodiments, the sample obtained from the patient is a blood sample (e.g., a whole blood sample, a serum sample, a plasma sample, or a combination thereof), a tissue sample, a sputum sample, a bronchial lavage sample, a mucosal fluid (MLF) sample , bronchosorption sample and nasosorption sample.

In any of the preceding methods, the level of expression of a biomarker of the invention (e.g., tryptase) in a sample obtained from a patient can be changed to/in at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times , 15 times, 16 times or more relative to the reference level of the biomarker. For example, in some embodiments, the expression level of a biomarker of the invention in a patient sample can be increased by/in at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80 %, 90%, 100%, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times or more relative to the reference biomarker level. In other embodiments, the expression level of a biomarker of the invention in a patient sample may be reduced by/in at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times or more relative to the reference level of the biomarker.

In some embodiments of any of the preceding methods, the reference level may be set to any percentile between, for example, the 20th percentile and the 99th percentile (e.g., 20th, 25th, 30th, 35th, 40th th, 45th, 50th, 55th, 60th, 65th, 70th, 75th, 80th, 85th, 90th, 95th, or 99th percentile ) the overall distribution of the level of expression of a biomarker (eg, tryptase), for example, in healthy subjects or in patients with a disorder (eg, a mast cell-mediated inflammatory disease (eg, asthma)). In some embodiments, the implementation of the reference level may be set to the 25th percentile of the overall distribution of values in the population of patients with asthma. In other embodiments, the reference level may be set to the 50th percentile of the overall distribution of values in a population of patients with a mast cell-mediated inflammatory disease (eg, asthma). In yet other embodiments, the reference level may be the median of the overall distribution of values in a population of patients with a mast cell-mediated inflammatory disease (eg, asthma).

In any of the preceding methods, the patient may have an elevated T _H 2 biomarker level relative to a reference level. In some embodiments, the _TH 2 biomarker is selected from the group consisting of serum periostin, exhaled nitric oxide fraction (FeNO), sputum eosinophil count, and peripheral blood eosinophil count. In some embodiments, the _TH 2 biomarker is serum periostin. For example, a patient may have a serum periostin level of about 20 ng/mL or higher (e.g., about 20 ng/mL, about 25 ng/mL, about 30 ng/mL, about 35 ng/mL, about 40 ng/mL, about 45 ng/ml, about 50 ng/ml or higher). In other embodiments, the patient may have a serum periostin level of about 50 ng/mL or higher (e.g., about 50 ng/mL, about 55 ng/mL, about 60 ng/mL, about 65 ng/mL, about 70 ng/mL, about 75 ng/ml, about 80 ng/ml or higher). Serum periostin levels can be determined using any suitable method, such as enzyme immunoassay (ELISA). This document describes suitable approaches.

In some embodiments of any of the preceding methods, the therapy comprises a tryptase antagonist. The tryptase antagonist can be an alpha tryptase antagonist (eg, an alpha 1 tryptase antagonist) or a beta tryptase antagonist (eg, a beta 1 tryptase, a beta 2 tryptase, and/or a beta 3 tryptase antagonist). In some embodiments, the tryptase antagonist is an alpha tryptase antagonist and a beta tryptase antagonist. In some embodiments, the tryptase antagonist (eg, alpha-tryptase antagonist and/or beta-tryptase antagonist) is an anti-tryptase antibody (eg, anti-alpha-tryptase antibody and/or anti-beta-tryptase antibody). Any anti-tryptase antibody described in Section VII below may be used.

In some embodiments of any of the preceding methods, the therapy comprises an FcεR antagonist. In some embodiments, the FcεR antagonist inhibits FcεRlα, FcεRlβ, and/or FcεRlγ. In other embodiments, the FcεR antagonist inhibits FcεRlI. In yet other embodiments, the FcεR antagonist inhibits a member of the FcεR signaling pathway. For example, in some embodiments, the FcεR antagonist inhibits tyrosine protein kinase Lyn (Lyn), Bruton's tyrosine kinase (BTK), tyrosine protein kinase Fyn (Fyn), spleen-associated tyrosine kinase (Syk), T cell activation linker (LAT), protein -2, growth factor receptor-associated (Grb2), son of sevenless (Sos), Ras, Raf-1, mitogen-activated protein kinase 1 (MEK), mitogen-activated protein kinase 1 (ERK), cytosolic phospholipase A2 ( cPLA2), arachidonate-5-lipoxygenase (5-LO), arachidonate-5-lipoxygenase-activating protein (FLAP), guanine nucleotide exchange factor VAV (Vav), Rac, mitogen-activated protein kinase kinase-3, mitogen-activated protein kinase-7 activated protein kinase, p38 MAP kinase (p38), c-Jun-N-terminal kinase (JNK), protein-2 associated with protein-2, which is associated with the growth factor receptor (Gab2), phosphatidylinositol-4,5-bisphosphate -3-kinase (PI3K), phospholipase C gamma (PLCy), protein kinase C (PKC), 3-phosphoinositide-dependent protein kinase 1 (PDK1), RAC serine/threonine protein kinase (ACT), histamine, heparin, interleukin (IL) -3, IL-4, IL-13, IL-5, granulocyte-macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor-alpha (TNF-a), leukotrienes (eg, LTC4, LTD4, and LTE4), and prostaglandins ( e.g. PDG2). In some embodiments, the FcεR antagonist is a BTK inhibitor (eg, GDC-0853, acalabrutinib, GS-4059, spebrutinib, BGB-3111, or HM71224).

In some embodiments of any of the preceding methods, the therapy comprises an IgE ⁺ B cell depleting agent (eg, an IgE ⁺ B cell depleting antibody). In some embodiments, the IgE ⁺ depleting B cell antibody is an antibody against the M1 domain. Any suitable anti-MV domain antibody can be used, for example any anti-MV domain antibody described in International Patent Application Publication No. WO 2008/116149, which is incorporated herein by reference in its entirety. In some embodiments, the anti-M1' domain antibody is afucosylated. In some embodiments, the anti-M1' domain antibody is kilizumab or 47H4 (see, for example, Brightbill et al. J. Clin. Invest. 120(6):2218-2229, 2010).

In some embodiments of any of the preceding methods, the therapy comprises a mast cell or basophil depleting agent (eg, a mast cell or basophil depleting antibody). In some embodiments, the antibody depletes mast cells. In other embodiments, the antibody depletes basophils. In yet other embodiments, the antibody depletes mast cells and basophils.

In some embodiments of any of the preceding methods, the therapy comprises a PAR2 antagonist. Exemplary PAR2 antagonists include small molecule inhibitors (e.g., K-12940, K-14585, FSLLRY-NH2 peptide (SEQ ID NO: 30), GB88, AZ3451, and AZ8838), soluble receptors, siRNAs, and anti-PAR2 antibodies (e.g., MAB3949 and Fab3949 ).

In some embodiments of any of the preceding methods, the therapy comprises an IgE antagonist. In some embodiments, the IgE antagonist is an anti-IgE antibody. Any suitable anti-IgE antibody may be used. Exemplary anti-IgE antibodies include omalizumab (XOLAIR®), E26, E27, CGP-5101 (Hi-901), HA, ligelizumab, and talizumab. In some embodiments, the anti-IgE antibody comprises one, two, three, four, five, or all six of the following six HVRs: (a) HVR-H1 containing the amino acid sequence GYSWN (SEQ ID NO: 40); (b) HVR-H2 containing the amino acid sequence SITYDGSTNYNPSVKG (SEQ ID NO: 41); (c) HVR-H3 containing the amino acid sequence GSHYFGHWHFAV (SEQ ID NO: 42); (d) HVR-L1 containing the amino acid sequence RASQSVDYDGDSYMN (SEQ ID NO: 43); (e) HVR-L2 containing the amino acid sequence AASYLES (SEQ ID: 44); and (f) HVR-L3 containing the amino acid sequence QQSHEDPYT (SEQ ID NO: 45). In some embodiments, the anti-IgE antibody comprises (a) a VH domain comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 38; (b) a VL domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 39; or (c) a VH domain as in (a) and a VL domain as in (b). In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 38. In some embodiments, the VL domain contains the amino acid sequence of SEQ ID NO: 39. In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 38 and the VL domain contains the amino acid the sequence of SEQ ID NO: 39. Any of the anti-IgE antibodies described herein can be used in combination with any anti-tryptase antibody described herein, for example, in Section VII below. In specific embodiments, the anti-IgE antibody is omalizumab (XOLAIR®).

In some embodiments of any of the preceding methods, the therapy comprises a T _H 2 pathway inhibitor. In some embodiments, the T _H 2 pathway inhibitor inhibits any of the targets selected from interleukin-2 inducible T cell kinase (ITK), Bruton's tyrosine kinase (BTK), Janus kinase 1 (JAK1) (eg, ruxolitinib, tofacitinib, oclacitinib, baricitinib, filgotinib, gandotinib, lestaurtinib, momelotinib, pacrinitib, upadacitinib, pefitinib, and fedratinib), GATA binding protein 3 (GATA3), IL-9 (eg, MEDI-528), IL-5 (eg, mepolizumab, CAS no. 196078-29-2; resilizumab), IL-13 (eg, IMA-026, IMA-638 (also called anrukinzumab, INN no. 910649-32-0; QAX-576; IL-4/IL-13 decoy), tralokinumab (also called CAT-354, CAS no. 1044515-88-9); AER-001, ABT-308 (also called 13C5.5 humanized antibody)), IL-4 (eg AER-001, IL-4/IL-13 traps), OX40L, TSLP, IL-25, IL-33 and IgE (eg XOLAIR®, QGE-031 and MEDI-4212); and receptors, e.g.: IL-9 receptor, IL-5 receptor (e.g. MEDI-563 (benilizumab, CAS No. 1044511-01-4)), IL-4 receptor alpha (e.g. AMG-317, AIR-645), IL-13 receptor alpha-1 (eg R-1671) and IL-13 receptor alpha-2, OX40, TSLP-R, IL-7R-alpha (co-receptor for TSLP), IL-17RB (receptor for IL-25) , ST2 (IL-33 receptor), CCR3, CCR4, CRTH2 (eg AMG-853, AP768, AP-761, MLN6095, AST129968), FcεRI, FcεRIl/CD23 (IgE receptor), Flap (eg GSK2190915) , Syk kinase (R-343, PF3526299); CCR4 (AMG-761), TLR9 (QAX-935) and a multicytokine inhibitor of CCR3, IL-5, IL-3 and GM-CSF (eg TPI ASM8).

In some embodiments of any of the preceding methods, the asthma is chronic persistent severe asthma with severe worsening symptoms (attacks or exacerbations) that can be life threatening. In some embodiments, the asthma is atopic (also known as allergic) asthma, non-allergic asthma (e.g., often caused by a respiratory viral infection (e.g., influenza, parainfluenza, rhinovirus, human metapneumovirus, and respiratory syncytial virus), or an inhaled irritant (e.g., air pollutants). , smog, diesel particles, volatile chemicals and gases indoors or outdoors, or even cold, dry air).

In some embodiments of any of the preceding methods, the asthma is episodic or exercise-induced asthma due to acute or chronic primary or secondary exposure to "smoke" (typically cigarettes, cigars, or pipes), inhalation, or "vaping" (tobacco, marijuana, or other similar substances), or asthma caused by recent use of aspirin or related NSAIDs. In some embodiments, asthma is mild or corticosteroid-untreated asthma, newly diagnosed and untreated asthma, or not previously requiring chronic use of inhaled topical or systemic steroids to control symptoms (cough, wheezing, dyspnea/dyspnea, or chest pain). In some embodiments, the asthma is chronic, corticosteroid-resistant asthma, corticosteroid-refractory asthma, or asthma not controlled by corticosteroids or other drugs to control chronic asthma.

In some embodiments of any of the preceding methods, the asthma is moderate to severe asthma. In certain embodiments, the asthma is high T _H 2 asthma. In some embodiments, the asthma is severe asthma. In some embodiments, the asthma is atopic asthma, allergic asthma, non-allergic asthma (e.g., due to infection and/or respiratory syncytial virus (RSV)), exercise-induced asthma, aspirin-responsive/aspirin-induced asthma, mild asthma, moderate or severe asthma, corticosteroid-untreated asthma, chronic asthma, corticosteroid-resistant asthma, corticosteroid-refractory asthma, newly diagnosed and untreated asthma, smoking-induced asthma, asthma not controlled by corticosteroids. In some embodiments, the asthma is high T-helper lymphocyte type 2 asthma (TH ₂ ), type 2 asthma ( _TH 2), or type 2 asthma (12). In some embodiments, the asthma is eosinophilic asthma. In some embodiments, the asthma is allergic asthma. In some embodiments, the individual has been determined to be positive for eosinophilic inflammation (EIP). See WO 2015/061441. In some embodiments, the asthma is high periostin asthma (eg, in which the periostin level is at least any of about 20 ng/mL, 25 ng/mL, or 50 ng/mL serum). In some embodiments, the asthma is asthma with high eosinophils (eg, at least any of about 150, 200, 250, 300, 350, 400 eosinophils/mL of blood). In some embodiments, the asthma is low T _H 2 or non- _TH 2 asthma. In some embodiments, the individual has been determined to be eosinophilic inflammation (EIN) negative. See WO 2015/061441. In some embodiments, the asthma is low periostin asthma (eg, less than about 20 ng/ml serum periostin). In some embodiments, the asthma is asthma with a low eosinophil level (eg, less than about 150 eosinophils/µl of blood or less than about 100 eosinophils/µl of blood).

For example, in specific embodiments of any of the preceding methods, the asthma is moderate to severe asthma. In some embodiments, asthma is not controlled by corticosteroids. In some embodiments, the asthma is high T _H 2 asthma or low T _H 2 asthma. In specific embodiments, the asthma is high T _H 2 asthma.

It should be understood that any of the methods of treating a patient described herein, for example, in Section II of the detailed description of the invention above, can be used in embodiments, and the method includes the use of therapy (for example, therapy comprising an agent selected from the group consisting from a tryptase antagonist, an Fc epsilon receptor (FcεR) antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a protease-activated receptor 2 (PAR2) antagonist, an IgE antagonist, and combinations thereof) in a patient. For example, in some embodiments, the method includes administering a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an Fc epsilon receptor (FcεR) antagonist, an IgE ⁺ B cell depleting antibody, a mast cell depleting antibody, or a basophil depleting antibody, a protease-activated receptor 2 (PAR2) antagonist, an IgE antagonist; and combinations thereof. In other embodiments, the implementation of the method includes the use of therapy, including an IgE antagonist.

IV. Detection of nucleic acid polymorphisms

In several embodiments, the methods of treatment and diagnosis provided by the invention include determining the genotype of a patient in one or more polymorphisms, for example, to determine the number of active tryptase alleles in a patient. Detection techniques for evaluating nucleic acids for the presence of a polymorphism (e.g. SNP (e.g. SNP c733 G>A at TPSAB1, CTGCAGGCGGGCGTGGTCAGCTGGG[G/A]CGAGGGCTGTGCCCAGCCCAACCGG (SEQ ID NO: 36) (see also rs145402040) or insertion (e.g. mutation c980_981insC in TPSB2, CACACGGTCACCCTGCCCCCTGCCTCAGAGACCTTCCCCCC C (SEQ ID NO: 37) indicated by bold and underlined nucleotide C)) involve procedures well known in the field of molecular genetics. Many, but not all, methods involve nucleic acid amplification. Illustrative references include guidelines such as Erlich, ed., PCR Technology: Principles and Applications for DNA Amplification, Freeman Press, 1992; Innis et al. eds., PCR Protocols: A Guide to Methods and Applications, Academic Press, 1990; Ausubel, ed., Current Protocols in Molecular Biology, 1994-1999, including additional updates through April 2004; and Sambrook et al. eds., Molecular Cloning, A Laboratory Manual, 2001. General methods for detecting single nucleotide polymorphisms are disclosed in Kwok, ed., Single Nucleotide Polymorphisms: Methods and Protocols, Humana Press, 2003.

Although the methods typically use PCR steps, other amplification protocols may also be used. Suitable amplification methods include ligase chain reaction (see, for example, Wu et al. Genomics 4:560-569, 1988); strand displacement analysis (see, for example, Walker et al. Proc. Natl. Acad. Sci. USA 89:392-396, 1992; US Pat. No. 5,455,166); and several amplification systems based on transcription, including the methods described in US patent No. 5437990; 5409818; and 5399491; transcription-based amplification system (TAS) (Kwoh et al. Proc. Natl. Acad. Sci. USA 86:1173-1177, 1989); and self-sustaining sequence replication (3SR) (Guatelli et al. Proc. Natl. Acad. Sci. USA 87:1874-1878, 1990; WO 1992/08800). Alternatively, methods that amplify the sample to a detectable level can be used, such as Qβ replicase amplification (Kramer et al. Nature 339:401-402, 1989; Lomeli et al. Clin. Chem. 35:1826-1831, 1989) . A review of known amplification methods can be found, for example, in Abramson et al. Curr. Opin. Biotech. 4:41-47, 1993.

Detection of a genotype, haplotype, SNP, microsatellite locus, or other polymorphism of an individual can be performed using oligonucleotide primers and/or probes. Oligonucleotides may be prepared by any suitable method, typically chemical synthesis. Oligonucleotides can be synthesized using commercially available reagents and instruments. Alternatively, they can be purchased from commercial sources. Methods for synthesizing oligonucleotides are well known in the art (see, for example, Narang et al. Meth. Enzymol. 68:90-99, 1979; Brown et al. Meth. Enzymol. 68:109-151, 1979; Beaucage et al. Tetra Lett 22:1859-1862, 1981 and the solid phase method described in US Patent No. 4,458,066). In addition, modifications of the synthesis methods described above can be used to influence the behavior of the enzyme towards synthesized oligonucleotides as desired. For example, incorporation of modified phosphodiester linkages (eg, phosphorothioate, methylphosphonates, phosphoamidate, or boranophosphate) or linkages other than a phosphorous acid derivative into the oligonucleotide can be used to prevent cleavage at the selected site. In addition, the use of 2'-amino-modified sugars promotes substitution compared to cleavage of the oligonucleotide upon hybridization with a nucleic acid that is also a template for the synthesis of a new nucleic acid strand.

The genotype of an individual (eg, a patient with a mast cell-mediated inflammatory disease (eg, asthma)) can be determined using many detection methods that are well known in the art. Most assays involve one of several common protocols: sequencing, hybridization using allele-specific oligonucleotides, primer extension, allele-specific ligation, or electrophoretic separation methods such as single strand conformational polymorphism (SSCP) and heteroduplex analysis. Illustrative assays include 5'-nuclease assay, template-driven incorporation of stained terminators, allele-specific oligonucleotide assays by molecular beacon analysis, single base chain extension assay, and SNP evaluation by real-time pyrophosphate sequencing. Analysis of the amplified sequences can be performed using a variety of techniques such as microarray technology, fluorescence polarization assays, and time-of-flight mass spectrometry with laser ionization and liquid matrix desorption (MALDI-TOF). Two methods that can also be used are assays based on invasive cleavage with Flap nucleases and ring-closing probe methodology.

Determination of the presence or absence of a particular allele is usually carried out by analyzing a nucleic acid sample obtained from the individual to be analyzed. Often, a nucleic acid sample contains genomic DNA. Genomic DNA is usually obtained from blood samples, but can also be obtained from other cells or tissues.

It is also possible to analyze RNA samples for the presence of polymorphic alleles. For example, mRNA can be used to determine an individual's genotype at one or more polymorphic sites. In this case, the nucleic acid sample is obtained from cells in which the target nucleic acid is expressed, such as type 2 T helper cells (Th2) and mast cells. Such analysis can be performed by first reverse transcription of the target RNA using, for example, viral reverse transcriptase, and then amplification of the resulting cDNA; or using a combined high temperature reverse transcription polymerase chain reaction (RT-PCR) as described in US Pat. No. 5,310,652; 5322770; 5561058; 5641864; and 5693517.

The sample may be taken from a patient who is suspected of having a mast cell-mediated inflammatory disease or who has been diagnosed with a mast cell-mediated disease and therefore is likely to need attraction, or from a normal person who is not suspected of having any disorder. Patient samples, such as samples containing cells or nucleic acids produced by these cells, can be used to determine genotypes in the methods of this invention. Body fluids or secretions used as samples in this invention include, for example, blood, urine, saliva, stool, pleural fluid, lymphatic fluid, sputum, BAL, mucosal fluid (MLF) (for example, MLF obtained by nasosorption or bronchosorption), ascites, prostate secretion, cerebrospinal fluid (CSF), or any other body secretion or derivative thereof. The word blood refers to whole blood, plasma, serum, or any blood derivative. The nucleic acid sample for use in the methods described herein can be obtained from any cell type or tissue of a subject. For example, a subject's body fluid (eg, blood) can be obtained using known methods. Alternatively, nucleic acid tests can be performed on dry samples (eg, hair or skin).

The sample may be frozen, fresh, fixed (eg formalin fixed), centrifuged and/or embedded (eg embedded in paraffin), etc. The cell sample may, of course, be subjected to various well-known post-collection preparation and storage methods (e.g., nucleic acid and/or protein extraction, fixation, storage, freezing, ultrafiltration, concentration, evaporation, centrifugation, etc.) prior to genotyping. in the sample. Similarly, biopsies may also be subjected to post-collection preparation and storage methods, such as fixation.

Frequently used methodologies for analyzing nucleic acid samples to detect the presence of polymorphisms such as SNPs or inserts that are useful in the present invention are briefly described below. However, any method known in the art can be used in the invention to detect the presence of single nucleotide substitutions.

A. DNA sequencing and single base chain extension

Polymorphisms, such as SNPs or inserts, can be detected by direct sequencing. Methods include, for example, dideoxy sequencing methods (eg, Sanger sequencing) and other methods such as the Maxam-Gilbert method (see, for example, Sambrook and Russell, supra). In some embodiments, the sequencing approach is Sanger sequencing.

The sequencing approach may be a massively parallel sequencing approach (eg, ILLUMINA® sequencing). Other detection methods include PYROSEQUENCING™ oligonucleotide length products. Such methods often use amplification methods such as PCR. For example, in pyrosequencing, a sequencing primer hybridizes to a single-stranded, PCR-amplified DNA template and incubated with enzymes, DNA polymerase, ATP sulfurylase, luciferase, and apyrase, as well as the substrates adenosine 5'-phosphosulfate (APS) and luciferin. The first of four deoxynucleotide triphosphates (dNTPs) is added to the reaction. DNA polymerase catalyzes the incorporation of deoxynucleotide triphosphate into the DNA strand if it is complementary to a base in the template strand. Each inclusion event is accompanied by the release of pyrophosphate (PP) in an amount equimolar to the amount of the included nucleotide. ATP sulfurylase quantitatively converts PP to ATP in the presence of APS. This ATP mediates the luciferase-mediated conversion of luciferin to oxyluciferin, which generates visible light in amounts that are proportional to the amount of ATP. The light generated in the reaction catalyzed by luciferase is detected by a charge-coupled device (CCD) camera and viewed as a peak in PYROGRAM™. Each light signal is proportional to the number of nucleotides included. Apyrase, a nucleotide degrading enzyme, continuously cleaves unincorporated dNTPs and excess ATP. When degradation is complete, another dNTP is added.

In some embodiments, RNA sequencing (RNA sequencing), also referred to as full transcriptome shotgun sequencing (WTSS), can be used to detect polymorphisms (eg, SNPs or inserts). See, for example, Wang et al. Nature Reviews Genetics 10:57-63, 2009.

Another similar method for characterizing SNPs does not require the use of full PCR, but typically only uses primer extension per fluorescently labeled dideoxyribonucleic acid (ddNTP) molecule that is complementary to the nucleotide to be tested. A nucleotide at a polymorphic site can be identified by detecting a primer that is one base long and fluorescently labeled (eg, Kobayashi et al, Mol. Cell. Probes, 9:175-182, 1995).

b. Allele-specific hybridization

This method, also commonly referred to as allele-specific oligonucleotide hybridization (ASO) (e.g., Stoneking et al. Am. J. Hum. Genet. 48:70-382, 1991; Saiki et al. Nature 324, 163-166, 1986; EP 235726; and WO 1989/11548) is based on distinguishing two DNA molecules that differ in one base by hybridizing an oligonucleotide probe specific for one of the variants with an amplified product resulting from the amplification of a nucleic acid sample. In this method, as a rule, short oligonucleotides are used, for example, 15-20 bases in length. Probes are designed for differential hybridization of one variant with another. Principles and guidance for designing such a probe are available in the art. The hybridization conditions must be sufficiently stringent that there is a significant difference in the intensity of hybridization between the alleles and that a substantially binary response is obtained in which the probe hybridizes to only one of the alleles. Some probes are designed to hybridize to a target DNA segment such that the polymorphic site aligns with the central position of the probe (e.g., in a 15 base oligo at position 7; in a 16 base oligo at position 8 or 9), but such a construct is not necessary. .

The amount and/or presence of an allele can be determined by measuring the amount of an allele-specific oligonucleotide that hybridizes with a sample. Typically, the oligonucleotide is labeled with a label, such as a fluorescent label. For example, an allele-specific oligonucleotide is hybridized to immobilized oligonucleotides representing SNP sequences. After stringent hybridization and washing conditions, the fluorescence intensity is measured for each SNP oligonucleotide.

In one embodiment, a nucleotide present at a polymorphic site is identified by hybridization under sequence-specific hybridization conditions with an oligonucleotide probe or primer that is exactly complementary to one of the polymorphic alleles in the region encompassing that polymorphic site. The probe or primer that hybridizes the sequence and the sequence-specific hybridization conditions are chosen such that a single mismatch in the polymorphic site destabilizes the hybridization duplex sufficiently so that it is not effectively formed. Thus, under sequence-specific hybridization conditions, stable duplexes will only form between a probe or primer and an exactly complementary allelic sequence. Thus, oligonucleotides of about 10 to about 35 nucleotides in length, typically about 15 to about 35 nucleotides in length, that are exactly complementary to the allelic sequence in the region that spans the polymorphic site are within the scope of the invention.

In an alternative embodiment, a nucleotide present at a polymorphic site is identified by hybridization under sufficiently stringent hybridization conditions to an oligonucleotide that is substantially complementary to one of the SNP alleles in the region spanning the polymorphic site and exactly complementary to the allele at the polymorphic site. Since the mismatches that occur at non-polymorphic sites are mismatches with both allele sequences, the difference in the number of mismatches in a duplex formed with the target allele sequence and in a duplex formed with the corresponding non-target allele sequence is the same as when an oligonucleotide is used, exactly complementary to the target allele sequence. In this embodiment, the hybridization conditions are loosened sufficiently to allow the formation of stable duplexes with the target sequence while maintaining sufficient stringency to prevent the formation of stable duplexes with non-target sequences. Under such fairly stringent hybridization conditions, stable duplexes will form only between the probe or primer and the target allele. Thus, oligonucleotides are about 10 to about 35 nucleotides in length, typically about 15 to about 35 nucleotides in length, that are substantially complementary to the allele sequence at the region that spans the polymorphic site, and are exactly complementary to the allele sequence at the polymorphic site, are within the scope of the invention.

The use of substantially, rather than exactly complementary, oligonucleotides may be desirable in assay formats where optimization of hybridization conditions is limited. For example, in a typical multi-target immobilized oligonucleotide assay format, the probes or primers for each target are immobilized on a single solid support. Hybridizations are carried out simultaneously by bringing the solid support into contact with a solution containing the target DNA. Since all hybridizations are carried out under identical conditions, hybridization conditions cannot be optimized separately for each probe or primer. Inclusion of mismatches in a probe or primer can be used to control duplex stability when the assay format does not allow for control of hybridization conditions. The effect of a particular mismatch introduced on duplex stability is well known, and duplex stability can generally be evaluated and empirically determined as described above. Suitable hybridization conditions, which depend on the exact size and sequence of the probe or primer, can be selected empirically using the guidance provided herein and well known in the art. The use of oligonucleotide probes or primers to detect single base pair differences in sequence is described, for example, in Conner et al. Proc. Natl. Acad. sci. USA 80:278-282, 1983, and US Pat. Nos. 5,468,613 and 5,604,099.

The proportional change in stability between a perfect match hybridization duplex and a single base mismatch hybridization duplex depends on the length of the hybridized oligonucleotides. Duplexes formed with shorter probe sequences destabilize proportionately more due to the presence of mismatches. Oligonucleotides from about 15 to about 35 nucleotides in length often use sequence-specific detection. In addition, since the ends of the hybridized oligonucleotide undergo continuous random dissociation and reannealing due to thermal energy, a mismatch at both ends destabilizes the hybridization duplex less than a mismatch occurring within the hybridization duplex. To recognize a single base pair change in the target sequence, a probe sequence is selected that hybridizes to the target sequence such that a polymorphic site occurs within the interior of the probe.

The above criteria for selecting a probe sequence that hybridizes to a particular allele apply to the hybridization region of the probe, that is, that part of the probe that is involved in hybridization to the target sequence. The probe may be coupled to an additional nucleic acid sequence, such as a poly-T tail used to immobilize the probe, without significantly altering the hybridization characteristics of the probe. One skilled in the art will appreciate that, for use in these methods, a probe bound to an additional nucleic acid sequence that is not complementary to the target sequence and thus does not participate in hybridization is essentially equivalent to an unbound probe.

Suitable assay formats for detecting hybrids formed between probes and target nucleic acid sequences in a sample are known in the art and include immobilized target assays (dot blot) and immobilized probe assays (reverse dot blot or linear blot). ). Dot blot and reverse dot blot formats are described in US Pat. No. 5,310,893; 5451512; 5468613; and 5604099.

In the dot blot format, the amplified target DNA is immobilized on a solid support such as a nylon membrane. The membrane-target complex is incubated with the labeled probe under suitable hybridization conditions, the unhybridized probe is removed by washing under suitable stringent conditions, and the membrane is examined for the presence of bound probe.

In a reverse dot blot (or linear blot) format, the probes are immobilized on a solid support such as a nylon membrane or a microtiter plate. The target DNA is usually labeled during amplification by incorporating labeled primers. One or both primers may be labeled. The membrane-probe complex is incubated with labeled amplified target DNA under appropriate hybridization conditions, unhybridized target DNA is removed by washing under appropriate stringent conditions, and the membrane is examined for bound target DNA. This example describes a discovery analysis based on an inverse linear blot.

An allele-specific probe specific for one of the polymorphisms is often used in conjunction with an allele-specific probe for another polymorphism. In some embodiments, the probes are immobilized on a solid support and the target sequence is analyzed in the individual using both probes simultaneously. Examples of nucleic acid chips are described in WO 95/11995. The same chip or a different chip can be used to analyze the characterized polymorphisms. WO 95/11995 also describes sub-arrays that are optimized for detecting variant forms of a pre-characterized polymorphism. Such a subchip can be used to detect the presence of the polymorphisms described herein.

With. Allele specific primers

Polymorphisms such as SNPs or inserts are also typically detected using allele-specific amplification or primer extension techniques. These reactions typically involve the use of primers that are designed to specifically target the polymorphism via a mismatch at the 3' end of the primer. The presence of a mismatch affects the ability of the polymerase to extend the primer when the polymerase lacks error correcting activity. For example, to detect an allele sequence using an allele-specific amplification or primer extension method, a primer is designed that is complementary to one allele of the polymorphism such that the 3'-terminal nucleotide hybridizes at the polymorphic position. The presence of a particular allele can be determined by the ability of the primer to initiate extension. If the 3' end does not match, elongation is difficult.

In some embodiments, the primer is used together with a second primer in an amplification reaction. The second primer hybridizes at a site not associated with the polymorphic position. Amplification occurs from two primers resulting in a detectable product indicating the presence of a particular allelic form. Methods based on allele-specific amplification or primer extension are described, for example, in WO 93/22456 and US patent No. 5137806; 5595890; 5639611; and 4851331.

Using genotyping based on allele-specific amplification, the identification of alleles only requires detection of the presence or absence of amplified target sequences. Methods for detecting amplified target sequences are well known in the art. For example, the gel electrophoresis and probe hybridization assays described are often used to detect the presence of nucleic acids.

In an alternative probeless method, the amplified nucleic acid is detected by monitoring the increase in the total amount of double-stranded DNA in the reaction mixture, as described, for example, in US patent No. 5994056; and European Patent Publication Nos. 487218 and 512334. Detection of double-stranded target DNA depends on the increased fluorescence that various DNA-binding dyes, such as SYBR Green, exhibit when bound to double-stranded DNA.

As one skilled in the art will appreciate, allele-specific amplification methods can be performed in reactions that use multiple allele-specific primers to target specific alleles. Primers for such multiplex applications are usually labeled with recognizable labels or chosen so that the amplification products derived from the alleles vary in size. Thus, for example, both alleles in one sample can be identified using a single amplification by gel analysis of the amplification product.

As with allele-specific probes, an allele-specific oligonucleotide primer may be exactly complementary to one of the polymorphic alleles in the hybridization region, or may have some mismatches at positions other than the 3'-terminus of the oligonucleotide such that mismatches occur at non-polymorphic sites at both allele sequences.

d. Detectable Probes

i) 5'-nuclease assay probes

Genotyping can also be done using "TAQMAN®" or "5'-nuclease assay" as described in US Pat. No. 5,210,015; 5487972; and 5804375; and Holland et al. Proc. Natl. Acad. sci. USA 88:7276-7280, 1988. In the TAQMAN® assay, labeled detector probes that hybridize in the amplified region are added during the amplification reaction. The probes are modified so that they do not act as primers for DNA synthesis. Amplification is carried out using DNA polymerase with 5'-3'-exonuclease activity. During each step of the amplification synthesis, any probe that hybridizes to the target nucleic acid downstream of the primer to be extended is degraded by the 5'-3' exonuclease activity of the DNA polymerase. Thus, the synthesis of a new target strand also results in degradation of the probe, and the accumulation of the degradation product provides a measure of control over the synthesis of target sequences.

The hybridization probe may be an allele-specific probe that differentiates SNP alleles. Alternatively, the method can be carried out using an allele-specific primer and a labeled probe that binds to the amplified product.

In the 5'-nuclease assay, any method suitable for detecting the degradation product can be used. Often the detector probe is labeled with two fluorescent dyes, one of which is capable of quenching the fluorescence of the other dye. Dyes are attached to the probe, usually one is attached to the 5' end and the other is attached to the internal site, so that quenching occurs when the probe is in an unhybridized state, and such that cleavage of the probe by DNA polymerase with a 5'-3' exonuclease activity occurs between the two dyes. Amplification results in splitting of the probe between dyes, with a concomitant elimination of quenching and an increase in fluorescence observed from the originally quenched dye. The accumulation of the degradation product is monitored by measuring the increase in the fluorescence response. US Pat. Nos. 5,491,063 and 5,571,673 describe alternative methods for detecting probe degradation that occurs concurrently with amplification.

ii) Secondary structure of probes

Probes detected by secondary structural change are also suitable for the detection of polymorphisms, including SNPs. Examples of the secondary or loop-on-stem structure of probes include molecular beacons or SCORPION® primer/probes. Molecular beacon probes are single-stranded oligonucleic acid probes that can form a hairpin structure in which the fluorophore and quencher are typically located at opposite ends of the oligonucleotide. At both ends of the probe, short complementary sequences allow the formation of an intramolecular stem that allows the fluorophore and quencher to be in close proximity. The loop portion of the molecular beacon is complementary to the target nucleic acid of interest. Binding of this probe to the target nucleic acid of interest forms a hybrid that retracts the stem. This causes a conformational change that moves the fluorophore and quencher apart and results in a stronger fluorescent signal. However, molecular beacon probes are very sensitive to small sequence changes in the target probe (see, for example, Tyagi et al. Nature Biotech. 14:303-308, 1996; Tyagi et al. Nature Biotech. 16:49-53, 1998; Piatek et al Nature Biotech 16: 359-363, 1998; Marras et al Genetic Analysis: Biomolecular Engineering 14:151-156, 1999; Tapp et al, BioTechniques 28: 732-738, 2000). The SCORPION® primer/probe includes a stem-loop probe covalently bonded to the primer.

e. Electrophoresis

Amplification products obtained using the polymerase chain reaction can be analyzed using denaturing gradient gel electrophoresis. Different alleles can be identified based on different sequence dependent melting and electrophoretic migration properties of DNA in solution (see, for example, Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, W. H. Freeman and Co., 1992).

Discrimination of polymorphisms of microsatellites can be carried out using capillary electrophoresis. Capillary electrophoresis makes it easy to identify the number of repeats in a particular microsatellite allele. The use of capillary electrophoresis for the analysis of DNA polymorphisms is well known to those skilled in the art (see e.g. Szantai et al. J Chromatogr A. 1079(1-2):41-9, 2005; Bjorheim et al. Electrophoresis 26(13) :2520-30, 2005 and Mitchelson, Mol. Biotechnol. 24(1):41-68, 2003).

The identity of an allelic variant can also be obtained by analyzing the movement of a nucleic acid containing a polymorphic region in polyacrylamide gels containing a denaturant gradient, which is analyzed using denaturing gradient gel electrophoresis (DGGE) (see, for example, Myers et al. Nature 313: 495-498, 1985). When DGGE is used as an assay method, the DNA will be modified to ensure that it is not completely denatured, for example by adding an approximately 40 bp GC clamp. GC-rich DNA with a high melting point by PCR. In a further embodiment, instead of a denaturing agent gradient, a temperature gradient is used to identify mobility differences between control DNA and sample DNA (see, for example, Rosenbaum et al. Biophys. Chem. 265:1275, 1987).

f. Analysis of single-strand conformational polymorphism

Alleles of target sequences can be differentiated using single strand conformational polymorphism analysis, which identifies base differences by altering the electrophoretic migration of single strand PCR products, as described, for example, in Orita et al. Proc. Nat. Acad. sci. 86, 2766-2770, 1989; Cotton Mutat. Res. 285:125-144, 1993; and Hayashi Genet. Anal. Tech. Appl. 9:73-79, 1992. Amplified PCR products can be prepared as described above and heated or otherwise denatured to form single stranded amplification products. Single-stranded nucleic acids can re-form or form secondary structures that depend in part on the base sequence. Different electrophoretic mobility of single-stranded amplification products may be due to the difference in base sequences between the target alleles, and the resulting change in electrophoretic mobility allows even a single base change to be detected. DNA fragments can be labeled or detected using labeled probes. The sensitivity of the assay can be improved by using RNA (rather than DNA) in which the secondary structure is more sensitive to sequence change. In another preferred embodiment, this method uses heteroduplex analysis to separate double-stranded heteroduplex molecules based on changes in electrophoretic mobility (see, for example, Keen et al. Trends Genet. 7:5-10, 1991).

Methods for detecting SNPs often use labeled oligonucleotides. Oligonucleotides can be labeled by incorporating a label determined by a spectroscopic, photochemical, biochemical, immunochemical, or chemical method. Useful labels include fluorescent dyes, radioactive labels such as ³² R, electron dense reagents, enzymes such as peroxidase or alkaline phosphatase, biotin or haptens, and proteins for which antisera or monoclonal antibodies are available. Labeling techniques are well known in the art (see, for example, Current Protocols in Molecular Biology, supra; Sambrook et al., supra).

g. Additional methods for determining the genotype of an individual in polymorphisms

DNA microarray technology can be used, such as DNA chip instruments, high density microarrays for high throughput screening methods, and low density microarrays. Methods for making microarrays are known in the art and include various technologies and processes for depositing or applying spots on inkjet and microjet devices, photolithographic processes for in situ or on-chip synthesis of oligonucleotides, and methods for producing DNA probes using electrofocusing. DNA microarray hybridization techniques have been successfully applied in the fields of gene expression analysis and genotyping for point mutations, single nucleotide polymorphisms (SNPs), and short tandem repeats (STRs). Additional methods include interfering RNA microarrays and combinations of microarrays and other methods such as laser capture microdissection (LCM), comparative genomic hybridization (CGH), matrix CGH, and chromatin immunoprecipitation (ChIP). See, for example, He et al. Adv. Exp. Med. Biol. 593:117-133, 2007 and Heller Annu. Rev. Biomed. Eng. 4:129-153, 2002.

In some embodiments, protection against cleaving agents (such as nuclease, hydroxylamine, or osmium tetroxide and with piperidine) can be used to detect base mismatches in RNA/RNA, DNA/DNA, or RNA/DNA heteroduplexes (see, e.g., Myers et al. Science 230:1242, 1985). In general, the "mismatch cleavage" method begins by providing heteroduplexes formed by the hybridization of a control nucleic acid that is optionally labeled, such as RNA or DNA containing the nucleotide sequence of an allelic variant of a gene, with a sample nucleic acid, such as RNA or DNA obtained from a tissue sample. Double-stranded duplexes are treated with an agent that cleaves single-stranded regions of the duplex, such as duplexes formed based on base pair mismatches between the control strand and the sample strand. For example, RNA/DNA duplexes can be treated with RNase, and DNA/DNA hybrids can be treated with S1 nuclease to enzymatically cleave mismatched regions. Alternatively, DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and piperidine to cleave mismatched regions. After cleavage of the mismatched regions, the resulting material is then size-separated on denaturing polyacrylamide gels to determine if the control nucleic acid and nucleic acid from the sample have the same nucleotide sequence or at which nucleotides they differ. See, for example, US patent No. 6455249, Cotton et al. Proc. Natl. Acad. sci. USA 85:4397-4401, 1988; Saleeba et al. Meth. Enzymol. 217:286-295, 1992.

In some cases, the presence of a specific allele in a subject's DNA can be shown using restriction analysis. For example, a specific nucleotide polymorphism may result in a nucleotide sequence containing a restriction site that is not present in the nucleotide sequence of another allelic variant.

In another embodiment, the identification of the allelic variant is carried out using oligonucleotide probe ligation (OLA), as described, for example, in US patent No. 4998617 and Laridegren et al. Science 241:1077-1080, 1988. The OLA protocol uses two oligonucleotides that are designed to hybridize to adjacent sequences on the same target strand. One of the oligonucleotides is linked to a separating marker, such as biotinylation, and the other is detectably labeled. If the exact complementary sequence is found in the target molecule, the oligonucleotides hybridize so that their ends are adjacent to each other and create a substrate for ligation. Ligation then allows the labeled oligonucleotide to be isolated using avidin or another biotin ligand. Nucleic acid detection assays that combine the properties of PCR and OLA are also known in the art (see, for example, Nickerson et al. Proc. Natl. Acad. Sci. USA 87:8923-8927, 1990). In this method, PCR is used to exponentially amplify target DNA, which is then detected using OLA.

A single base polymorphism can be detected using a specific exonuclease resistance nucleotide as described, for example, in US Patent No. No. 4,656,127 In this method, a primer that is complementary to the allele sequence immediately 3' to the polymorphic site is allowed to hybridize to a target molecule derived from a particular animal or human. If the polymorphic site in the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant derivative of the nucleotide present, then that derivative will be included at the end of the hybridized primer. This inclusion renders the primer resistant to exonuclease and thus allows it to be detected. Since the identity of the exonuclease-resistant derivative of the pattern is known, finding that the primer has become exonuclease-resistant demonstrates that the nucleotide present in the polymorphic site of the target molecule was complementary to the derivative of the nucleotide used in the reaction. The advantage of this method is that it does not require a large amount of extraneous sequence data to be determined.

The solution based method can also be used to determine the nucleotide identity of a polymorphic site (see, for example, WO 1991/02087). As stated above, a primer is used that is complementary to allele sequences immediately 3' to the polymorphic site. The method determines the nucleotide identity of this site using labeled dideoxynucleotide derivatives that, being complementary to the nucleotide of the polymorphic site, will be included at the end of the primer.

An alternative method that can be used is described in WO 92/15712. This method uses a mixture of labeled terminators and a primer that is complementary to the sequence located 3' to the polymorphic site. The labeled terminator, which is included in this way, is determined by the nucleotide present in the polymorphic site of the evaluated target molecule, and is complementary to it. The method is typically a heterogeneous phase assay in which the primer or target molecule is immobilized on a solid phase.

Many other procedures for primer-directed incorporation of nucleotides have been described for the analysis of polymorphic sites in DNA (Komher et al. Nucl. Acids. Res. 17:7779-7784, 1989; Sokolov Nucl. Acids Res. 18:3671, 1990; Syvanen et al. Genomics 8:684-692, 1990; Kuppuswamy et al. Proc. Natl. Acad. Sci. USA 88:1143-1147, 1991; Prezant et al. Hum. Mutat. 1:159-164, 1992; Ugozzoli et al. GATA 9:107-112, 1992; Nyren et al Anal Biochem 208:171-175, 1993). All of these methods rely on the incorporation of labeled deoxynucleotides to differentiate bases at the polymorphic site.

V. Determination of the expression level of biomarkers

Therapeutic and diagnostic methods of the invention may include determining the level of expression of one or more biomarkers (eg, tryptase). Determination of the level of biomarkers can be performed by any of the methods known in the art or described below.

Expression of the biomarkers described herein (eg, tryptase) can be detected using any method known in the art. For example, mammalian tissue or cell samples can be easily analyzed, for example, for mRNA or DNA of a biomarker of interest, using Northern dot, dot blot, or PCR, array hybridization, RNase protection, or DNA microarray analysis. with SNPs that are commercially available, including images of DNA microarrays. For example, real-time PCR (RT-PCR) assays, such as quantitative PCR assays, are well known in the art. In an exemplary embodiment of the invention, a method for detecting mRNA of a biomarker of interest (eg, tryptase) in a biological sample comprises obtaining cDNA from the sample by reverse transcription using at least one primer; amplifying the cDNA thus obtained; and detecting the presence of the amplified cDNA. In addition, such methods may include one or more steps that allow the levels of mRNA in a biological sample to be determined (eg, by simultaneously examining the levels of a comparative control mRNA sequence of a housekeeping gene, eg, a member of the actin family). Optionally, the sequence of the amplified cDNA can be determined.

Other methods that can be used to detect nucleic acids for use in the invention include high-throughput analysis of RNA sequence expression, including RNA-based genomic analysis, such as, for example, RNA sequencing.

In one specific embodiment, the expression of a biomarker (eg, tryptase) can be performed using RT-PCR technology. Probes used for PCR may be labeled with a detectable marker such as, for example, a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelate, or an enzyme. Such probes and primers can be used to detect the presence of an expressed biomarker in a sample. As one of skill in the art will appreciate, a wide variety of primers and probes can be derived from the sequences provided herein and effectively used for amplification, cloning, and/or determination of the presence and/or levels of a biomarker.

Other methods include protocols that examine or detect mRNA for a biomarker (eg, tryptase) in a tissue or cell sample using microarray technology. Using nucleic acid microarrays, mRNA test and control samples from test and control tissue samples are reverse transcribed and labeled to obtain cDNA probes. The probes are then hybridized to a nucleic acid chip immobilized on a solid support. The chip is configured so that the sequence and position of each chip element is known. For example, a selection of genes that can potentially be expressed in certain disease states can be placed on a solid support. Hybridization of a labeled probe with a particular chip element indicates that the sample from which the probe was derived expresses that gene. Analysis of differential gene expression in affected tissue can provide valuable information. Microarray technology uses nucleic acid hybridization techniques and computational technology to assess the mRNA expression profile of thousands of genes in a single experiment (see, for example, WO 2001/75166). See, for example, US Pat. Biotech. 14:1675-1680, 1996; and Cheung et al. Nat. Genet. 21(Suppl):15-19, 1999 to discuss chip fabrication.

In addition, the microarray DNA profiling and detection method described in EP 1753878 can be used. This method quickly identifies and differentiates different DNA sequences using short tandem repeat (STR) analysis and DNA microarrays. In one embodiment, the labeled target STR sequence is hybridized to a DNA microarray carrying complementary probes. These probes vary in length to cover the range of possible STRs. Labeled single-stranded regions of DNA hybrids are selectively removed from the surface of the microarray using enzymatic cleavage after hybridization. The number of repeats in the unknown target is determined based on the structure of the target DNA, which remains hybridized to the microarray.

One example of a microarray system is the Affymetrix GENECHIP® system, which is commercially available and contains chips made by direct synthesis of oligonucleotides on a glass surface. Other systems known to the person skilled in the art may also be used.

There are many references to provide guidance on the use of the above methods (Kohler et al. Hybridoma Techniques, Cold Spring Harbor Laboratory, 1980; Tijssen, Practice and Theory of Enzyme Immunoassays, Elsevier, 1985; Campbell, Monoclonal Antibody Technology, Elsevier, 1984; Hurrell, Monoclonal Hybridoma Antibodies: Techniques and Applications, CRC Press, 1982; and Zola, Monoclonal Antibodies: A Manual of Techniques, pp. 147-158, CRC Press, Inc., 1987). Northern blot analysis is a common technique well known in the art and is described, for example, in Sambrook et al., supra. Typical protocols for assessing the status of genes and gene products can be found, for example, in Ausubel et al., supra.

With regard to the detection of protein biomarkers, various protein assays are available, including, for example, antibody-based methods, as well as mass spectroscopy and other similar methods known in the art. For example, in the case of antibody-based methods, the sample can be contacted with an antibody specific for a biomarker (eg, tryptase) under conditions sufficient to form an antibody-biomarker complex, and then the complex is detected. Detection of the presence of a protein biomarker can be performed by a number of methods such as Western blot (with or without immunoprecipitation), 2-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), immunoprecipitation, fluorescence-activated cell sorting (FACS™) , flow cytometry and enzyme immunoassay (ELISA) to analyze a wide range of tissues and samples, including plasma or serum. A wide range of immunoassay techniques are available using this assay format, see, for example, US Pat. Nos. 4,016,043; 4424279; and 4,018,653. These include both single-stage and two-stage or sandwich assays of non-competitive types, as well as conventional competitive binding assays. These assays also include direct binding of the labeled antibody to the target biomarker.

Sandwich assays are among the most useful and commonly used assays. There are a number of variations on the sandwich assay, all of which are covered by this invention. Briefly, in a typical direct assay, an unlabeled antibody is immobilized on a solid support and the test sample is brought into contact with the bound molecule. After a suitable incubation period, for a period of time sufficient for the formation of an antibody-antigen complex, then a second antigen-specific antibody labeled with a reporter molecule capable of generating a detectable signal is added and incubated, allowing time sufficient for the formation of another antibody-antigen-labeled complex. antibody. Any unreacted material is washed away and the presence of antigen is determined by observing the signal generated by the reporter molecule. Results can either be qualitative, by simply observing a visible signal, or can be quantified by comparison with a control sample containing known amounts of the biomarker.

Direct assay options include simultaneous assays in which both the sample and the labeled antibody are added simultaneously to the bound antibody. These methods are well known to those skilled in the art, including any minor changes that will be apparent. In a typical direct sandwich assay, the first antibody having specificity for a biomarker is either covalently or passively attached to a solid surface. The solid surface is typically glass or polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. Solid supports may be in the form of tubes, beads, discs or microplates, or any other surface suitable for immunoassay. Coupling processes are well known in the art and typically consist of cross-linking, covalent bonding or physical adsorption, the polymer-antibody complex is washed in preparation for sample testing. An aliquot of the test sample is then added to the solid phase complex and incubated for a sufficient period of time (e.g. 2-40 minutes or overnight if more convenient) and under suitable conditions (e.g. room temperature to 40°C, e.g. 25 °C up to and including 32°C) to allow binding of any subunit present in the antibody. After an incubation period, the solid phase with the antibody subunit is washed, dried, and incubated with a second antibody specific for the biomarker portion. The second antibody is linked to a reporter molecule, which is used to determine the binding of the second antibody to a molecular marker.

An alternative method involves immobilizing the target biomarkers in the sample and then exposing the immobilized target to a specific antibody, which may or may not be labeled with a reporter molecule. Depending on the amount of target and the signal strength of the reporter molecule, the bound target can be detected by direct labeling with the antibody. Alternatively, a second labeled antibody specific for the first antibody is subjected to a target-first antibody complex to form a triple target-first antibody-second antibody complex. The complex is detected by the signal emitted by the reporter molecule. By “reporter molecule,” as used herein, is meant a molecule that, by its chemical nature, provides an analytically identifiable signal that allows detection of an antigen-bound antibody. The most commonly used reporter molecules in this type of assay are either enzymes, fluorophores, or molecules containing radionuclides (i.e., radioisotopes) and chemiluminescent molecules.

In the case of an enzyme immunoassay (EIA), the enzyme is conjugated to a second antibody, usually with glutaraldehyde or periodate. However, as will be readily appreciated, there is a wide variety of different conjugation methods that are readily available to those skilled in the art. Examples of commonly used enzymes suitable for the methods of this invention include horseradish peroxidase, glucose oxidase, beta-galactosidase and alkaline phosphatase. Substrates for use with specific enzymes are generally chosen to produce a detectable color change upon hydrolysis of the respective enzyme. It is also possible to use fluorogenic substrates which produce a fluorescent product rather than the chromogenic substrates mentioned above. In all cases, the enzyme labeled antibody is added to the first antibody-molecular marker complex, allowed to bind, and then the excess reagent is washed off. A solution containing the appropriate substrate is then added to the antibody-antigen-antibody complex. The substrate will react with the enzyme associated with the second antibody, producing a qualitative visual signal that can be further quantified, typically spectrophotometrically, to determine the amount of the biomarker (eg, tryptase) that was present in the sample. Alternatively, fluorescent compounds such as fluorescein and rhodamine can be chemically linked to antibodies without altering their binding ability. When activated by light of a certain wavelength, a fluorochrome-labeled antibody absorbs light energy, inducing a state of excitability in the molecule, followed by the emission of light of a characteristic color, visually determined using a light microscope. As in the EIA, the fluorescently labeled antibody can bind to the first antibody-molecular marker complex. After washing off the unbound reagent, the remaining ternary complex is then exposed to light of the appropriate wavelength, the observed fluorescence indicating the presence of a molecular marker of interest. Immunofluorescence and EIA techniques are very well known in the art. However, other reporter molecules such as radioisotope, chemiluminescent or bioluminescent molecules can also be used.

In some embodiments, the level of active tryptase in a sample (e.g., blood (e.g., serum or plasma), BAL, or MLF) can be determined using an active tryptase ELISA, such as as described in Example 6 of the U.S. Provisional Application No. 62/457722. The concentration of active human tryptase (tetramer) can be determined using ELISA analysis. Briefly, a monoclonal antibody clone recognizing human tryptase is used as the capture antibody (eg, the B12 monoclonal antibody described in Fukuoka et al. above, or the E88AS antibody clone). You can use any suitable antibody that binds human tryptase. Recombinant active human beta-1-tryptase is purified and used as starting material for the preparation of assay standards. Assay standards, controls, and diluted samples were incubated with 500 µg/mL soybean trypsin inhibitor (SBTI; Sigma cat#10109886001) for 10 minutes and then labeled with an activity-based probe (ABP) (G0353816) for 1 hour. A small molecule tryptase inhibitor (G02849855) is added over 20 minutes to stop ABP labeling. Depending on the capture antibody used in the assay, this mixture can be incubated with an anti-human tryptase antibody that is capable of dissociating the tryptase tetramer (e.g., hu31A.v11 or B12) before being added to the capture antibody ELISA plate for 1 hour, washed 1x phosphorus saline - TWEEN® (PBST) and incubated with SA-HRP reagent (streptavidin conjugated horseradish peroxidase, GE catalog number RPN4401V) for 2 hours. A colorimetric signal is generated by using the HRP substrate, tetramethylbenzidine (TMB), and the reaction is stopped by adding phosphoric acid. The plates are read on a plate reader (eg SpectraMax® M5 plate reader) at 450 nm for absorbance determination and 650 nm for reference absorbance. A similar assay can be performed to determine the level of active cynomolgus monkey (cynomolgus monkey) tryptase in a sample (e.g., blood (e.g., serum or plasma), BAL, or MLF), for example, using a 13G6 antibody clone as the capture antibody.

In some embodiments, the level of total tryptase in a sample (e.g., blood (e.g., serum or plasma), BAL, or MLF) can be determined using a total tryptase ELISA, such as as described in Example 6 of the U.S. Provisional Application No. 62/457722. Briefly, the concentration of human total tryptase can be determined using an ELISA assay. An antibody that recognizes human tryptase is used as a capture antibody (eg, a B12 antibody clone). A monoclonal antibody that recognizes human tryptase is used as the detection antibody (eg, E82AS antibody clone). Recombinant active human beta-1-tryptase is purified and used as starting material for the preparation of assay standards. Depending on the capture antibody used in the assay, this mixture can be incubated with an anti-human tryptase antibody that is capable of dissociating the tryptase tetramer (e.g., hu31A.v11 or B12) before being added to the capture antibody ELISA plate for 2 hours and then washed with 1x PBST. Biotinylated detection antibody is added over 1 hour. The SA-HRP reagent is then added over 1 hour. A colorimetric signal is generated by applying TMB and the reaction is stopped by adding phosphoric acid. The plates are read on a plate reader (eg SpectraMax® M5 plate reader) at 450 nm for absorbance determination and 650 nm for reference absorbance. A similar assay can be performed to determine the level of cynomolgus macaque (cynomolgus monkey) total tryptase in a sample (e.g., blood (e.g., serum or plasma), BAL, or MLF), for example, using a 13G6 antibody clone as the capture antibody and clone of the E88AS antibody as a detection assay.

In some embodiments, an exemplary reference level for total tryptase in blood (e.g., serum or plasma) may be about 1 ng/mL, about 2 ng/mL, about 3 ng/mL, about 4 ng/mL, about 5 ng/mL. ml, about 6 ng/ml, about 7 ng/ml, about 8 ng/ml, about 9 ng/ml, or about 10 ng/ml. For example, in some embodiments, an exemplary reference level for plasma total tryptase is about 3 ng/mL. In another example, in some embodiments, an exemplary reference level for serum total tryptase is about 4 ng/mL. For example, in some embodiments, a subject may have a total tryptase level that is equal to or greater than a reference level if the subject's total tryptase level (e.g., in blood (e.g., serum or plasma) is about 1 ng/mL or greater, about 2 ng /ml or more, about 3 ng/ml or more, about 4 ng/ml or more, about 5 ng/ml or more, about 6 ng/ml or more, about 7 ng/ml or more, about 8 ng/ml or higher, about 9 ng/mL or higher, or about 10 ng/mL or higher For example, in some embodiments, the subject may have a total tryptase level that is equal to or higher than a reference level if the plasma level of total tryptase is 3 ng/mL. ml or higher In another example, in some embodiments, a subject may have a total tryptase level that is equal to or greater than a reference level if the subject's serum total tryptase level is 4 ng/ml or greater.

In some embodiments of the invention, total periostin assay is used to determine the level of periostin in a patient sample, as described in International Patent Application Publication No. WO 2012/083132, which is incorporated herein by reference in its entirety. For example, a periostin capture ELISA can be used, which is very sensitive (about 1.88 ng/ml sensitivity), called the E4 assay in WO 2012/083132. The antibodies recognize periostin isoforms 1-4 (SEQ ID NO: 5-8 in WO 2012/083132) with nanomolar affinity. In other embodiments, the ELECSYS® periostin assay described in WO 2012/083132 can be used to determine the level of periostin in a patient sample.

In some embodiments, an exemplary reference level for periostin levels is 20 ng/mL, such as when using the E4 assay described above. For example, using the E4 assay, a patient may have a periostin level equal to or greater than a reference level if the patient's periostin level (eg, in serum or plasma) is 20 ng/mL or greater, 21 ng/mL or greater, 22 ng/mL, or higher, 23 ng/mL or higher, 24 ng/mL or higher, 25 ng/mL or higher, 26 ng/mL or higher, 27 ng/mL or higher, 28 ng/mL or higher, 29 ng/mL or higher , 30 ng/mL or higher, 31 ng/mL or higher, 32 ng/mL or higher, 33 ng/mL or higher, 34 ng/mL or higher, 35 ng/mL or higher, 36 ng/mL or higher, 37 ng/mL or higher, 38 ng/mL or higher, 39 ng/mL or higher, 40 ng/mL or higher, 41 ng/mL or higher, 42 ng/mL or higher, 43 ng/mL or higher, 44 ng/mL or higher, 45 ng/mL or higher, 46 ng/mL or higher, 47 ng/mL or higher, 48 ng/mL or higher, 49 ng/mL or higher, 50 ng/mL or higher, 51 ng /ml or greater, 52 ng/ml or greater, 53 ng/ml or greater, 54 ng/ml or greater, 55 ng/ml or greater, 56 ng/ml or greater, 57 ng/ml or greater, 58 ng/ml ml or more, 59 ng/ml or more, 60 ng/ml or more, 61 ng/ml or more, 62 ng/ml or more, 63 ng/ml or more, 64 ng/ml or more, 65 ng/ml or higher, 66 ng/mL or higher, 67 ng/mL or higher, 68 ng/mL or higher, 69 ng/mL or higher, or 70 ng/mL or higher.

When using the E4 assay, a patient may have a periostin level equal to or less than the reference level if the patient's periostin level (e.g., in serum or plasma) is 20 ng/mL or lower, 19 ng/mL or lower, 18 ng/mL, or below, 17 ng/ml or below, 16 ng/ml or below, 15 ng/ml or below, 14 ng/ml or below, 13 ng/ml or below, 12 ng/ml or below, 11 ng/ml or below , 10 ng/ml or less, 9 ng/ml or less, 8 ng/ml or less, 7 ng/ml or less, 6 ng/ml or less, 5 ng/ml or less, 4 ng/ml or less, 3 ng/ml or less, 2 ng/ml or less, or 1 ng/ml or less.

In other embodiments, an exemplary reference level for periostin levels (eg, in serum or plasma) is 50 ng/mL, eg, using the ELECSYS® periostin assay described above. For example, using the ELECSYS® Periostin Assay, a patient may have a periostin level equal to or greater than the reference level if the patient's periostin level is 50 ng/mL or higher, 51 ng/mL or higher, 52 ng/mL or higher, 53 ng/mL. ml or higher, 54 ng/mL or higher, 55 ng/mL or higher, 56 ng/mL or higher, 57 ng/mL or higher, 58 ng/mL or higher, 59 ng/mL or higher 60 ng/mL, or higher, 61 ng/mL or higher, 62 ng/mL or higher, 63 ng/mL or higher, 64 ng/mL or higher, 65 ng/mL or higher, 66 ng/mL or higher, 67 ng/mL or higher , 68 ng/mL or higher, 69 ng/mL or higher, 70 ng/mL or higher, 71 ng/mL or higher, 72 ng/mL or higher, 73 ng/mL or higher, 74 ng/mL or higher, 75 ng/mL or higher, 76 ng/mL or higher, 77 ng/mL or higher, 78 ng/mL or higher, 79 ng/mL or higher, 80 ng/mL or higher, 81 ng/mL or higher, 82 ng/mL or higher, 83 ng/mL or higher, 84 ng/mL or higher, 85 ng/mL or higher, 86 ng/mL or higher, 87 ng/mL or higher, 88 ng/mL or higher, 89 ng /ml or greater, 90 ng/ml or greater, 91 ng/ml or greater, 92 ng/ml or greater, 93 ng/ml or greater, 94 ng/ml or greater, 95 ng/ml or greater, 96 ng /ml or greater, 97 ng/ml or greater, 98 ng/ml or greater, or 99 ng/ml or greater.

When using the ELECSYS® Periostin Assay, a patient may have a periostin level equal to or less than the reference level if the patient's periostin level (e.g. serum or plasma) is 50 ng/mL or lower, 49 ng/mL or lower, 48 ng /ml or less, 47 ng/ml or less, 46 ng/ml or less, 45 ng/ml or less, 44 ng/ml or less, 43 ng/ml or less, 42 ng/ml or less, 41 ng/ml ml or less, 40 ng/ml or less, 39 ng/ml or less, 38 ng/ml or less, 37 ng/ml or less, 36 ng/ml or less, 35 ng/ml or less, 34 ng/ml or less, 33 ng/ml or less, 32 ng/ml or less, 31 ng/ml or less, 30 ng/ml or less, 29 ng/ml or less, 28 ng/ml or less, 27 ng/ml or below, 26 ng/ml or below, 25 ng/ml or below, 24 ng/ml or below, 23 ng/ml or below, 22 ng/ml or below, 21 ng/ml or below, 20 ng/ml or below , 19 ng/ml or less, 18 ng/ml or less, 17 ng/ml or less, 16 ng/ml or less, 15 ng/ml or less, 14 ng/ml or less, 13 ng/ml or less, 12 ng/ml or less, 11 ng/ml or less, 10 ng/ml or less, 9 ng/ml or less, 8 ng/ml or less, 7 ng/ml or less, 6 ng/ml or less, 5 ng/ml or less, 4 ng/ml or less, 3 ng/ml or less, 2 ng/ml or less, or 1 ng/ml or less.

VI. Sets

For use in detecting the presence and/or level of expression of biomarkers (eg, tryptase), the invention also provides kits or articles of manufacture. Such kits can be used to determine whether a patient with a mast cell mediated inflammatory disease (e.g., asthma) may respond to therapy, e.g., therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an FcεR antagonist , an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist), or a therapy comprising an IgE antagonist or an Fc epsilon receptor (FcεR) antagonist, and /or can be used to evaluate or monitor the response of an asthma patient to therapy. In some embodiments, the kits can be used to determine the number of active tryptase alleles in a patient. In other embodiments, the kits can be used to determine the level of tryptase expression (eg, active or total tryptase) in a sample from a patient. Such kits may be used to carry out any of the methods of the invention.

For example, the invention provides a kit for identifying a patient with a mast cell-mediated inflammatory disease that is likely to respond to a mast cell-targeted therapy (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an IgE antagonist, an FcεR antagonist , an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, a PAR2 antagonist, and combinations thereof (e.g., a tryptase antagonist and an IgE antagonist)), wherein the kit includes: (a) reagents for determining the number of active tryptase alleles in a patient or to determine the level of expression of tryptase in a sample from a patient; and optionally (b) instructions for using the reagents to identify a patient with a mast cell-mediated inflammatory disease that is likely to respond to mast cell-targeted therapy (e.g., therapy comprising an agent selected from the group consisting of a tryptase antagonist , an IgE antagonist, an FcεR antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a PAR2 antagonist, and combinations thereof (eg, a tryptase antagonist and an IgE antagonist)). In some embodiments, the kit contains reagents for determining the number of active tryptase alleles in a patient. In other embodiments, the kit contains reagents for determining the level of tryptase expression in a sample from a patient.

In another example, the invention provides a kit for identifying a patient with a mast cell-mediated inflammatory disease that is likely to respond to therapy comprising an IgE antagonist or an FcεR antagonist that includes (a) reagents for determining the number of active tryptase alleles in a patient or for determining the level of expression tryptase in a patient sample; and optionally (b) instructions for using reagents to identify a patient with a mast cell-mediated inflammatory disease that is likely to respond to therapy comprising an IgE antagonist or an FcεR antagonist.

Any suitable reagents for determining the number of active tryptase alleles in a patient or for determining the level of tryptase expression can be used in any of the preceding kits, including, for example, oligonucleotides, polypeptides (eg, antibodies), and the like.

In some embodiments, the kit further comprises reagents for determining the level of a type 2 biomarker in a patient sample.

For example, in some embodiments, the implementation of the reagent contains an oligonucleotide. Oligonucleotides "specific for" a genetic locus bind either to the polymorphic region of the locus or bind adjacent to the polymorphic region of the locus. For oligonucleotides to be used as amplification primers, the primers are contiguous if they are close enough to be used to produce a polynucleotide containing the polymorphic region. In one embodiment, oligonucleotides are contiguous if they bind within about 1-2 kb, such as less than 1 kb. from polymorphism. Specific oligonucleotides are capable of hybridizing to a sequence and, under the right conditions, will not bind to a sequence that differs by one nucleotide.

The oligonucleotides, whether used as probes or primers, contained in the kit can be detectably labeled. Labels can be detected either directly, such as for fluorescent labels, or indirectly. Indirect detection may include any detection method known to one of skill in the art, including biotin and avidin interactions, antibody binding, and the like. Fluorescently labeled oligonucleotides may also contain a quenching molecule. Oligonucleotides can be associated with the surface. In some embodiments, the surface is silica or glass. In some embodiments, the surface is a metal electrode.

In other embodiments, the tryptase expression level reagent may be a polypeptide, such as an antibody. In some embodiments, the antibody may be detectably labeled.

Still other kits according to the invention contain at least one reagent required for analysis. For example, the kit may contain an enzyme. Alternatively, the kit may contain a buffer or any other necessary reagent. Kits may include all or some of the positive controls, negative controls, reagents, primers, sequencing markers, probes, and antibodies described herein for determining the number of active tryptase alleles in a patient or determining the level of tryptase expression in a sample from a patient.

Any of the preceding kits may contain a carrier divided into parts for placement in hermetically sealed one or more containers, such as vials, test tubes, and the like, each of the containers containing one of the individual elements to be used in the method. For example, one of the containers may contain a probe that has or can be detectably labeled. Such a probe may be an antibody or an oligonucleotide specific for a protein or transcript, respectively. If the kit is used to hybridize a nucleic acid to detect a target nucleic acid, then the kit may also have containers containing the nucleotide(s) to amplify the target nucleic acid sequence and/or a container containing a reporter such as a biotin-binding protein (e.g., avidin or streptavidin) linked to a reporter molecule such as an enzymatic, fluorescent, or radioisotope label.

Such kits typically contain the container described above and one or more other containers containing commercially and consumerly desirable materials, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. A label may be present on the container indicating that the composition is being used for a particular application and may also indicate directions for both in vivo and in vitro use, such as those described above.

Kits according to the invention have a number of embodiments. A typical embodiment is a kit containing a container, a label on said container, and a composition contained in said container, wherein the composition contains a primary antibody that binds to a protein biomarker (e.g., tryptase), and the label on said container indicates that the composition can be used to assess the presence of such proteins in a sample, and the kit includes instructions for using the antibody to assess the presence of biomarker proteins in a particular type of sample. The kit may further comprise a set of instructions and materials for preparing the sample and applying the antibody to the sample. The kit may include both a primary and a secondary antibody, wherein the secondary antibody is conjugated to a label, such as an enzymatic label.

Another embodiment is a kit containing a container, a label on said container, and a composition contained in said container, wherein the composition contains one or more polynucleotides that hybridize to a biomarker (e.g., tryptase) complement under stringent conditions, and the label on said container indicates that the composition can be used to assess the presence of a biomarker (eg, tryptase) in a sample, and the kit includes instructions for using the polynucleotide(s) to assess the presence of an RNA or DNA biomarker in a particular type of sample.

Other optional components of the kit include one or more buffers (e.g., blocking buffer, wash buffer, substrate buffer, etc.), other reagents such as a substrate (e.g., chromogen) that is chemically modified with an enzymatic label, a demasking solution antigen, control samples (positive and/or negative controls), control(s) microscope slide(s), etc. Kits may also include instructions for interpreting results obtained using the kit.

In other specific embodiments for antibody-based kits, the kit may contain, for example: (1) a first antibody (eg, attached to a solid support) that binds to a biomarker protein (eg, tryptase); and optionally (2) a second, different antibody that binds to either the protein or the first antibody and is conjugated to a detectable label.

For oligonucleotide-based kits, the kit may contain, for example: (1) an oligonucleotide, such as a detectable labeled oligonucleotide that hybridizes to a tryptase gene (eg, TPSAB1 or TPSB2), and/or a nucleic acid sequence encoding a biomarker protein nucleic acid sequence ( eg tryptase) or (2) a pair of primers used to amplify the biomarker nucleic acid molecule. The kit may also contain, for example, a buffering agent, a preservative or a protein stabilizing agent. The kit may additionally contain components necessary to detect a detectable label (eg, enzyme or substrate). The kit may also contain a control sample or a series of control samples that can be analyzed and compared with the test sample. Each component of the kit may be placed in a separate container, and all the different containers may be in the same package, along with instructions for interpreting the results of analyzes performed using the kit.

Any of the preceding kits may further comprise one or more therapeutic agents, including any of tryptase antagonists, FcεR antagonists, IgE ⁺ B cell depleting antibodies, mast cell or basophil depleting antibodies, PAR2 antagonists, IgE antagonists, and combinations thereof (e.g., tryptase antagonist and IgE antagonist) and/or additional therapeutic agents described herein.

VII. Compositions and pharmaceutical formulations

In one aspect, the invention is based in particular on the discovery that the biomarkers of the invention (e.g., the number of active tryptase alleles in a patient and/or the tryptase expression level) can be used to identify patients with mast cell-mediated inflammatory disease who are likely to respond to therapy. (e.g., a therapy comprising an agent selected from the group consisting of a tryptase antagonist, an Fc epsilon receptor (FcεR) antagonist, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, a protease-activated receptor 2 antagonist ( PAR2), an IgE antagonist, and combinations thereof (eg, a tryptase antagonist and an IgE antagonist)). These agents and combinations thereof are useful in the treatment of mast cell mediated inflammatory diseases, for example, as part of any of the methods described herein, for example, in sections II and III above. In some embodiments, the therapy is a therapy directed at mast cells. Any suitable tryptase antagonist (e.g., anti-tryptase antibody), Fc epsilon receptor (FcεR) antagonist, IgE ⁺ B cell depleting antibody, mast cell or basophil depleting antibody, protease-activated receptor 2 (PAR2) antagonist, and/or an IgE antagonist may be used in the methods and assays described herein. Non-limiting examples suitable for use in the methods and assays of the invention are described further below.

A. Antibodies

Any suitable antibody may be used in the methods described herein, e.g., anti-tryptase antibodies, anti-FcεR antibodies, IgE ⁺ B cell depleting antibodies, mast cell or basophil depleting antibodies, anti-PAR2 antibodies, and/or anti-IgE antibodies. . It is contemplated that such anti-tryptase antibodies, anti-FcεR antibodies, IgE ⁺ B cell depleting antibodies, mast cell or basophil depleting antibodies, anti-PAR2 antibodies, and/or anti-IgE antibodies for use in any of the above embodiments may have any the features, singly or in combination, as described in sections a-c and 1-7 below.

A. Anti-tryptase antibodies

Any suitable anti-tryptase antibody can be used in the methods of the invention. For example, the anti-tryptase antibody can be any anti-tryptase antibody described in US Provisional Application No. 62/457,722, which is incorporated herein by reference in its entirety.

In some embodiments, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) may contain at least one, at least two, at least three, at least four, at least five, or all six hypervariable regions (HVRs) selected from (a) HVR-H1 containing the amino acid sequence DYGMV (SEQ ID NO: 1); (b) HVR-H2 containing the amino acid sequence FISSGSSTVYYADTMKG (SEQ ID NO: 2); (c) HVR-H3 containing the amino acid sequence RNYDDWYFDV (SEQ ID NO: 3); (d) HVR-L1 containing the amino acid sequence SASSSVTYMY (SEQ ID NO: 4); (e) HVR-L2 containing the amino acid sequence RTSDLAS (SEQ ID: 5); and (f) an HVR-L3 comprising the amino acid sequence QHYHSYPLT (SEQ ID NO: 6), or a combination of one or more of the above HVRs and one or more variants thereof, having at least about 80% sequence identity (e.g., 81% , 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, or 99% identity) with any of SEQ ID NOs: 1-6. For example, in some embodiments, the anti-tryptase antibody comprises (a) HVR-H1 containing the amino acid sequence DYGMV (SEQ ID NO: 1); (b) HVR-H2 containing the amino acid sequence FISSGSSTVYYADTMKG (SEQ ID NO: 2); (c) HVR-H3 containing the amino acid sequence RNYDDWYFDV (SEQ ID NO: 3); (d) HVR-L1 containing the amino acid sequence SASSSVTYMY (SEQ ID NO: 4); (e) HVR-L2 containing the amino acid sequence RTSDLAS (SEQ ID: 5); and (f) HVR-L3 containing the amino acid sequence QHYHSYPLT (SEQ ID NO: 6).

In some embodiments, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) may comprise (a) a heavy chain variable domain (VH) containing an amino acid sequence having at least 90% sequence identity with (e.g., at least 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 7; (b) a light chain variable domain (VL) comprising an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 8; or (c) a VH domain as in (a) and a VL domain as in (b). For example, in some embodiments, the VH domain comprises the amino acid sequence of SEQ ID NO: 7. In some embodiments, the VL domain comprises the amino acid sequence of SEQ ID NO: 8. In specific embodiments, the VH domain comprises the amino acid sequence of SEQ ID NO: 7, and the VL domain contains the amino acid sequence of SEQ ID NO: 8.

In some embodiments, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) may comprise (a) a heavy chain containing an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 9; and (b) a light chain containing an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 10. For example, in some embodiments, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) comprises (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 9, and ( b) a light chain containing the amino acid sequence of SEQ ID NO: 10.

In other embodiments, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) may comprise (a) a heavy chain containing an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 11; and (b) a light chain containing an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 10. For example, in some embodiments, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) comprises (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 11, and ( b) a light chain containing the amino acid sequence of SEQ ID NO: 10.

In still other embodiments, the anti-tryptase antibody (e.g., anti-beta-tryptase antibody) contains at least one, at least two, at least three, at least four, at least five, or all six hypervariable regions (HVRs) selected from (a) HVR-H1 containing the amino acid sequence GYAIT (SEQ ID NO: 12); (b) HVR-H2 containing the amino acid sequence GISSAATTFYSSWAKS (SEQ ID NO: 13); (c) HVR-H3 containing the amino acid sequence DPRGYGAALDRLDL (SEQ ID NO: 14); (d) HVR-L1 containing the amino acid sequence QSIKSVYNNRLG (SEQ ID NO: 15); (e) HVR-L2 containing the amino acid sequence ETSILTS (SEQ ID: 16); and (f) an HVR-L3 containing the amino acid sequence AGGFDRSGDTT (SEQ ID NO: 17), or a combination of one or more of the above HVRs and one or more variants thereof, having at least about 80% sequence identity (e.g., 81% , 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, or 99% identity) with any of SEQ ID NOs: 12-17. For example, in some embodiments, the anti-tryptase antibody comprises (a) HVR-H1 containing the amino acid sequence GYAIT (SEQ ID NO: 12); (b) HVR-H2 containing the amino acid sequence GISSAATTFYSSWAKS (SEQ ID NO: 13); (c) HVR-H3 containing the amino acid sequence DPRGYGAALDRLDL (SEQ ID NO: 14); (d) HVR-L1 containing the amino acid sequence QSIKSVYNNRLG (SEQ ID NO: 15); (e) HVR-L2 containing the amino acid sequence ETSILTS (SEQ ID: 16); and (f) HVR-L3 containing the amino acid sequence AGGFDRSGDTT (SEQ ID NO: 17).

In some embodiments, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) comprises (a) a heavy chain variable domain (VH) comprising an amino acid sequence having at least 90% sequence identity with (e.g., at least 91% 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 18; (b) a light chain variable domain (VL) comprising an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 19; or (c) a VH domain as in (a) and a VL domain as in (b). For example, in some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 18. In some embodiments, the VL domain contains the amino acid sequence of SEQ ID NO: 19. In specific embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 18, and the VL domain contains the amino acid sequence of SEQ ID NO: 19.

In some embodiments of any of the preceding methods, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) comprises (a) a heavy chain comprising an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 20; and (b) a light chain containing an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 21. For example, in some embodiments, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) comprises (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 20, and ( b) a light chain containing the amino acid sequence of SEQ ID NO: 21.

In other embodiments of any of the preceding methods, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) comprises (a) a heavy chain comprising an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 22; and (b) a light chain containing an amino acid sequence having at least 90% sequence identity with (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) or the amino acid sequence of SEQ ID NO: 21. For example, in some embodiments, an anti-tryptase antibody (e.g., an anti-beta-tryptase antibody) comprises (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 22, and ( b) a light chain containing the amino acid sequence of SEQ ID NO: 21.

In some embodiments, the anti-tryptase antibody is an antibody that binds to the same epitope as any of the previous antibodies.

Any of the anti-tryptase antibodies described herein may be administered in combination with any of the anti-IgE antibodies described in subsection C below, including omalizumab (XOLAIR®).

b. Antibodies that deplete IgE ⁺ B cells

Any suitable IgE ⁺ B cell depleting antibody may be used in the methods of the invention. In some embodiments, the IgE ⁺ B cell depleting antibody is an anti-M1' antibody (eg, kilizumab). In some embodiments, the anti-M1' antibody is any of the anti-M1' antibodies described in International Patent Application Publication No. WO 2008/116149.

c. Antibodies against IgE

Any suitable anti-IgE antibody may be used in the methods of the invention. Exemplary anti-IgE antibodies include rhuMabE25 (E25, omalizumab (XOLAIR®)), E26, E27, as well as CGP-5101 (Hi-901), anti-HA (hemagglutinin), ligelizumab, and talizumab. The amino acid sequences of the heavy and light chain variable domains of the humanized anti-IgE antibodies E25, E26 and E27 are described, for example, in US Pat. No. 6,172,213 and WO 99/01556. The CGP-5101 (Hi-901) antibody is described in Corne et al. J.Clin. Invest. 99(5): 879-887, 1997; W092/17207; and ATCC Deposit No. BRL-10706, BRL-11130, BRL-11131, BRL-11132 and BRL-11133. An antibody to HA is described in US No. 60/444229, WO 2004/070011, and WO 2004/070010.

For example, in some embodiments, the anti-IgE antibody comprises one, two, three, four, five, or all six of the following six HVRs: (a) an HVR-H1 containing the amino acid sequence GYSWN (SEQ ID NO: 40); (b) HVR-H2 containing the amino acid sequence SITYDGSTNYNPSVKG (SEQ ID NO: 41); (c) HVR-H3 containing the amino acid sequence GSHYFGHWHFAV (SEQ ID NO: 42); (d) HVR-L1 containing the amino acid sequence RASQSVDYDGDSYMN (SEQ ID NO: 43); (e) HVR-L2 containing the amino acid sequence AASYLES (SEQ ID: 44); and (f) HVR-L3 containing the amino acid sequence QQSHEDPYT (SEQ ID NO: 45). In some embodiments, the anti-IgE antibody comprises (a) a VH domain comprising an amino acid sequence having at least 90% sequence identity (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) with the amino acid sequence of SEQ ID NO: 38; (b) a VL domain containing an amino acid sequence having at least 90% sequence identity (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) with the amino acid sequence of SEQ ID NO: 39; or (c) a VH domain as in (a) and a VL domain as in (b). In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 38. In some embodiments, the VL domain contains the amino acid sequence of SEQ ID NO: 39. In some embodiments, the VH domain contains the amino acid sequence of SEQ ID NO: 38 and the VL domain contains the amino acid the sequence of SEQ ID NO: 39. Any of the anti-IgE antibodies described herein can be used in combination with any anti-tryptase antibody described in subsection A above.

1. Antibody affinity

In certain embodiments, an antibody provided herein (e.g., an anti-tryptase antibody, an anti-FcεR antibody, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, an anti-PAR2 antibody, or an anti-IgE antibody) has a dissociation constant (K _D ) ≤1 μM, ≤100 nM, ≤10 nM, ≤1 nM, ≤0.1 nM, ≤0.01 nM, ≤1 pM, or ≤0.1 pM (e.g., 10 ^-6 M or less , for example, from 10 ^-6 M to 10 ^-9 M or less, for example, from 10 ^-9 M to 10 ^-13 M or less). For example, in some embodiments, an anti-tryptase antibody binds a striptase (e.g., human tryptase, e.g., human beta tryptase) with a K _D of about 100 nM or less (e.g., 100 nM or less, 10 nM or less, 1 nM or less, 100 pM or less, 10 pM or less, 1 pM or less, or 0.1 pM or less). In some embodiments, the antibody binds a tryptase (e.g., human tryptase, e.g., human beta-tryptase) with a K _{D of} 10 nM or less (e.g., 10 nM or less, 1 nm or less, 100 pM or less, 10 pM or less, 1 pM or less, or 0.1 pM or less). In some embodiments, the antibody binds tryptase (e.g., human tryptase, e.g., human beta tryptase) with a K _D of 1 nM or less (e.g., 1 nM or less, 100 pM or less, 10 pM or less, 1 pM or less, or 0.1 pM or less). In some embodiments, any of the anti-tryptase antibodies described above or herein binds to a tryptase (e.g., human tryptase, e.g., human beta tryptase) with a K _D of about 0.5 nM or less (e.g., 0.5 nM or less, 400 pM or less, 300 pM or less, 200 pM or less, 100 pM or less, 50 pM or less, 25 pM or less, 10 pM or less, 1 pM or less, or 0.1 pM or less ). In some embodiments, the antibody binds to tryptase (e.g., human tryptase, e.g., human beta tryptase) with a K _D of about 0.1 nM to about 0.5 nM (e.g., about 0.1 nM, about 0.2 nM , about 0.3 nM, about 0.4 nM, or about 0.5 nM). In some embodiments, the antibody binds a tryptase (eg, human tryptase, eg, human beta tryptase) with a K _D of about 0.4 nM. In some embodiments, the antibody binds a tryptase (eg, human tryptase, eg, human beta tryptase) with a K _D of about 0.18 nM. Any of the other antibodies described herein can bind to its antigen with affinities as described above for antibodies against tryptase.

In one embodiment, K _D is measured using a radiolabelled antigen (RIA) binding assay. In one embodiment, RIA was performed using the Fab version of the antibody of interest and its antigen. For example, the binding affinity of a Fab in solution for an antigen is measured by equilibrating the Fab with a minimum concentration of ( ¹²⁵ I)-labeled antigen in the presence of a series of unlabeled antigen titers, then immobilizing the bound antigen on an anti-Fab coated plate (see, for example, Chen et al J Mol Biol 293:865-881, 1999). To determine assay conditions, MICROTITER® multiwell plates (Thermo Scientific) were coated overnight with anti-Fab capture antibody (Cappel Labs) at 5 µg/mL in 50 µM sodium carbonate solution (pH 9.6) and then blocked with 2% ( w/v) with a solution of bovine serum albumin in PBS for two to five hours at room temperature (about 23°C). In a non-adsorbent plate (Nunc #269620), 100 pM or 26 pM [ ¹²⁵ I] antigen was mixed with serial dilutions of the target Fab (e.g., as assessed by the anti-VEGF antibody, Fab-12, in Presta et al. Cancer Res. 57: 4593-4599, 1997). The Fab of interest was then incubated overnight; however, incubation may be continued for a longer period (eg, about 65 hours) to ensure equilibrium is reached. The mixture was then transferred to a capture plate and incubated at room temperature (eg, one hour). The solution is then removed and the plate washed eight times with a 0.1% solution of polysorbate 20 (TWEEN®-20) in PBS. After the plates were dry, 150 μl/well of scintillator (MICROSCINT-20™; Packard) was added and the plates were read on a TOPCOUNT™ gamma counter (Packard) for ten minutes. Concentrations of each Fab that provided less than or equal to 20% of maximum binding were selected for use in a competitive binding assay.

According to another embodiment, K _D is measured by the BIACORE® Surface Plasmon Resonance method. For example, assay using BIACORE®-2000 or BIACORE®-3000 (BIAcore, Inc., Piscataway, NJ) was performed at 25° C. with immobilized antigen CM5 chips at 10 response units (RU). In one embodiment, carboxymethylated dextran biosensor chips (CM5, BIACORE, Inc.) are activated with N-ethyl-N'-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the manufacturer's instructions. The antigen is diluted with 10 mM sodium acetate, pH 4.8, to 5 μg/ml (˜0.2 μM) prior to injection at a flow rate of 5 μl/minute to achieve approximately 10 response units (RU) of bound protein. After the introduction of the antigen, a 1 M solution of ethanolamine was introduced to block unreacted groups. For kinetic measurements, two-fold dilution series of Fab (from 0.78 nM to 500 nM) were injected into PBS with 0.05% polysorbate 20 (TWEEN®-20) surfactant (PBST) at 25° C. at a flow rate of approximately 25 μl/min. Association (k _on ) and dissociation (k _off ) rates were calculated as simple unambiguous Langmuir binding models (BIACORE® Evaluation software version 3.2) by simultaneously fitting association and dissociation sensorgrams. The equilibrium dissociation constant (K _D ) was calculated as the ratio k _off /k _on . See, for example, Chen et al. (J. Mol. Biol. 293:865-881, 1999). If the rate exceeds 10 ⁶ M ^-1 s ^-1 from the above surface plasmon resonance method, then the forward reaction rates can be determined using the fluorescence decay method, which measures the increase or decrease in the intensity of fluorescent emission (excitation = 295 nm; emission = 340 nm, 16 nm bandwidth) at 25° C. 20 nM anti-antigen (Fab form) in PBS, at pH 7.2, in the presence of increasing concentrations of antigen, as measured by a spectrometer such as a spectrophotometer with flow stop device (Aviv Instruments) or SLM-AMINCO™ 8000 series spectrometer (ThermoSpectronic) with stirring cell.

In some embodiments, K _D is measured using a BIACORE® SPR assay. In some embodiments, the BIAcore® T200 or equivalent device may be used for SPR (surface plasmon resonance) analysis. In some embodiments, BIAcore® S series CM5 sensor chips (or equivalent sensor chips) are immobilized with monoclonal mouse anti-human IgG (Fc), and anti-tryptase antibodies are subsequently captured in the flow cell. Serial 3-fold dilutions of His-tagged human beta-1-tryptase monomer (SEQ ID NO: 128) were administered at a flow rate of 30 μl/min. Each sample is analyzed with a 3 minute association and a 10 minute dissociation. The analysis is carried out at 25°C. After each injection, the chip is regenerated using 3 M MgCl ₂ . The binding response is corrected by subtracting response units (RU) from a flow cell capturing irrelevant IgG at a similar density. For the analysis of kinetics, the Langmuir 1:1 model is used with simultaneous approximation of the values of k _on and k _off .

2. Antibody fragments

In some embodiments, an antibody provided herein (e.g., an anti-tryptase antibody, an anti-FcεR antibody, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, an anti-PAR2 antibody, or an anti-IgE antibody) is a fragment antibodies. Antibody fragments include, without limitation, Fab-, Fab'-, Fab'-SH-, F(ab') ₂ -, Fv and scFv fragments and other fragments described below. For a review of some antibody fragments, see Hudson et al. Nat. Med. 9:129-134 (2003). For a review of scFv fragments, see, for example, Pluckthun, in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., (Springer-Verlag, New York), pp. 269-315 (1994); see also WO 93/16185; US Pat _.

Diabodies are antibody fragments with two antigen-binding sites, which can be divalent or bispecific. See, for example, EP 404097; WO 1993/01161; Hudson et al. Nat. Med. 9:129-134, 2003; and Hollinger et al. Proc. Natl. Acad. sci. USA 90: 6444-6448, 1993. Triatebodies and tetrabodies are also described in Hudson et al. Nat. Med. 9:129-134, 2003.

Single domain antibodies are antibody fragments that contain all or part of the heavy chain variable domain, or all or part of the light chain variable domain of an antibody. In some embodiments, the implementation of the single-domain antibody is a human single-domain antibody (see, for example, US patent No. 6248516 B1).

Antibody fragments can be obtained by various methods, including, without limitation, proteolytic cleavage of intact antibodies, as well as obtaining using recombinant host cells (eg, E. coli or phage), as described in this document.

3. Chimeric and humanized antibodies

In some embodiments, an antibody provided herein (e.g., an anti-tryptase antibody, an anti-FcεR antibody, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, an anti-PAR2 antibody, or an anti-IgE antibody) is a chimeric antibody. Some chimeric antibodies are described, for example, in US patent No. 4816567; and Morrison et al. Proc. Natl. Acad. sci. USA, 81:6851-6855, 1984). In one example, a chimeric antibody comprises a non-human variable region (eg, a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate such as a monkey) and a human constant region. In a further example, a chimeric antibody is a "class-switched" antibody in which the class or subclass has been changed from the parent antibody. The term "chimeric antibodies" includes antigen-binding fragments of such antibodies.

In certain embodiments, the chimeric antibody is a humanized antibody. Typically, a non-human antibody is humanized to reduce human immunogenicity while retaining the specificity and affinity of the original non-human antibody. Typically, a humanized antibody contains one or more variable domains in which the HVRs (or portions thereof) are derived from a non-human antibody and the FRs (or portions thereof) are derived from human antibody sequences. The humanized antibody will optionally also contain at least a portion of the human constant region. In some embodiments, some FR residues in a humanized antibody are replaced with corresponding residues from a non-human antibody (eg, the antibody from which the HVR residues are derived), eg, to restore or improve the specificity or affinity of the antibody.

Humanized antibodies and methods for their preparation are discussed, for example, in Almagro et al. front. biosci. 13:1619-1633, 2008, and are further described, for example, in Riechmann et al. Nature 332:323-329, 1988; Queen et al. Proc. Natl. Acad. sci. USA 86:10029-10033, 1989; US Patent Nos. 5821337, 7527791, 6982321, and 7087409; Kashmiri et al. Methods 36:25-34, 2005 (which describes grafting a specificity-determining region (SDR)); Padlan, Mol. Immunol. 28:489-498, 1991 (which describes "surface change"); Dall'Acqua et al. Methods 36:43-60, 2005 (which describes "FR shuffling"); and Osbourne et al. Methods 36:61-68, 2005 and Klimka et al. Br. J. Cancer, 83:252-260, 2000 (which describes a "directed selection" approach to FR shuffling).

Human frameworks that can be used for humanization include, but are not limited to: frameworks selected using the "best fit" method (see, for example, Sims et al. J. Immunol. 151:2296, 1993); framework regions derived from the consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable regions (see, e.g., Carter et al. Proc. Natl. Acad. Sci. USA, 89:4285, 1992; and Presta et al. J. Immunol., 151:2623, 1993); mature human framework regions (somatically mutated) or human germline framework regions (see, for example, Almagro et al. Front. Biosci. 13:1619-1633, 2008); and framework regions resulting from screening of FR libraries (see e.g. Baca et al. J. Biol. Chem. 272:10678-10684, 1997 and Rosok et al. J. Biol. Chem. 271:22611-22618, 1996).

4. Human antibodies

In some embodiments, an antibody provided herein (e.g., an anti-tryptase antibody, an anti-FcεR antibody, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, an anti-PAR2 antibody, or an anti-IgE antibody) is a human antibody. Human antibodies can be obtained using various methods known in the art. Human antibodies are described in general terms by van Dijk et al. Curr. Opin. Pharmacol. 5:368-74, 2001 and Lonberg, Curr. Opin. Immunol. 20:450-459, 2008.

Human antibodies can be generated by administering an immunogen to a transgenic animal modified to produce intact human antibodies or intact antibodies with human variable regions in response to antigen challenge. Such animals typically contain all or part of the human immunoglobulin loci that replace endogenous immunoglobulin loci or that are extrachromosomal or randomly integrated into the animal's chromosomes. As a rule, endogenous immunoglobulin loci are inactivated in such transgenic mice. For a review of methods for generating human antibodies from transgenic animals, see Lonberg, Nat. Biotech. 23:1117-1125, 2005. Also see, for example, US Pat. Nos. 6,075,181 and 6,150,584 describing XENOMOUSE™ technology; US patent No. 5770429 describing HUMAB® technology; US Pat. No. 7,041,870 describing K-M MOUSE® technology; and US Patent Application Publication No. US 2007/0061900 describing VELOCIMOUSE® technology. Human variable regions from intact antibodies generated by such animals can be further modified, for example by combining with different human conserved regions.

Human antibodies can also be generated using hybridoma-based methods. Human myeloma and murine-human heteromyeloma cell lines have been described for the production of human monoclonal antibodies. (See, for example, Kozbor J. Immunol. 133:3001, 1984; Brodeur et al. Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987); and Boerner et al J. Immunol 147:86, 1991). Human antibodies generated using human B-cell hybridoma technology are described in Li et al. Proc. Natl. Acad. sci. USA, 103:3557-3562, 2006. Additional methods include those described in, for example, US Pat. No. 7,189,826 (which describes the production of human IgM monoclonal antibodies from hybridoma cell lines) and Ni, Xiandai Mianyixue, 26(4): 265-268, 2006 (which describes human-human hybridomas). Technology using human hybridomas ("Trioma" technology) is also described in Vollmers et al. Histology and Histopathology 20(3):927-937, 2005 and Vollmers et al. Methods and Findings in Experimental and Clinical Pharmacology 27(3):185-91, 2005.

Human antibodies can also be generated by isolating the Fv clone variable domain sequences from phage display libraries of human origin. Such variable domain sequences can then be combined with the desired human constant domain. Methods for selecting human antibodies from antibody libraries are described below.

5. Antibodies obtained from libraries

Antibodies of the invention can be isolated by screening combinatorial libraries of antibodies with the desired activity or properties. For example, many methods are known in the art for obtaining phage display libraries and screening such libraries for antibodies having the desired binding characteristics. Such methods are discussed, for example, in Hoogenboom et al. in Methods in Molecular Biology 178:1-37 (O'Brien et al., ed., Human Press, Totowa, NJ, 2001) and are further described, for example, in McCafferty et al. Nature 348:552-554, 1990; Clackson et al. Nature 352: 624-628, 1991; Marks et al. J. Mol. Biol. 222:581-597, 1992; Marks et al. in Methods in Molecular Biology248:161-175 (Lo, ed., Human Press, Totowa, NJ, 2003); Sidhu et al. J. Mol. Biol. 338(2): 299-310, 2004; Lee et al. J. Mol. Biol. 340(5): 1073-1093, 2004; Fellouse, Proc. Natl. Acad. sci. USA 101(34):12467-12472, 2004; and Lee et al. J. Immunol. Methods 284(1-2): 119-132, 2004.

In some phage display methods, VH and VL gene repertoires are separately cloned by polymerase chain reaction (PCR) and recombined randomly in phage libraries, which can then be screened for antigen-binding phage as described in Winter et al. Ann. Rev. Immunol., 12: 433-455, 1994. Phage typically represents antibody fragments, both single chain Fv (scFv) and Fab fragments. Libraries from immunized sources allow the production of antibodies with high affinity for the immunogen without the need for hybridoma construction. Alternatively, a naive repertoire (eg, from a human) can be cloned to obtain a single source of antibodies to a wide range of foreign antigens and self-antigens without immunization, as described in Griffiths et al. EMBO J. 12: 725-734, 1993. Finally, naïve libraries can also be generated synthetically by cloning unrearranged V gene segments from stem cells and using random sequence PCR primers to encode HVR3 hypervariable regions and to effect rearrangement. in vitro as described in Hoogenboom et al. J. Mol. Biol., 227: 381-388, 1992. Patent publications that describe human antibody phage libraries include, for example: US Patent No. 5,750,373 and US Patent Publication Nos. /0117126, 2007/0160598, 2007/0237764, 2007/0292936, and 2009/0002360.

Antibodies or antibody fragments isolated from human antibody libraries are referred to herein as human antibodies or human antibody fragments.

6. Multispecific Antibodies In some embodiments, an antibody provided herein (e.g., an anti-tryptase antibody, an anti-FcεR antibody, an IgE ⁺ B cell depleting antibody, a mast cell or basophil depleting antibody, an anti-PAR2 antibody, or an anti-IgE antibody ) is a multispecific antibody, such as a bispecific antibody. Multispecific antibodies are monoclonal antibodies that have binding specificities for at least two different sites. For example, with respect to anti-tryptase antibodies, in some embodiments, the bispecific antibodies can bind to two different tryptase epitopes. In some embodiments, one of the binding specificities is for ctryptase and the other is for any other antigen (eg, a second biological molecule). In some embodiments, the bispecific antibodies can bind to two different tryptase epitopes. In other embodiments, one of the binding specificities is for ctryptase (e.g., human tryptase, e.g., human beta tryptase) and the other is for any other antigen (e.g., a second biological molecule, e.g., IL-13, IL-4, IL- 5, IL-17, IL-33, IgE, M1 prime segment, CRTH2, or TRPA). Accordingly, a bispecific antibody may have a binding specificity for tryptase and IL-13; tryptase and IgE; tryptase and IL-4; tryptase and IL-5; tryptase and IL-17 or tryptase and IL-33. In particular, the bispecific antibody may have a binding specificity for tryptase and IL-13 or tryptase and IL-33. In other specific embodiments, the bispecific antibody may have a binding specificity for tryptase and IgE. Bispecific antibodies can be prepared as full length antibodies or antibody fragments.

Techniques for generating multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs having different specificities (see Milstein et al. Nature 305:537, 1983; WO 93/08829; and Traunecker et al. EMBO J 10: 3655,1991), and a lip-to-bottom design method (see, for example, US Pat. No. 5,731,168). Multispecific antibodies can also be obtained by design using the effect of electrostatic interaction to obtain molecules of Fc-heterodimeric antibodies (WO 2009/089004A1); by cross-linking two or more antibodies or fragments (see, for example, US patent No. 4676980, and Brennan et al. Science, 229: 81, 1985); using leucine zippers to create bispecific antibodies (see, for example, Kostelny et al. J. Immunol., 148(5):1547-1553, 1992); using diabody technology to generate bispecific antibody fragments (see, for example, Hollinger et al. Proc. Natl. Acad. Sci. USA 90:6444-6448, 1993); and using single chain Fv (sFv) dimers (see, for example, Gruberet al. J. Immunol. 152: 5368, 1994); and obtaining trispecific antibodies, as described, for example, in Tutt et al. J. Immunol. 147:60, 1991.

Engineered antibodies with three or more functional antigen-binding sites, including "octopus antibodies", are also included in this document (see, for example, US 2006/0025576 A1).

As used herein, an antibody or fragment also includes a "dual acting Fab" or "DAF" containing an antigen binding site that binds to tryptase as well as another different antigen (see, for example, US 2008/0069820).

ledges-in-troughs

The use of ridges-in-cavities as a method for producing multispecific antibodies is described, for example, in US Pat. sin. (2005) 26(6):649-658, and Kontermann (2005) Acta Pharmacol. sin. 26:1-9. A brief non-limiting discussion follows.

"Bump" refers to at least one amino acid side chain that protrudes from the interaction surface of the first polypeptide and, therefore, can be located in the compensatory cavity on the adjacent interaction surface (i.e., the interaction surface of the second polypeptide) to stabilize the heteromultimer, and thereby most contribute to the formation of a heteromultimer, for example, the formation of a homomultimer. The bulge may be present on the original interaction surface or may be introduced synthetically (eg, by altering the nucleic acid encoding the interaction surface). In some embodiments, the nucleic acid encoding the interaction surface of the first polypeptide is changed to encode a bulge. To achieve this, the nucleic acid encoding at least one "original" amino acid residue on the interaction surface of the first polypeptide is replaced with a nucleic acid encoding at least one "imported" amino acid residue that has a larger side chain than the original amino acid residue. It should be borne in mind that there may be several original and corresponding imported residues. The side chain volumes of various amino acid residues are shown, for example, in Table 1 of US 2011/0287009 or Table 1 of US Pat. No. 7,642,228.

In some embodiments, the imported bulge residues are natural amino acid residues selected from arginine (R), phenylalanine (F), tyrosine (Y), and tryptophan (W). In some embodiments, the imported residue is tryptophan or tyrosine. In some embodiments, the initial bulge residue has a small side chain volume, such as alanine, asparagine, aspartic acid, glycine, serine, threonine, or valine. See, for example, US Pat. No. 7,642,228.

"Cavity" refers to at least one amino acid side chain that is recessed from the interaction surface of the second polypeptide and therefore accommodates a corresponding protrusion on the adjacent interaction surface of the first polypeptide. The cavity may be present on the original interaction surface or may be introduced synthetically (eg, by altering the nucleic acid encoding the interaction surface). In some embodiments, the nucleic acid encoding the interaction surface of the second polypeptide is altered to encode a cavity. To achieve this, the nucleic acid encoding at least one "original" amino acid residue on the interaction surface of the second polypeptide is replaced with DNA encoding at least one "imported" amino acid residue that has a smaller side chain than the original amino acid residue. It should be borne in mind that there may be several original and corresponding imported residues. In some embodiments, the imported cavity residues are natural amino acid residues selected from alanine (A), serine (S), threonine (T), and valine (V). In some embodiments, the imported residue is serine, alanine, or threonine. In some embodiments, the starting residue to form the cavity has a large side chain volume, such as tyrosine, arginine, phenylalanine, or tryptophan.

The bulge is "positioned" in the cavity, which means that the spatial arrangement of the bulge and the cavity on the interaction surface of the first polypeptide and the second polypeptide, respectively, and the dimensions of the bulge and the cavity are such that the bulge can be located in the cavity without significantly disturbing the normal association of the first and second polypeptides on the interaction surface. Because bulges such as Tyr, Phe, and Trp generally do not run perpendicular to the interaction surface axis and have preferred conformations, alignment of the bulge to the corresponding cavity may, in some cases, be based on modeling a bulge/cavity pair based on a three-dimensional structure such as a structure obtained by X-ray crystallography or nuclear magnetic resonance (NMR). This can be achieved using methods widely used in the art.

In some embodiments, the bump and IgG1 constant region mutation is T366W. In some embodiments, the trough mutation in the IgG1 constant region contains one or more mutations selected from T366S, L368A, and Y407V. In some embodiments, the trough mutation in the IgG1 constant region contains T366S, L368A, and Y407V.

In some embodiments, the bump mutation in the IgG4 constant region is T366W. In some embodiments, the bump mutation in the IgG4 constant region contains one or more mutations selected from T366S, L368A, and Y407V. In some embodiments, implementation of a mutation of the type "hollow" in the constant region of IgG4 contains T366S, L368A and Y407V.

7. Antibody variants

In certain embodiments, amino acid sequence variants of the antibodies provided herein are contemplated. For example, it may be desirable to improve the binding affinity and/or other biological properties of an antibody, such as inhibitory activity. Variants of the amino acid sequences of an antibody can be obtained by making appropriate modifications to the nucleotide sequence encoding the antibody, or by peptide synthesis. Such modifications include, for example, deletions and/or insertions and/or substitutions of residues in the amino acid sequences of the antibody. Any combination of deletions, insertions, and substitutions can be performed to obtain the final construct, as long as the final construct has the desired characteristics, such as antigen binding.

a) Options for substitutions, insertions and deletions

In some embodiments, antibody variants having one or more amino acid substitutions are provided. Sites of interest for substitution mutagenesis include HVR and FR. Conservative substitutions are shown in Table 1 under the heading "preferred substitutions". More significant changes are presented in Table 1 under the heading "illustrative substitutions", and as further described below with reference to classes of amino acid side chains. Amino acid substitutions can be made to the antibody of interest and the resulting products screened for desired activity, eg, maintaining/improving antigen binding, reducing immunogenicity, or improving ADCC or CDC.

Amino acids can be divided into groups according to the general properties of the side chains:

(1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile;

(2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln;

(3) acidic: Asp, Glu;

(4) main: His, Lys, Arg;

(5) residues that affect chain orientation: Gly, Pro;

(6) aromatic: Trp, Tyr, Phe.

Non-conservative substitutions are the replacement of a member of one of the specified classes by a member of another class.

One type of replacement variant involves replacing one or more hypervariable region residues of the original antibody (eg, a humanized or human antibody). Typically, the resulting variant(s) selected for further study will have modifications (e.g., improvements) in certain biological properties (e.g., increased affinity, reduced immunogenicity) compared to the parent antibody, and/or will have substantially retained certain biological properties. properties of the parent antibody. An exemplary replacement variant is an affinity matured antibody, which can traditionally be generated, for example, using phage display maturation techniques such as those described herein. Briefly, one or more HVR amino acid residues are mutated and the variant antibodies are displayed on the surface of the phage and screened for a particular biological activity (eg, binding affinity).

Changes (eg substitutions) can be made to the HVR, eg to improve the affinity of the antibody. Such changes can be made at HVR hotspots, i.e. codon-encoded residues that mutate at a high rate during the somatic maturation process (see, for example, Chowdhury, Methods Mol. Biol. 207:179-196, 2008), and/or residues that come into contact with an antigen, testing the resulting VH or VL variant for binding affinity. Affinity maturation by construction and reselection from secondary libraries has been described, for example, in Hoogenboom et al. in Methods in Molecular Biology 178:1-37 (O'Brien et al. ed., Human Press, Totowa, NJ, 2001). In some embodiments of affinity maturation, the diversity is introduced into variable genes selected for maturation by any of a variety of methods (eg, reduced precision PCR, strand shuffling, or oligonucleotide directed mutagenesis). Then a secondary library is created. The library is then screened to identify any antibody variants with the desired affinity. Another way to introduce diversity includes approaches directed to HVR, in which several amino acid residues of HVR (4-6 amino acid residues in a row) are randomized. HVR residues involved in antigen binding can be specifically identified, for example, using alanine-scanning mutagenesis or modeling. Targets in particular are HVR-H3 and HVR-L3.

In some embodiments, substitutions, insertions, or deletions may be made within one or more HVRs, provided that such changes do not significantly reduce the ability of the antibody to bind antigen. For example, conservative substitutions (eg, conservative substitutions provided herein) can be made in HVR that do not significantly reduce binding affinity. Such changes may be, for example, beyond antigen-contacting residues in the HVR. In some embodiments, in the VH and VL sequence variants above, each HVR is either unchanged or contains no more than one, two, or three amino acid substitutions.

A convenient way to identify antibody residues or regions that can be targets for mutagenesis is called "alanine-scanning mutagenesis" described in Cunningham et al. Science 244:1081-1085, 1989. In this method, an amino acid residue or group of target amino acid residues (e.g., charged amino acid residues such as Arg, Asp, His, Lys, and Glu) are identified and replaced with a neutral or negatively charged amino acid (e.g., Ala or polyalanine) to determine the effect on the interaction of the antibody with the antigen. Additional substitutions may be made at those amino acid arrangements that were functionally sensitive to the original substitutions. Alternatively or additionally, the crystal structure of the antigen-antibody complex is used to identify points of contact between the antibody and antigen. Such contact residues and adjacent residues can be used as targets or removed from candidates for replacement. Variants can be screened to determine if they contain the desired properties.

Amino acid sequence insertions include N- and/or C-terminal fusions ranging in length from one residue to polypeptides containing one hundred or more residues, as well as intrasequence insertions of one or more amino acid residues. Examples of end inserts include an antibody with an N-terminal methionyl residue. Other insertion variants of an antibody molecule include the fusion of the N- or C-terminus of the antibody with an enzyme (eg, for ADEPT therapy) or a polypeptide that increases serum half-life.

b) Glycosylation variants

In certain embodiments, an antibody provided herein is modified to increase or decrease the degree of glycosylation of the antibody. The addition or removal of glycosylation sites in an antibody is easily accomplished by altering the amino acid sequence resulting in the creation or removal of one or more glycosylation sites.

If the antibody contains an Fc region, then you can change the carbohydrate attached to it. Native antibodies produced by mammalian cells typically contain a branched, biantennary oligosaccharide that is generally N-linked to the Asn297 CH2 domain of the Fc region. See, for example, Wright et al. TIBTECH 15:26-32, 1997. The oligosaccharide may contain various carbohydrates such as mannose, N-acetylglucosamine (GlcNAc), galactose and sialic acid, as well as fucose attached to the GlcNAc in the stem of the biantennary oligosaccharide structure. In some embodiments, modifications can be made to the oligosaccharide in an antibody of the invention in order to create antibody variants with certain improved properties.

In one embodiment, antibody variants are provided in which the carbohydrate structure attached (either directly or indirectly) to the Fc region has a reduced fucose content. For example, the amount of fucose in such an antibody may be 1% to 80%, 1% to 65%, 5% to 65%, or 20% to 40%. The amount of fucose is determined by calculating the average amount of fucose in the Asn297 sugar chain relative to the total number of glycostructures attached to Asn 297 (e.g., complex, hybrid, or mannose-rich structures) according to MALDI-TOF mass spectrometry, as described, for example, in WO 2008/077546. Asn297 refers to an asparagine residue located at position 297 in the Fc region (following the EU numbering of Fc region residues); while Asn297 can also be located about ±3 amino acids upstream or downstream of position 297, i.e. between positions 294 and 300 due to minor sequence variations in the antibodies. Such fucosylated variants may have improved ADCC function. See, for example, US Patent Publications Nos. 2003/0157108 and 2004/0093621. Examples of publications related to "defucosylated" or "fucose-deficient" antibody variants include: US 2003/0157108; WO2000/61739; WO 2001/29246; US 2003/0115614; US 2002/0164328; US 2004/0093621; US 2004/0132140; US 2004/0110704; US 2004/0110282; US 2004/0109865; WO2003/085119; WO2003/084570; WO2005/035586; W02005/035778; WO2005/053742; WO2002/031140; Okazaki et al. J. Mol. Biol. 336:1239-1249, 2004; Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614, 2004. Examples of cell lines capable of producing defucosylated antibodies include protein fucosylation deficient CHO 1_ec13 cells (Ripka et al. Arch. Biochem. Biophys. 249:533-545, 1986; US 2003/0157108; and WO 2004 /056312 A1, especially in Example 11), and knockout cell lines such as CHO knockout cells for the alpha-1,6-fucosyltransferase gene, FUT8, (see, for example, Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614, 2004; Kanda et al Biotechnol Bioeng 94(4):680-688, 2006; and WO 2003/085107).

In addition, variants of antibodies with oligosaccharides bisected are provided, for example, in which the biantennary oligosaccharide attached to the Fc region of the antibody is bisected by GlcNAc. Such antibody variants may have reduced levels of fucosylation and/or improved ADCC function. Examples of such antibody variants are described, for example, in WO 2003/011878; in US patent No. 6602684; and US 2005/0123546. Antibody variants with at least one galactose residue in the oligosaccharide attached to the Fc region are also provided. Such antibody variants may have improved CSC function. Such antibody variants are described, for example, in WO 1997/30087; WO 1998/58964; and WO 1999/22764.

c) Fc region variants

In certain embodiments, one or more amino acid modifications can be introduced into the Fc region of an antibody provided herein, thereby providing a variant Fc region. A variant Fc region may comprise a human Fc region sequence (eg, an IgG1, IgG2, IgG3, or IgG4 human Fc region) containing an amino acid modification (eg, substitution) at one or more amino acid positions.

In certain embodiments, the invention provides an antibody variant that has some, but not all, effector functions, making it a suitable candidate for applications where the in vivo half-life of the antibody is important, although certain effector functions (such as complement and ADCC ) are not necessary or harmful. Cytotoxic assays can be performed in vitro and/or in vivo to confirm recovery/attenuation of CDC and/or ADCC activity. For example, Fc receptor (FcR) binding assays can be performed to ensure that an antibody does not bind to FcγR (and therefore does not have ADCC activity) while retaining FcRn binding ability. Primary cells to mediate ADCC only express FcγRIII, while monocytes express FcγRI, FcγRII and FcγRIII. FcR expression on hematopoietic cells is shown in Table 3 on page 464 in Ravetch et al. Annu. Rev. Immunol. 9:457-492, 1991. Non-limiting examples of in vitro assays for evaluating ADCC activity of a molecule of interest are described in US Pat. , 1986 and Hellstrom et al. Proc. Natl. Acad. Sci. USA 82:1499-1502, 1985; US Pat. Alternatively, non-radioactive assays may be used (see, for example, non-radioactive ACTI™ cytotoxicity assay for flow cytometry (CellTechnology, Inc. Mountain View, CA; and non-radioactive cytotoxicity assay CytoTox 96® (Promega, Madison, Wisconsin). Effector cells suitable for this assay include peripheral blood mononuclear cells (PBMCs) and natural killer (NK) cells.Alternatively or additionally, ADCC activity of the molecule of interest can be assessed in vivo, e.g., in an animal model, as disclosed in Clynes et al., Proc. Natl. Acad. sci. USA 95:652-656, 1998. A C1q binding assay can also be performed to confirm that the antibody is unable to bind C1q and therefore lacks CSC activity. See, for example, ELISA analysis of C1q and C3c binding in WO 2006/029879 and WO 2005/100402. CSC analysis can be performed to assess complement activation (see, e.g., Gazzano-Santoro et al. J. Immunol. Methods 202:163, 1996; Cragg et al. Blood 101:1045-1052, 2003; and Cragg et al. Blood 103:2738-2743, 2004). Determination of FcRn binding and in vivo clearance/half-life can also be performed using methods known in the art (see, for example, Petkova et al. Intl. Immunol. 18(12):1759-1769, 2006).

Antibodies with reduced effector function include those containing substitutions for one or more of residues 238, 265, 269, 270, 297, 327, and 329 of the Fc region (US Pat. No. 6,737,056). Such Fc mutants include Fc mutants with substitutions at two or more amino acid positions 265, 269, 270, 297, and 327, including the so-called "DANA" Fc mutants with substitutions of residues 265 and 297 for alanine (US Patent 7,332,581).

Certain modifications of the antibody with improved or reduced FcR binding have been described. (See, for example, US patent No. 6737056; WO 2004/056312; and Shields et al. J. Biol. Chem. 9(2): 6591-6604, 2001).

In some embodiments, the antibody variant comprises an Fc region with one or more amino acid substitutions that improve ADCC, such as substitutions at positions 298, 333, and/or 334 of the Fc region (EU residue numbering).

In some embodiments, changes are made in the Fc region that result in a change (i.e., either improvement or deterioration) in C1q binding and/or complement dependent cytotoxicity (CDC), for example, as described in US Pat. No. 6,194,551, WO 99/ 51642, and Idusogie et al. J. Immunol. 164: 4178-4184, 2000.

Antibodies with extended half-life and improved binding to the neonatal Fc receptor (FcRn), which is responsible for the transfer of maternal IgG to the fetus (Guyer et al. J. Immunol. 117:587, 1976 and Kim et al. J. Immunol. 24: 249, 1994) are described in US2005/0014934. flaHHbie antibodies contain an Fc region with one or more substitutions therein that improve the binding of the Fc region to FcRn. Such Fc variants include those with substitutions of one or more Fc region residues: 238, 256, 265, 272, 286, 303, 305, 307, 311, 312, 317, 340, 356, 360, 362, 376, 378, 380 , 382, 413, 424 or 434, for example, substitution of amino acid residue 434 in the Fc region (US patent No. 7371826).

See also Duncan et al. Nature 322:738-40, 1988; U.S. Patent Nos. 5,648,260 and 5,624,821; and WO 94/29351 for other examples of Fc region variants.

d) Antibody variants engineered with cysteine

In some embodiments, it may be desirable to create cysteine-engineered antibodies, such as "ThioMAb", in which one or more antibody residues are replaced with cysteine residues. In specific embodiments, the implementation of the substituted residues are located in accessible areas of the antibody. Thus, by replacing such residues with cysteine, thiol-reactive groups are located at accessible sites on the antibody and can be used to conjugate the antibody to other moieties, such as drug moieties or drug-linker moieties, to create an immunoconjugate such as described later in this document. In some embodiments, one or more of the following residues can be replaced with cysteine: V205 (Kabat numbering) in the light chain, A118 (EU numbering) in the heavy chain, and S400 (EU numbering) in the Fc region of the heavy chain. Cysteine engineered antibodies can be prepared as described, for example, in US Pat. No. 7,521,541.

e) Antibody derivatives

In certain embodiments, an antibody provided herein may be further modified to include additional non-protein components that are known in the art and are commonly available. Fragments suitable for derivatization of antibodies include, without limitation, water-soluble polymers. Non-limiting examples of water-soluble polymers include, but are not limited to, polyethylene glycol (PEG), ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidone, poly-1,3-dioxolane, poly-1,3,6-trioxane, ethylene/maleic copolymer anhydride, polyamino acids (either homopolymers or random copolymers), dextran or poly(p-vinylpyrrolidone) polyethylene glycol, propylene glycol homopolymers, oxide/ethylene oxide copolymers, polyoxyethylene polyols (eg glycerol), polyvinyl alcohol and mixtures thereof. Propionaldehyde polyethylene glycol may be advantageous in production due to its stability in water. The specified polymer may have any molecular weight and be branched or unbranched. The number of polymers attached to an antibody may vary and, if more than one polymer is attached, they may be the same or different molecules. In general, the amount and/or type of polymers used for derivatization can be determined based on factors including, but not limited to, the specific properties or functions of the antibody to be improved, whether or not the antibody derivative is to be used in therapy under certain conditions and whether similar.

In another embodiment, the invention provides conjugates of an antibody and a non-protein component that can be selectively heated by irradiation. In one embodiment, the non-protein component is a carbon nanotube (Kam et al. Proc. Natl. Acad. Sci. USA 102: 11600-11605, 2005). The radiation may be of any wavelength and includes, without limitation, wavelengths that do not harm normal cells, but that heat the non-protein component to a temperature at which cells located close to the antibody-non-protein component die.

B. Pharmaceutical formulations

Therapeutic formulations comprising therapeutic agents used in accordance with the invention (e.g., any of the tryptase antagonists (e.g., anti-tryptase antibodies, including any of the anti-tryptase antibodies described herein), FcεR antagonists, IgE ⁺ B cell depleting antibodies , antibodies that deplete mast cells or basophils, PAR2 antagonists, IgE antagonists (eg, anti-IgE antibodies, such as omalizumab (XOLAIR®)) and combinations thereof (eg, a tryptase antagonist (eg, an anti-tryptase antibody, including any of the anti-tryptase antibodies described herein) and an IgE antagonist (e.g., an anti-IgE antibody, e.g., omalizumab (XOLAIR®))) and/or additional therapeutic agents described herein) are prepared for storage by mixing a therapeutic agent(s) having the desired degree of purity, with optional pharmaceutically acceptable excipients, excipients or stabilizers in the form of lyophilized formulations or aqueous solutions. For general formulation information, see, for example, Gilman et al. (eds.) The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press, 1990; A. Gennaro (ed.), Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co., Pennsylvania, 1990; Avis et al. (eds.) Pharmaceutical Dosage Forms: Parenteral Medications Dekker, New York, 1993; Lieberman et al. (eds.) Pharmaceutical Dosage Forms: Tablets Dekker, New York, 1990; Lieberman et al. (eds.), Pharmaceutical Dosage Forms: Disperse Systems Dekker, New York, 1990; and Walters (ed.) Dermatological and Transdermal Formulations (Drugs and the Pharmaceutical Sciences), Vol.119, Marcel Dekker, 2002.

Acceptable carriers, excipients or stabilizers are non-toxic to recipients at the dosages and concentrations employed and include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (eg Zn-protein complexes); and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).

The composition herein may also contain more than one active compound, preferably compounds with complementary activities that do not adversely affect each other. The type and effective amounts of such drugs depend, for example, on the amount and type of therapeutic agent(s) present in the formulation and on the clinical parameters of the subjects.

The active ingredients can also be placed in microcapsules obtained, for example, by coacervation or interfacial polymerization, for example, microcapsules of hydroxymethylcellulose or gelatin and microcapsules of poly(methyl methacrylate), respectively; in colloidal drug delivery systems (eg, liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules) or macroemulsions. Such methods are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).

Sustained release preparations can be made. Suitable examples of sustained release formulations include semi-permeable matrices of solid hydrophobic polymers containing an antagonist, the matrices being in the form of, for example, films or microcapsules. Examples of controlled release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl methacrylate) or polyvinyl alcohol)), polylactides (US Pat. No. 3,773,919), copolymers of L-glutamic acid and ethyl-L-glutamate, non-degradable ethylene vinyl acetate, degradable copolymers lactic acid and glycolic acid, such as LUPRON DEPOT™ (injectable microspheres consisting of a copolymer of lactic acid and glycolic acid and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid.

Formulations used for in vivo administration must be sterile. This condition is easily achieved by filtration through sterile filtration membranes.

EXAMPLES

The following examples are provided to illustrate and not limit the presently claimed invention.

Example 1: Materials and Methods

A) Number of active tryptase alleles

PCR followed by Sanger sequencing of genomic DNA was used to quantify active tryptase alleles as previously described (Trivedi et al. J. Allergy Clin. Immunol. 124:1099-1105 e1-4, 2009). Briefly, the number of active tryptase alleles was estimated as the number of remaining active tryptase genes after counting deficient tryptase alleles, ie those defined as α and βIII ^FS . Genotypes were automatically determined by the intensity ratio of two alleles (A/B). Patients were assigned a genotype group based on this ratio. Genotypes were confirmed by visual inspection of chromatograms for 5% of the population without error. Patient data that were not correctly distributed were checked visually. Genotyping for the number of active tryptase alleles was performed in subjects of European ancestry with asthma, determined by the principal component analysis of genome-wide SNP data, as described previously (Ramirez-Carrozzi et al. J. Allergy Clin. Immunol. 135:1080-1083 e3, 2015 ).

For genotyping α-tryptase, forward primer 5'-CTG GTG TGC AAG GTG AAT GG-3' (SEQ ID NO: 31) and reverse primer 5'-AGG TCC AG C ACT CAG GAG GA-3' (SEQ ID NO: 32) was used to amplify a portion of the TPSAB1 locus. PCR conditions were as follows: Qiagen HOTSTARTAQ® Plus polymerase was used under cycler conditions at 95°C for 5 minutes followed by 35 cycles at 94°C for 60 seconds, 58°C for 60 seconds and 72°C for 2 minutes. After PCR, EXOSAP-IT™ Product Purification Reagent was used for purification. The same forward and reverse primers were used for sequencing. Sequencing was performed using the BIG-DYE® terminator on an ABI 3730XL DNA analyzer manufactured by Applied Biosystems.

For βIII ^FS -tryptase genotyping, forward primer 5'-GCA GGT GAG CCT GAG AGT CC 3' (SEQ ID NO: 33) and reverse primer 5-GGG ACC TTC ACC TGC TTC AG-3' (SEQ ID NO: 34) was used to amplify a portion of the TPSB2 locus. The PCR conditions were as follows: Qiagen HOTSTARTAQ® Plus Polymerase was used under cycler conditions at 95°C for 5 minutes followed by 35 cycles at 94°C for 60 seconds, 60°C for 60 seconds and 72°C for 2 minutes . After PCR, EXOSAP-IT™ Product Purification Reagent was used for purification. For sequencing, forward primer 5-GCA GGT GAG CCT GAG AGT CC-3' (SEQ ID NO: 33) and reverse primer 5'-CAG CCA GTG ACC CAG CAC-3' (SEQ ID NO: 35) were used. Sequencing was performed using the BIG-DYE® terminator on an ABI 3730XL DNA analyzer manufactured by Applied Biosystems.

B) Clinical cohorts

EXTRA (ClinicalTrials.gov ID: NCT00314574) was a randomized, double-blind, placebo-controlled trial of Xolair (anti-IgE) in patients aged 12 to 75 years with persistent moderate or severe asthma. Full details of the study design have been published previously (Hanania et al. Ann. Intern. Med. 154:573-582, 2011; Hanania et al. Am. J. Respir. Crit. Care Med. 187:804-811, 2013; Choy et al J Allergy Clinic Immunol 138:1230-1233e8, 2016). In short, after a 2-4 week run-in period, eligible patients were randomized 1:1 to receive XOLAIR® (omalizumab) or placebo (in addition to high doses of inhaled corticosteroids (ICS) and long-acting beta-adrenergic agonists (LABAs) , with or without additional control medications) for 48 weeks.

BOBCAT (Arron et al. Eur. Respir. J. 43:627-629, 2014; Choy et al. supra; Huang et al. J. Allergy Clin. Immunol. 136:874-884, 2015; Jia et al. J Allergy Clin Immunol 130:647-654, 2012) was a multicentre observational study conducted in the United States, Canada and the United Kingdom in 67 adult patients with moderate to severe asthma. Required inclusion criteria were a diagnosis of moderate or severe asthma (confirmed by a forced expiratory volume in 1 second (FEV ₁ ) between 40% and 80% of the predicted value, and evidence over the past 5 years of >12% reversibility of airway obstruction with bronchodilator sensitivity short-acting or methacholine (provocative concentration causes a 20% decrease in FEV ₁ (PC20) <8 mg / ml), which is not controlled (as defined by at least 2 exacerbations in the previous year or a score > 1.50 according to the control questionnaire symptoms of asthma (ACQ) in the 5-item version (ACQ-5) when receiving a stable high-dose ICS (>1000 mg fluticasone or equivalent per day) regimen (> 6 weeks) with or without LABA.

MILLY (ClinicalTrials.gov ID: NCT00930163) was a randomized, double-blind, placebo-controlled trial of lebrikizumab (an anti-IL-13 antibody) in adults who had asthma that was not adequately controlled despite inhaled glucocorticoid therapy (Corren et al N. Engl. J. Med. 365:1088-1098, 2011).

C) ELISA of total tryptase

Serum or plasma tryptase levels were measured using a sandwich enzyme-linked immunosorbent assay (ELISA) with 2 monoclonal antibodies capable of detecting human β1-, β2-, β3-, and α1-tryptase monomers and tetramers. Briefly, 384-well plates were coated with 1.0 µg/ml anti-tryptase monoclonal antibody in phosphate buffered saline (PBS) overnight at 4°C and then blocked with 90 µl of blocking buffer (1x PBS + 1% bovine serum). albumin (BSA)) for at least 1 hour at room temperature. Serum or plasma samples were diluted 1:100 in assay buffer (1X PBS pH 7.4, 0.35 M NaCl, 0.5% BSA, 0.05% TWEEN® 20 (polysorbate 20), 0.25% 3-[ (3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 5 mM ethylenediaminetetraacetic acid (EDTA), and 15 ppm PROCLIN™ (broad-spectrum antimicrobial)) and added in triplicate to plates after washings and incubated with stirring at room temperature for 2 hours at room temperature. Recombinant β1-tryptase was used to establish a standard range (7.8-500 pg/ml) in the assay. After washing, biotinylated anti-human tryptase antibody (0.5 μg/ml) in assay diluent (1x PBS, pH 7.4, 0.5% BSA, 0.05% TWEEN® 20) was added and incubated for 1 hour at room temperature. Color developed after washing with streptavidin peroxidase and tetramethylbenzidine (TMB) substrate. The data were interpreted based on a standard curve with a 4-parameter fit (4P) model. The detection limit of this assay was approximately 7.8 pg/mL.

D) Statistical Methods

R software was used for plotting and analysis (RCoreTeam, R: A Language an Environment for Statistical Computing, 2014).

Example 2: The number of active tryptase genes is heterogeneous in moderate and severe asthma

Tryptase is a granular protein that is highly expressed in mast cells and is an important asthma mediator with a marked effect on lung function. The genes encoding the enzymatically active tryptase, TSPAB1 and TPSB2, are polymorphic, and we have previously described the frequencies and inheritance patterns of common, inactivating, loss-of-function mutations (Trivedi et al. J. Allergy Clin. Immunol. 124:1099-1105 e1-4, 2009). Despite the advent of modern whole-heme assays, including high-density SNP arrays and next-generation sequencing, tryptase loci have not been well studied because the high homology and repetitive nature of this region is not suitable for these methodologies, thus requiring direct resequencing. We hypothesized that the number of active tryptase alleles, as determined by accounting for TSPAB1 and TPSB2 inactivating mutations, would influence the expression of mast cell-derived tryptase and predict clinical response to mast cell-related therapies, e.g., XOLAIR® (omalizumab), an antibody against IgE.

We assessed the number of active tryptase alleles in European patients with moderate to severe asthma from the BOBCAT, EXTRA and MILLY studies (see Example 1). Consistent with previous reports on Earth populations (Trivedi et al. J. Allergy Clin. Immunol. 124:1099-1105 e1-4, 2009), loss-of-function mutations were common in our study participants (Fig. 1); 88.3% of subjects (408 of 462) had at least one loss-of-function mutation, resulting in 1, 2, or 3 remaining active copies of tryptase. Subjects with null active copies were not observed in these studies, and those with one active copy were relatively rare (<1%, 3 of 462). Our cohort was dominated by subjects having two or three active copies of tryptase (88%, 405 of 462); the prevalence of two or three active copies was comparable (43%, 199 or 462; and 45%, 206 of 462, respectively).

The observed distribution of active tryptase alleles is consistent with the finding that specific TPSAB1 and TPSB2 alleles are in linkage disequilibrium, resulting in dysfunctional tryptase alleles being co-inherited with functional alleles (Trivedi et al. supra). Thus, subjects with zero or four active tryptase alleles are expected to be rare. Thus, the number of active tryptase alleles is not uniform in patients with moderate or severe asthma.

Example 3: The number of active tryptase alleles is a measure of protein derived from a specific gene (pQTL) for asthmatic peripheral blood tryptase levels.

We then assessed the relationship of tryptase active copy number to total peripheral blood tryptase levels in moderate or severe asthma from the BOBCAT (Fig. 2A) and MILLY (Fig. 2B) studies. A significant pQTL (P < 0.0001) was observed in each study, further associating that the number of active tryptase alleles is a major determinant of tryptase expression, and that asthma subjects with elevated numbers of active tryptase alleles are associated with elevated levels of tryptase expression. Thus, these data demonstrate that the expression level of peripheral blood tryptase (eg, in blood samples) correlates with the number of active tryptase alleles in a subject. Based on this correlation, it is expected that the level of tryptase expression, eg in blood (eg serum or plasma), can be used to predict response to treatment, eg anti-IgE therapy or other therapeutic interventions.

Example 4 Active Tryptase Allele Number Predicts FEV ₁ Asthmatic Response to Anti-IgE Therapy

Based on the finding that the number of active tryptase alleles correlates with ex vivo expression of active tryptase from primary mast cells and with peripheral blood levels of total tryptase in asthmatic patients (see Example 3), we hypothesized that the number of active tryptase alleles would predict clinical response to mast cell therapy in asthma. XOLAIR® (omalizumab) is an approved anti-IgE monoclonal antibody therapy to reduce exacerbations in atopic asthma. Because IgE blocking improves clinical asthma by reducing IgE/FcεRI-dependent degranulation from mast cells, we performed a post hoc analysis of improvement in FEV ₁ from baseline based on the number of active tryptase alleles. Since two and three active tryptase alleles were observed predominantly (88%) in asthma, and therefore subjects with one or four active tryptase alleles are relatively rare, we divided our study population into parts with 1 or 2 active tryptase alleles and 3 or 4 active tryptase alleles. to improve statistical power.

Subjects with one or two active tryptase alleles experienced a significant percentage improvement in FEV ₁ by week 12 of anti-IgE treatment (Fig. 3, mean ± standard error = 11.3 (3, 19.6)%, P=0.009) . In contrast, subjects with three or four active tryptase alleles received no effect on FEV ₁ from anti-IgE therapy (FIG. 3). These observations were consistent throughout the 48 weeks of the study. Thus, asthma patients with one or two active tryptase alleles showed significant improvement in lung function when treated with anti-IgE (XOLAIR®) compared to subjects with three or four copies.

Mast cell tryptase has been shown to directly affect airway smooth muscle, increasing contractility and cell differentiation in vitro, and hence is an important asthmatic mediator of airway obstruction. These data suggest that anti-IgE therapy may be most effective in subjects who express low levels of mast cell tryptase, which can be released by both IgE/FcεRI-dependent degranulation and IgE/FcεRI-independent mechanisms. These data also indicate that the number of active tryptase alleles can be used as a prognostic biomarker to predict response to asthma therapeutic interventions. For example, patients with a low number of active tryptase alleles are likely to benefit from XOLAIR® (omalizumab) therapy. In other examples, patients with a high number of active tryptase alleles may benefit from tryptase antagonist therapy (eg, anti-tryptase antibodies).

Example 5: The number of active tryptase alleles is not associated with type 2 biomarkers in moderate or severe asthma

Previous studies have shown that expression levels of type 2 biomarkers enriched for treatment benefit, i.e. reduce the frequency of exacerbations, with XOLAIR® (omalizumab) therapy for asthma (Hanania et al. Am. J. Respir. Crit. Care Med 187:804-811, 2013). To explore how the number of active tryptase alleles is associated with biomarkers of type 2 inflammation, we assessed serum periostin levels, exhaled nitric oxide fraction (FeNO), and blood eosinophil counts relative to the number of active tryptase alleles in subjects at baseline. from the BOBCAT, EXTRA and MILLY studies and found no relationship (FIGS. 4A-4C). These data indicate that various subpopulations of asthmatics are independently distinguished by the number of active tryptase alleles and type 2 biomarkers. The independence of tryptase active copy number from levels of type 2 inflammatory biomarkers suggests that evaluation of tryptase active copy number provides unique insights into tryptase and mast cell biology. For example, subjects with increased active tryptase alleles and low levels of type 2 biomarkers (eg, asthma with low T _H 2 levels) may benefit from mast cell-targeting therapy (eg, therapy that includes a tryptase antagonist, an antibody that depletes IgE ⁺ B cells, an antibody that depletes mast cells or basophils, or a protease-activated receptor 2 (PAR2) antagonist). Conversely, subjects with increased active tryptase alleles and high levels of type 2 biomarkers (eg, high _TH 2 asthma) may benefit from treatment with a _TH 2 pathway inhibitor and/or mast cell therapy.

Other embodiments

Although the foregoing invention has been described in some detail by way of illustration and examples for purposes of unambiguous understanding, the description and examples should not be taken as limiting the scope of the invention. The contents of all patents and scientific literature referenced in this document are expressly and in their entirety incorporated by reference.

Claims (191)

1. A method of treating a patient with an inflammatory disease mediated by mast cells, which has been identified as having (i) a genotype containing the number of active tryptase alleles equal to 3 or 4; or (ii) a tryptase expression level in a sample from a patient that is equal to or greater than a tryptase level that corresponds to an active tryptase allele count of 3 or 4, the method comprising administering to a patient with a mast cell-mediated inflammatory disease a therapy comprising a tryptase antagonist. 2. A method for determining whether a patient with a mast cell mediated inflammatory disease may respond to therapy comprising a tryptase antagonist, the method comprising: (a) determining in a sample from a patient with a mast cell-mediated inflammatory disease that the number of active tryptase alleles in the patient is 3 or 4; and then (b) identifying a patient with a likelihood of responding to a therapy comprising a tryptase antagonist, wherein the number of active tryptase alleles is 3 or 4, indicating that the patient has an increased likelihood of responding to therapy. 3. A method for determining whether a patient with a mast cell mediated inflammatory disease may respond to therapy comprising a tryptase antagonist, the method comprising: (a) determining the level of expression of tryptase in a sample from a patient with an inflammatory disease mediated by mast cells; And (b) identifying a patient with a likelihood of responding to therapy comprising a tryptase antagonist if the tryptase expression level in the sample from the patient corresponds to an expression level of the number of active tryptase alleles equal to 3 or 4, and the tryptase expression level in the sample is equal to or greater than the specified tryptase expression level , indicates that the patient has an increased likelihood of responding to therapy. 4. The method of claim 2 or 3 further comprising administering the therapy to the patient. 5. The method according to any one of paragraphs. 1-4 in which a patient has been identified as having a level of a type 2 biomarker in a patient sample that is below a reference level of a type 2 biomarker, where a reference level of a type 2 biomarker is the level of a biomarker in individuals who lack said inflammatory disease mediated by mast cells. 6. The method of claim 5 wherein the tryptase antagonist is administered to the patient as monotherapy. 7. The method according to any one of paragraphs. 1-4, wherein the patient has been identified as having a type 2 biomarker level in the patient sample that is equal to or greater than the reference level of the type 2 biomarker, wherein the reference level of the type 2 biomarker is the level of the biomarker in individuals lacking said mast cell-mediated inflammatory disease. 8. The method of claim 7, wherein the method further comprises administering an additional TH2 pathway inhibitor to the patient. 9. A method for selecting therapy for a patient with a mast cell mediated inflammatory disease, the method comprising: (a) determining, in a sample from a patient with a mast cell-mediated inflammatory disease, the number of active tryptase alleles in the patient; And (b) selecting for the patient a therapy comprising a tryptase antagonist if the number of active tryptase alleles in the patient is 3 or 4. 10. A method for selecting therapy for a patient with a mast cell mediated inflammatory disease, the method comprising: (a) determining the level of expression of tryptase in a sample from a patient with an inflammatory disease mediated by mast cells; And (b) selecting for the patient a therapy comprising a tryptase antagonist if the level of tryptase expression in the sample from the patient corresponds to a tryptase expression level of the number of active tryptase alleles equal to 3 or 4. 11. The method of claim 9 or 10, further comprising administering the therapy selected according to (b) to the patient. 12. The method according to any one of paragraphs. 9-11 in which a patient has been identified as having a level of a type 2 biomarker in a patient sample that is below a reference level of a type 2 biomarker, where a reference level of a type 2 biomarker is the level of a biomarker in individuals who lack said inflammatory disease mediated by mast cells. 13. The method of claim 12 wherein the tryptase antagonist is administered to the patient as monotherapy. 14. The method according to any one of paragraphs. 9-11, wherein the patient has been identified as having a level of a type 2 biomarker in a patient sample that is equal to or greater than a reference level of a type 2 biomarker, wherein the reference level of a type 2 biomarker is the level of the biomarker in individuals in which said mast cell-mediated inflammatory disease is absent, and the method further comprises selecting a combination therapy comprising a TH2 pathway inhibitor. 15. The method of claim 14, wherein the method further comprises administering a TH2 pathway inhibitor to the patient. 16. A method for monitoring the response of a patient with a mast cell mediated inflammatory disease being treated with a therapy comprising a tryptase antagonist, the method comprising: (a) determining the level of expression of tryptase in a sample from the patient during or after the use of therapy, including a tryptase antagonist; And (b) comparing the expression level of tryptase in a sample from a patient with a reference level of tryptase, where the reference level of tryptase corresponds to a tryptase expression level of the number of active tryptase alleles equal to 3 or 4, thus monitoring the response of the patient being treated with therapy. 17. The method according to any one of paragraphs. 1, 2, 4-9 and 11-15, in which the number of active tryptase alleles is determined by sequencing the TPSAB1 and TPSB2 loci of the patient's genome. 18. The method of claim 17, wherein the sequencing is Sanger sequencing or massively parallel sequencing. 19. The method of claim 17 or 18, wherein the TPSAB1 locus is sequenced using a method comprising (i) amplifying a nucleic acid from a subject in the presence of a first forward primer containing the nucleotide sequence of SEQ ID NO: 31 and a first reverse primer containing the nucleotide sequence the sequence of SEQ ID NO: 32, to obtain the TPSAB1 amplicon; and (ii) sequencing the TPSAB1 amplicon. 20. The method of claim 19 wherein sequencing the TPSAB1 amplicon comprises applying a first forward primer and a first reverse primer. 21. The method according to any one of paragraphs. 17-20, in which the TPSB2 locus is sequenced using a method comprising (i) amplifying a nucleic acid from a subject in the presence of a second forward primer containing the nucleotide sequence of SEQ ID NO: 33 and a second reverse primer containing the nucleotide sequence of SEQ ID NO: 34 , to obtain the TPSB2 amplicon; and (ii) sequencing the TPSB2 amplicon. 22. The method of claim 21 wherein sequencing the TPSB2 amplicon comprises using a second forward primer and a reverse sequencing primer comprising the nucleotide sequence of SEQ ID NO: 35. 23. The method according to any one of paragraphs. 1, 2, 4-9, 11-15 and 17-22, in which the number of active tryptase alleles is determined by the formula: 4 - the sum of the number of alleles of α-tryptase and βIII-tryptase with a frame shift (βIII ^FS ) in the patient's genotype. 24. The method of claim 23, wherein alpha tryptase is determined by detecting the c733 G>A SNP in TPSAB1 containing the nucleotide sequence of SEQ ID NO: 36, wherein the presence of A in the c733 G>A SNP indicates alpha tryptase. 25. The method according to claim 23 or 24, wherein beta-III ^FS -tryptase is determined by detecting the c980_981insC mutation in TPSB2 containing the nucleotide sequence of SEQ ID NO: 37 . 26. The method according to any one of paragraphs. 1, 3-8 and 10-16, wherein the tryptase is beta-I-tryptase, beta-II-tryptase, beta-III-tryptase, alpha-I-tryptase, or a combination thereof. 27. The method according to any one of paragraphs. 1, 3-8, 10-16 and 26, wherein the tryptase expression level is the protein expression level. 28. The method of claim 27, wherein the tryptase protein expression level is an active tryptase expression level. 29. The method of claim 27 wherein the tryptase protein expression level is total tryptase expression level. 30. The method according to any one of paragraphs. 27-29, in which the level of protein expression is measured using immunoassay, enzyme immunoassay (ELISA), Western blot or mass spectrometry. 31. The method according to any one of paragraphs. 1, 3-8, 10-16 and 26, wherein the tryptase expression level is the mRNA expression level. 32. The method of claim 31, wherein the mRNA expression level is measured using a polymerase chain reaction (PCR) method or a microarray chip. 33. The method of claim 32, wherein the PCR method is qPCR. 34. The method according to any one of paragraphs. 1-33, wherein the patient sample is selected from a blood sample, a tissue sample, a sputum sample, a bronchial lavage sample, a mucosal fluid (MLF) sample, a bronchosorption sample, and a nasosorption sample. 35. The method of claim 34, wherein the blood sample is a whole blood sample, a serum sample, a plasma sample, or a combination thereof. 36. The method of claim 35 wherein the blood sample is a serum sample or a plasma sample. 37. The method of any one of claims 1 to 36, wherein the tryptase antagonist is an alpha tryptase antagonist or a beta tryptase antagonist. 38. The method of claim 37, wherein the tryptase antagonist is a beta-tryptase antagonist. 39. The method of claim 37 or 38, wherein the beta-tryptase antagonist is an anti-beta-tryptase antibody or an antigen-binding fragment thereof. 40. The method of claim 39, wherein the antibody contains the following six hypervariable regions (HVRs): (a) HVR-H1 containing the amino acid sequence of SEQ ID NO: 1; (b) HVR-H2 containing the amino acid sequence of SEQ ID NO: 2; (c) HVR-H3 containing the amino acid sequence of SEQ ID NO: 3; (d) HVR-L1 containing the amino acid sequence of SEQ ID NO: 4; (e) HVR-L2 containing the amino acid sequence of SEQ ID NO: 5; And (f) HVR-L3 containing the amino acid sequence of SEQ ID NO: 6. 41. The method of claim 39 or 40, wherein the antibody comprises (a) a heavy chain variable domain (VH) comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 7; (b) a light chain variable domain (VL) comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 8; or (c) a VH domain as in (a) and a VL domain as in (b). 42. The method of claim 41, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 7. 43. The method of claim 41, wherein the VL domain contains the amino acid sequence of SEQ ID NO: 8. 44. The method of claim 41, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 7 and the VL domain contains the amino acid sequence of SEQ ID NO: 8. 45. The method according to any one of paragraphs. 39-42, in which the antibody contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 9, and (b) a light chain containing the amino acid sequence of SEQ ID NO: 10. 46. The method according to any one of paragraphs. 39-44, in which the antibody contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 11, and (b) a light chain containing the amino acid sequence of SEQ ID NO: 10. 47. The method of claim 39, wherein the antibody contains the following six HVRs: (a) HVR-H1 containing the amino acid sequence of SEQ ID NO: 12; (b) HVR-H2 containing the amino acid sequence of SEQ ID NO: 13; (c) HVR-H3 containing the amino acid sequence of SEQ ID NO: 14; (d) HVR-L1 containing the amino acid sequence of SEQ ID NO: 15; (e) HVR-L2 containing the amino acid sequence of SEQ ID NO: 16; And (f) HVR-L3 containing the amino acid sequence of SEQ ID NO: 17. 48. The method according to p. 39 or 47, in which the antibody contains (a) a VH domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO : 18; (b) a VL domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 19; or (c) a VH domain as in (a) and a VL domain as in (b). 49. The method of claim 48, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 18. 50. The method of claim 48, wherein the VL domain contains the amino acid sequence of SEQ ID NO: 19. 51. The method of claim 48, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 18 and the VL domain contains the amino acid sequence of SEQ ID NO: 19. 52. The method according to any one of paragraphs. 39 or 47-51, in which the antibody contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 20, and (b) a light chain containing the amino acid sequence of SEQ ID NO: 21. 53. The method according to any one of paragraphs. 39 or 47-51, in which the antibody contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 22, and (b) a light chain containing the amino acid sequence of SEQ ID NO: 21. 54. The method according to any one of paragraphs. 1-53, wherein the therapy further comprises an IgE antagonist. 55. The method of claim 54 wherein the IgE antagonist is an anti-IgE antibody. 56. The method of claim 55 wherein the anti-IgE antibody is an IgE blocking antibody and/or an IgE depleting antibody. 57. The method of claim 56, wherein the anti-IgE antibody contains the following six HVRs: (a) HVR-H1 containing the amino acid sequence of SEQ ID NO: 40; (b) HVR-H2 containing the amino acid sequence of SEQ ID NO: 41; (c) HVR-H3 containing the amino acid sequence of SEQ ID NO: 42; (d) HVR-L1 containing the amino acid sequence of SEQ ID NO: 43; (e) HVR-L2 containing the amino acid sequence of SEQ ID NO: 44; And (f) HVR-L3 containing the amino acid sequence of SEQ ID NO: 45. 58. The method of claim 56 or 57, wherein the anti-IgE antibody comprises (a) a VH domain comprising an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 38; (b) a VL domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 39; or (c) a VH domain as in (a) and a VL domain as in (b). 59. The method of claim 58, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 38. 60. The method of claim 58, wherein the VL domain contains the amino acid sequence of SEQ ID NO: 39. 61. The method of claim 58, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 38 and the VL domain contains the amino acid sequence of SEQ ID NO: 39. 62. The method according to any one of paragraphs. 55-61, wherein the anti-IgE antibody is omalizumab (XOLAIR®) or XmAb7195. 63. The method of claim 62 wherein the anti-IgE antibody is omalizumab (XOLAIR®). 64. The method according to any one of paragraphs. 5-8, 12-15 and 17-63, wherein the type 2 biomarker is a cell-associated TH2 cytokine, periostin, eosinophil count, eosinophil profile, FeNO, or IgE. 65. The method of claim 64 wherein the TH2 cell-associated cytokine is IL-13, IL-4, IL-9, or IL-5. 66. The method according to any one of paragraphs. 5-8, 12-15 and 17-65, wherein the TH2 pathway inhibitor inhibits interleukin-2 inducible T cell kinase (ITK), Bruton's tyrosine kinase (BTK), Janus kinase 1 (JAK1), GATA binding protein 3 ( GATA3), IL-9, IL-5, IL-13, IL-4, IL-33, OX40L, TSLP, IL-25, IL-9 receptor, IL-5 receptor, IL-4 alpha receptor, alpha-1 IL-13 receptor, IL-13 alpha-2 receptor, OX40, TSLP-R, IL-7R-alpha, IL-17RB, ST2, CCR3, CCR4, CRTH2, Flap, Syk-kinase; CCR4, TLR9 or GM-CSF. 67. The method according to any one of paragraphs. 1, 4-8 and 11-66, further comprising administering an additional therapeutic agent to the patient. 68. The method of claim 67, wherein the additional therapeutic agent is selected from an antibody that depletes IgE+ B cells, an antibody that depletes mast cells or basophils, a protease-activated receptor 2 (PAR2) antagonist, a corticosteroid, an antagonist that binds the IL-33 axis, a TRPA1 antagonist, a bronchodilator or an asthma symptom control drug, an immunomodulator, a tyrosine kinase inhibitor, and a phosphodiesterase inhibitor. 69. The method of claim 68 wherein the additional therapeutic agent is a corticosteroid. 70. The method of claim 68 or 69, wherein the corticosteroid is an inhaled corticosteroid. 71. The method according to any one of paragraphs. 1-70, wherein the mast cell-mediated inflammatory disease is selected from asthma, atopic dermatitis, chronic spontaneous urticaria (CSU), systemic anaphylaxis, mastocytosis, chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis (IPF), and eosinophilic esophagitis. 72. The method of claim 71 wherein the mast cell mediated inflammatory disease is asthma. 73. The method of claim 72, wherein the asthma is moderate to severe asthma. 74. The method according to any one of paragraphs. 71-73 in which asthma is not controlled by corticosteroids. 75. The method according to any one of paragraphs. 71-74, wherein asthma is high TH2 asthma or low TH2 asthma. 76. A kit for identifying a patient with a mast cell-mediated inflammatory disease that is likely to respond to therapy including a tryptase antagonist, the kit comprising: (a) reagents for determining the number of active tryptase alleles in a patient or for determining the level of expression of tryptase in a sample from a patient; and optionally (b) instructions for using reagents to identify a patient with a mast cell-mediated inflammatory disease that is likely to respond to therapy including a tryptase antagonist. 77. The kit of claim 76 wherein the therapy further comprises an IgE antagonist. 78. A kit according to claim 76 or 77, additionally containing reagents for determining the level of a type 2 biomarker in a sample from a patient. 79. The use of a tryptase antagonist for the manufacture of a medicament for the treatment of a patient with an inflammatory disease mediated by mast cells, and (i) it was determined that the patient's genotype contains the number of active tryptase alleles, which is equal to 3 or 4; or (ii) the sample from the patient was determined to have a tryptase expression level that is equal to or greater than the tryptase reference level, where the tryptase reference level corresponds to a tryptase expression level of the number of active tryptase alleles equal to 3 or 4. 80. The use of claim 79 wherein the patient has been determined to have a type 2 biomarker level in a patient sample that is below a reference level of a type 2 biomarker, where the reference level of a type 2 biomarker is the level of the biomarker in individuals who do not have said mast cell-mediated inflammatory disease and the drug is intended for use as monotherapy. 81. The use of claim 79 wherein the patient has been identified as having a type 2 biomarker level in the patient sample that is equal to or greater than the reference level of the type 2 biomarker, where the reference level of the type 2 biomarker is the level of the biomarker in individuals who do not have said mast cell-mediated inflammatory disease and the drug is intended for use in combination with a TH2 pathway inhibitor. 82. Application according to any one of paragraphs. 79-81, in which the number of active tryptase alleles is determined by sequencing the TPSAB1 and TPSB2 loci of the patient's genome. 83. The use of claim 82, wherein the sequencing is Sanger sequencing or massively parallel sequencing. 84. Use according to claim 82 or 83, wherein the TPSAB1 locus is sequenced by a method comprising (i) amplifying a nucleic acid from a subject in the presence of a first forward primer containing the nucleotide sequence of SEQ ID NO: 31 and a first reverse primer containing the nucleotide sequence the sequence of SEQ ID NO: 32, to obtain the TPSAB1 amplicon; and (ii) sequencing the TPSAB1 amplicon. 85. The use of claim 84, wherein sequencing the TPSAB1 amplicon includes applying a first forward primer and a first reverse primer. 86. Application according to any one of paragraphs. 82-85, in which the TPSB2 locus is sequenced using a method comprising (i) amplifying a nucleic acid from a subject in the presence of a second forward primer containing the nucleotide sequence of SEQ ID NO: 33 and a second reverse primer containing the nucleotide sequence of SEQ ID NO: 34 , to obtain the TPSB2 amplicon; and (ii) sequencing the TPSB2 amplicon. 87. The use of claim 86 wherein sequencing the TPSB2 amplicon comprises the use of a second forward primer and a reverse sequencing primer comprising the nucleotide sequence of SEQ ID NO: 35. 88. Application according to any one of paragraphs. 79-87, in which the number of active tryptase alleles is determined by the formula: 4 - the sum of the number of alleles of α-tryptase and βIII-tryptase with a frame shift (βIII ^FS ) in the patient's genotype. 89. The use of claim 88, wherein alpha tryptase is determined by detecting the c733 G>A SNP in TPSAB1 containing the nucleotide sequence of SEQ ID NO: 36, wherein the presence of A in the c733 G>A SNP indicates alpha tryptase. 90. Use according to claim 88 or 89, wherein beta-III ^FS -tryptase is determined by detecting the c980_981insC mutation in TPSB2 containing the nucleotide sequence of SEQ ID NO: 37 . 91. Application according to any one of paragraphs. 79-90, wherein the tryptase is beta-I-tryptase, beta-II-tryptase, beta-III-tryptase, alpha-I-tryptase, or a combination thereof. 92. Application according to any one of paragraphs. 79-91, wherein the tryptase expression level is the protein expression level. 93. The use of claim 92, wherein the expression level of the tryptase protein is the expression level of active tryptase. 94. The use of claim 92, wherein the tryptase protein expression level is total tryptase expression level. 95. Application according to any one of paragraphs. 92-94, in which the level of protein expression is measured using immunoassay, ELISA, Western blot or mass spectrometry. 96. Application according to any one of paragraphs. 79-91, in which the tryptase expression level is the mRNA expression level. 97. Use according to claim 96, wherein the level of mRNA expression is measured using a PCR method or a microarray chip. 98. Use according to claim 97, wherein the PCR method is qPCR. 99. Application according to any one of paragraphs. 79-98 wherein the patient sample is selected from a blood sample, a tissue sample, a sputum sample, a bronchial lavage sample, a mucosal fluid (MLF) sample, a bronchosorption sample, and a nasosorption sample. 100. The use of claim 99, wherein the blood sample is a whole blood sample, a serum sample, a plasma sample, or a combination thereof. 101. The use of claim 100 wherein the blood sample is a serum sample or a plasma sample. 102. Application according to any one of paragraphs. 79-101 wherein the tryptase antagonist is an alpha tryptase antagonist or a beta tryptase antagonist. 103. The use of claim 102, wherein the tryptase antagonist is a beta-tryptase antagonist. 104. Use according to claim 102 or 103, wherein the beta-tryptase antagonist is an anti-beta-tryptase antibody or an antigen-binding fragment thereof. 105. The use of claim 104, wherein the antibody contains the following six hypervariable regions (HVRs): (a) HVR-H1 containing the amino acid sequence of SEQ ID NO: 1; (b) HVR-H2 containing the amino acid sequence of SEQ ID NO: 2; (c) HVR-H3 containing the amino acid sequence of SEQ ID NO: 3; (d) HVR-L1 containing the amino acid sequence of SEQ ID NO: 4; (e) HVR-L2 containing the amino acid sequence of SEQ ID NO: 5; And (f) HVR-L3 containing the amino acid sequence of SEQ ID NO: 6. 106. Use according to claim 104 or 105, wherein the antibody contains (a) a VH domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO : 7; (b) a VL domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 8; or (c) a VH domain as in (a) and a VL domain as in (b). 107. The use of claim 106, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 7. 108. The use of claim 106, wherein the VL domain contains the amino acid sequence of SEQ ID NO: 8. 109. The use of claim 106, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 7 and the VL domain contains the amino acid sequence of SEQ ID NO: 8. 110. Application according to any one of paragraphs. 104-109, in which the antibody contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 9, and (b) a light chain containing the amino acid sequence of SEQ ID NO: 10. 111. Application according to any one of paragraphs. 104-109, in which the antibody contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 11, and (b) a light chain containing the amino acid sequence of SEQ ID NO: 10. 112. The use of claim 104, wherein the antibody contains the following six HVRs: (a) HVR-H1 containing the amino acid sequence of SEQ ID NO: 12; (b) HVR-H2 containing the amino acid sequence of SEQ ID NO: 13; (c) HVR-H3 containing the amino acid sequence of SEQ ID NO: 14; (d) HVR-L1 containing the amino acid sequence of SEQ ID NO: 15; (e) HVR-L2 containing the amino acid sequence of SEQ ID NO: 16; And (f) HVR-L3 containing the amino acid sequence of SEQ ID NO: 17. 113. Use according to claim 104 or 112, in which the antibody contains (a) a VH domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO : 18; (b) a VL domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 19; or (c) a VH domain as in (a) and a VL domain as in (b). 114. The use of claim 113, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 18. 115. The use of claim 113, wherein the VL domain contains the amino acid sequence of SEQ ID NO: 19. 116. The use of claim 113, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 18 and the VL domain contains the amino acid sequence of SEQ ID NO: 19. 117. Application according to any one of paragraphs. 104 and 112-116, in which the antibody contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 20, and (b) a light chain containing the amino acid sequence of SEQ ID NO: 21. 118. Application according to any one of paragraphs. 104 and 112-116, in which the antibody contains (a) a heavy chain containing the amino acid sequence of SEQ ID NO: 22, and (b) a light chain containing the amino acid sequence of SEQ ID NO: 21. 119. Application according to any one of paragraphs. 79-118, wherein the tryptase antagonist is to be used in combination with an IgE antagonist. 120. The use of claim 119 wherein the IgE antagonist is an anti-IgE antibody. 121. The use of claim 120 wherein the anti-IgE antibody is an IgE blocking and/or IgE depleting antibody. 122. The use of claim 121, wherein the anti-IgE antibody contains the following six HVRs: (a) HVR-H1 containing the amino acid sequence of SEQ ID NO: 40; (b) HVR-H2 containing the amino acid sequence of SEQ ID NO: 41; (c) HVR-H3 containing the amino acid sequence of SEQ ID NO: 42; (d) HVR-L1 containing the amino acid sequence of SEQ ID NO: 43; (e) HVR-L2 containing the amino acid sequence of SEQ ID NO: 44; And (f) HVR-L3 containing the amino acid sequence of SEQ ID NO: 45. 123. Use according to claim 121 or 122, wherein the anti-IgE antibody comprises (a) a VH domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 38; (b) a VL domain containing an amino acid sequence having at least 90%, at least 95%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 39; or (c) a VH domain as in (a) and a VL domain as in (b). 124. The use of claim 123, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 38. 125. The use of claim 123, wherein the VL domain contains the amino acid sequence of SEQ ID NO: 39. 126. The use of claim 123, wherein the VH domain contains the amino acid sequence of SEQ ID NO: 38 and the VL domain contains the amino acid sequence of SEQ ID NO: 39. 127. Application according to any one of paragraphs. 120-126, wherein the anti-IgE antibody is omalizumab (XOLAIR®) or XmAb7195. 128. The use of claim 127 wherein the anti-IgE antibody is omalizumab (XOLAIR®). 129. Application according to any one of paragraphs. 80-128, in which the type 2 biomarker is a cell-associated TH2 cytokine, periostin, eosinophil count, eosinophil profile, FeNO, or IgE. 130. The use of claim 129, wherein the cell-associated TH2 cytokine is IL-13, IL-4, IL-9, or IL-5. 131. Application according to any one of paragraphs. 81-130, wherein the TH2 pathway inhibitor inhibits interleukin-2 inducible T cell kinase (ITK), Bruton's tyrosine kinase (BTK), Janus kinase 1 (JAK1), GATA binding protein 3 (GATA3), IL-9, IL -5, IL-13, IL-4, IL-33, OX40L, TSLP, IL-25, IL-9 receptor, IL-5 receptor, IL-4 alpha receptor, IL-13 alpha-1 receptor, alpha-2 receptor IL-13, OX40, TSLP-R, IL-7R-alpha, IL-17RB, ST2, CCR3, CCR4, CRTH2, Flap, Syk-kinase; CCR4, TLR9 or GM-CSF. 132. Application according to any one of paragraphs. 79-131, wherein the drug is formulated for use with an additional therapeutic agent. 133. The use of claim 132, wherein the additional therapeutic agent is selected from an antibody that depletes IgE+ B cells, an antibody that depletes mast cells or basophils, a protease-activated receptor 2 (PAR2) antagonist, a corticosteroid, an antagonist that binds the IL-33 axis, a TRPA1 antagonist, a bronchodilator or an asthma symptom control drug, an immunomodulator, a tyrosine kinase inhibitor, and a phosphodiesterase inhibitor. 134. The use of claim 133, wherein the additional therapeutic agent is a corticosteroid. 135. Use according to claim 133 or 134, wherein the corticosteroid is an inhaled corticosteroid. 136. Application according to any one of paragraphs. 79-135, wherein the mast cell-mediated inflammatory disease is asthma, atopic dermatitis, chronic spontaneous urticaria (CSU), systemic anaphylaxis, mastocytosis, COPD, idiopathic pulmonary fibrosis (IPF), and eosinophilic esophagitis. 137. The use of claim 136 wherein the mast cell mediated inflammatory disease is asthma. 138. The use of claim 137, wherein the asthma is moderate to severe asthma. 139. Application according to any one of paragraphs. 136-138 in which asthma is not controlled by corticosteroids. 140. Application according to any one of paragraphs. 136-139, wherein asthma is high TH2 asthma or low TH2 asthma. 141. A method of treating a patient with asthma, comprising determining that the patient has i) a genotype containing the number of active tryptase alleles equal to 3 or 4; or (ii) a tryptase expression level in a sample from a patient that is equal to or greater than a tryptase level that corresponds to an active tryptase allele count of 3 or 4, and administering a tryptase antagonist to said patient for the treatment of asthma. 142. A method of treating a patient with asthma, comprising determining that the patient has either (i) a genotype containing the number of active tryptase alleles equal to 1 or 2; or (ii) a tryptase expression level in a sample from a patient that is equal to or greater than a tryptase level that corresponds to an active tryptase allele count of 1 or 2, and administering anti-IgE therapy to said patient for the treatment of asthma. 143. The method of claim 142, wherein the anti-IgE therapy is omalizumab (XOLAIR®).

Images