RU2789735C1 - Strain of bacteria escherichia coli - producer of recombinant protein ns1 - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: proposed is a recombinant plasmid DNA pET22b(+)-NS1-6×His for the expression of recombinant non-structural protein NS1 of the influenza A virus in Escherichia coli cells. Also proposed is a strain of Escherichia coli BL-21(DE3)-pET22b(+)-NS1 being a producer of recombinant non-structural protein NS1 of the influenza A virus and produced by transforming cells of Escherichia coli BL-21(DE3) with recombinant plasmid DNA pET22b(+)-NS1-6×His. Said strain is deposited in the Bioresource Centre of the Russian National Collection of Industrial Microorganisms (BRC RNCIM) of NRC Kurchatov Institute State Research Institute of Genetics under No. B-14117.

EFFECT: production of a storage-stable recombinant non-structural protein NS1 of influenza A usable as a target in the development of approaches to targeted antiviral therapy.

2 cl, 6 dwg

Description

Technical field

The invention relates to biotechnology, in particular to strains of microorganisms, in particular to a bacterial strain of Escherichia coli - a producer of recombinant non-structural protein NS1 of the influenza A virus, suitable for its use as a target in the development of new approaches to targeted antiviral therapy.

Prior Art

The NS1 protein is a key antagonist of the interferon system and is involved in multiple interactions with cellular proteins, the level of its production is considered as one of the main factors determining the pathogenicity of the influenza A virus. to antiviral therapy.

The eighth segment of the influenza A virus encodes at least two non-structural proteins NS1 and NS2 (NEP), the production ratio of which is regulated by splicing. Initially, continuous mRNA is transcribed from the vRNA of the NS segment, from which the production of NS1 is then started. Synthesis of the NS1 protein begins at the early stages of infection, and the level of production constantly increases throughout the entire life cycle of the virus [1]. At the same time, NEP is detected at later stages of the viral cycle, despite the fact that the ratio of spliced and unspliced forms of the NS gene mRNA is maintained at a constant level during infection [2]. According to published data, it is assumed that the balance of NS1 and NEP protein levels is crucial in the coordination of viral infection [3]. It has now been shown that both proteins are part of the influenza virus virion [4].

The influenza A virus NS1 protein is a multifunctional nonstructural protein that, through interaction with viral and cellular proteins, is involved in the regulation of splicing, export, and translation of viral mRNAs, counteracts the cellular response to infection, and disables a whole range of cellular defense mechanisms [5]. The NS1 protein belongs to the factors of virulence and interspecies adaptation of the virus, which is due to its effect on the immune response, as well as on the efficiency of replication and the degree of pathogenicity of the virus [6].

The NS1 sequence is conservative and varies from 215 to 237 amino acids, as there are strains of the influenza A virus with a shortened C-terminal region [6]; [7]. The protein consists of an N-terminal RNA-binding domain (RBD, RNA-binding domain, 73 a.a.), a linker domain (LR, linker domain, 10-15 a.a.), an effector domain (ED, effector domain, 88-202 a.a.) and a small unstructured C-terminal tail (CTT, C-terminal tail, 11-33 a.a.) [5]. RBD is formed by 3 α-helices and recognizes double-stranded RNA in the form of homodimers [8]. ED consists of 3 α-helices and 7 β-strands and mediates the interaction of NS1 with nuclear cell proteins [9]. Tryptophan at position 187 of the ED plays a key role in the oligomerization of NS1 proteins [6]. LD provides the spatial orientation of RBD and ED, which changes during infection and may affect the switching of NS1 activities [10].

In the cell, NS1 is mainly localized in the nucleus; however, at later stages of infection, the protein is also found in the cytoplasm [6]. It is assumed that the intracellular distribution of NS1 depends on the availability of signal sequences during its interaction with cellular proteins, as well as post-translational modifications [5]. A highly conserved nuclear localization signal (NLS) sequence in the RBD domain is recognized by the cellular protein importin-α and ensures active transport of NS1 into the nucleus [11]; [12]. Some strains are also characterized by the presence of an additional NLS and a competing nucleolar localization sequence (NoLS) signal at the C-terminus of the protein [12]. At position 138-147 a.a. the sequence of the nuclear export signal (NES, nuclear export signal) is located [13].

Suppression of the immune response of the infected cell also occurs as a result of multiple interactions of the NS1 protein with various cell signaling systems. Double-stranded RNA (lncRNA) in the cytoplasm is a key signal for the activation of the antiviral response of the cell, including the induction of interferons (IFN). The NS1 protein directly and through binding to viral RNA inhibits the ability of intracellular sensors such as protein kinase PKR [14], RIG-1-like receptors [15]; [16] and 2'-5'-oligoadenylate synthase (OAS, 2'-5'-oligoadenylate synthase) [17] to recognize lncRNA. In addition, NS1 blocks cellular proteins that regulate the activation of intracellular sensors, including protein kinase activator PACT [18], TRIM25 ubiquitin ligase [19], and antiviral factor NF90 [20]. Thus, numerous interactions of NS1 with cellular proteins allow the virus to remain unnoticed in the infected cell, creating conditions for efficient virus replication.

An important component of the innate response is the expression of interferons, which are secreted by infected cells in response to viral entry. NS1 is the main antagonist of the type I interferon system (INF-α/β). This was established due to the development of reverse genetics, when it was possible to obtain and characterize recombinant viruses carrying a deletion of the NS1 gene (delNS1) [21] or its truncated form [22]. Such viruses exhibited attenuated properties and induced higher levels of interferon expression compared to wild-type HAV strains in interferon-competent systems. In interferon-deficient living systems such as Vero cell culture, developing chick embryos, and STAT1-knockout mice (delNS1), recombinant and wild-type viruses exhibited the same infectious properties [21]; [22].

Interferon induction is inhibited at the co- and post-transcriptional levels of expression. NS1 inhibits the activation pathways of the transcription factors IRF-3 [23], NF-kB [24], and AP-1 [25] required to initiate transcription of IFN-mRNA. In the NS1 protein of the A/H3N2 viruses, an H3-histone-like sequence was identified that, by the principle of molecular mimicry, interacts with the PAF1 transcription elongation complex (PAF1C) and causes suppression of cellular genes [26]. In addition, it was shown that the NS1 protein can nonspecifically bind to cellular DNA and thereby disrupt the assembly of the cellular transcription machinery [27].

As mentioned above, NS1 negatively affects the processing and transport of cellular mRNAs. The protein interacts with the 30-kDa subunit of the cleavage and polyadenylation specificity factor (CPSF) [28]; [29] and poly(A)-binding protein PABPII [30], thus preventing polyadenylation of cellular mRNAs. This process does not impair the efficiency of viral gene expression, since cellular machinery is not involved in the maturation of the 3'-ends of viral mRNAs. In addition, NS1 directly interacts with spliceosome components: with U2 and U6 small nuclear RNAs [31] and with the splicing regulator protein SF2 [32]. It is assumed that NS1 disrupts the assembly of the spliceosome on cellular mRNA and regulates the splicing of viral mRNA [33]; [34]. Blocking of the transport of host mRNAs from the nucleus occurs due to the formation of the NS1 complex with the cellular mRNA export proteins: NXF-1, RAE-1, p15, Nup98, and E1B-AP5 [35].

Triggering of apoptosis by an infected cell is one of the key antiviral mechanisms aimed at limiting viral replication. It is known that viruses use various strategies to delay cell apoptosis in the early stages of infection [6]. According to published studies, NS1 activates the phosphatidylinositol-3-kinase signaling pathway (PI3K, phosphoinositide 3-kinase), which prevents premature apoptosis and thus promotes the full cycle of viral replication [36]. Previously, it was demonstrated that NS1 interacts with the p85β PI3K regulatory subunit either by direct binding or by the formation of the NS1/PI3K/Crk (Crkl) complex through the N-terminal SH3 domain of the Crk/Crkl proteins [37]. NS1 also increases cell survival through interaction with the serine/threonine Akt protein kinase and the p53 protein [38]; [39]. In contrast to its antiapoptotic properties, NS1 is able to bind to the heat shock protein HSP90 [40] and α-tubulin [41], which, on the contrary, can promote the initiation of apoptosis.

Another role of the NS1 protein is to enhance the translation of viral mRNAs. NS1 selectively recognizes conserved sequences on the 5'-UTR and also interacts with cellular proteins involved in translation, such as the translation factor eIF4GI [42], the poly(A)-binding protein PABPI [43], and lncRNA-recognition protein hStaufen, which provides transport mRNA to active translation sites [44].

Known MDCK cell-producer of influenza virus proteins [45], containing the lentiviral plasmid vector pLenti6.3/TO/HA(H1N1)-M1-NA, containing the genes for hemagglutinin, neuraminidase and M1 protein of the influenza virus (H1N1). Described is an MDCK cell producing influenza virus proteins containing the pLenti6.3/TO/HA(H3N2)-M1-NA lentiviral plasmid vector containing the cloned hemagglutinin gene from the H3N2 subtype strain, as well as the neuraminidase and M1 protein genes of the H1N1 subtype strain. Described is an MDCK cell producing influenza virus proteins containing the pLenti6.3/TO/HA(B-)-M1-NA lentiviral plasmid vector containing the influenza B hemagglutinin gene, as well as the neuraminidase and Ml genes of the H1N1 influenza virus protein.

The technical problem is the need to develop a strain-producer of the recombinant non-structural protein NS1 of the influenza A virus, as well as to expand the range of means for obtaining the non-structural protein NS1 of the influenza A virus.

The technical result consists in obtaining a strain of bacteria Escherichia coli BL-21(DE3)-pET22b(+)-NS1 - a producer of recombinant non-structural protein NS1 of the influenza A virus.

The technical result is achieved by the proposed recombinant plasmid DNA pET-22b(+)-NS1-6×His for expression in E. coli cells of the recombinant non-structural protein NS1 of the influenza A virus, having a plasmid map, as shown in Fig. 1, including the following sections:

- β-lactamase gene (AmpR), which determines the resistance of bacterial cells to ampicillin;

- site of replication initiation (ori);

- ROP gene that regulates the copy number of the plasmid;

- fragment containing T7 transcription terminator;

- transcriptional repressor LacI, which regulates the transcription of the T7lac promoter;

- NdeI/XhoI fragment containing the artificial NS1 gene;

- NdeI/XhoI fragment encoding the recombinant non-structural protein NS1 of the influenza A virus, in which the nucleotide sequence corresponds to SEQ ID NO:1.

The technical result is also achieved by the fact that the proposed strain Escherichia coli BL-21(DE3)-pET22b(+)-NS1 is a producer of a recombinant protein with the sequence NS1, while the strain is obtained by transforming cells of the E. coli strain BL-21(DE3) recombinant pET22b(+)-NS1 plasmid DNA having the map shown in FIG. 1. This strain was deposited in the Bioresource Center of the All-Russian Collection of Industrial Microorganisms (BRC VKPM) of the National Research Center "Kurchatov Institute" - GosNIIgenetika under No. B-14117.

Description of figures

Fig. 1. Map of recombinant plasmid DNA pET-22b(+)-NS1-6×His.

Fig. Fig. 2. Electropherogram of fractions of lysates of the NS1 producer strain (E. coli BL-21). Production of recombinant protein NS1-6×His. Cell lysate before the addition of the inductor, cell lysate 3 hours and 9 hours after the addition of the inducer.

Fig. 3. Determination of NS1 protein in infected A549 and NS1-6xHis cells by immunoblotting. Tracks: No. 1 - uninfected A549 cells; No. 2, 3, 4 - A549 cells infected with a laboratory strain of influenza virus A/Puerto Rico/8/1934 H1N1 at a dose corresponding to 1TID ₅₀ /cell 3, 6, 9 hours after infection; No. 5 - 0.5 μg of recombinant protein NS1-6×His; No. 6 - 0.1 μg of recombinant protein NS1-6×His.

Fig. 4. Electropherogram of the purified recombinant NS1 protein. Lane 1 - protein molecular weight marker Precision Plus Protein Unstained, 10-250 kDa (Bio-Rad, USA), lane 2 - target protein NS1-6×His.

Fig. 5. Affinity of 1H7 antibodies to the recombinant NS1 protein.

Fig. 6. Determination of NS1 protein in the lungs of infected mice by ELISA sandwich method.

Description of the invention

Proposed recombinant plasmid DNA pET-22b(+)-NS1-6×His for expression in E. coli cells of recombinant non-structural protein NS1 of influenza A virus, having a plasmid map, as shown in Fig. 1, including the following sections:

- β-lactamase gene (AmpR), which determines the resistance of bacterial cells to ampicillin;

- site of replication initiation (ori);

- ROP gene that regulates the copy number of the plasmid;

- fragment containing T7 transcription terminator;

- transcriptional repressor LacI, which regulates the transcription of the T7lac promoter;

- NdeI/XhoI fragment containing the artificial NS1 gene;

- NdeI/XhoI fragment encoding recombinant NS1 protein, in which the nucleotide sequence corresponds to SEQ ID NO:1.

In addition, according to the invention, a strain of Escherichia coli BL-21(DE3)-pET22b(+)-NS1 is proposed, a producer of a recombinant protein with the NS1 sequence, while the strain is obtained by transforming cells of the E. coli strain BL-21(DE3) with a recombinant plasmid pET-22b(+)-NS1-6xHis DNA having the map shown in FIG. 1.

The technical problem lies in the need to develop an effective method for obtaining a producer strain of recombinant non-structural protein NS1 of influenza A virus using recombinant plasmid DNA pET-22b(+)-NS1-6×His and available producer cells, for example, E. coli.

The technical result consists in obtaining a producer strain of Escherichia coli BL-21(DE3)-pET22b(+)-NS1, which is a producer of recombinant non-structural protein NS1 of influenza A virus.

The technical result is achieved due to the fact that by transforming Escherichia coli cells with recombinant plasmid DNA pET-22b(+)-NS1-6×His, an E. coli strain BL-21(DE3)-pET22b(+)-NS1 is obtained, which is a producer recombinant non-structural protein NS1 of the influenza A virus. This strain was deposited with the Bioresource Center of the All-Russian Collection of Industrial Microorganisms (BRC VKPM) of the National Research Center "Kurchatov Institute" - GosNIIgenetika under No. B-14117.

Also, the technical result is achieved due to the fact that in order to transform E. coli cells in order to obtain a recombinant non-structural protein NS1 of the influenza A virus, they synthesize and encode into the recombinant plasmid DNA pET-22b (+) an optimized in silico sequence of SEQ ID NO: 1 encoding the recombinant non-structural protein NS1 of the influenza A virus with the sequence SEQ ID NO:2, and the recombinant plasmid DNA contains a sequence encoding a polyhistidine tag at the C-terminus of the synthesized protein. Next, a DNA construct pET-22b(+)-NS1-6×His is obtained, with the help of which the E. coli cell culture is transformed with subsequent production of the E. coli BL-21(DE3)-pET22b(+)-NS1 producer strain. The obtained recombinant non-structural protein NS1 of the influenza A virus is stable during storage and can be used as a target in the development of new approaches to targeted antiviral therapy.

Hereinafter, a method for producing recombinant plasmid DNA pET-22b(+)-NS1-6×His and recombinant non-structural protein NS1 of influenza A virus will be described by way of examples, which are intended to illustrate the invention and do not limit it in any way.

Preparation of recombinant plasmid DNA pET22b(+)-NS1-6 × His

The Escherichia coli BL21[DE3]pet22b(+)-NS1 strain is a producer of a recombinant protein with the NS1 sequence of influenza virus A/Puerto Rico/8/1934 (H1N1), while the strain was obtained by electroporation of cells of the E. coli strain BL-21(DE3 ) recombinant plasmid DNA pET22b(+)-NS1-6xHis having the map shown in FIG. 1.

The final amino acid sequence of the recombinant protein encoded by the recombinant plasmid DNA pET22b(+)-NS1-6xHis is shown in SEQ ID NO:2.

The DNA fragment encoding the influenza A virus NS gene was synthesized by polymerase chain reaction. For this, we used the A/Puerto Rico/8/1934 (H1N1) strain obtained from the collection of viruses of the Federal State Budgetary Institution “Influenza Research Institute named after N.N. A.A. Smorodintsev" of the Ministry of Health of Russia. The primer sequences used to amplify the target fragment contained restriction sites at the 5' ends: the Nde I restriction site in the forward primer (5'-AACCTTCATATggATCCAAACACTgTg-3' - SEQ ID NO:3) and the Xho I restriction site in the reverse primer (5 '-TTAACTCgAgAACTTCTgACCTAATTgTTC-3' - SEQ ID NO:4). PCR was performed using a Bio-Rad C1000 thermal cycler, high fidelity Q5 DNA polymerase (NEB, #M0491S) and 5× Q5 reaction buffer (NEB, #B9027S) according to the manufacturer's recommendations. Next, electrophoretic separation of the PCR product in 1% agarose in 1x TBE buffer at room temperature was carried out, followed by extraction of the amplicon from the gel using the Cleanup Standard kit (Evrogen, BC022).

The following enzymes were used to carry out the ligation reaction: restriction enzymes Xho I Fast Digest (Thermo Fisher Scientific, #FD0695) and Nde I Fast Digest (Thermo Fisher Scientific, #FD0585) and T4 DNA ligase (NEB, #M0202L). Electroporation of the DH5a bacterial culture was performed according to the manufacturer's protocol (Bio-Rad, #1652100). Next, the selection of bacterial clones was carried out in the presence of an antibiotic (ampicillin, 100 µg/ml). Isolation of plasmid DNA was carried out using Qiagen (#12943) and Eurogen (#BC021) kits, followed by confirmation of the introduced mutations by Sanger sequencing. The sequencing procedure was performed using T7 primers at the Evrogen company (Moscow).

Reagents:

1. Enzymes:

Q5® High-Fidelity DNA Polymerase (NEB, M0491S);

5x Q5 Reaction Buffer (NEB, B9027S)

Xho I Fast Digest (Thermo Fisher Scientific, FD0695)

Nde I Fast Digest (Thermo Fisher Scientific, FD0585)

Fast Digest Buffer (10×, Thermo Fisher Scientific, B64)

T4 DNA Ligase (NEB, M0202L)

T4 DNA Ligase Buffer (10×, NEB, B0202S)

2. Plasmids:

pET-22b+

pHW2006 encoding the NS gene segment of influenza A/Puerto Rico/8/1934(H1N1).

3. Primers:

cl-NS1-Nde1-F AACCTTCATATggATCCAAACACTgTg (SEQ ID NO:3)

cl-NS1-Xho1-R TTAACTCgAgAACTTCTgACCTAATTgTTC (SEQ ID NO:4)

4. Bacterial cultures:

DH5a, BL-21(DE3)

5. Sets:

Kit for isolation and purification of plasmid DNA from E. coli culture “Plasmid Miniprep” (Evrogen, BC021);

Kits for DNA purification from agarose gel and reaction mixtures “Cleanup Standard” (Evrogen, BC022);

PCR program:

98°C - 30 seconds

98°C - 10 seconds

53°C - 20 seconds

72°C - 20 seconds

25 cycles

72°C - 1 minute

Conditions for cultivating recombinant non-structural protein NS1 of influenza A virus in a bioreactor

The initial seed culture of E. coli BL-21(DE3) cells containing pET-22b(+)-NS1-6×His was incubated for 8 h at 37°C. To obtain an inoculum for cultivation in the bioreactor, 200 μl of the seed culture was transferred into 250 ml Erlenmeyer flasks containing 50 ml of Luria-Bertani (LB) medium. Medium composition: 5 g/l yeast extract, 10 g/l trypton, 10 g/l NaCl and 100 mg/l ampicillin.

The optimal conditions for obtaining the recombinant protein were obtained by culturing bacterial cells in a 10-liter fermenter (BioFlo / CelliGen 115, New Brunswick). An overnight seed culture was used to inoculate 8 liters of culture medium (pH 7.4) containing (g/l): casein hydrolyzate - 15; yeast extract - 7.5; NaCl - 7; glucose - 5; NH ₄ Cl - 1; MgSO ₄ - 0.24; KH ₂ PO ₄ × 1H ₂ O - 3; Na ₂ HPO ₄ × 2H ₂ O - 14.3; and ampicillin - 0.1. The bioprocess was controlled by the following parameters: the concentration of dissolved oxygen in the culture medium and pH. The concentration of dissolved oxygen was maintained by varying the air flow rate and the speed of rotation of the agitator. The pH of the medium was constantly maintained in the range of values from 6.9 to 7.0 by adding 1 M solution of H ₃ PO ₄ or 2M NaOH solution. The time of adding additional carbon sources to the medium was determined by increasing the concentration of dissolved oxygen and decreasing the pH in the culture medium. Then the temperature was lowered to 32°C and IPTG was added to a concentration of 1 mM, and then additional carbon sources were added to the culture medium (casein hydrolyzate - 1.5 g/l, yeast extract - 0.75 g/l and glycerol 6 g/l ) and continued cultivation. After adding the inductor, the cultivation process was carried out for 3 hours. The total duration of cultivation in the bioreactor was 8 hours.

Purification and refolding of recombinant non-structural protein NS1 of influenza A virus

Chromatographic purification of recombinant influenza A virus NS1 nonstructural protein was performed using metal affinity chromatography followed by buffer exchange by gel filtration on a GE Healthcare AKTA Start chromatographic system. The cells were pelleted by centrifugation, then the wet pellet was resuspended in denaturing buffer (30 mM sodium phosphate, pH 7.5, 750 mM sodium chloride, 20 mM imidazole, 1 mM PMSF) at a ratio of 10 ml of buffer per 1 g of cells, and the suspension was sonicated for ice bath (ultrasonic homogenizer MSE). 10 cycles were carried out: on for 1 minute, turned off for 1 minute. Further, the resulting lysate was clarified by centrifugation for 1 hour at +4°C with an acceleration of 13000 g (Eppendorf 5810R centrifuge).

A 1 ml HisTrap FF Crude chromatography column (GE Healthcare, USA) was equilibrated with 5 ml starting buffer (30 mM sodium phosphate, 750 mM sodium chloride, 20 mM imidazole, pH 7.5, 1 mM PMSF) at a flow rate of 1 ml/min . Further, the clarified lysate was introduced into the column at the same flow rate, after which the column was washed with 20 ml of starting buffer at a flow rate of 1 ml/min. The target protein was eluted with 10 ml of elution buffer (30 mM sodium phosphate, 750 mM sodium chloride, 500 mM imidazole, pH 7.5) at a flow rate of 1 ml/min, and 0.5 ml fractions were collected during the elution. Fractions containing the target protein were identified by denaturing PAAG, pooled, and passed through a Sartorius syringe filter (diameter 33 mm, PES membrane, pore size 0.22 µm). The recombinant nonstructural protein NS1 of the influenza A virus was further purified by gel filtration using an AKTA Pure chromatograph (GE Healthcare, USA). An XK 16/60 chromatographic column filled with 120 ml of Sephadex S-200 HR sorbent (globular protein fractionation range 5–250 kDa) was washed successively with 120 ml of distilled water and 240 ml of 2× PBS. The recombinant protein was then loaded onto the column with a 5 ml loop and eluted with 180 ml 2x PBS. Fractions of 2.5 ml were collected during the elution. The presence of protein in the eluate was monitored by absorbance at a wavelength of 280 nm using a flow UV detector with an optical path length of 2 mm. Fractions were analyzed by denaturing electrophoresis in PAAG. Fractions containing pure target protein without impurities were pooled. The column was calibrated using a mixture of standard proteins (GE Gel Filtration Calibration Kit) according to the manufacturer's instructions.

Analysis of the obtained recombinant non-structural protein NS1 of the influenza A virus

PAAG electrophoresis

Analysis of the purity of the obtained recombinant nonstructural protein NS1 of the influenza A virus was carried out by PAGE electrophoresis according to the Laemmli method under reducing conditions [46]. For this purpose, TGX anyKD pre-filled gels, a PowerPac Basic DC source, and a Mini Protean Tetra PAGE electrophoresis chamber manufactured by Bio-Rad were used. The gel was stained with a Coomassie dye solution as described in [47], after which it was washed and visualized using the ChemiDoc MP gel documentation system and analyzed using the Bio-Rad Image Lab Software. The theoretical mass of the protein is 25 kDa. On FIG. 2 shows the preparation before chromatographic purification, FIG. Figure 4 shows the purified recombinant influenza A virus NS1 protein.

MALDI-TOF

The amino acid sequence of the recombinant non-structural protein NS1 influenza virus A SEQ ID NO:2 was confirmed using MALDI-TOF. The gel fragments were excised and washed twice from the dye using a solution containing 30 mm NH ₄ HCO ₃ and 40% acetonitrile. After that, the gel piece was dehydrated with 100% acetonitrile, dried in air and subjected to enzymatic cleavage with trypsin or chymotrypsin. Trypsin (20 μg/ml in 50 mM NH ₄ HCO ₃ ) was added to the gel and incubated for 2 hours at 60°C. Incubation with chymotrypsin (20 μg/ml in 100 mM Tris-HCl, 1 mM CaCl ₂ , pH 8.0) was carried out for 18 h at 25°C. In both cases, the reaction was stopped with 1% TFA, 10% acetonitrile. Peptides after enzymatic cleavage were mixed with an HCCA matrix, deposited on a metal target, and mass spectra were recorded in the reflective positive ion detection mode using a MALDI-TOF UltrafleXtreme mass spectrometer (Bruker). The spectra were processed using the flexAnalysis program (Bruker). Protein identification was performed in BioTools (Bruker) using MASCOT (http://www.matrixscience.com/). It should be noted that the amino acid sequence of the recombinant protein SEQ ID NO:2 was added to the local database, and two databases (local and SwissProt, https://www.uniprot.org/) were used simultaneously in the identification process. The weight tolerance was set at 20 ppm, the methionine oxidation is labeled as a variable modification. Identification was considered reliable if the Score of the spectra exceeded the threshold value (p <0.05).

ELISA

1H7 antibodies were adsorbed to the bottom of the plate (kindly provided by the laboratory of biotechnology of diagnostic preparations of the A.A. Smorodintsev Research Institute of Influenza, Ministry of Health of Russia). After blocking with 5% milk, test samples of lung suspension diluted 50, 100, 200, and 400 times in PBST buffer (PBS containing 0.1% Tween-20) were added to the wells of the plate, as well as sequential two-fold dilutions of the resulting recombinant NS1 protein -6×his. To detect the NS1 protein, a high-titer rabbit antiserum to the NS1 protein (obtained in the framework of previous works) and horseradish peroxidase-labeled Goat Anti-Rabbit IgG (H+L)-HRP Conjugate (Bio-Rad, #1706515) (Fig. 5) were used. .

Immunoblotting

A daily monolayer of A549 cells in 6-well plates was infected with the A/Puerto Rico/8/1934 (H1N1) virus at a dose of 1.0 TID ₅₀ /cell, in three independent repetitions for each virus. At 3, 6 and 9 hours after infection, the cells were carefully removed with a scraper and then dissolved in PBS. Measurement of total protein concentration was performed using the Lowry method using the DC Protein Assay Kit I (Bio-Rad, #5000111). The samples were mixed with Laemmli's buffer containing beta-mercaptoethanol, and the proteins were denatured at 95°C for 5 minutes in a Gnome solid-state thermostat (DNA-Technology, Russia). Wells of Any kD Mini-PROTEAN TGX Stain-Free precast Protein Gel (Bio-Rad, #4568121) were coated with 0.5 µg protein from each infected cell sample and 0.5/0.1 µg recombinant NS1-6 protein ×His. Separation of proteins was carried out in a Mini-PROTEAN Tetra Vertical Electrophoresis Cell (Bio-Rad) at the following parameters: 25 mA per gel, 220 V. Cellular proteins were separated by electrophoresis in PAAG, after which they were transferred to a nitrocellulose membrane and stained with monoclonal antibodies 1H7 to NS1 [48]. For subsequent protein visualization, a horseradish peroxidase-labeled goat anti-mouse IgG conjugate (Goat Anti-Mouse IgG (H+L)-HRP Conjugate, Bio-Rad #1721011) was used. The membranes were developed with the Clarity Western ECL Substrate (Bio-Rad). A photograph of the membranes was taken using the ChemiDoc MP imaging system (Bio-Rad) (FIG. 3).

Infection of laboratory animals

Female mice of the BALB/c lines (weighing 17-20 grams) at the age of 6-8 weeks were obtained from the nursery "Stolbovaya" of the Federal State Budgetary Institution "Scientific Center for Biomedical Technologies" of the Federal Medical and Biological Agency of Russia. Animals were infected with a laboratory strain of influenza virus A/Puerto Rico/8/1934 (H1N1) at a dose of 10 MID ₅₀ (calculated from the MID ₅₀ value for this batch of mice). On the second day after infection, the animals were euthanized and the lungs were removed. Animal lung homogenization was performed using a Tissue Lyser II device (Qiagen) in a sterile DPBS solution (Biolot). A 10% suspension clarified by centrifugation (3000 rpm, 10 min) was used for the determination of NS1 protein by ELISA (Fig. 6).

Bibliography

1 . Robb, Nicole C., David Jackson, Frank T. Vreede, and Ervin Fodor. 2010. “Splicing of Influenza A Virus NS1 MRNA Is Independent of the Viral NS1 Protein.” Journal of General Virology 91(9): 2331-40.

2. Huang, Xiaofeng et al. 2017. “An NS-Segment Exonic Splicing Enhancer Regulates Influenza A Virus Replication in Mammalian Cells.” Nature Communications 8:1-15.

3. Chua, Mark A. et al. 2013. “Influenza A Virus Utilizes Suboptimal Splicing to Coordinate the Timing of Infection.” Cell Reports 3(1): 23-29. http://dx.doi.org/10.1016/j.celrep.2012.12.010.

4. Eisfeld, Amie J., Gabriele Neumann, and Yoshihiro Kawaoka. 2015. “At the Centre: Influenza A Virus Ribonucleoproteins.” Nature Reviews Microbiology 13(1): 28-41.

5. Klemm, Carolin, Yvonne Boergeling, Stephan Ludwig, and Christina Ehrhardt. 2018. “Immunomodulatory Nonstructural Proteins of Influenza A Viruses.” Trends in Microbiology 26(7): 624-36.

, and D. Jackson. 2008. The Multifunctional NS1 Protein of Influenza A Viruses. Society for General Microbiology.6. Hale, BG, RE Randall, J.

, and D. Jackson. 2008. The Multifunctional NS1 Protein of Influenza A Viruses. Society for General Microbiology.

7. Vasin, A.V. et al. 2017. “Evolutionary Dynamics of the Structural and Functional Domains of the Ns1 Protein in Human Influenza Viruses.” Issues of Virology 62(15): 246-58.

8. Hale, Benjamin G. 2014. “Conformational Plasticity of the Influenza A Virus NS1 Protein.” Journal of General Virology 95(10): 2099-2105. https://www.microbiologyresearch.org/content/journal/jgv/10.1099/vir.0.066282-0 (October 25, 2020).

9. Bornholdt, Zachary A., and B. V. Venkataram Prasad. 2006. “X-Ray Structure of Influenza Virus NS1 Effector Domain.” Nature Structural and Molecular Biology 13(6): 559-60. https://www.nature.com/articles/nsmb1099 (October 26, 2020).

10. Carrillo, B. et al. 2014. “The Influenza A Virus Protein NS1 Displays Structural Polymorphism.” Journal of Virology 88(8): 4113-22. http://jvi.asm.org/ (October 25, 2020).

11. Greenspan, D, P Palese, and M Krystal. 1988. “Two Nuclear Location Signals in the Influenza Virus NS1 Nonstructural Protein.” Journal of Virology 62(8): 3020-26.

, Krister et al. 2007. “Nuclear and Nucleolar Targeting of Influenza A Virus NS1 Protein: Striking Differences between Different Virus Subtypes.” Journal of Virology 81(11): 5995-6006. http://jvi.asm.org/ (October 25, 2020).12.

, Christer et al. 2007. “Nuclear and Nucleolar Targeting of Influenza A Virus NS1 Protein: Striking Differences between Different Virus Subtypes.” Journal of Virology 81(11): 5995-6006. http://jvi.asm.org/ (October 25, 2020).

13. Li, Yongzhong, Yoshihiko Yamakita, and Robert M. Krug. 1998. “Regulation of a Nuclear Export Signal by an Adjacent Inhibitory Sequence: The Effector Domain of the Influenza Virus NS1 Protein.” Proceedings of the National Academy of Sciences of the United States of America 95(9): 4864-69. www.pnas.org. (October 25, 2020).

14. Min, Ji Young, Shoudong Li, Ganes C. Sen, and Robert M. Krug. 2007. “A Site on the Influenza A Virus NS1 Protein Mediates Both Inhibition of PKR Activation and Temporal Regulation of Viral RNA Synthesis.” Virology 363(1): 236-43.

15 Guo, Zhu et al. 2007. “NS1 Protein of Influenza A Virus Inhibits the Function of Intracytoplasmic Pathogen Sensor, RIG-I.” American Journal of Respiratory Cell and Molecular Biology 36(3): 263-69. http://www.atsjournals.org/doi/abs/10.1165/rcmb.2006-0283RC (October 26, 2020).

16. Mibayashi, Masaki et al. 2007. “Inhibition of Retinoic Acid-Inducible Gene I-Mediated Induction of Beta Interferon by the NS1 Protein of Influenza A Virus.” Journal of Virology 81(2): 514-24. http://jvi.asm.org/ (October 26, 2020).

17. Min, Ji Young, and Robert M. Krug. 2006. “The Primary Function of RNA Binding by the Influenza A Virus NS1 Protein in Infected Cells: Inhibiting the 2'-5' Oligo (A) Synthetase/RNase L Pathway.” Proceedings of the National Academy of Sciences of the United States of America 103(18): 7100-7105. www.pnas.orgcgidoi10.1073pnas.0602184103 (October 26, 2020).

18. Tawaratsumida, K. et al. 2014. “Quantitative Proteomic Analysis of the Influenza A Virus Nonstructural Proteins NS1 and NS2 during Natural Cell Infection Identifies PACT as an NS1 Target Protein and Antiviral Host Factor.” Journal of Virology 88(16): 9038-48. http://dx.doi.org/10.1128 (October 26, 2020).

19 Rajsbaum, Ricardo et al. 2012. “Species-Specific Inhibition of RIG-I Ubiquitination and IFN Induction by the Influenza A Virus NS1 Protein” ed. Andrew Pekosz. PLoS Pathogens 8(11): e1003059. https://dx.plos.org/10.1371/journal.ppat.1003059 (October 26, 2020).

20 Li, Ting et al. 2016. “NF90 Is a Novel Influenza A Virus NS1-interacting Protein That Antagonizes the Inhibitory Role of NS1 on PKR Phosphorylation.” FEBS Letters 590(16): 2797-2810. https://febs.onlinelibrary.wiley.com/doi/full/10.1002/1873-3468.12311%4010.1002/%28ISSN%291873-3468.FEMS (October 26, 2020).

, Adolfo et al. 1998. “Influenza A Virus Lacking the NS1 Gene Replicates in Interferon-Deficient Systems.” 330: 324-30.21.

, Adolfo et al. 1998. “Influenza A Virus Lacking the NS1 Gene Replicates in Interferon-Deficient Systems.” 330:324-30.

22. Egorov, Andrej et al. 1998. “Transfectant Influenza A Viruses with Long Deletions in the NS1 Protein Grow Efficiently in Vero Cells.” 72(8): 6437-41.

23 Talon, Julie et al. 2000. “Activation of Interferon Regulatory Factor 3 Is Inhibited by the Influenza A Virus NS1 Protein.” Journal of Virology 74(17): 7989-96. http://jvi.asm.org/ (October 28, 2020).

24. Wang, Xiuyan et al. 2000. “Influenza A Virus NS1 Protein Prevents Activation of NF-KB and Induction of Alpha/Beta Interferon.” Journal of Virology 74(24): 11566-73. http://jvi.asm.org/ (October 28, 2020).

25. Ludwig, Stephan et al. 2002. “The Influenza A Virus NS1 Protein Inhibits Activation of Jun N-Terminal Kinase and AP-1 Transcription Factors.” Journal of Virology 76(21): 11166-71. http://jvi.asm.org/ (October 28, 2020).

26 Marazzi, Ivan et al. 2012. “Suppression of the Antiviral Response by an Influenza Histone Mimic.” Nature 483(7390): 428-33. https://www.nature.com/articles/nature10892 (October 28, 2020).

27. Anastasina, Maria et al. 2016. “Influenza Virus NS1 Protein Binds Cellular DNA to Block Transcription of Antiviral Genes.” Biochimica et Biophysica Acta - Gene Regulatory Mechanisms 1859(11): 1440-48.

28. Nemeroff, Martin E. et al. 1998. “Influenza Virus NS1 Protein Interacts with the Cellular 30 KDa Subunit of CPSF and Inhibits 3′ End Formation of Cellular Pre-MRNAs.” Molecular Cell 1(7): 991-1000.

29. Noah, Diana L., Karen Y. Twu, and Robert M. Krug. 2003. “Cellular Antiviral Responses against Influenza A Virus Are Countered at the Posttranscriptional Level by the Viral NS1A Protein via Its Binding to a Cellular Protein Required for the 3′ End Processing of Cellular Pre-MRNAS.” Virology 307 (2): 386-95.

30. Chen, Zhongying, Yongzhong Li, and Robert M. Krug. 1999. “Influenza A Virus NS1 Protein Targets Poly(A)-Binding Protein II of the Cellular 3'-End Processing Machinery.” EMBO Journal 18(8): 2273-83. https://www.embopress.org/doi/full/10.1093/emboj/18.8.2273 (November 2, 2020).

31. Qiu, Yun M, Martin Nemeroff, and Robert M. Krug. 1995. “The Influenza Virus NS1 Protein Binds to a Specific Region in Human U6 SnRNA and Inhibits U6-U2 and U6-U4 SnRNA Interactions during Splicing.” RNA (New York, N.Y.) 1(3): 304-16.

32. Huang, Xiaofeng et al. 2017. “An NS-Segment Exonic Splicing Enhancer Regulates Influenza A Virus Replication in Mammalian Cells.” Nature Communications 8:1-15.

33. Robb, Nicole C., and Ervin Fodor. 2012. “The Accumulation of Influenza A Virus Segment 7 Spliced MRNAs Is Regulated by the NS1 Protein.” Journal of General Virology 93(1): 113-18. https://www.microbiologyresearch.org/content/journal/jgv/10.1099/vir.0.035485-0 (October 26, 2020).

34. Tsai, Pei-Ling et al. 2013. “Cellular RNA Binding Proteins NS1-BP and HnRNP K Regulate Influenza A Virus RNA Splicing” ed. Andrew Pekosz. PLoS Pathogens 9(6): e1003460. https://dx.plos.org/10.1371/journal.ppat.1003460 (October 26, 2020).

35 Satterly, Neal et al. 2007. “Influenza Virus Targets the MRNA Export Machinery and the Nuclear Pore Complex.” Proceedings of the National Academy of Sciences of the United States of America 104(6): 1853-58. www.pnas.org/cgi/content/full/ (October 30, 2020).

36. Ehrhardt, Christina et al. 2007. “Influenza A Virus NS1 Protein Activates the PI3K/Akt Pathway To Mediate Antiapoptotic Signaling Responses.” Journal of Virology 81(7): 3058-67. http://jvi.asm.org/ (November 2, 2020).

37. Heikkinen, Leena S. et al. 2008. “Avian and 1918 Spanish Influenza A Virus NS1 Proteins Bind to Crk/CrkL Src Homology 3 Domains to Activate Host Cell Signaling.” Journal of Biological Chemistry 283(9): 5719-27. http://www.jbc.org/ (November 2, 2020).

38 Wang, Xiaodu et al. 2010. “The Non-Structural (NS1) Protein of Influenza A Virus Associates with P53 and Inhibits P53-Mediated Transcriptional Activity and Apoptosis.” Biochemical and Biophysical Research Communications 395(1): 141-45.

39. Zhirnov, Oleg P., and Hans Dieter Klenk. 2007. “Control of Apoptosis in Influenza Virus-Infected Cells by up-Regulation of Akt and P53 Signaling.” Apoptosis 12(8): 1419-32. https://link.springer.com/article/10.1007/s10495-007-0071-y (November 2, 2020).

40 Zhang, Chuanfu et al. 2011. “The NS1 Protein of Influenza a Virus Interacts with Heat Shock Protein Hsp90 in Human Alveolar Basal Epithelial Cells: Implication for Virus-Induced Apoptosis.” Virology Journal 8(1): 1-9. https://link.springer.com/articles/10.1186/1743-422X-8-181 (November 2, 2020).

41. Han, Xueqing et al. 2012. “Influenza Virus A/Beijing/501/2009(H1N1) NS1 Interacts with β-Tubulin and Induces Disruption of the Microtubule Network and Apoptosis on A549 Cells” ed. Michael C. W. Chan. PLOS ONE 7 (11): E48340. https://dx.plos.org/10.1371/journal.pone.0048340 (November 2, 2020).

,

et al. 2000. “Eukaryotic Translation Initiation Factor 4GI Is a Cellular Target for NS1 Protein, a Translational Activator of Influenza Virus.” Molecular and Cellular Biology 20(17): 6259-68. http://mcb.asm.org/ (November 3, 2020).42.

,

et al. 2000. “Eukaryotic Translation Initiation Factor 4GI Is a Cellular Target for NS1 Protein, a Translational Activator of Influenza Virus.” Molecular and Cellular Biology 20(17): 6259-68. http://mcb.asm.org/ (November 3, 2020).

, Juan

, and Amelia Nieto. 2003. “PABP1 and EIF4GI Associate with Influenza Virus NS1 Protein in Viral MRNA Translation Initiation Complexes.” Journal of General Virology 84(12): 3263-74. https://www.microbiologyresearch.org/content/journal/jgv/10.1099/vir.0.19487-0 (November 3, 2020).43 Burgui, Idoia,

Juan

, and Amelia Nieto. 2003. “PABP1 and EIF4GI Associate with Influenza Virus NS1 Protein in Viral MRNA Translation Initiation Complexes.” Journal of General Virology 84(12): 3263-74. https://www.microbiologyResearch.org/content/journal/jgv/10.1099/vir 0.19487-0 (November 3, 2020).

, Ana

et al. 1999. “Interaction of Influenza Virus NS1 Protein and the Human Homologue of Staufen in Vivo and in Vitro.” Nucleic Acids Research 27(11): 2241-47. https://academic.oup.com/nar/article/27/11/2241/1252689 (November 3, 2020).44.

, Ana

et al. 1999. “Intection of influenza virus ns1 Protein and the Human Homologue of Staufen in Vivo and Vitro.” Nucleic Acids Research 27(11): 2241-47. https://academic.oup.com/nar/article/27/11/2241/1252689 (Novmber 3, 2020).

45. MDCK cell-producer of influenza virus proteins (variants): patent RU2681482, Russian Federation, application RU2018105364, dec. 02/13/2018, publ. 03/06/2019.

46. Laemmli U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4 //nature. - 1970. - T. 227. - No. 5259. - S. 680-685.

47 Shaldzhyan A. et al. Clean and folded: Production of active, high quality recombinant human interferon-λ1 //Process Biochemistry. - 2021. - T. 111. - S. 32-39.

48. Krivitskaya V.Z. et al. Preparation and characterization of a panel of monoclonal antibodies specific to the NS1 protein of the influenza A virus // Biotechnology. 2017 Vol. 33, No. 5. P. 61-72.

--->

SEQUENCE LIST

<110> federal state autonomous educational

institution of higher education "St. Petersburg

Peter the Great Polytechnic University

<120> Bacterial strain Escherichia coli is a producer of recombinant NS1 protein

<160> 3

<170>PatentIn version 3.5

<210> 1

<211> 693

<212> DNA

<213> Escherichia coli

<400> 1

atggatccaaacactgtgtcaagctttcaggtagattgctttctttggcatgtccgcaaacgagttgcagaccaa

gaactaggtgatgccccattccttgatcggcttcgccgagatcagaaatccctaagaggaaggggcagcaccctc

ggtctggacatcgagacagccacacgtgctggaaagcagatagtggagcggattctgaaagaagaatccgatgag

gcacttaaaatgaccatggcctctgtacctgcgtcgcgttacctaactgacatgactcttgaggaaatgtcaagg

gagtggtccatgctcatacccaagcagaaagtggcaggccctctttgtatcagaatggaccaggcgatcatggat

aagaacatcatactgaaagcgaacttcagtgtgatttttgaccggctggagactctaatattgctaagggctttc

accgaagagggagcaattgttggcgaaatttcaccattgccttctcttccaggacatactgctgaggatgtcaaa

aatgcagttggagtcctcatcgggggacttgaatggaatgataacacagttcgagtctctgaaactctacagaga

ttcgcttggagaagcagtaatgagaatgggagacctccactcactccaaaacagaaacgagaaatggcgggaaca

attaggtcagaagtttga

<210> 2

<211> 182

<212> PRT

<213> Escherichia coli

<400> 2

MetAspProAsnThrValSerSerPheGlnValAspCysPheLeuTrpHisValArgLysArgValAlaAspGln

GluLeuGlyAspAlaProPheLeuAspArgLeuArgArgAspGlnLysSerLeuArgGlyArgGlySerThrLeu

GlyLeuAspIleGluThrAlaThrArgAlaGlyLysGlnIleValGluArgIleLeuLysGluGluSerAspGlu

AlaLeuLysMetThrMetAlaSerValProAlaSerArgTyrLeuThrAspMetThrLeuGluGluMetSerArg

GluTrpSerMetLeuIleProLysGlnLysValAlaGlyProLeuCysIleArgMetAspGlnAlaIleMetAsp

LysAsnIleIleLeuLysAlaAsnPheSerValIlePheAspArgLeuGluThrLeuIleLeuLeuArgAlaPhe

ThrGluGluGlyAlaIleValGlyGluIleSerProLeuProSerLeuProGlyHisThrAlaGluAspValLys

AsnAlaValGlyValLeuIleGlyGlyLeuGluTrpAsnAspAsnThrValArgValSerGluThrLeuGlnArg

PheAlaTrpArgSerSerAsnGluAsnGlyArgProProLeuThrProLysGlnLysArgGluMetAlaGlyThr

IleArgSerGluValHisHisHisHisHisHis

<210> 3

<211> 28

<212> PRT

<213> artificial sequence

AACCTTCATATggATCCAAACACTgTg

<210> 4

<211> 30

<212> PRT

<213> artificial sequence

TTAACTCgAgAACTTCTgACCTAATTgTTC

<---

Claims (13)

1. Recombinant plasmid DNA PET22B (+)-NS1-6 × HIS for expression in the cells of the E. Coli cells of the recombinant unstructural protein NS1 of the influenza virus A, which has a sequence of SEQ ID NO: 2, which has a plasmid map, as shown in FIG. 1, including the following sections: - β-lactamase gene (AMPR), which determines the stability of bacterial cells to ampicillin; - site of replication initiation (ori); - ROP gene that regulates the copy number of the plasmid; - fragment containing T7 transcription terminator; - transcriptional repressor LacI, which regulates the transcription of the T7lac promoter; - NDEI/XHOI Fragment containing an artificial NS1 gene, in which the nucleotide sequence corresponds to SEQ ID No: L and which encodes the NS1 recombinant protein, which has an amino acid sequence SEQ ID NO: 2; - AmpR promoter; - LacI promoter; - T7 promoter; - lac operator; - 6×His. 2. Escherichia coli BL-21 (DE3) -pet22b (+)-NS1-PROMODICTION between the Recombinant Squirrel Protein NS1 of the influenza virus A, which has a sequence of SEQ ID NO: 2, and deposited in the bioresary center of industrial microorganisms (BRC VKPM) of NIS “Kurchatov Institute” is the State Netics under No. B-14117, while the strain was obtained by transforming the cells of the E. Coli BL-21 strain (DE3) of the PET22B recombinant plasmid DNA (+)-NS1-6 × HIS according to clause 1.

Images