RU2788638C9 - Modified oncolytic adeno viruses - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: modified replicating adenovirus of serotype 5, having lytic activity in cancer target cells, is proposed, containing: a) deletion of E1A gene, while the specified deletion is deletion of base pairs 923-946; b) chimeric substitution of 5/3 of a protrusion of adenovirus fiber protein, while the specified protrusion of serotype 5 Ad is substituted with a protrusion of serotype 3 Ad; c) deletion of 14.7k gene, while the specified deletion is deletion of base pairs 30,448-30,834 compared to a wild-type adenovirus, and a sequence of C-end of RID beta GGA GGA GAT GAC TGA gene is substituted with GGA GGA GAC GAC TGA; and d) deletion of gp19k gene and deletion of 7.1k gene, while the specified deletions are deletions of base pairs 28,541-29,211 compared to the wild-type adenovirus. A pharmaceutical composition is proposed, containing at least one modified adenovirus competent for replication, showing lytic activity against a target cell. The use of at least one modified adenovirus competent for replication, showing lytic activity against a target cell, or a pharmaceutical composition in the production of a drug for the treatment of cancer is proposed. A method for the treatment of cancer in a patient is proposed, including administration to the patient of effective amount of a pharmaceutical composition or a composition containing at least one modified adenovirus competent for replication, showing lytic activity against a target cell.

EFFECT: claimed invention solves the problem of immunosuppression in the tumor environment, since the presence of a highly immunogenic oncolytic adenovirus encoding human immune-stimulating transgenes forms the tumor microenvironment towards an “immuno-inflammatory” phenotype, which is more susceptible to immunotherapeutic approaches.

22 cl, 10 dwg, 5 tbl

Description

Field of invention

The present invention relates to a modified replication-competent oncolytic adenovirus; a pharmaceutical composition containing said adenovirus; and a method of treating cancer using them.

Prior Art

The perception of the role of oncolytic viruses in cancer treatment has changed dramatically over the past decade as immunotherapy and stimulation of a patient's own immune system to target and affect cancer have gained popularity. At the beginning of the century, oncolytic viruses were perceived as active agents in the treatment of cancer, acting solely due to their inherent ability to lyse tumor cells through oncolysis. Recently, there has been interest in their use as cancer vaccines, and their ability to release tumor antigens from cancer cells during oncolysis to activate the immune system has been recognized as an important feature in the development of definitive cancer immunotherapy.

Adenoviruses are highly immunogenic viruses often used as vectors in various approaches to develop vaccines against infectious diseases. Importantly, they have an exceptional ability to prime and stimulate immune responses. In addition, the presence of oncolytic adenovirus in tumors and the immune cell-mediated cell death it elicits is likely to shape an aggressive tumor microenvironment towards a more receptive state for the emergence of clinically relevant antitumor immunity by inducing the expression of TH1-type immunomodulators such as interferon gamma (IFN- gamma). Immune cell infiltration into tumors is a frequent consequence of oncolytic virus treatment, and importantly, adenoviruses cause infiltration of CD8+ T cells, which are key effector cells in cancer immunity. Adenoviruses cause immunogenic lysis of cancer cells, after which tumor antigens, including unique patient-specific neoantigens previously hidden from the immune system or not presented in an immunogenic context, are released into the immunogenic environment. This represents the basis for the tumor-specific immune response elicited by oncolytic adenoviruses.

However, tumors have evolved several immunosuppressive mechanisms to counteract the body's immune cells. Immune cells express cell surface molecules that regulate their activation and effector functions, in particular co-stimulatory and co-inhibitory molecules. Negative feedback molecules, i.e. checkpoint molecules, provide auto-tolerance under normal physiological conditions, but are often used by tumor cells to induce severe immunosuppression. The best characterized checkpoint pathways are the cytotoxic T-lymphocyte protein 4 (CTLA-4) pathway and the programmed cell death protein 1 (PD-1/PD-L1) pathway. Because of these strong immunosuppressive mechanisms within the tumor, the virus-induced antitumor immune response may be weak unless it is enhanced by the use of immunostimulatory transgenes. The present approach addresses the problem of immunosuppression in the tumor environment, as the presence of a highly immunogenic oncolytic adenovirus encoding human immunostimulatory transgenes shapes the tumor microenvironment towards an "immunoinflammatory" phenotype that is more susceptible to immunotherapeutic approaches. Importantly, the oncolytic virus of this approach can be used in combination with checkpoint modulators such as anti-PD1, anti-PD-L1, or anti-CTLA-4 molecules to counteract the tumor's immunosuppressive environment and to elicit a strong anti-immune response. answer.

Brief description of the invention

According to the first aspect of the present invention, there is provided a modified replicating adenovirus having lytic activity in target cancer cells, comprising:

a) a deletion of the E1A a gene, said deletion being a deletion of the nucleotides encoding amino acids 923-946;

b) a chimeric replacement of a 5/3 protrusion of an adenovirus fiber protein, wherein said Ad serotype 5 protrusion is replaced with an Ad serotype 3 protrusion;

c) deletion of the 14.7k gene, wherein said deletion refers to a deletion of base pairs 30448-30834 compared to wild-type adenovirus, and the sequence GGA GGA GA T GAC TGA (SEQ ID NO: 1) is changed to GGA GGA GA C GAC TGA (SEQ ID NO: 2); And

d) a deletion of the gp19k gene and a deletion of the 7.1k gene, wherein said deletions are deletions of base pairs 28541-29211 compared to wild-type adenovirus.

In the above modified adenovirus, amino acids 923-946 are deleted from the wild-type (wt) Ad5 sequence. This deletion is a precautionary measure because the E1A viral protein cannot bind to the retinoblastoma (Rb) molecule and release the E2F transcription factor from Rb to transcribe the viral gene. Thus, said adenovirus is dependent on the presence of free E2F in the host cell and can replicate its genome either in dividing normal cells or in cancer cells where free E2F is constantly available. Thus, this modification is relatively protective of non-dividing cells and is directed against dividing or cancerous cells.

In addition, the 5/3 chimeric substitution, that is, the replacement of the adenovirus serotype 5 fiber protrusion region with the protrusion region of adenovirus serotype 3; allows said virus to bypass the native Ad5 coxsackie adenovirus receptor (CAR) and use the native Ad3 receptor desmoglein 2 (DSG2) for internalization instead. DSG2 is present in large amounts in cancer cells. Thus, said modification is relatively protective of non-dividing cells and directed against dividing or cancerous cells.

Adenovirus infection begins with recognition of host cell receptors by specialized proteins on the surface of the virus, i.e., the adenovirus fiber protein and, in particular, the globular domain at the carboxy-terminus of the adenovirus fiber protein, called the carboxy-terminal knob domain (knob). Accordingly, in this application, reference to the protrusion region of the adenovirus fiber protein refers to the globular domain of the carboxy-terminus of the adenovirus fiber protein.

Moreover, the deletion of the 14.7k gene prevents the death of infected cells by TNF-alpha-induced cytolysis, and thus the deletion is advantageous. It is important to note that the present inventors observed a short overlap at the beginning of the 14.7k gene and the upstream RID beta gene (14.5k), and thus a modification was made to remove the 14.7k gene without removing the last amino acid and stop codon of the RID beta gene. . Specifically, the native sequence of the junction reads GGAGGAGATGACTGA TTAGGTA (SEQ ID NO: 3) and has the underlined sequence being the C-terminus of the RID beta gene and the remainder being the N-terminus of the 14.7k gene. Translation into amino acids is read as GGDD stop (GGA GGA G AT G AC TGA; SEQ ID NO: 1) for the RID beta gene. Thus, in order to eliminate ATG in the ORF of the RID beta gene, to avoid misreading if the transgene is inserted at a deletion site, and to ensure that the C-terminal function of RID beta is retained, the present inventors slightly changed the sequence of RID beta: GGA GGA GA C GAC TGA (SEQ ID NO: 2). Thus, the indicated sequence still reads GGDD stop, but does not contain the ATG for any subsequent misread that could interfere with transgene expression.

Finally, gp19k is a gene that suppresses MHCI (major histocompatibility complex class I) on an infected cell, and said gene is redundant for adenovirus replication, packaging, etc., and therefore can be deleted. In addition, since this gene is an immunoregulatory gene that adenovirus uses to evade the immune system, its deletion is preferred. 7.1k is a gene associated with degradation of the TRAIL 2 receptor and inhibits apoptosis induced by Ca2+ release from the endoplasmic reticulum (ER). However, since the stop codon of the 7.1k gene is in the open reading frame of gp19k, no transgenes are added to this remote site.

In a preferred embodiment of the present invention, said adenovirus is further modified by inserting a molecule encoding OX40L, ideally human OX40L, into the region of the 14.7k gene deletion. OX40L is a T cell activator and is therefore useful in the practice of the present invention.

The OX40L gene has its own start codon (ATG), and when inserted into the 14.7k gene deletion, it is preferable that the CC base pair be added between the RID beta stop codon and the OX40L start codon to optimize translation (i.e. to obtain the Kozak sequence ACCATGG ).

Most preferably, human OX40L is located in the E3B region, replacing the 14.7K gene deletion. The 3' end of the RID beta gene and the 5' end of 14.7K overlap in wild-type adenovirus (wt), and thus the T/C modification described above was performed at the 3' end of RID beta to ensure correct transcription of the transgene.

In yet another preferred embodiment of the present invention, said adenovirus is alternatively or additionally modified with a CD40L insert, ideally a human CD40L. Human CD40L is inserted in the late gene region of the virus, specifically in the late gene 3 (L3), ideally downstream of the 23K gene, or in the L5 region, after the fiber gene. CD40L activates antigen presenting cells (APCs) and is therefore useful in the practice of the present invention.

Preferably, the CD40L transgene is located immediately after the coding region of the adenovirus 23K gene, before its polyadenylation site, or immediately after the fiber gene, before its polyadenylation site. Usually, but not always, deletions are not made to accommodate said gene, and thus expression of said transgene is dependent on the adenovirus alternative splicing machinery and splice acceptor site (SAS) preceding the transgene (e.g., SAS adapted from US2006/0292682 A1 and WO2006/012393).

In yet another preferred embodiment of the present invention, said adenovirus is further modified by inserting a splicing acceptor site (SAS) and/or a Kozak sequence upstream of the CD40L transgene to promote CD40L transcription.

Alternatively, and most preferably, the CD40L transgene is inserted directly after OX40L using either

A) FMDV 2A (F2A) processing site (e.g. see Ad5/3-D24-OX40L-F2A-CD40L, construct C1 in the graphics) or

B) porcine teshovirus-1 2A (P2A) processing site (eg, see Ad5/3-D24-OX40L-P2A-CD40L, construct C3 in the graphics).

A 2A processing site is inserted between two transgenes and ideally both 2A processing sites are preceded by a cleavage site (eg furin cleavage site: RKRR) and a SGSG linker to ensure efficient cleavage of the transgenes.

Those skilled in the art will appreciate that the 2A processing sites are "self-cleaving" small peptides found in picornaviruses. Host cell ribosomes skip the synthesis of the glycyl-prolyl peptide bond at the C-terminus of the 2A peptide, resulting in a cleavage between the 2A peptide and the immediately following peptide. As a result, the cleaved downstream peptide has a proline at its N-terminus, which means that the CD40L protein produced by the viral constructs described herein has a proline at its N-terminus.

Accordingly, in a preferred embodiment of the present invention, said modified adenovirus comprises one and more preferably two transgenes: OX40L and CD40L. In addition, usually, but not exclusively, said CD40L transgene is provided substantially immediately after or immediately after said OX40L transgene, or vice versa.

Activation of the T cell receptor by antigen-MHCI/II complexes generates the main signal, signal 1, for the activation of naive T cells. However, signal 1 is insufficient to initiate the productive formation and maintenance of effector T cells. Full activation of CD8+ T cells requires additional signals driven by costimulatory molecules present on activated APCs or helper T cells, but rarely on tumors. The co-stimulatory molecules that the present inventors have chosen for use as transgenes in the present invention, ie CD40L and OX40L, are members of the tumor necrosis factor (TNF) ligand superfamily. Most TNF superfamily ligands are predominantly expressed on cells associated with the immune system, including B cells, T cells, natural killer (NK), monocytes, and DCs (dendritic cells).

OX40 ligand (OX40L) and CD40 ligand (CD40L) are type II transmembrane proteins that have a relatively long extracellular domain and a short cytoplasmic region. The extracellular domain (particularly the TNF homology domain) exhibits the receptor binding specificity that is required to provide ligand functionality. Most TNF superfamily ligands are expressed as homotrimers on the cell surface and are inactive or inactive as soluble trimeric fusion proteins. Thus, a soluble form without a transmembrane region is not applicable to the approach of the present invention. Therefore, the present invention uses the full length cDNA of each transgene. Thus, transgene products contain all the domains that are naturally present in the protein produced by the cell, i.e. also the transmembrane domain that guides the protein along the secretory pathway and retains it in the cell membrane, as well as naturally occurring sites that cause cleavage from the surface. proteinase cells.

Accordingly, in a preferred embodiment of the present invention, a molecule encoding the full length of at least one or each transgene is inserted into said adenovirus, ideally a cDNA encoding the full length of at least one or each transgene.

Most approaches that use co-stimulatory molecules as a therapeutic agent to induce/enhance antitumor immunity use either monoclonal agonist antibodies specific for TNF ligand receptors or soluble forms of the ligands. This approach requires systemic delivery of these therapeutic molecules. On the contrary, the approach of the authors of the present invention resembles the natural situation in the body, where these ligands are presented to their cognate receptors in the form of membrane-bound proteins produced by the cellular machinery of the infected cancer cell.

CD4+ T cells play a critical role in maintaining an effective CD8+ T lymphocyte response in resistant viral infections. The novel viral construct of the present invention with the co-stimulatory(s) transgene(s) elicits Th1-type antiviral immunity in the tumor environment. The presence of tumor antigens on the surface of the virus and the release of other tumor antigens in the presence of local inflammation, as well as the spread of determinants, leads to the formation of antitumor immune T cell clones. In order to maintain the effector phase of cytotoxic CD8+ T cells, costimulatory molecules (namely OX40L and CD40L) have unique properties that the present inventors wish to apply in the treatment of immunosuppressive cancer.

Surprisingly, the present inventors' data show that the addition of the immunostimulatory transgenes, human OX40L and human CD40L, at the 14.7K locus does not reduce the oncolytic efficacy of the viruses of the present invention compared to an Ad5/3D24 backbone virus or a virus with an immunostimulatory transgene, such as GM- Human CSF replacing the deleted gp19K/7.1K genes. This is unexpected because these transgenes can strongly influence viral replication due to the size of the transgene and the direct effect of the transgene on infected cells. In addition, the 14.7K gene deletion is not as widely studied as the gp19K/7.1K gene deletion, and thus may have unexpected consequences for the viral replication apparatus, especially in the context of incorporating transgenes into the 14.7K deletion site.

The present inventors also show that the virus of the present application is capable of producing functional human transgenes from the 14.7K gene locus. This is unexpected because the present inventors used, somewhat atypically, a transcription cassette with a 2A virus processing site between two transgenes.

In addition, the authors of the present invention show that the virus according to the present invention is able to induce MAGE-A3 and NY-ESO-1-specific immune response.

Accordingly, in a further aspect, the present invention relates to a pharmaceutical composition comprising at least one replication-competent adenovirus exhibiting lytic activity against a target cell according to the present invention and a suitable carrier.

OX40/OX40L

OX40L is expressed on activated APCs, including dendritic cells, B cells, and macrophages. It is expressed on the cell surface as a trimer allowing it to bind to three OX40 molecules. T cell activation is required for the expression of OX40, the OX40L receptor, on CD8+ and CD4+ T cells. OX40 induction occurs within 24 hours and peaks 48-72 hours after initial TCR stimulation and typically lasts 3-4 days. The relative level of the OX40 receptor expressed on T cells is strongly influenced by the local environment through contact with professional antigen-presenting cells expressing CD80 or CD86, or through microenvironment rich in TNF-alpha or similar inflammatory cytokines. Moreover, OX40L expression is generally found at the site of inflammation. Thus, T cells expressing OX40, which are activated by TCR signaling, receive costimulation by OX40L at the site of inflammation. This specificity of costimulation by OX40 is similar to the danger signal received from the inflammatory environment and thus adds a level of safety to its use. In addition, the transient expression of OX40 on the surface of T cells after priming suggests its importance for the late proliferation and survival of effector T cells. Activation of the anti-apoptotic molecules BCL-2, BCL-xL, and survivin in OX40-stimulated T cells is hypothesized to be responsible for increased clonal expansion and an increase in the pool of memory T cells.

CD40/CD40L

In addition to providing co-stimulatory signals directly to T cells, it is also advantageous to promote the activation of APCs, which are likely to cross-present the tumor antigen, such that increased expression of the co-stimulatory ligand is achieved in situ. CD40 is critical to the function of B cells and the DCs that constantly express it. The CD40 ligand (CD40L) is mainly expressed on activated T helper cells. CD40 ligation has been shown to "license" APCs and allow them to drive effector CTL responses, in part by inducing IL-12 secretion, but also by upregulating members of the B7 family (CD80, CD86). Costimulation of CD40/CD40L is important for inducing effective antitumor T-cell responses, and incorporation of CD40L into tumor cell-based vaccines has been shown to significantly enhance immune responses to weakly immunogenic tumors in mice, highlighting the importance of indirectly influencing adaptive immunity via APC in antitumor immunity. .

In yet another preferred embodiment of the present invention, said adenovirus may be any type and species of adenovirus, for example, not limited to human adenovirus, but is most commonly a human adenovirus. Most suitably, said adenoviruses are capable of replicating and killing cancer cells by directing an antiviral immune response against the tumor.

It follows from the foregoing that said modified adenovirus according to the present invention was designed to stimulate an immune response against cancer, and in particular in a tumor environment where the immune system normally functions abnormally due to the evasion mechanisms used by cancer cells.

In a preferred embodiment of the present invention, said virus has at least one of the following polypeptides, which is covalently or non-covalently attached to the viral capsid, but is not genetically encoded by said adenovirus vector,

1) VFGIELMEVDPIGHLYIFAT [SEQ ID NO: 1];

2) YLAMPFATPMEAELARRSLA [SEQ ID NO: 2];

3) RGPESRLLEFYLAMPFATPM [SEQ ID NO: 3] or

4) a polypeptide identical to the above polypeptide at least 60%.

Accordingly, in yet another aspect, the present invention relates to a method of treating cancer in a patient, comprising administering to the patient an effective amount of a composition comprising at least one replication-competent modified adenovirus exhibiting lytic activity against a target cell, according to the present invention.

Additionally or alternatively, the present invention relates to at least one replication-competent modified adenovirus exhibiting lytic activity against a target cell of the present invention for use in the treatment of cancer.

Additionally or alternatively, the present invention relates to the use of at least one replication-competent modified adenovirus exhibiting lytic activity against a target cell according to the present invention for the treatment of cancer.

Additionally or alternatively, the present invention relates to the use of at least one replication-competent modified adenovirus exhibiting lytic activity against a target cell according to the present invention in the manufacture of a medicament for the treatment of cancer.

Most preferably in this application, the cancer includes any one or more of the following cancers: nasopharyngeal cancer, synovial cancer, hepatocellular cancer, kidney cancer, connective tissue cancer, melanoma, lung cancer, colon cancer, colon cancer, rectal cancer, colorectal cancer, brain cancer, throat cancer, oral cancer, liver cancer, pancreatic cancer, choriocarcinoma, gastrinoma, pheochromocytoma, prolactinoma, T-cell leukemia/lymphoma, neuroma, von Hippel-Lindau disease, Zollinger-Ellison syndrome, adrenal cancer , anus cancer, bile duct cancer, bladder cancer, ureter cancer, oligodendroglioma, neuroblastoma, meningioma, spinal cord tumor, bone cancer, osteochondroma, chondrosarcoma, Ewing's sarcoma, cancer of unknown primary site, carcinoid, gastrointestinal carcinoid, fibrosarcoma , breast cancer, Paget's disease, cervical cancer, esophageal cancer, gallbladder cancer, head cancer, eye cancer, neck cancer, kidney cancer, Wilms tumor, liver cancer, Kaposi's sarcoma, prostate cancer, testicular cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, skin cancer, mesothelioma, multiple myeloma, ovarian cancer, pancreatic endocrine cell cancer, glucagonoma, parathyroid cancer, penis cancer, pituitary cancer, soft tissue sarcoma, retinoblastoma, small intestine cancer, stomach cancer, thymus cancer, cancer thyroid gland, trophoblastic cancer, hydatidiform mole (chorionadenoma), uterine cancer, endometrial cancer, vaginal cancer, vulvar cancer, acoustic neuroma, mycosis fungoides, insulinoma, carcinoid syndrome, somatostatinoma, gingival cancer, heart cancer, lip cancer, head shell cancer brain, oral cancer, nerve cancer, palate cancer, parotid cancer, peritoneal cancer, throat cancer, pleura cancer, salivary gland cancer, tongue cancer, and tonsil cancer.

It follows from the foregoing that the present invention relates to the use of a modified adenovirus optimized for safety and survival as an active adjuvant in a therapeutic agent for the treatment of cancer, and which uses at least one, and ideally two immunostimulatory agents, i.e. OX40L and CD40L.

Said modified adenovirus acts as an active adjuvant in that it provides the danger signals necessary for an optimal immune response against the target peptide, but also retains its ability to kill the cancer cells it infects and in which it replicates its genome. Oncolytic cell killing is immunogenic in nature, causing changes in the tumor microenvironment that likely enhance the immune response to the peptides/tumor.

In the claims below and in the previous description of the invention, except where the context requires otherwise due to language expressions or necessary semantic meaning, the word "comprises" or variants such as "comprises" or "comprising" use in a broad sense, that is, to indicate the presence of the claimed features, without excluding or adding additional features in various embodiments of the present invention.

All sources, including any patents or patent applications cited in this application, are incorporated into this application by reference. It is not allowed that any sources be considered as prior art. In addition, it is not allowed that any of the prior art sources be considered as part of the general knowledge in this field.

Preferred features of each aspect of the present invention may be as described in connection with any of the other aspects.

Other features of the present invention will become clear from the following examples. In general, the present invention extends to any new or any new combination of features disclosed in this application (including the attached claims and drawings). Thus, it should be understood that features, integers, characteristics, compounds, or chemical moieties described in connection with a particular aspect, embodiment, or example of the invention are applicable to any other aspect, embodiment, or example described in this application, if they are not incompatible with them.

Moreover, in this application, any feature may be replaced by an alternative feature serving the same or similar purpose, unless otherwise indicated.

Throughout the specification and claims, the singular encompasses the plural unless otherwise required by the context. In particular, the use of the singular is to be understood to include both the plural and the singular, unless the context otherwise requires.

The following describes an embodiment of the present invention by way of example only, with reference to the following, in which:

On FIG. 1 shows the agarose gel electrophoresis analysis of the PCR amplified fragments after the Gibson assembly reaction of GA-OX40L/F2A/CD40L and GA-OX40L/P2A/CD40L. Lane 1 shows PCR amplification of assembled fragments 1, 2, and 3 to give a full length 3974 bp GA-OX40L/F2A/CD40L fragment. Lane 2 shows PCR amplification of assembled fragments 1, 2, and 3 to give a full-length 3929 bp GA-OX40L/P2A/CD40L fragment. Lane 3 shows PCR amplification of the pAd5/3D24 virus backbone plasmid with amplification of a 3564 bp fragment. However, in both lanes 1 and 2, some amplification of the virus backbone can be seen.

On FIG. 2 shows the ability of the virus-produced OX40L protein to bind its OX40 receptor, as confirmed by flow cytometry. An anti-OX40 receptor antibody (rabbit) and a goat anti-rabbit antibody labeled with Alexa fluor 488 were used to bind the OX40L protein expressed by the viruses on the surface of infected A549 cells. Unstained cells, uninfected stained cells, and stained cells infected with no transgene virus were used as negative controls. Data are presented as A) histogram or B) as average of absolute or proportional frequencies. GM = geometric mean number of Alexa fluor 488 positive cells, Freq parent = proportion of Alexa fluor 488 positive cells, Ctrl virus = Ad5/3D24, virus with identical framework and no transgene, OX40L virus = virus with OX40L as transgene only, OX40L/CD40L.C1 and OX40L/CD40L.C3 = viruses with OX40L and CD40L as transgenes.

On FIG. 3 shows that OX40L capable of binding the OX40 receptor is expressed from Ad5/3-D24-OX40L-CD40.C1 (C1 in Fig.) and Ad5/3-D24-OX40L-CD40.C3 (C3 in Fig.) viruses with a double transgene, as well as from a virus expressing only the OX40L transgene (used as an expression control). Functional sandwich ELISA was used to detect the native form of OX40L expressed from viruses in the supernatant of infected cells. The supernatant of uninfected cells was used as a negative control. Dilutions are shown for each sample in the figure.

On FIG. 4 shows the functionality of virally expressed OX40L determined using HEK-293 cells expressing the OX40 receptor with a luciferase reporter system. Virus without transgene (Ctrl virus), virus with only OX40L as transgene (OX40L virus), viruses with OX40L and CD40L as transgenes (OX40L/CD40L.C1 and OX40L/CD40L.C3) were analyzed for their ability to trigger activity luciferase dependent on OX40L/OX40 interaction. Unequivocal luciferase activity was found for viruses expressing OX40L, indicating that OX40L expressed from the viral genome is functional.

On FIG. 5 shows absorptive capacity measured using the Ramos Blue cell assay to determine functional levels of CD40L expression. (A) CD40L was expressed from dual transgene viruses (OX40L/CD40L.C1 and OX40L/CD40L.C3), and no transgene virus (Ctrl virus) or OX40L as a single transgene (OX40L virus) or uninfected cells (A549) were used in as a negative control. (B) Absorption capacity measurements of Ramos Blue cells treated with recombinant human CD40L.

On FIG. 6 shows the frequency of T cells in treated and contralateral, untreated tumors treated with oncolytic virus without peptide coating (VALO-C1), oncolytic virus coated with NYESO-1 or MAGE-A3 peptide antigens (PeptiCRAd), or with peptide alone. The number of CD3+ T cells (A), CD4+ T cells (B) and CD8+ T cells (C) is shown as the number of cells per gram of tumor tissue in each treatment group. Treatment resulted in a higher frequency of T cells in all groups compared to sham. The highest number was observed in tumors treated with VALO-C1 or PeptiCRAd.

On FIG. 7 shows the frequency of all immune cells (CD45+ cells) in treated and contralateral, untreated tumors when treated with oncolytic virus without peptide coating (VALO-C1), oncolytic virus coated with NYESO-1 or MAGE-A3 peptide antigens (PeptiCRAd), or with peptide alone. Frequencies were similar across all groups, with somewhat lower numbers in animals treated with sham.

On FIG. 8 shows that treatment with VALO-C1 and PeptiCRAd reduces the percentage of regulatory T cells of all TILs in treated tumors.

On FIG. 9 shows that PeptiCRAd (containing OX40L- and CD40L-expressing viruses coated with NY-ESO-1 and MAGE-A3 proteins) is able to arrest tumor growth in a humanized mouse melanoma model, even when treatment is started in large, well-developed tumors. Experimental design: 2x10 ⁶ SK-MEL-2 cells were implanted subcutaneously (one tumor per animal) in the flank of NOD/Shi-scid/IL-2Rγnull immunodeficient mice on day 1. On day 13, 5x10 ⁶ PBMCs (peripheral blood mononuclear cells) were injected intravenously ). On day 16, 5x10 ⁴ plasmacytoid and myeloid dendritic cells were injected intratumorally. Intratumoral treatment with PeptiCRAd at a dose of 1x10 ⁹ VP (viral particles) was performed on days 16, 17, 18 (priming) and on day 25 (stimulation). The first dose of PeptiCRad was administered immediately after the DC injection. Tumor growth was monitored. Animals were sacrificed on day 32. PeptiCRAd = Ad5/3-D24-OX40L-CD40L, 24 bp deletion oncolytic adenovirus in E1A, with chimeric capsid 5/3 and CD40L and OX40L transgenes expressed from the 14.7K locus, coated with NY-ESO-1 and MAGE-A3 peptides; OX40L PeptiCRAd = Ad5/3-D24-OX40L, oncolytic adenovirus with a 24 bp deletion. in E1A, with a 5/3 chimeric capsid and the OX40L transgene expressed from the 14.7K locus, coated with NY-ESO-1 and MAGE-A3 peptides.

On FIG. 10 shows that OX40L(only)-PeptiCRAd increased the number of MAGE-A3-specific CD8+ T cells in peripheral blood compared to sham treated animals. The two animals treated with PeptiCRAd also showed an increased number of MAGE-A3-specific CD8+ T cells in the blood. Anti-MAGE-A3 T cells were assessed by flow cytometry (pentamer analysis) at the end of the previously mentioned tumor growth study at day 32.

Detailed description

Materials and methods:

Creation of an oncolytic adenovirus having a deletion of nucleotides encoding amino acids 923-946 of the E1A gene

A 24 bp deletion was made in the Ad5 framework sequence using a shuttle plasmid targeting the E1A region, this cloning method is described by Kanerva et al., the deletion was first described by Fueyo et al.

Creation of an oncolytic adenovirus having a chimeric replacement of 5/3 of the adenovirus fiber protein

The serotype 5 overhang was replaced with a serotype 3 overhang using a fiber region-modified shuttle plasmid to introduce the sequence by homologous recombination into the virus backbone. Specific cloning methods are described in Kanerva et al.

Generation of an oncolytic adenovirus having a deletion of base pairs 30448-30834 of the 14.7k gene compared to wild-type adenovirus and in which the sequence GGA GGA GA T GAC TGA (SEQ ID NO: 1) is changed to GGA GGA GA C GAC TGA (SEQ ID NO: 2), and the creation of an oncolytic adenovirus having a deletion of base pairs 28541-29211 of the gp19k gene and the 7.1k gene compared to the wild-type adenovirus.

Deletion of 14.7K and replacement of GGA GGA GA T GAC TGA (SEQ ID NO: 1) with GGA GGA GA C GAC TGA (SEQ ID NO: 2) (with insertion of the OX40L transgene in place of 14.7K) and deletion of the gp19k/7.1k genes into a shuttle plasmid (pShuttle-OX40L) by chemical synthesis. Based on the virtual sequence developed in the Vector NTI program, overlapping oligonucleotides were created at GeneArt (Thermo Fisher Scientific) that together included the entire sequence. The synthesis of oligonucleotides was carried out by solid phase synthesis using controlled pore glass as a solid material. The oligonucleotides were then liquefied and assembled by PCR in a fully automated assembly station. The synthetically cloned sequence was introduced into the pMX cloning vector and verified by sequencing.

Cloning of OX40L and CD40L in pAD5/3-D24 to produce pAd5/3-D24-OX40L/F2A/CD40L and pAd5/3-D24-OX40L/P2A/CD40L

To create viruses containing the OX40L and CD40L genes and one of the FMDV 2A (F2A) processing sites or the porcine teshovirus-1 2A (P2A) processing site inserted between transgenes for co-translational processing, 3 fragments for each construct were amplified by PCR .

For constructs containing F2A, fragment 1 containing the OX40L sequence and part of the F2A processing site was amplified from pShuttle-OX40L using primers Gibson OX40L and reverse primer F2A OX40L (see list of all primers used in Table 1), fragment 2 containing part of the F2A processing site and the complete CD40L sequence were amplified from pShuttle-CD40L using primers F2A CD40L forward primer and F2A CD40L reverse primer.

For constructs containing P2A, fragment 1 containing the OX40L sequence and part of the P2A processing site was amplified from pShuttle-OX40L using primers Gibson OX40L and reverse primer P2A OX40L (see list of all primers used in Table 1), fragment 2 containing a portion of the P2A processing site and the entire CD40L sequence were amplified from pShuttle-CD40L using the P2A CD40L forward primer and the P2A CD40L reverse primer.

For the F2A and P2A constructs, fragment 3, containing the adenovirus genomic sequence flanking the 3' end of CD40L, was amplified from pShuttle-OX40L using the F2A forward primer to the adeno-terminus without insert and the Gibson OX40L REV primer. All PCR reactions were performed using Phusion High-Fidelity DNA Polymerase (Thermo Fisher, F530) according to manufacturer's instructions followed by DpnI (NEB, R0176) treatment. Reaction mixtures were purified using the NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL, 740609.50). The purified fragments were then assembled together, creating the GA-OX40L/F2A/CD40L and GA-OX40L/P2A/CD40L fragments using the Gibson assembly master mix (NEB, E2611), followed by PCR amplification of the assembled fragment using Gibson OX40L FW primers. and Gibson OX40L REV (see Fig. 1 for analysis of final fragments on agarose gel).

To assemble GA-OX40L/F2A/CD40L or GA-OX40L/P2A/CD40L into a virus scaffold, pAd5/3-D24 was digested with SrfI (NEB, R0629L) and BarI (SibEnzyme®, E548) followed by ethanol precipitation. Cleaved pAd5/3-D24 virus backbone was assembled with GA-OX40L/F2A/CD40L or GA-OX40L/P2A/CD40L fragments using the Gibson assembly master mix (NEB, E2611) following the manufacturer's instructions for generating pAd5/3- D24-OX40L/F2A/CD40L and pAd5/3-D24-OX40L/P2A/CD40L. Gibson assembly reactions were transformed into NEB® 5 alpha competent E. coli cells (NEB, C2987H) according to the manufacturer's instructions. Positive colonies were screened by PCR and correct recombination events were further confirmed by construct sequencing.

Cloning of CD40L and OX40L in pAD5/3-D24 to generate pAd5/3-D24-CD40L-OX40L

To create a fragment including CD40L (CD40L-GA) to be cloned into the backbone of the pAd5/3-D24 virus using specific homologous recombination reaction (trademark of Gibson Assembly, New England Biolabs), three PCR products were first assembled together with the assembly recombination reaction Gibson. The fragments fused together contained the following sequences: Fragment A corresponds to nucleotides 21376 to 22114 of plasmid pAd5/3-D24. Fragment B corresponds to nucleotides 999 to 2623 of the pShuttle-CD40L plasmid. Fragment C corresponds to nucleotides 22820-27107 of plasmid pAd5/3-D24 (see the list of primers used and primer sequences in Tables 1b-3b). PCR reactions were performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher, F530) according to the manufacturer's instructions, and these reactions were purified using NucleoSpin® Gel and a PCR purification kit (MACHEREY-NAGEL, 740609.50). The purified PCR fragments were then assembled together by a Gibson assembly recombination reaction according to the manufacturer's instructions (Gibson assembly master mix, NEB E2611) to generate CD40L-GA. After homologous recombination, the newly generated CD40L-GA fragment was further amplified by PCR using primers AA and DD (see Tables 1b and 3b for primer sequences) using Phusion High-Fidelity DNA polymerase according to the manufacturer's instructions. CD40L-GA amplified by PCR was gel purified using NucleoSpin® Gel and a PCR purification kit. To clone CD40L-GA into the virus backbone, pAd5/3-D24 was digested with SpeI (NEB, R0133S) and AsiSI (NEB, R0630S) followed by ethanol precipitation. The cleaved pAd5/3-D24 virus backbone was assembled with the CD40L-GA fragment using the Gibson assembly master mix (NEB, E2611) according to the manufacturer's instructions for generating pAd5/3-D24-CD40L. The Gibson assembly reaction mixture was transformed into NEB® 5 alpha competent E. coli cells (NEB, C2987H) according to the manufacturer's instructions. Positive colonies were screened by PCR and correct recombination was further confirmed by construct sequencing. To generate the final construct, i.e. a virus containing both the CD40L and OX40L genes, the fragment including OX40L (OX40L-GA) was amplified using the following primers: Gibson OX40L FW and Gibson OX40L REV (amplification of the region in pShuttle-OX40L corresponding to nucleotides with 11 to 3287), see the primer sequences in Table 4b. The PCR reaction was performed using Phusion High-Fidelity DNA Polymerase (Thermo Fisher, F530) according to the manufacturer's instructions, and these reactions were purified using NucleoSpin® Gel and PCR Purification Kit (MACHEREY-NAGEL, 740609.50). To clone OX40L-GA into the virus backbone, pAd5/3-D24-CD40L was digested with SrfI (NEB, R0629L) and BarI (SibEnzyme®, E548) followed by ethanol precipitation. The digested pAd5/3-D24-CD40L virus backbone was assembled with the OX40L-GA fragment using the Gibson assembly master mix (NEB, E2611) according to the manufacturer's instructions for generating pAd5/3-D24-CD40L-OX40L. The Gibson assembly reaction mixture was transformed into NEB® 5 alpha competent E. coli cells (NEB, C2987H) according to the manufacturer's instructions. Positive colonies were screened by PCR and correct recombination was further confirmed by construct sequencing.

Methods for testing a modified adenovirus with one or two transgenes in vitro

Flow Cytometry Analysis to Determine OX40L/OX40 Interaction

Flow cytometric analysis was performed to ensure that OX40L expressed by viruses was able to bind its native OX40 receptor (FIG. 2). Human A549 cells were plated in a 6-well plate and infected with two transgene viruses (Ad5/3-D24-OX40L-CD40L.C1 and Ad5/3-D24-OX40L-CD40L.C3, designated OX40L/CD40L.C1 and OX40L/ CD40L.C3), an OX40L-only virus (Ad5/3-D24-OX40L, designated as OX40L virus in the graphics) or a transgene-free virus (Ad5/3-D24, designated as ctrl virus) with a multiplicity of infection of 10 (then there are 10 viruses per cell).

72 hours after infection, these cells were collected and counted, and 3×10 ⁵ cells were seeded per well of a 96-well plate in duplicate. The plate was centrifuged at 400g for 5 minutes and resuspended in PBS. This step was repeated twice, and then the cells were suspended in a mixture of anti-OX40 receptor antibody and goat anti-rabbit antibody with Alexa fluor 488, incubated for 30 minutes, washed 3 times, and then analyzed on a BD Accuri flow cytometer to determine the geometric mean of cells with complex OX40L/OX40. The data was analyzed using FlowJo software.

Sandwich ELISA to test OX40L/OX40 interaction

To further verify that OX40L, expressed by viruses, is able to bind its own OX40 receptor, a sandwich ELISA functional assay was performed (FIG. 3). A 96-well plate was coated with 2 μg/ml OX40 receptor in its native form overnight and then washed 3 times with 0.05% Tween20 v/v. at PBS. Supernatant from virus-infected A549 cells was added to the wells and the plate was incubated at 37° C. for 1 hour and then washed again 3 times. Wells were incubated for 1 hour with mouse anti-human OX40L (1:1000 dilution in PBS), washed 3 times, and incubated with anti-mouse HRP conjugate (1:1000 dilution in PBS) for 1 hour. After washing the plates 3 times, 90 μl of TMB substrate was added and the plate was incubated in the dark at room temperature for 10 minutes. HRP conjugated with anti-mouse antibody reacted calorimetrically with TMB substrate and color intensity was measured at 450 nm spectrophotometrically.

Functionality assay with recombinant cell line OX40/NF-kB - HEK293

To verify that OX40L produced by viruses (either single transgene viruses or dual transgene viruses) is functional and able to activate downstream signals when bound to its OX40 receptor, a functionality assay was performed using the human embryonic kidney 293 (HEK- 293) constantly expressing OX40 (Fig. 4).

The OX40L product is produced in the culture medium of a culture of A549 cells infected with a virus expressing the OX40L gene. The medium is harvested and added to a culture of OX40/NF-κB HEK293 reporter cells continuously expressing the OX40 receptor. Binding of OX40L to the OX40 receptor triggers an intracellular signaling pathway that, through activation of NF-κB, leads to the expression of the firefly luciferase reporter gene. Luciferase activity is measured using the ONE-step luciferase assay system and a luminometer to determine the relative bioluminescence of a known concentration of the OX40L standard. The concentration of OX40L in the virus sample can then be analyzed based on the luminescence reading and the standard curve. Before a concentration of OX40L can be determined, a standard curve for OX40L must be determined using known concentrations of recombinant human OX40L.

Briefly, 1.5×10 ⁴ A549 cells were seeded onto a 96-well plate in 10% DMEM. The next day, A549 cells were infected with an MOI of 10, i.e. 10 viruses per cell, either a single transgene virus (Ad5/3-D24-OX40L, designated as OX40L virus in the graphics) or dual transgene viruses (Ad5/3-D24-OX40L-CD40L.C1 and Ad5/3 -D24-OX40L-CD40L.C3, designated OX40L/CD40L.C1 and OX40L/CD40L.C3) or no transgene virus (Ad5/3-D24, designated ctrl virus) in 2% DMEM.

Some wells were left uninfected to be used as negative controls. 72 hours after infection, the cells were centrifuged at 500g for 5 minutes, the medium was removed and 2×10 ⁵ OX40/NF-kB-HEK293 cells in 100 μl of 10% MEM were added on top of the A549 cells. After centrifugation at 400g for 1 minute, cells were incubated at 37°C for 6 hours before lysing with lysis buffer and adding 20 μl of each lysate to the wells of a clear 96-well plate. After adding 100 μl of luciferase reagent as a substrate, luminescence was immediately read on a luminometer.

Analysis of the functionality of the transgenic product CD40L

To verify that the CD40L protein expressed from the dual transgene viruses is able to bind its native CD40 receptor and activate downstream signals on CD40 expressing cells, functionality analysis of Ramos Blue cells was performed (FIG. 5).

Ramos Blue is a B-lymphocyte cell line that stably expresses the NF-κB-inducible SEAP (Secreted Embryonic Alkaline Phosphatase) reporter gene. The CD40L product is produced in the culture medium of a cell culture infected with a PeptiCRAd virus expressing the CD40L gene. The medium is harvested and added to a culture of Ramos Blue cells continuously expressing the CD40 receptor. Binding of CD40L to CD40 triggers an intracellular signaling pathway that results in the secretion of SEAP, which stains the substrate blue, which can be measured spectrophotometrically at 620-655 nm. The relative concentration of functional CD40L is determined using a standard curve for recombinant human CD40L.

Briefly, human A549 cells were seeded in a 6-well plate and infected with viruses with two transgenes (OX40L/CD40L.C1 or OX40L/CD40L.C3), a virus with only OX40L (OX40L virus) as a transgene, or with a virus without transgenes (Ctrl- virus) with a multiplicity of infection of 10. The supernatant was collected after 72 hours, and any cells and cellular debris were removed by centrifugation at 500 g for 5 minutes. A 2-fold dilution series was prepared from supernatants and recombinant CD40L protein at an initial concentration of 100 μg/ml. 100 μl of each supernatant was added to 4×10 ⁵ Ramos Blue cells in a 96-well plate (seeded at 100 μl) and the plate was incubated at 37°C for 18 hours. After incubation, the cells were pelleted by centrifugation at 400 g for 5 minutes, and 40 μl of the supernatant was added to a new 96-well plate. 160 μl of QUANTI-Blue substrate was added, the plate was incubated for 1 hour and the SEAP level was determined spectrophotometrically.

Methods for testing modified adenovirus with and without peptide antigen coating in vivo

NOD/Shi-scid/IL-2Rγnull immunodeficient mice were humanized using hematopoietic stem cells (CD34+, HLA-B35+) isolated from human umbilical cord blood. A375 human melanoma tumors were implanted subcutaneously (2 x 10 ⁶ cells per 100 μl) and animals were randomized into groups based on the degree of humanization and tumor size. Animals were treated with oncolytic virus without peptide coating (VALO-C1) or with oncolytic virus coated with peptide antigen (PeptiCRAd) (viral dose 1 x 10 ⁸ for both groups; a suboptimal dose of 1 x 10 ⁷ was also tested for PeptiCRAd). Peptide vaccines (0.12 or 30 μg) were administered intradermally with Poly-IC as an adjuvant.

Treatment was started 25 days after randomization (C0) with a bolus dose of cyclophosphamide (1 mg/mouse intravenously (IV)). Treatment was intratumoral (sham, virus and PeptiCRAd) or intradermal (peptide control) on days 1, 2, 3 and 12. Secondary tumors were implanted in the contralateral flank two days after the third treatment (day 5). Treatment of secondary tumors was not performed.

Peripheral blood mononuclear cells (PBMC) and tumor-infiltrating CD8+ lymphocytes (TIL) were analyzed for CD8+ T cells specific for NY-ESO-1 and MAGE peptide antigens by flow cytometry using dextramer analysis. Different subpopulations of immune cells were evaluated among PBMC and TIL. Flow cytometry analysis was performed on an Attune NxT flow cytometer (Life Technologies).

Immunization in a mouse model with PBMC

35 immunodeficient (NCG) NOD-Prkdcem26Cd52/IL-2Rγ em26Cd22/NjuCrl mice at eight weeks of age were inoculated with 2.10 ⁶ SKMEL-2(HLA-B35+) tumor cells in the right flank (day 0). On day 13, 5x10 ⁶ HLA-B35+ human peripheral blood mononuclear cells (PBMC) were intravenously administered from two different donors. Intratumoral treatment with NYESO-1 and MAGE-A3 in complex with capsid 5/3, OX40L-expressing virus (“OX40L PeptiCRAd”) or containing NYESO-1 and MAGE-A3 in complex with capsid 5/3, OX40L- and CD40L-expressing virus ("PeptiCRAd") - started on day 16 with a dose of virus 1 x 10 ⁹ VP in complex with each peptide. Simultaneously with the first PeptiCRAd treatment, 50,000 autologous plasmacytoid and myeloid dendritic cells were injected intratumorally. On days 17, 18 (priming with primary treatment) and 25 (stimulation) tumors were treated with intratumoral injections of PeptiCRAd without the addition of dendritic cells. The processing scheme is shown in Fig. 10. Observed the growth of the tumor. Animals were sacrificed on the 32nd day. OX40L-PeptiCRAd and PeptiCRad contain a 24 bp deletion. in E1A, the gp19k/7.1K deleted region, the human OX40L transgene expressed from the 14.7K locus, and the 5/3 fiber chimeric protein.

results

Functionality of OX40L expressed by viruses

Flow cytometric analysis as well as sandwich ELISA show that the OX40L transgene product, expressed by viruses on the cell surface of the infected cell, and also released to some extent from the cell surface, is able to bind its OX40 receptor (FIGS. 2 and 3, respectively). Most importantly, when analyzing the functionality of OX40L expressed from viruses, a clear downstream gene activation was seen using HEK-293 cells stably expressing the OX40 receptor (FIG. 4). Binding of OX40L to OX40 triggers an intracellular signaling pathway in these cells that, through activation of NF-κB, leads to the expression of the firefly luciferase reporter gene. Bioluminescence levels obtained using A549 cells infected with OX40L-expressing viruses clearly show that the OX40L protein is functional and activates downstream signaling when bound to OX40 compared to bioluminescence levels obtained using virus without a transgene or negative cell control.

Functionality of CD40L expressed from viruses expressing OX40L/CD40L

Clear downstream gene activation was observed when analyzing CD40L functionality using Ramos Blue cells stably expressing the CD40 receptor (FIG. 5). Binding of CD40L to CD40 triggers an intracellular signaling pathway in these cells that, via NF-κB activation, leads to SEAP gene expression. Uptake levels obtained using A549 cells infected with CD40L-expressing viruses clearly show that the CD40L protein is functional and activates downstream signaling when bound to CD40 compared to uptake levels obtained using viruses without CD40L as transgene or negative cellular control.

Modified oncolytic virus with and without peptide surface antigen elicits a peptide-specific immune response in a humanized mouse model

All active treatments (peptide only, virus without peptide [VALO-C1], and virus with peptide [PeptiCRAd]) increased the number of immune cells in primary tumors compared to sham-treated animals. Animals treated with both VALO-C1 and PeptiCRAd-1 showed more T cells (CD3, CD4, CD8) in primary tumors compared to animals treated with peptide vaccine or sham after treatment, while the total number of infiltrating immune cells (CD45) was the same in all groups (Fig. 6 and 7, respectively).

In addition, the number of T-regulatory cells (CD3+/CD4+/FoxP3+) was lower in primary tumors treated with VALO-C1 and PeptiCRAd-1 compared with primary tumors in animals treated with peptide vaccine or sham (Fig. 8). This suggests that an intratumorally administered immunogenic adenovirus (uncoated VALO-C1 or PeptiCRAd-1 virus) modulates the tumor microenvironment, reducing local immunosuppression.

Oncolytic adenovirus with (PeptiCRAd) or without peptide antigen (VALO-C1) is superior to standard peptide vaccination in triggering systemic tumor-targeted CD8+ T cell responses and CD8+ TIL infiltration into untreated distant tumors. These data indicate that PeptiCRAd improves the specificity of the standard oncolytic virus for tumor targeting.

PeptiCRAd induces a peptide-specific immune response in a PBMC mouse model

Treatments with PeptiCRAd complexed with NY-ESO-1 and MAGE-A3 resulted in tumor growth arrest in a humanized mouse melanoma model, even when treatment was initiated for large, well-developed tumors (FIG. 9). OX40L-PeptiCRAd-treated mice showed significantly more MAGE-A3-specific CD8+ T cells among all PBMC CD8+ T cells than sham-treated mice, indicating that PeptiCRAd treatment was able to elicit a peptide-specific response in humanized mice. (Fig. 10).

Links

Kanerva et al 2003 Mol Ther 12:449-458.

Fueyo et al 2000. Oncogene 19:2-12.

Table 1 Primers used to clone pAd5/3-D24-CD40L-OX40L.

Primer name Primer sequence P2A rev OX40L 5'CGCCGGCCTGCTTCAGCAGGCTGAAGTTGGTGGCGCCCGCTGCCGCTCCTCCTCTTCCTAAGGACACAGAATTCACCAGG 3'
(SEQ ID NO: 4) P2A fwd CD40L 5'AGCGGCGCACCAACTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCATGA
TCGAAACATACAACCAAAC 3' (SEQ ID NO: 5) F2A fwd Adeno end without insert 5'ACTCAAACTCTGATAAAAAAAAAATAATAAAGCATCACTTACTTAAAATCAGTTAGCAAATTTCTGTCC 3' (SEQ ID NO: 6) F2A rev OX40L 5'TCGAAGTTCAGGGTCTGCTTCACGGGGCCACGATCTTCTGCTTGTGCCTGGCCTCGCCGCTGCCGCTCC
TCCTCTTCCTAAGGACACAGAATTCACCAGG 3' (SEQ ID NO: 7) F2A fwd CD40L 5'AGAAGATCGTGGCCCCCGTGAAGCAGACCCTGAACTTCGACCTGCTGAAGCTGGCCGGCGA
CGTGGAGAGCAACCCCGGCCCCATGATCGAAACATACAACCAAAC3' (SEQ ID NO: 8) F2A rev CD40L 5'AAGTGATGCTTTATTATTTTTTTTTATCAGAGTTTGAGTAAGCCAAAGGACGTGAAGCCAG 3' (SEQ ID NO: 9) Gibson OX40L FW 5'GCCGAAGTTCAGATGACTAACTCAG 3' (SEQ ID NO: 10) Gibson OX40L REV 5'ATAGTGGGTGCGGATGGACAG 3' (SEQ ID NO: 11)

Table 1b Primers for PCR fragment A with pAd5/3D24 as template.

Name semantic sequence Primer 5'-3' Tm Position at paAd5/3D24 Primer AA ACCGCAGTTGACAGCATTACC (SEQ ID NO: 12) ACCGCAGTTGACAGCATTACC
(SEQ ID NO: 13) 57.9 21376-21396 Primer BB TCCACGCCTTTGCCAACTGG
(SEQ ID NO: 14) CAGTTGGCAAAGGCGTGG
(SEQ ID NO: 15) 57.5 22097-22114

Table 2b PCR primers for fragment B with pShuttle-CD40L as template.

Name semantic sequence Primer 5'-3' Tm Position at pShuttle-CD40L Primer CC GCCTGTGGACTATTCTGCTGC
(SEQ ID NO: 16) GCCTGTGGACTATTCTGCTGC
(SEQ ID NO: 17) 58.3 999-1019 Primer B GTCTGGGCGTTAGGATACAGC
(SEQ ID NO: 18) GCTGTATCTAACGCCCAGAC
(SEQ ID NO: 19) 57.5 2603-2623

Table 3b Primers for PCR fragment C with pAd5/3-D24 as template.

Name semantic sequence Primer 5'-3' Tm Position at paAd5/3D24 Primer C GCACCGTAGTGGCATCAAAAGG
(SEQ ID NO: 20) GCACCGTAGTGGCATCAAAAGG
(SEQ ID NO: 21) 58.8 22820-22841 Primer DD CTACGTCATCTCCAGCGGC
(SEQ ID NO: 22) GCCGCTGGAGATGAGCGTAG
(SEQ ID NO: 23) 57.9 27089-27107

Table 4b PCR primers for OX40L insert with pShuttle-OX40L as template.

Name semantic sequence Primer sequence
(5'->3') Tm (°C) Position at OX40L Block Gibson OX40L FW GCCGAAGTTCAGATGACTAACTCAG
(SEQ ID NO: 24) GCCGAAGTTCAGATGACTAACTCAG
(SEQ ID NO: 25) 62 11-37 Gibson OX40L REV CTGTCCATCCGCACCCACTAT
(SEQ ID NO: 26) ATAGTGGGTGCGGATGGACAG
(SEQ ID NO: 27) 62 3167-3187

Claims (26)

1. A modified replicating adenovirus of serotype 5, having lytic activity in target cancer cells, containing: a) deletion of the E1A gene, wherein said deletion is a deletion of base pairs 923-946; b) a chimeric replacement of 5/3 of the adenovirus fiber protein overhang, wherein said serotype 5 Ad overhang is replaced with a serotype 3 Ad overhang; c) a deletion of the 14.7k gene, wherein the deletion is a deletion of base pairs 30446-30460 compared to the wild type adenovirus, and wherein the deleted C-terminal sequence of the RID beta gene GGA GGA GAT GAC TGA (SEQ ID NO: 1) is replaced on GGA GGA GAC GAC TGA (SEQ ID NO: 2); And d) a deletion of the gp19k gene and a deletion of the 7.1k gene, these deletions being deletions of base pairs 28541-29211 compared to the wild type adenovirus. 2. A modified adenovirus according to claim 1, characterized in that said adenovirus is additionally modified by the insertion of a molecule encoding OX40L. 3. Modified adenovirus according to claim 2, characterized in that said OX40L is human OX40L. 4. A modified adenovirus according to claim 2 or 3, characterized in that said OX40L is inserted into the E3B region, at the site of the 14.7K gene deletion. 5. A modified adenovirus according to any of the previous claims, characterized in that said adenovirus is modified by insertion of a molecule encoding CD40L. 6. The modified adenovirus according to claim 5, characterized in that said CD40L is human CD40L. 7. Modified adenovirus according to any one of paragraphs. 5, 6, characterized in that said CD40L molecule is inserted immediately after OX40L using the 2A processing site. 8. The modified adenovirus according to claim 7, characterized in that the 2A processing site is inserted between two transgenes, and said 2A processing site is preceded by a cleavage site and an SGSG linker to ensure efficient cleavage of said transgenes. 9. The modified adenovirus according to claim 7 or 8, characterized in that said 2A processing site is a foot-and-mouth disease virus 2A (F2A) processing site or a porcine teschovirus-1 2A processing site. 10. A modified adenovirus according to claim 5 or 6, characterized in that said CD40L molecule is inserted into the late gene region of the virus, specifically into the late gene 3 (L3) region. 11. The modified adenovirus according to claim 10, characterized in that said CD40L molecule is inserted after the 23K gene, before its polyadenylation site. 12. The modified adenovirus according to claim 10 or 11, characterized in that an acceptor splice site and/or a Kozak sequence is provided or inserted before the CD40L molecule. 13. Modified adenovirus according to any one of paragraphs. 2-12, characterized in that a molecule encoding a full-length cDNA of at least one or each of OX40L and CD40L is inserted into said adenovirus. 14. Modified adenovirus according to any one of paragraphs. 1-13 for use in the treatment of cancer. 15. A pharmaceutical composition containing at least one modified replication-competent adenovirus exhibiting lytic activity against a target cell, according to any one of paragraphs. 1-14 and suitable media. 16. The pharmaceutical composition according to claim 15, characterized in that said composition is prepared for intratumoral, intramuscular, intraarterial, intravenous, intrapleural, intravesical, intradermal, intracavitary or peritoneal injection or for oral administration. 17. Pharmaceutical composition according to claim 15 or 16 for use in the treatment of cancer. 18. The use of at least one modified replication-competent adenovirus exhibiting lytic activity against a target cell, according to any one of paragraphs. 1-14 or a pharmaceutical composition according to claim 15 or 16 in the production of a medicinal product for the treatment of cancer. 19. A method of treating cancer in a patient, comprising administering to the patient an effective amount of a pharmaceutical composition according to claim 15 or 16 or a composition containing at least one modified replication competent adenovirus exhibiting lytic activity against a target cell, according to any one of claims. 1-14. 20. The method of treating cancer according to claim 19, characterized in that said at least one modified replication-competent adenovirus exhibiting lytic activity against the target cell, according to any one of claims. 1-14 is administered with a cell checkpoint modulator. 21. The method of treating cancer according to claim 20, wherein said checkpoint modulator is an anti-PD1 molecule, an anti-PD-L1 molecule, or an anti-CTLA-4 molecule. 22. Adenovirus according to claim 14 or use according to claim 18, or a method according to any of paragraphs. 19-21, characterized in that said cancer is selected from a list containing or consisting of: nasopharyngeal cancer, synovial cancer, hepatocellular cancer, kidney cancer, connective tissue cancer, melanoma, lung cancer, intestinal cancer, colon cancer, cancer rectal cancer, colorectal cancer, brain cancer, throat cancer, oral cancer, liver cancer, bone cancer, pancreatic cancer, choriocarcinoma, gastrinoma, pheochromocytoma, prolactinoma, T-cell leukemia/lymphoma, neuroma, von Hippel-Lindau disease, syndrome Zollinger-Ellison, adrenal cancer, anal cancer, bile duct cancer, bladder cancer, ureteral cancer, oligodendroglioma, neuroblastoma, meningioma, spinal cord tumor, osteochondroma, chondrosarcoma, Ewing's sarcoma, cancer of unknown primary site, carcinoid, gastrointestinal carcinoid tract, fibrosarcoma, breast cancer, Paget's disease, cervical cancer, esophageal cancer, gallbladder cancer, head cancer, eye cancer, neck cancer, kidney cancer, Wilms tumor, liver cancer, Kaposi's sarcoma, prostate cancer, testicular cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, skin cancer, mesothelioma, multiple myeloma, ovarian cancer, pancreatic endocrine cell cancer, glucagonoma, parathyroid cancer, penile cancer, pituitary cancer, soft tissue sarcoma, retinoblastoma, small intestine cancer, stomach cancer, thymus cancer gland, thyroid cancer, trophoblastic cancer, hydatidiform mole, uterine cancer, endometrial cancer, vaginal cancer, vulvar cancer, acoustic neuroma, mycosis fungoides, insulinoma, carcinoid syndrome, somatostatinoma, gum cancer, heart cancer, lip cancer, cancer of the membrane of the brain brain, oral cancer, nerve cancer, palate cancer, parotid cancer, peritoneal cancer, pharynx cancer, pleural cancer, salivary gland cancer, tongue cancer and tonsil cancer.