RU2787060C1 - NUCLEOTIDE SEQUENCE ENCODING FUSED PROTEIN CONSISTING OF SOLUBLE EXTRACELLULAR FRAGMENT OF HUMAN Dll4 AND CONSTANT PART OF HEAVY CHAIN OF HUMAN IgG4 - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, specifically to the production of functional antagonists of human Delta-like ligand 4 (hereinafter – Dll4); it can be used for recombinant production of fused protein based on a soluble extracellular fragment of human Dll4, consisting of only DSL domain and domains of EGF-like repeats of Dll4 protein, placed in order corresponding to a natural sequence, and not including MNNL domain, and in this case the fragment Dll4 is connected to a constant part of a heavy chain of human IgG4.

EFFECT: invention provides obtainment of hybrid structures, which have only minimal effector function of antibody-dependent cell cytotoxicity, do not have complement-dependent cytotoxicity, and have relatively small molecular weight, which increases the efficiency of production of these molecules in mammalian cells and improves their properties related to a speed and efficiency of penetration into tissues; have decreased capability of aggregating and improved solubility, as well as provide effective blocking of Notch signaling due to the absence of MNNL domain in the structure.

18 cl, 2 dwg, 3 ex

Description

Technical field

The invention relates to the field of biomolecular pharmacology, biotechnology and genetic engineering and concerns nucleic acid molecules and new soluble proteins encoded by them - functional human Dll4 (Delta-like ligand 4) antagonists capable of blocking Dll4-Notch signaling pathways, as well as a method for their preparation.

State of the art

Dll4 is a transmembrane protein that is a ligand for Notch receptors, including Notch1 and Notch4. By activating these receptors, Dll4 is involved in angiogenesis, negatively regulates the proliferation and migration of endothelial cells and angiogenic sprouting. Numerous experiments have shown that blocking the interaction of Dll4 with its receptors makes it possible to stimulate productive angiogenesis in ischemic tissues, improving their oxygenation and nutrient intake. Blocking the interaction of Dll4 with its receptors also has an anti-inflammatory effect on the vascular endothelium due to the suppression of angiotensinogen expression and has a vasodilating effect (Lobovetal. The Dll4/Notch pathway controls postangiogenic blood vessel remodeling and regression by modulating vasoconstriction and blood flow // Blood, 2011, Vol 117, Number 24:6728-37 doi: 10.1182/blood-2010-08-302067). In addition, the anticancer effect of inhibitors of the interaction of Dll4 with its receptors is known, which can be achieved through several mechanisms, including suppression of the expression of the cellular oncogene MYC , stimulation of unproductive angiogenesis in the tumor, leading to its nonperfusion, etc.

One of the approaches to blocking the interaction of Dll4 with its receptors is the creation of competitive antagonists that bind to Notch receptors but do not cause its activation.

The literature describes a Dll4 delta ligand antagonist, which is a Dll4-Fc fusion polypeptide that may be involved in the regulation of angiogenesis. In particular, intraperitoneal administration of Dll4-Fc at a concentration of 2.5 mg/kg to mice with ischemic extremities was found to stimulate the growth and maturation of new vessels and thus improve blood supply to the extremities (Liu R. Et al. Inhibition of Notch signaling by Dll4- Fc promotes reperfusion of acutely ischemic tissues // Biochemical and Biophysical Research Communications, 2012, Vol. 418, No 1, pp. 173-179).

The use of the Dll4-Fc fusion polypeptide as a modulator of Notch signaling, vascular growth promotion, blood pressure regulation, and inflammatory markers is also published in Lobov et al., Blood, 2011.

A known method for the treatment of ischemic vascular diseases of the eye with Dll4 antagonists is described in patent EP2054082B1. When implementing this method, to prevent or reduce the loss of blood vessels and/or promote productive angiogenesis in a patient having ischemic injury or vascular insufficiency, a delta-like ligand 4 (Dll4) antagonist is used, including the extracellular domain of Dll4, optionally connected to a multimerized component. In specific embodiments, the Dll4 antagonist approximately comprises amino acids 27-172, 27-217, 218-400, 218-360, 218-322, or 218-282 of the Dll4 protein amino acid sequence (SEQ ID NO: 1).

In the method for activating angiogenesis described in US2007213266A1, patients are administered an effective amount of a therapeutic polypeptide, which is an extracellular part of the Dll4 protein, in one of the embodiments of the described method, the DSL domain of the Dll4 protein.

However, the implementation of the approaches described above has a number of limitations: the binding affinity of known therapeutic polypeptides to the Notch receptor is not high enough, and the large size of therapeutic polypeptides leads to a low rate of their penetration into tissues and causes a high dose of the drug administered to the patient, which, in turn, can lead to to patient sensitization and other undesirable effects. Also, the use of Dll4-Fc molecules with a full-length extracellular Dll4 domain in the composition, can lead to activation of Notch signaling. To date, despite promising potential, there are still no clinically approved drugs based on the Dll4-Fc fusion peptide.

The present invention has a number of improved properties compared to analogues, and therefore expands the range of available candidates for the treatment of diseases, the mechanism of action of which is based on blocking the interaction of Dll4 with Notch receptors.

The essence of the invention

The objective of the present invention is to expand the arsenal of technical means for the treatment of diseases of the cardiovascular system, ischemic conditions, inflammatory conditions in the vessels and oncological diseases, stimulation of therapeutic angiogenesis. In particular, the task concerns the production of new highly effective polypeptide drugs - Dll4 antagonists, which have a high affinity for the Notch receptor, are relatively small in size and do not activate Notch signal transmission upon interaction; the task also concerns the development of nucleotide sequences encoding such polypeptides and being the expression basis for their production.

The solution of this problem is carried out by creating a fusion protein hDll4-hFc, which is a Dll4 antagonist, the structure of which includes a fragment of the soluble extracellular part of the human Dll4 protein, including the following functional subunits: the DSL domain of the Dll4 protein (173-217 SEQ ID NO: 1), at least at least five domains of EGF-like repeats of the Dll4 protein, represented by fragments 218-251, 252-282, 284-322, 324-360, 362-400 of the sequence SEQ ID NO: 1; as well as the constant part of the heavy chain (Fc fragment) of IgG4 person. In this case, the human IgG4 Fc fragment is attached to the Dll4 protein fragment from the C-terminus directly or via a linker sequence.

In some embodiments, the fusion protein further comprises 1-3 EGF-like repeat domains of the Dll4 protein represented by fragments 402-438, 440-476, and 480-518 of SEQ ID NO: 1. In other words, the fusion protein further comprises at least one of the domains of 6-8 EGF-like repeats of the Dll4 protein located(s) from the C-terminus of the Dll4 protein fragment, and the order of these domains of 6-8 EGF-like repeats can be any.

In some embodiments, the human IgG4 Fc fragment is linked to the Dll4 protein fragment in a non-linker fashion. In some other embodiments, the human IgG4 Fc fragment is linked to the Dll4 protein fragment via a linker peptide. In some particular embodiments of the invention, the linker peptide is a GS dipeptide.

In some embodiments, a fragment of the soluble extracellular portion of the human Dll4 protein is included in the fusion protein structure as the sequence of SEQ ID NO: 6.

In some embodiments, the heavy chain constant portion (Fc fragment) of human IgG4 has the sequence of SEQ ID NO: 7.

In some embodiments, the fusion protein further includes a signal sequence located at the N-terminus of the fusion protein.

In some particular embodiments, the fusion protein has the amino acid sequence of SEQ ID NO: 2.

In some other particular embodiments of the invention, the fusion protein has the amino acid sequence of SEQ ID NO: 4.

The problem is also solved by creating an isolated nucleic acid molecule encoding such a fusion protein.

In some particular embodiments of the invention, the nucleic acid molecule has the sequence of SEQ ID NO: 3.

In some other particular embodiments of the invention, the nucleic acid molecule has the sequence of SEQ ID NO: 5.

This problem is also solved by creating an expression vector carrying a nucleotide sequence corresponding to the sequence of an isolated nucleic acid molecule encoding such a fusion protein, under the control of regulatory elements necessary for the expression of this nucleotide sequence in the host cell; and also by creating a host cell, including the expression vector described in this application, providing efficient production of such a fusion protein using the above nucleic acid molecule. In some embodiments of the invention, such cells are mammalian cells (in some particular embodiments of the invention, Chinese hamster ovary (CHO) cells).

The solution to this problem is also achieved by using the above fusion protein for the treatment of a wide range of ischemic conditions (in particular, ischemia of the lower extremities), cardiovascular diseases, oncological diseases, and the treatment of vascular complications of infectious diseases, including COVID-19.

Also, the solution of the problem is achieved by implementing a method for treating a wide range of ischemic conditions (in particular, ischemia of the lower extremities), cardiovascular diseases, oncological diseases, treating vascular complications of infectious diseases, including COVID-19, which includes administering a fusion protein according to the invention to a patient. According to the invention, such a protein is administered to a patient in a therapeutically effective amount, preferably as part of a pharmaceutical composition.

When implementing the invention, the following technical results are achieved:

- new versions of a therapeutic agent based on a fusion (hybrid) hDll4-hFc protein containing functional domains of DSL and EGF-like repeats (from five to eight) of the Dll4 protein, fused with the constant part (Fc-domain) of human IgG4 immunoglobulin, and capable of selectively block Notch-signaling, as well as developed nucleotide sequences encoding such fusion proteins and being the expression basis for their production;

- the developed hybrid constructs have only a minimal effector function of antibody-dependent cellular cytotoxicity and do not have complement-dependent cytotoxicity, which reduces the possible risk of inflammatory reactions and sensitization when using a therapeutic agent based on the hDll4-hFc fusion (hybrid) protein;

- the developed hybrid constructs include the minimum fragment of the human Dll4 protein (DSL domain and, at a minimum, the first 5 domains of EGF-like repeats), necessary and sufficient for interaction with Notch receptors;

- the developed hybrid constructs do not include the MNNL domain of the human Dll4 protein involved in the activation of Notch signal transmission;

- the developed hybrid structures have a relatively small molecular weight, which increases the efficiency of the production of these molecules in mammalian cells and improves their properties associated with the speed and efficiency of penetration into tissues;

- the developed hybrid constructs, due to the absence of the MNNL domain in the construct, have a reduced ability to aggregate and improved solubility;

- binding of the developed hybrid constructs to Notch receptors does not lead to their activation, due to the absence of the MNNL domain in the construct, as a result of which such binding ensures effective blocking of Notch signaling.

Brief description of the drawings

Fig.1. Scheme of an expression vector containing a nucleotide sequence encoding a fusion protein having the amino acid sequence of SEQ ID NO: 2.

Fig.2. Scheme of an expression vector containing a nucleotide sequence encoding a fusion protein having the amino acid sequence of SEQ ID NO: 4.

Definitions and terms

The following terms and definitions apply in this document unless otherwise stated. References to techniques used in the description of this invention refer to well-known methods, including modifications of these methods and replacing them with equivalent methods known to those skilled in the art.

In the documents of this invention, the terms "comprises", "comprising", and the like, as well as "comprises", "comprising", etc. are interpreted to mean "includes, among other things" (or "contains, among other things"). These terms are not intended to be construed as "consisting only of".

The terms "polypeptide", "protein" and "peptide" are used interchangeably herein, and they all mean a polymer of amino acid residues. These terms may also be used interchangeably herein to refer to the final product resulting from expression in a host cell of a nucleic acid sequence.

By "fusion protein" ("fusion protein", "recombinant protein", "fusion polypeptide", "recombinant polypeptide", "hybrid construct") is understood a construction of two or more parts of a polypeptide nature, covalently linked to each other, resulting from the expression a recombinant DNA molecule in which the coding regions, respectively, of two or more different genes or their fragments are connected to each other in the same reading frame.

The term "isolated" has its conventional meaning known to one of ordinary skill in the art, and when used in relation to an isolated nucleic acid or an isolated polypeptide is used without limitation to refer to a nucleic acid or polypeptide which, due to man, exists separately. from their native environment and therefore are not a product of nature. An isolated nucleic acid or polypeptide may exist in a purified form, or may exist in a non-native environment such as, for example, a host cell.

The term "synonymous substitution" refers to a nucleotide sequence having a nucleotide sequence that may differ from the reference nucleic acid sequence by one or more substitutions that do not lead to a change in the amino acid sequence of the protein encoded by that nucleic acid molecule. Due to the fact that the genetic code is “degenerate”, that is, triplets different in nucleotide sequence can encode the same amino acid, synonymous substitutions in the nucleotide sequence do not lead to a change in the amino acid sequence of the protein.

The term decoy ligand (from the English Decoyligand, also trap) refers to fusion proteins consisting of the extracellular domain of the ligand of the target molecule (receptor) and the Fc domain of an immunoglobulin. The extracellular domain of the ligand is responsible for target binding, while the Fc domain dimerizes the fusion protein. The latter is necessary to increase the efficiency of binding and ensure greater stability of the high-molecular complex. Within the scope of the present invention, the "trap ligand" consists of certain fragments of the soluble extracellular fragment of the human Dll4 protein (DSL domain and, at a minimum, the first 5 domains of EGF-like repeats), and the constant portion of the human IgG4 heavy chain.

The term "treatment" means curing, slowing down, stopping, or reversing the progression of a disease or disorder. As used herein, "treatment" also means alleviation of symptoms associated with a disease or disorder.

By "therapeutically effective amount (therapeutic dose)" is meant the amount of drug administered to a patient that is most likely to produce the expected therapeutic effect. The exact amount required may vary from subject to subject depending on numerous factors such as disease severity, age, body weight, general body condition, combination treatment with other drugs, and others. prevention of a disease or condition, carried out in a dose sufficient to achieve a therapeutic effect. When carrying out treatment and / or prophylaxis, the administration can be carried out both once and several times a day, more often in the form of a course administration for a period of time sufficient to achieve a therapeutic effect (from several days to a week, several weeks to months), while courses of drug administration may be repeated. In particular, in moderate forms of the disease, a single dose, frequency and/or duration of administration of the drug according to the invention can be increased. Preferably, the fusion protein of the invention is administered to a patient in a pharmaceutical composition comprising, in addition to the active ingredient, pharmaceutically acceptable carriers and/or excipients.

Unless otherwise defined, the technical and scientific terms in this application have the standard meanings generally accepted in the scientific and technical literature.

Detailed description of the invention

The present invention proposes DNA constructs encoding hDll4-hFc fusion proteins (recombinant polypeptides), Dll4 antagonists that block the Notch signaling pathway, but are relatively small in size compared to decoy ligands using the full-length human Dll4 protein ectodomain, which provides their improved properties. concerning the rate and efficiency of tissue penetration, protein production in mammalian cells, and the lack of activation of Notch signaling upon binding.

In particular, the invention relates to nucleotide constructs encoding polypeptides containing functional domains of DSL and EGF-like repeats (from five to eight) of the Dll4 protein, fused to the constant part (Fc-domain) of human IgG4 immunoglobulin, hDll4-hFc.

The natural sequence of the human Dll4 protein consists of 685 amino acids (aa) (SEQ ID NO: 1). The protein consists of a signal peptide (1-26 aa SEQ ID NO: 1), a transmembrane domain (530-550 aa SEQ ID NO: 1), a Delta/Serrate/Lag-2 domain (DSL, 173-217 aa SEQ ID NO : 1) and eight tandem repeats similar to epidermal growth factor (EGF-like repeat domains) (218-251, 252-282, 284-322, 324-360, 362-400, 402-438, 440-476, 480- 518 a.k.a. SEQ ID NO: 1). The protein contains an extracellular part (27-529 aa SEQ ID NO: 1) and a cytoplasmic part (551-685 aa SEQ ID NO: 1), while the N-terminal end of Dll4 (27-172 aa SEQ ID NO: 1) forms a separate functional domain of MNNL. Works by various authors on the structure and role of various domains of the Dll4 protein in interaction with Notch receptors and signaling are known in the prior art (see, for example, Luca et al. Structural basis for Notch1 engagement of Delta-like 4 // Science, 2015, Vol 347, Issue 6224, pp. 847-853 doi: 10.1126/science.1261093; Hirano et al. Delta-like 1 and Delta-like 4 differently require their extracellular domains for triggering Notch signaling in mice / / Elife 2020; 9: e50979. Publishedonline 2020 Jan 16 doi: 10.7554/eLife.50979), however, at the moment, all the subtleties and features of Notch signaling have not yet been fully studied.

In the framework of the present invention, in the process of developing new highly effective polypeptide drugs - Dll4 antagonists, it was assumed that the absence of the MNNL domain in the hybrid polypeptide would allow blocking Notch signaling. In accordance with the task, nucleotide sequences were created that encode therapeutic molecules that have properties to selectively block Notch signal transmission, which are Dll4 antagonist hybrid polypeptides (hDll4-hFc). These protein molecules include functional domains of DSL and EGF-like repeats (at least the first five domains) of the Dll4 protein fused to the constant portion (Fc fragment) of human IgG4. Blocking of Notch signal transmission during interaction with the Notch receptor is achieved due to the absence of the MNNL domain in the therapeutic molecule, which is involved in signal transmission. Such a construction causes, on the one hand, the antagonistic properties of the molecule according to the invention, and on the other hand, a reduced size of the molecule. The size of the molecule according to the invention can also be further reduced by reducing the number of EGF-like repeat domains (experiments have shown that the antagonistic properties of the molecule are retained when 5 to 8 EGF domains are included). According to the invention, the functional domains of the Dll4 protein can be fused to a human IgG4 heavy chain constant either directly (ie, without a linker) or via a linker sequence. The hDll4-hFc fusion protein of the invention may also optionally contain a signal sequence, which may include any sequence known to those skilled in the art of controlling the secretion of a polypeptide or protein from a cell, and include natural or synthetic sequences. Typically, the signal sequence is located at the N-terminus of the fusion protein of the present invention.

In particular embodiments of the invention, the recombinant polypeptides of the invention include the Dll4 DSL domain and the Dll4 EGF(1-5) domains or the Dll4 DSL domain and the Dll4 EGF(1-8) protein domains and are soluble recombinant ligands- traps (traps) are Dll4 antagonists. Such molecules inhibit the Notch signaling pathway by specifically binding to Notch1 and Notch4 receptors. In this case, the Notch pathway is not activated; instead, hDll4-hFc molecules prevent the binding of Notch receptors to endogenous full-length activating ligands. Notch1 and Notch4 signaling pathways are involved in the control of blood vessel growth, and their inhibition due to the action of hDll4-hFc leads to the activation of new vessel growth (therapeutic angiogenesis) in ischemic tissues and improves wound healing. Specific inhibition of Notch signaling pathways through the use of Dll4 antagonists can be used to treat a wide range of cardiovascular diseases, oncological diseases, as well as to treat vascular complications of infectious diseases, including COVID-19.

EFFECT: invention makes it possible to obtain polypeptides with high affinity for human Notch receptors, but with a reduced molecular weight in comparison with natural Dll4 proteins, as well as in comparison with Dll4-Fc molecules described earlier. Reducing the size of recombinant polypeptides makes it possible to increase the rate of their penetration into body tissues, to reduce the necessary doses of a preparation (pharmaceutical composition) based on them administered to patients, and to reduce the cost of synthesizing the described recombinant polypeptides.

Preparations based on the described recombinant polypeptides can be used to treat ischemic diseases of various organs and tissues. Ischemia is a decrease in blood supply to a part of the body, organ or tissue due to a weakening or cessation of arterial blood flow to it. Ischemia can be caused by various factors and occurs when the volume of blood flow does not match the needs of the organ. There are a number of therapeutic approaches to solving the problems of restoring blood flow and treating ischemic damage to various tissues, one of which is therapeutic angiogenesis, the formation of new functioning vessels based on existing ones, induced by drugs.

The described DNA constructs make it possible to obtain hDll4-hFc molecules that have a low molecular weight and high bioavailability and can be used to stimulate therapeutic angiogenesis, treat a wide range of ischemic conditions (in particular, ischemia of the lower extremities), cardiovascular diseases, oncological diseases, and treat vascular diseases. complications of infectious diseases, including COVID-19, and other diseases associated with pathological activity of Notch receptors, or in cases where modulation of the Dll4-Notch signaling pathway is appropriate.

Fusion proteins (recombinant polypeptides), which are the subject of the present invention, can be obtained as follows.

Soluble recombinant Dll4 antagonist polypeptides are produced by expression of the nucleotide sequences encoding them in eukaryotic cell lines, followed by purification of the synthesized recombinant proteins using affinity, ion exchange or hydrophobic chromatography, used individually or in various combinations with each other, as well as using other protein purification methods. Appropriate nucleotide sequences are obtained by combining DNA regions encoding selected Dll4 domains with a DNA sequence encoding a human IgG4 Fc fragment. In some particular embodiments, nucleic acid molecules encoding such Dll4 antagonist polypeptides have a nucleotide sequence corresponding to SEQ ID NO: 3 or SEQ ID NO: 5.

Also, this problem is solved by creating an expression vector containing this nucleic acid molecule under the control of regulatory elements necessary for the expression of this nucleic acid in the host cell. In preferred embodiments, the host cell comprising such an expression vector may be Chinese Hamster Ovary CHO cells (eg, CHO-K1 or CHO DG44 cell lines) adapted to produce therapeutic proteins. In the present invention, the expression vector is preferably selected for the expression of heterologous sequences in mammalian cells, but in some embodiments of the invention, the expression vector may be selected for expression in other systems, such as, for example, insect cells, yeast or bacterial cells. Accordingly, each expression vector has its own set of regulatory elements that allow the expression of a heterologous sequence (product) in the host cell, such as promoters and/or enhancers, Kozak sequences, polyA sequences, and other regulatory sequences. And it can also have sequences encoding leader (signal) peptides that ensure the secretion of recombinant polypeptides into the extracellular environment. Termination of protein synthesis from a given isolated nucleic acid sequence is determined by adding one or more stop codons to it from the 3'-end in one reading frame.

After transfection of the vector into cells of a eukaryotic cell line, the recombinant polypeptide is synthesized and secreted into a serum-free culture medium. The resulting recombinant polypeptide is purified from the medium, typically by protein-A or protein-G affinity chromatography, but other methods of protein purification may be used.

The unity of this invention is achieved through the use in all constructs of a common minimal sequence Dll4 that interacts with Notch receptors. This sequence is represented by amino acids 21-254 of SEQ ID NO: 2 and SEQ ID NO: 4, and corresponds to the sequence of SEQ ID NO: 6 and amino acids 171-404 of SEQ ID NO: 1. It includes DSL and EGF(1- 5)-like repeats of the human Dll4 protein, which are necessary and sufficient for interaction with Notch1 and Notch4 receptors. However, they do not contain the Dll4 MNNL domain, which is involved in the activation of Notch signal transmission.

In the present invention, the Dll4 antagonist contains amino acids 171-404 of the Dll4 protein. This region does not include the 27-172 region corresponding to the MNNL domain (in contrast, among other things, to the polypeptides known from patent EP2054082B1), due to which the molecules of the invention cannot lead to the activation of Notch receptors. In addition, the deletion of the MNNL domain reduces protein aggregation and improves its solubility, resulting in increased protein production compared to fusion polypeptides that use the full-length Dll4 extracellular domain. Thus, the present invention is unique and represents a new type of molecule that have not been described previously.

The essence of the technical solution is to create nucleotide sequences (in private versions, SEQ ID NO: 3 and SEQ ID NO: 5) that encode the corresponding hybrid proteins with sequences (in private versions, respectively, SEQ ID NO: 2 and SEQ ID NO: 2 and SEQ ID NO: 5) 4), which includes two main functional parts. The first of which corresponds to part of the extracellular domain of human Dll4, and in the presented particular embodiments of the invention corresponds to amino acids 21-254 for SEQ ID NO: 2 and amino acids 21-365 for SEQ ID NO: 4. The common Dll4 sequence that combines these constructs corresponds to the sequence SEQ ID NO: 6. The second functional part encodes the constant part of the human IgG4 heavy chain (SEQ ID NO: 7) and in the presented particular embodiments of the invention corresponds to amino acids 257-482 for SEQ ID NO: 2 and amino acids 368-593 for SEQ ID NO : four.

Coding nucleotide sequences (including SEQ ID NO: 3 and SEQ ID NO: 5) can be changed to optimize the level of expression in certain cell types. When using heterologous expression systems (for example, insect cells, bacterial or yeast cells), it may be necessary to optimize the codons in the sequence (replacing rarely used codons in the body with frequently used ones). This can be done using algorithms implemented in many available sequence design algorithms, such as Codon optimizer, Gene Designer, or OPTIMIZER. For the industrial production of fusion proteins, the sequences corresponding to SEQ ID NO: 3 and SEQ ID NO: 5 can be cloned into any other vector that allows the production and secretion of the target polypeptides into the culture fluid for subsequent purification of the products. In particular, the Freedom pCHO 1.0 vector (ThermoFisher) can be chosen as such a vector.

Expression of the hybrid construct in mammalian cells is possible by creating stable producer clones after cells are transfected with this construct. Transfection by electroporation or using a transfection reagent such as Lipofectamine 2000 can be used. This hybrid construct can also be used to introduce into a lentiviral construct and subsequently infect cells. Various approaches can be used to increase the yield of the fusion protein in mammalian cells. Optimization methods are known to specialists and are described, for example, in (Almoetal. Better and faster: improvements and optimization for mammalian recombinant protein production // Curr Opin Struct Biol. 2014 Jun; 26:39-43).

The proposed products are a previously uncreated combination of nucleotide sequences of the human genome (and have a common sequence corresponding to the Fc fragment of human IgG4 fused in the same reading frame with fragment(s) of the human Dll4 sequence) and are intended to be an expression basis for the production of the fusion protein hDll4- hFc, which has a whole range of improved pharmacological properties, namely: (1) the minimum effector function of antibody-dependent cellular cytotoxicity (antibody-dependent cellular cytotoxicity - ADCC) and complement-dependent cytotoxicity (complement-dependent cytotoxicity - CDC) due to the use of the constant part of immunoglobulin human IgG4 isotype; (2) a relatively small molecular weight, which increases the efficiency of the production of these molecules in mammalian cells and improves their properties associated with the speed and efficiency of penetration into tissues; (3) the ability to effectively block Notch signaling due to the presence of functional domains required for efficient binding to Notch receptors; the ability of the protein to aggregate and its improved solubility. After passing animal safety and clinical trials, the fusion protein of the present invention can be formulated into a pharmaceutical composition for the treatment of cardiovascular diseases, ischemic conditions, inflammatory conditions in the vessels and oncological diseases, promotion of therapeutic angiogenesis.

The following examples are given for the purpose of disclosing the characteristics of the present invention and should not be construed as limiting the scope of the invention in any way.

Example 1 Construction of Plasmids

To construct plasmids with the claimed nucleotide sequences, the sequence encoding the human Dll4 protein obtained from the plasmid RG212628 (OriGene, Dll4 (NM_019074) Human Tagged ORF clone) was used.

Dll4 fragments were selected based on bioinformatic sequence analysis and their corresponding nucleotide sequences encoding them were used for subsequent cloning. The following primers were chosen to clone the regions corresponding to amino acids 21-254 of SEQ ID NO: 2 and amino acids 21-365 of SEQ ID NO: 4:

DLL4DMF: AAgaattcctaccgggtcatctgcagtgacaacta (SEQ ID NO: 8)

DLL4DMDE5R: TAGGATCCGTCCACTTTCTTCTCGCAGTTGGA (SEQ ID NO: 9)

DLL4DMR2: TAGGATCCGCTGCCCACAAAGCCATAAGGGCA (SEQ ID NO: 10).

The primers included restriction sites for EcoRI (forward primer DLL4DMF) and BamHI (reverse primers DLL4DMDE5R and DLL4DMR2)

PCR was performed under the following conditions: 95°C 1 min, 30 cycles (95°C 10 sec, 63°C 10 sec, 72°C 2 min), 72°C 5 min. Reaction components: polymerase - ExTaqTakara (TakaraBio), buffer containing Mg2+ for ExTaq polymerase (TakaraBio), 12 pmol of each of the primers and 0.25 mM of a mixture of nucleotide triphosphates (TakaraBio). Post-PCR: The PCR product was purified with the PCRPurificationkitQIAquick PCR Purification Kit (QiaGeneCat. No 28106). The concentration and compliance with the predicted molecular weight was checked using gel electrophoresis in 1% agarose (TAE buffer). The obtained PCR products were used for further construction.

The target sequences were cloned using the pFUSE-hIgG4-Fc2(InvivoGen) vector, which makes it possible to obtain sequences fused with the IgG4 Fc domain and to study their properties. The vector was digested with EcoRI and BglII (Thermo), and the PCR product was digested with EcoRI and BamHI (Thermo) for 1 hour at 37°C, purified with PCRPurificationkitQIAquick (Thermo) and ligated using 1 U (ME) ligase (Thermo ) according to the manufacturer's protocol. The competent E. coli XL10-Gold cells were transformed with the ligation mixture and plated on LB medium containing zeocin.

Cups were incubated in a thermostat overnight at 37°C. The next day, 20 colonies from each ligation mixture were checked for the presence of the desired insert; for this, part of the colony was diluted in 20 μl of water and boiled for 5 minutes. After cooling, the mixture was twisted off and 1 μl was used as a template in the PCR reaction. The presence of the insert was checked after electrophoresis of the PCR products. From the two colonies containing the insert, plasmid DNA was isolated and sequenced on an AppliedBiosystems 3500 sequencer according to the manufacturer's instructions using PROMF2 (forward) and FC (reverse) primers.

PROMF2: GCCTGACCCTGCTTGCTCAACT(SEQ ID NO: 11)

FC: CTCACGTCCACCACCACGCA(SEQ ID NO: 12)

The resulting plasmids containing the target nucleotide sequences are shown in FIG. 1 and 2.

Example 2 Production of recombinant polypeptides

For transfection of CHO cells, extra pure (“transfectiongrade”) plasmid DNA was isolated using the EndoFreePlasmidMaxiKit (Qiagen) according to the manufacturer's protocol. Both constructs were linearized according to the Not1 site (Thermo). For transfection, 20 μg of the linearized vector was added per 100 μl of cell suspension at a concentration of 5x10 ⁷ cells/ml. Electroporation was carried out according to the protocol: 3 pulses of 1130 V each for 20 ms. Selection was started 48 hours after transfection by adding the antibiotic Zeocin at a concentration of 500 μg/ml and continued with further passages. Culture medium: Dynamis + 6 mM Glutamax + 0.5% anticlumpingreagentB (Lonza, Switzerland) + 500 µg/mL Zeocin. Cultivation was carried out in a _{MultitronCell} CO2 shaker incubator (Infors, Switzerland) in an atmosphere of ₅ % CO2 at a temperature of 37°C and a relative humidity of 95% in Ernlenmeyer flasks (Corning, USA) with a volume of 125 ml (stirring at 120 rpm). ). The concentration of target polypeptides in the culture liquid was determined by bilayer interferometry using ProteinA biosensors and Octet K2 system (Fortebio, Pall, USA) in real time. The binding of the Fc fragment of the fusion proteins to the ProteinA immobilized on the sensor was evaluated. When cultivating these pools in the fed-batch mode, the production of fused polypeptides and their secretion in the culture fluid was confirmed. The level of production of fusion proteins corresponding to the sequences of SEQ ID NO: 2 and SEQ ID NO: 4 was significantly higher than the level of production of the hDll4-hFc fusion protein containing the full-length extracellular domain of Dll4. The highest level of production was achieved for the molecule corresponding to SEQ ID NO: 2, which confirms the conclusion that the small size of the molecule and the absence of the MNNL domain play a fundamental role in protein production in CHO cells. This fact is of fundamental importance for the industrial production of protein, since effective production will make it possible to reduce the cost of production of the drug substance.

Example 3. Evaluation of the functional activity of the resulting recombinant polypeptides

To assess the functional activity of the obtained recombinant hDll4-hFc polypeptides, standard methods and approaches are used:

(1) comparative analysis of the binding of the recombinant hDll4-hFc polypeptide to Notch1 and Notch4 target receptors by protein co-immunoprecipitation;

(2) study of the kinetics of binding of the recombinant hDll4-hFc polypeptide to Notch1 and Notch4 target receptors by analyzing the change in the angle of total internal reflection due to the effect of surface plasmon resonance;

(3) study of the effectiveness of the suppression of Notch signaling in cells by adding the recombinant hDll4-hFc polypeptide using real-time RT-PCR, in particular, changes in the expression of target genes HEY1 , HEY2, HES1 and HES5,

(4) study of the angiogenic activity of the recombinant hDll4-hFc polypeptide in the model of human umbilical vein endothelial cells (HUVEC - Human umbilical vein endothelial cells).

The detailed procedure for the experiments is given below:

(1) According to the results of literature analysis, the most likely natural targets of the obtained recombinant hDll4-hFc polypeptide are Notch1 and Notch4 proteins. As part of the study of the biological properties of hDll4-hFc, recombinant human proteins Notch1 and Notch4, developed in a suspension culture of HEK293 cells and purified by high pressure liquid chromatography (HPLC), are used as targets. At the first stage of analysis, they are conjugated with biotin by the activated ester method, followed by purification on desalting columns. The hDll4-hFc polypeptide is produced in a suspension culture of CHO cells and purified by liquid chromatography on sepharose with Protein A. Further, the studied polypeptide is added to the biotinylated target proteins in a molar ratio of 1: 1 in phosphate-buffered saline (PBS, 1x, pH=7.4) with the addition of BSA, the mixture is incubated at room temperature. Then, the target polypeptide complexes are incubated with DynabeadsM280 magnetic microspheres (Invitrogen, USA) with streptavidin immobilized on their surface, washed, and eluted according to the manufacturer's protocol. The resulting complexes are then purified and bound hDll4-hFc is detected by Western blotting.

(2) To assess the kinetics of binding of the resulting hDll4-hFc polypeptide to Notch1 and Notch4, the surface plasmon resonance method in the BioRad Proteon XPR36 system was used. To do this, previously obtained biotinylated recombinant Notch1 and Notch4 proteins are immobilized on a streptavidin-coated chip in HBS-EP buffer (pH=7.4). After that, HBS-EP buffer containing varying concentrations of hDll4-hFc is passed through the analytical cell. When the solution is passed through, the association of the hDll4-hFc polypeptide with target proteins occurs. Next, the dissociation of the polypeptide and the target is assessed. Free biotin solution is used to block unoccupied streptavidin sites in Notch1, Notch4 and control cells. Data analysis is performed according to the manufacturer's protocol.

(3) Evaluation of the expression of genes HEY1 , HEY2, HES1 and HES5 carried out on the model of the primary line HUVEC. To do this, purified as described in the method (1) hDll4-hFc polypeptide is added to a suspension of HUVEC cells and incubated at 37ºC in a CO ₂ incubator. As a control, HUVEC cells without added protein (buffer solution) are used. Next, the cells are precipitated in a centrifuge, and total RNA is isolated from them. The concentration of the obtained RNA was measured using a Qubit 2.0 fluorimeter (Invitrogen, USA). DNA removal is carried out using the TurboDNA free kit (Invitrogen). Then a reverse transcription reaction is carried out, for which the same amount of RNA is taken from different samples (experiment and control). For reverse transcription, Superscript III (Invitrogen) and random hexamers were used as primers. This is followed by real-time PCR on a CFX96 Bio-Rad cycler using SsoFastEvaGreensupermix (Bio-Rad). The primer sequences for amplification are shown below:

HES1 -F: AAGAAAGATAGCTCGCGGCA(SEQ ID NO: 13)

HES1 -R: TACTTCCCCAGCACACTTGG(SEQ ID NO: 14)

HES5 -F: GATTCCTCTGTGTGGGTGGATG(SEQ ID NO: 15)

HES5- R: GATTTTATTATGGCGGCTTCGG(SEQ ID NO: 16)

HEY1 - F: CCTTCCCCTTCTCTTTCGGC(SEQ ID NO: 17)

HEY1 -R: AAAAGCTCCGATCTCCGTCC(SEQ ID NO: 18)

HEY2 -F: AAGGCGTCGGGATCGGATAA(SEQ ID NO: 19)

HEY2- R: AGAGCGTGTGCGTCAAAGTAG(SEQ ID NO: 20)

GAPDH -F: CCATCACCATCTTCCAGGAG(SEQ ID NO: 21)

GAPDH -R: AATGAGCCCCAGCCTTCTCC(SEQ ID NO: 22).

(4) To assess the angiogenic activity of the obtained recombinant hDll4-hFc trap protein, a standard method based on the cultivation of primary human umbilical vein endothelial cells HUVEC in a three-dimensional matrix was used. To do this, primary endothelial cells are isolated from the umbilical vein of newborns, and then cultured in enriched M199 medium supplemented with 20% fetal calf serum and a cocktail of antibiotics (penicillin and streptomycin) in culture flasks. When the cells reach 70-80% confluence, the culture is passaged according to the standard method until the 2nd passage. Two hours before cells are transferred to a three-dimensional matrix (matrigel), they are transferred to depleted EBM-2 medium supplemented with 0.2% fetal calf serum.

Next, a suspension of HUVEC cells at a concentration of 5x10 ⁸ cells/ml is mixed with an equivalent volume of Matrigel. After that, 50 µl of the mixture is applied to the center of the well in 24-well plates. The investigated recombinant hDll4-hFc protein at varying concentrations is added to the cells in 1 ml of EBM-2 medium one hour after application and incubation at 37°C. Each experiment is carried out in triplicate. As a control, cells without the addition of recombinant protein are used. The cells are then incubated for 72 hours in a CO ₂ incubator and fixed with 4% formalin in PBS.

Analysis of the formation of primary vessels (endothelial tubules) is carried out by confocal microscopy. After fixing the drops of Matrigel, they are permeabilized with a 0.5% solution of Triton X-100 detergent. Next, cells are stained with membrane dye BDP 505/515 and nuclear dye DAPI using a Leica TCS SP5 microscope (Leica, Germany). Characterization of primary vessels is carried out using software.

Recombinant hDll4-hFc polypeptides have a high selectivity for binding to Notch1 and Notch4 target receptors, without leading to their activation, as a result of which such binding provides effective blocking of Notch signaling, manifested, in particular, in the activation of new vessel growth (angiogenic activity) in ischemic tissues.

While the invention has been described with reference to the disclosed embodiments, it should be apparent to those skilled in the art that the specific experiments described in detail are for the purpose of illustrating the present invention only and should not be construed as limiting the scope of the invention in any way. It should be clear that various modifications are possible without departing from the essence of the present invention.

--->

Sequence listing

<110> Limited Liability Company "Palmira Biopharma" /

PALMIRA BIOPHARMA Limited Liability Company

<120> NUCLEOTIDE SEQUENCE ENCODING A FUNCTION PROTEIN CONSISTING

FROM SOLUBLE EXTRACELLULAR FRAGMENT OF HUMAN Dll4 AND CONSTANT

PARTS OF THE HUMAN IgG4 HEAVY CHAIN

<130> 455032

<160> 22

<170> BiSSAP 1.3.6

<210> 1

<211> 685

<212> PRT

<213> Homo sapiens

<400> 1

Met Ala Ala Ala Ser Arg Ser Ala Ser Gly Trp Ala Leu Leu Leu Leu

1 5 10 15

Val Ala Leu Trp Gln Gln Arg Ala Ala Gly Ser Gly Val Phe Gln Leu

20 25 30

Gln Leu Gln Glu Phe Ile Asn Glu Arg Gly Val Leu Ala Ser Gly Arg

35 40 45

Pro Cys Glu Pro Gly Cys Arg Thr Phe Phe Arg Val Cys Leu Lys His

50 55 60

Phe Gln Ala Val Val Ser Pro Gly Pro Cys Thr Phe Gly Thr Val Ser

65 70 75 80

Thr Pro Val Leu Gly Thr Asn Ser Phe Ala Val Arg Asp Asp Ser Ser

85 90 95

Gly Gly Gly Arg Asn Pro Leu Gln Leu Pro Phe Asn Phe Thr Trp Pro

100 105 110

Gly Thr Phe Ser Leu Ile Ile Glu Ala Trp His Ala Pro Gly Asp Asp

115 120 125

Leu Arg Pro Glu Ala Leu Pro Pro Asp Ala Leu Ile Ser Lys Ile Ala

130 135 140

Ile Gln Gly Ser Leu Ala Val Gly Gln Asn Trp Leu Leu Asp Glu Gln

145 150 155 160

Thr Ser Thr Leu Thr Arg Leu Arg Tyr Ser Tyr Arg Val Ile Cys Ser

165 170 175

Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn

180 185 190

Asp His Phe Gly His Tyr Val Cys Gln Pro Asp Gly Asn Leu Ser Cys

195 200 205

Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser

210 215 220

Gly Cys His Glu Gln Asn Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu

225 230 235 240

Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys Asn Glu Cys Ile Pro His

245 250 255

Asn Gly Cys Arg His Gly Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys

260 265 270

Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys

275 280 285

Thr His His Ser Pro Cys Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly

290 295 300

Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp

305 310 315 320

Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly

325 330 335

Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr His Cys Leu Cys Pro Pro

340 345 350

Gly Tyr Tyr Gly Leu His Cys Glu His Ser Thr Leu Ser Cys Ala Asp

355 360 365

Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala

370 375 380

Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu

385 390 395 400

Lys Lys Val Asp Arg Cys Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln

405 410 415

Cys Leu Asn Arg Gly Pro Ser Arg Met Cys Arg Cys Arg Pro Gly Phe

420 425 430

Thr Gly Thr Tyr Cys Glu Leu His Val Ser Asp Cys Ala Arg Asn Pro

435 440 445

Cys Ala His Gly Gly Thr Cys His Asp Leu Glu Asn Gly Leu Met Cys

450 455 460

Thr Cys Pro Ala Gly Phe Ser Gly Arg Arg Cys Glu Val Arg Thr Ser

465 470 475 480

Ile Asp Ala Cys Ala Ser Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr

485 490 495

Thr Asp Leu Ser Thr Asp Thr Phe Val Cys Asn Cys Pro Tyr Gly Phe

500 505 510

Val Gly Ser Arg Cys Glu Phe Pro Val Gly Leu Pro Pro Ser Phe Pro

515 520 525

Trp Val Ala Val Ser Leu Gly Val Gly Leu Ala Val Leu Leu Val Leu

530 535 540

Leu Gly Met Val Ala Val Ala Val Arg Gln Leu Arg Leu Arg Arg Pro

545 550 555 560

Asp Asp Gly Ser Arg Glu Ala Met Asn Asn Leu Ser Asp Phe Gln Lys

565 570 575

Asp Asn Leu Ile Pro Ala Ala Gln Leu Lys Asn Thr Asn Gln Lys Lys

580 585 590

Glu Leu Glu Val Asp Cys Gly Leu Asp Lys Ser Asn Cys Gly Lys Gln

595 600 605

Gln Asn His Thr Leu Asp Tyr Asn Leu Ala Pro Gly Pro Leu Gly Arg

610 615 620

Gly Thr Met Pro Gly Lys Phe Pro His Ser Asp Lys Ser Leu Gly Glu

625 630 635 640

Lys Ala Pro Leu Arg Leu His Ser Glu Lys Pro Glu Cys Arg Ile Ser

645 650 655

Ala Ile Cys Ser Pro Arg Asp Ser Met Tyr Gln Ser Val Cys Leu Ile

660 665 670

Ser Glu Glu Arg Asn Glu Cys Val Ile Ala Thr Glu Val

675 680 685

<210> 2

<211> 482

<212> PRT

<213> artificial sequence

<220>

<223> fusion protein

<400> 2

Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu

1 5 10 15

Val Thr Asn Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp

20 25 30

Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr

35 40 45

Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly

50 55 60

Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn

65 70 75 80

Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln

85 90 95

Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly

100 105 110

Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly

115 120 125

Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys

130 135 140

Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys

145 150 155 160

Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser

165 170 175

Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln

180 185 190

Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His

195 200 205

Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly

210 215 220

Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr Ala Cys Glu Cys

225 230 235 240

Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Gly Ser

245 250 255

Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly

260 265 270

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

275 280 285

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu

290 295 300

Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

305 310 315 320

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg

325 330 335

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

340 345 350

Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu

355 360 365

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

370 375 380

Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu

385 390 395 400

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

405 410 415

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

420 425 430

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp

435 440 445

Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His

450 455 460

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

465 470 475 480

Gly Lys

<210> 3

<211> 1446

<212> DNA

<213> artificial sequence

<220>

<223> nucleotide sequence encoding the fusion protein

<400> 3

atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcc 60

taccgggtca tctgcagtga caactactat ggagacaact gctcccgcct gtgcaagaag 120

cgcaatgacc acttcggcca ctatgtgtgc cagccagatg gcaacttgtc ctgcctgccc 180

ggttggactg gggaatattg ccaacagcct atctgtcttt cgggctgtca tgaacagaat 240

ggctactgca gcaagccagc agagtgcctc tgccgcccag gctggcaggg ccggctgtgt 300

aacgaatgca tcccccacaa tggctgtcgc cacggcacct gcagcactcc ctggcaatgt 360

acttgtgatg agggctgggg aggcctgttt tgtgaccaag atctcaacta ctgcacccac 420

cactccccat gcaagaatgg ggcaacgtgc tccaacagtg ggcagcgaag ctacacctgc 480

acctgtcgcc caggctacac tggtgtggac tgtgagctgg agctcagcga gtgtgacagc 540

aacccctgtc gcaatggagg cagctgtaag gaccaggagg atggctacca ctgcctgtgt 600

cctccgggct actatggcct gcattgtgaa cacagcacct tgagctgcgc cgactccccc 660

tgcttcaatg ggggctcctg ccgggagcgc aaccaggggg ccaactatgc ttgtgaatgt 720

ccccccaact tcaccggctc caactgcgag aagaaagtgg acggatctta tggtccccca 780

tgcccaccat gcccagcacc tgagttcctg gggggaccat cagtcttcct gttcccccca 840

aaacccaagg acactctcat gatctcccgg acccctgagg tcacgtgcgt ggtggtggac 900

gtgagccagg aagaccccga ggtccagttc aactggtacg tggatggcgt ggaggtgcat 960

aatgccaaga caaagccgcg ggaggagcag ttcaacagca cgtaccgtgt ggtcagcgtc 1020

ctcaccgtcc tgcaccagga ctggctgaac ggcaaggagt acaagtgcaa ggtctccaac 1080

aaaggcctcc cgtcctccat cgagaaaacc atctccaaag ccaaagggca gccccgagag 1140

ccacaggtgt acaccctgcc cccatcccag gaggagatga ccaagaacca ggtcagcctg 1200

acctgcctgg tcaaaggctt ctaccccagc gacatcgccg tggagtggga gagcaatggg 1260

cagccggaga acaactacaa gaccacgcct cccgtgctgg actccgacgg ctccttcttc 1320

1380

tccgtgatgc atgaggctct gcacaaccac tacacacaga agagcctctc cctgtctccg 1440

ggtaaa 1446

<210> 4

<211> 593

<212> PRT

<213> artificial sequence

<220>

<223> fusion protein

<400> 4

Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu

1 5 10 15

Val Thr Asn Ser Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp

20 25 30

Asn Cys Ser Arg Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr

35 40 45

Val Cys Gln Pro Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly

50 55 60

Glu Tyr Cys Gln Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn

65 70 75 80

Gly Tyr Cys Ser Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln

85 90 95

Gly Arg Leu Cys Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly

100 105 110

Thr Cys Ser Thr Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly

115 120 125

Leu Phe Cys Asp Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys

130 135 140

Lys Asn Gly Ala Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys

145 150 155 160

Thr Cys Arg Pro Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser

165 170 175

Glu Cys Asp Ser Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln

180 185 190

Glu Asp Gly Tyr His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His

195 200 205

Cys Glu His Ser Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly

210 215 220

Gly Ser Cys Arg Glu Arg Asn Gln Gly Ala Asn Tyr Ala Cys Glu Cys

225 230 235 240

Pro Pro Asn Phe Thr Gly Ser Asn Cys Glu Lys Lys Val Asp Arg Cys

245 250 255

Thr Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Asn Arg Gly Pro

260 265 270

Ser Arg Met Cys Arg Cys Arg Pro Gly Phe Thr Gly Thr Tyr Cys Glu

275 280 285

Leu His Val Ser Asp Cys Ala Arg Asn Pro Cys Ala His Gly Gly Thr

290 295 300

Cys His Asp Leu Glu Asn Gly Leu Met Cys Thr Cys Pro Ala Gly Phe

305 310 315 320

Ser Gly Arg Arg Cys Glu Val Arg Thr Ser Ile Asp Ala Cys Ala Ser

325 330 335

Ser Pro Cys Phe Asn Arg Ala Thr Cys Tyr Thr Asp Leu Ser Thr Asp

340 345 350

Thr Phe Val Cys Asn Cys Pro Tyr Gly Phe Val Gly Ser Gly Ser Tyr

355 360 365

Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro

370 375 380

Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser

385 390 395 400

Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp

405 410 415

Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn

420 425 430

Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val

435 440 445

Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu

450 455 460

Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys

465 470 475 480

Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr

485 490 495

Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr

500 505 510

Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu

515 520 525

Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu

530 535 540

Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys

545 550 555 560

Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu

565 570 575

Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

580 585 590

Lys

<210> 5

<211> 1779

<212> DNA

<213> artificial sequence

<220>

<223> nucleotide sequence encoding the fusion protein

<400> 5

atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcc 60

taccgggtca tctgcagtga caactactat ggagacaact gctcccgcct gtgcaagaag 120

cgcaatgacc acttcggcca ctatgtgtgc cagccagatg gcaacttgtc ctgcctgccc 180

ggttggactg gggaatattg ccaacagcct atctgtcttt cgggctgtca tgaacagaat 240

ggctactgca gcaagccagc agagtgcctc tgccgcccag gctggcaggg ccggctgtgt 300

aacgaatgca tcccccacaa tggctgtcgc cacggcacct gcagcactcc ctggcaatgt 360

acttgtgatg agggctgggg aggcctgttt tgtgaccaag atctcaacta ctgcacccac 420

cactccccat gcaagaatgg ggcaacgtgc tccaacagtg ggcagcgaag ctacacctgc 480

acctgtcgcc caggctacac tggtgtggac tgtgagctgg agctcagcga gtgtgacagc 540

aacccctgtc gcaatggagg cagctgtaag gaccaggagg atggctacca ctgcctgtgt 600

cctccgggct actatggcct gcattgtgaa cacagcacct tgagctgcgc cgactccccc 660

tgcttcaatg ggggctcctg ccgggagcgc aaccaggggg ccaactatgc ttgtgaatgt 720

ccccccaact tcaccggctc caactgcgag aagaaagtgg acaggtgcac cagcaacccc 780

tgtgccaacg ggggacagtg cctgaaccga ggtccaagcc gcatgtgccg ctgccgtcct 840

ggattcacgg gcacctactg tgaactccac gtcagcgact gtgcccgtaa cccttgcgcc 900

cacggtggca cttgccatga cctggagaat gggctcatgt gcacctgccc tgccggcttc 960

tctggccgac gctgtgaggt gcggacatcc atcgatgcct gtgcctcgag tccctgcttc 1020

aacagggcca cctgctacac cgacctctcc acagacacct ttgtgtgcaa ctgcccttat 1080

ggctttgtgg gcagcggatc ttatggtccc ccatgcccac catgcccagc acctgagttc 1140

ctggggggac catcagtctt cctgttcccc ccaaaaccca aggacactct catgatctcc 1200

cggacccctg aggtcacgtg cgtggtggtg gacgtgagcc aggaagaccc cgaggtccag 1260

ttcaactggt acgtggatgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag 1320

cagttcaaca gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg 1380

aacggcaagg agtacaagtg caaggtctcc aacaaaggcc tcccgtcctc catcgagaaa 1440

accatctcca aagccaaagg gcagccccga gagccacagg tgtacaccct gcccccatcc 1500

caggaggaga tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctacccc 1560

agcgacatcg ccgtggagtg ggagagcaat gggcagccgg agaacaacta caagaccacg 1620

cctcccgtgc tggactccga cggctccttc ttcctctaca gcaggctaac cgtggacaag 1680

agcaggtggc aggaggggaa tgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1740

cactacacac agaagagcct ctccctgtct ccgggtaaa 1779

<210> 6

<211> 234

<212> PRT

<213> Homo sapiens

<220>

<223>protein fragment

<400> 6

Tyr Arg Val Ile Cys Ser Asp Asn Tyr Tyr Gly Asp Asn Cys Ser Arg

1 5 10 15

Leu Cys Lys Lys Arg Asn Asp His Phe Gly His Tyr Val Cys Gln Pro

20 25 30

Asp Gly Asn Leu Ser Cys Leu Pro Gly Trp Thr Gly Glu Tyr Cys Gln

35 40 45

Gln Pro Ile Cys Leu Ser Gly Cys His Glu Gln Asn Gly Tyr Cys Ser

50 55 60

Lys Pro Ala Glu Cys Leu Cys Arg Pro Gly Trp Gln Gly Arg Leu Cys

65 70 75 80

Asn Glu Cys Ile Pro His Asn Gly Cys Arg His Gly Thr Cys Ser Thr

85 90 95

Pro Trp Gln Cys Thr Cys Asp Glu Gly Trp Gly Gly Leu Phe Cys Asp

100 105 110

Gln Asp Leu Asn Tyr Cys Thr His His Ser Pro Cys Lys Asn Gly Ala

115 120 125

Thr Cys Ser Asn Ser Gly Gln Arg Ser Tyr Thr Cys Thr Cys Arg Pro

130 135 140

Gly Tyr Thr Gly Val Asp Cys Glu Leu Glu Leu Ser Glu Cys Asp Ser

145 150 155 160

Asn Pro Cys Arg Asn Gly Gly Ser Cys Lys Asp Gln Glu Asp Gly Tyr

165 170 175

His Cys Leu Cys Pro Pro Gly Tyr Tyr Gly Leu His Cys Glu His Ser

180 185 190

Thr Leu Ser Cys Ala Asp Ser Pro Cys Phe Asn Gly Gly Ser Cys Arg

195 200 205

Glu Arg Asn Gln Gly Ala Asn Tyr Ala Cys Glu Cys Pro Pro Asn Phe

210 215 220

Thr Gly Ser Asn Cys Glu Lys Lys Val Asp

225 230

<210> 7

<211> 226

<212> PRT

<213> Homo sapiens

<220>

<223> Fc fragment of IgG4

<400> 7

Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly

1 5 10 15

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

20 25 30

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu

35 40 45

Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

50 55 60

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg

65 70 75 80

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

85 90 95

Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu

100 105 110

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

115 120 125

Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu

130 135 140

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

145 150 155 160

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

165 170 175

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp

180 185 190

Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His

195 200 205

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

210 215 220

Gly Lys

225

<210> 8

<211> 35

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 8

aagaattcct accgggtcat ctgcagtgac aacta 35

<210> 9

<211> 32

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 9

taggatccgt ccactttctt ctcgcagttg ga 32

<210> 10

<211> 32

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 10

taggatccgc tgcccacaaa gccataaggg ca 32

<210> 11

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 11

gcctgaccct gcttgctcaa ct 22

<210> 12

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 12

ctcacgtcca ccaccacgca 20

<210> 13

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 13

aagaaagata gctcgcggca 20

<210> 14

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 14

tacttcccca gcacacttgg 20

<210> 15

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 15

gattcctctg tgtgggtgga tg 22

<210> 16

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 16

gattttatta tggcggcttc gg 22

<210> 17

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 17

ccttcccctt ctctttcggc 20

<210> 18

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 18

aaaagctccg atctccgtcc 20

<210> 19

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 19

aaggcgtcgg gatcggataa 20

<210> 20

<211> 21

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 20

agagcgtgtg cgtcaaagta g 21

<210> 21

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 21

ccatcaccat cttccaggag 20

<210> 22

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer

<400> 22

aatgagcccc agccttctcc 20

<---

Claims (20)

1. Fusion protein - Dll4 antagonist, containing: a) a fragment of the soluble extracellular part of the human Dll4 protein, consisting only of the DSL domain and the domains of EGF-like repeats of the Dll4 protein, arranged in the order corresponding to the natural sequence, and not including the MNNL domain, and the domains of EGF-like repeats are at least domains 1-5 of EGF-like repeats of the Dll4 protein; b) Human IgG4 Fc fragment attached to the Dll4 protein fragment (a) from the C-terminus without a linker or via a linker sequence. 2. The fusion protein according to claim 1, in which the DSL domain of the Dll4 protein has an amino acid sequence corresponding to positions 173-217 of the sequence of SEQ ID NO: 1, and the EGF-like repeat domains of the Dll4 protein have amino acid sequences corresponding to positions 218-251, 252 -282, 284-322, 324-360 and 362-400 sequences of SEQ ID NO: 1. 3. A fusion protein according to claim 1, wherein the human IgG4 Fc fragment has the amino acid sequence of SEQ ID NO: 7. 4. The fusion protein according to claim 1, further comprising at least one of the domains of 6-8 EGF-like repeats of the Dll4 protein, located (s) from the C-terminus of the Dll4 protein fragment (a), and the order of these domains is 6- 8 EGF-like repeats can be any. 5. A fusion protein according to claim 4, wherein domains 6-8 of the EGF-like repeats of the Dll4 protein have amino acid sequences corresponding to positions 402-438, 440-476 and 480-518 of SEQ ID NO: 1. 6. The fusion protein of claim 1, wherein the human IgG4 Fc fragment (b) is linked to the Dll4 protein fragment (a) in a linkerless manner. 7. The fusion protein of claim 1, wherein the human IgG4 Fc fragment (b) is linked to the Dll4 protein fragment (a) via a linker peptide. 8. The fusion protein of claim 7, wherein the human IgG4 Fc fragment (b) is linked to the Dll4 protein fragment (a) via a GS linker peptide. 9. The fusion protein of claim 1, wherein the Dll4 protein fragment has the amino acid sequence of SEQ ID NO: 6. 10. The fusion protein of claim 1, further comprising a signal sequence located at the N-terminus of the fusion protein. 11. A fusion protein according to claim 1, having the amino acid sequence of SEQ ID NO: 2. 12. A fusion protein according to claim 4, having the amino acid sequence of SEQ ID NO: 4. 13. An isolated nucleic acid molecule encoding a fusion protein according to any one of claims 1-12. 14. An isolated nucleic acid molecule according to claim 13, having the sequence of SEQ ID NO: 3. 15. The isolated nucleic acid molecule according to claim 13, having the sequence of SEQ ID NO: 5. 16. An expression vector comprising a nucleic acid sequence according to any one of claims 13-15 under the control of regulatory elements necessary for its expression in the host cell. 17. A cell capable of expressing a fusion protein according to any one of claims 1 to 12 that is not a human embryonic cell and transfected with an expression vector according to claim 16. 18. A cell according to claim 17, which is a Chinese hamster ovary (CHO) cell.

Images