RU2786637C2 - Exon skip with peptidonucleic acid derivatives - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, specifically to new derivatives of peptido-nucleic acids, and can be applied in medicine. The invention discloses a peptidonucleic acid molecule capable of specific, strong binding to a splicing site in a pre-mRNA target. Due to the improved ability to penetrate the cell membrane, as well as the strong affinity for the target RNA, said peptidonucleic acid is able to induce exon skipping in cells.

EFFECT: invention can be used as an alternative to antisense oligonucleotides in vaccination and in the treatment of various diseases.

19 cl, 66 ex, 14 tbl, 56 dwg

Description

Technical field

The present invention relates to exon skipping induced by peptide nucleic acid derivatives with good cell penetration and strong nucleic acid affinity, and claims the benefit of priority from U.S. Provisional Application No. 62/440929, filed Dec. 30, 2016, which is incorporated herein by links in full.

BACKGROUND OF THE INVENTION

Oligonucleotides have been used for a variety of biological purposes, including antisense inhibition of gene expression, PCR (polymerase chain reaction), gene chip diagnostic analysis, and so on. Because oligonucleotides interact with nucleic acid, including DNA and RNA, in a sequence-specific manner, they are useful for predictably modulating biological processes involving DNA or RNA within a cell. Oligonucleotides with good cell penetration are able to modulate such biological processes in the cell in a sequence-predictable manner.

Proteins as drug targets : Proteins mediate a variety of cellular functions. Not surprisingly, most of the currently marketed drugs exhibit therapeutic activity by modulating the functions of the protein(s). For example, the non-steroidal anti-inflammatory drug aspirin inhibits enzymes called cyclooxygenases due to its anti-inflammatory activity. Losartan binds to a transmembrane receptor called the angiotensin II receptor due to its antihypertensive activity. Rosiglitazone selectively activates an intracellular receptor called peroxisome proliferator-activated receptor γ (PPARγ) to elicit its antidiabetic activity. Etanercept is a fusion protein that binds to a cytokine called tumor necrosis factor-α (TNF-α) and neutralizes the biological activity of TNF-α due to its antirheumatic activity. Herceptin is a monoclonal antibody for the treatment of breast cancer by selectively binding to erbB2 overexpressed in certain types of breast cancer cells.

Pre-mRNA : The genetic information is transferred to DNA (containing 2-deoxyribose nucleic acid as a sugar), which is transcribed to produce pre-mRNA (a messenger ribonucleic acid precursor) in the nucleus. Mammalian pre-mRNA usually consists of exons and introns, and the exon and intron are interconnected with each other. Exons and introns are numbered as shown in Fig. 1A.

Splicing of pre-mRNA into mRNA . In the nucleus, pre-mRNA is converted to mRNA after deletion of introns and ligation of exons through a series of complex reactions collectively referred to as "splicing", as shown schematically in FIG. 1B [ Ann. Rev. Biochem . 72(1), 291-336( 2003 ); Nature Rev. Mol. Cell Biol . 6(5), 386-398( 2005 ); Nature Rev. Mol. Cell Biol . 15(2), 108-121 ( 2014 )].

Splicing is initiated by the formation of a "splicesome E-complex" (ie, an early splice complex) between pre-mRNA and splicing adapter factors. In the "splicesome E-complex", U1 binds to the junction of exon N and intron N, and U2AF ³⁵ binds to the junction of intron N and exon (N+1). Thus, the site of exon/intron or intron/exon junction is critical for the formation of the early splicesome complex. The "splicesome E-complex" is converted to the "splicesome A-complex" by additional complexation with U2. The "splicesome A complex" then undergoes a series of complex reactions to remove or splice an intron to connect adjacent exons.

Alternative splicing and splicing variant (splice variant) : All pre-mRNA exons are not always saved to form "full-length" mRNA during splicing. Some exons are deleted, or spliced, to form variant mRNAs, i.e. splicing options. Thus, pre-mRNA can be "alternatively spliced" to produce multiple splicing variants.

Alternative splicing in mammalian cells was first reported in 1981 in the case of a gene encoding calcitonin [ Nature vol 290(5801), 63-65 ( 1981 ); Proc. Natl. Acad. sci. USA vol 79(6), 1717-1721 ( 1982 )]. The gene consists of 6 exons, and the mRNA for calcitonin is generated by skipping exon 5 and exon 6. Meanwhile, skipping exon 4 results in the generation of an mRNA variant encoding calcitonin gene-related peptide (CGRP).

Alternative splicing appears to be entirely dependent on the cells and the conditions the cells are exposed to. Through alternative splicing, multiple proteins are produced from a single gene. Alternative splicing allows animals to generate a wide variety of proteins for their genome size. In humans, 95% of genes with many exons are estimated to undergo alternative splicing [ Nature Genetics vol 40(12), 1413-1415 ( 2008 )].

Splicing variants and biological functions . Splicing variants are found to spontaneously occur in a cell or tissue dependent manner and encode proteins with biological profiles often different from those of the full length protein.

The androgen receptor (AR) would be a good example of genes giving rise to multiple splicing variants [ Int. J Biol. sci. vol 7(6), 815-822 ( 2011 )]. The pre-mRNA for AR consists of 8 exons plus 4 cryptic exons (cryptic exons are shaded in the diagram below). There are at least seven mRNA splicing variants for AR.

AR mRNA variant 1 consists of exons 1 to 8 concatenated and encodes a full-length AR protein as shown in FIG. 2A. In the case of mRNA variant 3 for AR, exons 4 to 8 are spliced (ie, deleted). Therefore, mRNA variant 3 for AR encodes a truncated AR protein (AR3) that lacks the ligand binding domain (LBD) present in the full-length protein.

The full-length AR protein becomes functional after complexing with an androgen such as testosterone or dihydrotestosterone (DHT). Meanwhile, the truncated AR3 protein is functionally active even in the absence of androgen. In prostate tumors resistant to androgen ablation therapy, an increase in the expression of the AR3 protein was often found. Thus, the endogenous production of the AR3 protein variant can be considered as a natural selection process for prostate cancer cells in order to avoid androgen ablation therapy.

Hypoxia inducible factor 1α (HIF-1α) is a subunit of a transcription factor called hypoxia inducible factor 1 (HIF-1) and is encoded by the HIF1A gene. HIF-1α is activated in response to hypoxia (i.e., low oxygen levels) and therefore can be considered as a cellular oxygen sensor [ Proc. Natl. Acad. sci. USA , vol 92, 5510-5514 ( 1995 )]. HIF-1α induces transcription of over 60 genes, including VEGF and EPO. HIF-1α promotes new blood vessel formation via VEGF [ Exp. Mol. Med . vol 36, 1-12 ( 2004 )]. Solid tumors experience hypoxia due to limited blood supply and upregulate HIF-1α expression to survive in hypoxic conditions.

The HIF-1α protein is composed of different domains for its functional activity as a transcriptional activator. It contains the basic helix-loop-helix (bHLH) element and two PAS domains [for the PAS domain, cf. Curr. Biol. vol 7(11), R674-677( 1997 ); Eur. J Biochem. vol 271(6), 1198-1208 ( 2004 )]. HIF-1α possesses an oxygen dependent degradation domain (ODD) that serves as an oxygen sensor and is known to be critical to the stability of the HIF-1α protein.

There are at least six HIF-1α protein variants encoded by six HIF-1α mRNA splicing variants, as shown in FIG. 2B [ Exp. Mol. Med . vol 36, 1-12 ( 2004 )]. Full-length HIF-1α mRNA (HIF-1α ^FL ) is similar to wild-type HIF-1α mRNA (HIF-1α ^WT ), except for an additional three bases (UAG) between exon 1 and exon 2 due to alternative splicing. Exon 14 is deleted or skipped in HIF-1α ⁷³⁶ . HIF-1α ⁷³⁶ lacks a C-terminal activating domain (CAD). Both HIF-1α ^FL and HIF-1α ⁷³⁶ are known to activate the VEGF promoter during hypoxia. Meanwhile, HIF-1α ⁵⁵⁷ (HIF-1αZ) and HIF-1α ⁵¹⁶ function as a dominant negative isoform of HIF-1α. In breast cancer, the HIF-1α ^FL mRNA splicing variant reflects the stage of cancer progression and is associated with poor prognosis [ BMC Medicine vol 8(44), 1-12 ( 2010 )].

As illustrated by the androgen receptor and HIF-1α protein, splicing variants play an important role in generating the physiological diversity of a particular mammalian gene. Nature spontaneously creates splicing variants to maintain homeostasis as well as respond to physiological dynamics.

Protein synthesis on ribosomes : Pre-mRNA introns are enzymatically spliced to form mRNA (messenger ribonucleic acid), which is then translocated to the cytosolic compartment. In the cytosol, a translation apparatus complex called the ribosome binds to mRNA and performs protein synthesis as it scans the genetic information encoded along the mRNA [ Biochemistry vol 41, 4503-4510 ( 2002 ); Cancer Res . vol 48, 2659-2668 ( 1988 )].

Codon : During protein synthesis on ribosomes, each amino acid is encoded by a triad in the mRNA sequence. For example, "AUG", "UUA", "CCC" and "AGA" code for "methionine", "leucine", "proline" and "arginine", respectively. Such triads are called "codons". Given that there are 4 monomers in mRNA: A, G, U and C, there are 64 (4x4 x 4=64) possible codons. Some codons correspond to the "stop" signal for protein synthesis on ribosomes. "UGA", "UAA" and "UAG" are codons for the "stop" signal. Protein synthesis on ribosomes is terminated when the ribosome recognizes a "stop codon" when scanning along the mRNA.

Antisense oligonucleotide (ASO). An oligonucleotide that binds to an mRNA or pre-mRNA in a sequence-specific manner (ie, complementary) is referred to as an "antisense oligonucleotide" (ASO). ASO, which binds tightly to mRNA, can block protein synthesis on ribosomes. Also, ASO binding tightly to pre-mRNA can interfere with the splicing process and give rise to mRNA splicing variants.

Antisense splicing inhibition . Splicing of the pre-mRNA begins after the formation of the "splicesome E-complex" (i.e., the E-complex). As schematically shown in FIG. 3, SR proteins (i.e., serine and arginine rich proteins) bind to "exon splicing enhancer" (ESE) regions and help recruit U1 and U2AF ³⁵ to bind to the "5' splicing site" and "3' splicing site splicing, respectively [ Biochem. Cell biol. vol 77(4), 277-291( 1999 ); Curr. Opin. Cell biol. vol 13(3), 302-309 ( 2001 )].

In principle, ASO can sterically inhibit the formation of the "splicesome E-complex" by binding to a specific region of the pre-mRNA that is critical for the formation of the E-complex. E-complex formation is inhibited or blocked if ASO binds tightly to the "5' splicing site", "3' splicing site", or the ESE region.

Since mRNA codes for a protein according to its sequence, the mRNA splicing variant encodes a different protein from the protein encoded by the "original" or "full-length" mRNA. Thus, antisense splicing inhibition is an effective therapeutic option by encoding a variant of the protein(s) exhibiting biological properties different from those of the protein encoded by the "original" or "full-length" mRNA.

Frameshift Induced by Antisense Splicing Inhibition : The "DNA coding sequence" (CDS) portion for human HIF-1α mRNA [NCBI code for mRNA: NM_001530] is shown in FIG. 4A as an example to illustrate the "frameshift" (ie, out of frame) induced by antisense splicing inhibition. The CDS (ie yellow bar) shows the codon and exon (ie green arrow). It should be noted that T (ie thymine) in CDS must be replaced by U (ie uracil) in mRNA or pre-mRNA.

If exon 3 is deleted as a result of antisense splicing inhibition, the 3' end of exon 2 binds directly to the 5' end of exon 4. The junction of exon 2 and exon 4 would then read "...-GAT-GCT-( G-TTT ) -GAA-CTA-..." as shown in FIG. 4B (cf. left diagram). There are four nucleotides between two adjacent full-length mRNA codons. Deletion of exon 3 moves codons starting from exon 4 out of frame. Thus, deletion of exon 3 causes a "frameshift" of codons.

If exon 3 and exon 4 are deleted simultaneously as a result of antisense splicing inhibition, the 3' end of exon 2 connects to the 5' end of exon 5. Then the junction of exon 2 and exon 5 will read "...-GAT-GCT-( G -GC )-CTT-GTC-..." as shown in FIG. 4B (cf. right diagram). There are three nucleotides between two adjacent codons of a full-length mRNA. The double deletion of exon 3 and exon 4 places the codons starting from exon 5 in-frame, i.e. no frame shift.

Frameshift produces codons other than the "original" codons and often generates a premature termination codon (PTC), as shown in FIG. 4C for the case of deletion of exon 3 in mRNA for HIF-1α. Exon skipping, which causes a frameshift, is designed to obtain a protein fragment truncated from the C-terminus due to premature termination of protein synthesis on ribosomes. Such a protein fragment may exhibit physiological properties different from the "original" or "full length" protein. Thus, antisense splicing inhibition may be an effective therapeutic option for a disease target gene.

Detection of exon skipping by nested RT-PCR : mRNA of the ASO-induced splicing variant is often detected by PCR (polymerase chain reaction). If ASO induces 150 bp exon 4 skipping as shown in FIG. 5A, there are two possible mRNAs derived from the ASO target pre-mRNA, i.e. a full-length mRNA and an mRNA splicing variant lacking exon 4. When induced with ASO to skip exon 4 completely (i.e., 100%), ASO-treated cells produced only a 150 bp smaller PCR product. PCR product in the form of full-length mRNA. The band associated with the PCR product in case of exon skipping is selected and sequenced to confirm that the band for the PCR product is indeed derived from an mRNA splicing variant.

Evaluation of exon skipping yield by PCR . In the literature, exon skipping yield or efficiency has generally been assessed by comparing the gel band intensity for a PCR product as a splice variant mRNA with the band intensity for full-length mRNA. This assessment is theoretically correct in general, provided that the full-length mRNA and mRNA of the splicing variant have comparable stability in cells, and also during the assay procedures adopted for PCR detection. However, given that mRNA stability is the cumulative result of evolution over billions of years, it is unlikely that mRNA splicing variants will exhibit the same stability as full-length mRNA.

It can also be assumed that the relative enrichment of the mRNA of the splicing variant and the full-length mRNA can vary greatly depending on the PCR primers, the PCR conditions and the PCR detection method. Recently, digital qPCR has been applied to assess the exon skipping yield of mRNA for dystrophin in mdx mice treated with dystrophin-specific ASO or morpholino- or 2'-OMe-PTO (phosphorothioate). The exon skipping yield estimated by digital qPCR was significantly different from the yields estimated by conventional methods such as nested qPCR [ Lab. Investigation, vol 90, 1396-1402 ( 2010 )]. A digital qPCR study of exon skipping in myoblasts and fibroblasts in human DMD patients suggests that digital qPCR is the choice for reliable detection of exon skipping products with high sensitivity [ PLoS One 0162467, September 09 ( 2016 )].

Whereas the apparent yield of exon skipping tends to vary depending on the method and condition of the PCR assay, in addition to the PCR assay, additional validation of the exon skipping yield by protein expression assays or functional assays for the target gene may be required.

Feedback amplification of transcription by EIciRNA : The intron lariat is formed as a by-product of pre-mRNA splicing. Exon skipping produces not only splicing variant mRNA, but also exon(s) and intron(s) circular RNA (EIciRNA), as shown in FIG. 5B, in which exon 3 and exon 4 are fused to form a lariat (lasso-type structure) consisting of introns, exon 3, and exon 4. The initially formed lariat, ie. EIciRNA ① can undergo additional splicing to form a secondary lariat, defined as EIciRNA ②.

These EIciRNA lariats retain the "exon 4"5' splicing site sequence and are able to recruit "small nuclear ribonuclear protein U1 (snRNP U1)". snRNP U1 then recruits RNA polymerase II, which can activate pre-mRNA transcription. Pre-mRNA transcription can be increased if EIciRNAs accumulate above a threshold level in the nucleus. Thus, EIciRNA can often function as a regulator in the transcriptional feedback loop when exon skipping occurs excessively [ Nature Struct. Mol. Biol. vol 22(3), 256-264 ( 2015 )].

Non-natural oligonucleotides : A DNA or RNA oligonucleotide is prone to degradation by endogenous nucleases, limiting their therapeutic use. To date, a number of non-natural (ie, not naturally occurring) oligonucleotides have been developed and extensively investigated [ Clin. Exp. Pharmacol. physiol. vol 33, 533-540 ( 2006 )]. Many of them show extended metabolic stability compared to DNA and RNA. In FIG. 6A shows the chemical structures of some representative non-natural oligonucleotides. These oligonucleotides bind predictably to a complementary nucleic acid, just like DNA or RNA.

Phosphorothioate oligonucleotide (PTO): PTO is a DNA analog in which one of the oxygen atoms in the phosphate backbone is replaced by a sulfur atom in each monomer. This small structural change made PTO relatively resistant to degradation by nucleases [ Ann. Rev. Biochem . vol 54, 367-402 ( 1985 )].

Reflecting the structural similarity between PTO and DNA backbones, both of them do not pass well through the cell membrane in most mammalian cell types. However, in some cell types expressing DNA transporter(s), DNA and PTO show relatively good cell permeability. It is known that systemically administered PTOs are easily distributed in the liver and kidneys due to the overexpression of DNA carriers [ Nucleic Acids Res . vol 25, 3290-3296 ( 1997 )].

Lipofection has been widely used to improve PTO cell permeability in vitro. However, lipofection physically alters the cell membrane, causes cytotoxicity, and therefore would not be ideal for long-term therapeutic use.

Over the past 30 years, PTO and PTO variants have been clinically evaluated for the treatment of cancers, immunological disorders, metabolic disorders, and so on [ Biochemistry vol 41, 4503-4510 ( 2002 ); Clin. Exp. Pharmacol. physiol. vol 33, 533-540 ( 2006 )]. Many of these antisense drug candidates have not been successfully developed due in part to the poor cell permeability of PTO. To overcome poor cell permeability, PTO must be administered at a high dose for therapeutic activity. However, PTOs are known to cause dose-limiting toxicity, including prolonged coagulation time, complement activation, tubular nephropathy, Kupffer cell activation, and immune stimulation, including splenomegaly, lymphoid hyperplasia, and mononuclear cell infiltration [ Clin. Exp. Pharmacol. physiol. vol 33, 533-540 ( 2006 )].

Many antisense PTOs have been found to exhibit clinical activity in diseases with a significant hepatic or renal contribution. Mipomersen is a PTO analogue that inhibits the synthesis of apoB-100, a protein involved in the transport of LDL cholesterol. Mipomersen has shown clinical activity in a specific population of atherosclerotic patients due to its predominant distribution in the liver. [ Circulation vol 118(7), 743-753 ( 2008 )]. ISIS-113715 is a PTO analog that inhibits tyrosine phosphatase 1B (PTP1B) protein synthesis and has been found to have therapeutic activity in type II diabetic patients [ Curr. Opin. Mol. Ther. vol 6, 331-336 ( 2004 )].

2'-O-alkyl-RNA : 2'-O-alkyl-RNA is an analog of RNA in which the 2'-hydroxy group in the ribose ring is replaced by an alkyloxy group. 2'-O-alkyl-RNA has a stronger affinity for RNA than for PTO or DNA. In addition, 2'-O-alkyl-RNA shows increased metabolic stability for therapeutic purposes. However, 2'-O-alkyl-RNA exhibits poor membrane permeability, which limits therapeutic options.

Closed Nucleic Acid (LNA): In LNA, the ribose ring in the RNA backbone is structurally restricted to increase binding affinity for RNA or DNA. Thus, LNA can be considered as high affinity DNA or RNA [ Biochemistry vol 45, 7347-7355 ( 2006 )]. However, LNA also exhibits poor cell permeability, similar to DNA or RNA.

DNA or RNA backbone hybrid oligonucleotide : PTO and 2-O-alkyl-RNA are often fused into a single oligonucleotide. Due to the 2'-O-alkyl-RNA moiety, such a hybrid oligonucleotide has a higher affinity for RNA than a PTO oligonucleotide with the same sequence. Similarly, LNA and PTO are often fused into one oligonucleotide, and the hybrid oligonucleotide has a higher affinity for RNA than a PTO oligonucleotide with the same sequence. However, such hybrid oligonucleotides also show poor cell permeability.

Morpholino-Phosphorodiamidate Oligonucleotide (PMO): In PMO, the DNA backbone modules of phosphate and 2-deoxyribose are replaced by phosphorodiamidate and morpholine, respectively [ Appl. microbiol. Biotechnol. vol 71, 575-586 ( 2006 )]. Although the DNA backbone is negatively charged, the PMO backbone is not. Thus, the bond between PMO and mRNA is free from electrostatic backbone repulsion and is generally stronger than the bond between DNA and mRNA. Because PMO differs markedly from DNA in its backbone structure, PMO will not be recognized by hepatic DNA or RNA-recognizing transporter(s). However, PMO does not easily cross the cell membrane.

Peptido nucleic acid (PNA): PNA is a polypeptide with a backbone of N-(2-aminoethyl)glycine as a unit and was discovered by Dr. Nielsen and colleagues [ Science vol 254, 1497-1500 ( 1991 )]. In FIG. 6B shows the chemical structure and nomenclature for prototype (ie, unmodified) PNA.

Like DNA and RNA, PNA also selectively binds to a complementary nucleic acid [ Nature (London) vol 365, 566-568 ( 1992 )]. When bound to a complementary nucleic acid, the N-terminus of PNA is equivalent to the 5' end of DNA or RNA, and the C-terminus of PNA is equivalent to the 3' end of DNA or RNA.

Like PMO, the PNA backbone is not charged. Thus, the bond between PNA and RNA is generally stronger than the bond between DNA and RNA. Because PNA is markedly different from DNA in chemical structure, PNA will not be recognized by hepatic DNA-recognizing transporter(s) and will show a tissue distribution profile different from that of DNA or PTO. However, PNA also poorly penetrates the mammalian cell membrane [ Adv. Drug Delivery Rev. vol 55, 267-280 ( 2003 )].

Duchenne muscular dystrophy (DMD): DMD is a muscle wasting disorder that affects one in about 3500 male newborns [ Lancet Neurol. vol 9, 77-93 ( 2010 )]. Patients with DMD gradually lose muscle function and die of heart or respiratory failure before the age of 30. In many DMD patients, the dystrophin gene is mutated to form dystrophin mRNA with a premature termination codon (PTC) and expresses a truncated, non-functional dystrophin that lacks the C-terminus [ HumanMol. Genetics vol. 12 (8), 907-914 (2003); and links there.

A popular approach to treating DMD is to skip the PTC-bearing exon in dystrophin mRNA using ASO, and encode a C-terminal splice variant protein, often referred to as full-length dystrophin.

Exon-23 skipping in dystrophin mRNA in MDX mice . The Mdx mouse is a PTC mutant in exon 23 of dystrophin pre-mRNA and has been widely used as an animal model of human DMD [ FEBS J. vol 280(17), 4177-4186 ( 2013 )]. ASOs complementarily targeting mouse dystrophin pre-mRNA have been evaluated for their ability to induce exon 23 skipping [ Artificial DNA: PNA & XNA vol 2(1), 6-15 ( 2011 )]. In this regard, the mdx mouse has served as a good model system for evaluating a class of oligonucleotides with respect to their ability to induce exon skipping.

A 20-mer 2'-OMe-PTO (2'-O-methylphosphorothioate) ASO, fully complementary to the junction of exon 23 and intron 23 (i.e., the 5' splicing site of exon 23) was locally injected into mdx mouse muscle in dose of approximately 10 μg/kg in combination with the amphiphilic agent for transfection F127 and increased the expression of full-length dystrophin in muscle tissue when injected according to immunohistochemistry analysis (IHC) and Western blotting for full-length dystrophin. These IHC and Western blot results indicate that exon 23 was skipped as a result of local injection of ASO. ASO is capable of 18-mer complementary overlap with the 5' end of intron 23 and 2-mer complementary overlap with the 3' end of exon 23 [ Nature Med. vol 9(8), 1009-1014 ( 2003 )].

Another 20-mer 2'-OMe-PTO ASO fully complementary to the junction of exon 23 and intron 23 (i.e. the 5' splicing site of exon 23) was evaluated for its ability to induce skipping of exon 23. 20-mer ASO complementarily targets the junction of exon 23 and intron 23 and is capable of 18-mer complementary overlap with the 5' end of intron 23 and 2-mer complementary overlap with the 3' end of exon 23. Incubation for 96 hours of mouse myoblasts with 2 or 4 μM ASO induced skipping of exon 23 as confirmed by nested RT-PCR. Exon 23 skipping was also identified by RT-PCR in mdx mice that received two intramuscular injections of 2.9 nmol ASO. Exon 23 skipping was found in the muscle tissue of mdx mice injected subcutaneously with 2'-OMe-PTO ASO at a dose of 50 mg/kg. 2'-FPS (2'-fluorophosphorothioate) ASO, having the same sequence as the aforementioned 2'-OMe-PTO ASO, also induced exon 23 skipping in muscle myoblasts, similar to 2'-OMe-PTO ASO. However, 2'-FPS ASO did not induce exon 23 skipping in mdx mice after intramuscular or subcutaneous injections [ Mol. Ther. Nucl. Acids vol 4, e265 ( 2015 )].

A 20-mer peptidonucleic acid (PNA) complementarily targeting the junction of exon 23 and intron 23 was evaluated for its ability to induce exon 23 skipping in MDX mice. 20-mer ASO PNA has the ability to 18-mer complementary overlap with the 5' end of intron 23 and 2-mer complementary overlap with the 3' end of exon 23. 20-mer PNA at a concentration of 250 nM induced deletion of exon 23 in H ₂ cells D MDX mice, as analyzed by nested RT-PCR. Following intramuscular injection of 5 to 20 μg (at a dose of approximately 0.25 to 2 mg/kg) to mdx mice, 20mer PNA induced skipping of exon 23 in muscle tissue at the injection site. It was concluded that the efficiency of exon skipping in the case of 20-mer PNA is higher than in the case of the aforementioned 2'-OMe-PTO ASO in mdx mice. The 20-mer PNA was covalently conjugated to various cell-penetrating peptides (CPPs) to increase cell permeability. These PNA-CPP conjugates and unmodified PNA comparatively induced exon 23 skipping in cells as well as in muscle tissue at the injection site [ Mol. Ther. vol 16(1), 38-45 ( 2008 )].

The 25mer PMO ASO fully complementary to the junction of exon 23 and intron 23 (ie, the 5' splicing site of exon 23) was evaluated for its ability to induce exon 23 skipping in MDX mice. 25-mer ASO is capable of 18-mer complementary overlap with intron 23 and 7-mer complementary overlap with exon 23. 100 mg/kg) [ Nat. Med. vol 12(2), 175-177 ( 2006 )]. The 25mer PMO has been covalently conjugated to various cell penetrating peptides (CPPs) to increase cell permeability. These PMO-CPP conjugates induced exon 23 skipping in muscle at a single intravenous dose of 3 mg/kg [ Human Mol. Genet. vol 18(22), 4405-4414 ( 2009 )].

Exon 46 skipping in dystrophin mRNA in myoblasts from a human patient with DMD : 2'-OMe-PTO ASOs were designed to complementarily target an exon splicing enhancer (ESE) region within exon 46 in human dystrophin pre-mRNA and evaluated for exon skipping efficiency 46 in myoblast cells derived from a human DMD patient lacking exon 45 in dystrophin mRNA. Cells were transfected with ASO at 1 μM by lipofection and incubated for 24 hours prior to RNA extraction for nested RT-PCR to detect exon 46 skipping. Some of the ASO tested induced exon 46 skipping [ Human Mol. Genet. vol 10(15), 1547-1554 ( 2001 )].

Exon 51 skipping in dystrophin mRNA in patients with DMD: Drisapersen (PRO051 or GSK24022968) is a 20-mer 2'-OMe-PTO designed to complementarily target the ESE region within exon 51 in human dystrophin pre-mRNA and has been evaluated for therapeutic activity in human DMD patients. Based on assessment of muscle biopsy by nested PCR, Drysapersen induced exon 51 skipping in DMD patients treated subcutaneously at 2 to 6 mg/kg per week, although the efficiency of exon skipping was not high. [N. Engl. J. Med. vol 364, 1513-1522 (2011)]

Eteplirsen (AVI-4658) is a 30mer PMO designed to complementarily target ESEs within exon 51 in human dystrophin pre-mRNA and has been evaluated for its therapeutic activity in DMD patients. Based on IHC (immunohistochemical analysis) assessment of muscle tissue for full-length dystrophin, Eteplirsen induced exon 51 skipping in DMD patients receiving 2 to 20 mg/kg per week by intravenous infusion [ Lancet vol 378(9791), 595- 605 ( 2011 )].

Exon 27 skipping of mRNA for APOB in HepG2 cells : Apolipoprotein B (APOB) forms an integral part of lipoprotein particles. mRNA for APOB consists of 29 exons. 2'-OMe-RNA APOB-specific ASOs were designed to target the 3' splice site of exon 27, the 5' splice site of exon 27, or both the 3' splice site and the 5' splicing site. Targeting the 3' splicing site ASO (3'-SS ASO) has a 15-mer overlap with intron 26 and a 5-mer overlap with exon 27 [ BMC Mol. Biol. 2007 , 8:3., 8:3. published January 17, 2007]. ASO's 5'-targeting splice site (5'-SS ASO) has the ability to 5-mer overlap with exon 27 and 15-mer overlap with intron 27. ASO's 40-mer 2'-OMe RNA was constructed by covalent fusion SS ASO with 5'-SS ASO. Thus, the 40mer ASO is able to interact simultaneously with the 3' splicing site as well as the 5' splicing site.

ASOs were evaluated for their ability to induce exon 27 skipping in HepG2 cells by lipofection. Interestingly, both 3'-SS ASO and 5'-SS ASO failed to induce exon 27 skipping in HepG2 cells at 25-250 nM. Meanwhile, 40-mer ASO showed a marked level of exon 27 skipping in a dose-dependent manner from 25 to 250 nM. It is likely that the 15-mer complementary overlap of 2'-OMe-RNA with only the intron part of the splice site was insufficient to effectively inhibit the formation of the early splicesome complex. Stronger binding to the splicing site spanning exon 27 of the APOB pre-mRNA would be desirable to induce exon skipping by effectively inhibiting the formation of the early splicesome complex in HepG2 cells.

Bel-x pre-mRNA alternative splicing : BCL2L1 (Bcl-x) is a human gene encoding Bcl-xL or Bcl-xS via alternative splicing. The 18-mer 2'-OMe-PTO ASO was designed to target the 5' splicing site of exon 2 and was capable of 16-mer complementary overlap with exon 2 and 2-mer overlap with intron 2. When lipofected at a concentration of 80-400 nM, ASO promoted cellular production of Bcl-xS through alternative splicing in a group of cancer cells including MCF7, PC3, Dul45, HeLa, and MDA MB231 [ J. Biol. Chem . vol 277(51), 49374-49382 ( 2002 )].

Cell-free correction of in vitro splicing in pre-mRNA for β-globin . Thalassemia is an inherited blood disorder caused by the abnormal production of hemoglobin. A rare IVS2 ⁷⁰⁵ mutation found in patients with thalassemia major carries a [T→G] point mutation at nucleotide position 705 in intron 2 of the human β-globin gene. The IVS2 ⁷⁰⁵ mutation creates an additional 5' splice site and activates a cryptic 3' splicing site at position 579 of the intron. The IVS2 ⁷⁰⁵ mutation induces alternative splicing with an insertion of 127 nucleotides; nucleotides 579-705 of the intron, between exon 2 and exon 3 [ J. Biol. Chem. vol 260, 16332-16337 ( 1985 )]

The 17mer 2'OMe RNA ASO, fully complementary to the cryptic 5' splicing site of the IVS2 ⁷⁰ mutant, was evaluated for its ability to correct aberrant splicing in an in vitro cell-free splicing system. ASO is capable of 8-dimensional overlap with the intron and 9-dimensional overlap with the cryptic exon. ASO effectively corrected aberrant splicing in the range of 0.12 to 2 μM with mRNA yield without a cryptic exon derived from intron 2 [ Proc. Natl. Acad. sci. USA vol 90, 8673-8677 ( 1993 )]. The in vitro splicing system is cell-free and therefore does not require any delivery vehicle to induce exon skipping. ASO induced exon skipping at 120 nM in a cell-free splicing system. If ASO had a stronger affinity for the 5' splicing site, the exon-passing activity would be greater. In order to increase exon-passing activity, it is desirable to use an ASO having strong affinity for the 5' splicing site.

Correction of pre-mRNA splicing for luciferase in HeLa cells pLuc/705 with 2'-OMe-RNA : pLuc/705 is a luciferase gene modified so that intron 2 of the IVS2 ⁷⁰⁵ human β-globin mutant was inserted between nucleotides 1368 and 1369. HeLa pLuc/705 cells stably express the modified pLuc/705 luciferase gene. The modified HeLa cells express luciferase mRNA with a cryptic exon between nucleotides 1368 and 1369 and therefore encode a non-functional variant of the luciferase protein.

A 17-mer 2'-OMe RNA oligonucleotide complementarily targeting the cryptic 5' splicing site of the IVS2 ⁷⁰ mutant (having the ability to 8-mer overlap with the intron and 9-mer overlap with the cryptic exon) was evaluated for its ability to to correct aberrant splicing of modified luciferase pre-mRNA in HeLa pLuc/705 cells. After lipofection at a concentration of 20-500 nM, 17-mer ASO restored luciferase activity in cells in a dose-dependent manner. It was found by RT-PCR that the cryptic exon was spliced upon ASO treatment. Exon-passing activity was observed at a concentration of 20 nM or higher [ Biochemistry vol 37, 6235-6239 ( 1998 )].

Correction of pre-mRNA splicing for luciferase in HeLa pLuc/705 cells by PNA : 17-mer PNA derivatives targeting the cryptic 5' splicing site of the IVS2 ⁷⁰⁵ mutant complementarily (possessing 8-mer overlap with intron and 9-mer overlap with a cryptic exon) were evaluated for their ability to correct aberrant splicing of modified pre-mRNA for luciferase in HeLa pLuc/705 cells. Derivatives were constructed that contained varying amounts of phosphonate groups covalently conjugated to the N-terminus of the PNA sequence [ Nucl. Acids Res . vol 30 (13), 4424-4432 ( 2008 )]. Covalent conjugation of phosphonate moieties to PNA has been introduced to facilitate transfection into cells by lipofection.

When lipofection at a concentration of 2.5-60 nM PNA ASO restored the activity of luciferase in the cell in a dose-dependent manner. It was found by RT-PCR that the cryptic exon was spliced upon ASO treatment. ASO PNAs with more phosphonate groups attached to them showed higher activity and efficiency in cryptic exon splicing. The ASO PNA with 12 phosphonate groups showed an exon skipping efficiency of 81% at 2.5 nM.

The observed subnanomolar exon-skip activity of ASO PNA is much greater than that of the 17-mer 2'-Ome-RNA of ASO. [ Biochemistry vol 37, 6235-6239 ( 1998 )]. PNA would be very useful for efficient induction of exon skipping if modified properly for delivery into the cell.

FOLH1 pre-mRNA exon skipping by 2'-Ome-PTO : Prostate-specific membrane antigen (PSMA) is a product of the folate hydrolase (FOLH1) gene and is highly expressed in prostate cancer. 2'-OMe-PTO ASOs targeting pre-mRNA for FOLH1 were evaluated for their ability to induce exon skipping in LNCap prostate cancer cells after transfection by lipofection [ Oligonucleotides , vol. 16, 186-175 ( 2006 )].

SSO1 is an 18-mer ASO targeting the 5' splicing site of exon 1 and is capable of 16-mer complementary overlap with exon 1 and 2-mer overlap with intron 1. SS06 and SSO18 are 18-mer ASOs, complementary targeting exon 6 and exon 18, respectively.

SSO1 induced alternative splicing with an IC ₅₀ of approximately 400 nM. SS06 induced skipping of exon 6 with an IC ₅₀ of approximately 4 nM. SSOl8 induced skipping exon 18 with an IC ₅₀ of approximately 4 nM.

Interestingly, SS06 and SS018 targeting the intra-exon region (i.e., the splicing enhancer exon site) induced exon skipping much more strongly than SSO1 targeting the 5' splicing site. Targeting the ESE region with 2'-OMe-PTO ASO was found to be more efficient than targeting the splicing site in this particular example.

Alternative splicing of IL-5Rα pre-mRNA by 2'-O-MOE-RNA: 2'-O-MOE-RNA (2'-O-methoxyethyl-RNA) ASOs complementarily targeting mouse IL-5Rα pre-mRNA were evaluated for their ability to induce alternative splicing (ie, exon skipping) in BCL1 cells after transfection by electroporation. [ Mol. Pharmacol . vol 58, 380-387 ( 2000 )].

ASOs were designed by scanning for complementarity scans of various regions of exon 9 and the splice sites flanking exon 9. alternative splicing at a concentration of 10 μM. ASOs targeting intra-exon regions of exon 9 induced alternative splicing at a concentration of 10 μM with an efficiency comparable to that of 3' SS ASO. All ASOs tested induced alternative splicing, indicating that exon 9 and its splice sites are highly susceptible to exon skipping. The 3' splicing site was more sensitive than the 5' splicing site.

The 20-mer ASOs were also designed to complementarily target splice sites flanking exon 8 with a 4-mer overlap with the intron. ASO induced exon 8 skipping at 10 μM, although 3' SS ASO was more effective than 5' SS ASO.

It is believed that the micromolar exon-skip activity of 2'-O-MOE-RNA ASO by electroporation is very low compared to the nanomolar exon-skip activity of 2'-OMe-PTO ASO targeting FOLH1 pre-mRNA by lipofection. [ Oligonucleotides , vol. 16, 186-175 ( 2006 )] Lipofection will be more efficient than electroporation for transfection of negatively charged backbone oligonucleotides into the cell.

Skipping exon 10 in tau pre-mRNA by 2'-O-MOE PTO : The 5' splicing site of exon 10 in tau pre-mRNA has an 18-mer sequence prone to stem looping and is not suitable for splicesome E formation -complex. Therefore, exon 10 of tau pre-mRNA is very prone to skipping.

2'-O-MOE PTO ASOs targeting either the 3' splicing site or the 5' splicing site of tau exon 10 have been evaluated for their ability to enhance exon 10 skipping [ J. Biol. Chem. vol 276(46), 42986-42993 ( 2001 )]. E10α is an 18-mer ASO complementary targeting the 3' splicing site. E10α has the ability to overlap 10-mer with intron 9 and 8-mer overlap with exon 10. E10β is a 21-mer ASO complementarily targeting the 5' splicing site. E10β has an 8-dimensional overlap with exon 10 and a 13-dimensional overlap with intron 10.

After transfection into COS-1 cells by lipofection, E10α and E10β induced exon 10 skipping with an IC ₅₀ =2-5 nM. In PC12 cells transfected by electroporation, ASO induced exon 10 skipping with a micromolar IC ₅₀ .

Pre-mRNA exon 2 skipping for MyD88 by 2'-O-MOE-RNA ASO : MyD88 is an adapter protein involved in IL-1R- and TLR-induced NF-κB activation. The 2'-O-methoxyethyl (2'-O-MOE) ASO RNAs were designed to complementarily target either the 3' splicing site or the 5' splicing site of exon 2 in pre-mRNA for human MyD88. 20-mer ASOs were constructed that were capable of 0-, 5-, 10-, 15-, or 20-mer overlap with either the 5' end of intron 1 (i.e., the 3' splicing site of exon 2) or the 3' end of intron 2 (i.e., the 5' splicing site of exon 2). ASOs have been evaluated for their ability to induce exon 2 skipping in A549 cells after transfection with lipofection [ J. Immunol , vol 176, 3652-3661 ( 2006 )].

Of all the ASOs, the ASO with the ability to overlap 20-mer with intron 1 at the 3' splicing site of exon 2 induced exon 2 skipping most strongly and efficiently. The observed IC ₅₀ for exon 2 skipping ranged from 50 to 100 nM. ASOs targeting the 5' splicing site were not as effective as ASOs targeting the 3' splicing site. Among the ASOs targeting the 5' splicing site, the strongest ASO was the ASO with the ability to overlap 20-mer with the 3' end of exon 2.

Among the 2'-O-MOE-RNA ASOs also designed to complementarily target either the 3' splicing site or the 5' splicing site of exon 2 in mouse MyD88 pre-mRNA, an ASO with 20-mer overlap with the 5' end of exon 2, most strongly induced skipping of exon 2 in RAW 264.7 cells transfected by lipofection.

The strongest ASO in mouse cells was administered twice a week for 2 weeks at a dose of 50 mg/kg. There was a significant decrease in mRNA for MyD88 by 60-85% in the intestine, adipose tissue and liver. 50 mg/kg is a large dose that would cause the typical adverse effects of phosphate-ribose backbone oligonucleotide therapy. There is an urgent need for a significant increase in exon skipping activity if the 2'-O-MOE-RNA ASO is to exhibit therapeutic activity without causing the typical adverse effects.

Recovery of exon 7 in SMN2 with Nusinersen : Spinal muscular atrophy (SMA) is a life-threatening rare disease caused by deletion or loss of function of the SMN1 (motor neuron 1 survival) gene. Humans have a paralogous SMN2 gene that has an identical coding sequence except for 11 nucleotides. SNP (single nucleotide polymorphism) C→T in exon 7 of SMN2 induces exon 7 skipping, and the resulting splice variant mRNA encodes a rapidly metabolized SMN2 protein variant. Therefore, the SMN2 mutant is unable to compensate for the functional deficiency of the SMN1 protein, resulting in an SMA flare. [ Neurology vol 86, 890-897( 2016 )]

Nusinersen (Spiranza™) is an 18mer 2'-O-MOE ASO RNA that complementarily targets the splicing silencer region in intron 7 of SMN2. Because Nusinersen sterically blocks the binding of the splicing silencer protein, exon 7 is saved or repaired to produce a full-length SMN2 protein. Nusinersen restores the normal splicing process by binding to the splicing silencer region located in intron 7 of SMN2.

Nusinersen was approved by the US Food and Drug Administration (FDA) in 2016 for the treatment of SMA. Nusinersen is administered intrathecally at a dose of 12 mg once every three months or six months. Nusinersen resides in the spinal cord with a half-life of 135 to 177 days in cerebrospinal fluid (CSF) [Nusinersen US Label, FDA, December 2016].

Therapeutic Activity of Exon Skipping Inducing Oligonucleotide Therapies: As in the exemplary cases cited earlier in this document, phosphate backbone oligonucleotides induce exon skipping with nanomolar activity in cells transfected by lipofection, but micromolar activity in cells treated with "naked" oligonucleotide.

The micromolar exon-skip activity in MyD88 pre-mRNA has been translated into a therapeutic dose of 10 mg/kg or higher when administered systemically as a naked oligonucleotide in mice [ J. Immunol , vol 176, 3652-3661 ( 2006 )]. At such a high therapeutic dose, phosphate backbone oligonucleotides are susceptible to immunological adverse events. Thus, it would be highly desirable to develop a method or formulation to markedly improve the therapeutic dose.

Drisapersen, a 20-mer 2'-OMe-PTO designed to induce exon 51 skipping in pre-mRNA for human dystrophin, induced exon 51 skipping in DMD patients treated subcutaneously with ASO at a dose of 2 to 6 mg/kg per week for as a naked oligonucleotide, although exon skipping efficiency was not high [ N. Engl. J. Med. vol 364, 1513-1522 ( 2011 )]. There has been concern about increasing the therapeutic dose of Drisapersen due to dose-limiting toxicity.

PNA and PMO have a neutral backbone, are not recognized by immune systems (especially Toll-like receptors) and will be free from the immunological reactions commonly seen with phosphate backbone oligonucleotides.

Eteplirsen (AVI-4658), a 30mer PMO designed to induce exon 51 skipping in pre-mRNA for human dystrophin, was well tolerated by DMD patients treated with ASO by intravenous infusion of 2 to 20 mg/kg per week [ Lancet vol 378 (9791), 595-605 ( 2011 )]. Eteplirsen recently received US FDA accelerated approval for use in patients with DMD.

Although Nusinersen is an ASO with exon repair instead of exon skipping, the approved therapeutic dose of 12 mg every three months is very attractive. Efficient uptake by neurons after intrathecal injection is believed to be largely responsible for the activity of Nusinersen.

Clinical development of phosphate backbone oligonucleotide therapy has been critically hampered by dose-limiting toxicity, including immunological toxicity via Toll-like receptor activation or complement activation, tissue-specific toxicity in the liver or kidneys. By increasing in vivo therapeutic activity, such dose-limiting toxicities can be overcome.

The production of oligonucleotides is very expensive. The current human therapeutic dose level of 100mg to 2g per week translates into an API (Active Pharmaceutical Ingredient) cost of US$100 to US$2,000 per week if the API production cost is generously assumed to be US$1,000 per gram. In fact, the production cost of an oligonucleotide therapy API far exceeds $1,000 per gram. Thus, there will be a significant need among healthcare stakeholders for a significant increase in therapeutic activity in order to provide oligonucleotide therapy at a moderate annual treatment cost for ongoing use.

Good cell permeability of the oligonucleotide . The cell membrane is a lipid bilayer barrier formed during evolution over a billion years. The cell membrane does indeed function as a large barrier to single stranded antisense oligonucleotides ranging in size from 4 to 10 kDa. Delivery of such ASOs into the cell by direct penetration through the cell membrane is almost impossible. There are other ways of cellular uptake of single-stranded oligonucleotides. To give some pathways, carrier-mediated endocytosis in hepatocytes seen with Miromersen targeting ApoB 100, neuronal uptake (probably endocytosis) seen with Nusinersen, GalNac (N-acetylgalactosamine)-mediated uptake by cells, etc. However, these cellular uptake pathways are highly tissue-dependent and are unlikely to apply in general to most tissue types [ Nature Biotechnol. vol 35(3), 222-229 ( 2017 )].

A phosphate backbone oligonucleotide could be properly formulated to have good cell permeability, and such a formulated oligonucleotide would be predicted to exhibit better in vivo therapeutic activity than "naked" (i.e. . without composition) oligonucleotide. Considering that oligonucleotides with a phosphate backbone exhibit nanomolar exon-skip activity most commonly in cells if they were transfected by lipofection, the in vivo therapeutic activity of oligonucleotides formulated so that they have good cell permeability would be markedly improved, since they would nanomolar exon-passing activity in vitro is prescribed. Thus, good cell permeability will be critical for the in vivo therapeutic activity of exon skipping oligonucleotides. However, developing a composition that provides good tissue delivery remains a huge technical challenge in the field of oligonucleotide therapy.

Modified PNA nucleotide bases for good cell permeability and high affinity . As previously mentioned, PNA derivatives have been constructed that contain varying amounts of phosphonate groups covalently conjugated to facilitate cell delivery by lipofection. Such ASO PNAs have been found to exhibit subanomolar exon skipping activity in HeLa cells upon lipofection. [ Nucl. Acids Res. vol 30(13), 4424-4432 ( 2008 )]. This subnanomolar activity is significantly greater than the exon skipping activity seen in ASO with a phosphate backbone. Thus, PNA would be useful for efficient induction of exon skipping if properly delivered to the cell.

PNA has been made highly permeable through the mammalian cell membrane by introducing modified nucleotide bases together with a cationic lipid or equivalent covalently attached to them. The chemical structure of such modified nucleotide bases is shown in FIG. 6C. These modified nucleotide bases of cytosine, adenine and guanine have been found to predictably hybridize to guanine, thymine and cytosine, respectively. [PCT Application No. PCT/KR2009/001256; EP2268607; US8680253]

The incorporation of such modified nucleotide bases into PNA mimics lipofection situations. In lipofection, oligonucleotide molecules are wrapped or complexed with cationic lipid molecules such as lipofectamine, and such lipofectamine/oligonucleotide complexes generally penetrate the cell membrane quite easily compared to naked oligonucleotide molecules.

In addition to good membrane permeability, these PNA derivatives have been found to have a super strong affinity for the complementary nucleic acid. For example, incorporation of 4 to 5 modified nucleotide bases into 11 to 13 mer PNA derivatives readily gives rise to T _m by 20 ^° C or more when duplexed with complementary DNA.

Such PNA derivatives have been found to be very sensitive to base pair mismatch (one base mismatch). Mismatched base pairs resulted in a decrease in T _m by 11-22 ^ο C, depending on the type of modified base, as well as the PNA sequence.

Given the good membrane permeability and ultra-high affinity for nucleic acid, PNA derivatives with such modified nucleotide bases would be applicable for efficient induction of exon skipping.

Brief description of the figures

Fig. 1A. Illustration of intron and exon numbering in pre-mRNA.

Fig. 1b. A brief illustration in the form of a diagram of the splicing process.

Fig. 2A. mRNA splicing variants for AR encoding AR protein variants.

Fig. 2b. HIF-1α mRNA splicing variants encoding HIF-α protein variants.

Fig. 3. Schematic representation of the biological processes involved in the formation of the early splicesome complex.

Fig. 4A. Portion of CDS read from mRNA for human HIF-1α.

Fig. 4B. Exon-exon junction site sequences in HIF-1α splicing variants lacking exon 3 (left) and exons 3-4 (right), illustrating frameshift (out of frame) and in-frame, respectively.

Fig. 4C. An exemplary frameshift giving PTC.

Fig. 5A. Schematic representation of nested RT-PCR for exon skipping detection.

Fig. 5b. Schematic representation of EIciRNA formation during exon skipping.

Fig. 6A. Chemical structure for representative non-natural oligonucleotides.

Fig. 6b. Chemical structures and abbreviation of prototype PNA.

Fig. 6C. Modified nucleotide bases designed to increase the membrane permeability of PNA.

Fig. 7. Examples of natural or non-natural (modified) nucleotide bases selected for the peptido nucleic acid derivative of formula I.

Fig. 8A. Examples of substituted or unsubstituted alkyl radicals to be chosen for the compound of formula I.

Fig. 8B. Examples of substituted or unsubstituted alkyl acyl and substituted or unsubstituted arylacyl radicals to be chosen for the compound of formula I.

Fig. 8C. Examples of selectable radicals for the compound of formula I: substituted alkylamino, substituted arylamino, substituted or unsubstituted aryl, substituted or unsubstituted alkylsulfonyl, substituted or unsubstituted arylsulfonyl, substituted or unsubstituted alkylphosphonyl, and substituted or unsubstituted arylphosphonyl.

Fig. 8D. Examples of selectable radicals for the compound of formula I: substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted aryloxycarbonyl, substituted or unsubstituted alkylaminocarbonyl and substituted or unsubstituted arylaminocarbonyl.

Fig. 8E. Examples of radicals selectable for the compound of formula I: substituted or unsubstituted alkyloxythiocarbonyl, substituted or unsubstituted alkylaminothiocarbonyl, substituted or unsubstituted arylaminothiocarbonyl, substituted or unsubstituted alkyloxythiocarbonyl and substituted or unsubstituted aryloxythiocarbonyl.

Fig. 9. Chemical structures of PNA monomers with natural or modified nucleotide base.

Fig. 10. Chemical structures of abbreviations for N-terminal or C-terminal substituents.

Fig. 11. Chemical structure of the 14-mer PNA derivative (N→C)Fethoc-GA(5)AC(102)TT-A(5)TC-CTA(5)-C(102)T-NH ₂

Fig. 12. Chemical structure of the 15-mer PNA derivative (N→C)Fmoc-Val-CTC(102)-A(5)TC-CTA(6)-C(103)TT-AA(202)C-NH ₂ .

Fig. 13. Chemical structures of the Fmoc-PNA monomers used to synthesize the PNA derivatives of this invention.

Fig. 14. Typical monomer elongation cycle adopted in solid phase peptide synthesis.

Fig. 15A. Reverse phase C ₁₈ HPLC chromatogram for "HIF-ASO 1" before purification.

Fig. 15b. Reverse phase C ₁₈ HPLC chromatogram for "HIF-ASO 1" after purification by HPLC.

Fig. 16. ESI-TOF mass spectrum of "HIF-ASO 1" purified by C ₁₈ reverse phase preparative HPLC.

Fig. 17A. Target positions of exon-specific primers used in HIF-1α-specific nested PCR to detect exon skipping induced by "HIF-ASO 2" in HeLa cells.

Fig. 17b. Electrophoresis data of HIF-1α-specific nested PCR products in HeLa cells treated with "HIF-ASO 2" at 0 (negative control), 10, 100, or 1000 µM.

Fig. 17C. Band Sanger sequencing data for the PCR product attributed to exon 2 skipping of HIF-1α.

Fig. 18A. Western blotting data of HIF-1α in HeLa cells treated with "HIF-ASO 2" at 0 uM (negative control), 10 uM, 100 uM, 1 aM, or 10 aM for 24 hours.

Fig. 18b. Relative levels of HIF-1α protein expression, normalized to β-actin, in HeLa cells treated with "HIF-ASO 2" at a concentration of 0 uM (negative control), 10 uM, 100 uM, 1 aM, or 10 aM for 24 hours ("whiskers" according to the standard error).

Fig. 18C. HIF-1α-specific nested qPCR using SYBR Green in HeLa cells treated with "HIF-ASO 2" at a concentration of 0 (negative control), 10, 100 or 1000 mM ("whiskers" according to the standard error).

Fig. 18D. HIF-1α-specific nested qPCR using a TaqMan probe in HeLa cells treated with "HIF-ASO 2" at a concentration of 0 (negative control), 10, 100 or 1000 mM ("whiskers" according to the standard error).

Fig. 19A. Electrophoresis data of HIF-1α-specific nested PCR products in HeLa cells treated with "HIF-ASO 6" at a concentration of 0 (negative control), 10, 100, or 1000 µM.

Fig. 19b. Western blotting data of HIF-1α in HeLa cells treated with "HIF-ASO 6" at 0 uM (negative control), 10 uM, 100 uM, or 1 aM for 24 hours.

Fig. 19c. HIF-1α expression levels, normalized to β-actin, in HeLa cells treated with "HIF-ASO 6" at a concentration of 0 uM (negative control), 10 uM, 100 uM, or 1 aM for 24 hours ("whiskers" according to rms error).

Fig. 20A. Nested qPCR data using SYBR Green in HeLa cells treated with "HIF-ASO 6" at a concentration of 0 (negative control), 10, 100, or 1000 µM ("whiskers" according to the standard error).

Fig. 20b. Nested qPCR data using the TaqMan probe in HeLa cells treated with "HIF-ASO 6" at 0 (negative control), 10, 100, or 1000 µM ("whiskers" according to standard error).

Fig. 21A. Electrophoresis data of HIF-1α-specific nested qPCR products in HeLa cells treated with "HIF-ASO 1" at a concentration of 0 (negative control), 1, 3, 10, 30, or 100 aM (left)); and Sanger sequencing data of the PCR product attributed to exon skipping 2-3 (right).

Fig. 21b. Western blotting data of HIF-1α in HeLa cells treated with "HIF-ASO 1" for 72 hours at a concentration of 0 uM (negative control), 100 uM, 300 uM, 1 aM, 3 aM, 10 aM, 30 aM, 100 aM or 300 aM.

Fig. 21c. HIF-1α expression levels, normalized to β-actin, in HeLa cells treated with "HIF-ASO 1" for 72 hours at a concentration of 0 uM (negative control), 100 uM, 300 uM, 1 aM, 3 aM, 10 aM , 30 aM, 100 aM or 300 aM.

Fig. 22A. HIF-1α-specific nested qPCR data obtained in HeLa cells treated with "HIF-ASO 12" at 0 (negative control), 10, 100, or 1000 µM (left), along with Sanger sequencing data of exon skipping bands ( on right).

Fig. 22b. Western blotting data of HIF-1α in HeLa cells treated with "HIF-ASO 12" at a concentration of 0 (negative control), 0.01, 0.1, 1 or 10 aM.

Fig. 22C. HIF-1α-specific nested qPCR data obtained in HeLa cells treated with "HIF-ASO 12" at a concentration of 0 (negative control), 10, 100, or 1000 mM ("whiskers" according to the standard error).

Fig. 23A. Electrophoretic analysis of AR-specific nested PCR products in MCF7 cells treated with "AR-ASO 1" for 3 hours at a concentration of 0 (negative control), 3, 30, 300 or 3000 aM.

Fig. 23b. Band Sanger sequencing data for the PCR product attributed to exon skipping 4-5.

Fig. 23C. Western blot data on AR in MCF7 cells treated with "AR-ASO 1" for 48 hours at 0 uM (negative control, i.e. N/C), 10 uM, 30 uM, 100 uM, 300 uM, 1 aM, 3 aM, 10 aM or 30 aM.

Fig. 24A. SYBR Green qPCR data for AR exon levels 4-6 in MCF7 cells treated with AR-ASO 1 for 5 hours at 0 (negative control), 1, 10, 100, or 1000 µM (whiskers according to rms error).

Fig. 24b. SYBR Green qPCR data for AR exon levels 4-6 in MCF7 cells treated with AR-ASO 5 for 5 hours at 0 (negative control), 1, 10, 100, or 1000 µM (“whiskers” according to rms error).

Fig. 24C. qPCR data using TaqMan assay for AR mRNA in MCF7 cells treated with "AR-ASO 5" for 24 hours at a concentration of 0 (negative control), 1, 10, 100, or 1000 µM ("whiskers" according to standard error).

Fig. 25A. Raw Western blot data obtained from the skin at the injection site. NC, 1p, 10p, 100p and 1000p refer to the negative control group, treatment group 1, 10, 100 and 1000 pmol/kg ASO, respectively.

Fig. 25b. Raw Western blot data obtained from skin at the non-injected site. NC, 1p, 10p, 100p and 1000p refer to the negative control group, treatment group 1, 10, 100 and 1000 pmol/kg ASO, respectively.

Fig. 26A. AR protein expression level by group, as well as by subject at injection site (left) and at non-injection site (right) (** for p<0.01 and * for p<0.05)

Fig. 26b. The average level of AR protein expression by group at the injection site (left) and at the site without injection (right). (** for p<0.01 and * for p<0.05)

Fig. 27A. Electrophoretic analysis of AR-specific nested PCR products in MCF7 cells treated with "AR-ASO 1" for 3 hours at a concentration of 0 (negative control), 30, 100 or 1000 aM.

Fig. 27b. Band Sanger sequencing data for the PCR product attributed to exon 5 skipping.

Fig. 28A. Electrophoretic analysis of SCN9A-specific nested PCR products in PC3 cells treated with SCN-ASO 7 for 24 hours at 0 (negative control), 10, 100, or 1000 µM.

Fig. 28b. Sanger sequencing data of nested PCR products attributed to exon 4 (top) and exon 4-5 (bottom) skipping, respectively.

Fig. 29A. SCN9A-specific nested qPCR data in PC3 cells treated with "SCN-ASO 7" for 24 hours at a concentration of 0 (negative control), 10, 100, or 1000 µM ("whiskers" according to the standard error).

Fig. 29b. SCN9A-specific nested qPCR data in PC3 cells treated with "SCN-ASO 3" for 24 hours at a concentration of 0 (negative control), 10, 100, or 1000 µM ("whiskers" according to the standard error).

Fig. 29C. SCN9A-specific nested qPCR data in PC3 cells treated with "SCN-ASO 8" for 24 hours at a concentration of 0 (negative control), 10 or 100 µM ("whiskers" according to the standard error).

Fig. 30A. Results of analysis using CoroNa in PC3 cells treated with "SCN-ASO 7" for 30 hours at a concentration of 0 (negative control), 100 or 1000 uM.

Fig. 30b. Results of analysis using CoroNa in PC3 cells treated with "SCN-ASO 3" for 30 hours at a concentration of 0 (negative control), 100 or 1000 uM.

Fig. 30C. Results of analysis using CoroNa in PC3 cells treated with "SCN-ASO 8" for 30 hours at a concentration of 0 (negative control), 100 or 1000 uM.

Fig. 31A. Electrophoresis data of SCN9A-specific nested RT-PCR products in PC3 cells treated with ASO 27 for 24 hours at 0 (negative control), 10 or 100 µM.

Fig. 31b. Band Sanger sequencing data for the PCR product attributed to exon skipping 4-5.

Fig. 31c. Electrophoresis data of SCN9A-specific RT-PCR products in PC3 cells treated with ASO 27 at 0 (negative control), 1, 10, 100, or 1000 aM.

Fig. 32A. SCN9A-specific qPCR data by one-step cDNA synthesis in PC3 cells treated with SCN-ASO 27 at 0 (negative control), 0.1, 1, or 10 aM for 24 hours ("whiskers" according to standard error).

Fig. 32b. SCN9A-specific qPCR data by random hexamer cDNA synthesis in PC3 cells treated with SCN-ASO 27 at 0 (negative control), 0.1, 1, or 10 aM for 24 hours ("whiskers" according to standard error ).

Fig. 33A. Average fluorescence intensity records of rat L5 DRG cells (stimulated by L5/L6 ligation) treated with SCN-ASO 27 at 0 (negative control), 100 or 1000 µM.

Fig. 33b. Fluorescence intensity records of mean rat L5 DRG cells (without L5/L6 ligation) treated with "SCN-ASO 27" at 0 (negative control), 100 or 1000 µM.

Fig. 34A. Western blot data for Na _v 1.7 protein expression in DRG nerve cells (stimulated with L5/L6 ligation) treated with "SCN-ASO 30" for 24 hours at a concentration of 0 (i.e. negative control), 10, 100, or 1000 cM.

Fig. 34b. Sodium current according to manual patch clamp analysis in DRG nerve cells (stimulated by L5/L6 ligation) treated with "SCN-ASO 30" for 4 hours at 0 (negative control) and 100 µM ("whiskers" according to standard error ).

Fig. 35A. Data from SCN9A-specific qPCR by one-step cDNA synthesis in rat DR5 L5 nerve cells treated with SCN-ASO 30 for 24 hours at a concentration of 0 (negative control), 10, 30, 100, or 300 µM (“whiskers” according to standard error ).

Fig. 35V. Data from SCN9A-specific qPCR by cDNA synthesis using a random hexamer in DRG L5 nerve cells treated with SCN-ASO 30 for 24 hours at a concentration of 0 (negative control), 10, 30, 100, or 300 µM (whiskers according to mean square error).

Fig. 36. Reversal of DPNP-induced allodynia in rats injected subcutaneously with vehicle (PBS, negative control), "SCN-ASO 7" 100 pmol/kg, "SCN-ASO 8" 100 pmol/kg, "SCN-ASO 21 » "100 pmol/kg", "SCN-ASO 35" 100 pmol/kg, "SCN-ASO 36" 100 pmol/kg or "SCN-ASO 37" 100 pmol/kg ("whiskers" according to standard error).

Fig. 37A. Electrophoresis data of nested PCR products (method A) obtained from muscle tissues from MDX mice injected subcutaneously with vehicle alone (negative control), 1000 pmol/kg "DMD-ASO 1" or 1000 pmol/kg "DMD-ASO 4" , 2 times a day (BID) for 3 days.

Fig. 37b. Band Sanger sequencing data for the PCR product attributed to exon 23 skipping.

Fig. 38A. Electrophoresis data of nested PCR products (method B) obtained from muscle tissues from MDX mice injected subcutaneously with vehicle alone (negative control), 1000 pmol/kg "DMD-ASO 1" or 1000 pmol/kg "DMD-ASO 4", 2 times a day (BID) for 3 days.

Fig. 38b. Band Sanger sequencing data for the PCR product attributed to exon skipping 21-23.

Fig. 38C. Electrophoresis data of nested PCR products (method A) obtained from triceps samples from mdx mice injected subcutaneously with "DMD-ASO 1" at a dose of 0 (negative control) or 10 pmol/kg, BID for 5 days.

Fig. 39A. Roll bar test scores in mdx mice treated with vehicle (negative control), 100 pmol/kg "DMD-ASO 1" or 1000 pmol/kg "DMD-ASO 1" (whiskers) according to standard error and * for p<0 .05)

Fig. 39b. Estimates of grip strength in mdx mice chronically injected with "DMD-ASO 1" at a dose of 0 (negative control), 10, 50 or 200 pmol/kg ("whiskers" according to standard error and * for p<0.05)

Fig. 40. IHC images of full-length dystrophin combined with DAPI staining in muscle tissue of mdx mice injected with "DMD-ASO 1" at a dose of 0 (negative control) or 200 pmol/kg, 2 times a week for 30 weeks.

Fig. 41. Relative expression levels of full length dystrophin protein in skeletal muscle of mdx mice chronically injected with "DMD-ASO 1" at a dose of 0 (negative control), 10, 50 or 200 pmol/kg. Expression level is normalized to the level of expression in WT mice ("whiskers" according to the standard error, * for p<0.05 and ** p<0.01)

Fig. 42. Electrophoresis data for nested PCR products obtained from skeletal muscle samples collected from mdx mice at week 7.

Fig. 43. Histopathological changes according to H&E staining of triceps of C57BL/6 mice (WT negative control) and mdx mice chronically injected with "DMD-ASO 1" at a dose of 0 (mdx negative control), 10, 50 or 200 pmol/kg.

Fig. 44A. Distances walked on a treadmill in C57BL/6 mice (WT negative control) and mdx mice chronically exposed to DMD ASO2 at 0 (mdx negative control), 10 pmol/kg, or 30 pmol/kg ("whiskers" according to rms error, * for p<0.05, ** for p<0.01 and *** for p<0.001)

Fig. 44b. Serum creatine kinase levels in C57BL/6 mice (WT negative control) and mdx mice chronically exposed to "DMD ASO2" at a dose of 0 (mdx negative control), 10 pmol/kg, or 30 pmol/kg ("whiskers" according to standard error , ** for p<0.01 and **** for p<0.0001)

Fig. 44C. Serum myoglobin levels in C57BL/6 mice (WT negative control) and mdx mice chronically exposed to "DMD ASO2" at a dose of 0 (mdx negative control), 10 pmol/kg, or 30 pmol/kg ("whiskers" according to standard error , *** for p<0.001 and **** for p<0.0001)

Fig. 45A. Western blotting data examining the presence of full-length dystrophins in skeletal muscle samples from wild-type mice (WT negative control) or mdx mice chronically exposed to DMD-ASO 2 at a dose of 0 (mdx negative control), 10 or 30 pmol/ kg.

Fig. 45b. Serum creatine kinase levels in WT mice (WT negative control), mdx mice without ASO exposure, and mdx mice injected subcutaneously with 50 mmol/kg "DMD-ASO 1", 10 mmol/kg "DMD-ASO 2", or 10 μmol/ kg "DMD-ASO 6", 2 times a week for 66 weeks ("whiskers" according to the standard error and ** for p<0.01)

Fig. 45C. Serum myoglobin levels in WT mice (WT negative control), mdx mice without ASO exposure, and mdx mice injected subcutaneously with 50 mmol/kg "DMD-ASO 1", 10 mmol/kg "DMD-ASO 2" or 10 μmol/ kg "DMD-ASO 6", 2 times a week for 66 weeks ("whiskers" according to the standard error, * for p<0.05 and *** for p<0.001)

Fig. 46A. Electrophoresis data for IDO-1-specific nested PCR products in SKOV3 cells treated with "IDO-ASO 1" at 0 (negative control), 10, 100, or 1000 µM (left panel) and Sanger sequencing data for PCR- product in case of exon skipping (right diagram).

Fig. 46b. Results of analysis of kynurenine secretion in SKOV3 cells treated with "IDO-ASO 1" at a concentration of 0 uM (negative control) or from 10 uM to 1 fM ("whiskers" according to the standard error, and * for p<0.05)

Fig. 47A. Electrophoresis data of IDO-1-specific nested PCR products in SKOV3 cells treated with IDO-ASO 5 at 0 (negative control), 1, 3, 10, 30, or 100 aM.

Fig. 47b. Sanger sequencing data for PCR products attributed to exon 2-4 and exon 2-6 skipping.

Fig. 47C. Electrophoresis data of IDO-1-specific nested PCR products in SKOV3 cells treated with "IDO-ASO 6" at a concentration of 0 (negative control), 1, 3, 10, 30 or 100 aM (left diagram), as well as Sanger sequencing data bands for the PCR product attributed to exon skipping 2-5 (right diagram).

Fig. 48A. Electrophoretic analysis of SNAP25-specific nested PCR products in PC12 cells treated with 0 (negative control), 10, 100, or 1000 µM "SNAP-ASO 3" (left diagram) and sequencing data of the band related to the PCR product in case of exon skipping 5-7.

Fig. 48b. Changes in the level of full-length mRNA for rat SNAP25 in PC12 cells treated with "SNAP-ASO 3" at a concentration of 0 (negative control), 10, 100 or 1000 nM ("whiskers" according to the standard error).

Fig. 48C. Changes in the level of full-length mRNA for rat SNAP25 in PC12 cells treated with "SNAP-ASO 1" at a concentration of 0 (negative control), 10, 100 or 1000 nM ("whiskers" according to the standard error).

Fig. 49A. Western blot data of SNAP25 (top chart) and relative levels of SNAP25 expression normalized to β-actin (bottom chart) in PC12 cells treated with "SNAP-ASO 3" for 48 hours at a concentration of 0 uM (negative control), 1 uM, 10 uM, 30 uM, 100 uM, 300 uM, 1 aM, 3 aM, or 10 aM.

Fig. 49b. Western blotting data of SNAP25 in PC12 cells treated with "SNAP-ASO 1" at a concentration of 0 (negative control), 0.1 or 1 aM, either within 48 hours or within 72 hours.

Fig. 50A. Western blotting data of SNAP25 (top chart) and relative levels of SNAP25 expression normalized to β-actin (bottom chart) in SiMa cells treated with "SNAP-ASO 3" for 48 hours at a concentration of 0 uM (negative control), 1 uM, 10 uM, 100 uM, 1 aM, 10 aM or 100 aM.

Fig. 50B. Changes in the level of full-length mRNA for human SNAP25 in SiMa cells treated with "SNAP-ASO 3" at a concentration of 0 cM (negative control), 1 cM, 10 cM, 100 cM, 1 aM, 10 aM, or 100 aM ("whiskers" according to rms error)

Fig. 51. IHC images of SNAP25 from skin samples of mice that were topically injected with "SNAP-ASO 1" at a concentration of 0 (negative control), 1, 10 or 100 fM, BID for 4 days.

Fig. 52A. Electrophoretic analysis of nested PCR products in B16F10 mouse melanoma cells treated with TYR-ASO 4 at a concentration of 0 (negative control), 1, 10 or 1000 aM.

Fig. 52b. Sanger sequencing of the PCR product attributed to exon skipping 2-3.

Fig. 52C. Changes in the level of full-length mRNA for TYR according to qPCR in B16F10 mouse melanoma cells treated with "TYR-ASO 4" at a concentration of 0 (negative control), 1, 10, 100 or 1000 aM ("whiskers" according to the standard error)

Fig. 53A. Western blot data on TYR in B16F10 cells treated with TYR-ASO 4 for 24 hours at 0 (negative control), 0.01, 0.1, 1 or 10 aM.

Fig. 53b. Changes in melanin content in B16F10 mouse melanoma cells treated with either "TYR-ASO 4" at a concentration of 0 (negative control), 1, 10, 100 or 1000 aM, or 10 μg/ml or 100 μg/ml arbutin ("whiskers" according to standard error, * for p<0.05, ** for p<0.01 and *** for p<0.001)

Fig. 53C. Changes in the level of full-length mRNA for TYR according to qPCR in primary human epidermal melanocytes treated with TYR-ASO 1 at a concentration of 0 cM (negative control), 1 cM, 100 cM or 10 aM ("whiskers" according to standard error)

Fig. 54A. Electrophoretic analysis of nested PCR products in Jurkat cells treated with "PD-ASO 3" at a concentration of 0 (negative control), 10, 100 or 1000 aM.

Fig. 54b. Sanger sequencing of PCR products attributed to exon 2 (left) and exon 3 (right) skipping, respectively.

Fig. 55A. Changes in human PD-1 mRNA levels according to nested qPCR in Jurkat cells treated with PD-ASO 3 at 0 (negative control), 10, 100, or 1000 aM (“whiskers” according to standard error, ** for p<0 .01 and * for p<0.05)

Fig. 55B. Changes in the mRNA level for human IL-2 according to qPCR in Jurkat cells treated with "PD-ASO 3" at a concentration of 0 (negative control), 10, 100 or 1000 aM ("whiskers" according to the standard error, ** for p<0, 01 and * for p<0.05)

Fig. 56A. Changes in human PD-1 mRNA levels according to nested qPCR in Jurkat cells treated with "PD-ASO 1" at 0 (negative control), 10, 100 or 1000 aM. ("whiskers" according to standard error and * for p<0.05)

Fig. 56b. Growth inhibition of B16F10 melanoma in C57BL/6 mice injected subcutaneously with "PD-ASO 2" at a dose of 2, 10 or 50 pmol/kg, 2 times a week ("whiskers" according to the standard error and * for p<0.05)

Brief summary of the present invention

The present invention provides a peptido-nucleic acid derivative represented by formula I, or a pharmaceutically acceptable salt thereof:

where

n is an integer between 10 and 25;

the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in the target pre-mRNA;

the compound of formula I is fully complementary to the target pre-mRNA sequence or partially complementary to the target pre-mRNA sequence with one or two mismatches;

radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n independently represent deuterido [D], hydrido [H], substituted or unsubstituted alkyl or substituted or unsubstituted aryl;

the radicals X and Y are independently hydrido, formyl [HC(=O)-], aminocarbonyl [NH ₂ -C(=O)-], aminothiocarbonyl [NH ₂ -C(=S)-], substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkylacyl, substituted or unsubstituted arylacyl, substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted aryloxycarbonyl, substituted or unsubstituted alkylaminocarbonyl, substituted or unsubstituted arylaminocarbonyl, substituted or unsubstituted alkylaminothiocarbonyl, substituted or unsubstituted arylaminothiocarbonyl, substituted or unsubstituted arylaminothiocarbonyl, alkylthiocarbonyl, substituted or unsubstituted arylaminothiocarbonyl, substituted or unsubstituted aryloxythiocarbonyl, substituted or unsubstituted alkylsulfonyl, substituted or unsubstituted arylsulfonyl, substituted or unsubstituted alkylphosphonyl, or substituted or unsubstituted arylphosphonyl;

radical Z is hydrido, hydroxy, substituted or unsubstituted alkyloxy, substituted or unsubstituted aryloxy, unsubstituted amino [-NH ₂ ], substituted or unsubstituted alkylamino, substituted or unsubstituted arylamino, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl;

_{B 1} , _{B 2} . and

at least _four of _{B 1} , B ₂ , .

In some embodiments, a compound of formula I has the ability to have at least a 10-mer complementary overlap with a 14-mer target splicing site sequence that consists of a 7-mer from an intron and a 7-mer from an exon, in the target pre-mRNA, wherein the sequence of the target splicing site is not [(5'→3')UUGCCUGGUAAGGA] in pre-mRNA for the human androgen receptor, [(5'→3')UUUUUGCGUAAGUA] in pre-mRNA for human SCN9A, [(5' →3')UAAGUAGGAUAAGU] in pre-mRNA for human HIF-1α, [(5'→3')AUCCCAGGGUAACA] in pre-mRNA for human SNAP25, [(5'→3')UGUUUAGGUACU] in pre-mRNA for SCN9A human or [(5'→3')UGUACAGAUUGUCU] in pre-mRNA for human tyrosinase.

In some embodiments, a compound of formula I has the ability to have at least a 10-mer complementary overlap with a target splice site in the target pre-mRNA, wherein the target splice site sequence does not include [(5'→3')UUGCCUGGUAAGGA] in the pre -mRNA for human androgen receptor, [(5'→3')UUUUUGCGUAAGUA] in pre-mRNA for human SCN9A, [(5'→3')UAAGUAGGAUAAGU] in pre-mRNA for human HIF-1α, [(5'→ 3')AUCCCAGGGUAACA] in pre-mRNA for human SNAP25, [(5'→3')UGUUUAGGUACACU] in pre-mRNA for human SCN9A, or [(5'→3')UGUACAGAUUGUCU] in pre-mRNA for human tyrosinase.

The compound of formula I effectively induces target pre-mRNA target exon skipping, produces mRNA splicing variant(s) lacking the target exon, and is therefore useful for modulating the functional activity of the gene from which the target pre-mRNA is transcribed. .

DESCRIPTION OF THE INVENTION

The present invention provides a peptido-nucleic acid derivative represented by formula I, or a pharmaceutically acceptable salt thereof:

where

n is an integer between 10 and 25;

the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in the target pre-mRNA;

the compound of formula I is fully complementary to the target pre-mRNA sequence or partially complementary to the target pre-mRNA sequence with one or two mismatches;

radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n independently represent deuterido [D], hydrido [H], substituted or unsubstituted alkyl or substituted or unsubstituted aryl;

the radicals X and Y are independently hydrido, formyl [HC(=O)-], aminocarbonyl [NH ₂ -C(=O)-], aminothiocarbonyl [NH ₂ -C(=S)-], substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkylacyl, substituted or unsubstituted arylacyl, substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted aryloxycarbonyl, substituted or unsubstituted alkylaminocarbonyl, substituted or unsubstituted arylaminocarbonyl, substituted or unsubstituted alkylaminothiocarbonyl, substituted or unsubstituted arylaminothiocarbonyl, substituted or unsubstituted arylaminothiocarbonyl, alkylthiocarbonyl, substituted or unsubstituted arylaminothiocarbonyl, substituted or unsubstituted aryloxythiocarbonyl, substituted or unsubstituted alkylsulfonyl, substituted or unsubstituted arylsulfonyl, substituted or unsubstituted alkylphosphonyl, or substituted or unsubstituted arylphosphonyl;

radical Z is hydrido, hydroxy, substituted or unsubstituted alkyloxy, substituted or unsubstituted aryloxy, unsubstituted amino [-NH ₂ ], substituted or unsubstituted alkylamino, substituted or unsubstituted arylamino, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl;

_{B 1} , _{B 2} . and

at least _four of _{B 1} , B ₂ , .

In some embodiments, a compound of formula I has the ability to have at least a 10-mer complementary overlap with a 14-mer target splicing site sequence that consists of a 7-mer from an intron and a 7-mer from an exon, in the target pre-mRNA, wherein the sequence of the target splicing site is not [(5'→3')UUGCCUGGUAAGGA] in pre-mRNA for the human androgen receptor, [(5'→3')UUUUUGCGUAAGUA] in pre-mRNA for human SCN9A, [(5' →3')UAAGUAGGAUAAGU] in pre-mRNA for human HIF-1α, [(5'→3')AUCCCAGGGUAACA] in pre-mRNA for human SNAP25, [(5'→3')UGUUUAGGUACU] in pre-mRNA for SCN9A human or [(5'→3')UGUACAGAUUGUCU] in pre-mRNA for human tyrosinase.

In some embodiments, a compound of formula I has the ability to have at least a 10-mer complementary overlap with a target splice site in the target pre-mRNA, wherein the target splice site sequence does not include [(5'→3')UUGCCUGGUAAGGA] in the pre -mRNA for human androgen receptor, [(5'→3')UUUUUGCGUAAGUA] in pre-mRNA for human SCN9A, [(5'→3')UAAGUAGGAUAAGU] in pre-mRNA for human HIF-1α, [(5'→ 3')AUCCCAGGGUAACA] in pre-mRNA for human SNAP25, [(5'→3')UGUUUAGGUACACU] in pre-mRNA for human SCN9A, or [(5'→3')UGUACAGAUUGUCU] in pre-mRNA for human tyrosinase.

The compound of formula I effectively induces target pre-mRNA target exon skipping, produces mRNA splicing variant(s) lacking the target exon, and is therefore useful for modulating the functional activity of the gene from which the target pre-mRNA is transcribed. .

The convention adopted to describe a compound of formula I that "n" is an integer between 10 and 25" literally means that "n" is an integer selected from 11, 12, 13, 14, 15, 16, 17, 18 , 19, 20, 21, 22, 23 and 24".

It has been estimated that there will be 26,564 genes in the entire human genome [ In Silico Biol. vol 4, 387-393 ( 2004 )]. Considering that on average there are approximately 8.8 exons and 7.8 introns in each gene, 368122 splicing sites are possible in the human genome [{(8.2×2) - 2} x 25564=368122]. Since there are 1048576 (ie 4 ¹⁰ ) possible sequences for a 10-mer pre-mRNA, even 10-mer PNA derivatives will show a sufficient level of specificity for the target splicing site. However, the 5' end and 3' end of each intron are highly conserved to have a sequence starting with [(5'→3')│GU-] and a sequence ending with [(5'→3')-AG│] , respectively, where "│" denotes the junction of intron-exon or exon-intron. Therefore, a compound of formula I with an oligomer length of 11 measures or more (ie, n is an integer greater than 10) is predicted to exhibit a sufficient level of specificity for the target splicing site.

A compound of formula I binds strongly to a complementary nucleic acid as shown in the prior art [PCT/KR2009/001256]. For example, incorporation of 4 to 5 modified (ie, non-natural or non-natural) nucleotide bases into the 11-13-mer PNA derivatives of Formula I easily results in an increase in _Tm when duplexed with complementary DNA by 20 ^° C or more. The compound of the present invention has a strong affinity for complementary RNA as well as for complementary DNA. Thus, it is preferred that the compound of this invention be as short as possible to avoid off-target effects resulting from the binding of said compound to other pre-mRNA sequences with few mismatches (base mismatches). Thus, the length of the oligomer of said compound is limited to less than 25-mer.

The compound of formula I is very sensitive to a single base mismatch as shown in the prior art [PCT/KR2009/001256]. For example, a single base mismatch resulted in a decrease in T _m by 11-22 ^ο C, depending on the type of modified base, as well as the PNA sequence. However, due to its strong RNA affinity, the compound of this invention still binds strongly to the target splicing site sequence having one or two mismatches and effectively induces target exon skipping.

The compound of formula I binds tightly to either the 3' splice site or the 5' splice site in the target pre-mRNA, depending on its sequence.

When a compound binds to a 3' splice site, said compound has the ability to have at least a 10-mer complementary overlap with a 14-mer sequence at the 3' target splice site, consisting of a 7-mer from the target intron and 7-mer from the target exon. Thus, the 3' splicing site is uniquely defined as the junction between the 3' end of the target intron and the 5' end of the target exon.

When a compound binds to a 5' splicing site, said compound has the ability to have at least a 10-mer complementary overlap with a 14-mer sequence at the 5'-target splice site consisting of a 7-mer from the target exon and 7-mer from the target intron. Thus, the 5' splicing site is uniquely defined as the junction between the 3' end of the target exon and the 5' end of the target intron.

The 14-mer sequence describing a compound of Formula I targeting the 3' splicing site is illustrated by the 3' splicing site spanning the junction of intron 1 and exon 2 in human HIF-1α (hypoxia-inducible factor 1α) pre-mRNA read from the human HIF1A gene [NCBI reference sequence: NG_029606.1]. The 40-mer sequence of the 3' splicing site, consisting of the 20-mer from intron 1 and the 20-mer from exon 2, reads [(5'→3') uucuuguuguuguuaaguag│GAUAAGUUCUGAACGUCGAA], in which the intron and exon sequences are designated, respectively, lowercase and uppercase letters, and the junction of intron 1 and exon 2 is indicated by "│". Thus, the 14-mer sequence of the 3' splicing site, consisting of the 7-mer from HIF-1α intron 1 and the 7-mer from HIF-1α exon 2, reads [(5'→3')uaaguag│GAUAAGU]. At this 3' splicing site, the intron and exon targets are intron 1 and exon 2 of HIF-1α, respectively.

The above 40mer pre-mRNA sequence was provided to uniquely identify the 3' splicing site of exon 2 in human HIF-1α pre-mRNA, as exon numbers often vary depending on mRNA transcripts. Throughout this invention, the target splice site of said PNA compound is uniquely identified, wherever applicable, by simultaneously indicating the target exon number and the pre-mRNA sequence containing the target splicing site.

The 14-mer sequence describing a compound of Formula I targeting the 5' splicing site is illustrated by the 5' splicing site spanning the junction of exon 2 and intron 2 in human HIF-1α pre-mRNA. The 40-mer sequence of the 5' splicing site, consisting of the 20-mer from exon 2 and the 20-mer from intron 2, reads [(5'→3') GAGGAAACUUCUGGAUGCUG│gugaguuauuuuuacacagggu], in which the exon and intron sequences are denoted by uppercase and lowercase letters, respectively, and the junction of exon 2 and intron 2 is indicated by "│". Thus, the 14-mer sequence of the 5' splicing site, consisting of the 7-mer from HIF-1α exon 2 and the 7-mer from HIF-1α intron 2, reads [(5'→3')GAUGCUG│gugaguu]. At this 5' splicing site, the exon and intron targets are exon 2 and intron 2 of HIF-1α, respectively.

The compound of formula I binds tightly to the target splice site in the target pre-mRNA and prevents the formation of a "splice early complex" comprising the splice target site of the compound. Said compound binds tightly to either the 3' splice site or the 5' splice site in the target pre-mRNA, depending on the nucleotide sequence of said compound. Since the compound of this invention sterically inhibits the formation of the "splicesome early complex", the target exon is spliced to produce mRNA splicing variant(s) lacking the target exon. Therefore, the compound of the present invention effectively induces target exon skipping.

The chemical structures of natural (ie, naturally occurring) or non-natural (ie, not naturally occurring) nucleotide bases adopted to describe the PNA derivative of Formula I are exemplified in FIG. Natural or non-natural nucleotide bases of this invention include, but are not limited to, the nucleotide bases shown in FIG. 7. The provision of such natural or non-natural nucleotide bases is illustrative of the variety of acceptable nucleotide bases and should therefore not be interpreted as limiting the scope of the present invention to the nucleotide bases shown in FIG. 7. A person skilled in the art can readily determine the natural nucleotide base complementary to each of the non-natural nucleotide bases exemplified in FIG. 7. Therefore, a person skilled in the art can unambiguously determine the complementarity between a compound of formula I and a target mRNA sequence.

The substituents adopted to describe the PNA derivative of formula I are exemplified in FIGS. 8A-8E. In FIG. 8A shows examples of substituted or unsubstituted alkyl radicals. Substituted or unsubstituted alkyl acyl and substituted or unsubstituted arylacyl radicals are exemplified in FIGS. 8B. Fig. 8C illustrates examples of the following radicals: substituted alkylamino, substituted arylamino, substituted or unsubstituted aryl, substituted or unsubstituted alkylsulfonyl, substituted or unsubstituted arylsulfonyl, substituted or unsubstituted alkylphosphonyl, and substituted or unsubstituted arylphosphonyl. In FIG. 8D provides examples of the following radicals: substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted aryloxycarbonyl, substituted or unsubstituted alkylaminocarbonyl, and substituted or unsubstituted arylaminocarbonyl. In FIG. 8E provides examples of the following radicals: substituted or unsubstituted alkyloxythiocarbonyl, substituted or unsubstituted alkylaminothiocarbonyl, substituted or unsubstituted arylaminothiocarbonyl, substituted or unsubstituted alkyloxythiocarbonyl, and substituted or unsubstituted aryloxythiocarbonyl. The provision of such exemplary substituents is intended to illustrate the variety of allowable substituents and, therefore, should not be interpreted as limiting the scope of the present invention to the substituents exemplified in FIGS. 8A-8E. Since one of ordinary skill in the art can readily appreciate that the oligonucleotide sequence is the determining factor for the sequence-specific binding of the oligonucleotide to the pre-mRNA target sequence as compared to substituents at the N-terminus or C-terminus, there is more variety of substituents allowed for the specified compounds of this invention than those substituents exemplified in FIG. 8A-8E.

The compound of formula I has good cell permeability and can be easily delivered into the cell as a "naked" (i.e. without the addition of adjuvant(s) to increase delivery to the cell) oligonucleotide, as shown in the prior art [PCT/KR2009/001256 ]. Thus, the compound of this invention effectively induces target exon skipping in the target pre-mRNA to produce mRNA splicing variant(s) lacking the target exon in cells treated with a naked oligonucleotide compound of Formula I.

The compound of formula I does not require any means or compositions to be delivered to the cell in order to effectively induce target exon skipping in cells. In this respect, the compound of the present invention differs greatly from other classes of oligonucleotides including DNA, RNA, PTO, 2'-OMe-PTO, 2'-OMe-RNA, 2'-OMOE-RNA, LNA, PMO, PNA, etc. .

Given the strong affinity for RNA and good cell permeability, the compound of formula I readily induces target exon skipping in cells with subfemtomolar antisense activity. To date, subfemtomolar antisense exon skipping activity has never been described or realized with other classes of oligonucleotides, including DNA, RNA, PTO, 2'-OMe-PTO, 2'-OMe-RNA, 2'-OMOE-RNA, LNA, PMO , PNK, etc. Even subnanomolar antisense exon skipping activity has rarely been documented with other classes of oligonucleotides. Subnanomolar antisense exon skipping activity has been described with ASO PNAs engineered to have varying numbers of phosphonate groups covalently conjugated to the N-terminus of the PNA sequence to facilitate lipofection for transfection into the cell [ Nucl. Acids Res. vol 30(13), 4424-4432 ( 2008 )]. As stated earlier in this document, in vitro antisense exon skipping activity is nanomolar or micromolar even under conditions of forced cell delivery such as lipofection, electroporation, etc. In this regard, the compound of formula I clearly differs from other classes of oligonucleotides, including DNA, RNA, PTO, 2'-OMe-PTO, 2'-OMe-RNA, 2'-OMOE-RNA, LNA, PMO, PNA, etc. .

In order for an oligonucleotide molecule to bind to its complementary sequence in the pre-mRNA, the molecule must be stretched or unfolded for complementary binding to the target pre-mRNA sequence. Oligonucleotide molecules tend to aggregate or remain folded (eg like a hairpin) due to their high propensity to form intermolecular or intramolecular hydrogen bonds between nucleotide bases. Thus, there will be an additional energetic barrier to unfolding against antisense exon skipping with widely studied oligonucleotides including DNA, RNA, PTO, 2'-OMe-PTO, 2'-OMe-RNA, 2'-OMOE-RNA, LNA, PMO , PNK, etc. Oligonucleotides are usually quantified by UV absorption after incubation at >90 ^° C in aqueous buffer to maximize the oligonucleotide molecules.

The PNA derivative of formula I has group positive charges distributed throughout the oligonucleotide chain at physiological pH due to several basic amino groups covalently linked to the modified nucleotide bases in it. Group positive charges allow the compound of formula I to remain unfolded or stretched due to electrostatic repulsion between adjacent positive charges on the same oligonucleotide strand. A formula I derivative has little tendency to aggregate with other formula I molecule(s). Thus, a formula I compound typically remains structurally ready (i.e. stretched) for complementary binding to a target sequence in the target pre-mRNA . Structural readiness is also important for the rapid alignment of the Formula I oligonucleotide with the target pre-mRNA sequence as the target pre-mRNA is transcribed from DNA. Thus, structural readiness coupled with strong affinity is believed to translate into strong affinity to produce sub-femtomolar exon-skipping antisense activity of a compound of formula I. In this respect, a compound of formula I is very different from other classes of oligonucleotides, including DNA, RNA, PTO, 2' -OMe-PTO, 2'-OMe-RNA, 2'-OMOE-RNA, LNA, PMO, PNA, etc.

Due to its good cell permeability, the PNA derivative of formula I can be administered systemically as a "naked" oligonucleotide to effectively induce exon skipping in the target tissue(s). The compound of formula I does not require a composition or adjuvant to increase delivery to the target tissue to elicit the desired therapeutic activity. The compound of formula I is dissolved simply in PBS (phosphate buffered saline) or saline and administered systemically to effortlessly elicit therapeutic activity in the target tissue(s).

Given the sub-femtomolar exon-skip activity in cells treated as a "naked" oligonucleotide, the PNA derivative of the present invention exhibits therapeutic activity in vivo, often at a systemic dose of 1 μg/kg or less. Such strong therapeutic activity has never been obtained with other classes of oligonucleotides including DNA, RNA, PTO, 2'-OMe-PTO, 2'-OMe-RNA, 2'-OMOE-RNA, LNA, PMO, PNA, etc. . Since the cost of producing an oligonucleotide is generally very high, ultra-high activity is a great advantage for realizing a moderate cost of treatment, especially for patients with chronic disease. In this respect, the compound of formula I is very different from other classes of oligonucleotides, including DNA, RNA, PTO, 2'-OMe-PTO, 2'-OMOE-RNA, LNA, PMO, PNA, etc.

Due to good cell permeability, the PNA derivative of the present invention is easily delivered topically or transdermally to induce therapeutic activity at the injection site. The compound of this invention does not need a strong or invasive composition to produce the intended local therapeutic activity. The PNA derivative of Formula I is easily delivered transdermally as a naked oligonucleotide. Due to its superstrong exon-passing activity, said compound exhibits therapeutic activity when administered topically or transdermally with a sub-picomolar solution of oligonucleotides. Topical or transdermal delivery as a naked oligonucleotide has been extremely challenging for other classes of oligonucleotides including DNA, RNA, PTO, 2'-OMe-PTO, 2'-OMe-RNA, 2'-OMOE-RNA, LNA, PMO , PNK, etc. In this regard, the compound of formula I clearly differs from other classes of oligonucleotides, including DNA, RNA, PTO, 2'-OMe-PTO, 2'-OMe-RNA, 2'-OMOE-RNA, LNA, PMO, PNA, etc. .

The compound of Formula I may be used in combination with a pharmaceutically acceptable acid or base, including but not limited to sodium hydroxide, potassium hydroxide, hydrochloric acid, methanesulfonic acid, citric acid, trifluoroacetic acid, and the like.

The PNA derivative of formula I, or a pharmaceutically acceptable salt thereof, may be administered to a subject in combination with a pharmaceutically acceptable adjuvant, including, but not limited to, citric acid, hydrochloric acid, tartaric acid, stearic acid, polyethylene glycol, polypropylene glycol, ethanol, isopropanol, sodium bicarbonate, distilled water, preservative(s), etc.

The compound of the present invention may be systemically administered to a subject at a therapeutically effective dose in the range of 1 fmol/kg to more than 1 nmol/kg, which may vary depending on the dosing regimen, conditions or situations of the subject, etc. The compound of the present invention may be topically administered to a subject at a therapeutically effective concentration ranging from 1 aM to greater than 1 nM, which may vary depending on the dosing regimen, conditions or situations of the subject, etc.

Preferred is a PNA derivative of formula I or a pharmaceutically acceptable salt thereof:

where

n is an integer between 10 and 25;

the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in the target pre-mRNA;

the compound of formula I is fully complementary to the target pre-mRNA sequence or partially complementary to the target pre-mRNA sequence with one or two mismatches;

radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n independently represent deuterido, hydrido, substituted or unsubstituted alkyl or substituted or unsubstituted aryl;

radicals X and Y are independently hydrido, formyl, aminocarbonyl, aminothiocarbonyl, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkylacyl, substituted or unsubstituted arylacyl, substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted aryloxycarbonyl, substituted or unsubstituted alkylaminocarbonyl, substituted or unsubstituted arylaminocarbonyl, substituted or unsubstituted alkylaminothiocarbonyl, substituted or unsubstituted arylaminothiocarbonyl, substituted or unsubstituted alkyloxythiocarbonyl, substituted or unsubstituted aryloxythiocarbonyl, substituted or unsubstituted alkylsulfonyl, substituted or unsubstituted arylsulfonyl, substituted or unsubstituted alkylphosphonyl, or substituted or unsubstituted alkylphosphonyl;

the Z radical is hydrido, hydroxy, substituted or unsubstituted alkyloxy, substituted or unsubstituted aryloxy, unsubstituted amino, substituted or unsubstituted alkylamino, substituted or unsubstituted arylamino, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl;

_{B 1} , _{B 2} .

at least four of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV:

where

the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are independently selected from hydrido and substituted or unsubstituted alkyl;

L ₁ , L ₂ and L ₃ are a covalent linker represented by formula V, covalently linking a basic amino group to a fragment of a nucleotide base:

where

Q ₁ and Q _m are substituted or unsubstituted methylene (-CH ₂ -) radical, and Q _m is directly linked to the basic amino group;

Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from a substituted or unsubstituted methylene radical, an oxygen radical (-O-), a sulfur radical (-S-) and a substituted or unsubstituted amino radical [-N(H)- or - N(substituent)-]; and

m is an integer between 1 and 15.

Non-natural nucleotide bases of formula II, formula III and formula IV are equivalent to cytosine, adenine and guanine, respectively, for complementary base pairing with pre-mRNA, as shown in the prior art [PCT/KR2009/001256].

The convention adopted to describe a compound of formula I that "m" is an integer between 1 and 15" literally means that "m" is an integer selected from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14".

Of interest is a PNA oligomer of formula I, or a pharmaceutically acceptable salt thereof:

where

n is an integer between 11 and 23;

the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in the target pre-mRNA;

the compound of formula I is fully complementary to the target pre-mRNA sequence or partially complementary to the target pre-mRNA sequence with one or two mismatches;

the radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are independently hydrido;

radicals X and Y are independently hydrido, aminocarbonyl, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkylacyl, substituted or unsubstituted arylacyl, substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted alkylaminocarbonyl, or substituted or unsubstituted arylsulfonyl;

the radical Z is an unsubstituted amino or a substituted or unsubstituted alkylamino;

_{B 1} , _{B 2} .

at least four of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV;

the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are independently selected from hydrido and substituted or unsubstituted alkyl;

Q ₁ and Q _m are a substituted or unsubstituted methylene radical, and Q _m is directly linked to the basic amino group;

Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from a substituted or unsubstituted methylene radical, an oxygen radical and an amino radical; and

m is an integer between 1 and 11.

Of particular interest is a PNA derivative of formula I or a pharmaceutically acceptable salt thereof:

where

n is an integer between 11 and 21;

the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in the target pre-mRNA;

the compound of formula I is fully complementary to the target pre-mRNA sequence or partially complementary to the target pre-mRNA sequence with one or two mismatches;

the radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are independently hydrido;

the radicals X and Y are independently hydrido, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkylacyl, substituted or unsubstituted arylacyl, substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted alkylaminocarbonyl, or substituted or unsubstituted arylsulfonyl;

the radical Z is an unsubstituted amino or a substituted or unsubstituted alkylamino;

_{B 1} , _{B 2} .

at least four of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV;

the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are independently selected from hydrido and substituted or unsubstituted alkyl;

Q ₁ and Q _m are a methylene radical, and Q _m is directly linked to the basic amino group;

Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from methylene radical, oxygen radical and amino radical; and

m is an integer between 1 and 11.

Of great interest is the PNA oligomer of formula I or a pharmaceutically acceptable salt thereof:

where

n is an integer between 11 and 19;

the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in the target pre-mRNA;

the compound of formula I is fully complementary to the target pre-mRNA sequence;

radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are hydrido;

the radicals X and Y are independently hydrido, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted alkylacyl, substituted or unsubstituted arylacyl, substituted or unsubstituted alkyloxycarbonyl, substituted or unsubstituted alkylaminocarbonyl, or substituted or unsubstituted arylsulfonyl;

the radical Z is an unsubstituted amino or a substituted or unsubstituted alkylamino;

_{B 1} , _{B 2} .

at least four of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV;

the radicals R ₁ , R ₃ and R ₅ are hydrido, and the radicals R ₂ , R ₄ and R ₆ are independently selected from hydrido and substituted or unsubstituted alkyl;

Q ₁ and Q _m are a methylene radical, and Q _m is directly linked to the basic amino group;

Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from a methylene radical and an oxygen radical; and

m is an integer between 1 and 9.

Of great interest is a PNA derivative of formula I or a pharmaceutically acceptable salt thereof:

where

n is an integer between 12 and 19;

the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in the target pre-mRNA;

the compound of formula I is fully complementary to the target pre-mRNA sequence;

radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are hydrido;

radicals X and Y are independently substituted or unsubstituted alkylacyl, substituted or unsubstituted arylacyl, or substituted or unsubstituted alkyloxycarbonyl;

the radical Z is an unsubstituted amino or a substituted or unsubstituted alkylamino;

B ₁ , B ₂ , ..., B _n-1 and B _n independently selected from adenine, thymine, guanine, cytosine and non-natural nucleotide bases;

at least five of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV;

the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are hydrido;

Q ₁ and Q _m are a methylene radical, and Q _m is directly linked to the basic amino group;

Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from a methylene radical and an oxygen radical; and

m is an integer between 1 and 9.

Of particular interest is the PNA derivative of formula I or a pharmaceutically acceptable salt thereof:

where

n is an integer between 12 and 18;

the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in the target pre-mRNA;

the compound of formula I is fully complementary to the target pre-mRNA sequence;

radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are hydrido;

radical X is hydrido;

the radical Y is a substituted or unsubstituted alkylacyl, a substituted or unsubstituted arylacyl, or a substituted or unsubstituted alkyloxycarbonyl;

the radical Z is an unsubstituted amino or a substituted or unsubstituted alkylamino;

B ₁ , B ₂ , ..., B _n-1 and B _n independently selected from adenine, thymine, guanine, cytosine and non-natural nucleotide bases;

at least five of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV;

the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are hydrido;

L ₁ is -(CH ₂ ) ₂ -O-(CH ₂ ) ₂ -, -CH ₂ -O-(CH ₂ ) ₂ -, -CH ₂ -O-(CH ₂ ) ₃ -, -CH ₂ - O-(CH ₂ ) ₄ -, -CH ₂ -O-(CH ₂ ) ₅ -, -CH ₂ -O-(CH ₂ ) ₆ - or -CH ₂ -O-(CH ₂ ) ₇ -, while the right end is directly connected to the basic amino group; and

L ₂ and L ₃ are independently selected from -(CH ₂ ) ₂ -, -(CH ₂ ) ₃ -, -(CH ₂ ) ₄ -, -(CH ₂ ) ₅ -, -(CH ₂ ) ₆ -, -( CH ₂ ) ₇ -, -(CH ₂ ) ₈ -, -(CH ₂ ) ₂ -O-(CH ₂ ) ₂ -, -(CH ₂ ) ₃ -O-(CH ₂ ) ₂ - and -(CH ₂ ) ₂ -O-(CH ₂ ) ₃ -, while the right end is directly connected to the main amino group.

Compounds of formula I may be abbreviated as described in the prior art [PCT/KR2009/001256; EP2268607; US8680253]. The following are examples of such abbreviations used to describe PNA derivatives of Formula I targeting the 3' splicing site spanning the junction of intron 1 and exon 2 in human HIF-1α pre-mRNA read from the HIF1A gene (NCBI reference sequence: NG_029606. one):

(N→C) Fethoc-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-NH ₂ ;

(N→C)Fmoc-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-NH ₂ ;

(N→C)H-CA(5)G-AA(5)C-TTA(5)-TCC(1O3)-TA(5)-NH ₂ ;

(N→C)Ac-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-NH ₂ ;

(N→C)Piv-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-NH ₂ ;

(N→C) Benzoyl-CA(5)G(2O3)-AA(5)C-TTA(4)-TCC(1O2)-TA(5)-NH ₂ ;

(N→C)n-propyl-CA(5)G-AA(5)C-TTA(5)-TCC(2O2)-TA(5)-NH ₂ ;

(N→C)Benzyl-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-NH ₂ ;

(N→C)p-toluenesulfonyl-CA(5)G-AA(5)C-TTA(2O2)-TCC(1O2)-TA(5)-NH ₂ ;

(N→C)[N-(2-phenylethyl)amino]carbonyl-CA(5)G(3)-AA(5)C-TTA(3)-TCC(1O2)-TA(5)-NH ₂ ;

(N→C) Fethoc-Lys-Leu-CA(5)G(2O2)-AA(5)C-TTA(8)-TCC(1O2)-TA-Lys-NH ₂ ;

(N→C)N-phenyl-N-Me-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-Lys-NH ₂ ;

(N→C)Piv-HEX-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-Lys-NH ₂ ;

(N→C)FAM-HEX-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-Lys-NH ₂ ;

(N→C)Fethoc-GA(5)AC(1O2)TT-A(5)TC-CTA(5)-C(1O2)T-NH ₂ ;

(N→C)Fethoc-Arg-GA(5)AC(1O2)TT-A(5)TC-CTA(5)-C(1O2)T-Gly-NH ₂ ;

(N→C) Fethoc-Val-GA(5)A-CTT-A(6)TC-CTA(5)-C(2O2)T-Gly-Lys-NH ₂ ;

(N→C) Fethoc-C(1O5)TT-A(6)TC-CTA(6)-C(1O2)TT-AA(6)C-NH ₂ ;

(N→C)Fmoc-Val-CTC(1O2)-A(5)TC-CTA(6)-C(1O3)TT-AA(2O2)C-NH ₂ ; and

(N→C) Fethoc-TTC(1O5)-AG(5)AA(4)CT-TA(5)T-CC(2O2)TA(6)CT-TA(6)-NH ₂ :

where,

A, G, T and C are PNA monomers with natural nucleotide base: adenine, guanine, thymine and cytosine, respectively;

C(pOq), A(p), A(pOq), G(p) and G(pOq) are non-natural nucleotide base PNA monomers represented by formula VI, formula VII, formula VIII, formula IX and formula X, respectively :

where

p and q are integers; and

abbreviations for N- and C-terminal substituents are specifically defined as follows: "Fmoc-" is an abbreviation for "[(9-fluorenyl)methyloxy]carbonyl-";"Fethoc-" for "[2-(9-fluorenyl)ethyl-1-oxy]carbonyl";"Ac-" for "acetyl-";"Benzoyl-" for "benzenecarbonyl-";"Piv-" for "pivalil-";"n-propyl-" for "1-(n-propyl)-";"H-" for "hydrido-"group;"p-toluenesulfonyl" for "(4-methylbenzene)-1-sulfonyl-";"-Lys-" for the amino acid residue "lysine";"-Val-" for the amino acid residue "valine";"-Leu-" for the amino acid residue "leucine";"-Arg-" for the amino acid residue "arginine";"-Gly-" for the amino acid residue "glycine";"[N-(2-phenylethyl)amino]carbonyl-" for "[N-1-(2-phenylethyl)amino]carbonyl-";"Benzyl-" for "1-(phenyl)methyl-";"Phenyl-" for "phenyl-";"Me-" for "methyl-";"-HEX-" for "6-amino-1-hexanoyl-";"FAM-" for "5 or 6-fluorescein-carbonyl-(isomer mixture)"; and "-NH ₂ " for an unsubstituted "-amino" group.

In FIG. 9 collectively shows the chemical structures of PNA monomers, abbreviated as A, G, T, C, C(pOq), A(p), A(pOq), G(p), and G(pOq). As discussed in the prior art [PCT/KR2009/001256], C(pOq) is regarded as a modified PNA monomer equivalent to "cytosine" due to its preferred hybridization with "guanine". A(p) and A(pOq) are taken to be modified PNA monomers acting like "adenine" due to their strong affinity for "thymine". Also, G(p) and G(pOq) are considered to be modified PNA monomers equivalent to "guanine" due to their productive base pairing with "cytosine".

In FIG. 10 uniquely represents the chemical structures for a number of substituent abbreviations used to diversify the N-terminus or C-terminus of the PNA derivative of formula I in this invention. The provision of N-terminal or C-terminal groups in FIG. 10 by way of example is intended to illustrate the variety of allowable substituents for the N-terminus or C-terminus of a PNA derivative of formula I and therefore should not be interpreted as limiting the scope of N-terminal or C-terminal groups for the compound of this invention. One skilled in the art can readily appreciate that an oligonucleotide sequence is a major contributor to the sequence-specific interaction with the target pre-mRNA sequence.

To illustrate the abbreviations adopted for such PNA derivatives, the chemical structure of the 14-mer PNA derivative, abbreviated as "(N→C)Fethoc-GA(5)AC(1O2)TT-A(5)TC-CTA(5) -C(1O2)T-NH ₂ ”, is shown in Fig. eleven.

As another illustration, the chemical structure of the 15-mer PNA derivative, abbreviated as ((N→C)Fmoc-Val-CTC(1O2)-A(5)TC-CTA(6)-C(1O3)TT-AA (2O2)C-NH ₂ ”, is shown in Fig. 12.

The compound of Formula I must meet the requirement of having "at least a 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in the pre-mRNA" target. If a compound of formula I is targeted, for example, at the 3' splicing site spanning the junction of intron 1 and exon 2 in human HIF-1α pre-mRNA, the 3' splicing site is uniquely determined by the 30-mer HIF pre-mRNA sequence. -1α human [(5'→3')guuguuguuaaguag│GAUAAGUUCUGAACG]. The 14-mer sequence of the HIF-1α splicing target 3' site then reads [(5'→3')uaaguag│GAUAAGU].

15-mer HIF-1α-specific ASO with the sequence "(N→C)Fethoc-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)C-NH ₂ " is equivalent to the DNA sequence "(5'→3')CAG-AAC-TTA-TCC-TAC" for complementary binding to human HIF-1α pre-mRNA. The 15-mer ASO is capable of 15-mer complementary overlap (i.e., is fully complementary) with a 3' splicing site spanning the junction of intron 1 and exon 2 in the pre-mRNA for HIF-1α, as noted "in bold ” and “underline” in the 30-mer pre-mRNA sequence [(5'→3')guuguuguuaa guag │ GAUAAGUUCUG AACG]. The ASO PNA has the ability to 11-mer complementary overlap (i.e. 4-mers from intron 1 and 7-mers from exon 2) with the 14-mer pre-mRNA sequence for HIF-1α [(5'→3')uaaguag │GAUAAGU]. Thus, the 15-mer HIF-1α-specific PNA ASO complementary overlap conditions required for a compound of Formula I.

Another 15mer HIF-1α-specific ASO with the sequence "(N→C)Fethoc-CTC(1O2)-A(6)TC-CTA(6)-C(1O2)TT-AA(6)C-NH ₂ ' is equivalent to the DNA sequence "(5'→3')CTC-ATC-CTA-CTT-AAC" for complementary binding to pre-mRNA for HIF-1α. The 15mer ASO PNA has a single mismatch with the 3' splicing site spanning the junction of intron 1 and exon 2, as indicated by "bold" and "underline" in the 30mer pre-mRNA sequence for HIF-1α [(5'→3')guuguu guuaaguag │ GAU "A" AG UUCUGAACG], in which one inconsistency is marked with a quotation mark (""). The 15-mer PNA has the ability to 12-mer complementary overlap with the 14-mer 3' splicing site sequence adopted to describe the compound of formula I, as indicated by "bold" and "underline" in [(5'→3') uaaguag │ GAU "A" AG U], in which one inconsistency is marked with a quotation mark (""). Despite one discrepancy, 15mer HIF-1α-ASO satisfies the complementary overlap conditions required for a compound of Formula I.

When a compound of formula I is targeted, for example, at the 5' splicing site spanning the junction of exon 4 and intron 4 in human SCN9A pre-mRNA, the 5' splicing site is uniquely identified by the 30-mer SCN9A pre-mRNA sequence. [(5'→3')CGUCAUUGUUUUUGC│guaaguacuuucagc] read from the human SCN9A gene (accessed from NCBI reference sequence: NC_000002.12). The 14-mer sequence of the 5' splicing site of the SCN9A target then reads [(5'→3')UUUUUGC│guaagua].

16-mer SCN9A-specific ASO with the sequence "(N→C)Fethoc-AC(1O2)T-TA(5)CG(6)CA-A(5)AA(5)-AC(1O2)AA(5) -NH ₂ 'is equivalent to the DNA sequence '(5'→3')ACT-TAC-GCA-AAA-ACA-A' for complementary binding to human SCN9A pre-mRNA. The 16-mer PNA has 16-mer complementary overlap capability (i.e., is fully complementary) with a 5' splicing site spanning the junction of exon 4 and intron 4 in the pre-mRNA for human SCN9A, as noted in bold and “underlining” in the 30mer pre-mRNA sequence for SCN9A [(5'→3')CGUCAUUG UUUUUGC │ guaagu acuuucagc]. The 16-mer SCN9A-ASO has a 13-mer complementary overlap capability with the 14-mer 5' splicing site sequence, as indicated by "bold" and "underline" in [(5'→3') UUUUUGC │ guaagu a]. 16-mer SCN9A-ASO complementary overlap conditions required for compound of formula I.

DETAILED DESCRIPTION OF THE PRESENT INVENTION

General procedures for obtaining PNA oligomers

PNA oligomers were synthesized using solid phase peptide synthesis (SPPS) based on Fmoc chemistry in accordance with the method described in the prior art [US patent 6133444; WO 96/40685] or with minor modifications. The solid carrier used in this invention was H-Rink Amide-ChemMatrix purchased from PCAS BioMatrix Inc. (Quebec, Canada). Nucleotide base-modified Fmoc-PNA monomers were synthesized as described in the prior art [PCT/KR 2009/001256] or with minor modifications.

The chemical structures of the base-modified Fmoc-PNA monomers used in this invention are shown in FIG. 13. The Fmoc-PNA monomers shown in FIG. 13 are to be taken as examples and therefore should not be taken to limit the scope of the present invention. A person skilled in the art can easily understand that, for example, for such Fmoc-PNA monomers used for the synthesis of a PNA derivative of formula I, a large number of options for protecting groups are possible.

PNA oligomers were purified by C ₁₈ reverse phase HPLC (water/acetonitrile or water/methanol with 0.1% TFA) and characterized by mass spectrometry (MS) including MALDI-TOF/MS and ESI -TOF/MS.

In FIG. 14 shows a typical monomer extension cycle as adopted in the SPPS of this invention and details of the synthesis are given below. However, many small variations should clearly be possible for one skilled in the art to carry out such SPPS reactions in an automated peptide synthesizer or in a manual peptide synthesizer. The corresponding SPPS reaction steps are provided below as exemplary reaction procedures.

[Activation of H-Rink-ChemMatrix Resin] 0.01 mmol (approximately 20 mg of resin) of ChemMatrix resin in 1.5 ml of 20% piperidine/dimethylformamide (DMF) was shaken in a Libta Tube® for 20 minutes, and the reaction solution was filtered. The resin was washed for 30 sec, sequentially, each time using 1.5 ml of methylene chloride (MC), 1.5 ml of DMF, 1.5 ml of MS, 1.5 ml of DMF and 1.5 ml of MS. The resulting free amino groups on the solid support were coupled with either the Fmoc-PNA monomer or the Fmoc-protected amino acid derivative.

[DeFmoc] The resin was shaken in 1.5 ml of 20% piperidine/DMF for 7 minutes and the DeFmoc solution was filtered. The resin was washed for 30 seconds, successively, each time using 1.5 ml of MC, 1.5 ml of DMF, 1.5 ml of MC, 1.5 ml of DMF and 1.5 ml of MC. The resulting free amino groups on the solid support were immediately coupled to the Fmoc-PNA monomer.

[Coupling with Fmoc-PNA Monomer] The free amino groups on the solid support were coupled with the Fmoc-PNA monomer as follows. 0.04 mmol Fmoc-PNA monomer, 0.05 mmol HBTU [2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate] and 10 mmol DIEA (N,N-diisopropylethylamine) were incubated for 2 min in 1 ml anhydrous DMF and added to the resin with free amino groups. The resin solution was shaken for 1 hour and the reaction medium was filtered. The resin was then washed for 30 seconds, successively, each time using 1.5 ml of MC, 1.5 ml of DMF and 1.5 ml of MC.

[Capping] After the coupling reaction, the unreacted free amino groups were shaken capped for 5 minutes in 1.5 ml capping solution (5% acetic anhydride and 6% 2,6-leutidine in DMF). Then the capping solution was filtered and the resin was washed for 30 sec, successively, each time using 1.5 ml of MC, 1.5 ml of DMF and 1.5 ml of MC.

[Introduction of "Fethoc-radical" at N-terminus] "Fethoc-radical" was introduced at the N-terminus by reacting the free amino groups in the resin with "Fethoc-OSu" under conventional basic coupling conditions. Chemical structure of Fethoc-OSu [CAS No. 179337-69-0, C20H17NO5, M.m. 351.36] appears as follows.

[Resin Cleavage] The resin-bound PNA oligomers were cleaved from the resin by shaking the resin for 3 hours in 1.5 ml of a cleavage solution (2.5% triisopropylsilane and 2.5% water in trifluoroacetic acid). The resin was filtered off and the filtrate was concentrated under reduced pressure or by blowing nitrogen gas over the solution. The resulting residue was triturated with diethyl ether, and the resulting precipitate was collected by filtration for purification by reverse phase HPLC.

[Analysis and Purification by HPLC] After cleavage from the resin, the crude PNA product was purified by _C18 reverse phase HPLC eluting with water/acetonitrile or water/methanol (gradient method) containing 0.1% TFA. Fig. 15A and FIG. 15B are typical HPLC chromatograms for "HIF-ASO 1" before and after HPLC purification, respectively. The oligomeric sequence of "HIF-ASO 1" is shown in Table 1.

Examples of the synthesis of PNA derivatives of formula I

PNA derivatives were prepared according to the synthetic procedures described above with little or no modification. The PNA derivatives of this invention are designed to target a splicing site in pre-mRNA, including, but not limited to, human or mouse HIF-1α pre-mRNA, human or mouse androgen receptor (AR) pre-mRNA, pre-mRNA for Human or rat SCN9A, pre-mRNA for mouse dystrophin, pre-mRNA for human or mouse tyrosinase, pre-mRNA for human or mouse SNAP25, pre-mRNA for human IDO1, pre-mRNA for human or mouse PD-1, etc. d. The provision of such PNA derivatives targeting a splicing site in a number of pre-mRNAs is an example of PNA derivatives of Formula I and should not be interpreted as limiting the scope of the present invention to those splice target sites that are exemplified.

Table 1 lists PNA derivatives complementarily targeting the 3' splicing site spanning the junction of intron 1 and exon 2 in human HIF-1α pre-mRNA, along with structural characterization data obtained by mass spectrometry. The provision of the HIF-1α-specific ASOs in Table 1 is an example of the PNA derivatives of formula I and should not be interpreted as limiting the scope of the present invention to the PNA derivatives shown in Table 1.

Table 1. PNA derivatives complementarily targeting the 3' splicing site spanning the junction of intron 1 and exon 2 in human HIF-1α pre-mRNA, along with structural characterization data obtained by mass spectrometry.

PNK Sequence (N→C) PNA Accurate weight, m/z Theor. ^a Obs. ^b HIF-ASO 1 Fethoc-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-NH ₂ 4486.05 4486.04 HIF-ASO 2 Fethoc-GA(5)AC(1O2)TT-A(5)TC-CTA(5)-C(1O2)T-NH ₂ 4473.99 4474.02 HIF-ASO 3 Fethoc-G(5)AA(5)-CTT-A(5)TC-CTA(5)-C(1O2)T-NH ₂ 4462.03 4462.07 HIF-ASO 4 Fethoc-GA(5)AC(1O2)TT-A(5)TC-CTA(5)-CT-NH ₂ 4376.94 4376.99 HIF-ASO 5 Fethoc-G(5)AA(6)-CTT-A(6)TC-CTA(6)-C(1O2)T-NH ₂ 4504.07 4504.09 HIF-ASO 6 Fethoc-A(6)GA-A(6)CT-TA(6)T-CC(1O2)TA(6)CT-TA(6)-NH ₂ 5393.47 5393.44 HIF-ASO 7 Fethoc-C(1O5)TT-A(6)TC-CTA(6)-C(1O2)TT-AA(6)C-NH ₂ 4784.18 4784.14 HIF-ASO 8 Fethoc-CTC(1O2)-A(6)TC-CTA(6)-C(1O2)TT-AA(6)C-NH ₂ 4727.13 4727.79 HIF-ASO 9 Piv-A(6)TC-CTA(6)-C(1O2)TT-A(5)AC-NH ₂ 3695.73 3695.74 HIF-ASO 10 Piv-Lys-AA(6)C-TTA(6)-TCC(1O2)-TA(6)C-TTA(5)-Val-NH ₂ 4844.33 4844.33 HIF-ASO 11 Fethoc-A(6)GA-A(6)CT-CA(6)T-CC(1O2)TA(6)CT-TA(6)-NH ₂ 5448.54 5448.50 HIF-ASO 12 H-CA(5)G-AA(5)C-TTA(5)-T CC(1O3)-TA(5)-NH ₂ 4263.98 4263.99 HIF-ASO 13 Benzoyl-CA(5)G(2O3)-AA(5)C-TTA(4)-TCC(1O2)-TA(5)-NH ₂ 4441.06 4441.06 HIF-ASO 14 n-Propyl-CA(5)G-AA(5)C-TTA(5)-TCC(2O2)-TA(5)-NH ₂ 4306.03 4306.05 HIF-ASO 15 p-Toluenesulfonyl-CA(5)G-AA(5)C-TTA(2O2)-TCC(1O2)-TA(5)-NH ₂ 4405.95 4405.90 HIF-ASO 16 [N-(2-phenylethyl)amino]carbonyl-CA(5)G(3)-AA(5)C-TTA(3)-TCC(1O2)-TA(5)-NH ₂ 4426.06 4426.08 HIF-ASO 17 Fethoc-Lys-Leu-CA(5)G(2O2)-AA(5)C-TTA(8)-TCC(1O2)-TA(5)-Lys-NH ₂ 4984.44 4984.46 HIF-ASO 18 N-Phenyl-N-Me-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-Lys-NH ₂ 4468.11 4468.14

^a) theoretical exact mass; ^b) observed exact mass

Fig. 15A is an HPLC chromatogram with crude "HIF-ASO 1" product. The crude product was purified by C ₁₈ reverse phase preparative HPLC. Fig. 15B is an HPLC chromatogram with purified "HIF-ASO 1" product. The purity of HIF-ASO 1 increased markedly after purification by preparative HPLC. In FIG. 16 shows the ESI-TOF/MS spectrum obtained with the purified "HIF-ASO 1" product. The provision of analysis data for "HIF-ASO 1" is intended to illustrate how the PNA derivatives of formula I were purified and identified in the present invention and should not be interpreted as limiting the scope of this invention.

Table 2 shows PNA derivatives complementarily targeting the 3' splicing site spanning the junction of intron 3 and exon 4 in human HIF-1α pre-mRNA, along with structural characterization data obtained by mass spectrometry. The provision of the HIF-1α-specific ASO in Table 2 is an example of PNA derivatives of Formula I and should not be interpreted as limiting the scope of the present invention to the HIF-1α-ASOs indicated in Table 2.

Table 2. PNA derivatives complementarily targeting the 3' splicing site spanning the junction of intron 3 and exon 4 in human HIF-1α pre-mRNA, along with structural characterization data obtained by mass spectrometry.

PNK example Sequence (N→C) PNA Accurate weight, m/z Theor. ^a Obs. ^b HIF-ASO 19 Fethoc-TA(5)G-TTC(1O2)-A(5)AA(5)-CTG(6)-TA(5)A-NH ₂ 4915.27 4915.26 HIF-ASO 20 Fethoc-TA(5)G-TTC(1O2)-A(5)AA(5)-CTG(6)-CA(5)A-NH ₂ 4900.27 4900.29

^a) theoretical exact mass; ^b) observed exact mass

Table 3 shows PNA derivatives that complementarily target the 5' splicing site spanning the junction of exon 5 and intron 5 in the human androgen receptor (AR) pre-mRNA read from the human AR gene (accessed from the reference sequence NCBI : NC_000023.11), along with data on structural characteristics obtained using mass spectrometry. The provision of AR-ASO in Table 3 is an example of PNA derivatives of Formula I and should not be interpreted as limiting the scope of the present invention to the AR-ASOs shown in Table 3.

Table 3. PNA derivatives complementarily targeting the 5' splicing site spanning the junction of exon 5 and intron 5 in human AR pre-mRNA, along with structural characterization data obtained by mass spectrometry.

PNK example Sequence (N→C) PNA Accurate weight, m/z Theor. ^a Obs. ^b AR-ASO 1 Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH ₂ 4257.90 4257.92 AR-ASO 2 Fethoc-TC(1O2)C-TTA(6)-CCA(6)-GGC(1O2)-AA(6)GG(6)-NH ₂ 5207.37 5207.42 AR-ASO 3 Fethoc-TC(1O2)C-TTA(5)-CCA(5)-GGC(1O2)-AA(5)GG(6)-NH ₂ 5165.32 5165.31 AR-ASO 4 Fethoc-TA(5)C-CAG(6)-GC(1O2)AA(5)GG(6)-C-NH ₂ 4283.97 4283.96 AR-ASO 5 Fethoc-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH ₂ 3968.85 3968.86 AR-ASO 6 Fethoc-C(1O2)TT-A(5)CC-A(6)GG(6)-CA(5)A-NH ₂ 3982.86 3982.88 AR-ASO 7 Ac-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH ₂ 3774.77 3774.83 AR-ASO 8 Fethoc-C(1O2)TT-A(6)CC-A(6)GG(6)-CA(6)A-NH ₂ 4010.89 4010.93 AR-ASO 9 H-CTT-A(5)C(1O3)CA(5)G(3)GC(1O2)AA(5)-G-NH ₂ 4092.89 4092.90 AR-ASO 10 Benzoyl-CTT-A(5)C(1O5)CA(5)G(2O2)GC(1O2)AA(5)-G-NH ₂ 4254.96 4254.99 AR-ASO 11 n-Propyl-CTT-A(5)C(2O2)CA(3)G(2O3)GC(1O2)AA(5)-G-NH ₂ 4150.93 4150.93 AR-ASO 12 p-Toluenesulfonyl-CTT-A(5)C(1O2)CA(8)G(5)GC(1O2)AA(5)-G-NH ₂ 4302.96 4302.90 AR-ASO 13 Fethoc-Lys-Leu-CTT-A(5)C(1O2)CA(2O2)GG-C(1O2)AA(5)-G-Lys-NH ₂ 4629.16 4629.16 AR-ASO 14 Fethoc-CTT-A(5)C(1O2)CA(5)GT-C(1O2)TA(5)-G-NH ₂ 4223.88 4223.93 AR-ASO 15 N-Phenyl-N-Me-CTT-A(5)C(1O2)CA(5)GG-C(1O2)AA(5)-G-Lys-NH ₂ 4239.96 4240.00

^a) theoretical exact mass; ^b) observed exact mass

Table 4 shows PNA derivatives that complementarily target the 5' splicing site spanning the junction of exon 4 and intron 4 in human SCN9A (sodium channel subtype 9A) pre-mRNA read from the human SCN9A gene (accessed from ref. NCBI sequence: NC_000002.12), along with structural characterization data obtained by mass spectrometry. The provision of SCN9A-specific ASOs in Table 4 is an example of PNA derivatives of formula I and should not be interpreted as limiting the scope of the present invention to the ASOs shown in Table 4.

Table 4. PNA derivatives complementarily targeting the 5' splicing site spanning the junction of exon 4 and intron 4 in human SCN9A pre-mRNA, along with structural characterization data obtained by mass spectrometry.

PNK example Sequence (N→C) PNA Accurate weight, m/z Theor. ^a Obs. ^b SCN-ASO 1 Fmoc-TA(5)AA(5)TA(5)-CGC(1O2)-AA(5)AA(5)A-NH ₂ 4640.19 4640.88 SCN-ASO 2 FAM-HEX-TA(5)AA(5)TA(5)-CGC(1O2)-AA(5)AA(5)A-NH ₂ 4887.24 4887.40 SCN-ASO 3 Fethoc-TA(5)AA(5)TA(5)-CGC(1O2)-AA(5)AA(5)A-NH ₂ 4652.20 4652.24 SCN-ASO 4 Fethoc-TG(6)T-TA(5)AA(5)TA(5)-CGC(1O2)-AA(5)AA(5)A-NH ₂ 5574.61 5574.57 SCN-ASO 5 Fethoc-TA(5)C-GC(1O2)AA(5)AA(5)-ACA(5)-A-NH ₂ 4261.98 4262.00 SCN-ASO 6 Fethoc-TA(6)C-GC(1O2)AA(6)AA(6)-ACA(6)-A-NH ₂ 4318.05 4318.17 SCN-ASO 7 Fethoc-AC(1O2)T-TA(5)CG(6)CA-A(5)AA(5)-AC(1O2)AA(5)-NH ₂ 5250.53 5250.46 SCN-ASO 8 Fmoc-TA(5)AA(5)TA(5)-CGC(1O2)-AA(5)AA(5)AC-A(5)A-NH ₂ 5539.61 5539.57 SCN-ASO 9 Piv-TA(5)AA(5)TA(5)-CGC(1O2)-AA(5)AA(5)A-NH ₂ 4500.17 4499.80 SCN-ASO 10 FAM-HEX-A(5)TA(5)-CGC(1O2)-AA(5)AA(5)A-NH ₂ 3970.82 3974.17 SCN-ASO 11 Fmoc-TA(6)AA(5)TA(6)-CGC(1O2)-AA(6)A-AA(6)CA(6)-NH ₂ 5334.57 5335.59 SCN-ASO 12 Fethoc-CTT-A(5)CG(6)-C(1O2)AA(5)-AA(5)AC(1O2)AA(5)-NH ₂ 4975.34 4975.34 SCN-ASO 13 H-CTT-A(5)CG(3)-C(1O2)AA(5)-AA(5)AC(1O3)AA(5)-NH ₂ 4711.22 4711.25 SCN-ASO 14 Benzoyl-CTT-A(5)CG(2O2)-C(1O2)AA(5)-AA(5)AC(1O5)AA(5)-NH ₂ 4873.30 4873.32 SCN-ASO 15 n-Propyl-CTT-A(5)CG(2O3)-C(1O2)AA(3)-AA(5)AC(2O2)AA(5)-NH ₂ 4769.27 4769.30 SCN-ASO 16 p-Toluenesulfonyl-CTT-A(5)CG(6)-C(1O2)AA(8)-AA(5)AC(1O2)AA(5)-NH ₂ 4935.32 4935.29 SCN-ASO 17 [N-(2-phenylethyl)amino]carbonyl-CTT-A(5)CG(6)-C(1O2)AA(2O2)-AA(5)AC(1O2)AA(5)-NH ₂ 4888.31 4888.32 SCN-ASO 18 Fethoc-CTT-A(5)CG(6)-C(1O2)TA(5)-AA(5)TC(1O2)AA(5)-NH ₂ 4957.32 4957.32 SCN-ASO 19 Fethoc-Lys-Leu-CTT-A(5)CG(6)-C(1O2)AA(4)-AA(5)AC(1O2)AA(5)-Lys-NH ₂ 5330.60 5330.60 SCN-ASO 20 N-Phenyl-N-Me-CTT-A(5)CG(6)-C(1O2)AA(5)-AA(5)AC(1O2)AA(5)-Lys-NH ₂ 4957.40 4957.42

^a) theoretical exact mass; ^b) observed exact mass

Table 5 shows PNA derivatives complementarily targeting the 3' splicing site spanning the junction of intron 3 and exon 4 in pre-mRNA for human SCN9A, along with structural characterization data obtained by mass spectrometry. The provision of the SCN9A-specific ASOs in Table 5 is an example of PNA derivatives of formula I and should not be interpreted as limiting the scope of the present invention to the SCN9A-ASOs shown in Table 5.

Table 5. PNA derivatives complementarily targeting the 3' splicing site spanning the junction of exon intron 3 and exon 4 in pre-mRNA for human SCN9A, along with structural characterization data obtained by mass spectrometry.

PNK example Sequence (N→C) PNA Accurate weight, m/z Theor. ^a Obs. ^b SCN-ASO 21 Fethoc-TA(5)AA(5)AG(6)-TG(6)TA(5)CC(1O2)-TA(5)AA(5)-NH ₂ 5398.60 5398.58 SCN-ASO 22 Fethoc-AA(5)G-TG(6)TA(5)CC(1O2)-TAA(5)-A-NH ₂ 4282.97 4283.00 SCN-ASO 23 Fethoc-AA(5)G-TG(6)T-AC(1O2)C-TAA(5)-A-NH ₂ 4182.87 4182.89 SCN-ASO 24 Fethoc-A(5)AG-TG(6)TA(5)CC(1O2)-TAA-A(5)-NH ₂ 4282.97 4283.00 SCN-ASO 25 Fethoc-AAG(6)-TG(6)TA(5)CC(1O2)-TA(5)AA-NH ₂ 4281.98 4282.05 SCN-ASO 26 Fethoc-AA(5)G-TG(5)TA(5)CC(1O2)-TA(5)AA(5)-NH ₂ 4369.06 4369.08 SCN-ASO 27 Fethoc-AA(5)G-TG(5)TA(5)CC(1O2)-TA(5)AA(5)C-NH ₂ 4620.16 4620.14 SCN-ASO 28 Fethoc-A(5)GT-G(5)TA(5)-CC(1O2)TA(5)AA(5)-C-NH ₂ 4345.56 4345.08 SCN-ASO 29 Fethoc-AA(6)G-TG(5)TA(6)CC(1O2)-TA(6)AA(6)C-NH ₂ 4676.22 4676.25 SCN-ASO 30 Fethoc-AA(5)G-TG(5)TA(5)CC(1O2)-TA(5)AA(5)G-NH ₂ 4660.16 4660.15 SCN-ASO 31 Fethoc-AA(5)G-TG(5)TA(5)CC(1O2)-TA(5)AA(5)CA-NH ₂ 4895.27 4895.20 SCN-ASO 32 Fethoc-AA(5)G-TG(5)TA(5)CC(1O2)-TA(5)AA(5)GG-NH ₂ 4951.27 4951.26 SCN-ASO 33 Fethoc-AA(5)G-TG(5)T-ACC(1O2)-TA(5)AA(5)CA(5)-C-NH ₂ 5146.37 5146.35

^a) theoretical exact mass; ^b) observed exact mass

Table 6 lists PNA derivatives complementarily targeting a specific splice site in pre-mRNA for human or rat SCN9A, along with structural characterization data obtained by mass spectrometry. The provision of the SCN9A-specific ASOs in Table 6 is an example of PNA derivatives of formula I and should not be interpreted as limiting the scope of the present invention to the SCN9A-ASOs shown in Table 6.

Table 6. PNA derivatives complementarily targeting a specific splicing site (SS) in pre-mRNA for human or rat SCN9A, along with structural characterization data obtained by mass spectrometry.

PNK example View Target site ^a) Sequence (N→C) PNA Accurate weight, m/z Theor. ^b Obs. ^c SCN-ASO 34 Man 5' SS exon 2 Fethoc-GA(5)TA(5)TG-A(5)GT-G(6)TA(5)-C(1O2)TA(5)-A-NH ₂ 5346.49 5346.46 SCN-ASO 35 Rat 5' SS exon 2 Fethoc-GA(5)TA(5)TG-A(5)GT-G(6)CA(5)-C(1O2)TA(5)-A-NH ₂ 5331.49 5331.52 SCN-ASO 36 Man
& Rat 5' SS of exon 7 Fethoc-A(5)TA(5)-CC(1O2)C-TG(6)AA(5)TC-TG(6)T-NH ₂ 4866.26 4866.29 SCN-ASO 37 Man & Rat 3' SS exon 15 Fethoc-AA(5)GA(5)C(12)T-CG(6)GA(5)GC(1O2)-TA(5)-NH ₂ 4772.23 4772.21

^a) SS means splicing site; ^b) theoretical exact mass; ^c) observed exact mass

"SCN-ASO 34" is a 16mer ASO fully complementary to the 5' splicing site spanning the junction of exon 2 and intron 2 in pre-mRNA for human SCN9A. "SCN-ASO 34" has the ability to 11-mer complementary overlap with exon 2 and 5-mer complementary overlap with intron 2, as indicated by "bold" and "underline" in the 25-mer pre-mRNA sequence for human SCN9A[( 5'→3')GAUU UUAGUACACUC │ auauc cuuuu].

"SCN-ASO 35" is a 16-mer ASO complementary targeting the 5' splicing site spanning the junction of exon 2 and intron 2 in pre-mRNA for rat SCN9A. "SCN-ASO 35" has the ability to 11-mer complementary overlap with exon 2 and 5-mer complementary overlap with intron 2, as noted by "bold" and "underline" in the 25-mer pre-mRNA sequence for rat SCN9A [( 5'→3')GAUC UUAGUGCACUC │ auauc cuuuc] read from rat genomic DNA [accessed from NCBI reference sequence: NC_005102.3]. "SCN-ASO 35" has one pre-mRNA mismatch for human SCN9A marked with a quotation mark ("") in the 25-mer pre-mRNA sequence [(5'→3')GAUU UUAGU "A" CACUC │ auauc cuuuu] .

"SCN-ASO 36" is a 15-mer ASO complementarily targeting the 5' splicing site spanning the junction of exon 7 and intron 7 in pre-mRNA for human SCN9A. "SCN-ASO 36" has the ability to 11-mer complementary overlap with exon 7 and 4-mer complementary overlap with intron 7, as noted by "bold" and "underline" in the 25-mer pre-mRNA sequence for human SCN9A [( 5 →3')CAGC ACAGAUUCAGG │ guau guaaua]. The target sequence "SCN-ASO 43" is conserved in pre-mRNA for rat SCN9A.

"SCN-ASO 37" is a 14-mer ASO complementarily targeting the 3' splicing site spanning the junction of intron 14 and exon 15 in pre-mRNA for human SCN9A. "SCN-ASO 37" has the ability to 3-mer complementary overlap with intron 14 and 11-mer complementary overlap with exon 15, as indicated by "bold" and "underline" in the 25-mer pre-mRNA sequence for human SCN9A [( 5→3')uugcuuu uag │ CUCCGAGUCUU CAAG]. The ASO target sequence is conserved in the rat SCN9A pre-mRNA and is marked in bold and underlined in the 25mer rat pre-mRNA [(5'→3')uuauuuc uag │ CUCCGAGUCUU CAAG].

Table 7 shows PNA derivatives targeting either the 3' or 5' splicing site of exon 23 in mouse dystrophin pre-mRNA read from mouse genomic DNA [accessed from NCBI reference sequence: NC_000086.7], along with data on structural characteristics obtained using mass spectrometry. The provision of the dystrophin-specific ASOs in Table 7 is an example of PNA derivatives of formula I and should not be interpreted as limiting the scope of the present invention to the dystrophin-specific ASOs shown in Table 7.

Table 7. PNA derivatives complementarily targeting either the 3' or 5' splicing site of exon 23 in mouse dystrophin pre-mRNA, along with structural characterization data obtained by mass spectrometry.

PNK example Target site ^a) Sequence (N→C) PNA Accurate weight, m/z Theor. ^b Obs. ^c DMD-ASO 1 3'SS Fethoc-A(5)GA-G(6)CC(1O2)-TCA-A(5)AA(5)-T-NH ₂ 4267.97 4267.97 DMD-ASO 2 3'SS Fethoc-TTG(6)-CA(5)G-AG(6)CC(1O2)TC-AA(5)AA(5)T-NH ₂ 5441.49 5441.54 DMD-ASO 3 3'SS Fethoc-TTG(6)-CA(6)G-AG(6)CC(12)TC-AA(6)AA(6)T-NH ₂ 5483.54 5483.55 DMD-ASO 4 3'SS Fethoc-A(6)CT-TTG(6)-CA(6)GA(6)GC(1O2)-CTC(1O2)-AA(6)-NH ₂ 5571.59 5571.59 DMD-ASO 5 3'SS Fethoc-TG(6)CA(5)GA-G(6)CC(1O2)-TCA(5)-A-NH ₂ 4258.96 4258.98 DMD-ASO 6 5'SS Fethoc-C(12)TC-GG(6)C-TTA(6)-CC(1O2)T-GA(6)AA(6)TT-NH ₂ 5672.52 5672.51 DMD-ASO 7 5'SS Fethoc-C(1O2)TT-A(5)CC(1O2)-TG(6)A-AA(5)T-TT-NH ₂ 4488.00 4488.00

^a) SS means splicing site; ^b) theoretical exact mass; ^c) observed exact mass

Table 8 lists PNA derivatives complementarily targeting the splicing site in human or mouse indolamine 2,3-dioxygenase (IDO1) pre-mRNA, along with structural characterization data obtained by mass spectrometry. Human and mouse IDO-1 pre-mRNA sequences were read from human genomic DNA [accessed from NCBI reference sequence: NC_000008.11] and from mouse genomic DNA [accessed from NCBI reference sequence: NC_000074], respectively. The provision of IDO1-specific ASOs in Table 8 is an example of PNA derivatives of Formula I and should not be interpreted as limiting the scope of the present invention to the IDO1-ASOs listed in Table 8.

Table 8. PNA derivatives complementarily targeting a specific splicing site (SS) in pre-mRNA for human or mouse IDO1, along with structural characterization data obtained by mass spectrometry.

PNK example View Target site ^a) Sequence (N→C) PNA Accurate weight, m/z Theor. ^b Obs. ^c IDO-ASO 1 Man 3' SS of exon 7 Fethoc-GG(6)AA(5)TT-A(5)CC(1O2)-TAA(5)-A-NH ₂ 4282.97 4283.00 IDO-ASO 2 Man 3' SS of exon 7 Fethoc-AA(5)T-TA(5)C-CTA(5)-AA(5)AC(1O2)A-NH ₂ 4503.08 4503.09 IDO-ASO 3 Mouse 3' SS of exon 7 Fethoc-GG(5)GA(5)TT-G(5)CC(1O2)-TTT-A(5)AA(5)-NH ₂ 4918.24 4918.26 IDO-ASO 4 Mouse 3' SS of exon 7 Fethoc-GG(5)GA(5)TT-G(5)CC(1O2)-TTT-A(5)-NH ₂ 4267.91 4267.93 IDO-ASO 5 Man 5' SS exon 3 Fethoc-CA(5)AA(5)CC(1O2)-TTA(5)-CGG(6)-A-NH ₂ 4243.96 4243.98 IDO-ASO 6 Man 3' SS of exon 4 Fethoc-GG(6)C-AA(5)GA(5)CC(1O2)-TGA(5)-T-NH ₂ 4299.96 4299.97

^a) SS means splicing site; ^b) theoretical exact mass; ^c) observed exact mass

Table 9 lists PNA derivatives complementarily targeting the 3' splicing site of "exon 7" in the pre-mRNA for human SNAP25 read from the human SNAP25 gene [NCBI reference sequence: NG_029626.1], along with structural characterization data obtained from using mass spectrometry. The provision of SNAP25-specific ASOs in Table 9 is an example of PNA derivatives of Formula I and should not be interpreted as limiting the scope of the present invention to the SNAP25-ASOs shown in Table 9.

Table 9. PNA derivatives complementarily targeting the 3' splicing site spanning the junction of intron 6 and exon 7 in pre-mRNA for human SNAP25, along with structural characterization data obtained by mass spectrometry.

PNK example Sequence (N→C) PNA Accurate weight, m/z Theor. ^b Obs. ^c SNAP-ASO 1 Fethoc-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)GA(6)-NH ₂ 5188.36 5188.38 SNAP-ASO 2 Fethoc-TG(5)T-TA(6)CC(1O2)CT-GG(5)GA(5)-NH ₂ 4266.93 4266.95 SNAP-ASO 3 Fethoc-TG(5)T-TA(6)CC(1O2)CT-GG(5)GA(5)T-NH ₂ 4533.03 4533.04 SNAP-ASO 4 Fethoc-TG(5)G-TA(5)CC(1O2)CT-TG(5)GA(5)T-NH ₂ 4519.01 4518.95 SNAP-ASO 5 Fethoc-TG(6)T-TA(3)C-CC(1O5)T-GG(6)GA(3)T-NH ₂ 4533.03 4533.04 SNAP-ASO 6 Fethoc-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)-NH ₂ 4601.07 4601.08 SNAP-ASO 7 Fethoc-C(1O2)AT-TTG(6)-TTA(5)-CCC(1O2)-TG(6)-NH ₂ 4478.98 4478.99 SNAP-ASO 8 Fethoc-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH ₂ 4468.02 4468.04 SNAP-ASO 9 Fethoc-A(6)TT-TG(5)T-TA(5)CC(1O2)CT-G(5)-NH ₂ 4216.91 4216.93 SNAP-ASO 10 Fethoc-CA(6)T-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH ₂ 5374.45 5374.44 SNAP-ASO 11 Fethoc-A(6)TT-TG(5)T-TA(6)CC(1O2)CT-GG(5)GA(5)-NH ₂ 5188.36 5188.35 SNAP-ASO 12 Fethoc-A(6)TT-TG(5)T-TA(6)CC(1O2)CT-G(5)G-NH ₂ 4522.04 4522.05

^a) theoretical exact mass; ^b) observed exact mass

Table 10 shows PNA derivatives complementarily targeting the 3' splicing site spanning the junction of intron 1 and exon 2 in human tyrosinase (TYR) pre-mRNA read from the human TYR gene [NCBI reference sequence: NG_0008748], or pre mRNA for mouse TYR read from mouse genomic DNA [accessed from NCBI reference sequence: NC_000073]. The provision of TYR-specific ASOs in Table 10 is an example of PNA derivatives of Formula I and should not be interpreted as limiting the scope of the present invention to the TYR-ASOs shown in Table 10.

Table 10. PNA derivatives complementarily targeting the 3' splicing site spanning the junction of intron 1 and exon 2 in pre-mRNA for human or mouse TYR, along with structural characterization data obtained by mass spectrometry.

PNK example View Sequence (N→C) PNA Accurate weight, m/z Theor. ^b Obs. ^c TYR-ASO 1 Man Fethoc-CA(5)G-ACA(5)-ATC(1O2)-TG(6)TA(5)-NH ₂ 4258.96 4260.99 TYR-ASO 2 Man Fethoc-AC(12)A-GA(5)C-AA(5)T-CTG(6)-TA(5)C(1O2)-AA(5)-NH ₂ 5532.55 5532.54 TYR-ASO 3 Man Fethoc-AC(1O2)A(5)-GA(5)C-AA(5)T-CTG(6)-C(1O2)C-NH ₂ 4592.11 4592.11 TYR-
ASO 4 Mouse Fethoc-CA(5)AA(5)TG-A(5)TC(1O2)-TG(6)TG-NH ₂ 4289.95 4289.96

^a) theoretical exact mass; ^b) observed exact mass

Table 11 shows PNA derivatives targeting either the 3' splicing site or the 5' splicing site of exon 2 complementarily in human PD-1 pre-mRNA read from the human PDCD1 gene [NCBI reference sequence: NG_012110], or mouse PD-1 pre-mRNA read from mouse genomic DNA [accessed from NCBI reference sequence: NC_000067]. The provision of PD-1 specific ASOs in Table 11 is an example of PNA derivatives of Formula I and should not be interpreted as limiting the scope of the present invention to the PD-1-ASOs shown in Table 11.

Table 11 PNA derivatives targeting either the 3' splicing site or the 5' splicing site of exon 2 complementarily in human or mouse PD-1 pre-mRNA, along with structural characterization data obtained by mass spectrometry .

PNK example View Sequence (N→C) PNA Accurate weight, m/z Theor. ^b Obs. ^c PD-ASO 1 Man Fethoc-C(1O2)TG(6)-GG(6)G-AG(6)T-CTG-A(5)G-NH ₂ 4636.07 4636.08 PD-ASO 2 Mouse Fethoc-CC(1O2)T-CA(5)C-CTG(5)-TTA(5)-C(1O2)CA(5)-C-NH ₂ 5022.27 5022.27 PD-ASO 3 Man Fethoc-CG(6)CA(5)CC-TG(6)T-CA(5)CC(1O2)C-NH ₂ 4422.03 4422.05

^a) SS means splicing site; ^b) theoretical exact mass; ^c) observed exact mass

Affinity of model PNA derivatives for complementary RNA or DNA

10-mer PNA derivatives containing modified nucleotide bases have been prepared as model compounds to demonstrate the strong affinity of PNA compounds of formula I for RNA as well as for DNA. These PNA model compounds were prepared according to the synthetic procedures of the present invention or with minor modifications. 10-mer derivatives of PNA are presented in table 12, along with data on structural characteristics obtained using mass spectrometry.

Table 12. 10-mer PNA derivatives as model compounds to demonstrate the strong affinity of PNA compounds of formula I for RNA or DNA.

PNK example Sequence (N→C) PNA Accurate weight, m/z Theor. ^b Obs. ^c PNK 10-1 Fmoc-GTA-GAT-CAC-T-NH ₂ 2948.14 2949.05 PNK 10-2 Fmoc-GTA-GA(5)T-CAC-T-NH ₂ 3048.24 3050.41 PNK 10-3 Fmoc-GTA(5)-GAT-CA(5)CT-NH ₂ 3148.34 3150.65 PNK 10-4 Fmoc-GTA(5)-GA(5)T-CA(5)CT-NH ₂ 3248.44 3250.81 PNK 10-5 Fmoc-GTA-G(5)AT-CAC-T-NH ₂ 3032.25 3035.01 PNK 10-6 Fmoc-GTA-GAT-C(1O2)AC-T-NH ₂ 3044.21 3047.02 PNK 10-7 Fmoc-GTA(5)-GA(5)TC(1O2)AC-T-NH ₂ 3245.39 3248.10

^a) theoretical exact mass; ^b) observed exact mass

The 10-mer PNA oligomers in Table 12 were evaluated for their binding affinity to complementary 10-mer RNA or DNA by measuring T _m values as described below.

A mixed solution of 4 μM 10-mer PNA oligomer and 4 μM complementary 10-mer DNA or RNA in 4 ml aqueous buffer (pH 7.16, 10 mM sodium phosphate, 100 mM NaCl) in 15 ml Falcon polypropylene tube was incubated at 90 ^ο C for a minute and slowly cooled to ambient temperature. The solution was then transferred to a 4 ml UV quartz cuvette and subjected to T _m measurement at 260 nm in a UV/Visible spectrophotometer as described in the prior art [PCT/KR2009/001256], or with minor modifications. DNA and RNA for T _m measurements were purchased from Bioneer (www.bioneer.com, Dajeon, Republic of Korea) and used without further purification.

Table 13 shows T _m values (not adjusted) measured between model PNA oligomers and complementary DNA or RNA. "PNA 10-1", a reference PNA oligomer without a modified nucleotide base, gave T _m values of 51 and 55 ^οC against the background of complementary DNA and RNA, respectively. Model PNA oligomers containing the modified nucleotide base(s) generally exhibited higher T _m along with greater incorporation of the modified nucleotide bases. "PNA 10-7" demonstrated T _m =69 ^ο C also against the background of complementary DNA and RNA, which suggests that the model PNA oligomers bind to their complementary DNA and RNA with comparable affinity.

Table 13. T _m values between 10-mer PNA and complementary DNA or RNA.

PNK Complementary DNA or RNA T _m , ^o C △T _m ^a , ^o C PNK 10-1 DNA (5'→3') AGT-GAT-CTA-C 51 - PNK 10-2 55 + 4 PNK 10-3 61 + 10 PNK 10-4 66 +15 PNK 10-5 53 + 2 PNK 10-6 59 + 8 PNK 10-7 69 +18 PNK 10-1 RNA (5'→3') AGU-GAU-CUA-C 55 - PNK 10-4 66 + 11 PNK 10-7 69 +18

^a) T _m value - T _m value "PNK 10-1"

Affinity of PNA derivatives for 10-mer complementary DNA

PNA derivatives of formula I were evaluated with respect to their affinity for 10-mer DNAs complementary targeting at the N-terminus or C-terminus. Affinity was assessed by the T _m value for the duplex between PNA and 10-mer complementary DNA. A duplex between PNA derivatives and DNA with complete complementarity usually exhibits T _m values too high to be reliably determined in an aqueous buffer solution. The aqueous buffer solution usually boils away during the measurement of T _m .

The observed T _m values (not adjusted) for the PNA derivatives of formula I were very high for complementary binding to 10-mer DNA and are shown in Table 14. For example, "AR-ASO 1" showed a T _m value of 86.1 ^° C for duplex with 10-mer complementary DNA targeting the 10-mer at the N-terminus of the PNA, as noted by "bold" and "underline" in [(N→C)Fethoc- C(1O2)TT-A(5)CC- A(5)GG-C(1O2) AA(5)-G-NH ₂ ]. Meanwhile, "AR-ASO 1" showed a T _m value of 81.3 ^οC for a duplex with 10-mer complementary DNA targeting the 10-mer at the C-terminus of PNA, as noted by "bold" and "underline" in [(N→C)Fethoc-C(1O2)TT- A(5)CC-A(5)GG-C(1O2)AA(5)-G- NH ₂ ].

Table 14. T _m values between PNA and 10-mer complementary DNA that targets either the N-terminus or the C-terminus of the PNA.

PNK Value T _m , ^o C 10mer DNA vs. N-terminus 10mer DNA vs. C-terminus AR-ASO 1 86.1 81.3 AR-ASO 4 84.3 84.5 AR-ASO 5 84.4 78.4 HIF-ASO 1 66.0 60.0 HIF-ASO 4 66.0 53.4 HIF-ASO 5 62.0 58.0 HIF-ASO 7 69.0 61.0 HIF-ASO 8 73.0 61.0 HIF-ASO 9 60.9 59.0 HIF-ASO 10 61.0 60.0 HIF-ASO 11 73.4 61.0 SCN-ASO 4 63.5 71.6 SCN-ASO 7 65.0 64.6 SCN-ASO 8 74.0 68.6 SCN-ASO 12 76.0 77.0 SCN-ASO 22 74.0 65.0 SCN-ASO 24 77.0 66.0 SCN-ASO 25 78.0 66.0 SCN-ASO 26 75.0 72.0 SCN-ASO 27 77.0 69.0 SCN-ASO 28 78.1 70.0 SCN-ASO 30 79.0 74.0 SNAP-ASO 2 76.0 87.6 SNAP-ASO 3 77.3 88.7 SNAP-ASO 8 58.0 68.0 SNAP-ASO 9 62.0 76.0 SNAP-ASO 10 61.0 68.0 SNAP-ASO 12 62.0 74.0 TYR-ASO 1 78.0 73.0 TYR-ASO 4 72.0 72.0

Examples of in vitro activity of HIF-1α-specific ASOs

PNA derivatives of formula I targeting complementarily the 3' splicing site of either exon 2 or exon 4 in pre-mRNA for human HIF-1α (hypoxia-inducible factor 1α) were evaluated for their HIF-1α antisense exon-skip activity in HeLa cells. Biological examples for these HIF-1α-ASOs are provided as examples to illustrate that exon skipping is effectively induced by a compound of formula I targeting a splicing site in a pre-mRNA target and should therefore not be interpreted as limiting the scope of the present invention. HIF-1α-specific ASO.

HIF-1α Example 1 Exon skipping induced by "HIF-ASO 2".

"HIF-ASO 2" listed in Table 1 is a 14-mer ASO fully complementary to the region at the 3' splicing site of exon 2 in pre-mRNA for human HIF-1α, as indicated by "bold" and "underline" in the 20-mer pre-mRNA sequence [(5'→3')uguua aguag │ GAUAAGUUC U], where the symbol "│" denotes the junction of the intron and exon. "HIF-ASO 2" is capable of 5-mer complementary overlap with intron 1 and 9-mer complementary overlap with exon 2.

"HIF-ASO 2" was evaluated by HIF-1α-specific nested PCR for its ability to induce mRNA exon 2 skipping for human HIF-1α in HeLa cells. The procedures used are listed below.

[Cell culture and ASO treatment] HeLa cells (Cat. No. CCL-2, ATCC) were grown in a 60 mm culture dish containing 5 ml of EMEM supplemented with 10% FBS (fetal bovine serum), 1% streptomycin/penicillin, 1 % L-glutamine and 1% sodium pyruvate in an atmosphere with 5% CO ₂ at 37 ^ο C. Cells were treated with "HIF-ASO 2" at a concentration of 0 (negative control), 10, 100 or 1000 μM. ASO was serially diluted to the appropriate concentration in DDW and aliquoted into a culture dish.

[RNA Extraction] After 5 hours, total RNA was extracted using the "Universal RNA Extraction Kit" (Cat. No. 9767, Takara) according to the manufacturer's instructions.

[cDNA Synthesis by One Step RT-PCR] 200 ng RNA template was reverse transcribed in 25 µl volume using the Super Script® One Step RT-PCR Kit with Platinum® Taq Polymerase (Cat. No. 10928-042, Invitrogen) against the background of a set of exon-specific primers [HIF exon 1_forward: (5'→3')CTTGCCTTTCCTTCTCTTCT; HIF exon 8_reverse: (5'→3')AACCCAGACATATCCACC] according to the following cycling regimes: 50 ^οC for 30 min and 94 ^οC for 2 min, followed by 15 cycles, each consisting of 30 sec at 94 ^ο C, 30 sec at 55 ^ο C and 1 min at 72 ^ο C.

[Nested PCR Amplification] 1 µl cDNA was subjected to a 20 µl volume nested PCR reaction (Cat. No. K2612, Bioneer) against the background of a set of exon-specific primers [HIF exon 1n_forward: (5→3')TGAAGACATCGCGGGGAC; HIF exon 5n_reverse: (5→3')TTTTTCACAAGG-CCATTTCT] according to the following cycling regimes: 95 ^οC for 5 min followed by 39 cycles, each consisting of 30 sec at 95 ^οC , 40 sec at 50 ^οC and 50 sec at 72 ^ο C.

The exon-specific primer sets for one-step RT-PCR and nested PCR amplification are summarized schematically in FIG. 17A.

[Identification of the "exon skipping 2" product] PCR products were subjected to electrophoretic separation in 2% agarose gel along with a mixture of size markers. Target size bands were harvested and analyzed by Sanger sequencing. The observed bands for the PCR products were consistent with full-length mRNA (ie, no exon skipping) and a splicing variant lacking exon 2, as shown in FIG. 17b. Cells treated with ASO gave a strong band for PCR product at a size attributed to exon 2 skipping. Cells without ASO treatment (i.e. negative control) also gave PCR product corresponding to exon 2 skipping, suggesting that exon 2 spontaneously deleted to a certain extent. However, the intensity of the exon skipping band was much higher in ASO-treated cells than in cells without ASO treatment. Thus, "HIF-ASO 2" promoted exon 2 skipping in HeLa cells. The sequencing data for the exon skipping band is shown in FIG. 17C showing the mRNA sequence for the junction of exon 1 and exon 3.

[Number of cells affected by one molecule of ASO] "HIF-ASO 2" induced exon 2 skipping even at 10 µM. Approximately 30 ASO molecules at a concentration of 10 µM (ie 10×10 ^-21 M) exists in 5 ml of culture medium in a 60 mm culture dish. Given that approximately 30 ASO molecules induced skipping in approximately 100,000 HeLa cells in a 60 mm culture dish, each ASO molecule was estimated to affect or control exon skipping in an average of approximately 3,000 HeLa cells. Therefore, it is believed that each ASO molecule moved rapidly around a large number of cells to fulfill its intended role of exon skipping.

HIF-1α Example 2 Inhibition of HIF-1α protein expression in HeLa cells by "HIF-ASO 2".

"HIF-ASO 2" was evaluated for its ability to inhibit HIF-1α protein expression in HeLa cells as described below.

[Cell culture and ASO treatment] HeLa cells grown in a 60 mm culture dish containing 5 ml of culture medium were treated with "HIF-ASO 2" at a concentration of 0 uM (negative control), 10 uM, 100 uM, 1 aM, or 10 aM.

[CoCl ₂ treatment and cell lysis] 24 hours after the ASO treatment, culture dishes, except for the dish without ASO treatment, were treated with 200 μM CoCl ₂ for another 3 hours to increase the level of HIF-1α protein by suppressing prolyl hydroxylase (PHD) activity. Cells were then washed twice with 1 ml cold PBS and lysed on ice using 200 µl 1X RIPA buffer (Cat. No. 9806, Cell Signaling Tech) supplemented with 1% SDS and 1X proteinase inhibitor mix (Complete Mini, Roche). Each lysate was collected in a 1.5 ml Eppendorf tube, mixed with 100 µl of 5X sample buffer and boiled for 5 min at 100 ^οC . Lysates were subjected to electrophoretic separation in 8% SDS-PAGE for electrophoresis and transferred to a PVDF 0 .45 µm. The membrane was examined using an anti-HIF-1α antibody (p/n 610958, BD Biosciences) and an anti-β-actin antibody (p/n sc4778, Santa Cruz).

[Inhibition of HIF-1α protein expression]. In FIG. 18A shows HIF-1α Western blot data obtained from HeLa cells treated with "HIF-ASO 2". While no band was detected for HIF-1α with cell lysate without CoCl ₂ treatment, cell lysates treated with CoCl ₂ gave a strong band for HIF-1α. In FIG. 18B shows individual band intensities for HIF-1α, plotted as individual band intensities for β-actin by densitometry. The expression of HIF-1α gradually decreased as the concentration of "HIF-ASO 2" increased. The observed reduction was approximately 75% at 10 aM "HIF-ASO 2".

HIF-1α Example 3 SYBR Green qPCR for mRNA for HIF-1α in HeLa cells treated with "HIF-ASO 2".

"HIF-ASO 2" was evaluated by nested qPCR for its ability to inhibit full-length mRNA expression for HIF-1α in HeLa cells as follows.

[Cell culture and ASO treatment] HeLa cells grown in a 60 mm culture dish containing 5 ml of medium were treated with "ASO 2" at a concentration of 0 (negative control), 10, 100, or 1000 µM (2 culture dishes per concentration ASO).

[RNA Extraction] 3 hours after ASO treatment, total RNA was extracted using the "MiniBEST Universal RNA Extraction Kit" (Cat. No. 9767, Takara) according to the manufacturer's instructions.

[cDNA Synthesis by One Step RT-PCR] 200 ng RNA template was reverse transcribed in 25 µl volume using the Super Script® One Step RT-PCR Kit with Platinum® Taq Polymerase (Cat. No. 10928-042, Invitrogen) against the background of a set of exon-specific primers [HIF exon 1_forward: (5'→3')CTTGCCTTTCCTTCTCTTCT; HIF exon 8_reverse: (5'→3')AACCCAGACATATCCACC] according to the following cycling regimes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 15 cycles, each consisting of 30 sec at 94 ^ο C, 30 sec at 55 ^ο C and 1 min at 72 ^ο C.

[Nested qPCR] 1 µl of cDNA diluted 100 times was subjected to a 20 µl volume real-time PCR reaction against the background of the following exon-specific primer sets: [HIF exon 2n_forward (5'→3')CTTGCTCATCAGTTGCCACTTC; HIF exon 2n_reverse (5'→3')AAGTTTCCT-CACACGCAAATAG; HIF exon 3n_straight (5'→3')GAAAGCACAGATGAATTGC; HIF exon 3n_reverse (5'→3')TCATGTCACCATCATCTGT; HIF exon 4n_straight (5'→3')CTAACTGGACACAGTGTGTTTG; HIF exon 4n_reverse (5'→3')TCTGTGTGTAAGCATTTCTCTC; HIF exon 5n_straight (5'→3')GCCTTGTGAAAAAGGGTAAAG; HIF exon 5n_reverse (5'→3')CCATGTTGCAGACTTTATGT]. PCR reactions were examined using SYBR Green (Takara, Japan) according to the following cycling regimes: 95 ^οC for 3 min followed by 40 cycles, each for 5 sec at 95 ^οC and 30 sec at 60 ^οC .

[Changes in exon levels in mRNA for HIF-1α]. Individual exon levels in ASO-treated samples were normalized to each individual exon level without ASO treatment. The observed relative individual exon levels are shown in FIG. 18C. All individual exon levels were significantly reduced by 60-80% and 50-70% in cells treated with HIF-ASO 2 at 10 uM and 100 uM, respectively. However, individual exon levels obtained with cells treated with "HIF-ASO 2" at a concentration of 1000 μM (ie 1 aM) did not differ from exon levels in cells without ASO treatment. Although it remains to be seen why the increased exon levels returned to negative control levels when the ASO concentration was increased to 1000 µM. However, the inverse dose response behavior of FIG. 18C is comparable to the dose-response reversal of exon skipping in "HIF-1α Example 1". (cf. Fig. 17A).

HIF-1α Example 4 qPCR using the TaqMan probe for HIF-1α mRNA in HeLa cells treated with "HIF-ASO 2".

"HIF-ASO 2" was evaluated by nested qPCR for its ability to inhibit full-length mRNA expression for HIF-1α in HeLa cells as described in "HIF-1α-Example 3" unless otherwise indicated.

[cDNA Synthesis by One Step RT-PCR] 200 ng RNA template was reverse transcribed in 25 µl volume using the Super Script® One Step RT-PCR Kit with Platinum® Taq Polymerase (Cat. No. 10928-042, Invitrogen) against the background of a set of exon-specific primers [HIF-exon l_forward(2): (5'→3')CGCGAACGACAAGAAAAA; HIF exon 8_reverse(2): (5'→3')CTGTGGTGACTTGTCCTTT] according to the following cycling regimes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 20 cycles, each consisting of 30 sec at 94 ^ο C, 40 sec at 51 ^ο C and 50 sec at 72 ^ο C.

[Nested qPCR] 1 µl cDNA diluted 100-fold was subjected to a 20 µl volume real-time PCR reaction using a TaqMan probe (Hs00936371_ml, Thermo Fisher) designed to detect the junction of exon 1 and exon 2 of human HIF-1α in according to the following cycling regimes: 95 ^ο C for 3 min followed by 40 cycles, each consisting of 10 s at 95 ^ο C and 30 s at 60 ^ο C.

[Changes in mRNA level for HIF-1α] The level of full-length mRNA in the samples treated with ASO, led to the level of mRNA without ASO treatment. The observed reduced mRNA levels are shown in FIG. 18D. The level of full-length mRNA for HIF-1α significantly (according to Student's t-test) decreased by 65% and 55% in cells treated with "HIF-ASO 2" at a concentration of 100 cM and 1000 cM, respectively. The level of full-length mRNA remained unchanged in cells treated with "ASO 2" at a concentration of 10 cM.

HIF-1α-example 5 . Exon skipping induced by "HIF-ASO 6".

"HIF-ASO 6" listed in Table 1 is a 17-mer ASO fully complementary to the 3' splicing site spanning the junction of intron 1 and exon 2 in pre-mRNA for human HIF-1α-1, as noted "bold" and "underline" in the 20-mer pre-mRNA sequence [(5'→3')ugu uaaguag | GAUAAGUUCU ]. "HIF-ASO 6" is capable of 7-mer complementary overlap with intron 1 and 10-mer complementary overlap with exon 2.

"HIF-ASO 6" was evaluated by HIF-1α-specific nested PCR for its ability to induce human HIF-1α mRNA exon 2 skipping in HeLa cells according to the procedures described in "HIF-1α-Example 1" unless otherwise specified.

The PCR products were subjected to electrophoretic separation on a 2% agarose gel and the electrophoresis results are shown in FIG. 19A. Exon 2 skipping was robust at all concentrations of HIF-ASO 6 treatment. "HIF-ASO 6" induced exon 2 skipping more efficiently than "HIF-ASO 2". The band for the PCR product in the form of full-length HIF-1α mRNA disappeared almost completely at all concentrations of "HIF-ASO 6". Meanwhile, in cells treated with "HIF-ASO 2" in the concentration range from 10 to 1000 nM, a significant level of full-length mRNA for HIF-1α remained [cf. fig. 17A]

"HIF-ASO 6" has the ability to overlap more complementarily with the 3' splicing site of exon 2 than "HIF-ASO 2", which is responsible for the higher exon skipping efficiency observed with "HIF-ASO 6". Stronger ASO binding to the target splicing site appears to be more efficient in inducing target exon skipping.

HIF-1α example 6 . Inhibition of HIF-1α protein expression in HeLa cells with "HIF-ASO 6".

"HIF-ASO 6" was evaluated for its ability to reduce HIF-1α expression in HeLa cells according to the procedures described in "HIF-1α-Example 2" unless otherwise indicated. Fig. 19B - Western blot data obtained from HeLa cells treated with "HIF-ASO 6" at a concentration of 0 (negative control), 10, 100 or 1000 mM for 24 hours. In FIG. 19C shows the intensities of individual bands for HIF-1α, normalized to the intensity of a single band for β-actin by densitometry. Expression of HIF-1α protein was reduced by approximately 45~55% in cells treated with "HIF-ASO 6".

HIF-1α Example 7 SYBR Green qPCR for HIF-1α mRNA in HeLa cells treated with "HIF-ASO 6".

"HIF-ASO 6" was evaluated for its ability to induce an mRNA change for HIF-1α in HeLa cells by nested qPCR according to the procedures described in "HIF-1α-Example 4" unless otherwise indicated.

[cDNA Synthesis by One Step RT-PCR] 200 ng RNA template was reverse transcribed in 25 µl volume using the Super Script® One Step RT-PCR Kit with Platinum® Taq Polymerase (Cat. No. 10928-042, Invitrogen) against the background of a set of exon-specific primers [HIF exon 1_forward(2): (5'→3')CGCGAACGACAAGAAAAA; HIF exon 8(2)_reverse: (5'→3')CTGTGGTGACTTGTCCTTT] according to the following cycling regimes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 15 cycles, each consisting of 30 sec at 94 ^ο C, 40 sec at 51 ^ο C and 50 sec at 72 ^ο C.

[Changes in mRNA exon levels for HIF-1α] Individual exon levels, normalized to individual exon levels without ASO treatment, are shown in FIG. 20(A). Exon levels significantly (Student's t-test) decreased by 35%, approximately 30% and approximately 45% in cells treated with "HIF-ASO 6" at a concentration of 10, 100 and 1000 nM, respectively.

HIF-1α example 8 . qPCR using the TaqMan probe for HIF-1α mRNA in HeLa cells treated with "ASO 6".

"HIF-ASO 6" was evaluated by nested qPCR for its ability to inhibit full-length mRNA expression for HIF-1α in HeLa cells as described in "HIF-1α-Example 4" unless otherwise indicated.

[Changes in full-length mRNA level for HIF-1α] The level of full-length mRNA in ASO-treated samples resulted in the level of mRNA without ASO treatment. The observed relative mRNA levels are shown in FIG. 20(B). The level of full-length HIF-1α mRNA was significantly (Student's t-test) decreased by approximately 60% and 80% in cells treated with "HIF-ASO 6" at a concentration of 100 cM and 1000 cM (1 aM), respectively. However, the level of full-length mRNA remained unchanged in cells treated with "HIF-ASO 6" at a concentration of 10 cM.

HIF-1α example 9 . Exon skipping induced by "HIF-ASO 1".

"HIF-ASO 1" is a 14-mer ASO fully complementary to the region at the 3' splicing site spanning the junction of intron 1 and exon 2 in human HIF-1α pre-mRNA, as indicated by "bold" and "underline » in the 23-mer pre-mRNA sequence [(5'→3')uguuaag uag | GAUAAGUUCUG AA]. "HIF-ASO 1" has the ability to overlap 3-dimensionally with intron 1 and 11-dimensionally overlap with exon 2.

"HIF-ASO 1" was evaluated for its ability to induce exon skipping in mRNA for HIF-1α as described in "HIF-1α-Example 1" unless otherwise indicated. HeLa cells were treated with "HIF-ASO 1" at a concentration of 0 (negative control), 1, 3, 10, 30 or 100 aM. After 24 hours, total RNA was extracted and subjected to HIF-1α-specific nested PCR to detect exon skipping.

[Exon Skipping Data] FIG. 21A shows electrophoresis data obtained with nested PCR products as well as Sanger sequencing data of the PCR product attributed to exon skipping 2-3. The level of full-length mRNA tended to decrease as the ASO concentration increased from 1 to 100 aM. Exon 2 skipping was dominant for "HIF-ASO 1" at 3 aM and 10 aM. However, exon skipping 2-3 became excessive when the ASO concentration was increased to 100 aM. The PCR product in case of exon 2-3 skipping was unambiguously confirmed by Sanger sequencing [cf. fig. 21 right]

HIF-1α example 10 . Inhibition of HIF-1α protein expression in HeLa cells with "HIF-ASO 1".

"HIF-ASO 1" was evaluated for its ability to inhibit HIF-1α protein expression in HeLa cells according to the procedures described in "HIF-1α-Example 2" unless otherwise indicated. In this example, HeLa cells were treated with "HIF-ASO 1" at 0 uM (negative control), 100 uM, 300 uM, 1 aM, 3 aM, 10 aM, 30 aM, 100 aM, or 300 aM for 72 hours to suppress PHD activity by incubation with 200 μM CoCl ₂ for 3 hours. 4 culture dishes were used for the negative control, ie. 0 uM "HIF-ASO 1".

In FIG. 21B shows HIF-1α Western blot data obtained from lysates of HeLa cells. The HIF-1α protein level was significantly higher in the negative control lysates than in all HIF-ASO 1 treated cell lysates. In FIG. 21C shows the intensities of individual bands for HIF-1α, normalized to the intensity of the band for β-actin using densitometry. Expression of HIF-1α in HeLa cells was reduced by 40-80% as a result of 72-hour incubation with "HIF-ASO 1" at a concentration of 0.1-300 aM.

HIF-1α Example 11 Exon skipping induced by "HIF-ASO 12".

"HIF-ASO 12" listed in Table 2 is a 15-mer ASO fully complementary to the region at the 3' splicing site spanning the junction of intron 3 and exon 4 in pre-mRNA for human HIF-1α, as noted "bold" and "underline" in the 20-mer pre-mRNA sequence [(5'→3')ugu uuacag | UUUGAACTA AC]. "HIF-ASO 12" has the ability to overlap 6-dimensionally with intron 3 and 9-dimensionally overlap with exon 4.

"HIF-ASO 12" was evaluated by HIF-1α-specific nested PCR for its ability to induce exon 4 skipping in mRNA for human HIF-1α in HeLa. HeLa cells were incubated with "HIF-ASO 12" for 6 hours and then subjected to total RNA extraction according to the protocol described in "HIF-1α-Example 1" unless otherwise indicated.

In FIG. 22A shows HIF-1α-specific nested PCR data in HeLa cells treated with "HIF-ASO 12". A band attributed to exon skipping 2-4 was found in all PCR products of ASO-treated cells, although not in PCR products of untreated cells (cf. left panel). The intensity of the band attributed to exon skipping was greatest at 100 µM "HIF-ASO 12". The intensity of the full-length mRNA band decreased the most at 100 µM "HIF-ASO 12". Exon skipping 2-4 was confirmed by Sanger sequencing as shown in the right diagram.

HIF-1α example 12 . Inhibition of HIF-1α protein expression in HeLa cells with "HIF-ASO 12".

"HIF-ASO 12" was evaluated for its ability to inhibit HIF-1α expression in HeLa cells as described in "HIF-1α-Example 2" unless otherwise indicated.

[ASO Treatment] HeLa cells were treated with "HIF-ASO 12" at a concentration of 0 uM (negative control), 10 uM, 100 uM, or 1 aM. Used 3 culture dishes for negative control. After 21 hours, cells were treated with 200 μm CoCl ₂ except for one plate of the negative control. After 3 hours, all cells were lysed on ice as follows. Cells were washed twice with 1 ml cold PBS and then lysed using 200 µl 2X Lammeli sample buffer (24 mM Tris-HCl, 20% glycerol, 0.8% SDS, 0.04% bromophenol blue, 2% β-mercaptoethanol) to minimize degradation of HIF-1α. Each lysate was collected in a 1.5 ml Eppendorf tube and boiled for 5 minutes. The lysates were then subjected to Western blotting in 8% SDS-PPAG for electrophoresis.

In FIG. 22B shows Western blot data showing that the intensity of the HIF-1α band was clearly reduced in cells treated with "HIF-ASO 12" at 1 and 10 aM.

HIF-1α Example 13 : SYBR Green qPCR for mRNA for HIF-1α in HeLa cells treated with "HIF-ASO 12".

"HIF-ASO 12" was evaluated by HIF-1α-specific nested qPCR for its ability to induce an mRNA change for HIF-1α in HeLa cells as described in "HIF-1α-Example 12" unless otherwise indicated. HeLa cells were treated with "HIF-ASO 12" for 6 hours and then subjected to total RNA extraction.

In FIG. 22C shows qPCR data in which mRNA levels of exons 2 and 3 were significantly (by Student's t-test) reduced by 70~80% in ASO-treated cells. qPCR results are consistent with exon skipping 2-4 induced by "HIF-ASO 12" (cf. "Example 11 HIF-1α").

Examples of in vitro and in vivo activity of AR-ASO.

PNA derivatives of formula I that complementarily target the 5' splicing site spanning the junction of exon 5 and intron 5 in human androgen receptor (AR) pre-mRNA were evaluated for their AR antisense exon-skip activity in cells as well as in mice. Biological examples for these AR-ASOs are provided as examples to illustrate that exon skipping is effectively induced by a compound of Formula I targeting a splicing site in a pre-mRNA target and should therefore not be interpreted as limiting the scope of the present invention. ASO.

AR Example 1: Exon skipping induced by "AR-ASO 1".

"AR-ASO 1" listed in Table 3 is a 13-mer ASO fully complementary to the region at the 5' splicing site spanning the junction of exon 5 and intron 5 in human androgen receptor (AR) pre-mRNA. "AR-ASO 1" binds complementarily to the 13mer sequence as indicated by "bold" and "underline" in the 20mer pre-mRNA sequence [(5'→3')GC CUUGCCUG | guaag gaaaa]. "AR-ASO 1" has the capacity for 8-dimensional overlap with exon 5 and 5-dimensional overlap with intron 5.

"AR-ASO 1" was evaluated by AR-specific nested PCR for its ability to induce exon 5 skipping in mRNA for human AR in MCF7 cells as follows.

[Cell Culture and ASO Treatment] MCF7 cells (Cat. No. HTB-22, ATCC) were maintained in EMEM supplemented with 10% FBS, 1% streptomycin/penicillin and 0.01 mg/mL bovine insulin in a 5% CO ₂ atmosphere at 37 ^° C. Cells grown in a 60 mm culture dish were treated with AR-ASO 1 for 3 hours at a concentration of 0 (negative control), 3, 30, 300 or 3000 aM (i.e. 3 fM ).

[RNA Extraction] Total RNA was extracted using the "Universal RNA Extraction Kit" (Cat. No. 9767, Takara) according to the manufacturer's instructions.

[cDNA Synthesis by One Step RT-PCR] 100 ng of RNA template was used in a 25 µl volume reverse transcription reaction using the Super Script® One Step RT-PCR Kit with Platinum® Taq Polymerase (Cat. No. 10928-042, Invitrogen ) and a set of exon-specific primers [AR exon 3_forward: (5'→3')TGGGTGTCACTATGGAGC; and AR-exon 9_reverse: (5'→3')GGGT GTGGAAATAGATGGG] according to the following cycling regimes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 39 cycles, each consisting of 30 sec at 94 ^° C, 30 seconds at 55 ^° C and 1 minute at 72 ^° C.

[Nested PCR Amplification] The amplification process used a unique amplification method (specified as an increase in the annealing temperature in each cycle) that worked efficiently and specifically in a temperature range, rather than at one particular annealing temperature (i.e. in the case of the conventional method PCR). 1 µl cDNA was further amplified in a 20 µl nested PCR reaction using the exon-specific primer set [AR-exon 3_forward: (5'→3')TGGGTGTCACTATGGAGC; and AR exon 7n_reverse: (5'→3')GGGGTGATTTGGAGCCAT] according to the following cycling modes: initial 10 cycles [each consisting of 94 ^ο C for 30 sec, 47 ^ο C for 40 sec (+ 0.5 ^ο C in each cycle), 72 ^ο C for 40 sec] followed by 20 cycles [each consisting of 94 ^ο C for 30 sec, 50 ^ο C for 30 sec, and 72 ^ο C for 40 sec].

[Identification of exon skipping products] PCR products were subjected to electrophoretic separation in 2% agarose gel. Target size bands were harvested and analyzed by Sanger sequencing. In FIG. 23A shows three bands of processing-related PCR products attributed to mRNA splicing variants for AR lacking exon 5. "AR-ASO 1" was found to induce skipping of exon 5, exons 4-5, and exons 4-6, although the ratio of skip products seems to depend on the concentration of ASO. In FIG. 23B shows the actual sequencing data for the band attributed to exon skipping 4-5, FIG. 23 a.

AR Example 2 Inhibition of AR protein expression in MCF7 cells with "AR-ASO 1".

MCF7 cells in a 60 mm culture dish containing 5 ml of culture medium were treated with "AR-ASO 1" at a concentration of 0 uM (negative control) or from 10 uM to 30 aM. There were 4 culture dishes for the negative control. After 48 hours, the cells were washed twice with cold PBS and then lysed using 200 μl of 1X Cell Lysis Buffer (Cat. No. 9803, Cell Signaling Tech) supplemented with 1X Protease Inhibitor Mix (Cat. No. P8340, Sigma). Lysates were collected in a 1.5 ml Eppendorf tube. 200 of each lysate was mixed with 100 µl of 3X sample buffer and boiled for 5 min. 20 μl of each lysate (4 negative controls and 8 ASO treated samples) was subjected to electrophoretic separation on 8% SDS-PAGE for electrophoresis and transferred to a PVDF membrane. The membrane was examined using an anti-AP antibody (Cat. No. 5153, Cell Signaling Tech) and an anti-β-actin antibody (Cat. No. sc4778, Santa Cruz). In FIG. 23C shows AR Western blot data obtained from MCF7 cells treated with "AR-ASO 1" at 0 uM (4 negative controls) to 30 aM. The intensity of the AR band (120K in size) in the case of ASO-treated lysates was weaker than the intensity of the adjacent negative control lysates.

AR Example 3 qPCR using SYBR Green for AR mRNA in MCF7 cells treated with "AR-ASO 1".

[ASO Treatment and RNA Extraction] MCF7 cells in 5 ml of culture medium were treated with "AR-ASO 1" at a concentration of 0 cM (negative control) or 1 cM to 1 aM. (2 culture dishes per concentration). After 5 hours, total RNA was extracted using the "MiniBEST Universal RNA Extraction Kit" according to the manufacturer's instructions (Cat. No. 9767, Takara).

[Oligo-dT cDNA Synthesis] 500 ng of template RNA were subjected to cDNA synthesis in the oligo-dT background according to the manufacturer's instructions (Cat. No. 6110A, Takara).

[First PCR] The cDNA was then subjected to 1st PCR against the background of a set of exon-specific primers [AR exon 3_forward: (5'→3')TGGGTGTCACTATGGAGC; and AR-exon 9_reverse: (5'→3')GGGTGTGGAAATAGATGGG] according to the following cycling regimes: 94 ^o C for 2 min followed by 15 cycles, each consisting of 15 sec at 94 ^o C, 30 sec at 55 ^o C and 2 minutes at 72 ^° C.

[Nested PCR] The 1st PCR products were diluted 2000-fold, and 1 μl of each diluted PCR product was subjected to a 20 μl volume real-time PCR reaction against the background of exon-specific primer sets [AR-exon 4_forward(q): ( 5'→3') GACCATGTTTTGCCCATTG; AR exon 4_reverse(q): (5'→3')GGCTCTTTTGAAGAAGACC; AR exon 5_straight(q): (5'→3')GAAACAGAAGTACCTGTGC; AR exon 5_reverse(q): (5'→3')GTCATCCCTGCTTTCATAAC; AR exon 6_straight(q): (5'→3')CGGAAGCTGAAGAAACTTG; AR exon 6_reverse(q): (5'→3')CACTTGACCACGTGTACAAG]. PCR reactions were examined using SYBR Green (Takara, Japan). Cycling regimens: 95 ^° C for 3 min followed by 40 cycles, each consisting of 5 sec at 95 ^° C and 30 sec at 60°C. ^Exon levels gradually but significantly decreased as the dose was increased from 1 to 100 mM. The reductions were 40~50% in cells treated with "AR-ASO 1" at a concentration of 100 cM [cf. fig. 24A]. However, exon levels returned close to those of the negative control in cells treated with "AR-ASO 1" at 1 am.

AR Example 4 qPCR using SYBR Green for AR mRNA in MCF7 cells treated with "AR-ASO 5".

"AR-ASO 5" listed in Table 3 is a 12-mer ASO fully complementary to the region at the 5' splicing site spanning the junction of exon 5 and intron 5 in human AR pre-mRNA. "AR-ASO 5" binds complementarily to the 12mer sequence as indicated by "bold" and "underline" in the 20mer pre-mRNA sequence [(5'→3')GCC UUGCCUG | guaag gaaaal. "AR-ASO 5" has the ability to overlap 7-dimensionally with exon 5 and 5-dimensionally overlap with intron 5.

"AR-ASO 5" was evaluated for its ability to induce changes in exon levels in mRNA for AR by qPCR according to the methods described in "AR Example 3". As shown in FIG. 24B, exon levels in AR were significantly (Student's t-test) reduced by approximately 60~80% in cells treated with "AR-ASO 5" at a concentration of 1-1000 uM.

In contrast to the "AR-ASO 1" case (cf. "AR-example 3"), there was no rebound in informational exon levels at 1000 µM "AR-ASO 5".

AR Example 5 qPCR using the TaqMan probe for AR mRNA in MCF7 cells treated with "AR-ASO 5".

"AR-ASO 5" was evaluated for its ability to reduce human AR mRNA expression by qPCR using a TaqMan probe.

MCF7 cells were treated with "AR-ASO 5" at a concentration of 0 uM (negative control) to 1 aM. (2 cups per concentration). After 24 hours, total RNA was extracted using the "MiniBEST Universal RNA Extraction Kit" according to the manufacturer's instructions (Cat. No. 9767, Takara).

400 ng of template RNA were subjected to cDNA synthesis using a one-step RT-PCR kit (Invitrogen) against the background of a set of exon-specific primers [AR exon 3_forward: (5'→3')TGGGTGTCACTATGGAGC; and AR-exon 9_reverse: (5'→3')GGGTGTGGAAATAGATGGG] according to the following cycling regimes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 15 cycles, each consisting of 30 sec at 94 ^o C, 30 sec at 50 ^o C and 1 min at 72 ^o C.

1 μl of each 50-fold diluted cDNA solution was subjected to a real-time PCR reaction in a volume of 20 μl against the background of a set of exon-specific primers [AR exon 4_forward(q2): (5'→3')TTGTCCATCTTGTCGTCTT; and AR-exon 5_reverse(q2): (5'→3') CCTCTCCTTCCTCCTGTA] according to the following cycling regimes: 95 ^° C for 3 min followed by 40 cycles, each consisting of 15 sec at 95 ^° C and 30 sec at 60 ^ο C. The qPCR reaction was monitored using a TaqMan probe [(5'→3')TTTCTTCAG-ZEN-CTTCCGGGCTC-3IABkFQ]. The TaqMan probe was designed to examine the junction of exon 4 and exon 5 in full-length mRNA for AR.

In FIG. 24C shows qPCR data using the TaqMan probe. The relative expression of the full-length mRNA for AR was significantly (Student's t-test) decreased by approximately 50-70% in cells treated with "AR-ASO 5" at a concentration of 1 cM to 1 aM.

AR Example 6 Inhibition of AR protein expression in the skin of mice injected with "AR-ASO-5" subcutaneously.

The target of "AR-ASO 5" is the AR pre-mRNA sequence, which is conserved in humans and mice. "AR-ASO 5" was evaluated for its ability to inhibit AR protein expression in the skin of mice after a single subcutaneous injection as follows.

[Hair removal and grouping]. On day 0, 7 week old male C57BL/6 mice were anesthetized with zoletil/rompoon and the back hair was trimmed with a hair clipper and removed with carbovac. On day 5, mice with perfect (i.e. clean) hair removal were selected and randomly assigned to five groups: 0 pmol/kg (vehicle only, negative control), 1 pmol/kg, 10 pmol/kg, 100 pmol/kg, and 1000 pmol/kg "AR-ASO 5" (6 animals in each group).

[ASO Injection and Administration] An aqueous stock solution of "AR-ASO 5" was serially diluted in PBS with the addition of 0.1% Tween 80 to prepare solutions of "AR-ASO 5" at a concentration of 0 nM (vehicle only, negative control), 0.5 nM, 5 nM, 50 nM or 500 nM. On day 5, individual mice in each dose group were given a single injection of the test drug at a dose of 2 ml/kg subcutaneously in the back of the head (ie, near the neck).

[Preparation of skin samples]. On day 10, animals were sacrificed to obtain skin samples from the injection site and the thigh as a non-injection site. Skin samples were frozen in liquid nitrogen immediately after collection. Each skin sample was micronized while keeping the sample frozen in liquid nitrogen. Micronized samples were lysed using RIPA buffer supplemented with 1% SDS. Lysates were mixed with 5X sample buffer and boiled for 5 min.

[Western blotting AR]. The lysates were subjected to AR Western blotting on a PVDF membrane. A total of 10 lysates were loaded into each 10% PAAG for electrophoresis, using two separate lysates from each group. The AR protein (120 kDa) was examined using an anti-AR polyclonal antibody (N-20, sc-816, Santa Cruz).

[Quantitative Analysis of AR Protein Expression] Each band for AR on a single PVDF membrane was led to a separate band for β-actin. The average intensity of the AR band (corrected to β-actin) of the two samples of the negative control group (ie, no ASO treatment) was used to adjust the intensities of the AR bands of the other 8 samples on the same PVDF membrane. This double alignment was applied to two other PVDF membranes to quantify AR protein expression in individual samples by densitometry. All levels of AR expression after double reduction of individual samples were pooled for statistical analysis using Student's t-test in relation to the level of expression without ASO treatment.

[Inhibition of AR protein expression]. In FIG. 25A and 25B show AR Western blot data obtained with skin samples from the injection site and the non-injection site, respectively.

In FIG. 26A shows the level of AR protein expression by group as well as by subject. There was a large degree of inter-subject variability in AR protein expression both at the injection site and at the non-injection site. However, AR expression tended to decrease as the dose of ASO was increased.

In FIG. 26B shows the mean AR expression level by group, normalized to the negative control group. At the injection site, AR protein expression was significantly reduced by approximately 35% in the 1000 pmol/kg "AR-ASO 5" injection group. At the non-injection site, AR protein expression was significantly reduced by approximately 40% in the 100 and 1000 pmol/kg injection groups.

The inhibition of AR protein expression observed in skin distal to the injection site indicates that ASO can easily spread to tissues distal to the injection site via the systemic circulation after subcutaneous injection. The ex vivo results were provided to illustrate systemic target damage following subcutaneous injection of a PNA derivative of Formula I and should therefore not be interpreted as limiting the scope of the present invention.

AR example 7 . Exon skipping induced by "AR-ASO 1" (2).

The morphology of MCF7 cells varied depending on passage, cell density, and culture conditions. MCF cells at early passages tended to grow relatively rapidly and exhibited tubercle-shaped colonies. MCF7 cells at later passages are likely to grow slowly and form squamous epithelial colonies. However, maintaining MCF7 cells to exhibit tubercular morphology has been challenging.

"AR-ASO 1" was evaluated for its exon skipping ability in MCF7 cells generally exhibiting tuberculous morphology as described in "AR Example 1" unless otherwise indicated.

[ASO Treatment] MCF7 cells were treated with "AR-ASO 1" for 3 hours at a concentration of 0 (negative control), 30, 100 or 1000 aM (ie 1 fM). (2 culture dishes per concentration of ASO).

[RNA extraction]. Total RNA was extracted using the Rneasy mini-prep kit (p/n 74104, Qiagen) according to the manufacturer's instructions. 500 ng of the RNA template were subjected to a reverse transcription reaction in a volume of 25 μl.

[Results of exon skipping]. In FIG. 27A shows electrophoresis data obtained with nested RT-PCR products. Exon skipping 5 (confirmed by Sanger sequencing: cf. Fig. 27B) was clearly dominant in ASO-treated cells, in contrast to the case of "AR Example 1" (cf. Fig. 23A).

Examples of in vitro and in vivo activity of SCN9A-ASO.

PNA derivatives of formula I that complementarily target multiple splicing sites in pre-mRNA for human SCN9A (sodium channel subtype 9A) were evaluated for their SCN9A antisense and exon skipping activity in cells as well as in animals. Biological examples for these SCN9A-ASOs are provided as examples to illustrate that exon skipping is effectively induced by a compound of Formula I targeting a splicing site in a pre-mRNA target and therefore should not be interpreted as limiting the scope of the present invention SCN9A- ASO.

SCN9A-example 1 . Exon skipping induced by "SCN-ASO 7".

"SCN-ASO 7" listed in Table 4 is a 16-mer ASO fully complementary to the region at the 5' splicing site spanning the junction of exon 4 and intron 4 in human SCN9A pre-mRNA read from the human SCN9A gene ( accessed from the NCBI reference sequence: NC_000002.12). "SCN-ASO 7" binds complementarily to the 16mer sequence as indicated by "bold" and "underline" in the 20mer pre-mRNA sequence [(5'→3') UUGUUUUUGC | guaagu acuu]. "SCN-ASO 7" has the ability to overlap 10-mer with exon 4 and 6-mer overlap with intron 4.

Given that PC3 cells are known to overexpress pre-mRNA for human SCN9A [ Br. J. Pharmacol , vol. 156, 420-431 (2009)], "SCN-ASO 7" was evaluated by SCN9A-specific nested PCR for its ability to induce pre-mRNA exon 4 skipping for human SCN9A in PC3 cells as follows.

[Cell Culture and ASO Treatment] PC3 cells (cat. no. CRL-1435, ATCC) were maintained in Ham's F-12K medium supplemented with 10% FBS, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate in atmosphere with 5% CO ₂ at 37 ^ο C.

PC3 cells grown in a 60 mm culture dish containing 5 ml of medium were treated with SCN-ASO 7 at 0 (negative control), 10, 100 or 1000 µM.

[RNA Extraction] After 18 hours of incubation, PC3 cells were treated with 100 µg/ml cycloheximide for another 6 hours to freeze translation on ribosomes. The total RNA was then extracted from the cells using the "Universal RNA Extraction Kit" (cat. no. 9767, Takara) according to the manufacturer's instructions.

[cDNA synthesis by one-step RT-PCR] 200 ng of RNA template was used for the reverse transcription reaction in a volume of 25 µl using the Super Script® One-step RT-PCR kit with Platinum® Taq polymerase (p/n 10928-042, Invitrogen ) and a set of exon-specific primers [SCN-exon 2_forward: (5'→3')CTTTCTCCTTTCAGTCCTCT and SCN-exon 9_reverse: (5'→3')CGTCTGTTGGTAAAGGTTTT] according to the following cycling regimes: 50 ^οC for 30 min and 94 ^° C for 2 minutes, followed by 40 cycles, each consisting of 30 seconds at 94 ^° C, 30 seconds at 55 ^° C, and 2 minutes at 72 ^° C.

[Nested PCR Amplification] 1 µl cDNA solution (100-fold diluted) was amplified by 20 µl nested PCR (Cat. No. K2612, Bioneer) against the backdrop of a set of exon-specific primers [SCN-exon 3n_forward: (5 '→3')GGACCAAAAATGTCGAGTATTT; and SCN exon 8_reverse: (5'→3')GCTAAAGAAGGCCCAGCTGAA] according to the following cycling regimes: 95 ^o C for 5 min followed by 35 cycles, each consisting of 30 sec at 95 ^o C, 30 sec at 50 ^o C and 1 min at 72 ^ο C.

It should be noted that the primer "SCN-exon 3n_forward" targets the junction of exon 3 and exon 5 to effectively examine the deletion of exon 4, although the 22-mer primer still has the ability to 18-mer complementary overlap with the junction of exon 3 and exon 4 Thus, "SCN-exon 3n_direct" recognizes "junction of exon 3 and exon 5" more selectively than "junction of exon 3 and exon 4" found in full-length mRNA for SCN9A. The primer sequence was designed to detect SCN9A splicing variants lacking exon 4 with greater sensitivity than the full-length mRNA for SCN9A. Such an exon-skipping primer would be useful for detecting mRNA splicing variants with low metabolic stability, since full-length mRNA typically exhibits good metabolic stability achieved over billions of years of evolution.

[Identification of exon skipping products] Nested PCR products were subjected to electrophoretic separation on a 2% agarose gel. Target size bands were harvested and analyzed by Sanger sequencing. Exon 4 skipping was markedly strong in PC3 cells treated with 1 aM "SCN ASO 7", although exon 4 skipping was also noticeable at 10 and 100 µM, as shown in FIG. 28A. The exon skipping band was unambiguously confirmed by Sanger sequencing as shown in FIG. 28b.

SCN9A Example 2 SYBR Green qPCR for SCN9A mRNA in PC3 cells treated with "SCN-ASO 7".

"SCN-ASO 7" was evaluated for its ability to inhibit mRNA expression for human SCN9A in PC3 cells by qPCR against a set of exon-specific primers as follows.

[Cell culture and ASO treatment] PC3 cells grown in a 60 mm culture dish containing 5 ml of culture medium were incubated with "SCN-ASO 7" for 24 hours at a concentration of 0 (negative control), 10, 100, or 1000 uM (2 culture dishes for each concentration)

[RNA Extraction] Total RNA was extracted using the "MiniBEST Universal RNA Extraction Kit" (Cat. No. 767, Takara) according to the manufacturer's instructions.

[cDNA Synthesis by One Step RT-PCR] 200 ng RNA template was reverse transcribed in 20 µl volume using the Super Script® One Step RT-PCR Kit with Platinum® Taq Polymerase (Cat. No. 10928-042, Invitrogen) and against the background of a set of exon-specific primers [SCN-exon 2_forward: (5'→3')CTTTCTCCTTTCAGTCCTCT; and SCN exon 9_reverse: (5'→3')TTGCCTGGTTCTGTTCTT]. Cycling modes: 50 ^° C for 30 minutes and 94 ^° C for 2 minutes, followed by 15 cycles, each consisting of 15 seconds at 94 ^° C, 30 seconds at 55 ^° C, and 2 minutes at 72 ^° C.

[Nested qPCR amplification] 1 µl of each 50-fold diluted cDNA solution was subjected to a real-time PCR reaction in a volume of 20 µl against the backdrop of exon-specific primer sets [SCN-exon 4_forward: (5'→3') GTACACTTTTACTGGAATATATATAC; SCN exon 4_reverse: (5'→3')AATGACGACAAAATCCAGC; SCN exon 5_straight: (5'→3')GTATTTAACAGAATTTGTAAACCT; SCN exon 5_reverse: (5'→3')CTGGGATTACAGAAATAGTTTTCA; SCN exon 6_straight: (5'→3')GAAGACAATTGTAGGGGC; SCN exon 6_reverse: (5'→3')GTCTTCTTCACTCTCTAGGG]. PCR reactions were examined using SYBR Green (Takara, Japan). Cycling modes: 95 ^° C for 30 seconds followed by 40 cycles, each consisting of 5 seconds at 95 ^° C and 30 seconds at 60 ^° C.

[qPCR Results] Individual exon levels in ASO-treated cells were matched to exon levels in negative control cells (ie, no ASO treatment). In FIG. 29(A) summarizes the qPCR results. The expression levels of exons 4-6 were significantly reduced by approximately 70%, 40% and 20~30% at concentrations of 10, 100 and 1000 µM, respectively.

SCN9A Example 3 SYBR Green qPCR for SCN9A mRNA in PC3 cells treated with "SCN-ASO 3".

"SCN-ASO 3" listed in Table 4 is a 14-mer ASO targeting the 5' splicing site spanning the junction of exon 4 and intron 4 in pre-mRNA for human SCN9A. "SCN-ASO 3" binds complementarily to the 12mer sequence as indicated by "bold" and "underline" in the 20mer pre-mRNA sequence [(5'→3')UUG UUUUUGC | gua "ag" ua cuu], in which two inconsistencies are marked with a quotation mark (""). "SCN-ASO 3" is capable of 7-mer complementary overlap with exon 4 and 5-mer complementary overlap with intron 4.

"SCN-ASO 3" was evaluated for its ability to inhibit full-length mRNA expression for SCN9A in PC3 cells according to the protocol described in "SCN9A-Example 2" unless otherwise indicated.

qPCR results are presented as shown in FIG. 29b. Expression levels of exons 4-6 were significantly reduced by >90%, approximately 70% and approximately 80% at concentrations of 10, 100 and 1000 µM, respectively. As with "SCN-ASO 7", 10 cM showed the greatest inhibition of full-length mRNA for SCN9A.

SCN9A Example 4 SYBR Green qPCR for SCN9A mRNA in PC3 cells treated with "SCN-ASO 8".

"SCN-ASO 8" listed in Table 4 is a 17-mer ASO targeting a region at the 5' splicing site spanning the junction of exon 4 and intron 4 in pre-mRNA for human SCN9A. "SCN-ASO 8" binds complementarily to the 15mer sequence as indicated by "bold" and "underline" in the 20mer pre-mRNA sequence [(5'→3') UUGUUUUUGC | gua "ag" ua cuu], in which the inconsistency is marked with a quotation mark (""). "SCN-ASO 8" has a 10-mer complementary overlap with exon 4 and a 5-mer complementary overlap with intron 4 in pre-mRNA for human SCN9A.

"SCN-ASO 8" was evaluated for its ability to inhibit full-length mRNA expression for SCN9A in PC3 cells according to the protocol described in "SCN9A-Example 2" unless otherwise indicated.

qPCR results are presented as shown in FIG. 29C. The expression levels of exons 4-6 were significantly reduced by 50~70% and 70~80% at 10 and 100 µM, respectively.

SCN9A Example 5 Sodium current inhibition according to CoroNa assay in PC3 cells treated with "SCN-ASO 7".

The sodium current in the cells is measured by a patch clamp (fixation of potentials). When sodium ions enter the cell, the intracellular level of sodium ions increases. The intracellular sodium level can be measured using a dye that is sensitive to sodium ions. CoroNa Green is a crown ether type sodium ion chelator. When chelated with sodium ion, CoroNa Green emits green fluorescence. CoroNa Green has been used to indirectly measure intracellular sodium levels. Sodium levels measured using "CoroNa Green" have been found to correlate well with sodium ion current measured by clamping potentials generated by sodium ions [ Proc. Natl. Acad. sci. USA vol. 106(38), 16145-16150 ( 2009 )]

PC3 cells are known to overexpress mRNA for human SCN9A, although there are other co-expressed SCN subtypes [ Br. J Pharmacol . vol 156, 420-431 ( 2009 )]. Thus, inhibition of SCN9A mRNA expression can lead to a significant decrease in sodium current in PC3 cells if the sodium ion current through the sodium channel subtype Na _v 1.7 occupies a significant part of the total sodium ion current in PC3 cells. It should be noted that the SCN9A mRNA encodes the sodium channel subtype Na _v 1.7.

"SCN-ASO 7" was evaluated for its ability to inhibit sodium ion current in PC3 cells using "CoroNa Green" as follows.

[ASO Treatment] PC3 cells grown in a 35 mm culture dish containing 2 ml of F-12K medium were treated with "SCN-ASO 7" at a concentration of 0 uM (negative control), 100 uM, or 1 aM.

[CoroNa Assay] After 30 hours, the cells were washed with 2 ml of HBSS (Hanks' balanced salt solution, Cat. No. 14025-092, Life Technologies), and then 2 ml of fresh HBSS was added. The cells were then treated with 5 μM "CoroNa Green" (Cat. No. ^C36676 , Life Technologies) at 37°C. After 30 min, the cells were washed twice with 2 ml HBSS, and 2 ml fresh HBSS was added. The culture dish was mounted on an Olympus fluorescent microscope equipped with a digital video camera to continuously capture green fluorescent images of the cells. Cells were abruptly treated with 100 mM NaCl, and then changes in cell fluorescence images were digitally recorded for 3 min. On average there were approximately 4 cells in each frame. The fluorescence intensity of each individual cell was monitored to the nearest second. Records of intracellular fluorescence intensities of individual cells were overlaid and averaged at each time point. Average records from individual cells at each ASO concentration were plotted as shown in FIG. 30A using ImageJ software (version 1.50i, NIH). The mean fluorescence intensity record was taken as an individual record of intracellular sodium concentration for cells treated with "SCN-ASO 7" at a concentration of 0 (negative control), 100 or 1000 uM.

[Results of analysis using CoroNa] The observed intracellular fluorescence intensity records are summarized in FIG. 29b. Records (curves) of fluorescence intensity for cells treated with 1000 μM "SCN-ASO 7" were located below the records for cells without ASO treatment. The average fluorescence intensity of the cells without ASO treatment was 81.86 (arbitrary units) at time point 100 sec. Meanwhile, the average fluorescence intensity of the cells treated with 1000 μM "SCN-ASO 7" was 51.47 (arbitrary units) at the time point of 100 sec. Thus, a 30-hour incubation with 1000 µM "SCN-ASO 7" induced a significant decrease in sodium channel activity by 37% (p<0.05 by Student's t-test) in PC3 cells. Considering that PC3 cells express various voltage-gated sodium channel (VGSC) subtypes, a 37% reduction is considered to be significant for the inhibition of Na _v 1.7 expression by "SCN-ASO 7". There was no noticeable decrease in sodium current in cells treated with 100 uM "SCN-ASO 7".

SCN9A example 6 . Sodium current inhibition assayed using CoroNa in PC3 cells treated with "SCN-ASO 3".

"SCN-ASO 3" was evaluated for its ability to inhibit sodium current in PC3 cells using "CoroNa Green" according to the protocol described in "SCN9A-example 5", unless otherwise indicated.

The observed cell fluorescence intensity records are shown in FIG. 30b. The average record (curve) of fluorescence intensity was lower in cells treated with "SCN-ASO 3" than in cells without ASO treatment. The mean fluorescence intensity of the cells without ASO treatment was 89.32 (arbitrary units) at time point 100 sec. Meanwhile, the average fluorescence intensity of the cells treated with 1000 μM "SCN-ASO 3" was 61.36 (arbitrary units) at the time point of 100 sec. Thus, 1000 uM "SCN-ASO 3" significantly (p<0.01) reduced sodium current by 31% in PC3 cells. The reduction induced by 100 mM "SCN-ASO 3" was 18%, although not significant.

SCN9A Example 7 Sodium current inhibition in PC3 cells treated with "SCN-ASO 8".

"SCN-ASO 8" was evaluated for its ability to inhibit sodium current in PC3 cells using "CoroNa Green" according to the protocol described in "SCN9A-example 3", unless otherwise indicated.

The observed cell fluorescence intensity records are shown in FIG. 30C. The average record (curve) of fluorescence intensity was lower in cells treated with "SCN-ASO 8" than in cells without ASO treatment. The mean cellular fluorescence intensity of cells without ASO treatment was 130.32 (arbitrary units) at time 100 sec. Meanwhile, the average fluorescence intensity of the cells treated with 1000 μM "SCN-ASO 8" was 89.7 (arbitrary unit) at the time point of 100 sec. Thus, 1000 uM "SCN-ASO 8" significantly (p<0.001) reduced sodium current by 31% in PC3 cells. The reduction caused by 100 μm "SCN-ASO 8" was 30% (p<0.001).

SCN9A Example 8 Exon skipping induced by "SCN-ASO 27" in PC3 cells (A).

"SCN-ASO 27" listed in Table 5 is a 14-mer ASO fully complementary to the 3' splicing site spanning the junction of "intron 3" and "exon 4" in pre-mRNA for human SCN9A. The 14-mer target sequence at the 3' splicing site is marked "bold" and "underlined" in the 20-mer pre-mRNA sequence for SCN9A [(5'→3') uugu guuuag | GUACACUU UU]. "SCN-ASO 27" has a 6-dimensional overlap with "intron 3" and an 8-dimensional overlap with "exon 4".

"SCN-ASO 27" was evaluated for its ability to induce "exon 4" skipping in PC3 cells as described in "SCN9A-Example 1" unless otherwise indicated.

[Cell culture and ASO treatment] PC3 cells grown in a 60 mm culture dish containing 5 ml of culture medium were treated with "SCN-ASO 27" at a concentration of 0 (negative control), 1, 10, or 100 µM.

[Nested PCR Amplification] 1 µl cDNA was further amplified in a 20 µl volume nested PCR reaction (Cat. No. K2612, Bioneer) against the backdrop of a set of exon-specific primers [SCN exon 2n_forward: (5'→3')CCACCGGACTGGACCAAAAAA; and SCN exon 9n_reverse: (5'→3')GCTAAAGAAGGCCCAGCTGAA] according to the following cycling regimes: 95 ^o C for 2 min followed by 34 cycles, each consisting of 30 sec at 95 ^o C, 30 sec at 55 ^o C and 1 min at 72 ^ο C.

[Identification of Exon Skipping Products] FIG. 31A shows electrophoresis data of nested PCR products in which cells treated with "SCN-ASO 27" gave a strong band for the PCR product attributed to exon skipping 4-5. However, the band intensity for the full-length mRNA PCR product for SCN9A was stronger in the 10 µM and 100 µM ASO samples than in the negative control samples. The strange dose-response behavior in nested PCR could be due to transcriptional activation caused by "exon(s) and intron(s) circular RNA (EIciRNA)" accumulated during exon skipping by "SCN-ASO 27" [ Nature struc. Mol. Biol , vol. 22 (3), 256-264 (2015)]. Using Sanger sequencing, it was confirmed that the PCR product in the case of exon skipping corresponded to exon skipping 4-5 (cf. Fig. 31B)

SCN9A Example 9 Exon skipping induced by "SCN-ASO 27" in PC3 cells (B).

"SCN-ASO 27" was evaluated for its ability to induce "exon 4" skipping in PC3 cells as described in "SCN9A-Example 8" unless otherwise indicated. In this experiment, PC3 cells were treated with "SCN-ASO 27" at a concentration of 0 (negative control), 1, 10, 100 and 1000 aM for 24 hours.

[Amplification by nested PCR]. The nested PCR reaction was performed against the background of the primer set [SCN-exon 3/6_forward: (5'→3')GGACCAAAAATGTCGAGCCT; and SCN exon 9n_reverse: (5'→3') GCTAAGAAGGCCCAGCTGAA], designed to selectively amplify a product having the sequence of the junction of exon 3 and exon 6.

Of note, the primer sequence "SCN-exon 3/6_forward" targets the junction of exon 3 and exon 6 to study exon skipping 4-5, although the 20-mer primer still retains the ability to 17-mer complementary overlap with the exon junction 3 and exon 4. Thus, the primer sequence "SCN-exon 3/6_forward" recognizes "junction of exon 3 and exon 6" more selectively than "junction of exon 3 and exon 4" found in full-length mRNA for SCN9A. The primer sequence was designed to detect the SCN9A splicing variant lacking exons 4-5 with greater sensitivity than the full-length mRNA for SCN9A. Such an exon-skipping primer would be useful for detecting mRNA splicing variants with low metabolic stability, since full-length mRNA typically exhibits good metabolic stability achieved over billions of years of evolution.

In FIG. 31C shows electrophoresis data of nested PCR products in which cells treated with "SCN-ASO 27" gave a strong band for the PCR product attributed to exon skipping 4-5, which was confirmed by Sanger sequencing.

SCN9A Example 10 One step qPCR cDNA synthesis for SCN9A mRNA in PC3 cells treated with "SCN-ASO 27".

"SCN-ASO 27" was evaluated by SCN9A-specific nested qPCR for its ability to induce mRNA level changes for human SCN9A in PC3 cells as described in "SCN9A-Example 2" unless otherwise indicated.

[ASO Treatment] PC3 cells were treated with "SCN-ASO 27" at a concentration of 0 (negative control), 0.1, 1, or 10 aM for 24 hours (2 culture dishes per ASO concentration).

[cDNA synthesis by one-step PCR] 200 ng of RNA template was subjected to a 25 µl volume reverse transcription reaction using a one-step RT-PCR kit (Invitrogen, USA) against the background of a set of exon-specific primers [SCN-exon 2_forward: (5'→3')CTTTCTCCTTTCAGTCCTCT; and SCN exon 8/9_reverse: (5'→3') ^{CGTCTGTTGGTAAAGGTTTT} ] according to the following cycling regimes: 50°C for 30 min and 94 ^° C for 2 min, followed by 15 cycles, each consisting of 30 sec at 94 ^° C, 30 sec at 55 ^° C and 2 min at 72 ^° C.

[Nested qPCR amplification] 1 µl of each 100-fold diluted cDNA solution was subjected to a real-time PCR reaction in a volume of 20 µl in the background of a set of exon-specific primers [SCN exon 3_forward: (5'→3')TGACCATGAATAACCCAC ; and SCN-exon 4_reverse(2): (5'→3')GCAAGGATTTTTACAAGT] according to the following cycling regimes: 95 ^° C for 30 sec followed by 40 cycles, each consisting of 5 sec at 95 ^° C and 30 sec at 60 ^° C. The qPCR reaction was monitored using the TaqMan probe [(5'→3')5,6-FAM-GGACCAAAA-Zen-ATGTCGAGTACAC-3IABkFQ] targeted at the junction of exon 3 and exon 4 in the full-length mRNA for SCN9A.

The level of full-length mRNA for SCN9A was significantly (by Student's t-test) decreased in cells treated with "SCN-ASO 27" by approximately 35-45%, as shown in FIG. 32A.

SCN9A-example 11 . qPCR by cDNA synthesis using random hexamers for SCN9A mRNA in PC3 cells treated with "SCN-ASO 27".

"SCN-ASO 27" was evaluated by SCN9A-specific qPCR for its ability to induce mRNA level changes for human SCN9A in PC3 cells as described in "SCN9A-Example 10" unless otherwise indicated. cDNA was synthesized using random hexamers and subjected to an SCN9A-specific qPCR reaction using a TaqMan probe.

The level of full-length mRNA for SCN9A was significantly (by Student's t-test) decreased in cells treated with "SCN-ASO 27" by approximately 50-60%, as shown in FIG. 32b.

SCN9A-Example 12 Sodium current inhibition according to CoroNa assay in SNL-activated rat L5 DRG cells with "SCN-ASO 27".

"SCN-ASO 27" is a 14mer SCN9A-ASO fully complementary to human SCN9A pre-mRNA but has one mismatch with rat SCN9A pre-mRNA read from rat genomic DNA [NCBI reference sequence: NC_000002.12] . "SCN-ASO 27" has 13mer complementary overlap capability and has one mismatch with pre-mRNA for rat SCN9A as noted by "bold" and "underline" in the 20mer rat pre-mRNA sequence [(5'→3')uuuc"c" uuuag | GUACACUU UU], in which one inconsistency is marked with a quotation mark ("").

"SCN-ASO 27" was evaluated for its ability to inhibit sodium ion current in rat DRG cells using "CoroNa Green" as follows.

[Spinal Nerve Ligation] Spinal nerve ligation (SNL) causes neuropathy in dorsal root ganglia (DRG) and spinal cord, and has been widely used as a neuropathic pain model [ Pain vol 50 (3), 355-363 (1992)]. However, depending on how the spinal nerve(s) are ligated, there may be several variations of SNL. The degree and duration of neuropathy in the DRG appears to vary depending on how the spinal nerve(s) are ligated [ Pain vol 43 (2), 205-218 (1990)]. Double L5 and L6 spinal nerve ligation (i.e., "L5/L6 ligation") causes more severe and longer-lasting neuropathy than L5 spinal nerve ligation alone (i.e., "L5 ligation").

[SNL surgery with L5/L6 ligation]. On day 0, 6 week old male SD rats were anesthetized with zoletil/rompun. The spinal nerves L5 and L6 (left side) were then exposed and tightly bandaged. Muscles and skin were closed and trimmed using appropriate aseptic procedures. The rats were occasionally tested for von Frey sensitivity over a period of 4 weeks.

[Preparation of nerve cells DRG]. On day 31, a rat with a low von Frey score was sacrificed to retrieve both the left (bandaged side) and right (non-bandaged side) DRG. DRG was immersed in 0.5 ml PBS immediately after extraction. DRG cells were prepared as follows according to the procedures disclosed in the literature [Methods Mol Biol. vol 846, 179-187 (2012);PLOS One vol 8(4); e60558 (2013)].

DRG погружали в пробирку Эппендорфа объемом 1,5 мл, содержащую 0,2 мл 0,125% коллагеназы (коллагеназы типа IV, кат. № C5138-100MG, Sigma) в HBSS (сбалансированном солевом растворе Хенкса, кат. № 14025-092, Life Technologies), нарезали ножницами на мелкие кусочки и инкубировали в течение 20 мин в термостате при 37^οC при 5% CO₂ и относительной влажности 95%;

добавляли 50 мкл 0,25% трипсина/ЭДТА в пробирку Эппендорфа, которую хранили в термостате еще 10 мин,

в пробирку Эппендорфа вносили 1 мл полной среды DMEM, и ее подвергали осаждению центрифугированием при 600хg в течение 5 мин,

полученный осадок суспендировали в 4 мл среды Neurobasal-А (среды Neurobasal®, кат № 21103-049, Gibco), дополненной 2X В-27 (В-27®, не содержащей сыворотки добавкой, кат № 17504-044, Gibco), 1X пенициллином/стрептомицином, 1X L-глютамином, и 1 мл клеточной суспензии осторожно высевали на покрытое ламинином покровное стекло (кат. № GG-25-1,5-ламинин, Neuvitro), помещаемое в 35 мм-чашку для культивирования;

через один день после посева в чашку осторожно вносили еще 1 мл свежей среды Neurobasal-A;

через два дня после посева среду заменяли на 2 мл свежей среды Neurobasal-A с добавлением 1 мкМ Ara-C (кат. № C1768-100MG, Sigma) для селективного подавления роста клеток, отличных от нервных клеток DRG;

через четыре дня после посева среду снова заменяли 2 мл свежей среды Neurobasal-A с добавлением 1 мкМ Ara-C; и

через пять или шесть дней после посева нервные клетки DRG обрабатывали «SCN-ASO 27».

The DRG was immersed in a 1.5 ml Eppendorf tube containing 0.2 ml of 0.125% collagenase (collagenase type IV, cat. no. C5138-100MG, Sigma) in HBSS (Hanks' balanced salt solution, cat. no. 14025-092, Life Technologies ), cut with scissors into small pieces and incubated for 20 min in a thermostat at 37 ^ο C at 5% CO ₂ and 95% relative humidity;

50 μl of 0.25% trypsin/EDTA was added to an Eppendorf tube, which was kept in a thermostat for another 10 minutes,

1 ml of complete DMEM medium was added to the Eppendorf tube, and it was subjected to sedimentation by centrifugation at 600xg for 5 min,

the resulting pellet was suspended in 4 ml of Neurobasal-A medium (Neurobasal® media, cat no. 21103-049, Gibco) supplemented with 2X B-27 (B-27®, serum-free supplement, cat no. 17504-044, Gibco), 1X penicillin/streptomycin, 1X L-glutamine, and 1 ml of the cell suspension were carefully seeded onto a laminin-coated coverslip (Cat. No. GG-25-1,5-laminin, Neuvitro) placed in a 35 mm culture dish;

one day after inoculation, another 1 ml of fresh Neurobasal-A medium was carefully added to the dish;

Two days after seeding, the medium was replaced with 2 ml of fresh Neurobasal-A medium supplemented with 1 μM Ara-C (Cat. No. C1768-100MG, Sigma) to selectively inhibit the growth of cells other than DRG nerve cells;

four days after seeding, the medium was again replaced with 2 ml of fresh Neurobasal-A medium supplemented with 1 μM Ara-C; and

five or six days after seeding, DRG nerve cells were treated with "SCN-ASO 27".

[ASO treatment and analysis using CoroNa] L5 DRG nerve cells with either L5/L6 ligation or no L5/L6 ligation were treated with "SCN-ASO 27" at a concentration of 0 (negative control), 100 or 1000 µM. After 30 hours the cells were washed with 2 ml HBSS and then 2 ml fresh HBSS was added. The cells were then treated with 5 μM " ^CoroNa Green" at 37°C. After 30 min, the cells were washed twice with 2 ml HBSS, and 2 ml fresh HBSS was added. The culture dish was mounted on a fluorescent microscope equipped with a charge-coupled camera to continuously capture green fluorescent images of the cells. Cells were abruptly treated with 10 mM NaCl, and then changes in cell fluorescence intensity were digitally recorded for 300 sec. In the case of each image capture, there were 4 to 5 cells per frame. The fluorescence intensity of each individual cell was monitored to the nearest second. Intracellular fluorescence intensity records from individual cells were averaged using the ImageJ software (version 1.50i, NIH) and the average records are shown in FIG. 33A and 33B for cells with "L5/L6 ligation" and without "L5/L6 ligation", respectively. The mean fluorescence intensity was taken as an individual record of the intracellular sodium concentration for cells treated with SCN-ASO 27 at 0 (negative control), 100 or 1000 µM.

[Results of analysis using CoroNa] In cells stimulated with L5/L6 ligation (cf. Fig. 33A), a 30-hour exposure to "SCN-ASO 27" at a concentration of 100 μM or 1 aM gave a significant (according to Student's t-test) reduction the average intensity of cellular fluorescence by 80-85% at a time point of 150 sec.

In cells without L5/L6 ligation (cf. Fig. 33B), a 30-hour exposure to "SCN-ASO 27" at 1 aM resulted in a decrease in fluorescence intensity of approximately 50%. In the case of unstimulated cells exposed to "SCN-ASO 27" at a concentration of 100 mM, there was no decrease in fluorescence intensity. The fluorescence intensity of cells without L5/L6 ligation was significantly less than that of cells stimulated with L5/L6 ligation, suggesting that L5/L6 induce marked activation of Na _v 1.7 sodium channel function.

DRG nerve cells are known to express various VGSC subtypes without neuropathic stimulation, including Na _v 1.7, Na _v 1.8, Na _v 1.2, etc. The Na _v 1.7 subtype shows a limited contribution to the total sodium current in DRG nerve cells without stimulation [ Nature Comm . vol 3, Article Number 791: DOI:10.1038/ncomms1795 ( 2012 )]. DRG nerve cells without L5/L6 ligation may show a limited contribution to sodium current from the Na _v 1.7 subtype.

Meanwhile, nerve cells are known to upregulate Na _v 1.7 expression in response to persistent neuropathy [ J Biol Chem. vol 279(28), 29341-29350( 2004 ); J Neurosci. vol 28(26), 6652-6658 ( 2008 )]. SCN-ASO 27 at both 100 µM and 1 aM inhibited sodium current by 80-85% in nerve cells stimulated with L5/L6 ligation. The higher degree of sodium current inhibition by "SCN-ASO 27" in DRG cells with "L5/L6 ligation" is consistent with Na _v 1.7 activation in nerve cells due to chronic neuropathy.

SCN9A Example 13 Inhibition of Na _v 1.7 protein expression in DRG L5 nerve cells with "SCN-ASO 30".

"SCN-ASO 30" is a 14-mer ASO fully complementary to rat SCN9A pre-mRNA, while "SCN-ASO 27" is a 14-mer ASO fully complementary to human SCN9A pre-mRNA. "SCN-ASO 30" has one mismatch with "SCN-ASO 27" at the C-terminus. "SCN-ASO 30" against rat SCN9A pre-mRNA can serve as a good model ASO for "SCN-ASO 27" against human SCN9A pre-mRNA.

"SCN-ASO 30" was evaluated for its ability to inhibit Na _v 1.7 protein expression in rat DRG nerve cells as described below.

[Preparation of Nerve Cells DRG] Male SD rats (7 weeks old) were subjected to a tight "L5/L6 ligation". After 7 days, 4 rats were anesthetized with Zoletil/Rompun to sample DRG L5 from the ligated side. DRGs were combined and processed to obtain DRG nerve cells as described in "SCN9A Example 12".

[ASO Treatment] DRG nerve cells were treated with "SCN-ASO 30" at a concentration of 0 (negative control), 10, 100, or 1000 µM for 24 hours, and then subjected to Western blot lysis in the presence of an antibody against the C-terminus of the Na protein _v 1.7 (cat. no. ab85015, Abeam). β-actin was investigated for comparison.

[Inhibition of the expression of Na _v 1.7]. In FIG. 34A shows Western blot data obtained from DRG nerve cells treated with "SCN-ASO 30" at 0 (negative control), 10, 100, or 1000 µM. All lysates produced a strong band at the 170 K position that could be attributed to a fragment or metabolite of the full-length Na _v 1.7 protein. The band for the full length Na _v 1.7 protein was found at the position corresponding to 220~240 K with negative control lysates and 10 µM "SCN-ASO 30" only. Thus, Na _v 1.7 expression was markedly inhibited in rat DRG nerve cells after 24 h incubation with "SCN-ASO 30" at 100 and 1000 nM.

SCN9A example 14 . Inhibition of sodium current in rat DRG L5 nerve cells with "SCN-ASO 30".

"SCN-ASO 30" was evaluated for its ability to inhibit sodium current in rat DRG L5 nerve cells stimulated with L5/L6 ligation as indicated below.

DRG погружали в пробирку Эппендорфа объемом 1,5 мл, содержащую 0,2 мл 0,125% коллагеназы в HBSS, нарезали ножницами на мелкие кусочки и инкубировали в течение 20 мин в термостате при 37^ο C при 5% CO₂ и относительной влажности 95%;

добавляли 50 мкл 0,25% трипсина/ЭДТА в пробирку Эппендорфа, и пробирку Эппендорфа хранили в термостате еще 10 мин,

в пробирку Эппендорфа вносили 1 мл полной среды DMEM, и ее подвергали осаждению центрифугированием при 600хg в течение 5 мин,

затем полученный осадок суспендировали в 4 мл среды Neurobasal-А (среды Neurobasal®, кат № 21103-049, Gibco), дополненной 2X В-27 (В-27®, не содержащей сыворотки добавкой, кат № 17504-044, Gibco), 1X пенициллином/стрептомицином, 1X L-глютамином;

суспензию клеток DRG переносили на приблизительно один часа в закрытом виде в 15-мл пробирку фирмы Falcon, содержащую приблизительно 15 мл среды Neurobasal-A;

0,5 мл суспензии клеток осторожно высевали на покрытое ламинином покровное стекло, помещенное в лунку 24-луночного планшета для культивирования;

клетки, высеянные в планшет для культивирования, инкубировали в термостате с CO₂ при 37^οC в течение 2 часов для прикрепления клеток к покровному стеклу, а затем обрабатывали «SCN-ASO 30» в концентрации 0 (отрицательный контроль) или 100 цМ в течение 4 часов в термостате; и

нервные клетки DRG подвергали измерению натриевого тока с помощью анализа с использованием патч-клампа вручную на устройстве для фиксации потенциалов, генерированных ионами натрия (Axopatch 200B Amplifier, Axon Instruments).[Preparation of Nerve Cells DRG] Male SD rats (6 weeks old) were subjected to a tight "L5/L6 ligation". After 7 days, rats were anesthetized with Zoletil/Rompun to extract DRG L5 from the ligated side. DRG L5 nerve cells were prepared as follows:

DRG was immersed in a 1.5 ml Eppendorf tube containing 0.2 ml of 0.125% collagenase in HBSS, cut into small pieces with scissors and incubated for 20 min in an incubator at 37 ^οC at 5% CO ₂ and 95% relative humidity;

50 µl of 0.25% trypsin/EDTA was added to the Eppendorf tube, and the Eppendorf tube was kept in the incubator for another 10 min,

1 ml of complete DMEM medium was added to the Eppendorf tube, and it was subjected to sedimentation by centrifugation at 600xg for 5 min,

the resulting pellet was then suspended in 4 ml of Neurobasal-A medium (Neurobasal® media, cat no. 21103-049, Gibco) supplemented with 2X B-27 (B-27®, serum free supplement, cat no. 17504-044, Gibco), 1X penicillin/streptomycin, 1X L-glutamine;

the DRG cell suspension was transferred for approximately one hour, closed, into a 15 ml Falcon tube containing approximately 15 ml of Neurobasal-A medium;

0.5 ml of the cell suspension was carefully seeded onto a laminin-coated coverslip placed in the well of a 24-well culture plate;

cells seeded in a culture plate were incubated in a CO ₂ incubator at 37 ^οC for 2 hours to attach the cells to the coverslip, and then treated with "SCN-ASO 30" at a concentration of 0 (negative control) or 100 μM for 4 hours in a thermostat; and

DRG nerve cells were subjected to sodium current measurement by manual patch clamp analysis on a sodium ion potential fixator (Axopatch 200B Amplifier, Axon Instruments).

[Results of Patch Clamp Analysis] FIG. 34B shows sodium current data adjusted for cell size. After incubation with 100 µM "SCN-ASO 30" for 4 hours, sodium current significantly (p<0.01 by Student's t-test) decreased by approximately 90% in DRG nerve cells expressing tetrodotoxin-sensitive sodium channels, i.e. . in nerve cells of small size (N=4 cells per group).

SCN9A-example 15 . qPCR by one-step cDNA synthesis for SCN9A mRNA in rat DRG cells treated with "SCN-ASO 30".

"SCN-ASO 30" was evaluated by SCN9A-specific nested qPCR for its ability to inhibit mRNA expression for SCN9A in rat DRG cells as follows.

[Preparation of DRG L5 Cells] A 4-week-old male SD rat was anesthetized with Zoletil/Rompun to extract DRG L5. DRG samples were pooled and processed to prepare L5 DRG cells as described in "SCN9A-Example 12".

[ASO Treatment] Rat DRG cells were treated with "SCN-ASO 30" at a concentration of 0 (negative control), 10, 30, 100, 300, or 1000 µM (1 culture dish per ASO concentration)

[RNA Extraction and cDNA Synthesis by One Step PCR] After 24 hours, total RNA was extracted from the cells using the "Universal RNA Extraction Kit" (Cat. No. 9767, Takara) according to the manufacturer's instructions. 200 ng of template RNA was used for the reverse transcription reaction in a volume of 25 µl using a one-step RT-PCR kit (Invitrogen, USA) against the background of a set of exon-specific primers [SCN-exon 2(3)_forward: (5'→3')CAATCTTCCGTTTCAACGCC; and SCN-exon 10_reverse: (5'→3') ACCACAGCCAGGATCAAGTT] according to the following cycling regimes: 50 ^o C for 30 min and 94 ^o C for 2 min, followed by 15 cycles, each consisting of 30 sec at 94 ^o C, 30 sec at 55 ^o C and 2 min at 72 ^o C.

[Nested qPCR Amplification] 1 µl of each cDNA solution (duplicate per concentration) diluted 100-fold was subjected to a real-time PCR reaction in a volume of 20 µl using a TaqMan probe (p/n Rn01514993_mH, ThermoFisher) targeting junction of exon 3 and exon 4 of SCN9A, according to the following cycling regimes: 95 ^° C for 30 sec followed by 40 cycles, each consisting of 5 sec at 95 ^° C and 30 sec at 60 ^° C.

In FIG. 35A shows qPCR data. The expression level of the full-length mRNA for SCN9A was significantly (by Student's t-test) decreased in cells treated with "SCN-ASO 30" by about 45~60%, although there was one culture dish for each concentration of ASO.

SCN9A example 16 . qPCR by cDNA synthesis using random hexamers for SCN9A mRNA in rat DRG cells treated with "SCN-ASO 30".

"SCN-ASO 30" was evaluated by SCN9A-specific qPCR for its ability to inhibit mRNA expression for SCN9A in rat DRG L5 cells. Total RNA was prepared as described in "SCN9A Example 15" and subjected to cDNA synthesis using random hexamers. cDNA solutions (duplicate for each ASO concentration) were diluted 100-fold and 1 µl of each diluted PCR product was subjected to a 20 µl volume real-time PCR reaction using a TaqMan probe aimed at the junction of exon 3 and exon 4 of SCN9A, in according to the following cycling regimes: 95 ^° C for 30 seconds followed by 40 cycles, each consisting of 5 seconds at 95 ^° C and 30 seconds at 60 ^° C.

The cDNA solutions were also subjected to qPCR amplification for GAPDH mRNA. mRNA Ct values for SCN9A resulted in mRNA Ct values for GAPDH.

In FIG. 35B shows SCN9A-specific qPCR data converted to GAPDH. The expression level of full-length mRNA for SCN9A significantly (Student's t-test) decreased in cells treated with "SCN-ASO 30" by approximately 45~75%.

SCN9A example 17 . Reversal of allodynia by SCN9A-ASO in rats with diabetic peripheral neuropathic pain.

The SCN9A gene encodes the α-subunit of the Na _v 1.7 VGSC subtype. There is a very small number of individuals who do not experience severe pain but are normal in other sensory functions. In such individuals, the SCN9A gene was found to be mutated to encode a non-functional Na _v 1.7 subtype [ Nature vol 444, 894-898 (2006) ]. This has been termed "channelopathy SCN9A". The behavioral phenotypes of human SCN9A channelopathy have been reproduced quite frequently in SCN9A knockout mice [ PLOS One 9(9): e105895 ( 2014 )]. Thus, the SCN9A-ASOs of formula I may exhibit analgesic activity in animal models of pain accompanying an increase in Na _v 1.7 expression.

"SCN-ASO 7", "SCN-ASO 8", "SCN-ASO 21", "SCN-ASO 35", "SCN-ASO 36" and "SCN-ASO 37" were evaluated for their ability to reverse development allodynia in rats with diabetes-induced peripheral neuropathic pain (DPNP). In this example, six SCN9A-ASOs targeting a total of five splicing sites were evaluated for their ability to reverse allodynia caused by diabetic neuropathy in rats.

[DPNP induction and bundling]. Diabetes was induced in rats by intraperitoneal injection of 60 mg/kg sterptozotocin on day 0. On day 10, DPNP rats were randomly assigned to 6 groups: negative control (vehicle only), "SCN-ASO 7" 100 pmol/kg, "SCN-ASO 8" 100 pmol/kg, "SCN-ASO 21" 100 pmol/kg, "SCN-ASO 35" 100 pmol/kg, "SCN-ASO 36" 100 pmol/kg, and "SCN-ASO 37 » 100 pmol/kg. Animals were grouped based on von Frey scores of individual animals on day 10. (N=8~9 per group). Allodynia was assessed using a microfilament kit (Touch Test®) according to the up and down method [ J Neurosci. Methods vol 53(1), 55-63( 1994 )]

[ASO Treatment and Von Frey Score] ASO injection solutions were prepared by serially diluting aqueous stock solutions of SCN9A-ASO to 100 nM in PBS (phosphate buffered saline). Animals were injected subcutaneously with ASO at a dose of 1 ml/kg on days 11, 13, 15, 17, and 19. Von Frey assessment was performed 2 hours post-dose on days 11, 13, 15, 17, and 19. Additional von Frey assessment were performed on days 21 and 23 to assess the duration of therapeutic activity after the final dose. Daily von Frey scores were assessed for statistical significance using Student's t-test against a negative control group (vehicle only, ie PBS).

[Therapeutic Activity] The obtained von Frey scores are summarized in FIG. 36. The development of allodynia was significantly reversed with all ASOs except "SCN-ASO 36" and "SCN-ASO 37", although "SCN-ASO 37" showed a clear trend in therapeutic activity (p-value=0.057 at day 19 ). Therapeutic activity, as a rule, gradually increased with repeated doses. The maximum therapeutic efficacy, based on von Frey scores at day 19, was approximately 76% (significant), 61% (significant), 93% (significant), 52% (significant), 0%, and 22% (not significant, p- value=0.05X) for "SCN-ASO 7", "SCN-ASO 8", "SCN-ASO 21", "SCN-ASO 35", "SCN-ASO 36" and "SCN-ASO 37", respectively .

"SCN-ASO 7", "SCN-ASO 8", "SCN-ASO 21" and "SCN-ASO 35" are capable of 5-mer complementary overlap with the target intron. At the same time, "SCN-ASO 36" and "SCN-ASO 37" have the ability to 4-dimensional and 3-dimensional complementary overlap with the target intron, respectively. Although there are a number of factors that affect therapeutic efficacy, the amount of complementary overlap with the target intron appears to affect therapeutic efficacy.

In this example, in vivo antisense activity was observed with SCN9A-ASO targeting 4 out of 5 splicing sites. A hit rate of 80% is considered to be very high given that in vivo therapeutic activity is dependent on various factors including cellular antisense activity, increase in drug molecules in the target tissue, pharmacokinetic half-life, etc. Thus, the compound of formula I predictably modulates the expression of its target gene.

Given the molecular weight of "SCN-ASO 7" (cf. table 4), 100 pmol/kg translates into a therapeutic dose of approximately 0.53 μg/kg. The in vitro subattomolar exon-skipping activity of "SCN-ASO 7" is believed to be largely responsible for the super-potent in vivo therapeutic activity of approximately 0.53 μg/kg in rats with diabetic neuropathy. Even more surprisingly, ASO was administered as a "naked" oligonucleotide. Such strong in vivo therapeutic activity has never been realized with other classes of oligonucleotides including DNA, RNA, PTO, 2'-OMe-PTO, 2'-OMe-RNA, 2'-OMOE-RNA, LNA, PMO, PNA, etc. .d.

Examples of in vivo and ex vivo activity of DMD-ASO.

Duchenne muscular dystrophy (DMD) is a life-threatening monogenic rare disease with muscle degeneration. DMD patients do not code for full-length dystrophin protein due to PTC (premature termination codon) resulting from point mutation or deletion of exon(s).

The Mdx mouse (C57BL/10ScSn-Dmd ^mdx /J. Jackson Lab) is a point mutant mouse in exon 23 of the dystrophin gene that results in PTC. Mdx mice encode a truncated form of dystrophin without the C-terminus. Because the C-terminus binds to the extracellular matrix (ECM), the truncated form loses its intended role of firmly binding muscle fibers to the ECM. Consequently, MDX mice gradually lose muscle integrity and strength with age.

Mdx mice have been widely used as a human animal model of DMD. Dystrophin-specific ASOs that target exon 23 of mouse dystrophin have been investigated to exclude PTC by skipping exon 23.

PNA derivatives of Formula I complementarily targeting the 3' or 5' splicing site of exon 23 in mouse dystrophin pre-mRNA were evaluated for their ability to induce dystrophin exon 23 skipping in MDX mice. The biological examples provided herein serve to illustrate the exon skipping capability of dystrophin-specific ASOs as examples of a compound of formula I and should therefore not be interpreted as limiting the scope of the present invention to dystrophin-specific ASOs.

DMD Example 1 Exon skipping induced by "DMD-ASO 1" and "DMD-ASO 4" in Mdx mice (nested PCR method A).

"DMD-ASO 1" listed in Table 7 is a 13-mer ASO fully complementary to the region at the 3' splicing site spanning the junction of intron 22 and exon 23 in mouse dystrophin pre-mRNA. "DMD-ASO 1" binds complementarily to the 13-mer sequence as indicated by "bold" and "underline" in the 25-mer sequence [(5'→3')uaa uuuugag | GCUCUGCAAAGTTCT ]. "DMD-ASO 1" has the ability to overlap 8 dimensionally with intron 22 and 5 dimensionally overlap with exon 23.

"DMD-ASO 4" listed in Table 7 is a 17-mer ASO fully complementary to the region at the 3' splice site spanning the junction of intron 22 and exon 23 in mouse dystrophin pre-mRNA. "DMD-ASO 4" binds complementarily to the 17-mer sequence as indicated by "bold" and "underline" in the 25-mer sequence [(5'→3') uaauu uugag | GCUCUGCAAAGT TCT]. "DMD-ASO 4" has the ability to overlap 5 dimensionally with intron 22 and 12 dimensionally overlap with exon 23.

"DMD-ASO 1" and "DMD-ASO 4" were evaluated for their ability to induce exon skipping in MDX mouse muscle when administered subcutaneously as follows.

[ASO Treatment and Muscle Sampling] Injectable solutions were prepared by diluting an aqueous stock solution of "DMD-ASO 1" or "DMD-ASO 4" in PBS to 500 nM. Male mdx mice were injected subcutaneously with vehicle alone (negative control), "DMD-ASO 1" or "DMD-ASO 4" at a dose of 2 ml/kg, 2 times a day (BID) for 3 days. One day after the last dose, animals were anesthetized with zoletil/rompun and sacrificed for muscle tissue sampling, including heart, diaphragm, calf, quadriceps, and triceps.

[RNA extraction]. Muscle samples were homogenized by grinding in a tube kept on ice and subjected to total RNA extraction using 1 ml of Trizol reagent (Invitrogen) per approximately 100 mg of muscle tissue.

[cDNA Synthesis by One Step RT-PCR] 500 ng of RNA template was used in a 25 µl volume reverse transcription reaction using the Super Script® One Step RT-PCR Kit with Platinum® Taq Polymerase (Cat. No. 10928-042, Invitrogen ) and a set of exon-specific primers [DMD exon 21_forward: (5'→3') CAAAGAGAAAGAGCTACAGACA; and DMD exon 25_reverse: (5'→3') ^{CTGGGCTGAATTGTTTGAAT} ] according to the following cycling regimes: 50°C for 30 min and 94 ^° C for 2 min, followed by 40 cycles, each consisting of 30 sec at 94 ^o C, 1 min at 58 ^o C and 2 min at 72 ^o C.

[Nested PCR Amplification] 1 µl of cDNA was further amplified in a 20 µl nested PCR reaction (Cat. No. K2612, Bioneer) in the background of the primer set [DMD exon 22n_forward: (5'→3')ATCCAGCAGTCAGAAAGCAAA; and DMD exon 25n_reverse: (5'→3')ACTAAAAGTCTGCATTGT] according to the following cycling regimes: 95 ^o C for 5 min followed by 39 cycles, each consisting of 30 sec at 95 ^o C, 40 sec at 50 ^o C and 50 sec at 72 ^° C.

[Identification of exon skipping product] PCR products were subjected to electrophoretic separation on a 2% agarose gel as shown in FIG. 37A. Exon 23 skipping was only found in animals treated with "DMD-ASO 1" and "DMD-ASO 4". Although exon 23 skipping was only found in the quadriceps and gastrocnemius muscles. "DMD-ASO 1" appears to be more effective than "DMD-ASO 4".

The subject as a negative control (ie, no ASO treatment) gave a band for the PCR product attributable to quadriceps exon skipping 22-23. Skipping of exons 22-23 leads to a frameshift, and a dystrophin mRNA splicing variant that lacks exons 22-23 is doomed to encode a truncated dystrophin without a C-terminus.

Bands of target size were collected and analyzed by Sanger sequencing, and exon 23 skipping induced by "DMD-ASO 1" and "DMD-ASO 4" was confirmed (cf. Fig. 37B). Bands for full-length PCR products (ie, no skipping) and for exon skipping 22-23 were confirmed by sequencing, although sequencing data for exon skipping 22-23 was not provided.

DMD Example 2 Exon skipping induced by "DMD-ASO 1" and "DMD-ASO 4" in Mdx mice (nested PCR method B).

The RNA samples obtained in "DMD Example 1" were subjected to one-step cDNA synthesis using a set of exon-specific primers [DMD exon 20_forward: (5'→3')CAGAATTCTGCCAATTGCTGAG; and DMD exon 26_reverse:(5'→3')TTCTTCAGCTTGTGTCATCC]. The cDNA samples were then analyzed by nested PCR against the background of another set of exon-specific primers [DMD exon 20n_forward: (5'→3')CCCAGTCTACCACCCTATCAGAGC; and DMD exon 26n_reverse: (5'→3')CCTGCCTTTAAGGCTTCCTT].

The nested RT-PCR results are presented as shown in FIG. 38A and FIG. 38b. Animals treated with ASO (N=2 per group) were found to skip exons 21-23 and exons 22-25. While exon skipping 21-23 occurs in-frame (i.e., no frameshift), exon skipping 22-25 occurs out-of-frame. The band for the PCR product attributed to exon skipping 21-23 was unambiguously confirmed by Sanger sequencing (cf. Fig. 38B)

Exon skipping profiles varied depending on the PCR method above. Thus, exon skipping profiles should be interpreted with caution.

DMD Example 3 Exon skipping induced by "DMD-ASO 1" in Mdx mice (nested PCR method A).

Mdx mice received "DMD-ASO 1" at a dose of 0 (negative control) or 10 pmol/kg subcutaneously, 2 times a day for 5 days (2 animals per group). One day after the final dose, animals were sacrificed for tissue sampling. Triceps samples were evaluated for exon 23 skipping according to the nested RT-PCR method described in "DMD Example 1".

The nested RT-PCR results are summarized in FIG. 38C. Although one animal in the negative control group produced a band for the PCR product when exons 22-23 were skipped, the mRNA splicing variant that lacks exons 22-23 is out of frame. The PCR product band for exon 23 skipping was found in only one animal in the ASO injection group. Thus, DMD-ASO 1 induced skipping of exon 23 as planned.

DMD Example 4 Improvement in muscle function according to the rolling rod test in Mdx mice injected subcutaneously with "DMD-ASO 1".

Skipping exon 23 in mdx mice removes PTC in exon 23, and the mRNA splicing variant lacking exon 23 is in-frame and therefore encodes an ECM-binding C-terminal protein variant. Therefore, a full-length dystrophin protein variant partially restores the physiological functions of the original full-length dystrophin or wild-type dystrophin.

Considering the possibility of exon skipping, "DMD-ASO 1" was evaluated in MDX mice for its ability to improve muscle function according to the rotating rod test, as described below.

[Groups] Male MDX mice at 6 weeks of age were prepared for the rolling rod test for 2 weeks and then randomly assigned to 3 groups: 0 (negative control), 100 and 1000 pmol/kg "DMD-ASO 1" - per based on the scores of individuals on the rotating rod test on day 0, i.e. on the day of grouping. (N=10 per group)

[ASO Treatment] Injectable solutions were prepared by serially diluting ASO to 20 nM and 200 nM in PBS. Animals were injected subcutaneously with vehicle (PBS, negative control), 20 nM "DMD-ASO 1" (100 pmol/kg) or 200 nM "DMD-ASO 1" (1000 pmol/kg) at a dose of 5 ml/kg, 3X per week during the period from day 0 to day 21.

[Rotating Rod Test and Statistical Analysis] Mice were subjected to a rotating rod test on a rotating rod apparatus (Model No. 47650, Ugo Basile) with an acceleration circuit from 4 rpm to 45 rpm for 60 seconds. Time to fall (ie the period during which the animal remained on the rotating rod) was estimated for each individual animal. Statistical significance was assessed using Student's t-test against the negative control group.

[improved muscle function]. In FIG. 39A summarizes the scores on the rotating rod test by group. Rolling rod test scores (ie, time to fall) remained stable at an average of approximately 70 to 120 seconds in the negative control group. Meanwhile, muscle function in the 1000 pmol/kg administration group gradually and markedly improved until day 12, and then remained unchanged when assessed in the rotating rod test for an average of 210 to 230 seconds. Muscle function was significantly improved on days 12, 14 and 19 with 1000 pmol/kg ASO. Muscle function in the 100 pmol/kg administration group showed a strong tendency to improve but was not significant.

DMD Example 5 Improvement in muscle function as measured by paw grip and muscle integrity in Mdx mice chronically injected with "DMD-ASO 1".

"DMD-ASO 1" was evaluated chronically administered to mdx mice for its ability to improve muscle function as measured by the paw grip test, to induce exon skipping, to increase the expression of full-length dystrophin (i.e., the encoded C-terminal dystrophin protein) according to IHC and to improve muscle integrity according to histopathology with H&E staining as described below.

[Grouping and ASO Treatment] Male MDX mice (7 weeks old) were randomly assigned to 4 groups: 0 (MDX negative control), 10, 50, and 200 pmol/kg "DMD-ASO 1" based on individual assessments of grip strength with paw grip test (“walking on the raised bar”) (N=12 per group). An auxiliary group of 12 male C57BL/6 mice (7 weeks old) was included in this study as a wild-type negative control for full-length dystrophin expression level.

The 50 and 200 pmol/kg administration group received "DMD-ASO 1" subcutaneously dissolved in PBS, 2 times a week until the final sacrifice at week 43. Meanwhile, the 10 pmol/kg administration group received "DMD-ASO 1" subcutaneously 2x/week initially for week 0 to 8 and 3x/week thereafter to increase ASO exposure.

[Grip Test Muscle Function] Muscle function was assessed weekly by grip strength on a grip force meter (Cat. No. 47200, Ugo Basile) according to the literature [ J. Appl. Physiol , vol 106 (4), 1311-1324 ( 2009 )] Group grip strength scores were assessed for statistical significance by Student's t-test against the MDX negative control group.

In FIG. 39B summarizes estimates of observed grip strength by group during weeks 0 through 30. During the first 11 weeks after the first dose, there were no noticeable changes in grip strength between the ASO treatment groups and the negative control group. The grip strength of the MDX negative control group peaked at approximately 107 g at week 3, decreased gradually over several weeks, and then remained relatively unchanged at approximately 75 to 95 g. The grip strength of the ASO treatment groups began to gradually improve from week 10 or so Togo. In the treatment groups, the grip strength generally increased by 30~50% compared to the MDX negative control group.

Of note, 2-3 animals in each group were randomly selected and sacrificed at weeks 7, 13, 21 and 30 for evaluation by IHC (immunohistochemical analysis) or nested PCR (see below)

[IHC assessment of skeletal muscle versus full length dystrophin] At weeks 7, 13 and 21, two animals in each group were randomly selected and sacrificed for muscle tissue harvesting. At week 30, 3 animals in each group were sacrificed.

Muscle tissues harvested at week 7 were subjected to IHC for full length dystrophin by frozen tissue sectioning. Muscle tissues collected at weeks 13, 21 and 30 were immunostained using a paraffin block. IHC using a paraffin block produced better images than IHC using frozen tissue sections.

Muscle samples were immunostained sequentially with the first anti-mouse dystrophin C-terminal antibody (cat. no. sc-816, Santa Cruz) diluted 1:100, the second anti-IgG antibody (cat. no. BA-1100, Vector) diluted 1: 200 followed by Dylight 594-Steptavidin (Cat. No. SA-5594, Vector, CA, USA) at a 1:200 dilution for red fluorescence labeling. IHC images were captured on a Zeiss slide scanner (at weeks 13, 21 and 30) or on an Olympus fluorescence microscope (at week 7). Additionally, DAPI staining was performed.

In FIG. 40 shows a representative set of IHC images of full-length dystrophin by group for muscle samples taken at week 30. The wild-type (WT) negative control group produced distinctive and angular dystrophin expression patterns reflecting the natural structure of the muscle fiber bundles. In the negative control group of mdx mice, there was no high degree of full-length dystrophin staining. Meanwhile, strong and angular patterns of dystrophin staining were observed in skeletal muscle in the 200 pmol/kg injection group. Although the muscle fiber bundle structures were blurred in MDX mice compared to WT mice, full-length dystrophin expression was markedly increased in ASO-treated animals.

Dystrophin IHC images were quantified for full-length dystrophin expression by numerically assessing the intensity of red fluorescence in each individual IHC image using ImageJ (NIH) software. Individual fluorescence scores were pooled by group and muscle type for statistical evaluation relative to the wild-type negative control group.

In FIG. 41 summarizes changes in the relative expression level of full-length dystrophin protein in MDX mice. Full-length dystrophin expression tended to increase more with higher ASO dose and longer duration of treatment. At week 30, expression of full length dystrophin in the 200 pmol/kg administration group reached >80% of that in the WT negative control group, while expression in the mdx negative control group was less than 20% of that in the wild type negative control group.

[Nested PCR for Exon Skipping Detection (Method B)] Muscle samples were homogenized by grinding in a tube kept on ice and subjected to total RNA extraction using 1 ml of Trizol reagent (Invitrogen) per approximately 100 mg of muscle tissue. Total RNA was assessed for exon skipping by nested PCR as described in "DMD Example 2".

In FIG. 42 shows electrophoresis data of nested PCR products obtained using skeletal muscles sampled at week 7. PCR products of Δexons 21-23 and Δexons 21-24 in frame were detected in the muscle samples of the ASO treatment groups, but were completely absent in the negative control group. mdx.

[Histopathology using H&E staining] Inflammation and muscle degeneration are hallmarks of DMD symptoms. Skeletal muscle samples were subjected to histopathological evaluation by H&E staining. In FIG. 43 is a representative set of H&E staining images for triceps by group and sampling times.

In the WT negative control group, muscle structure was dense at all sampling times. There was no suggestion of muscle inflammation in the muscles of wild-type mice at all time points.

In the mdx negative control group, the muscle structure showed a clear pattern of gradual degeneration with age. Especially at week 30, the muscle bundles were not interconnected and tended to degenerate into a rounded shape. There was also a massive infiltration of inflammatory cells, as evidenced by blue dot patches, especially at weeks 13 and 21.

In the 200 pmol/kg administration group, the loose muscle structure at week 7 was gradually restored to a dense structure. A marked infiltration of inflammatory cells at week 7 gradually disappeared with age. Thus, muscle degeneration and inflammation in mdx mice were reversed with continuous administration of ASO at 200 pmol/kg, corresponding to an increase in full-length dystrophin expression in the 200 pmol/kg administration group.

According to histopathological data, the severity of degeneration in the 10 and 50 pmol/kg administration groups was less than that in the mdx negative control, but greater than in the 200 pmol/kg administration group. Thus, the increase in full-length dystrophin expression induced by ASO exposure is largely consistent with histopathological findings.

[Other data] There were three cases of unplanned mortification or death (weeks 26, 39 and 43) in the MDX negative control group due to a large mass of muscle lymphoma most likely due to chronic muscle inflammation. There were no cases of lymphoma in all ASO treatment groups.

[Comparison with another dystrophin-specific ASO] Eteplirsen (exondys 51) is a PMO antisense oligonucleotide designed to induce exon 51 skipping in pre-mRNA for human dystrophin. The US Food and Drug Administration (FDA) recently granted accelerated approval for the use of Eteplirsen in the DMD patient population requiring exon 51 skipping. The recommended dose of Eteplirsen is an intravenous injection of 30 mg/kg per week.

A subcutaneous dose of 200 pmol/kg "DMD-ASO 1" corresponds to approximately 1 μg/kg. The dystrophin-specific ASO of Formula I is approximately 30,000 times more potent than the PMO ASO, although there are species and exon differences between the two types of ASO. The unprecedentedly potent exon-skip activity of the PNA derivative of Formula I has again been translated into a super potent in vivo therapeutic activity for this difficult-to-treat rare disease.

DMD Example 6 Improvement in muscle function by distance traveled in MDX mice chronically injected with "DMD-ASO 2".

The "DMD ASO 2" listed in Table 7 is a 17mer ASO fully complementary to the region at the 3' splicing site spanning the junction of intron 22 and exon 23 in mouse dystrophin pre-mRNA. "DMD-ASO 2" binds complementarily to the 17mer sequence, as indicated by "bold" and "underline, as in the 20mer mouse dystrophin pre-mRNA sequence [(5'→3')ua auuuugag | GCUCUGCAA A] "DMD-ASO 2" is capable of 8-mer overlap with intron 22 and 9-mer complementary overlap with exon 23.

"DMD-ASO 2" was chronically administered to mdx mice to evaluate its ability to improve muscle function by treadmill distance traveled and suppress muscle degradation by serum creatine kinase (CK) and myoglobin levels.

[Animals and Grouping] Male MDX mice (6 weeks old) were randomly assigned to three groups: MDX negative control (no ASO treatment), "DMD-ASO 2" 10 pmol/kg, and "DMD-ASO 2" 30 mg/kg. kg based on body weight. (N=16 per group). Twelve male C57BL/6 mice (6 weeks of age) were accepted as wild-type (WT) negative controls.

[Solutions for injection and treatment of ASO] An aqueous stock solution of "DMD-ASO 2" was diluted in either PBS or PBS with the addition of 0.1% Tween 80 to prepare injection solutions of 20 and 60 nM "DMD-ASO 2" for 10 pmol /kg and 30 pmol/kg "DMD-ASO 2", respectively. It was believed that the addition of 0.1% Tween 80 to the PBS injection solution was necessary to prevent the adhesion of ASO molecules to plastic injection tubes, pipette tips and syringes.

[Distance Walked on the Treadmill] During the first 30 weeks after grouping, the animals were injected with solutions without Tween 80 2 times a week at a dose of 2 ml/kg. Starting at week 7, the animals were subjected to weekly walking on a treadmill (Model # LE8710, PanLab). However, during the first 30 weeks, the ASO treatment groups did not show any significant increases in walking distance compared to the MDX negative control group.

In order to effectively increase the dose of ASO, the animals were injected with solutions supplemented with Tween 80, 2 times a week from week 36. Between periods of treatment there was a washout period (ie, no dose of ASO) of 5 weeks.

In FIG. 44A shows treadmill distances walked by group in weeks 43 through 48. The mean distance walked on the mdx negative control group gradually but rapidly decreased from approximately 250 meters at week 43 to 130 meters at week 48. The average distance walked of the ASO treatment groups was noticeable greater than the distance traveled for the MDX negative control group.

At weeks 46 to 48, the 10 pmol/kg group showed an average walking distance of 240-280 meters, which was significantly greater than the walking distance for the MDX negative control group. Meanwhile, the 30 pmol/kg administration group showed a walking distance of approximately 180-230 meters at weeks 46 to 48. In the case of the 10 pmol/kg administration group, compared with the 30 pmol/kg administration group, there was a tendency to increase distance traveled. An inverse dose response in terms of distance traveled would suggest a natural selection of distinct exon(s) at higher ASO dose, as observed in "HIF-1α Example 9". Interestingly, the WT negative control group and the 30 mmol/kg administration group showed comparable walking distances at weeks 44 to 47.

[Final killing] In a week, 48 animals were subjected to final killing. Blood samples were analyzed for serum CK (using creatine kinase activity assay kit, cat. no. abl55901, Abeam) and myoglobin (using myoglobin ELISA kit, cat. no. ab210965, Abeam) to assess the degree of muscle degradation according to the instructions manufacturer. Muscle tissues were analyzed by Western blotting for full length dystrophin.

[Serum CK and Myoglobin Levels] FIG. 44B shows observed serum CK levels by group. Reflecting the muscle weakness of the mdx mice, all groups of mdx mice produced much higher serum CK activities than the WT negative control group. For example, the serum CK level in the MDX negative control group was approximately 54 times higher than that in the WT negative control group. Serum CK levels in the 10 and 30 pmol/kg administration group were lower than those in the MDX negative control group by 58% and 38%, respectively. The difference in serum CK levels between the 10 pmol/kg administration group and the MDX negative control group was significant.

In FIG. 44C shows observed serum myoglobin levels by group. Reflecting the muscle weakness of the mdx mice, all groups of mdx mice produced much higher serum myoglobin levels than the level in the WT negative control group. For example, the serum myoglobin level in the MDX negative control group was approximately 22 times higher than that in the WT negative control group. Serum myoglobin levels in the 10 and 30 pmol/kg administration group were significantly lower than those in the MDX negative control group by 67% and 58%, respectively.

The observed data for serum biomarkers of muscle degradation are broadly consistent with the dose dependence of distance traveled presented in FIG. 44A.

[Full length dystrophin expression in triceps as assessed by Western blotting] After homogenization at liquid nitrogen temperature, muscle samples (triceps) were lysed in RIPA buffer with 1% SDS. The protein concentration in each lysate was determined using a BCA assay against a BSA standard. 50 mg of the protein of each lysate was subjected to electrophoretic separation in 8% PAAG for electrophoresis. The PVDF membrane was then examined using an antibody against the C-terminus of dystrophin (cat. no. ab 154168, Abeam).

In FIG. 45A shows the observed Western blot data. Full-length 427K dystrophin was not found in all samples. Instead, WT muscle samples yielded smaller dystrophin proteins: 170K, 130K, and 117K, among which the 130K band was the most enriched.

In the case of the MDX groups, three bands for dystrophin were found. The 10 and 30 pmol/kg treatment groups produced a markedly stronger 117K band than the MDX negative control group as well as the WT control group. The intensity of the 130K band was significantly higher in the 10 pmol/kg treatment group than in the MDX negative control group.

DMD Example 7 Long- term evaluation of MDX mice treated with "DMD-ASO 1", "DMD-ASO 2", or "DMD-ASO 6".

"DMD ASO 6" listed in Table 7 is an 18-mer ASO fully complementary to the region at the 5' splicing site spanning the junction of exon 23 and intron 23 in mouse dystrophin pre-mRNA. "DMD-ASO 6" overlaps complementarily with the 18mer sequence as noted by "bold" and "underline" in the 25mer mouse dystrophin pre-mRNA sequence [(5'→3')AA AAUUUCAG | guaagccgag guuug]. "DMD-ASO 6" has the ability to overlap 8 dimensionally with exon 23 and 10 dimensionally overlap with intron 23.

"DMD-ASO 1", "DMD-ASO 2" and "DMD-ASO 6" were evaluated for their physiological effects in male MDX mice by long-term subcutaneous administration. During this evaluation, the animals were not subjected to physical tests requiring muscle stress so that excessive muscle stimulation does not disrupt the transcription of the dystrophin gene.

[Animals and grouping] Male mdx mice (6 weeks old) were randomly assigned to 4 groups: mdx negative control (no ASO exposure), "DMD-ASO 1" 50 pmol/kg, "DMD-ASO 2" 10 mg /kg and "DMD-ASO 6" 10mg/kg based on body weight (N=12~13 per group). Twelve male C57BL/6 mice (6 weeks old) were accepted as a wild-type (WT) negative control group.

[Injection solutions and exposure to ASO] Aqueous stock solutions of ASO were serially diluted in PBS to prepare injection solutions of 25 nM "DMD-ASO 1" for 50 pmol/kg "DMD-ASO 1", 5 nM "DMD-ASO 2" for "DMD -ASO 2" 10 pmol/kg and 5 nM "DMD-ASO 6" for "DMD-ASO 6" 10 pmol/kg. Animals were injected subcutaneously with injection solutions at a dose of 2 ml/kg, 2 times a week.

[Unplanned Death or Killing] MDX mice treated with ASO tended to have a longer survival time than the MDX negative control group, indicating the therapeutic activity of ASO.

There were three unplanned deaths or homicides in the MDX negative control group: one each time at weeks 42, 58, and 61. Two premature deaths occurred in the DMD-ASO 1 treatment group, one at week 38 and the other at week 61 In the case of the DMD-ASO 2 treatment group, one death occurred at week 56 and another at week 62. In the DMD-ASO 6 treatment group, three premature deaths occurred: one each time at weeks 55, 65, and 66.

[Final Kill] All surviving animals were sacrificed for blood sampling at week 66 after grouping. Blood samples were subjected to ELISA assays for serum creatine kinase (CK) and serum myoglobin as described in "DMD Example 6".

[Serum CK and Myoglobin Levels] FIG. 45B shows observed serum CK levels by group. Reflecting the muscle weakness of the mdx mice, all groups of mdx mice produced much higher serum CK activities than the WT negative control group. For example, the serum CK level in the MDX negative control group was approximately 17-fold higher than that in the WT negative control group. Serum CK levels in the ASO treatment groups were generally lower than those in the MDX negative control group, indicating the therapeutic activity exhibited by ASO. However, the differences were not significant.

In FIG. 45C shows observed serum myoglobin levels by group. Reflecting the muscle weakness of the MDX mice, all groups of MDX mice produced much higher serum myoglobin levels than the WT negative control group. For example, the serum myoglobin level in the MDX negative control group was approximately 26 times higher than the level in the WT negative control group. Serum myoglobin levels in the DMD-ASO 1, DMD-ASO 2, and DMD-ASO 6 treatment groups were lower than those in the MDX negative control group by 43%, 49%, and 68%, respectively. The difference between the MDX negative control and the DMD-ASO 6 treatment group was significant. Serum biomarkers of muscle integrity indirectly suggest that "DMD-ASO 6" induces dystrophin exon 23 skipping and produces functionally active full-length dystrophin(s) in MDX mice.

Examples of in vitro activity of IDO1-ASO

The PNA derivatives of formula I in Table 8 were designed to complementarily target different splicing sites in human IDO1 pre-mRNA. IDO1-ASO was evaluated for exon skipping activity in SKOV3 cells. Given that IDO1 catalyzes the degradation of L-tryptophan to N-formylkynurenine. IDO1-ASO was evaluated in relation to their functional ability to inhibit the production of kynurenine. The biological examples provided herein serve to illustrate the exon-passing activity of IDO1-ASO as examples of a compound of Formula I and should therefore not be interpreted as limiting the scope of the present invention of IDO1-ASO.

IDO1 Example 1 Exon skipping induced by "IDO-ASO 1".

"IDO-ASO 1" listed in Table 8 is a 13-mer ASO fully complementary to the region at the 3' splicing site spanning the junction of intron 6 and exon 7 in human IDO1 pre-mRNA. "IDO-ASO 1" complementarily targets the 13-mer sequence as indicated by "bold" and "underline" in the 20-mer human IDOl pre-mRNA sequence [(5'→3')uuugu uuuag | GUAAUUC UA1. "IDO-ASO 1" has the ability to overlap 5-dimensionally with intron 6 and 8-dimensionally overlap with exon 7.

"IDO-ASO 1" was evaluated for its ability to induce exon skipping in SKOV3 cells (Cat. No. HTB-77, ATCC) by IDO1-specific nested PCR as follows.

[Cell Culture and ASO Treatment] SKOV3 (human ovarian adenocarcinoma) cells were subcultured in a 60 mm culture dish containing 5 ml of modified 5C McCoy medium supplemented with 10% FBS, 1% streptomycin/penicillin, 1% L-glutamine and 1% sodium pyruvate, in an atmosphere with 5% CO ₂ at 37 ^ο C and treated with "IDO-ASO 1" for 48 hours at a concentration of 0 μM (negative control), 10 μM, 100 μM or 1 aM.

[RNA Extraction and cDNA Synthesis by One-Step RT-PCR] Total RNA was extracted from the cells using the "Universal RNA Extraction Kit" (Cat. No. 9767, Takara) according to the manufacturer's instructions. 200 ng of template RNA was reverse-transcribed in a volume of 25 µl using the Super Script® one-step RT-PCR kit with Platinum® Taq polymerase (p/n 10928-042, Invitrogen) against the backdrop of a set of exon-specific primers [IDO- exon 2_straight: (5'→3')TTCATTGCTAAACATCTGCC; and IDO-exon 10_reverse: (5'→ 3')TGAAAGGACAAACTCACGGA] according to the following cycling regimes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 40 cycles, each consisting of 30 sec at 94 ^ο C, 30 sec at 50 ^ο C and 1 min at 72 ^ο C.

[Nested PCR Amplification] 1 µl cDNA was further amplified in a 20 µl nested PCR reaction (cat. no. K2612, Bioneer) against the backdrop of an exon-specific primer set [IDO-exon 4_forward: (5'→3')CCTTACTGCCAACTCTCC; and IDO exon 9_reverse: (5'→3')CTGCTTTGGCCTGCACTG] according to the following cycling regimes: 95 ^οC for 5 min followed by 30 cycles, each consisting of 30 sec at 95 ^οC , 30 sec at 50 ^οC and 1 min at 72 ^ο C.

[Identification of exon skipping product] PCR products were subjected to electrophoretic separation in 2% agarose gel. Target size bands were harvested and analyzed by Sanger sequencing.

In FIG. 46A shows electrophoresis data of nested PCR products (left panel) and Sanger sequencing data of the PCR product attributable to exon skipping 6-7 (right). Exon skipping 6-7 was detected in an RNA extract of cells treated with 100 µM "IDO-ASO 1". An exon skipping band was not detected in RNA extracts from cells treated with ASO at 10 µM or 1 aM, most likely due to the poor stability of the IDO1 mRNA splicing variant, which lacks exons 6-7. Although the intensity of the full-length mRNA for IDO-1 decreased in cells treated with ASO at 10 or 100 cM, the intensity of the full-length mRNA increased in cells treated with ASO at 1 aM. The observed increase in the level of full-length mRNA at 1 aM remains to be elucidated. This may be an artifact during PCR reactions or may be due to (transient) transcriptional activation caused by "exon(s) and intron(s) circular RNA (EIciRNA)" accumulated during exon skipping by "IDO-ASO 1" [ Nature Struc. Mol. Biol , vol. 22 (3), 256-264 (2015)]. Sanger sequencing data (right panel) unambiguously demonstrated exon skipping 6-7 induced by "IDO-ASO 1" in SKOV3 cells.

IDO1-example 2 Antisense functional activity "IDO-ASO 1".

The functional activity of "IDO-ASO 1" was evaluated in relation to its ability to inhibit kynurenine secretion in SKOV3 cells as follows.

[Kynurenine Secretion Assay] SKOV3 cells grown in a 60 mm culture dish containing 5 ml of culture medium were treated with "IDO-ASO 1" at a concentration of 0 uM (negative control) or 10 uM to 1 fM (3 dishes for each concentration). Cells were treated with ASO along with 10 ng/ml γ-interferon to increase kynurenine secretion. After 24 hours, 200 μl of the culture medium was removed from each culture dish and mixed with 100 μl of 30% trichloroacetic acid. The mixture was shaken and centrifuged at 8000xg for 5 min. 75 µl of the resulting supernatant was mixed with 75 µl of Ehrlich's reagent (0.8% p-dimethylaminobenzaldehyde in acetic acid) and the mixture was quantified for kynurenine at 490 nm in an ELISA reader. [ PLOS One 5 (8): e63301 ( 2013 )]

In FIG. 46B shows the results of the analysis of kynurenine. With the exception of cells treated with 1 aM "IDO-ASO 1", kynurenine secretion was significantly (Student's t-test) reduced in cells treated with ASO at a concentration of 10 cM - 1 fM. Secretion of kynurenine was reduced by approximately 40% in cells treated with 1 fM "IDO-ASO 1".

IDO1 Example 3 Exon skipping induced by "IDO-ASO 5".

"IDO-ASO 5" listed in Table 8 is a 13-mer ASO fully complementary to the region at the 5' splicing site spanning the junction of exon 3 and intron 3 in pre-mRNA for human IDO1. "IDO-ASO 5" overlaps complementarily with the 13mer sequence as noted by "bold" and "underline" in the 20mer pre-mRNA sequence for human IDO1 [(5'→3')UG UCCGUAAG | guuug gagau]. "IDO-ASO 5" is capable of 8-mer complementary overlap with exon 3 and 5-mer complementary overlap with intron 3.

"IDO-ASO 5" was evaluated for its ability to induce exon skipping in SKOV3 cells by IDO1-specific nested RT-PCR as described in "IDO1 Example 1" unless otherwise indicated.

[ASO Treatment] SKOV3 cells grown in a 60 mm culture dish were treated with "IDO-ASO 5" at a concentration of 0 (negative control), 1, 3, 10, 30, or 100 aM for 48 hours.

[cDNA synthesis by one-step PCR] 200 ng of template RNA were subjected to a 25 µl volume reverse transcription reaction using the Super Script® One-step RT-PCR Kit with Platinum® Taq polymerase (p/n 10928-042, Invitrogen) in the background set of exon-specific primers [IDO exon 1_forward: (5'→3')AAAACTCCTGGACAATCAGT; and IDO-exon 8_reverse: (5'→3')ACTTGAAGGGCTTTCTCC] according to the following cycling regimes: 50 ^οC for 30 min and 94 ^οC for 2 min, followed by 40 cycles, each consisting of 30 sec at 94 ^ο C, 30 sec at 52 ^ο C and 40 sec at 72 ^ο C.

[Nested PCR Amplification] 1 µl cDNA was further amplified in a 20 µl volume nested PCR reaction (Cat. No. K2612, Bioneer) using the exon-specific primer set [IDO exon 1n_forward: (5'→3')TATTGATGAAGAAGTGGG; and IDO exon 8n_reverse: (5'→3')GTTCACATGATCGTGGATTTG] according to the following cycling regimes: 95 ^οC for 5 min followed by 30 cycles, each consisting of 30 s at 95 ^οC , 40 s at 52 ^οC and 40 sec at 72 ^ο C.

[Nested PCR Product Data] FIG. 47A shows electrophoresis data of nested PCR products. Cells treated with IDO-ASO 5 at 30 and 100 aM clearly produced mRNA splicing variants that lacked exons 2-4 and exons 2-6. The intensity of the full-length mRNA band decreased in ASO-treated cells, although the intensity increased slightly in cells treated with ASO at 10 aM. In FIG. 47B shows Sanger sequencing data for mRNA splicing variants lacking exons 2-4 and exons 2-6.

IDO1 Example 4 Exon skipping induced by "IDO-ASO 6".

"IDO-ASO 6" listed in Table 8 is a 13-mer ASO fully complementary to the region at the 3' splicing site spanning the junction of intron 3 and exon 4 in pre-mRNA for human IDO1. "IDO-ASO 6" complementarily targets the 13mer sequence as indicated by "bold" and "underline" in the 20mer pre-mRNA sequence for human IDO1 [(5'→3')uuuua aucag | GUCUUGCCAA ]. "IDO-ASO 6" is capable of 5-mer complementary overlap with intron 3 and 8-mer complementary overlap with exon 4.

"IDO-ASO 6" was evaluated for its ability to induce exon skipping in SKOV3 cells by IDO1-specific nested PCR as described in "IDO1 Example 3" unless otherwise indicated.

[Nested PCR Product Data] FIG. 47C shows electrophoresis data of nested PCR products (left panel) as well as band Sanger sequencing data for the PCR product attributed to exon skipping (right panel). Cells treated with "IDO-ASO 6" ranging from 1 to 30 aM clearly produced one mRNA splicing variant that lacked exons 2-5, although no exon skipping band was detected in cells treated with ASO at 100 aM. The intensity of the full-length mRNA band was greater in cells treated with ASO than in cells without ASO treatment, which could be due to transcriptional activation caused by "composed of exon(s) and intron(s) circular RNA (EIciRNA)" accumulated during exon skipping time with "IDO-ASO 1" [ Nature Struc. Mol. Biol , vol. 22 (3), 256-264 ( 2015 )].

Examples of in vitro and ex vivo activity of SNAP25-ASO.

SNAP25 (25 kDa synaptosome-associated protein) is a SNARE protein involved in neurotransmitter exocytosis in motor neuron cells. Botulinum Toxin A (Botox™) breaks down SNAP25 to display its renowned anti-wrinkle activity. The PNA derivatives of formula I in Table 9 were designed to complementarily target the 3' splicing site of exon 7 in human SNAP25 pre-mRNA. SNAP25-ASO was evaluated for SNAP25 antisense activity in SiMa (human neuroblastoma) cells and PC12 cells of rat origin, as well as their ability to inhibit SNAP25 expression in the skin of mice when administered topically. The biological examples provided herein serve to illustrate the exon-passing activity of SNAP25-ASO as examples for a compound of formula I and should therefore not be interpreted as limiting the scope of the present invention of SNAP25-ASO.

SNAP25 Example 1 Exon skipping in PC12 cells treated with "SNAP-ASO 3".

"SNAP-ASO 3" listed in Table 9 is a 14mer ASO fully complementary to the 14mer sequence at the 3' splicing site spanning the junction of "intron 6" and "exon 7" in pre-mRNA for SNAP25 human. "SNAP-ASO 3" overlaps complementarily with the 14mer pre-mRNA sequence, as indicated by "bold" and "underline" in the 30mer pre-mRNA sequence [(5'→3') cucuuugg aucccag | GGUAACA AAUGAUGC1. "SNAP-ASO 3" has the ability to have a 7-dimensional overlap with "intron 6" and another 7-dimensional overlap with "exon 7".

"SNAP-ASO 3" was evaluated for its ability to induce exon skipping in PC12 cells (Cat. No. CRL-1721, ATCC), although "SNAP-ASO 3" has one mismatch with the 3' splicing site of "exon 7" in pre-mRNA for rat SNAP25 read from rat genomic DNA [accessed from NCBI reference sequence: NC_005012]. The 14-mer ASO has the ability to 13-mer complementary overlap with pre-mRNA for rat SNAP25, as indicated by "bold" and "underline" in the 25-mer pre-mRNA sequence [(5'→3')ugg"c" ucctag | GGUAACA AACGAUGC], in which the only inconsistency is marked with a quotation mark ("").

[Cell Culture and ASO Treatment] PC12 cells were maintained in RPMI 1640 medium supplemented with 5% FBS, 10% horse serum, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate in a 5% CO ₂ atmosphere at 37 ^ο C. Cells grown in a 60 mm culture dish containing 5 ml culture medium were treated with "SNAP-ASO 3" at a concentration of 0 (negative control), 10, 100, or 1000 µM.

[RNA Extraction and cDNA Synthesis by One Step PCR] After incubation with "SNAP-ASO 3" for 42 hours, cells were treated with 100 μg/ml cycloheximide for another 6 hours to freeze translation on ribosomes. The total RNA was then extracted using the "Universal RNA Extraction Kit" (p/n 9767, Takara) according to the manufacturer's instructions. 200 ng of template RNA was reverse-transcribed in a volume of 25 µl using the Super Script® One-Step RT-PCR Kit with Platinum® Taq Polymerase (cat. no. 10928-042, Invitrogen) against the backdrop of a set of exon-specific primers exon 1_straight: (5'→3') ATGGCCGAGGACGCAGACA; and SNAP exon 14_reverse: (5'→3') AGCATCTTTGTTGCACCGTTG] according to the following cycling regimes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 40 cycles, each consisting of 30 sec at 94 ^ο C, 30 sec at 50 ^ο C and 1 min at 72 ^ο C.

[Nested PCR Amplification] 1 μl cDNA was subjected to a 20 μl nested PCR reaction (Cat. No. K2612, Bioneer) against the background of a set of exon-specific primers [SNAP exon 1_forward: (5'→3')ATGGCCGAGGACGCAGACA; SNAP exon 14n_reverse: (5'→3')TTGTTGGAGTCAGCGCCT] according to the following cycling patterns: 95 ^οC for 2 min followed by 34 cycles, each consisting of 30 sec at 95 ^οC , 30 sec at 55 ^οC , and 1 min at 72 ^° C.

[Identification of exon skipping products] PCR products were subjected to electrophoretic separation in 2% agarose gel. Target size bands were harvested and analyzed by Sanger sequencing.

In FIG. 48A shows electrophoresis data of PCR products in which the 10 µM ASO treatment sample gave a faint band for the PCR product attributable to exon skipping 5-7 (cf. left panel). Even when cells were treated with cycloheximide to destabilize full-length mRNA by freezing translation on ribosomes, only a weak exon-skipping band was found. Thus, the SNAP25 mRNA splicing variant attributed to exon skipping 5-7 likely exhibits poor metabolic stability in cells compared to full-length mRNA. The exon skipping PCR product, based on the sequencing data, was consistent with exon skipping 5-7 as shown in FIG. 48A. (See right panel) Given that the PCR product attributed to exon 6 skipping was observed regardless of ASO concentration, exon 6 skipping is thought to occur spontaneously.

The band intensity for full length SNAP25 mRNA decreased most in cells treated with 10 µM "SNAP-ASO 3". The intensity of the full-length mRNA band gradually increased to the level of the negative control (ie, no ASO treatment) as the ASO concentration increased from 10 to 1000 µM. The inverse dose-response pattern in the nested PCR data may be due to transcriptional activation induced by "exon(s) and intron(s) circular RNA (EIciRNA)" accumulated during exon skipping by "SNAP-ASO 3" [ nature struc. Mol. Biol , vol. 22 (3), 256-264 ( 2015 )].

SNAP25 example 2 . qPCR for SNAP25 mRNA in PC12 cells treated with "SNAP-ASO 3".

"SNAP-ASO 3" was evaluated by SNAP25-specific nested qPCR for its ability to induce mRNA level changes for rat SNAP25 in PC12 cells as follows.

[Cell culture and ASO treatment] PC12 cells grown in a 60 mm culture dish containing 5 ml of culture medium were treated with "SNAP-ASO 3" at a concentration of 0 (negative control), 10, 100 or 1000 µM (2 dishes for cultivation per concentration of ASO)

[RNA Extraction and cDNA Synthesis by One-Step RT-PCR] After incubation with "SNAP-ASO 3" for 42 hours, cells were treated with 100 μg/ml cycloheximide for another 6 hours to freeze translation on ribosomes. The total RNA was then extracted from the cells using the "Universal RNA Extraction Kit" (cat. no. 9767, Takara) according to the manufacturer's instructions. 200 ng of the template RNA were subjected to a reverse transcription reaction in a volume of 25 µl using a one-step RT-PCR kit (Invitrogen, USA) against the background of a set of exon-specific primers [SNAP exon 1_forward: (5'→3')ATGGCCGAGGACGCAGACAA; and SNAP exon 14_reverse: (5'→3')AGCATCTTTGTTGCACGTTG] according to the following cycling regimes: 50 ^οC for 30 min and 94 ^οC for 2 min, followed by 20 cycles, each consisting of 30 sec at 94 ^ο C, 30 sec at 55 ^ο C and 1 min at 72 ^ο C.

[Nested qPCR amplification] 1 µl of each 100-fold diluted cDNA solution was subjected to a real-time PCR reaction in a volume of 20 µl against the backdrop of a set of exon-specific primers [SNAP exon 7q_forward: (5'→3')ATGGATGAAAACCTAGAGC ; and SNAP exon 8q_reverse: (5'→3')CTTCCCAGCATCTTTGTT] according to the following cycle modes: 95 ^οC for 3 min followed by 40 cycles, each consisting of 10 sec at 95 ^οC and 30 sec at 60 ^οC The qPCR reaction was monitored with a Taqman [[5'→3')5,6-FAM-CAGCCTTCT-ZEN-CCATGATCCT-3IABkFQ] probe targeting the junction of exon 7 and exon 8 to quantify full-length mRNA for SNAP25.

In FIG. 48B shows qPCR data in which the level of full-length mRNA significantly (Student's t-test) decreased in cells treated with "SNAP-ASO 3" at a concentration of 10 cM and 100 cM, approximately 50% and 20%, respectively. However, the level of full-length mRNA in cells treated with 1000 μM "SNAP-ASO 3" was slightly higher than the level in cells without ASO treatment (ie negative control).

The inverse dose-response pattern in the qPCR data is highly consistent with the dose-response pattern of the full-length mRNA level during exon skipping described in "SNAP25 Example 1", suggesting an increase in transcription as the dose of ASO increases from 10 to 1000 nM. . Thus, the 13-mer complementary overlap with pre-mRNA for rat SNAP25 was insufficient to suppress EIciRNA-induced transcriptional activation accumulated during exon skipping.

SNAP25 example 3 . qPCR for SNAP25 mRNA in PC12 cells treated with "SNAP-ASO 1".

"SNAP-ASO 1" listed in Table 8 is a 16mer ASO fully complementary to the 16mer sequence of the 3' splicing site spanning the junction of intron 6 and exon 7 in pre-mRNA for human SNAP25. "SNAP-ASO 1" overlaps complementarily with the 16-mer target sequence as indicated by "bold" and "underline" in the 30-mer human pre-mRNA sequence [(5'→3')cucuuugga ucccag | GGUAACAAU GAUGC]. "SNAP-ASO 1" has the ability to overlap 6-mer with intron 6 and 10-mer overlap with exon 7. However, with mRNA for rat SNAP25, ASO has one inconsistency, as noted by "bold" and "underline" in the 25-mer pre-mRNA sequences [(5'→3')uggcu cccag | GGUAACAAA "C" GAUGC1. where one inconsistency is marked with a quotation mark ("").

"SNAP-ASO 1" was evaluated by SNAP25-specific nested qPCR for its ability to induce changes in mRNA levels for rat SNAP25 in PC12 cells as described in "SNAP25-Example 2" unless otherwise noted.

In FIG. 48C shows qPCR data in which the level of full-length mRNA significantly (Student's t-test) decreased in cells treated with "SNAP-ASO 1" at a concentration of 10 cM, 100 cM and 1000 cM by approximately 50%, 40% and 70%, respectively. .

As with SNAP-ASO 3, the inverse dose-response pattern was partially reproduced with SNAP-ASO 1 when the dose was increased from 10 to 100 µM. However, given that the level of full-length mRNA further decreased as the ASO concentration increased to 1000 µM, the efficiency of exon skipping in the case of "SNAP-ASO 1" appears to be higher than in the case of "SNAP-ASO 3". The 15-mer complementary overlap of "SNAP-ASO 1" with rat pre-mRNA would be responsible for the higher efficiency of exon skipping.

SNAP25 Example 4 Inhibition of SNAP25 protein expression in PC12 cells with "SNAP-ASO 3".

"SNAP-ASO 3" was evaluated for its ability to inhibit SNAP25 protein expression in PC12 cells as follows.

PC12 cells were grown in a 60 mm culture dish containing 5 ml culture medium and treated with "SNAP-ASO 3" at a concentration of 0 uM (negative control), 1 uM, 10 uM, 30 uM, 100 uM, 300 uM, 1 aM, 3 aM, or 10 aM for 48 hours. 4 negative control culture dishes were used to compensate for possible technical artifacts during analysis by Western blot.

[Cell Lysis] Cells were then lysed on ice using 200 µl of 1X RIPA buffer (Cat. No. 9806, Cell Signaling Tech) supplemented with 1% SDS and 1X Proteinase Inhibitor Mix (Complete Mini, Roche). The lysates were collected in a 1.5 ml Eppendorf tube, mixed with 100 µl of 5X sample buffer and boiled for 5 minutes.

[Western Blotting] Lysates were subjected to electrophoretic separation in a 4-15% gradient TGX-PAGE electrophoresis gel (p/n 456-1086, Bio-Rad) and then transferred to a 0.45 μm PVDF membrane. The membrane was examined using an anti-SNAP25 antibody (Cat. No. S9684, Sigma) and an anti-β-actin antibody (Cat. No. A3845, Sigma).

In FIG. 49A shows SNAP25 Western blot data obtained from PC12 cell lysates (upper panel) and relative SNAP25 expression levels adjusted for β-actin by densitometry (lower panel). The level of SNAP25 protein was reduced by 10-60% in cells treated with "SNAP-ASO 3". The expression level of the negative control (ie, 0 μM "SNAP-ASO 3") is the average expression level of 4 samples.

SNAP25 example 5 . Inhibition of SNAP25 protein expression in PC12 cells using "SNAP-ASO 1".

"SNAP-ASO 1" was evaluated for its ability to inhibit SNAP25 protein expression in PC12 cells as described in "SNAP25-Example 4" unless otherwise indicated. PC12 cells were treated with "SNAP-ASO 1" at a concentration of 0 (negative control), 100 or 1000 uM for either 48 hours or 72 hours. (One culture dish for each concentration of ASO).

In FIG. 49B shows Western blot data for ASO treatment at 48 hours (left) and 72 hours (right). "SNAP-ASO 1" significantly inhibited SNAP25 protein expression in PC12 cells at both time points.

SNAP25 Example 6 Inhibition of SNAP25 protein expression in SiMa cells with "SNAP-ASO 3".

"SNAP-ASO 3" was evaluated for its ability to inhibit SNAP25 protein expression in SiMa human neuroblastoma cells as follows.

[Cell Culture and ASO Treatment] SiMa cells (cat. no. ACC164, DSMZ) were maintained in RPMI 1640 medium supplemented with 10% FBS, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate in an atmosphere of 5% CO ₂ at 37 ^οC . SiMa cells were grown in a 60 mm culture dish containing 5 ml of culture medium and treated for 48 hours with "SNAP-ASO 3" at a concentration of 0 mM (negative control), from 1 mM to 100 aM . For the negative control, 3 culture dishes were used to compensate for possible technical artifacts during analysis by Western blotting.

[Cell Lysis] Cells were lysed on ice using 200 µl of 1X RIPA buffer (Cat. No. 9806, Cell Signaling Tech) supplemented with 1% SDS and 1X Proteinase Inhibitor Mix (Complete Mini, Roche). The lysates were then collected in a 1.5 ml Eppendorf tube, mixed with 100 µl of 5X sample buffer and boiled for 5 minutes.

[Western blotting] Lysates were subjected to electrophoretic separation in 12% SDS-PAGE for electrophoresis and transferred to a 0.2 μm polyvinylidene difluoride (PVDF) membrane. The membrane was examined using an anti-SNAP25 antibody (p/n ab41455, Sigma) and an anti-β-actin antibody (p/n A3845, Sigma).

In FIG. 50A shows SNAP25 Western blot data obtained from SiMa cell lysates (upper panel) and relative SNAP25 expression levels normalized to β-actin by densitometry (lower panel). The level of SNAP25 protein was reduced by 40-50% in cells treated with "SNAP-ASO 3".

SNAP25 Example 7 qPCR for SNAP25 mRNA in SiMa cells treated with "SNAP-ASO 3".

"SNAP-ASO 3" was evaluated by SNAP25-specific nested qPCR for its ability to induce changes in human SNAP25 mRNA levels in SiMa cells as follows.

[Cell culture and ASO treatment] SiMa cells were grown in a 60 mm culture dish containing 5 ml of culture medium and treated with "SNAP-ASO 3" at a concentration of 0 uM (negative control), 1 uM, 10 uM, 100 uM, 1 aM, 10 aM, or 100 aM (2 culture dishes for each ASO concentration)

[RNA Extraction and cDNA Synthesis] Total RNA was extracted from cells using the RNeasy mini preparation kit (Cat. No. 74106, Qiagen) according to the manufacturer's instructions. 200 ng of template RNA was subjected to a 25 µl reverse transcription reaction using the PrimeScript First Strand cDNA Synthesis Kit (Cat. No. 6110B, Takara) in a background of random hexamers.

[Amplification by qPCR]. PCR reactions were monitored using the Taqman probe [(5'→3')56-FAM-CGGCTTCAT-ZEN-CCGCAGGGTAACAA-3IABkFQ] targeted at the junction of exon 6 and exon 7 against the backdrop of a set of exon-specific primers. [SNAP exon 6_forward: (5'→3')GACGAACGGGAGCAGATG; and SNAP exon 8_reverse (2): (5'→3')ATCTCATTGCCC-ATATCCAGG]. Cycling modes: 95 ^ο C for 3 min followed by 40 cycles: 15 sec at 95 ^ο C and 30 sec at 60 ^ο C.

In FIG. 50B shows qPCR data in which the level of full-length mRNA for human SNAP25 significantly (Student's t-test) decreased in cells treated with "SNAP-ASO 3" at a concentration of 1 cM, 100 cM, 1 aM and 100 aM, by 20-40% . Cells treated with ASO at 100 aM showed the strongest inhibition at 40%.

SNAP25 example 8 . Inhibition of SNAP25 protein expression in the skin of a mouse topically injected with "SNAP-ASO 1".

"SNAP-ASO 1" is a 16mer ASO fully complementary to the 3' splicing site spanning the junction of intron 6 and exon 7 in mouse SNAP25 pre-mRNA read from mouse genomic DNA [accessed from the reference sequence NCBI: NC_000068]. "SNAP-ASO 1" was evaluated for its ability to inhibit SNAP25 protein expression in the skin when administered topically as follows.

[Cutting and grouping] On day 0, 8 female C57BL/6 mice (5 weeks old) were anesthetized with zoletil/rompoon and clipped on the back (approximately 3 cm×4 cm) with a clipper. Mice were randomly assigned to 4 groups, ie. group without ASO treatment (negative control) and 3 treatment groups 1 fM, 10 fM and 100 fM "SNAP-ASO 1". (2 animals per group)

[Topical administration] Solutions for topical application were prepared by serially diluting the aqueous stock solution of "SNAP-ASO 1" in a 30% (v/v) aqueous ethanol solution with the addition of 3% (v/v) glycerol to 0, 1, 10 and 100 fM "SNAP-ASO 1". Each animal was topically injected with approximately 1000 μl of topical solution to the back skin with hair removal using a cotton swab twice a day on days 0-4.

[Skin Sampling] Day 4, the animals were anesthetized with Zoletil/Rompun to sample the portion of the skin treated topically with ASO. The skin samples were then subjected to IHC against the SNAP25 protein as described below.

[SNAP25-IHC] Skin samples were subjected to frozen tissue sectioning and immunostaining sequentially with the first anti-SNAP25 antibody (p/n ab41455, Abeam) at a 1:200 dilution, the second anti-IgG antibody (p/n BA-1100, Vector ) at a 1:200 dilution, followed by Dylight 594-Steptavidin (Cat. No. SA-5594, Vector, CA, USA) at a 1:200 dilution for red fluorescence labeling. An anti-SNAP25 antibody probes the C-terminus of the SNAP25 protein. IHC images were obtained on a Zeiss slide scanner to evaluate SANP25 protein expression. DAPI staining was performed to visualize the microstructure of the skin.

In FIG. 51 shows a representative set of SNAP25 IHC images by group. In the negative control group, SNAP25 protein expression was high in the muscle layer just below the dermis. It is believed that the expression of the SNAP25 protein in the muscle layer is due to the expression of the SNAP25 protein in the axons of motor neurons embedded in the muscle layer. Expression of the SNAP25 protein in the muscle layer gradually decreased with increasing dose. The most marked decrease was seen in the 100 fM treatment group.

Inhibition of full-length SNAP25 protein expression in skin by IHC appears to be stronger than that Western blot inhibition observed in PC12 cells (cf. "SNAP25 Example 5"). Transcriptional activation by EIciRNA in primary cells, if any, does not appear to be as pronounced as the upregulation seen in cancer cells, including PC12 and SiMa cells.

Examples of in vitro activity of TYR-ASO.

Tyrosinase (TYR) is an enzyme involved in melanogenesis or skin pigmentation. The PNA derivatives of Formula I in Table 10 were designed to complementarily target the 3' splicing site of exon 2 in human or mouse TYR pre-mRNA. TYR-ASO was evaluated for TYR antisense exon skipping activity in human melanocytes as well as in B16F10 (mouse melanoma) cells. The biological examples presented here serve to illustrate the exon-passing activity of TYR-ASO as examples of a compound of formula I and should therefore not be interpreted as limiting the scope of the present invention of TYR ASO.

TYR Example 1 Exon skipping induced by "TYR-ASO 4" in B 16F10 cells.

"TYR-ASO 4" listed in Table 10 is a 13-mer TYR-ASO fully complementary to the 3' splicing site spanning the junction of intron 1 and exon 2 in mouse TYR, as indicated by "bold" and "underline » in 30-dimensional. mouse TYR pre-mRNA sequences [[5'→3')aauuguuuuu cacag | AUCAUUUG UAGCAGA]. Meanwhile, "TYR-ASO 4" has 4 mismatches with the 3' splicing site spanning the junction of intron 1 and exon 2 in human pre-mRNA TYR marked with a quotation mark ("") in the 30-mer pre-mRNA sequence [ (5'→3')ggguguuuug"u" acag | AU "UG" U "C" UG UAGCCGA].

"TYR-ASO 4" was evaluated for its ability to induce mouse TYR exon 2 skipping in B16F10 melanoma cells as follows. "TYR-ASO 4" can serve as a good substitute for "TYR-ASO 1", which is fully complementary to the pre-mRNA for human TYR.

[Cell Culture and ASO Treatment] B16F10 mouse melanoma cells (Cat. No. CRL-6475, ATCC) were maintained in DMEM (Dulbecco's Modified Minimum Eagle's Medium) supplemented with 10% FBS, 1% streptomycin/penicillin and 0.01mg/ ml of bovine insulin. B16F10 cells grown in a 60 mm culture dish containing 5 ml of DMEM were incubated for 5 hours with "TYR-ASO 4" at a concentration of 0 (negative control), 1, 10, 100 or 1000 aM.

[RNA Extraction and cDNA Synthesis by One Step PCR] Total RNA was extracted using the "Universal RNA Extraction Kit" (Cat. No. 9767, Takara) according to the manufacturer's instructions. 200 ng of template RNA was used for the reverse transcription reaction in a volume of 25 µl using the Super Script® one-step RT-PCR kit with Platinum® Taq polymerase (p/n 10928-042, Invitrogen) against the background of the exon-specific primer kit [TYR -exon 1_straight: (5'→3')GTAAGTTTGGATTTGGGG; and TYR-exon 4_reverse: (5'→3')AGAGCGGTATGAAAGGAA] according to the following cycling regimes: 50 ^οC for 30 min and 94 ^οC for 2 min, followed by 15 cycles, each consisting of 30 sec at 94 ^ο C, 30 sec at 52 ^ο C and 40 sec at 72 ^ο C.

[Nested PCR Amplification] 1 µl cDNA was further amplified in a 20 µl nested PCR reaction (Cat. No. K2612, Bioneer) against the backdrop of a set of exon-specific primers [TYR exon 1n_forward: (5'→3')GAGAACTAACTGGGGATGA; and TYR exon 4n_reverse: (5'→3')CGATAGGTGCATTGGCTT] according to the following cycling regimes: 95 ^οC for 5 min followed by 30 cycles, each consisting of 30 s at 95 ^οC , 30 s at 52 ^οC and 40 sec at 72 ^ο C.

[Identification of exon skipping products] PCR products were subjected to electrophoretic separation in 2% agarose gel. Target size bands were harvested and analyzed by Sanger sequencing.

In FIG. 52A shows electrophoresis data of PCR products. Cells without ASO treatment gave two bands for PCR products, one for full-length TYR mRNA and the other for a TYR mRNA splicing variant that lacks exons 2 and 3, suggesting spontaneous skipping of exons 2-3. However, cells treated with TYR-ASO 4 at 1-1000 aM essentially produced only a TYR mRNA splicing variant that lacks exons 2 and 3. Thus, TYR-ASO 4 increases the propensity for exon skipping 2- 3 in B16F10 melanoma cells.

The exon-skipping PCR product, according to sequencing, is an mRNA splicing variant lacking exons 2-3, as shown in FIG. 52V.

TYR Example 2 qPCR for TYR mRNA in B16F10 cells treated with "TYR-ASO 4".

"TYR-ASO 4" was evaluated by TYR-specific nested qPCR for its ability to induce changes in mouse TYR mRNA levels in B16F10 cells as follows.

[Cell culture and ASO treatment] B16F10 cells grown in a 60 mm culture dish containing 5 ml of culture medium were treated with "TYR-ASO 4" at a concentration of 0 (negative control), 1, 10, 100 or 1000 aM. (2 culture dishes for each dose)

[RNA extraction and cDNA synthesis by one-step PCR]. Total RNA was extracted and subjected to cDNA synthesis as described in "TYR Example 1".

[Nested qPCR Amplification] 1 µl of each 100-fold diluted cDNA solution was subjected to a real-time PCR reaction in a volume of 20 µl against a set of Taqman probes targeting the junction of exon 2 and exon 3 (p/n Mm00495818_ml, Thermo Fisher Scientific) according to the following cycles: 95 ^° C for 3 minutes followed by 30 cycles, each consisting of 10 seconds at 95 ^° C and 30 seconds at 60 ^° C.

[Statistical analysis] The nested qPCR experiment was repeated independently four times, and the individual mRNA levels in each experiment were adjusted to the mRNA level without ASO treatment. mRNA levels obtained from all 4 separate experiments were pooled for statistical analysis using Student's t-test. Thus, the number of RNA samples is 8 per concentration of ASO.

In FIG. 52C shows pooled qPCR data in which full-length mRNA levels were significantly (Student's t-test) reduced by approximately 40% in cells treated with TYR-ASO 4 at 1-1000 aM.

TYR Example 3 Inhibition of TYR protein expression by "TYR-ASO 4" in B16F10 cells.

"TYR-ASO 4" was evaluated for its ability to inhibit TYR protein expression in B16F10 cells as described below.

B16F10 cells grown in a 60 mm culture dish containing 5 ml of culture medium were treated with TYR-ASO 4 for 24 hours at a concentration of 0 uM (negative control), 10 uM, 100 uM, 1 aM, or 10 aM, and were lysed using 200 μl of 1X Cell Lysis Buffer (Cat. No. 9803, Cell Signaling Tech) supplemented with 1X Inhibitor Mix (Cat. No. P8340, Sigma). 200 µl of each lysate was mixed with 100 µl of 5X sample buffer and boiled at 100 ^° C for 5 min. 20 μl of each lysate was subjected to electrophoretic separation on a 4-15% gradient TGX gel (p/n 456-1086, Bio-Rad) and protein transfer to a 0.45 μm PVDF membrane. The membrane was examined using an anti-TYR antibody (Cat. No. 9319, Cell Signaling Tech) and an anti-β-actin antibody (Cat. No. a3845, Sigma).

In FIG. 53A shows TYR Western blot data obtained from lysates of B16F10 cells. The TYR protein level was significantly higher in the negative control lysates than in the TYR-ASO 4 treated cell lysates.

TYR Example 4 Inhibition of Melanogenesis by "TYR-ASO 4" in B16F10 Cells.

"TYR-ASO 4" was evaluated for its ability to inhibit melanogenesis in B16F10 cells as described below.

B16F10 cells grown in a 60 mm culture dish containing 5 ml of culture medium were treated with either TYR-ASO 4 at a concentration of 0 (negative control) or 1-1000 aM, or 10 or 100 μg/ml arbutin as a positive control (2 culture dishes for each dose). After 24 hours, the cells were lysed with 200 μl of 1 N NaOH. Each lysate was collected in a 1.5 ml Eppendorf tube and stored overnight at room temperature. The melanin content of each lysate was determined by optical density at 475 nm on an ELISA reader. The experiment was repeated four times using cells at different passages. The four sets of melanin content data were pooled for statistical analysis using Student's t-test for untreated melanin content (negative control).

In FIG. 53B summarizes changes in melanin content in B16F10 cells after 24 hours of incubation with either "TYR ASO 4" or arbutin. Melanin content was significantly reduced by approximately 15% and 25% in cells treated with 10 μg/ml and 100 μg/ml arbutin, respectively. In the case of cells treated with "TYR-ASO 4", the melanin content was significantly reduced by approximately 15% without significant dose dependence. The inhibitory activity of "TYR-ASO 4" was comparable to that of 10 μg/ml arbutin.

TYR Example 5 qPCR for TYR mRNA in human melanocytes treated with "TYR-ASO 1".

"TYR-ASO 1" listed in Table 10 is a 13-mer TYR-ASO fully complementary to the 3' splicing site spanning the junction of intron 1 and exon 2 in human TYR, as indicated by "bold" and "underline » in the 30-mer pre-mRNA sequence for human TYR [(5'→3')ggguguuuug uacag | AUUGUCUG UAGCCGA].

"TYR-ASO 1" was evaluated by TYR-specific nested qPCR for its ability to induce changes in the level of TYR mRNA in primary human epidermal melanocytes as follows.

[Cell Culture and ASO Treatment] Primary epidermal melanocytes (Part No. PCS-200-013, ATCC) were maintained in skin cell basal medium (Part No. PCS-200-030, ATCC) supplemented with a component from the Melanocyte Growth Kit. adults (Part No. PCS-200-042, ATCC). Melanocytes grown in a 60 mm culture dish containing 5 ml culture medium were treated with TYR-ASO 1 at a concentration of 0 uM (negative control), 1 uM, 100 uM, or 10 aM (3 culture dishes for each concentration) .

[RNA Extraction and cDNA Synthesis by One Step PCR] After incubation with "TYR-ASO 1" for 5 hours, total RNA was extracted using the RNeasy mini preparation kit (Cat. No. 74106, Qiagen) according to the manufacturer's instructions. 200 ng of template RNA was reverse transcribed in a 25 µl volume using the Super Script® One Step RT-PCR Kit with Platinum® Taq Polymerase (cat. no. -exon 1_straight (2): (5'→3')CTCTTTGTCTGGATGCATT; and TYR exon 5_reverse: (5'→3')CTGTGGTAATCCTCTTTCT] according to the following indicated cycling regimes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 15 cycles, each consisting of 30 sec at 94 ^ο C, 30 sec at 50 ^ο C and 1 min at 72 ^ο C.

[Nested PCR Amplification] 1 µl cDNA was further amplified in a 20 µl volume nested PCR reaction (Cat. No. K2612, Bioneer) against the backdrop of a set of exon-specific primers [TYR exon 2n_forward: (5'→3')GATAAAGCTGCCAATTTC; and TYR exon 3n_reverse: (5'→3')TTGTGCATGCTGCTTTGA] against the background of the Taqman probe [(5'→3')5,6-FAM-CACTGG-ZEN-AAGGATTTGCTAGTCCAC-3IABkFQ]. Cycling modes: 95 ^ο C for 3 min followed by 40 cycles, each consisting of 10 sec at 95 ^ο C and 30 sec at 60 ^ο C.

In FIG. 53C shows qPCR data in which the level of full-length mRNA for TYR was reduced by approximately 30% in human melanocytes treated with "TYR-ASO 1" at a concentration of 1 cM to 10 aM. The observed reductions were significant (Student's t-test) in cells treated with TYR-ASO 1 at 1 cM and 10 aM.

Examples of the biological activity of PD-1-ASO

PD-1, also known as programmed cell death protein 1 or CD279, is a cell surface receptor expressed in immune cells. PD-1 is an immune checkpoint protein involved in the suppression of the immune response. Anti-PD-1 monoclonal antibodies such as nivolumab and pembrolizumab have been used to treat solid tumors by enhancing the immune response.

The PD-1-ASOs of Formula I in Table 11 were designed to complementarily target either the 3' splicing site or the 5' splicing site of exon 2 in human or mouse PD-1 pre-mRNA. PDO-1-ASO was evaluated for antisense exon skipping activity in Jurkat cells as well as for antitumor activity in syngeneic tumor implanted wild-type mice. The biological examples provided herein serve to illustrate the exon-passing activity of PD-1-ASO as examples of a compound of Formula I and should therefore not be interpreted as limiting the scope of the present invention of PD-1-ASO.

PD-1 Example 1 Exon skipping induced by “PD-ASO 32 in Jurkat cells.

"PD-ASO 3" listed in Table 11 is a 14-mer PD-1-ASO fully complementary to the 5' splicing site spanning the junction of exon 2 and intron 2 in human PD-1 pre-mRNA, as noted "bold" and "underline" in the 30-mer pre-mRNA sequence for human PD-1 [(5'→3')AGCUCA GGGUGACAG | gugcg gcccgggagg]. "PD-ASO 3" has the ability to overlap 9-dimensionally with exon 2 and 5-dimensionally overlap with intron 2.

"PD-ASO 3" was evaluated for its ability to induce human PD-1 exon 2 skipping in Jurkat cells as follows.

[Cell Culture and ASO Treatment] Jurkat cells (Cat. No. TIB-152, ATCC) were maintained in RPMI-1640 supplemented with 10% FBS and 1% streptomycin/penicillin. Jurkat cells grown in a 60 mm culture dish containing 5 ml culture medium were treated for 5 hours with PD-ASO 5 at 0 (negative control), 10, 100 or 1000 aM.

[RNA Extraction and cDNA Synthesis by One Step RT-PCR] Total RNA was extracted using a Rneasy mini preparation kit (Qiagen, USA) according to the manufacturer's protocol. 500 ng of template RNA were subjected to reverse transcription in a volume of 25 µl using a one-step RT-PCR kit (Invitrogen, USA) against the background of a set of exon-specific primers [PD-exon 1_forward: (5'→3')GTCGTCTGGGCGGTGCTACAAC; and PD exon 5_reverse: (5'→3')GGGTGTGGAA-ATAGATGGG]. Cycling modes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 30 cycles, each consisting of 30 s at 94 ^ο C, 30 s at 53 ^ο C and 1 min at 72 ^ο C.

[Nested PCR Amplification] 1 µl cDNA diluted 100 times was further amplified in a 20 µl volume nested PCR reaction (Invitrogen, USA) using the following cycling modes: 20 sec at 95 ^οC , 30 sec at 56 ^οC and 40 sec at 72 ^ο C for 40 cycles against the background of a set of exon-specific primers [PD exon 1n_forward: (5'→3')GGCTGGCGGCCAGGATGGTTC; and PD-exon 5n_reverse: (5'→ 3')GAAAGAC AATGGTGGC ATACTCC].

[Identification of exon skipping products] The resulting nested PCR products were subjected to electrophoretic separation in a 2% agarose gel. Target size bands were harvested and analyzed by Sanger sequencing.

In FIG. 54A shows electrophoresis data of PCR products. Cells without ASO treatment gave only a full-length mRNA product band. Meanwhile, three bands of PCR products were observed newly formed in cells treated with PD-1-ASO. Of the three bands for PCR products, a band of approximately 470 bp. (labeled "non-specific" in FIG. 54A) was not an exon-skipping PD-1 mRNA splicing variant according to Sanger sequencing analysis.

Cells treated with "PD-ASO 3" at 10 and 100 aM gave a band for the PCR product corresponding to exon 2 skipping as determined by Sanger sequencing. However, in cells treated with 1000 aM "PD-ASO 3", the PCR product disappeared in case of exon 2 skipping, and the level of full-length mRNA was higher than the level of full-length mRNA in cells treated with lower concentrations of ASO. Two PCR products attributed to exon 2 and exon 3 skipping were confirmed by Sanger sequencing (cf. FIG. 54B). The inverse dose-response pattern in the nested PCR data could be due to transcriptional activation caused by "exon(s) and intron(s) circular RNA" (EIciRNA) accumulated during exon skipping by "PD-ASO 3" [ Nature Struc. Mol. Biol , vol. 22 (3), 256-264 ( 2015 )].

PD-1 Example 2 qPCR for PD-1 mRNA in Jurkat cells treated with "PD-ASO 3".

"PD-ASO 3" was evaluated by PD-1-specific nested qPCR for its ability to induce changes in mRNA levels for human PD-1 in Jurkat cells as follows.

[Cell culture and ASO treatment] Jurkat cells grown in a 60 mm culture dish were activated with anti-CD3 antibody (cat. no. 16-0037, eBioscience) at a dose of 1 μg/ml and anti-CD28 antibody (cat. no. 16 -0289, eBioscience) at a dose of 0.5 µg/ml for 48 hours. The culture medium was then replaced with fresh medium and treated with "PD-ASO 3" at a concentration of 0 (negative control), 10, 100 or 1000 aM for 24 hours (4 culture dishes for each concentration of ASO)

[RNA extraction and cDNA synthesis by one-step RT-PCR]. Total RNA was extracted using the RNAeasy mini-prep kit (Qiagen, USA) according to the manufacturer's protocol. 500 ng of template RNA were subjected to reverse transcription in a volume of 25 µl using a one-step RT-PCR kit (Invitrogen, USA) against the background of a set of exon-specific primers [PD-exon 1_forward: (5'→3')GTCGTCTGGGCGGTGCTACAAC; and PD exon 5_reverse: (5'→3')GGGTGTGGAA-ATAGATGGG]. Cycling modes: 50 ^ο C for 30 min and 94 ^ο C for 2 min, followed by 30 cycles, each consisting of 30 s at 94 ^ο C, 30 s at 53 ^ο C and 1 min at 72 ^ο C.

[Nested qPCR using SYBR] 1 µl of each 100-fold diluted cDNA solution was amplified by 20 µl nested qPCR against a set of exon-specific primers [PD-exon 2_forward: (5'→3')ACAACGCCACCTTCACCTGC; and PD-exon 2_reverse: (5'→3')GCCAGCTTGTCCGTCTGGTTG] according to the following cycling regimes: 20 sec at 95 ^οC , 30 sec at 56 ^οC , and 40 sec at 72 ^οC for 40 cycles. The qPCR reaction was studied using SYBR (Bio-Rad, USA).

In FIG. 55A shows qPCR data in which PD-1 mRNA was significantly (Student's t-test) reduced by >80% in cells treated with "PD-ASO 3" at 10 and 100 aM. In the case of cells treated with ASO at 1000 aM, the PD-1 mRNA level returned to approximately 55% of the negative control. The return of the mRNA level at 1000 aM is consistent with the reversal of the dose response observed in "PD-1 Example 1" (cf. FIG. 54A).

PD-1-example 3 . qPCR for IL-2 mRNA in Jurkat cells treated with "PD-ASO 3".

Suppression of PD-1 activity is known to enhance the expression of interleukin 2 (IL-2) [ Am. J.Clin. oncol . Vol 39(1), 98-106 ( 2016 )]. "PD-ASO 3" was evaluated by IL-2-specific nested qPCR for its ability to induce changes in mRNA levels for human IL-2 in Jurkat cells as follows.

[Cell culture and ASO treatment] Jurkat cells grown in a 60 mm culture dish were activated with anti-CD3 antibody (cat. no. 16-0037, eBioscience) at a dose of 1 μg/ml and anti-CD28 antibody (cat. no. 16 -0289, eBioscience) at a dose of 0.5 µg/ml for 48 hours. The culture medium was then replaced with fresh medium and treated with "PD-ASO 3" at a concentration of 0 (negative control), 10, 100 or 1000 aM for 24 hours (4 culture dishes per ASO concentration).

[RNA Extraction and cDNA Synthesis] Total RNA was extracted using an RNAeasy mini preparation kit (Qiagen, USA) according to the manufacturer's protocol. 500 ng of template RNA were reverse transcribed in a volume of 25 µl using the PrimeScript™ First Strand cDNA Synthesis Kit (Takara, Japan) according to the manufacturer's protocol.

[qPCR using SYBR] 1 μl of each cDNA solution was subjected to amplification by qPCR in a volume of 20 μl against a set of primers targeting mRNA for IL-2 [IL-2_direct: (5'→3')GTCACAAACAGTGCACCTAC; and IL-2_reverse: (5'→3')GGTGAGTTTGGGATTCTTGTA], according to the following cycle modes: 20 sec at 95 ^ο C, 30 sec at 56 ^ο C and 40 sec at 72 ^ο C for 40 cycles. The qPCR reaction was studied using SYBR (Bio-Rad, USA).

In FIG. 55B shows IL-2-specific qPCR data in which IL-2 mRNA levels increased significantly (Student's t-test) by approximately 140%, 120%, and 40% in cells treated with "PD-ASO 3" at a concentration of 10, 100 and 1000 aM, respectively. The inverse dose-response pattern is consistent with the inverse dose-response pattern observed in "PD-1 Example 1" and "PD-1 Example 2" (cf. Fig. 54A and Fig. 55A)

PD-1 Example 4 qPCR for PD-1 mRNA in Jurkat cells treated with "PD-ASO 1".

"PD-ASO 1" listed in Table 11 is a 14-mer PD-1-ASO fully complementary to the 3' splicing site spanning the junction of intron 1 and exon 2 in pre-mRNA for human PD-1 as marked "bold" and "underlined" in the 30-mer pre-mRNA sequence for human PD-1 [(5'→3')cucuccaucu cucag | ACUCCCCAG ACAGGC1. "PD-ASO 1" has the ability to overlap 5-dimensionally with intron 1 and 9-dimensionally overlap with exon 2.

"PD-ASO 1" was evaluated by PD-1-specific nested qPCR for its ability to induce changes in mRNA levels for human PD-1 in Jurkat cells as described in "PD-1 Example 2" unless otherwise noted.

In FIG. 56A shows qPCR data in which mRNA for PD-1 significantly (Student's t-test) decreased by approximately 60% in cells treated with "PD-ASO 1" at 100 and 1000 aM. Unlike the case with "PD-ASO 3", "PD-ASO 1" did not explicitly suggest a reversal of the dose-response relationship.

PD-1 example 5 . Antitumor activity of "PD-ASO 2" against B16F10 melanoma in C57BL/6 mice.

"PD-ASO 2" listed in Table 11 is a 16-mer PD-1-ASO fully complementary to the 5' splicing site spanning the junction of exon 2 and intron 2 in mouse PD-1 pre-mRNA as marked "bold" and "underlined" in the 30mer pre-mRNA sequence for mouse PD-1 [(5'→3')AGCUC GUGGUAACAG | gugagg cuaguagaa]. "PD-ASO 2" has the ability to overlap 10-mer with exon 2 and 6-mer overlap with intron 2.

Meanwhile, "PD-ASO 2" has four mismatches with human PD-1 pre-mRNA as noted by "bold" and "underline" in the 30mer human PD-1 pre-mRNA sequence [(5'→ 3')AGCUC"AG" GGU "G" ACAG | gug "c" gg ccucggagg], in which the four mismatches are marked with a quotation mark (""). "PD-ASO 2" can be considered as an ASO substituent of "PD-ASO 3" for human PD-1 pre-mRNA.

"PD-ASO 2" was evaluated for its antitumor activity in male C57BL/6 mice (4 weeks old) injected with B16F10 melanoma cells as follows.

[Inoculation of B16F10 Melanoma Cells] Mouse B16F10 melanoma cells (Cat. No. CRL-6475, ATCC) were maintained in a 150 mm culture dish containing DMEM supplemented with 10% FBS, 1% streptomycin/penicillin, and 0.01 mg/ml bovine insulin. On day 0, approximately 1×10 ⁵ B16F10 cells suspended in 50 μl PBS were injected into each animal in the rear right flank.

[Group and ASO treatment] On day 3, animals were randomized by weight into 4 groups: 0 (negative control), 2, 10 and 50 pmol/kg "PD-ASO 2". (N=15 per group)

Injectable solutions were prepared by serially diluting an aqueous stock solution of "PD-ASO 2" in PBS to 0 nM (PBS only), 0.4 nM, 2 nM and 12.5 nM "PD-ASO 2" for negative control, treatment group 2 , 10 and 50 pmol/kg "PD-ASO 2", respectively.

Animals were injected subcutaneously with an injection solution at a dose of 5 ml/kg, 2 times a week on days 3-17.

[Antineoplastic Activity] Antitumor activity was evaluated by changes in tumor volume between each ASO treatment group and a negative control group.

In FIG. 56B shows the observed tumor volumes by group on days 0-19. Tumor growth in the 2 pmol/kg treatment group was significantly inhibited on days 10-19. The observed inhibition at day 19 was approximately 55% (approximately 375 mm ³ and 850 mm ³ in the case of the 2 pmol/kg treatment group and the negative control group, respectively). The antitumor activity in the 50 pmol/kg treatment group was comparable to that in the 2 pmol/kg treatment group on days 10-17. However, the antitumor activity in the 50 pmol/kg treatment group disappeared on day 19. The antitumor activity in the 10 pmol/kg treatment group was minimal without significance throughout the period.

The strange dose-response pattern may be due to transcriptional activation caused by "exon(s) and intron(s) circular RNA (EIciRNA)" accumulated during exon skipping by "PD-ASO 2" [ Nature Struc. Mol. Biol , vol. 22 (3), 256-264 ( 2015 )]. However, given that nivolumab, a US FDA-approved monoclonal antibody against PD-1, has demonstrated a bell-shaped dose-response pattern in patients with tumors [ J. Clin. oncol . Vol 33 (18), 2013-2020 (2015)], the strange dose-response pattern of "PD-ASO 2" may be due to the intrinsic pharmacology of PD-1 inhibition.

On day 19, the animals were sacrificed to measure the weight of the tumor in groups. The mean tumor weight was approximately 0.35 g and 1.20 g for the 2 pmol/kg treatment group and the negative control group, respectively. Thus, tumor growth according to weight was significantly inhibited in the 2 pmol/kg treatment group by approximately 70% (p<0.01 by Student's t-test).

Claims (95)

1. A peptido nucleic acid derivative represented by formula I, or a pharmaceutically acceptable salt thereof, for inducing exon skipping in a pre-mRNA target:

where n is an integer between 10 and 25; the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in said target pre-mRNA; the compound of formula I is fully complementary to the target pre-mRNA sequence or partially complementary to the target pre-mRNA sequence with one or two mismatches; the radicals S ₁ , S ₂ , …, S _n-1 , S _n , T ₁ , T ₂ , …, T _n-1 and T _n are hydrido [H]; radicals X and Y are independently hydrido or substituted or unsubstituted alkyloxycarbonyl; the radical Z is unsubstituted amino [-NH ₂ ]; _{B 1} , _{B 2} . and at least four of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV:

where the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are hydrido; L ₁ , L ₂ and L ₃ are a covalent linker represented by formula V, covalently linking a basic amino group to a fragment of a nucleotide base:

where Q ₁ and Q _m are substituted or unsubstituted methylene (-CH ₂ -) radical and Q _m is directly linked to the basic amino group; Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from a substituted or unsubstituted methylene radical and an oxygen radical (-O-); and m is an integer between 1 and 15. 2. A peptidonucleic acid derivative according to claim 1 or a pharmaceutically acceptable salt thereof, where n is an integer between 11 and 23; the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in said target pre-mRNA; the compound of formula I is fully complementary to the target pre-mRNA sequence or partially complementary to the target pre-mRNA sequence with one or two mismatches; radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are hydrido; radicals X and Y are independently hydrido or substituted or unsubstituted alkyloxycarbonyl; the radical Z is unsubstituted amino; _{B 1} , _{B 2} . at least four of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV; the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are hydrido; Q ₁ and Q _m are a substituted or unsubstituted methylene radical and Q _m is directly linked to the basic amino group; Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from a substituted or unsubstituted methylene radical and an oxygen radical; and m is an integer between 1 and 11. 3. A peptidonucleic acid derivative according to claim 1 or a pharmaceutically acceptable salt thereof, where n is an integer between 11 and 21; the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in said target pre-mRNA; the compound of formula I is fully complementary to the target pre-mRNA sequence or partially complementary to the target pre-mRNA sequence with one or two mismatches; radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are hydrido; radicals X and Y are independently hydrido or substituted or unsubstituted alkyloxycarbonyl; the radical Z is unsubstituted amino; _{B 1} , _{B 2} . at least four of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV; the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are hydrido; Q ₁ and Q _m are a methylene radical and Q _m is directly linked to the basic amino group; Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from a methylene radical and an oxygen radical; and m is an integer between 1 and 11. 4. A peptido-nucleic acid derivative according to claim 1 or a pharmaceutically acceptable salt thereof, where n is an integer between 11 and 19; the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in said target pre-mRNA; the compound of formula I is fully complementary to the target pre-mRNA sequence; radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are hydrido; radicals X and Y are independently hydrido or substituted or unsubstituted alkyloxycarbonyl; the radical Z is unsubstituted amino; B ₁ , B ₂ , ..., B _n-1 and B _n independently selected from natural nucleotide bases, including adenine, thymine, guanine, cytosine and uracil, and non-natural nucleotide bases; at least four of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV; the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are hydrido; Q ₁ and Q _m are a methylene radical and Q _m is directly linked to the basic amino group; Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from a methylene radical and an oxygen radical; and m is an integer between 1 and 9. 5. A peptidonucleic acid derivative according to claim 1 or a pharmaceutically acceptable salt thereof, where n is an integer between 12 and 19; the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in said target pre-mRNA; the compound of formula I is fully complementary to the target pre-mRNA sequence; radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are hydrido; radicals X and Y are independently hydrido or substituted or unsubstituted alkyloxycarbonyl; the radical Z is unsubstituted amino; B ₁ , B ₂ , ..., B _n-1 and B _n independently selected from adenine, thymine, guanine, cytosine and non-natural nucleotide bases; at least five of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV; the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are hydrido; Q ₁ and Q _m are a methylene radical and Q _m is directly linked to the basic amino group; Q ₂ , Q ₃ , ... and Q _m-1 are independently selected from a methylene radical and an oxygen radical; and m is an integer between 1 and 9. 6. A peptidonucleic acid derivative according to claim 1 or a pharmaceutically acceptable salt thereof, where n is an integer between 12 and 18; the compound of formula I is capable of at least 10-mer complementary overlap with a 14-mer target splicing site sequence consisting of a 7-mer from an intron and a 7-mer from an exon in said target pre-mRNA; the compound of formula I is fully complementary to the target pre-mRNA sequence; radicals S ₁ , S ₂ , ..., S _n-1 , S _n , T ₁ , T ₂ , ..., T _n-1 and T _n are hydrido; radical X is hydrido; the radical Y is a substituted or unsubstituted alkyloxycarbonyl; the radical Z is unsubstituted amino; B ₁ , B ₂ , ..., B _n-1 and B _n independently selected from adenine, thymine, guanine, cytosine and non-natural nucleotide bases; at least five of B ₁ , B ₂ , ..., B _n-1 and B _n are independently selected from non-natural nucleotide bases represented by formula II, formula III or formula IV; the radicals R ₁ , R ₂ , R ₃ , R ₄ , R ₅ and R ₆ are hydrido; L ₁ is -(CH ₂ ) ₂ -O-(CH ₂ ) ₂ -, -CH ₂ -O-(CH ₂ ) ₂ -, -CH ₂ -O-(CH ₂ ) ₃ -, -CH ₂ - O-(CH ₂ ) ₄ -, -CH ₂ -O-(CH ₂ ) ₅ -, -CH ₂ -O-(CH ₂ ) ₆ - or -CH ₂ -O-(CH ₂ ) ₇ -, while the right end is directly connected to the basic amino group; and L ₂ and L ₃ are independently selected from -(CH ₂ ) ₂ -, -(CH ₂ ) ₃ -, -(CH ₂ ) ₄ -, -(CH ₂ ) ₅ -, -(CH ₂ ) ₆ -, -( CH ₂ ) ₇ -, -(CH ₂ ) ₈ -, -(CH ₂ ) ₂ -O-(CH ₂ ) ₂ -, -(CH ₂ ) ₃ -O-(CH ₂ ) ₂ - and -(CH ₂ ) ₂ -O-(CH ₂ ) ₃ -, while the right end is directly connected to the main amino group. 7. A derivative of a peptido-nucleic acid according to claim 1 or a pharmaceutically acceptable salt thereof, where the radical X is a hydrido; and the radical Y is a substituted or unsubstituted alkyloxycarbonyl. 8. A method of inducing cells to skip a target exon in a pre-mRNA target, comprising bringing the cells into contact with a peptide nucleic acid derivative according to any one of paragraphs. 1-7. 9. The method of claim 8, wherein said cells are contacted with said peptide nucleic acid derivative at a concentration of 1 pM or less in an aqueous solution. 10. A method of inducing a target exon skip in a pre-mRNA target in a subject, comprising administering to the subject a peptidonucleic acid derivative according to any one of paragraphs. 1-7. 11. A method of inhibiting in cells the functional activity of a gene from which a pre-mRNA target is transcribed, including bringing the cells into contact with a peptidonucleic acid derivative according to any one of paragraphs. 1-7. 12. The method of claim 11, wherein said cells are brought into contact with said peptide nucleic acid derivative at a concentration of 1 pM or less in an aqueous solution. 13. A method of inhibiting in a subject the functional activity of a gene from which a pre-mRNA target is transcribed, comprising the introduction of a peptidonucleic acid derivative according to any one of paragraphs. 1-7. 14. Derived peptido-nucleic acid according to any one of paragraphs. 1-7 which is capable of at least 10 mer complementary overlap with the 14 mer target splicing site sequence, which consists of a 7 mer from an intron and a 7 mer from an exon, in the target pre-mRNA, wherein the sequence The target splicing site is not [(5'→3')UUGCCUGGUAAGGA] in pre-mRNA for the human androgen receptor, [(5'→3')UUUUUGCGUAAGUA] in pre-mRNA for human SCN9A, [(5'→3 ')UAAGUAGGAUAAGU] in pre-mRNA for human HIF-1α, [(5'→3')AUCCCAGGGUAACA] in pre-mRNA for human SNAP25, [(5'→3')UGUUUAGGUACU] in pre-mRNA for human SCN9A, or [(5'→3')UGUACAGAUUGUCU] in pre-mRNA for human tyrosinase. 15. Derived peptido-nucleic acid according to any one of paragraphs. 1-7 which is capable of at least 10-mer complementary overlap with the target splice site in the target pre-mRNA, wherein the target splice site sequence does not include [(5'→3')UUGCCUGGUAAGGA] in the pre-mRNA for the human androgen receptor, [(5'→3')UUUUUGCGUAAGUA] in pre-mRNA for human SCN9A, [(5'→3')UAAGUAGGAUAAGU] in pre-mRNA for human HIF-1α, [(5'→3' )AUCCCAGGGUAACA] in pre-mRNA for human SNAP25, [(5'→3')UGUUUAGGUACACU] in pre-mRNA for human SCN9A, or [(5'→3')UGUACAGAUUGUCU] in pre-mRNA for human tyrosinase. 16. The use of a peptidonucleic acid derivative according to any one of paragraphs. 1-7 in the manufacture of a medicament for inducing target exon skipping in a pre-target mRNA in a subject. 17. The use of a peptidonucleic acid derivative according to any one of paragraphs. 1-7 in the manufacture of a drug for inhibiting in a subject the functional activity of a gene from which a pre-mRNA target is transcribed. 18. The use of a peptidonucleic acid derivative according to any one of paragraphs. 1-7 to induce target exon skipping in the target pre-mRNA in the subject. 19. The use of a peptidonucleic acid derivative according to any one of paragraphs. 1-7 to inhibit in the subject the functional activity of the gene from which the pre-mRNA target is transcribed.

Images