RU2783116C2 - Modification of b-cells - Google Patents

Abstract

FIELD: biotechnology; cell biology.

SUBSTANCE: present invention relates to biotechnology and cell biology, in particular to a genetically modified B-cell, a composition for its delivery, a method for the production of protein, and the use of the specified cell in a method for the production of protein. The specified genetically modified B-cell produces inhibitory antibodies against a blood clotting factor or protein, which participates in an autoimmune disease, and it is capable of expressing a transgene (an antibody specific relatively to a B-cell). It contains one or more transgenes and one or more additional modifications, which perform knockout of genes of a B-cell receptor, and/or modify cell interactions in germ centers, and modifications inhibiting suppression of any function of the B-cell, associated with an infection by a pathogen or regulation of malignant tumor. At the same time, the specified transgene is expressed episomal in the specified modified B-cells or is integrated into locus of a safety area, selected from a group consisting of CCR5, Rosa, albumin, AAVS1, TCRA, TCRB.

EFFECT: present invention allows for expansion of the arsenal of means for expression of a desired transgene at a therapeutically significant level in a subject for the treatment of genetic diseases, such as hemophilia, diabetes, diseases with lysosome accumulation, A1AT insufficiency, and malignant tumors.

18 cl, 10 ex, 39 dwg

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims the benefit of U.S. Provisional Application No. 62/450917, filed Jan. 26, 2017, the entire contents of which are hereby incorporated by reference herein.

FIELD OF TECHNOLOGY

[0002]This description relates to the field of gene therapy, in particular genome editing and targeted delivery of transgene-encoding constructs to B cells to express benefit (therapeutic) proteins.

BACKGROUND OF THE INVENTION

[0003]Gene therapy can be used to genetically engineer a cell to obtain the presence of one or more inactivated genes and/or to cause that cell to express a product not previously produced in that cell (e.g., by inserting a transgene and/or by correcting the endogenous sequence). Examples of applications for transgene insertion include nuclease-mediated modification, including insertion of one or more genes encoding one or more novel therapeutic proteins, including therapeutic antibodies, insertion of a coding sequence encoding a protein absent in a cell or individual, insertion of a wild-type gene into a cell containing a mutant gene sequence; and/or an insertion of a sequence encoding a structural nucleic acid, such as a microRNA or miRNA. These methods can also be used to knock out endogenous gene expression and/or to change the toxicity profile of a cell. Cm., for example, US Patent No. 9394545; 9150847; 9206404; 9045763; 9005973; 8956828; 8936936; 8945868; 8871905; 8586526; 8563314; 8329986; 8399218; 6534261; 6599692; 6503717; 6689558; 7067317; 7262054; 7888121; 7972854; 7914796; 7951925; 8110379; 8409861; US Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060063231; 20080159996; 20100218264; 20120017290; 20110265198; 20130137104; 20130122591; 20130177983 and 20130177960, and 20150056705.

[0004] B cells function in humoral immunity by secreting antibodies against a variety of antigens. They are professional antigen-presenting cells (APCs) and are activated by helper T cells to differentiate into plasma cells that produce large amounts of antigen-specific antibodies. B cell development occurs in both the liver and bone marrow of the fetus, and a critical step in B cell development is the formation of the B cell receptor (BCR), a complex structure containing unique heavy and light chains. The process of BCR formation involves the rearrangement of various fragments of immunoglobulin (Ig) genes, both in the heavy and light chains of BCR genes, during the pro-B cell phase of B cell maturation. Pro-B cells become pre-B cells after successful pairing of the rearranged heavy and light chains, where the resulting pre-BCR is expressed on the cell surface of the pre-B cells. Signaling through the pre-BCR drives further development of the B cell leading to an increase in pre-B cells. Ultimately, the large pre-B cells stop proliferation and further light chain rearrangement occurs, resulting in the expression of the unique IgM BCR on the cell surface of what is now considered an immature B cell. These cells then exit the bone marrow and circulate in the periphery as transitional B cells.

[0005] Maturation of immature B cells occurs primarily in the spleen, where selection also occurs, so that B cells producing antibodies with high affinity for self antigens are destroyed (see Naradikian et al. (2014) in Drugs Targeting B - Cells in Autoimmune Diseases, Milestones in Drug Therapy (X. Bosch et al. ( eds )) doi 10.1007/978-3-3-0348-0706-7_2, Springer Basel). Circulating B cells are able to enter secondary lymph nodes and spleen and receive antigen from follicular dendritic cells. After entering the lymph node/spleen and interacting with dendritic cells, B cells internalize the antigen and process it such that peptide fragments of the antigen are presented by MHC class II molecules to related CD4+ T cells. These T cells are previously activated by APC presenting the same antigen. The interaction between B and T cells results in a number of events including complete activation of the T cell leading to T cell proliferation. The T cells then produce cytokines that act directly on the B cells to induce B cell proliferation and switch the class of antibody expressed on the surface of the B cell. Proliferating B cells cluster in temporary areas in the lymph nodes and spleen known as "germ centers". These activated B cells differentiate either into specialized antibody-secreting cells (plasmoblast or plasma cell), which appear to undergo a preprogrammed number of divisions (typically 5-6) before they complete their final stage of differentiation in order to become non-proliferating plasma cells. Alternatively, activated B cells leave the germinal center and differentiate into memory B cells (Zhang et al. , (2016) Immunol Rev 270(1): 8-19).

[0006] Upon activation, cytidine deaminase (AID), which is induced by enzyme activation by a genomic mutator, is expressed, which leads to somatic hypermutation in antibody genes and class-switched recombination (CSR) that alters antibody effector function. Somatic hypermutation occurs in the immunoglobulin variable region (IgV) gene, producing a repertoire of antibody mutants with different affinities for the antigen (Klein and Heise (2015) Curr Opin Hematol 22(4): 379-387). This process takes place in the so-called "dark zone" in the germinal center. Differentiated B cells migrate to the "light zone" where B cells producing higher affinity antibodies compete for available antigen and/or T cell help so that they receive survival signals through B cell receptors. B cells producing lower affinity antibodies do not receive these survival signals because they cannot compete with their sister B cells producing higher affinity antibodies and thus undergo apoptosis. B cells producing higher affinity antibodies can then either re-enter the dark zone for additional cycles of proliferation and somatic hypermutation, can leave the germinal center and differentiate into plasmablasts, or can differentiate into long-lived memory B cells (Recaldin and Fear (Recaldin and Fear). 2015) Clin and Exp Immunol 183:65-75).

[0007]Thus, in a very complex process, B cells are induced to express large amounts of antibodies against antigens to protect the host from a range of potential threats. Interestingly, there are a number of pathogens (for example, parasites, bacteria, viruses) that are capable of disrupting the antibody response. These pathogens include a number of agents responsible for a variety of human diseases including, but not limited to, Plasmodium, Schistosoma, Mycobacterium, HIV, HCV, and HBV (Borhis and Richard (2015)BMC Immunology 16:15 doi 10.1186/s12865-015-0079-y). The mechanisms behind pathogen-mediated suppression of antibody responses are not fully known, but certain pathogens appear to induce the production of unusual B cell subtypes that alter the cellular microenvironment, leading to suppression of both B and T cells. For example, HBV has been shown to interfere with stimulation by Toll-like receptor 9 (TLR9) so that dendritic cells produce less IFN-α (known to induce B cells to proliferate and secrete IgM). Apparently, HBV can selectively inhibit TLR9 expression in B-lymphocytes (Vincentet al. (2011)PLOS ONE 6(10):e26315. doi:10.1371/journal.pone.0026315).

[0008] Over the past decade, studies have provided well-established evidence of discrete subgroups of immunoregulatory B cells in both mice and humans. These suppressor B cells have the ability to maintain immune tolerance and suppress pathological autoimmune and inflammatory immune responses, as well as to suppress responses during the immune surveillance of malignant tumors, through the release of anti-inflammatory mediators such as interleukin-10 (IL-10), and the expression of inhibitory molecules such as PD-L1. These studies have led to the conclusion that there is a pool of B cells that play a suppressor role in immune tolerance, and this pool is currently referred to as regulatory B cells or "B-reg". Other phenotypes associated with human Breg include suppression of autoimmune inflammation and a role in allergen tolerance. More recent studies have shown that B cells may play conflicting roles in the progression of malignant tumors. For example, for IL-10-producing CD1d ^high CD5+ B cells isolated from rituximab-treated CLL patients, anti-CD20 antibody-mediated B-cell depletion largely enriched the B-reg pool. It has been suggested that enriched B-regs suppress antitumor immunity required to kill anti-CD20 antibody-associated tumor cells, causing patients to develop lymphoma resistance to anti-CD20 antibody therapy and/or eventually relapse as a result of increased cancer progression ( Bodogai et al. , (2013) Cancer Res 73:2127-2138).

[0009] Observations that human B cells negatively regulate tumor growth were noted when the presence of tumor-infiltrating CD20+ tumor lymphocyte B cells in ovarian cancer, non-small cell lung carcinoma, and cervical cancer was correlated with improved survival and lower recurrence rates. These studies showed that tumor-infiltrating B cells correlated with favorable outcomes. B-regs can suppress a variety of cell subtypes, including T cells, through the secretion of anti-inflammatory mediators such as IL-10, and can promote the transition of T cells to regulatory T cells, thus attenuating antitumor immune responses. Potential mechanisms underlying B-cell antitumor immunity may include B-cell secretion of effector cytokines such as IFN-γ, which may induce T cell polarization towards a Th1 or Th2 response, or stimulate T cell responses through its role as antigen presenting cells (Sarvaria et al. (2017) Cell Mol Immunol 14(8):662-674).

[0010] However, human B cells have also been shown to promote tumor progression. A correlation could be shown between the presence of B cells with activated STAT3 in human tumor tissues and the severity of tumor angiogenesis. And also, infiltration of CD19+ B cells in patients with metastatic ovarian carcinoma; or increased infiltration of CD20+ and CD138+ B cells in patients with epithelial ovarian cancer is associated with poor prognosis and outcome. In addition, a reduction in tumor burden after partial reduction of B cells with rituximab was found in 50% of patients with advanced colorectal cancer. Thus, the exact role that B-regs play in malignant tumors is still unclear, but most likely relates to the activity of B-reg subtypes (Sarvaria, ibid.).

[0011] A significant number of disorders are either caused by deficiency of a secreted gene product or are treatable by secretion of a therapeutic protein. Blood clotting disorders, for example, are very common genetic disorders where factors in the blood clotting cascade are impaired in some way, ie. with no expression or with the production of a mutant protein. Most clotting disorders result in hemophilias such as hemophilia A (factor VIII deficiency), hemophilia B (factor IX deficiency), or hemophilia C (factor XI deficiency). The treatment of these disorders is often related to their severity. For mild hemophilias, treatment may include drugs designed to increase expression of the underexpressing factor, while for more severe hemophilias, therapy involves regular infusion of the missing clotting factor (often 2-3 times per week via enzyme replacement therapy (ERT) ) to prevent bleeding. Patients with severe hemophilia are often warned against playing many sports and must take extra precautions to avoid everyday injury.

[0012]Failure alpha-1 antitrypsin (A1AT) is an autosomal recessive disease caused by a deficiency in the production of alpha-1 antitrypsin, resulting in inadequate levels of A1AT in the blood and lungs. It may be associated with the development of chronic obstructive pulmonary disease (COPD) and liver disorders. Currently, the treatment of diseases associated with this deficiency may include infusion of exogenous A1AT and transplantation of the lung or liver.

[0013] Lysosome storage diseases (LSD) are a group of rare metabolic monogenic diseases characterized by the absence of functional individual lysosomal proteins normally involved in the breakdown of waste lipids, glycoproteins, and mucopolysaccharides. These diseases are characterized by the accumulation of these compounds in the cell because it is unable to process them for recycling due to the malfunctioning of a specific enzyme. Common examples include Gaucher's disease (glucocerebrosidase deficiency - gene name: GBA), Fabry disease (α-galactosidase deficiency - GLA), Gunther's disease (iduronate-2-sulfatase deficiency - IDS), Hurler's disease (alpha-L-iduronidase deficiency - IDUA) and Niemann -Pika (deficiency of sphingomyelinphosphodiesterase 1 - SMPD1).

[0014] Type I diabetes is a disorder in which immune-mediated destruction of pancreatic beta cells results in significant deficiency of insulin, the primary secreted product of these cells. Restoration of baseline insulin levels provides significant relief from many of the more serious complications of this disorder, which may include "macrovascular" complications affecting large vessels: coronary heart disease (angina pectoris and myocardial infarction), stroke, and peripheral vascular disease, as well as "microvascular" complications from due to damage to small blood vessels. Microvascular complications can include diabetic retinopathy, which affects the formation of blood vessels in the retina of the eye, and can lead to visual symptoms, visual impairment and potentially blindness, and diabetic nephropathy, which can include scarring of the kidney tissue, loss of a small or gradually increasing amount protein in the urine, and ultimately chronic renal failure requiring dialysis.

[0015]However, the provision of therapeutic proteins for the treatment of disorders in a subject may be limited by the subject's own immune response to the therapeutic protein, including the production of antibodies by the subject's B cells, which may limit the effectiveness of such treatments. For example, in patients with hemophilia who are exposed to ERT clotting factor(s) that are deficient or absent (eg, factor VIII, factor IX, etc.), antibodies can be formed against these essential proteins (for example, antibodies against F9). An estimated 15-50% of patients with hemophilia A develop inhibitory antibodies against the factor 8 therapeutic protein (Krudysz-Ambloet al., (2009)Blood 113(11):2587-2594). In some cases, reactions can be severe (anaphylactic shock), leading to a situation where the required ERT causes dangerous side effects in the patient (see for example, JM Lusher (2000)Semin Thromb Hemost 26(2):179-188).

[0016]In addition, antibodies are secreted protein products whose binding plasticity has been used to develop a wide variety of drugs. Therapeutic antibodies can be used to neutralize target proteins that directly cause disease (for example, VEGF in macular degeneration), as well as for the highly selective killing of cells whose persistence and reproduction poses a risk to the host (eg, cancer cells, as well as certain immunocytes in autoimmune diseases, including B cells that produce antibodies against self antigens). In such applications, therapeutic antibodies take advantage of the body's normal response through its own antibodies to achieve selective killing, neutralization, or clearance of target proteins or cells bearing the antibody's target antigen. Thus, antibody therapy is widely used for a variety of human conditions, including oncology, rheumatology, transplantation, and eye diseases.

[0017] Thus, there remains a need for additional methods and compositions that can be used to express a desired transgene at a therapeutically relevant level in a subject for the treatment of genetic diseases such as hemophilia, diabetes, lysosome storage diseases, and/or A1AT deficiency, including treatment and/or exclusion of any associated toxicity, and which may limit the expression of the transgene or therapeutic protein to the desired tissue type, including limiting innate B cell responses. In addition, there remains a need for additional methods and compositions for expressing a desired transgene (eg, antibody) at a therapeutically relevant level for the treatment of other diseases such as cancer.

SUMMARY OF THE INVENTION

[0018]Site-specific modification of B cells at one or more genetic loci can improve B cell function (including enhancing antibody production by these cells and/or targeting B cells to produce proteins that limit unwanted innate immune responses), differentiation into plasmablasts, and the ability to engraftment during transplantation. Control of B cells through targeted gene modification (eg, disruption and/or addition of a genomic or episomal gene) provides effective and less toxic protein replacement therapies and furthermore allows communication within the germinal centers to be programmed.

[0019]The present invention relates to compositions and methods for modulating the expression of a target gene in a B cell and/or the expression of a transgene in a B cell (including plasmablast derivatives or plasma cells). Thus, the present invention relates to genetically modified B cells (including B cells derived from genetically modified hematopoietic stem cells or other B cell progenitors) containing one or more of the following modifications: incorporation of one or more transgenes into the cell; and/or insertions and/or deletions modifying (i) B-cell receptor genes and/or (ii) cellular interactions at germinal centers; and/or (c) modifications that inhibit the suppression of any B cell function associated with pathogen infection or cancer regulation. The transgene(s) can be expressed outside of chromosomes (episomal) and/or can be integrated into the B cell genome (eg, via nuclease-mediated targeted integration, eg, into a safety region locus). In some embodiments, one or more transgenes are episomal maintained and one or more transgenes are integrated into the genome of a cell (B cell or HSC to be differentiated into a B cell). In some embodiments, the transgene encodes a protein involved in the blood coagulation cascade. In other embodiments, the transgene encodes an enzyme defective in lysosome accumulation disorder or encodes a therapeutic antibody. In other embodiments, the transgene encodes a molecule that targets a B cell that produces an unwanted antibody, e.g., an antibody against a therapeutic protein, including, but not limited to, antibodies against an endogenous protein (e.g., autoantibodies in autoimmune diseases) and/or exogenous protein (for example, a protein supplied by the ERT, such as a blood clotting factor). For example, a transgene may encode an antibody that recognizes a B cell receptor on B cells that are sensitive to a desired protein (an endogenous protein in an autoimmune disease and/or a protein supplied via ERT) to target a population of B cells that produce unwanted antibodies. against the desired protein. Non-limiting examples of such antibodies include antibodies that recognize a B cell receptor associated with a B cell that produces antibodies against proteins delivered by ERT, such as hemophilia coagulation factors (e.g., B cells producing anti-F9 or anti-F8 antibodies); and/or recognizing a B-cell receptor on a B-cell producing antibodies against self/self antigens, including, but not limited to, antibodies against myelin basic protein (MBP) in MS, antinuclear antibodies (ANA) in systemic lupus erythematosus (SLE) ), antibodies against glycoproteins in the heart, joints and other tissues in rheumatic fever, antibodies against the Fc fragment of IgG in rheumatoid arthritis (RA), as well as on autoantibody-producing B cells in Reiter's syndrome, Sjögren's syndrome, systemic scleroderma (scleroderma ), inflammatory myopathies, polyarteritis nodosa, Graves' disease, type I diabetes, and the like. The compositions and methods described herein provide high levels of protein production asin vitro, andin vivo, including levels sufficient to produce clinically significant (therapeutic) effectsin vivo.

[0020]In one aspect, the present invention provides a polynucleotide expression construct comprising at least one B cell-specific promoter directing the expression of one or more transgenes. The B cell promoter can be selected from any promoter that is active in B cells, including, but not limited to, the immunoglobulin kappa chain promoter (Igk, Laurieet al. (2007)Gene Ther 14(23): 1623-31), B29 (Hermansonet al. (1989)Proc Nat'l Acad Sci 86: 7341-7345), BCL6 (Ramachandrareddyet al. (2010)Proc Nat'l Acad Sci 107(26):11930-11935), promoter III CIITA (Defferneset al. (2001)J. Immunol 167(1): 98-106), mb-1 (see e.g. Malone and Wall (2001)J. Immunol 168(7):3369-3375) and an EEK promoter containing a light chain promoter (VKp) preceded by an intron enhancer (iEκ), MAR and a 3' enhancer (3'Eκ) (see US Pat. No. 8,133,727). In some embodiments, the B cell-specific promoter used is normally expressed at the germinal center such that the transgene is expressed when the cell is at the germinal center (e.g., BCL6, Bassoet al. (2010)Blood 115(5):975-984). In some embodiments, the transgene is inserted via nuclease-mediated targeted integration such that it is driven by a B cell-specific promoter in the cell's genome. In other embodiments, the B cell promoter-transgene construct is part of a DNA vector maintained off chromosomes. In some embodiments, the B cell promoter-transgene construct is inserted into a transcriptionally silent locus and/or a security region locus of the B cell genome, e.g., an albumin gene or a gene encoding a T cell receptor subunit (e.g., TCRA or TCRB) .

[0021] In some aspects, the transgene encodes for an enzyme that is absent or deficient in the subject. In some embodiments, the transgene encodes a blood clotting factor such as factor VII, factor VIII, factor IX, factor X, factor XI, or factor XII. In other embodiments, the transgene encodes an enzyme deficient in lysosome storage disease, including, but not limited to, glucocerebrosidase (GBA), α-galactosidase (GLA), β-glucuronidase (GUSB), iduronate-2-sulfatase (IDS), alpha-L-iduronidase (IDUA), sphingomyelin phosphodiesterase 1 (SMPD1), or alpha-glucosidase (GAA). In some embodiments, the transgene encodes for A1AT. Non-limiting examples of proteins that can be expressed as described herein also include fibrinogen, prothrombin, tissue factor, factor V, von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C , protein S, protein Z, protein Z-related protease inhibitor, plasminogen, alpha-2 antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator inhibitor-1, plasminogen activator inhibitor-2, MMAA, MMAB, MMACHC, MMADHC (C2orf25), MTRR, LMBRD1, MTR, propionyl-CoA carboxylase (PCC) (PCCA and/or PCCB subunits), glucose-6-phosphate transporter protein (G6PT) or glucose-6-phosphatase (G6P-ase), LDL receptor (LDLR ), ApoB, LDLRAP-1, PCSK9, mitochondrial protein such as NAGS (N-acetylglutamate synthetase), CPS1 (carbamoyl phosphate synthetase I) and OTC (ornithine transcarbamylase), ASS (argininosuccinic acid synthetase), ASL (argininosuccinic acid lyase), and/or ARG1 (ar ginase), and/or a protein from the solute transporter family 25 (SLC25A13, aspartate/glutamate transporter), UGT1A1 or UDP-glucuronyltransferase A1 polypeptide, fumarylacetoacetate hydrolyase (FAH), alanine glyoxylate aminotransferase (AGXT) protein, glyoxylate reductase protein/ hydroxypyruvate reductase (GRHPR), transthyretin (TTR) gene product protein, ATP7B protein, phenylalanine hydroxylase (PAH) protein, lipoprotein lipase (LPL) protein, engineered nuclease, engineered transcription factor, and/or engineered single-chain variable antibody fragment (diabody, camelid antibody, etc.) .d.). In one preferred embodiment, the transgene encodes a FVIII polypeptide. In some embodiments, the FVIII polypeptide contains a B domain deletion. In some embodiments, the present invention provides methods and compositions for expressing therapeutically relevant levels of one or more therapeutic proteins from one or more transgenes. In specific embodiments, expression of a transgene construct encoding a replacement protein results in 1% of normal levels of protein produced, while in others 2%, 3%, 4%, 5%, 10%, 15%, 20% are produced. , 30%, 50%, 80%, 100%, 150%, 200% or more of normal protein levels. In some embodiments, the transgene encodes a polypeptide that overcomes inhibition of an antibody response by a virus, bacterium, or parasite.

[0022]Positive by CD19 B cells undergo differentiationin vitro to plasmablasts and plasma cells producing more than 10,000 ng/ml of antibodies (IgG, IgM, IgA). Thus, in some aspects, the transgene encodes a therapeutic protein, such as a single chain antibody. In some embodiments, the single chain antibody is a scFv, while in other embodiments, the single chain antibody is a camelid or nanoantibody (see e.g. Mejiaset al. (2016)Sci Reports6: srep24913, doi:10:1038). In other aspects, more than one transgene is expressed in a B cell. In one embodiment, more than one transgene includes sequences necessary for the expression of a full-length antibody or fragment thereof, or other antigen-binding protein (e.g., monobody, aptamer, darpin, adnectins, affitels, anticalins, Kunitz-type inhibitors, etc. (Gebauer and Skerra (2009)Curr Opin Chem Biol 13(3):245-55).

[0023] In some embodiments, a population of B cells containing a transgene encoding a therapeutic protein of interest is modified ex vivo and then reintroduced to a subject in need thereof. The B cell population can be modified as described herein at any stage of development, including, but not limited to, the hematopoietic stem cell (HSC), lymphoid progenitor, or mature B cell form. Stem cells or progenitor B cells can be modified and then differentiated in vitro and administered as progenitors (linearly committed B cells) or mature cells to a subject. Alternatively, modified stem cells or B cell progenitors can be modified in vitro as described herein and fully differentiate into mature B cells in vivo after administration. Thus, for ex vivo administration, B cell populations as described herein may be heterogeneous in that they include stem cells, progenitor cells and/or mature B cells at various stages of development. Alternatively, B cell populations may be homogeneous and include only stem cells, progenitor cells, or mature cells. In other embodiments, the modified B cells are generated in vivo using a delivery vector capable of transducing B cells. In further embodiments, the delivery vector is a viral vector, preferably an adeno-associated virus (AAV). In preferred embodiments, the AAV vector is AAV6. In other embodiments, the delivery vector is non-viral, such as an mRNA, lipid nanoparticle (LNP), or plasmid vector.

[0024]In a further aspect, modified B cells as described herein (including B cell populations) are grownin vitro for the production of the protein encoded by the transgene. In preferred embodiments, the protein is an antibody or an antigen binding protein (e.g., an antibody that binds to endogenous B cells that produce unwanted antibodies in a subject, including endogenous B cells that produce antibodies against ERT-supplied proteins, such as coagulation factors, and/or B cells that produce antibodies against self proteins in autoimmune disorders), or an antibody that neutralizes unwanted antibodies. Protein produced by B cells can be isolated and used for protein therapy, such as enzyme replacement therapy, and/or in combination with enzyme replacement therapy, to reduce and/or eliminate innate production of unwanted antibodies (e.g., anti-ERT antibodies formed after ERT).

[0025] In some aspects, the invention relates to methods and compositions for delivering a B cell or plasma cell expressing a transgene that crosses the blood-brain barrier, which can be used to treat and/or prevent a CNS disease or a disease affecting the CNS. In some embodiments, the transgene encodes an enzyme that is absent in a subject with a lysosome accumulation disorder. In further embodiments, the transgene encodes for glucocerebrosidase (GBA), α-galactosidase (GLA), β-glucuronidase (GUSB), iduronate-2-sulfatase (IDS), alpha-L-iduronidase (IDUA), sphingomyelin phosphodiesterase 1 (SMPD1), or alpha-glucosidase (GAA), and is used to treat or prevent CNS disease associated with Gaucher disease (Bae et al. , (2015) Exp Mol Med 47, e153; doi:10:1038/emm.2014,128), Fabry disease, MPS type VII (Sly et al. (1973) J Pediatr . 1973 Feb; 82(2):249-57), MPS II, MPS I, Niemann-Pick or Pompe disease, respectively.

[0026] In further aspects, the methods and compositions of the invention include a modified B cell or B cell derivative (plasmoblast, plasma cell) containing a transgene, as well as one or more additional modifications. The additional modification may be additional episomal or additional integrated sequences (which may be integrated into the same and/or different locations in the genome). In some embodiments, the transgene-containing B cells contain additional protein or peptide sequences (or polynucleotides encoding them) that contribute to the efficiency of crossing the blood-brain barrier. In some embodiments, the peptide comprises a peptide known in the art to facilitate barrier crossing to the brain. In the following embodiments, the peptide is an antibody expressed on the surface of a B cell targeting the transferrin receptor, while in other embodiments, the peptide is a metallotransferrin (Karkan et al. (2008) PLoS ONE 3(6): e2469 doi:10.1371/journal.poine.0002469 In some embodiments, the peptide is a receptor such as VLA-4, ICAM-1, IL-8Ra (CXCR1), or IL-8Rb (CXCR2) (Alter et al. (2003) J. Immunol 170:4497-4505) In any of these embodiments, the transgene may encode an enzyme that is absent in a lysosome storage disease such as those described above, such that the enzyme is delivered to the CNS of a subject in need thereof.

[0027]In some aspects, the modified B cells of the invention comprise further modifications (e.g., mutations) that promote engraftment after transplantation. In some embodiments, the expression of specific genes is inhibited (for example, via temporary repression or permanent knockout) to increase engraftment and/or germinal center size. Genes subject to such inhibition include, but are not limited to, inositol hexakisphosphate kinase genes (Zhanget al. (2014)Basic Res Cardio 109(4): 417), glycogen synthase kinase-3β (GSK-3β, see Koet al. (2011)Stem Cells 29(1):108-18), CD26 peptidases (DPPIV/dipeptidyl peptidase IV), (Tianet al. (2006)Gene Ther 13(7):652-8), RhoA (Ghiauret al. (2006)Blood 108(6):2087-94), EAF2 (Liet al., (2016)NatCom 7; doi: 10.1038/ncomms10836), autophagy proteins such as Atg5 (Pengoet al., (2013)Nat Immunol14(3):298-305), etc. In further embodiments, modified B cells can be further modified for repression (e.g., knockout) of genes associated with induction of graft-versus-host disease. In some embodiments, the genes encoding the B cell receptor are knocked out to prevent stimulation of the B cell in the host.

[0028]In other aspects, the modified B cells of the invention comprise additional modifications (mutations such as genomic insertions and/or deletions; episomal expression of transgenes, etc.) that regulate cellular interactions (e.g., interactions T-cell-B-cell) in germinal centers and/or inhibition of suppression of any B-cell function (eg, antibody production, cytokine expression, signaling, etc.) associated with pathogen infection. In some aspects, the modified B cells of the invention further comprise proteins (or sequences encoding these proteins) to inhibit B cells involved in oncogenic activity. For example, in some embodiments, the modified B cells comprise a surface-expressed UCH-L1 ubiquitin hydrolase antibody (including a transgene encoding it) to suppress B cells involved in certain types of large B cell lymphoma (Bedekovicset al. (2016)Blood 127(12):1564-74).

[0029] In another aspect, the present invention relates to pharmaceutical compositions containing one or more of the cells, expression constructs and/or, optionally, nucleases described in the present description.

[0030] For nuclease-mediated targeted integration of expression constructs of the present invention into a suitable localization in a B cell, any nuclease can be used, including, but not limited to, one or more zinc finger nucleases (ZFN), TALEN, CRISPR/Cas nucleases, and /or TtAgo nucleases, so that the expression construct integrates into the region (gene) cleaved by the nuclease(s). In specific embodiments, one or more pairs of nucleases are used. Nucleases can be introduced in the form of mRNA or can be introduced into the cell using non-viral or viral vectors. In some aspects, the nuclease polynucleotides can be delivered by a lentivirus or by a non-integrating lentivirus. In other aspects, the expression cassette can be delivered via AAV and/or DNA oligonucleotides.

[0031] In any of the described compositions and methods, expression cassettes and/or nucleases can carry an AAV vector, including, but not limited to, AAV1, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9, and AAVrh10, or a pseudotyped AAV such as AAV2 /8, AAV8.2, AAV2/5 and AAV2/6, etc. In specific embodiments, the polynucleotides (expression constructs and/or nucleases) are delivered using the same types of AAV vector. In other embodiments, the polynucleotides are delivered using various types of AAV vectors. Polynucleotides can be delivered using one or more vectors. In further embodiments, the polynucleotides are delivered via a lipid nanoparticle (LNP). In specific embodiments, the polynucleotides are delivered by administration to the spleen or lymph node of an intact animal. In other embodiments, the polynucleotides are delivered via intravenous administration to a peripheral vein.

[0032]The methods described in the present description can be practicedin vitro,ex vivo orin vivo. In specific embodiments, the compositions are administered to a living, intact mammal. The mammal may be at any stage of development at the time of delivery, such as an embryo, fetus, newborn, infant, adolescent, or adult. In addition, target cells may be healthy or diseased. In specific embodiments, one or more of the compositions is delivered to a specific tissue (e.g., spleen or lymph node), intra-arterially, intraperitoneally or intramuscularly. Deliveryex vivocan be carried out using homogeneous or heterogeneous cell populations, including stem cells, B cell progenitors and/or mature B cells.

[0033]The present invention also relates to a kit containing one or more of the expression constructs, AAV vectors, B cells, and/or pharmaceutical compositions described herein. The kit may further comprise nucleic acids encoding nucleases (e.g., RNA molecules encoding ZFN, TALEN or Cas and modified Cas proteins and guide RNAs), or aliquots of nuclease proteins, cells, instructions for carrying out the methods of the invention, and the like.

[0034] These and other aspects will be clearly apparent to a person skilled in the art in light of the description as a whole.

BRIEF DESCRIPTION OF THE DRAWINGS

[0035] FIG. 1 is a diagram showing an overview of the in vitro B cell thawing and differentiation protocol followed (see Jourdan et al. (2009) Blood 114:5173-5181).

[0036] FIG. 2A-2C are graphs showing the ability of in vitro differentiated B cells to produce antibodies, including IgM antibodies (FIG. 2A), IgG antibodies (FIG. 2B), and IgA antibodies (FIG. 2C). Samples were treated with cytokines ("+cytokines") or not, and then the amount of antibody was detected by ELISA. Supernatants were collected on days t4, t7 and t10 and total IgM, IgG and IgA antibody levels were quantified by specific ELISA. The data are technical repetitions. Error bars represent the standard deviation.

[0037] FIG. 3A-3D are graphs showing the percentage of GFP positive cells after mRNA electroporation into B cells at 0 days (Fig. 3A), 1 day (Fig. 3B), 2 days (Fig. 3C), or 3 days (Fig. 3D) after defrosting. CD19+ B cells were electroporated with mRNA at t0, t1, t2 and t3, where t is the number of days after thawing, to determine the optimal time point for mRNA addition. CD19+ positive B cells (2.0E+05 cells) were mixed with GFP mRNA (2 μg) followed by electroporation. Cells were harvested 24 hours later and analyzed by flow cytometry to assess GFP levels. Day 2 after thawing (t2) had the highest GFP levels and was chosen for further studies. The data are technical repetitions. Error bars represent the standard deviation.

[0038] FIG. 4A and 4B are graphs showing selection by flow cytometry for GFP expression in transduced cells. In FIG. 4A defines plot areas associated with side scatter ("SSC") and forward scatter ("FSC"). Fig. 4B illustrates the differences between a group of B cells after sham treatment (left panel) and cells electroporated using GFP mRNA encoding (right panel). As can be seen in the right panel of Figure 4B, expression of GFP mRNA results in an increase in GFP-generated fluorescence, which can be quantified after selection.

[0039] FIG. 5A-5C are graphs showing genome editing in B cells. Deep sequencing at multiple loci showed robust genome editing using zinc finger nucleases targeting AAVS1, CCR5 and TCRA (TRAC). The percentage of genome modification was calculated by dividing the number of sequences containing insertion and deletion (indels) by the total number of sequences. CD19+ B cells (2.0E+5 cells) were mixed with ZFN mRNA (4 μg) followed by electroporation. Cells were harvested over time (t=day) after transfection. The data are technical repetitions. Error bars represent the standard deviation. Figure 5A depicts genome editing at the AAVS1 locus on days 4, 7 and 10. FIG. 5B shows a similar dataset at the CCR5 locus, while FIG. 5C shows data for the TCRA (TRAC) locus.

[0040] In FIG. 6A-6C show the effect of transient cold shock on B-cell genome editing. CD19+ B cells (2.0E+5 cells) were mixed with ZFN mRNA (0.75, 1.5, 3 and 6 μg) followed by electroporation. Cells after electroporation were divided into two groups. One group was placed in an incubator at 37°C for 4 days. The second group was placed at 30°C overnight, then transferred to an incubator at 37°C for 3 days. Deep sequencing revealed an increase in genome editing (% indels) in cells treated using transient cold shock.

[0041] In FIG. 7A and 7B depict the transduction ability of several AAV serotypes tested by delivering the GFP donor CMV promoter to CD19+ B cells. In FIG. 7A shows results for recombinant AAV serotypes 2, 5, 6, 8, and 9 bearing CMV-GFP delivered at vector doses of 2.4E+6, 1.2E+6, 6.0E+5, 3.0E+5 genomes. vector (vg)/cell. Shown are data from n=2 biological replicates where cells were analyzed for GFP expression at days 4, 7 and 10 post-transduction and demonstrate that AAV6 easily transduces B cells. Error bars represent the standard deviation of technical and biological replicates. Figure 7B is a schematic representation of the expression cassette used in the experiments shown.

[0042] FIG. 8 depicts exemplary AAV expression cassettes used. Illustrative donor cassettes for insertion at the AAVSI, CCR5 and TCRA (TRAC) loci are shown. AAVS1 has a left ("AAVS1-L") and a right ("AAVS1-R") homology arm, having a length of 801 and 568 base pairs, respectively. CCR5 has a left ("CCR5-L") and a right ("CCR5-R") homology arm having a length of 473 and 1431 base pairs, respectively. TCRA ("TRAC") has left ("TRAC-L") and right ("TRAC-R") homology arms having a length of 925 and 989 base pairs, respectively. Donors contained either a phosphoglycerate kinase ("PGK") promoter or a B-cell specific promoter ("EEK" containing a light chain promoter (VKp) preceded by an intron enhancer (iEκ), MAR and a 3-enhancer (3'Eκ); US Pat. No. 8,133,727), followed by the encoding GFP transgene ("GFP") and the bovine growth hormone polyadenylation signal ("pA"). AAV2 inverted terminal repeats ("ITR") were used to ensure packaging into AAV capsids.

[0043] FIG. 9A-9C are graphs showing that the combination of ZFN mRNA and rAAV2/6 vectors contributed to high levels of transgene addition at multiple loci. GFP expression levels were measured by flow cytometry. B cell cultures were harvested over time (t=day) after addition of ZFN mRNA and donor AAV to B cells. The AAVS1 (FIG. 9A), CCR5 (FIG. 9B), and TCRA (TRAC, FIG. 9C) loci were evaluated by the addition of the transgene. ZFN:donor samples show long-term GFP expression, while donor-only samples show a decrease in GFP expression over time. Under each graph, a nuclease target site is shown (eg, in FIG. 9A, "ZFN: AAVS1"). A description of the GFP transgene is also shown (for example, in Figure 9A, "Donor: PGK-AAVS1" shows that the GFP transgene was driven by the PGK promoter and that the GFP coding sequence was flanked by homology arms with homology to the nuclease site in the AAVS1 gene). In FIG. 9A - 9C, left panel shows results after harvest 4 days (t4) post-transfection; the middle panel shows the results after collection 7 days (t7) after transfection; and the right panel shows the results after collection 10 days after transfection.

[0044] FIG. 10A and 10B are graphs showing the percentage of GFP donor targeted integration at the AAVS1 (FIG. 10A) and CCR5 (FIG. 10B) loci in CD19+ B cells. Confirmation of directed integration (transgene addition) was performed by deep sequencing. The percentage of gene modification was calculated by dividing the number of sequences containing the integrated target by the total number of sequences. B cells were harvested over time (t=day) after addition of ZFN mRNA and donor AAV to B cells. Data for AAVSI represent 3 independent experiments. Data for CCR5 represent 2 independent experiments. Error bars represent the standard deviation. Under each graph, the nuclease target site and donor configuration are shown as described above.

[0045] FIG. 11 is a graph showing the results of determining whether homologous recombination (HDR) or non-homologous end bridging (NHEJ) is used by B cells for targeted integration. The table below the graph shows the ZFN specificity and donor configuration. All donors used the PGK promoter, but only in experiment #1 was the donor GFP transgene flanked by homology arms coinciding with the nuclease cleavage site. Samples with mismatched homology arms between ZFN and the donor showed GFP expression similar to expression with the donor alone without the addition of any nuclease. The strongest directed integration occurred when the homology arms matched the nuclease target site, indicating that HDR is used for integration in B cells.

[0046] FIG. 12 is a graph showing a comparison of the PGK promoter driving GFP expression with the B-cell specific EEK promoter driving GFP expression. B cells were mixed with ZFN mRNA (4 μg) targeting the TCRA (TRAC) locus, followed by electroporation. After electroporation, CD19+ B cells were then transduced with AAV6 containing TRAC homology arms flanking the transgene expression cassette and either a PGK or a B cell specific promoter (EEK) driving GFP transgene expression. They were delivered at a vector dose of 2.4E+06 vg/cell. The data show that using the B cell-specific (EEK) promoter shows a slight increase in GFP expression compared to the PGK promoter.

[0047] FIG. 13A - 13Dare graphs showing expression level of the GFP transgene in CD19+ B cells in the dose range of donor AAV. In all cases, the GFP transgene was integrated into the TCRA (TRAC) locus using TCRA-specific nucleases. Each graph also shows the results for GFP expression when transduction was performed in the absence of nucleases. The donor constructs contained TCRA-specific homology arms and either the EEK promoter as described above or the PGK promoter. The AAV range used included 3.0E+05br/cell (Fig. 13D), 6.0E+05br/cell (Fig. 13C), 1.2E+06br/cell (Fig. 13B), and 2.4E+06br/cell (Fig. 13A). CD19+ positive B cells were mixed with ZFN-encoding mRNA (4 μg) targeting the TCRA locus, followed by electroporation. After electroporation, CD19+ B cells were transduced with AAV containing TCRA homology arms, with either PGK or a B cell-specific promoter (EEK) driving GFP expression. They were delivered at vector doses of 2.4E+06, 1.2E+06, 6.0E+05 and 3.0E+05 vg/cell. The percentage of GFP expression driven by the PGK promoter decreased with decreasing dose, while the B-cell specific promoter maintained GFP expression throughout the 8-fold dilution. There was an almost 5-fold difference at 3.0E+05 vg/cell between the two promoters.

[0048] FIG. 14A-14C are graphs showing the effect on antibody production after genome editing manipulations, showing no large loss of in vitro IgG production, as measured by ELISA, as a result of the manipulations. Total secreted IgG levels were similarly independent over the course of the experiment (representing pooled secreted IgG levels on days 4, 7 and 10), indicating that electroporation and transduction do not adversely affect IgG production. The addition of cytokines is essential for IgG production. CD19+ B cells were treated with AAVS1-specific ZFN (Fig. 14A), CCR5-specific ZFN (Fig. 14B), or TCRA-specific (TRAC) ZFN (Fig. 14C). The different conditions used for each dataset included ZFN-specific pairing with a GFP transgene using matched homology arms ("ZFN:donor"), GFP transgene and homology arms ("Donor"), ZFN-specific only ("ZFN") , CD19+ B cells treated in the BTX device using only buffer ("BTX cells"), untreated CD19+ B cells plus cytokines ("B cells"), and untreated CD19+ B cells in the absence of cytokines ("B cells - cytokines). ZFN:donor, Donor, ZFN, BTX cells and B cells were all treated with cytokines.

[0049] FIG. 15A-15C are graphs showing the effect on antibody production after genome editing manipulations demonstrating no large loss of IgM production in vitro as measured by ELISA. CD19+ B cells were treated with AAVS1-specific ZFN (Fig. 15A), CCR5-specific ZFN (Fig. 15B), or TCRA-specific (TRAC) ZFN (Fig. 15C). The samples are as described above in FIG. fourteen.

[0050] FIG. 16represents graph showing IgM production in differentiated CD19+ B cells treated with cytokines from a single human donor. CD19+ B cells were treated with AAV2, 5, 6, 8 or 9 virus. In the presence of added cytokines, IgM production, as measured by ELISA, was "boostered" by treatment with AAV2 alone. The predominance of antibodies over wild-type AAV in the human population is strong and not associated with disease. In the present description shows the potential booster effect on antibody production due to what can be considered as re-infection with AAV.

[0051] FIG. 17A and 17B are illustrations depicting a potential mechanism for increased IgM expression as a result of the "booster effect" of AAV2. The left panel (FIG. 17A) depicts a simplified scenario for antibody production in a B cell following AAV infection. The panel shown on the right (FIG. 17B) is an example showing how AAV can be used to function as a booster to increase the expression of an inserted antibody promoter-driven transgene in a modified B cell.

DETAILED DESCRIPTION

[0052] The present invention relates to methods and compositions for genetically engineering a B cell, including knockout of endogenous genes and insertion (stably or episomal) of expression cassettes for transgene expression. The methods can be performed in vitro , ex vivo or in vivo and can be used to express any transgene(s) for the treatment and/or prevention of any disease or disorder that can be alleviated by providing one or more of the transgenes.

general description

[0053] In the practice of the methods, as well as in the preparation and use of the compositions described in the present description, use, unless otherwise indicated, conventional methods of molecular biology, biochemistry, chromatin structure and analysis, computer chemistry, cell culture, recombinant DNA and related areas that are within the competence of specialists in this field. These methods are fully explained in the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and updates from time to time; series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, "Chromatin" (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, "Chromatin Protocols" (PB Becker, ed.) Humana Press, Totowa, 1999.

Definitions

[0054] The terms "nucleic acid", "polynucleotide", and "oligonucleotide" are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single-stranded or double-stranded form. For the purposes of this disclosure, these terms are not intended to be limiting in relation to the length of the polymer. The terms may include known analogs of naturally occurring nucleotides, as well as nucleotides that are modified at base, sugar, and/or phosphate (eg, phosphorothioate backbones). Typically, an analog of a particular nucleotide will have the same base pairing specificity; those. base analog A pairs with base T.

[0055] The terms "polypeptide", "peptide", and "protein" are used interchangeably to refer to a polymer of amino acid residues. The term also refers to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of the corresponding naturally occurring amino acids.

[0056] "Recombination" refers to the process of exchanging genetic information between two polynucleotides, including, but not limited to, non-homologous end joining (NHEJ) and homologous recombination. For the purposes of this specification, "homologous recombination (HR)" refers to a specialized form of such exchange that occurs, for example, during the repair of double-strand breaks in cells via homology-guided repair mechanisms.

[0057]In specific methods as described herein, one or more targeted nucleases as described herein form a double-strand break (DSB) in a target sequence (e.g., cellular chromatin) at a predetermined site (e.g., gene albumin). DSB mediates design integration as described herein. Optionally, the construct has homology to the nucleotide sequence at the break. The expression construct may be physically integrated or, alternatively, the expression cassette is used as a template to repair the break by homologous recombination resulting in the introduction of all or part of the nucleotide sequence as an expression cassette into the cell chromatin. Thus, the first sequence in the cellular chromatin can be changed and, in specific embodiments, can be converted to a sequence present in the expression cassette. Thus, the use of the terms "substitute" or "substitution" can be understood to represent the substitution of one nucleotide sequence for another, (i.e., a substitution of a sequence in the informational sense), and does not necessarily require the physical or chemical substitution of one polynucleotide for another.

[0058] In any of the methods described herein, the exogenous nucleotide sequence ("expression construct" or "expression cassette" or "vector") may contain sequences that are homologous, but not identical, to genomic sequences in the region of interest. , thus promoting homologous recombination to insert a non-identical sequence into the region of interest. Thus, in particular embodiments, portions of the expression cassette sequence that are homologous to sequences in the region of interest have between about 80% and 99% (or any integer in between) sequence identity with the genomic sequence it replaces. In other embodiments, the homology between the expression cassette and the genomic sequence is greater than 99%, for example, if only 1 nucleotide differs between regions of homology of the expression cassette and genomic sequences of more than 100 contiguous base pairs. In specific cases, the non-homologous portion of the expression cassette may contain sequences not present in the region of interest, such that new sequences are introduced into the region of interest. In these cases, the non-homologous sequence is typically flanked by sequences of 50-1000 base pairs (or any integer in between) or any number of base pairs greater than 1000 that are homologous or identical to sequences in the region of interest.

[0059] The term "sequence" refers to a nucleotide sequence of any length, which may be DNA or RNA; may be linear, circular or branched and may be either single or double stranded. The term "transgene" refers to a nucleotide sequence that is inserted into the genome. The transgene may be of any length, such as between 2 and 100,000,000 nucleotides in length (or any integer value in between or above), preferably between about 100 and 100,000 nucleotides in length (or any integer value in between), more preferably between about 2000 and 20000 nucleotides (or any integer value in between) and even more preferably between about 5 and 15 kb. (or any value in between).

[0060] A "chromosome" is a complex of chromatin containing all or part of a cell's genome. A cell's genome is often characterized by its karyotype, which is the set of all chromosomes that contain the cell's genome. The genome of a cell may contain one or more chromosomes.

[0061] An "episome" is a replicating nucleic acid, nucleoprotein complex, or other structure containing a nucleic acid that is not part of a cell's chromosomal karyotype. Examples of episomes include plasmids and certain viral genomes. The liver-specific constructs described herein can be maintained episomal or, alternatively, can be stably integrated into a cell.

[0062] An "exogenous" molecule is a molecule that is not normally present in a cell, but that can be introduced into the cell by one or more genetic, biochemical, or other means. "Normal presence in the cell" is defined in relation to the particular stage of development and environmental conditions of the cell. Thus, for example, a molecule present only during the embryonic development of a muscle is an exogenous molecule when applied to an adult muscle cell. Similarly, a heat shock induced molecule is an exogenous molecule when applied to a non-heat shock cell. An exogenous molecule may contain, for example, a functional variant of a misfunctioning endogenous molecule or a misfunctioning variant of a normally functioning endogenous molecule.

[0063] The exogenous molecule may be, among other molecules, a small molecule such as obtained by a combinatorial chemistry process, or a macromolecule such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex containing one or more of the above molecules. Nucleic acids include DNA and RNA, may be single or double stranded; may be linear, branched or circular; and can be of any length. Nucleic acids include nucleic acids capable of forming duplexes, as well as triplex-forming nucleic acids. See, for example, US Patent No. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, ligases, deubiquitinases, integrases, recombinases, ligases, topoisomerases, gyrases and helicases.

[0064]An exogenous molecule may refer to the same type of molecule as an endogenous molecule, such as an exogenous protein or nucleic acid. For example, the exogenous nucleic acid may contain an infectious viral genome, a plasmid or episome introduced into the cell, or a chromosome that is not normally present in the cell. Methods for introducing exogenous molecules into cells are known to those skilled in the art and include, but are not limited to, lipid-mediated transfer (i.e. liposomes containing neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer, and viral vector-mediated transfer. An exogenous molecule may also refer to the same type of molecule as an endogenous molecule, but be isolated from a species different from that from which the cell originates. For example, a human nucleic acid sequence can be introduced into a cell line originally derived from a mouse or hamster.

[0065] In contrast, an "endogenous" molecule is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions. For example, an endogenous nucleic acid may comprise a chromosome, a mitochondrial, chloroplast, or other organelle genome, or a naturally occurring episomal nucleic acid. Additional endogenous molecules may include proteins such as transcription factors and enzymes.

[0066] As used herein, the term "exogenous nucleic acid product" includes both polynucleotide and polypeptide products, for example transcription products (polynucleotides such as RNA) and translation products (polypeptides).

[0067]A "fusion" molecule is one in which two or more subunit molecules are linked, preferably covalently. The subunit molecules may be the same chemical type of molecules or may be different chemical types of molecules. Examples of fusion molecules include, but are not limited to, fusion proteins (e.g., a fusion protein between a DNA-binding domain and a cleavage domain of a protein), fusion molecules between a DNA-binding domain of a polynucleotide (e.g., sgRNA) operably linked to the cleavage domain, and fusion nucleic acids (eg, the nucleic acid encoding the fusion protein).

[0068] Expression of a fusion protein in a cell can occur by delivering the fusion protein to the cell, or by delivering the polynucleotide encoding the fusion protein into the cell, where the polynucleotide is transcribed and the transcript is translated to produce the fusion protein. Trans-splicing, polypeptide cleavage, and polypeptide ligation may also be involved in protein expression in a cell. Methods for delivering a polynucleotide and a polypeptide to cells are presented elsewhere in this specification.

[0069] "Gene", for the purposes of the present description, includes the DNA region encoding the gene product (see below), as well as all DNA regions that regulate the production of the gene product, whether or not such regulatory sequences are adjacent. with coding and/or transcribed sequences. Accordingly, a gene includes, but is not limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome binding sites, enhancers, silencers, insulators, border elements, origins of replication, matrix attachment sites, and loci control regions. .

[0070] "Gene expression" refers to the translation of information contained in a gene into a gene product. The gene product may be the direct transcription product of the gene (eg, mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, or any other type of RNA) or a protein obtained by translation of the mRNA. Gene products also include RNAs modified by processes such as capping, polyadenylation, methylation, and editing, and proteins modified, for example, by methylation, acetylation, phosphorylation, ubiquitinylation, ADP-ribosylation, myristylation, and glycosylation.

[0071] "Modulation" of gene expression refers to a change in the activity of a gene. Modulation of expression may include, but is not limited to, gene activation and gene repression. Genome editing (eg, cleavage, alteration, inactivation, random mutation) can be used to modulate expression. Gene inactivation refers to any decrease in gene expression compared to a cell that does not contain ZFP, TALE, or the CRISPR/Cas system, as described herein. Thus, gene inactivation may be partial or complete. A "genetically modified" cell includes cells with any change in the genetic material in the cell, including, but not limited to, episomal and/or genomic modifications. Non-limiting examples of genetic modifications include insertions and/or deletions (eg, episomal and/or targeted integration of one or more transgenes, RNA, or non-coding sequences) and/or mutations (eg, point mutations, substitutions, etc.) that alter protein expression in a cage).

[0072] A "region of interest" is any region of cellular chromatin, such as, for example, a gene or a non-coding sequence within or adjacent to a gene, in which binding of an exogenous molecule is desired. Linking may occur for the purpose of directed DNA cleavage and/or directed recombination. The region of interest may be present, for example, on a chromosome, episome, in the genome of an organelle (eg, mitochondria, chloroplast), or in the infecting viral genome. The region of interest may be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences, or introns, or within non-transcribed regions, either upstream or downstream of the coding region. The region of interest can be as small as a single base pair, or up to 2000 base pairs in length, or any integer number of base pairs.

[0073] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells (eg, B cells), including stem cells (pluripotent and multipotent).

[0074] The terms "operably linked" and "operably linked" (or "operably linked") are used interchangeably with respect to an adjacent position of two or more components (such as elements of a sequence) in which the components are arranged in such a way that both components function normally. and provide the possibility that at least one of the components can mediate a function that affects at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operably linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional control sequence is typically cis- operably linked to a coding sequence, but need not be directly adjacent to it. For example, an enhancer is a transcriptional regulation sequence operably linked to a coding sequence, even though they are not contiguous.

[0075] A "functional fragment" of a protein, polypeptide, or nucleic acid is a protein, polypeptide, or nucleic acid whose sequence is not identical to the full-length protein, polypeptide, or nucleic acid, yet retains the same function as the full-length protein, polypeptide, or nucleic acid. A functional fragment may have more, fewer, or the same number of residues as the corresponding native molecule, and/or may contain one or more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (eg, coding function, ability to hybridize with another nucleic acid) are well known in the art. Likewise, methods for determining the function of a protein are well known. For example, human factor VIII with a deleted B domain is a functional fragment of the full-length factor VIII protein.

[0076] A polynucleotide "vector" or "construct" is capable of transferring gene sequences to target cells. Generally, "vector construct", "expression vector", "expression construct", "expression cassette" and "gene transfer vector" means any nucleic acid construct that is capable of directing the expression of a gene of interest and that can transfer gene sequences to cells. -targets. Thus, the term includes cloning and expression vectors as well as integrating vectors.

[0077] The terms "subject" and "patient" are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, dogs, cats, rats, mice, and other animals. Accordingly, the term "subject" or "patient", within the meaning of the invention, refers to any patient or mammalian subject to whom the expression cassettes of the invention may be administered. Subjects of the present invention include subjects with a disorder.

Expression constructs for B cells

[0078]The present invention relates to expression cassettes (constructs) for use in directing the expression of a transgene in a B cell (including plasmablasts and plasma cells), includingin vivo, upon administration of the expression cassette(s) to the subject (e.g., intravenous delivery). Expression constructs can be maintained episomal and can direct expression of the transgene outside of chromosomes, or alternatively, the expression construct can be integrated into the B cell genome, for example, via nuclease-mediated targeted integration.

[0079] Any suitable promoter sequence can be used in the expression cassettes of the invention. In specific embodiments, the promoter is a constitutive promoter. In other embodiments, the promoter is inducible and/or is a B-cell specific promoter. Promoterless constructs, in which the transgene is driven by the endogenous promoter of the B cell, are also provided for the genetic modification of cells, as described herein.

[0080] Obviously, any transgene can be used in the constructs described in the present description. In addition, the individual components of the expression construct (promoter, enhancer, insulator, intron, transgene, etc.) of the constructs described herein may or may not be present and may be mixed and matched in any combination.

[0081]The constructs described herein may be contained in any viral or non-viral vector. The constructs can be maintained episomal or can be integrated into the cell's genome (e.g., via nuclease-mediated targeted integration).

[0082] Non-viral vectors include DNA or RNA plasmids, mcDNA, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome, lipid nanoparticle, nanoparticle, or poloxamer. Viral vectors that can be used to transfer the expression cassettes described herein include, but are not limited to, retroviral, lentiviral, adenovirus, adeno-associated, vaccinia, and herpes simplex virus vectors. Integration into the host genome is possible using retrovirus, lentivirus, and adeno-associated virus gene transfer techniques, and as described herein, can be facilitated by nuclease-mediated integration.

[0083]In specific preferred embodiments, the constructs are incorporated into an adeno-associated viral ("AAV") vector or vector system that can be maintained episomal or integrated into the B cell genome (e.g., via nuclease-mediated targeted integration). The construction of recombinant AAV vectors has been reported in a number of publications, including US Patent No. 5173414; Tratschin et al., Mol. cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).

[0084]Thus, in specific embodiments, the expression construct is carried over into the AAV constructs and additionally contains 5'- and 3'-ITR flanking elements of the expression constructs (e.g., enhancer, promoter, optionally intron, transgene, etc.) as described herein. Optionally, spacer molecules are also included between one or more of the components of the expression construct, for example between the 5'-ITR and the enhancer and/or between the polyadenylation signal and the 3'-ITR. Spacers can function as homology arms to facilitate recombination into a safety region locus (e.g., albumin). In specific embodiments, the design is the design as shown in Figure 8.

[0085] In specific embodiments, the AAV vectors as described herein can be derived from any AAV. In specific embodiments, the AAV vector is derived from a defective and non-pathogenic parvovirus adeno-associated virus type 2. All such vectors are derived from a plasmid retaining only the 145 bp AAV inverted terminal repeats flanking the expression cassette for the transgene. Efficient gene transfer and stable delivery of transgenes due to integration into the genomes of transduced cells are the key features of this vector system. (Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAVrh.10 and any new AAV serotype can also be used in accordance with the present invention. AAV6 serotypes are particularly preferred. In some embodiments, a chimeric AAV is used, wherein the viral origins of ITR sequences from the viral nucleic acid are heterologous to the viral origins of the capsid sequences. Non-limiting examples include a chimeric virus with ITRs derived from AAV2 and capsids derived from AAV5, AAV6, AAV8 or AAV9 (i.e. AAV2/5, AAV2/6, AAV2/8 and AAV2/9, respectively).

[0086] Retroviral vectors include murine leukemia virus (MuLV), gibbon simian leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al. , J. Virol 66:2731-2739 (1992), Johann et al., J. Virol 66:1635-1640 (1992), Sommerfelt et al., Virol 176:58-59 (1990), Wilson et al. al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT/US94/05700).

[0087] The constructs described herein can also be included in an adenoviral vector system. Adenovirus vectors are capable of very high transduction efficiency in a variety of cell types and do not require cell division. With such vectors, high titer and high expression levels are obtained. This vector can be obtained in large quantities in a relatively simple system.

[0088] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical studies (Dunbar et al., Blood 85:3048-305 (1995); Kohn et al., Nat. Med. 1:1017-102 (1995 ); Malech et al., PNAS 94:22 12133-12138 (1997)). PA317/pLASN was the first therapeutic vector used in a gene therapy study. (Blaese et al., Science 270:475-480 (1995)). Transduction efficiency of 50% or more was observed for packaged MFG-S vectors. (Ellem et al., Immunol Immunother. 44(1):10-20 (1997); Dranoff et al., Hum. Gene Ther. 1:111-2 (1997).

[0089] Replication-deficient recombinant adenoviral vectors (Ad) can also be used with the polynucleotides described herein. Most adenoviral vectors are designed such that the transgene replaces the Ad E1a, E1b and/or E3 genes; then, the replication-defective vector is propagated in human 293 cells that provide the function of the deleted gene in trans. Ad vectors can transduce many tissue types in vivo , including non-dividing, differentiated cells such as those found in liver, kidney, and muscle. Conventional vectors Ad have a large transfer capacity. An example of the use of the Ad vector in clinical studies includes polynucleotide therapy for tumor immunization by intramuscular injection (Sterman et al., Hum. Gene Ther. 7:1083-9 (1998)). Additional examples of the use of adenoviral vectors for gene transfer in clinical studies include Rosenecker et al., Infection 24:1 5-10 (1996); Sterman et al., Hum. Gene Ther. 9:7 1083-1089 (1998); Welsh et al., Hum. Gene Ther. 2:205-18 (1995); Alvarez et al., Hum. Gene Ther. 5:597-613 (1997); Topf et al., Gene Ther. 5:507-513 (1998); Sterman et al., Hum. Gene Ther. 7:1083-1089 (1998).

[0090] Packaging cells are used to generate viral particles capable of infecting a host cell. Such cells include HEK293 and Sf9 cells, which can be used to package AAV and adenovirus, and ψ2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually produced in a producer cell line that packages the vector's nucleic acid into a viral particle. Vectors typically contain the minimum viral sequences required for packaging and subsequent integration into the host (if applicable), where other viral sequences are replaced by an expression cassette encoding a protein to be expressed. The missing functions of the virus are provided by a packaging cell line in trans-. For example, AAV vectors used in gene therapy typically only possess the inverted terminal repeat (ITR) sequences from the AAV genome required for packaging and integration into the host genome. The viral DNA is packaged in a cell line containing a helper plasmid encoding other AAV genes, namely rep and cap , but lacking the ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus stimulates AAV vector replication and AAV gene expression from the helper plasmid. The helper plasmid is not packaged in significant amounts due to the lack of ITR sequences. Adenovirus contamination can be reduced by, for example, heat treatment, to which adenovirus is more sensitive than AAV. In some embodiments, AAV is produced using a baculovirus expression system (see, for example, US Pat. Nos. 6,723,551 and 7,271,002).

[0091]Purification of AAV particles from a 293 or baculovirus system typically involves growing the virus-producing cells and then harvesting the virus particles from the cell supernatant, or lysing the cells and harvesting the virus from the crude lysate. The AAV is then purified by methods known in the art, including ion exchange chromatography (e.g., see US Pat. PCT WO2011094198A10), immunoaffinity chromatography (for example, WO2016128408) or purification using Sepharose AVB (for example, GE Healthcare Life Sciences).

[0092] For many gene therapy applications, it is desirable that the gene therapy vector be delivered with a high degree of specificity to a particular tissue type. Accordingly, it is possible to modify the viral vector to have cell type specificity by expressing the ligand in the form of a protein fused to the viral envelope protein on the outer surface of the virus. A ligand is selected that has affinity for a receptor known to be present on the cell type of interest. For example, in Han et al., Proc. Natl. Acad. sci. USA 92:9747-9751 (1995), Moloney murine leukemia virus can be modified to express human heregulin fused to gp70 and the recombinant virus infects specific breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs in which the target cell expresses the receptor and the virus expresses a fusion protein containing a ligand for the cell surface receptor. For example, filamentous phage can be designed to display antibody fragments (eg, FAB or Fv) having a specific binding affinity for virtually any chosen cellular receptor. Although the above description applies primarily to viral vectors, the same principles can be applied to non-viral vectors. Such vectors can be designed to contain specific uptake sequences that favor uptake by specific target cells.

[0093] The polynucleotides described herein may include one or more non-natural bases and/or backbones. In particular, an expression cassette as described herein may include methylated cytosine residues to achieve a state of transcriptional silencing in the region of interest.

[0094] In addition, expression constructs as described herein may also include additional transcriptional or translational regulatory sequences, or other sequences, e.g., Kozak sequences, additional promoters, enhancers, insulators, introns, internal ribosome binding sites, sequences, encoding 2A peptides, furin cleavage sites and/or polyadenylation signals. In addition, control elements of genes of interest can be operably linked to reporter genes to produce chimeric genes (eg, reporter-expressing cassettes).

Modifications

[0095] The present invention relates to genetically modified B cells containing one or more of the following modifications: (a) providing in the cell one or more transgenes (episomal and/or integrated in any combination); (b) insertions and/or deletions in one or more genes that modify (i) B-cell receptor genes and/or (ii) cellular interactions at germinal centers; and/or (c) modifications (mutations) that inhibit the suppression of any B cell function associated with pathogen infection or cancer regulation. Genetically modified B cells, as described herein, may also be derived from HSCs containing one or more of these genetic modifications.

[0096]In specific embodiments, the constructs described herein can be used to express any transgene(s) in a B cell. One or more transgenes can be expressed episomal in modified B cells and/or after nuclease-mediated targeted integration of one or more transgenes. Exemplary transgenes (also referred to as genes of interest and/or exogenous sequences) include, but are not limited to, any polypeptide coding sequence (e.g., cDNA), promoter sequences, enhancer sequences, epitope tags, marker genes, degrading enzyme recognition sites, and/or various types of expression constructs. Marker genes include, but are not limited to, sequences encoding proteins conferring antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding stained or fluorescent or luminescent proteins (e.g., green fluorescent protein, improved green fluorescent protein, red fluorescent protein, luciferase), and proteins mediating enhanced cell growth and/or gene amplification (eg, dihydrofolate reductase). Epitope tags include, for example, one or more copies of FLAG, His, myc, Tap, HA, or any detectable amino acid sequence.

[0097] In a preferred embodiment, the transgene contains a polynucleotide encoding any polypeptide whose expression in a cell is desired, including, but not limited to, antibodies, antigens, enzymes, receptors (cell surface or nuclear), hormones, lymphokines, cytokines, reporter polypeptides, growth factors and functional fragments of any of the above. The coding sequences may be, for example, cDNA.

[0098]In specific embodiments, the transgene(s) encode(s) functional variants of proteins that are absent or deficient in any genetic disease, including, but not limited to, lysosome accumulation disorders (e.g., Gaucher, Fabry, Gunther, Hurler, Niemann-Pick, etc.), metabolic disorders and/or blood disorders such as hemophilias and hemoglobinopathies, etc. Cm., e.g. Patent publications USA No. 20140017212 and 20140093913; US Patent No. 9255250 and 9175280.

[0099]For example, the transgene may contain a sequence encoding a polypeptide that is absent or non-functional in a subject suffering from a genetic disease, including, but not limited to, any of the following genetic diseases: achondroplasia, achromatopsia, acid maltase deficiency, adenosine deaminase deficiency (OMIM No. 102700), adrenoleukodystrophy , Acardi's syndrome, alpha-1 antitrypsin deficiency, alpha thalassemia, androgen insensitivity syndrome, Apert's syndrome, arrhythmogenic right ventricular dysplasia, telangiectatic ataxia, Barth's syndrome, beta thalassemia, blue elastic vesicular nevus syndrome, Canavan disease, chronic granulomatous diseases (CGD), feline crying syndrome, cystic fibrosis, Derkum's disease, ectodermal dysplasia, Fanconi anemia, progressive fibrodysplasia ossificans, fragile X syndrome, galactosemia, Gaucher's disease, generalized gangliosidosis (e.g., GM1), hemochromatosis, hemoglobin mutation lobin C at codon 6 of beta-globin (HbC), hemophilia, Huntington's disease, Hurler's syndrome, hypophosphatasia, Klinefelter's syndrome, Krabbe's disease, Langer-Giedion syndrome, leukocyte adhesion disorder (LAD, OMIM No. 116920), leukodystrophy, long QT syndrome, Marfan syndrome, Möbius syndrome, mucopolysaccharidosis (MPS), patellar nail syndrome, renal diabetes insipidus, neurofibromatosis, Niemann-Pick disease, osteogenesis imperfecta, porphyria, Prader-Willi syndrome, progeria, syndrome Proteus, retinoblastoma, Rett syndrome, Rubinstein-Tayby syndrome, Sanfilippo syndrome, severe combined immunodeficiency (SCID), Schwachmann syndrome, sickle cell disease (sickle cell anemia), Smith-Magenis syndrome, Stickler syndrome, Tay-Sachs disease, syndrome thrombocytopenia with absent radius (TAR), Treacher-Collins syndrome, trisomy, tuberous sclerosis, Turner syndrome, urea cycle disorder, von Hippel-Lindau disease, Waardenburg syndrome, Williams syndrome, Wilson's disease, Wiskott-Aldrich syndrome, X-linked lymphoproliferative syndrome (XLP, OMIM No. 308240), acquired immunodeficiencies, lysosome storage diseases (eg, Gauche disease e, GM1, Fabry disease and Tay-Sachs disease), mucopolysaccharidosis (eg, Gunther's disease, Hurler's disease), hemoglobinopathies (eg sickle cell disease, HbC, α-thalassemia, β-thalassemia), and hemophilia.

[0100] Non-limiting examples of proteins (including functional fragments thereof, such as truncated variants) that can be expressed as described herein include fibrinogen, prothrombin, tissue factor, factor V, factor VII, factor VIII, factor IX, factor X , factor XI, factor XII (Hageman factor), factor XIII (fibrin-stabilizing factor), von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z , protein Z-related protease inhibitor, plasminogen, alpha-2-antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator inhibitor-1, plasminogen activator inhibitor-2, glucocerebrosidase (GBA), α-galactosidase A (GLA), iduronate sulfatase ( IDS), iduronidase (IDUA), acid sphingomyelinase (SMPD1), MMAA, MMAB, MMACHC, MMADHC (C2orf25), MTRR, LMBRD1, MTR, propionyl-CoA carboxylase (PCC) (PCCA and/or PCCB subunits), protein- main conveyor yucose-6-phosphate (G6PT) or glucose-6-phosphatase (G6P-ase), LDL receptor (LDLR), ApoB, LDLRAP-1, PCSK9, mitochondrial protein such as NAGS (N-acetylglutamate synthetase), CPS1 (carbamoyl phosphate synthetase I ) and OTC (ornithine transcarbamylase), ASS (argininosuccinic acid synthetase), ASL (argininosuccinic acid lyase) and/or ARG1 (arginase), and/or protein from the solute transporter family 25 (SLC25A13, aspartate/glutamate transporter) protein, UGT1A1 or UDP-glucuronyl transferase A1 polypeptide, fumarylacetoacetate hydrolyase (FAH), alanine glyoxylate aminotransferase (AGXT) protein, glyoxylate reductase/hydroxypyruvate reductase (GRHPR) protein, transthyretin (TTR) gene product protein, ATP7B protein, phenylalanine hydroxylase (PAH) protein, protein a lipoprotein lipase (LPL), an engineered nuclease, an engineered transcription factor, and/or a therapeutic single chain antibody.

[0101] In other embodiments, the modified B cells described herein comprise one or more transgenes encoding one or more antibodies, which are engineered molecules designed to target immunocytes through specific molecular targets expressed on cell surfaces. In some embodiments, the modified B cells express antibodies designed to target endogenous B cells. These antibodies can induce antibody-mediated killing (eg, via ADCC or complement-mediated killing) of B cells or other immunocytes involved in attenuating the immune response.

[0102]B cells, as described herein, can be genetically modified to produce one or more antibodies specific for B cells that produce unwanted antibodies. Non-limiting examples of B cells producing unwanted antibodies include B cells producing antibodies against proteins administered at ERT (blood clotting factors such as F8, F9, etc. in patients with hemophilia and/or proteins missing from or deficient in disorders with lysosome accumulation). Antibody-coding constructs are introduced into a progenitor B cell or into a B cellex vivo,so that when the cell is reintroduced to the patient, the antibody-producing B cells are specifically targeted to cells (B-cells) that produce the protein (eg, antibody) bound by the engineered antibody. In specific embodiments, the engineered antibody is specific for an antibody directed against a therapeutic protein supplied exogenously (via ERT and/or gene therapy) such that antibodies against the therapeutic proteins are neutralized. Thus, the compositions and methods described herein include engineered B cells that produce antibodies that specifically target antibodies (e.g., anti-F9 antibodies) produced in the patient. The modified B cells from these compositions and methods can be administered to a subject in the form of mature B cells or in the form of progenitor cells (such as HSC or lymphoid progenitor cells) that undergo differentiation in the subject upon administration or, alternatively, may undergo genetic modification.in vivo. In additional embodiments, proteins produced from transgenes (e.g., anti-ERT antibodies) from genetically modified B cells are isolated for administration to a subject in need, for example, a patient in need of anti-ERT antibodies produced by his body.

[0103]In additional embodiments, the transgene may be an antibody specific for a B cell sensitive to a protein involved in an autoimmune disease. The term "autoimmune disease" refers to any disease or disorder in which a subject mounts a destructive immune response against his own tissues. Autoimmune disorders can affect almost every organ system in a subject (eg, human), including, but not limited to, diseases of the nervous, gastrointestinal, and endocrine systems, as well as skin and other connective tissues, eyes, blood, and blood vessels. Examples of autoimmune diseases include, but are not limited to, Hashimoto's thyroiditis, systemic lupus erythematosus, Sjögren's syndrome, Graves' disease, scleroderma, rheumatoid arthritis, multiple sclerosis, myasthenia gravis, and diabetes. Thus, B cells, as described herein, may contain a molecule (eg, engineered antibody) that targets a population of B cells in a subject that is sensitive to (and produces antibodies to) a self-antigen involved in an autoimmune disease, including, but not limited to, myelin basic protein (MBP), insulin, ANA, joint proteins, or muscles, thyroid proteins, etc.

[0104] In specific embodiments, the transgene may comprise a marker gene (described above) that allows selection of cells that have undergone targeted integration and an associated sequence encoding additional functionality. Non-limiting examples of marker genes include GFP, drug selection marker(s), and the like.

[0105] The constructs described herein can also be used to deliver non-coding transgenes. Sequences encoding antisense RNAs, RNAi, shRNAs and micro-RNAs (miRNAs) can also be used for targeted inserts.

[0106]In specific embodiments, the transgene includes sequences (e.g., coding sequences, also referred to as transgenes) longer than 1 kb, for example, between 2 and 200 kb, between 2 and 10 kb. (or any value in between). The transgene may also include one or more nuclease target regions. The transgene may also contain one or more homology arms. Homology arms contain sequences with a high degree of homology to sequences flanking the target site for nuclease cleavage. The homology arm can be 50, 100, 200, 500, 1000, 2000 or more nucleotides long, or any value in between.

[0107]When integrating (for example, via nuclease-mediated integration), the transgene can be inserted into an endogenous gene such that all of the endogenous gene is expressed, some of it is expressed, or the endogenous gene is not expressed.

Nucleases

[0108]As noted above, expression cassettes can be maintained episomal or can be integrated into the cell's genome. Integration may be accidental. In specific embodiments, integration of the transgene construct(s) is targeted to the specified gene after cleavage of the target gene with one or more nucleases (e.g., zinc finger nucleases ("ZFN"), TALEN, TtAgo, CRISPR/Cas nuclease systems, and homing endonucleases), and the construct is integrated in ways driven by either homology dependent repair (HDR) or non-homologous end joining (NHEJ) . Cm., for example, US Patent No. 9394545; 9150847; 9206404; 9045763; 9005973; 8956828; 8936936; 8945868; 8871905; 8586526; 8563314; 8329986; 8399218; 6534261; 6599692; 6503717; 6689558; 7067317; 7262054; 7888121; 7972854; 7914796; 7951925; 8110379; 8409861; US Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060063231; 20080159996; 20100218264; 20120017290; 20110265198; 20130137104; 20130122591; 20130177983 and 20130177960, and 20150056705, the entire contents of which are incorporated by reference for all purposes.

[0109] Any nuclease can be used for targeted integration of the transgene expression construct.

[0110]In specific embodiments, the nuclease comprises a zinc finger nuclease (ZFN) comprising a zinc finger DNA-binding domain and a cleaving (nuclease) domain. Cm., e.g. US Patent No. 9255250; 9200266; 9045763; 9005973; 9150847; 8956828; 8945868; 8703489; 8586526; 6534261; 6599692; 6503717; 6689558; 7067317; 7262054; 7888121; 7972854; 7914796; 7951925; 8110379; 8409861.

[0111]In other embodiments, the nuclease contains a TALEN containing a TAL effector DNA binding domain and a cleavage (nuclease) domain. Cm., for example, US Patent No. 8586526 and US Patent Publication No. 20130196373.

[0112]In additional embodiments, the nuclease comprises a CRISPR/Cas nuclease system comprising a single guide RNA for target site recognition and one or more cleavage domains. Cm., for example, US Patent Publication No. 20150056705. In some embodiments, the CRISPR-Cpf1 system is used (see Fagerlundet al., (2015)Genom Bio 16:251). It is understood that the term "CRISPR/Cas" system refers to both CRISPR/Cas and CRISPR/Cfp1 systems.

[0113]Cleavage domains of nucleases can be wild-type or mutant domains, including unnatural (engineered) cleavage domains forming obligate heterodimers. Cm., for example, US Patent No. 8623618; 7888121; 7914796; and 8034598 and U.S. Publication no. 20110201055.

[0114]The nuclease(s) can make one or more double-stranded and/or single-stranded cuts in the site. In specific embodiments, the nuclease contains a catalytically inactive cleavage domain (e.g., proteinFoxI and/or Cas). Cm., for example, US Patent No. 9200266; 8703489 and Guillingeret al. (2014)nature biotech.32(6):577-582. The catalytically inactive cleaving domain can, in combination with the catalytically active domain, act as a nickase to effect a single strand cut. Thus, two nickases can be used in combination to make a double strand cut in a specific region. Additional nickases are also known in the art, such as McCafferyet al. (2016)Nucleic Acids Res. 44(2):e11. doi: 10.1093/nar/gkv878. Epub 2015 Oct 19.

[0115]In specific embodiments, the nuclease cleaves a security region gene (e.g., CCR5, Rosa, Albumin, AAVS1, TCRA, TCRB, etc. Cm., for example, US Patent No. 7888121; 7972854; 7914796; 7951925; 8110379; 8409861; 8586526; US Patent Publications 20030232410; 20050208489; 20050026157; 20060063231; 20080159996; 201000218264; 20120017290; 20110265198; 20130137104; 20130122591; 20130177983 and 20130177960. In preferred embodiments, the nuclease cleaves the endogenous albumin gene such that the expression cassette integrates into the endogenous albumin locus of the liver cell. Albumin-specific nucleases are described, for example, in US Patent No. 9150847; and US Patent Publication No. 20130177983 and 20150056705.

Delivery

[0116]The constructs described herein (and/or nucleases) can be deliveredin vivo by any suitable means to any cell type, preferably to the spleen or secondary lymph nodes. Similarly, when used in combination with nucleases for targeted integration, nucleases can be delivered in polynucleotide and/or protein form, e.g. using non-viral vector(s), viral vector(s), and/or in RNA form, e.g. in the form of mRNA.

[0117] Methods for non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolisting, virosomes, liposomes, lipid nanoparticles, immunoliposomes, another nanoparticle, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced DNA uptake. Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used to deliver nucleic acids. Additional exemplary nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX Molecular Delivery Systems (Holliston, MA) and Copernicus Therapeutics Inc. (See, for example, US6008336).

[0118] In preferred embodiments, the expression constructs are AAV vectors. Optionally, nucleases can be introduced in mRNA form or using one or more viral vectors (AAV, Ad, etc.). Administration can be by any means in which the polynucleotides are delivered to the desired target cells. Both in vivo and ex vivo methods are contemplated. Intravenous injection into a peripheral blood vessel is the preferred route of administration. Other in vivo routes of administration include, for example, direct injection into tissues containing B cells, including lymph nodes, bone marrow, plasma, lymphatic system, and spleen.

[0119]In systems involving the delivery of more than one polynucleotide (for example, constructs as described herein and nucleases in polynucleotide form), two or more polynucleotide(s) are delivered using one or more of the same and/or different vectors. For example, a nuclease in the form of a polynucleotide can be delivered in the form of an mRNA, and B cell-specific constructs as described herein can be delivered by other means such as viral vectors (e.g., AAV), minicircular DNA, plasmid DNA, linear DNA, liposomes, lipid nanoparticles, nanoparticles, and the like.

[0120] Pharmaceutically acceptable carriers are determined in part by the particular composition administered, as well as by the particular route used to administer the composition. Accordingly, there are a wide variety of suitable formulations of pharmaceutical compositions available, as described below (see, for example, Remington's Pharmaceutical Sciences, 17th ed., 1989).

[0121]The effective amount of expression cassette (and optionally nuclease(s) and/or modified cells) to be administered may vary from patient to patient. Accordingly, effective amounts are best determined by the physician administering the compositions (e.g., cells) and appropriate doses can be readily determined by one skilled in the art. By assaying serum, plasma, or other tissue levels of the therapeutic polypeptide and comparing it to baseline prior to administration, it can be determined whether the amount administered is too low, in the correct range, or too high. Appropriate modes of initial and subsequent introductions can also be changed, however, a typical example is the initial introduction with subsequent introductions then, if necessary. Subsequent administrations can be made at various intervals, ranging from daily to annual, up to once every few years. One of skill in the art will appreciate that suitable immunosuppression methods may be recommended to avoid inhibition or blocking of transduction by immunosuppression of delivery vectors, see, for example, Vilquin et al., (1995) Human Gene Ther., 6:1391-1401.

[0122]Compositions for introductions asex vivo, andin vivo, include suspensions (for example, genetically modified cells, liposomes, lipid nanoparticles or nanoparticles) in liquid or emulsified liquids. Active ingredients are often mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. In addition, the composition may contain minor amounts of excipients such as wetting or emulsifying agents, pH buffering agents, stabilizers or other agents that enhance the effectiveness of the pharmaceutical composition.

Applications

[0123] The methods and compositions described herein are intended to provide therapy for a disease by providing a transgene that expresses a product absent or deficient in that disease, or otherwise treats or prevents the disease. The cell may be modified in vivo or may be modified ex vivo and then administered to a subject. Thus, the methods and compositions provide for the treatment and/or prevention of such genetic diseases. In addition, the methods and compositions described herein allow modification of B cells such that these cells have modified toxicity, antibody production and/or production characteristics.

[0124] The following examples include illustrative embodiments of the present disclosure, wherein the nuclease optionally used comprises a zinc finger nuclease (ZFN). It should be understood that this is for exemplary purposes only, and that other nucleases may be used, e.g., TALEN, CRISPR/Cas systems, homing endonucleases (meganucleases) with engineered DNA-binding domains, and/or proteins fused to naturally occurring DNA-binding domains. or engineered homing endonucleases (meganucleases) and heterologous cleavage domains, and/or proteins fused to meganucleases and TALE proteins. In addition, it should be understood that expression constructs as described herein can be transferred in other vectors (other than AAV) to obtain the same results in the treatment and/or prevention of protein deficiency disorders.

EXAMPLES

Example 1 : Ways

Cell culture

[0125] Frozen human peripheral blood CD19+ B cells were purchased from STEMCELL Technologies (Vancouver, Canada). A system for in vitro B cell culture differentiation (see Figure 1) has been previously described (Jourdan et al. , ibid.). All cultures were performed in Iskov's Modified Dulbecco's Medium (Corning, Corning, NY) and 10% fetal bovine serum (VWR, Radnor, PA).

[0126] Cells were cultured in a 24-well plate at a density of 2.0E+5 cells per well in 0.5 ml of culture medium. Cells were thawed and cultured for 4 days in B-cell activation medium containing anti-His Ab (5 µg/mL), ODN (10 µg/mL), sCD40L (50 ng/mL), IL-2 (10 ng/mL). ml), IL-10 (50 ng/ml) and IL-15 (10 ng/ml). On day 4 of culture, cells were harvested, supernatants were collected, cells were washed with DPBS and then transferred to plasmablast preparation (PB) medium containing IL-2 (10 ng/ml), IL-6 (40-50 ng/ml) , IL-10 (50 ng/ml) and IL-15 (10 ng/ml). On day 7 of culture, cells were harvested, supernatants were harvested, cells were washed with DPBS and then transferred to plasma cell (PC) medium containing IL-6 (40-50 ng/ml), IL-15 (10 ng/ml), IFN-α (500 units/ml). On day 10 of culture, cells were harvested and supernatants were harvested.

Genetic modification of B cells

ZFN reagents:

[0127] ZFN was designed to target TCRA (TRAC, SBS53909 and SBS53885, see US Patent Publication No. US-2017-0211075-A1), CCR5 (SBS8266 and SBS8196, see US Patent No. 7925921) and AAVS1 (SBS30035 and SBS30054, see US Patent No. 8110379). The ZFN coding sequences for CCR5 and AAVS1 were cloned into a modified version of the pGEM4Z plasmid (Promega, Madison, WI) containing a 64 adenine sequence 3' from the inserted gene sequence (Boczkowski et al. (2000) Canc Res 60:1028-1034) , which was linearized by SpeI digestion to obtain templates for mRNA synthesis. ZFN mRNA for TRAC was generated from linear DNA templates (one for each ZFN) by PCR amplification of the ZFN encoding sequence using the Accuprime PFX DNA polymerase kit (Invitrogen, Carlsbad, CA). PCR products were used as templates for mRNA synthesis. mRNA was obtained using the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies, Carlsbad, CA) according to the manufacturer's protocol.

[0128] Briefly, 1.0 µg of DNA encoding ZFN, used as a template for mRNA synthesis, was incubated at 37°C for hours of the supplied buffer, followed by digestion with DNase supplied with the kit. The in vitro poly-A tail addition reaction was not carried out because the poly-T tail was included in the DNA template during the preparation of the TRAC template by PCR. The AAVS1 and CCR5 templates contain the poly-T template in the vector. The mRNA was then purified using the RNeasy Mini kit (Qiagen, Carlsbad, CA), following the manufacturer's protocol, and quantified in a Nanodrop 8000 (ThermoScientific, Waltham, MA). The primers used for mRNA templates were forward primer: 5' GCAGAGCTCTCTGGCTAACTAGAG (SEQ ID NO:1) and reverse primer: 5'TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTGGCAACTAGAAGGCACAG (SEQ ID NO:2).

AAV vectors :

[0129] All AAV vectors were obtained from Sangamo Therapeutics as described below. AAV donor templates for AAVS1, CCR5 and TRAC contained arms homologous to their target loci. AAVS1 had left and right homology arms of 801 and 568 base pairs, respectively. CCR5 had left and right homology arms of 473 and 1431 base pairs, respectively. TRAC had left and right homology arms of 925 and 989 base pairs, respectively. A GFP expression cassette containing the promoter, the GFP sequence and the human growth hormone polyadenylation signal (hGHpA) was cloned between the right and left arms of the homology. The promoter was either the phosphoglycerate kinase (PGK) promoter or the B-cell specific (EEK) promoter. The B cell-specific promoter (EEK) consisted of a 3' enhancer, MAR, and an intron enhancer upstream of the human κ light chain promoter (Luo et al. (2009) Blood 113:1422-1431). The TRAC donor template was cloned into the pAAV vector. AAVS1 and CCR5 donor templates were cloned into a custom made plasmid pRS165 (Lombardo et al. (2011) Nat Methods 8:861-869; Wang et al. (2012) Genome Res 22:1316-1326) derived from pAAV-MCS ( Agilent Technologies, Santa Clara, CA). AAV2 inverted terminal repeats (ITRs) were used to ensure packaging as for AAV vectors using a triple transfection method (Xiao and Samulski (1998) J. Virol 72:2224-2232). Briefly, HEK 293 cells were seeded into 10-layer CellSTACK chambers (Corning, Acton, MA), grown 3 days to 80% density, then transfected using the calcium phosphate method with an AAV helper plasmid expressing the AAV2 Rep genes and specific for serotype Cap, an adenoviral helper plasmid, and an ITR-containing donor plasmid vector. After 3 days, cells were lysed through three freeze/thaw cycles and cell debris was removed by centrifugation. AAV vectors were precipitated from lysates using polyethylene glycol and purified by overnight ultracentrifugation in a cesium chloride gradient. Vector formulations were obtained by dialysis and sterilized by filtration.

ELISA IgM, IgG, IgA:

[0130] The supernatants were harvested at the end of the B-cell activation culture, plasmablast production, and plasma cell production steps. IgM, IgG, IgA were analyzed using commercial ELISA kits (Bethyl Laboratories; Montgomery, TX) according to the manufacturer's protocol. Briefly, the supernatant was added to the plate, incubated with shaking at room temperature for one hour, followed by washing four times with the buffer provided in the kit. The detection antibody supplied with the kit was added and incubated for 1 hour at room temperature, followed by washing four times with the wash buffer supplied with the kit. Horseradish peroxidase (HRP) supplied with the kit was added and incubated for 30 minutes at room temperature, followed by washing four times with the buffer supplied with the kit. The tetramethylbenzidine (TMB) substrate supplied with the kit was added and development was allowed for 30 minutes. The reaction was stopped using the stop solution supplied with the kit and the absorbance was read at 450 nM using a plate reader.

Example 2 Production of Antibodies in Cultured in vitro B cells

[0131] CD19+ B cells were thawed and cultured as described above and illustrated in FIG. 1. Culture supernatants were collected at days t4, t7 and t10 and total IgM, IgG and IgA were detected by ELISA as described above.

[0132] The results (FIGS. 2A-2C) showed that the cells are capable of responding to cytokine stimulation of antibody production and produce antibodies as expected.

Example 3 Electroporation of mRNA

[0133] Cultured B cells were treated with mRNA encoding the transgene (GFP) to determine the best time frame for introducing the mRNA. CD19+ B cells (2.0E+05 cells) were electroporated with 2 μg of GFP mRNA on day t0, t1, t2, or t3, where t0 is the day the cells were thawed (FIG. 1). The electroporated cells were analyzed by FACs analysis where selection was made as shown in FIG. 4. The results (Figures 3A-3D) showed that electroporation at day t2 resulted in the highest expression of GFP, so these time frames were chosen for subsequent studies.

Example 4 Nuclease Digestion in Cultured B Cells

[0134] ZFNs specific for three loci, AAVS1, CCR5 and TCRA, were used to cleave their targets in cultured B cells. CD19+ B cells were thawed and cultured for 2 days in B cell activation medium. Cells were washed 2 times with DPBS, then resuspended in BTXpress High Efficiency Electroporation Solution (Harvard Apparatus, Holliston, MA) to a final density of 2.0E+6 cells/mL. Cells (100 μl) and electroporation solution were mixed with ZFN mRNA (4 μg) followed by electroporation in a BTX ECM830 square pulse electroporator (Harvard Apparatus) in a 96-well multi-well MOS 2 mm electroporation plate (Harvard Apparatus). After electroporation, cells were transferred to B-cell activation medium in a 24-well plate for two days. After 2 days, the cells were harvested, the supernatants were harvested, and the cells were washed with DPBS, then transferred to plasmablast medium. After 3 days, the cells were harvested, the supernatants were harvested, and the cells were washed with DPBS, then transferred to plasma cell preparation medium. Cells were harvested for genomic DNA (gDNA) isolation at days t4, t7 and t10, to analyze ZFN activity by deep sequencing. Briefly, CD19+ B cells (2.0E+5 cells) were mixed with ZFN mRNA (4 μg), followed by electroporation.

[0135] To measure ZFN activity at the TCRA (TRAC), CCR5 and AAVS1 loci, DNA was isolated using the QIAamp DNA mini kit (Qiagen, Carlsbad, CA) according to the manufacturer's instructions. One hundred nanograms of genomic DNA (gDNA) was used. Two step PCR was then performed for the AAVS1 and TRAC loci using Phusion®Hot Start Flex polymerase (New England Biolabs, Ipswich, MA). Three-step PCR was used for the CCR5 loci. Using Illumina deep sequencing, indels were measured at each locus. The primers used for each locus are shown below:

Primers for AAVS1 :

[0136] AAVS1 Direct: GACGTGTGCTCTTCCGATCTNNNNCCGGTTAATGTGGCTCTGGT (SEQ ID NO:3)

[0137] AAVS1 Reverse: ACACGACGCTCTTCCGATCTNNNNGACTAGGAAGGAGGAGGCCT (SEQ ID NO:4).

[0138] The AAVS1 amplicon was: 5'NNNNGACTAGGAAGGAGGAGGCCTAAGGATGGGCTTTTCTGTCACCAATCCTGTCCCTAGTGGCCCCACTGTGGGGTGGAGGGGACAGATAAAAGTACCCAGAACCAGAGCCACATTAACCGGNNNN (SEQ ID NO:5).

Primers for CCR5 :

[0139] CCR5 Straight 1: CTGTGCTTCAAGGTCCTTGTCTGC (SEQ ID NO:6),

[0140] CCR5 Reverse 1: CTCTGTCTCCTTCTACAGCCAAGC (SEQ ID NO:7),

[0141] CCR5 Straight 2: CTGCCTCATAAGGTTGCCCTAAG (SEQ ID NO:8),

[0142] CCR5 Reverse 2: CCAGCAATAGATGATCCAACTCAAATTCC (SEQ ID NO:9),

[0143] CCR5 Straight 3: ACACGACGCTCTTCCGATCTNNNNNGCCAGGTTGAGCAGGTAGATG (SEQ ID NO:10),

[0144] CCR5 Reverse 3: AGACGTGTGCTCTTCCGATCTGCTCTACTCACTGGTGTTCATCTTT (SEQ ID NO:11).

[0145] The CCR5 amplicon was:

5'NNNNNGCCAGGTTGAGCAGGTAGATGTCAGTCATGCTCTTCAGCCTTTTGCAGTTTATCAGGATGAGGATGACCAGCATGTTGCCCACAAAACCAAAGATGAACACCAGTGAGTAGAGC (SEQ ID NO:12).

Primers for TCRA (TRAC) :

[0146] TCRA Straight: 5'ACACGACGCTCTTCCGATCTNNNNCCTCTTGGTTTTACAGATACGAAC (SEQ ID NO:13)

[0147] TCRA Reverse: 5'GACGTGTGCTCTTCCGATCTCTCACCTCAGCTGGACCAC (SEQ ID NO:14)

[0148] The TCRA amplicon was:

5'NNNNCCTCTTGGTTTTACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGCTGAGGTGAG (SEQ ID NO:15).

[0149] The results of these studies are shown in FIG. 5A-5C and demonstrate that nucleases were active in cultured B cells using these methods and that more than 80% modification was achieved at multiple loci.

[0150] Experiments were also conducted testing the effect of temporary (overnight) cold shock (see US Pat. No. 8,772,008) on the cleavage activity of nucleases. In these studies, a range of administered mRNA amounts from 0.75 to 6 μg was used. After electroporation, the cultures were separated and one part was placed in an incubator at 37°C for 4 days. The second group was placed at 30°C overnight, then transferred to an incubator at 37°C for 3 days. Deep sequencing was performed to measure the % of indels detected by nuclease digestion.

[0151] The results (as shown in Figures 6A-6C) showed that the cold shock method increased the overall cleavage activity.

Example 5 Comparison of AAV Serotypes in B Cell Transduction

[0152] An AAV virus containing a transgene expression cassette (GFP) was used to compare the ability of different AAV serotypes to transduce cultured B cells. Briefly, cells were thawed and cultured for 2 days in B-cell activation medium in a 24-well plate at a density of 2.0E+5 cells/well. Cells were harvested, counted, and then seeded into a 24-well plate at a density of 2.0E+5 cells/well. B cells were transduced using AAV serotypes 2, 5, 6, 8 and 9 at vector doses of 2.4E+6, 1.2E+6, 6.0E+5, 3.0E+5 vector genomes (vg)/cell . The AAV vector genomes contained a CMV promoter driven eGFP expression cassette and inverted terminal repeats (ITRs), see Figure 7B. AAV vectors were obtained from Sangamo Therapeutics. Cell culture (25 µl from 500 µl in one well of a 24-well plate) was harvested and mixed with DPBS (175 µl) at days t4, t7 and t10 and analyzed for GFP expression using Guava EasyCyte 5HT (EMD Millipore, Billerica, MA , USA). Data was analyzed using InCyte version 2.5 (EMD Millipore).

[0153] The results (Figure 7A) showed that AAV6 was the most efficient AAV serotype in transducing cultured B cells during the process of differentiation into plasmablasts and plasma cells.

Example 6 Nuclease-Guided Directional Integration

[0154] The nucleases described above were then used in combination with a transgene donor (GFP, proteins absent or deficient in the subject, and/or therapeutic antibodies of interest) to test the ability of the system to support targeted integration of the donor into the genome. Several exemplary GFP donors were generated (FIG. 8) containing the GFP transgene flanked by homology arms, where the arms have homology to regions surrounding the cleavage target of either AAVS1, CCR5, or TCRA. In addition, two different promoters were tested, either PGK or EEK.

[0155] CD19+ B cells were thawed and cultured for 2 days in B cell activation medium. A combination of ZFN mRNA and donor AAV or mRNA donor targeting the same loci (AAVS1, TCRA, CCR5, albumin, HPRT, etc.) was used. Cells were washed 2 times with DPBS, then resuspended in BTXpress High Efficiency Electroporation Solution (Harvard Apparatus, Holliston, MA) to a final density of 2.0E+6 cells/mL. Cells (100 μl) and electroporation solution were mixed with ZFN mRNA (4 μg) followed by electroporation in a BTX ECM830 square pulse electroporator (Harvard Apparatus) in a 96-well multi-well MOS 2 mm electroporation plate (Harvard Apparatus). After electroporation, the cells were transferred to 0.5 ml of B-cell activation medium in a 24-well plate. AAV containing homologous donor templates for target loci was then added at 2.4×10 ⁶ vg/cell. The plates were gently shaken for 2 minutes. After 2 days, cell cultures were harvested, 25 μl of cell culture was withdrawn, mixed with DPBS (175 μl) for flow cytometry analysis, the rest of the cell culture was pelleted by centrifugation in a benchtop centrifuge, supernatants were collected, and cells were washed with DPBS before being transferred to the medium to obtain plasmablasts. After 3 days, the cell culture was harvested, 25 µl of the cell culture was removed, mixed with DPBS (175 µl) for flow cytometry analysis, the rest of the cell culture was pelleted by centrifugation in a bench centrifuge, supernatants were collected, and the cells were washed with DPBS before being transferred to the medium to obtain plasma cells. After 3 days of the experiment, the cell culture (25 µl out of 500 µl in one well of a 24-well plate) was collected and mixed with PBS (175 µl) for flow cytometry analysis, the rest of the cell culture was precipitated by centrifugation in a tabletop centrifuge, supernatants were collected, cells were washed using DPBS and harvested for gDNA.

[0156] For flow cytometry, cell culture (25 μl out of 500 μl in one well of a 24-well plate) was collected and mixed with PBS (175 μl) on days 2, 5 and 8 after mRNA and AAV donor administration. GFP expression was analyzed using Guava EasyCyte 5HT (EMD Millipore, Billerica, MA, USA). Data was analyzed using InCyte version 2.5 (EMD Millipore). The results (FIGS. 9A-9C) show that GFP transgene integration was present in all cases, and that the use of specific nucleases resulted in the highest percentage of GFP positive cells.

[0157] To measure the directed integration of CCR5 and AAVS1 donors, DNA was isolated using the QIAamp DNA mini kit (Qiagen, Carlsbad CA), following the manufacturer's instructions. One hundred nanograms of gDNA was used and then a three step PCR was performed using Phusion®Hot Start Flex polymerase (New England Biolabs, Ipswich, MA) and HotStartTaq premix kit (Qiagen, Carlsbad, CA). Directional integration at each locus was measured using Illumina deep sequencing. Primers for each stage are shown below:

Primers for AASV1 :

Primers for stage 1 PCR :

[0158] AAVS1 Straight 1: 5'CGGAACTCTGCCCTCTAACG (SEQ ID NO:16).

[0159] AAVS1 Reverse 1: 5'GTGTGTCACCAGATAAGGAATCTG (SEQ ID NO:17).

Primers for stage 2 PCR :

[0160] AAVS1 Straight 2: 5'CGTCTCTCTCCTGAGTCCG (SEQ ID NO:18).

[0161] AAVS1 Reverse 2: 5'GTGTGTCACCAGATAAGGAATCTG (SEQ ID NO:17).

Primers for stage 3 PCR :

[0162] AAVS1 Straight 3: 5'CTCTTTCCCTACACGACGCTCTTCCGATCTNNNNCTCTGGTTCTGGGTACTTTTATCTG (SEQ ID NO:19).

[0163] AAVS1 Reverse 3: 5'AGACGTGTGCTCTTCCGATCTGTGTGTCACCAGATAAGGAATCTG (SEQ ID NO:20).

[0164]Amplicon sequence AAVS1 wild type:

5'NNNNCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCCACTAGGGACAGGATTGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGACACAC (SEQ ID NO:21).

[0165] AAVS1 GFP-TI sequence (SEQ ID NO:22):

5'NNNNCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCAAGCTTCGAGCCATCAGGGCCTGGTTCTTTCCGCCTCAGAAGGCCTTTTGCAGTTTATCAGGATGAGGATGACCAGCATGTTGCCCACAAAACCAAAGATGAACACCAGATTCCTTATCTGGTGACACAC

Primers for CCR5

Primers for stage 1 PCR :

[0166] CCR5 Straight 1: 5'GCTCTACTCACTGGTGTTCATCTTT (SEQ ID NO:12).

[0167] CCR5 Reverse 1: 5'CTCTGTCTCCTTCTACAGCCAAGC (SEQ ID NO:7).

Primers for stage 2 PCR:

[0168] CCR5 Straight 2: 5'GCTCTACTCACTGGTGTTCATCTTT (SEQ ID NO:12).

[0169] CCR5 Reverse 2: 5'CCAGCAATAGATGATCCAACTCAAATTCC (SEQ ID NO:9).

Primers for stage 3 PCR :

[0170] CCR5 Straight 3: 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCCAGGTTGAGCAGGTAGATG (SEQ ID NO:23).

[0171] CCR5 Reverse 3: 5'AGACGTGTGCTCTTCCGATCTGCTCTACTCACTGGTGTTCATCTTT (SEQ ID NO:11).

[0172]Amplicon sequence wild-type CCR5:

5'NNNNNGCCAGGTTGAGCAGGTAGATGTCAGTCATGCTCTTCAGCCTTTTGCAGTTTATCAGGATGAGGATGACCAGCATGTTGCCCACAAAACCAAAGATGAACACCAGTGAGTAGAGC (SEQ ID NO:12)

[0173] TI-GFP CCR5 sequence:

5'NNNNNGCCAGGTTGAGCAGGTAGATGTCAGTCATGCTCTTCAGCCTTTTGCAGTTTCTCGAGCCATCAGGGCCTGGTTCTTTCCGCCTCAGAAGTAGAAAGATGAACACCAGTGAGTAGAGC (SEQ ID NO:24)

[0174] The results (as shown in FIGS. 10A and 10B) showed directional integration between 38% and 50% for these loci.

[0175] Experiments were also performed using donors of mismatched transgenes. The homology arms in these mismatched transgene donors had no homology to the sequences flanking the nuclease target site for the co-nuclease. For example, TCRA-specific (TRAC) ZFNs were used in combination with a GFP transgene donor containing CCR5 homology arms. This donor was also used in combination with AAVS1-specific ZFN. The increase in integration detected using the matching ZFN target region and donor homology arms may indicate that, at least in part, the integration of the transgene is based on a homologous recombination reaction. The results (FIG. 11) showed that increased donor integration occurs when the donor is flanked by homology arms coinciding with the area surrounding the nuclease cleavage site, and thus show that cultured B cells preferentially use homologous recombination for directed integration. Low-level integration was observed for mismatched donors, indicating that integration can also occur via end binding using NHEJ.

[0176] Cells transduced using donor constructs containing two alternative promoters were also compared. GFP expression was analyzed by flow cytometry as described above (see Figure 12) and the results indicated that the EEK promoter caused higher GFP expression in B cells than the PGK promoter.

[0177] A titration comparing different amounts of the AAV donor construct was performed using a constant dose of ZFN mRNA. The B cell culture was treated with 4 μl of TCRA-specific (TRAC) ZFN by electroporation and then transduced using a donor AAV range of 3.0E+05 to 2.4E+06 vg/cell. In addition, the two promoters were also compared under these conditions. The results (FIGS. 13A-13D) showed that at lower donor concentrations, the EEK promoter retained GFP expression throughout the 8-fold dilution during B cell progression to plasmablast and plasma cell. The experiment also confirmed that the use of nucleases to direct integration led to higher expression of GFP in B cells.

Example 7 Expression of antibodies during genome editing

[0178]Levels IgG and IgM were analyzed by ELISA as described above for cultured B cells that were electroporated to deliver ZFN pairs as well as a GFP donor. The results (Figures 14 and 15) show that the levels of antibodies produced by B cells were not significantly affected by electroporation or electroporation followed by transduction of an AAV donor.

Example 8 Potential Booster Function of AAV in Cultured B Cells

[0179] It is possible that in cultured B cells expressing anti-AAV antibody, repeated exposure of the B cell to an AAV serotype against which the B cell is reactive may cause a "booster" effect and induce an increase in the production of anti-AAV antibodies. One population of CD19+ B cells from one human donor showed an increase in IgM secretion after treatment with AAV2. Anti-AAV2 antibodies are known to be highly prevalent in the human population due to the ubiquitous presence of AAV2. Thus, this study showed that in a population of CD19+ B cells from a single human donor potentially expressing anti-AAV2 antibodies, a dramatic increase in IgM production was induced after exposure to AAV2, but not to other AAV serotypes (Fig. 16).

[0180] A potential mechanism for dramatically increasing antibody expression is shown in Figure 17 and demonstrates the use of this system to express a transgene of interest.

Example 9: Booster effect on transgene expression after exposure to AAV2 in vivo

[0181]Donor cassettes transgenes were designed to insert the transgene downstream of the B-cell promoter. B cells were treatedex vivo using a specific nuclease and a donor construct containing a specific antibody promoter linked to a transgene of interest. It was previously confirmed that the B cells selected for this work produce antibodies against AAV2. The cells were re-introduced to the subject, and after a short period of time for engraftment, the subject was exposed to AAV2 or AAV2 peptides. The AAV booster upregulates the antibody promoter causing a dramatic increase in transgene expression.

Example 10: Modification of B cells by targeted integration of a B cell-specific antibody

[0182]Donor cassettes transgenes (AAV, mRNA, plasmid, etc.) were designed to insert antibody-encoding transgenes in which the antibody is(are) specific for a B cell producing unwanted antibodies (e.g., inhibitors) against a protein delivered by an ERT (or self-antigen), for example, a B cell producing antibodies against a blood clotting factor such as F9 (anti-F9 antibodies). Donor cassettes may include homology arms with nuclease target loci (e.g., albumin, TCRA, CCR5, AAVS1, etc.), and they are administeredin vivo in combination with an appropriate nuclease and/orex vivo in a population of B cells (populations of mature cells, stem cells and/or B cell progenitors) to a subject in need (hemophilia patient with anti-F9 antibodies).

[0183] After ex vivo or in vivo modification, antibody-producing B cells secrete targeted antibodies that bind to B cells that produce unwanted antibodies. These targeted antibodies then mediate lysis through the mobilization and activation of antibody-dependent cytotoxic cells or through complement-mediated lysis. Thus, in the patient, these administered B cells cause a decrease in the number of endogenous B cells producing undesired antibodies, for example against ERT-delivered proteins or self-antigen.

[0184]Complete the content of all patents, patent applications and publications mentioned in the present description, therefore, is given as a reference.

[0185]Although the description is presented in some detail by way of illustration and example for the purpose of clarity of understanding, one skilled in the art will appreciate that various changes and modifications can be practiced without deviating from the content or scope of the description. Accordingly, the above description and examples should not be construed as limiting.

Claims (22)

1. A genetically modified B cell capable of expressing a transgene, containing one or more transgenes and one or more additional modifications selected from: (a) insertions and/or deletions that (i) knock out B-cell receptor genes and/or (ii) modify cellular interactions at germinal centers, and (b) modifications that inhibit the suppression of any B cell function associated with pathogen infection or cancer regulation, wherein said transgene is episomal expressed in said modified B cells or integrated into a security region locus selected from the group consisting of CCR5, Rosa, albumin, AAVS1, TCRA, TCRB, and wherein said transgene encodes a therapeutic antibody specific for a B cell that produces inhibitory antibodies against a blood coagulation factor or protein that is involved in an autoimmune disease. 2. The genetically modified B cell of claim 1, wherein one or more transgenes are integrated into the security region locus of the B cell. 3. The genetically modified B cell of claim 1 or 2, wherein the transgene encodes a protein that is absent or deficient in a subject with hemophilia, a lysosome accumulation disease, a therapeutic antibody, and/or a peptide that facilitates crossing the blood-brain barrier when fused to the therapeutic protein. 4. The genetically modified B cell of claim 3, wherein the therapeutic antibody is specific for a B cell that produces inhibitory antibodies to a blood coagulation factor or protein that is involved in an autoimmune disease. 5. The genetically modified B cell of claim 3, wherein the therapeutic antibody is specific for a regulatory B cell (Breg) capable of attenuating the antitumor response. 6. The genetically modified B cell of claim 2, wherein the security region locus is TCRA. 7. The genetically modified B cell of claim 6, wherein the clotting factor is factor IX (F9). 8. The genetically modified B cell according to any one of claims 1 to 7, wherein the transgene further comprises a promoter that directs expression of the transgene. 9. The genetically modified B cell of claim 8, wherein the promoter is a constitutive promoter or a B cell line-specific promoter. 10. The genetically modified B cell of claim 8, wherein the B cell line specific promoter is the immunoglobulin kappa chain promoter, B29, BCL6, CIITA III promoter, mb-1 or EEK promoter. 11. A transgene-expressing B cell delivery composition comprising a genetically modified B cell according to any one of claims 1-10. 12. The composition of claim 11, wherein the genetically modified B cell is derived from a genetically modified hematopoietic stem cell. 13. A method of producing a protein in a subject in need thereof, comprising administering to the subject a B cell according to any one of claims 1 to 10 or a composition according to claim 11 or 12. 14. The method of claim 13 wherein the protein modulates an antibody response in the subject. 15. The use of a genetically modified B cell according to any one of claims 1 to 12 in a method for producing a protein in a subject, comprising: administering B cells or progenitor cells thereof to the subject under conditions such that the B cell produces protein in the subject. 16. Use according to claim 15, wherein the protein is a protein absent or deficient in a disease or disorder selected from hemophilia or a lysosome accumulation disease or an autoimmune disease, or an antibody specific for a B cell producing antibodies against the therapeutic protein, supplied through enzyme replacement therapy (ERT). 17. Use according to claim 16, wherein the therapeutic protein delivered by the ERT is a blood coagulation factor and the antibody is specific for B cells producing antibodies against the blood coagulation factor. 18. Use according to claim 17, wherein the coagulation factor is factor IX (F9).

Images