RU2780660C2 - COMBINED PURIFICATION AND MEASUREMENT OF DNA METHYLATION WITH COMBINED MEASUREMENT OF MUTATIONS AND/OR LEVELS OF mRNA EXPRESSION IN AUTOMATED REACTION CARTRIDGE - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: present invention relates to a set of cartridges for the determination of a status of nucleic acid methylation; to a system for the determination of nucleic acid methylation in a biological sample; to a method for the production of bisulfite-converted DNA; to a method for the detection of cancer or predisposition to cancer in a subject, as well as to a kit for the determination of DNA methylation, including the above-mentioned set of cartridges.

EFFECT: invention allows for carrying out the whole process at one stage: DNA purification, incubation with bisulfite, desulphurization, the second DNA purification, and methyl-specific PCR; it is also possible to carry out the analysis of different types of samples with the assessment of changes in methylation, observed at different types of cancer diseases.

32 cl, 37 dwg, 16 tbl, 16 ex

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority from prior U.S. Provisional Application No. 62/433,165, filed Dec. 12, 2016, the entire contents of which are incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0002] The genome of higher eukaryotes contains a modified nucleoside 5-methylcytosine (5-meC). This modification is usually present as part of a CpG dinucleotide in which cytosine is converted to 5-methylcytosine in a reaction that involves flipping out of the target cytosine from the native double helix and transfer of a methyl group from S-adenosylmethionine by the enzyme methyltransferase (see ., for example, Klimasauskas et al (1994) Cell 76: 357-369). Enzymatic transformation is the primary epigenetic modification of DNA known to occur in vertebrates and is critical to normal embryonic development (see, for example, Bird (1992) Cell 70: 5-8; Laird and Jaenisch (1994) Human Mol. Genet 3: 1487-1495 and Li et al (1992) Cell 69: 915-926).

[0003] In eukaryotes, DNA methylation regulates the normal course of cellular processes such as genomic imprinting, chromosomal instability, and X chromosome inactivation. Typically, DNA methylation occurs at the position of the fifth carbon atom of cytosine in the 5'-CpG-3' dinucleotide regions or near gene promoters called CpG islands or shores. Methylation controls gene expression by down-regulating transcription, either through direct inhibition of the transcriptional apparatus or indirectly through the involvement of chromatin remodeling proteins. Chromosome methylation patterns change dynamically during embryonic development, and proper methylation patterns must be maintained throughout an individual's lifetime. Changes in methylation patterns are associated with aging, and errors in DNA methylation are among the earliest changes that occur during oncogenesis. Thus, the detection (detection) of methylation of gene promoters, among other things, is important for the diagnosis and/or monitoring of patients with cancer.

[0004] Epigenetic changes, including DNA methylation, disrupt the DNA-RNA-protein order in which genetic information is converted into messenger RNA (mRNA) by transcription. The relationship between genomic changes in DNA, mRNA copy number and protein levels can be described by the level of DNA methylation. Thus, the joint measurement of DNA methylation levels and corresponding subsequent mRNA levels may be important for understanding the mechanism of epigenetic regulation of the cell.

[0005] Several methods have been developed to efficiently and accurately detect (detect) and quantify methylation. The most common method is the bisulfite conversion method, in which unmethylated cytosine is converted to uracil. After conversion, the DNA methylation profile can be determined by standard PCR, sequencing, and the like.

[0006] There are several DNA methylation kits suitable for bisulfite conversion and DNA purification (eg, EZ DNA METHYLATION™ kits from Zymo Research). Most kits use multiple steps, multiple reagents, multiple incubation periods, and often require DNA extraction before conversion, although some kits may use tissues or plasma/serum as starting material.

[0007] In general, the bisulfite conversion process requires at least four steps: 1) DNA denaturation; 2) incubation with bisulfite; 3) DNA purification; and 4) desulfurization. The final desulfurization step can be performed on a column or in solution followed by ethanol precipitation. There are currently no methylation kits that allow the user to complete the entire process in one step: DNA purification, bisulfite incubation, desulfurization, second DNA purification and methyl-specific PCR.

SHORT DESCRIPTION

[0008] Various implementations provided herein may include, but should not be limited to, one or more of the following:

[0009] The various implementations provided herein may include, but should not be limited to, one or more of the following:

[0010] Embodiment 1: A method for determining the methylation status of a nucleic acid, comprising:

[0011] i) bringing the biological sample containing the nucleic acid into contact with a first matrix material containing a first column or filter, where said matrix material binds and/or filters the nucleic acids in said sample and thereby purifies the DNA;

[0012] ii) eluting the bound DNA from the first template material and denaturing the DNA to obtain eluted denatured DNA;

[0013] iii) heating the eluted DNA in the presence of a bisulfite reagent to obtain a deaminated nucleic acid;

[0014] iv) bringing said deaminated nucleic acid into contact with a second matrix material containing a second column to bind said deaminated nucleic acid to said second matrix material;

[0015] v) desulfurizing the bound deaminated nucleic acid and/or simultaneously eluting and desulfurizing said nucleic acid by contacting the deaminated nucleic acid with an alkaline solution to produce a converted (eg, bisulfite-converted) nucleic acid;

[0016] vi) eluting the bisulfite-converted nucleic acid from the second matrix material; and

[0017] vii) performing a methylation-specific polymerase chain reaction (PCR) and/or nucleic acid sequencing and/or high-precision melting curve (HRM) analysis of said converted nucleic acid to determine methylation of said nucleic acid, and at least At least steps iv) to vi) are carried out in one reaction cartridge.

[0018] Embodiment 2: The method of Embodiment 1 wherein at least steps iv) to vi) are carried out in a single reaction cartridge.

[0019] Embodiment 3: The method of Embodiment 1 wherein at least steps iii) to vi) are carried out in a single reaction cartridge.

[0020] Embodiment 4: The method of Embodiment 1 wherein at least steps ii) to vi) are carried out in a single reaction cartridge.

[0021] Embodiment 5: The method of Embodiment 1 wherein at least steps i) through vi) are carried out in a single reaction cartridge.

[0022] Embodiment 6: The method of any one of Embodiments 1-5, wherein step vii is carried out in a single reaction cartridge.

[0023] Embodiment 7: The method of any one of Embodiments 1-6, wherein said first matrix material and said second matrix material are the same material forming the same column.

[0024] Embodiment 8: The method of any one of Embodiments 1-7, wherein said first matrix material and said second matrix material form different columns.

[0025] Embodiment 9: The method of any one of Embodiments 1-8, wherein said methylation-specific PCR, when performed, is carried out in said cartridge.

[0026] Embodiment 10: The method of any one of embodiments 1-9, wherein sequencing of said nucleic acid, if carried out, is carried out in said cartridge or in a device combined with said cartridge.

[0027] Embodiment 11: The method of any one of embodiments 1-10, wherein said cartridge includes a column containing said first matrix material, a sample receiving chamber, a temperature controlled channel or chamber, a plurality of chambers containing reagents and/or buffers and during use (operation) at least one of said chambers contains a desulfurization/elution buffer, said cartridge optionally containing a second column containing said second matrix material.

[0028] Embodiment 12: The method of Embodiment 11 wherein, during use, at least one of said chambers contains a reagent that provides bisulfite ions.

[0029] Embodiment 13: The method of any one of embodiments 11-12 wherein said second column is omitted.

[0030] Embodiment 14: The method of any one of embodiments 11-13, wherein said second column is present.

[0031] Embodiment 15: The method of any one of embodiments 11-14, wherein said cartridge comprises, in addition to said temperature controlled channel or chamber, a thermal cycling channel or chamber.

[0032] Embodiment 16: The method of any one of embodiments 11-14, wherein said temperature controlled channel or chamber is a thermal cycling channel or chamber.

[0033] Embodiment 17: The method of any of embodiments 11-16, wherein said cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation-specific PCR primers specific for methylation of PCR probes, PCR enzyme(s) and PCR reaction buffer.

[0034] Embodiment 18: The method of Embodiment 17, wherein said cartridge includes one or more chambers containing one or more primers and probes for detecting forward strand methylation of bisulfite-converted DNA.

[0035] Embodiment 19: The method of any one of Embodiments 17-18, wherein said cartridge includes one or more chambers containing one or more primers and probes to detect reverse strand methylation of bisulfite-converted DNA.

[0036] Embodiment 20: The method of any one of embodiments 11-19, wherein said sample receiving chamber, said column(s), a plurality of chambers, and, if present, said temperature controlled channel or chamber, and/ or the thermal cycling channel or chamber has a selective fluid connection.

[0037] Embodiment 21: The method of Embodiment 20, wherein said sample receiving chamber, said column(s), said plurality of chambers, and, if present, said thermal cycling channel or chamber are fluid selectively connected by microfluidic channels and valves.

[0038] Embodiment 22: The method of Embodiment 20, wherein said sample receiving chamber, said column(s), said plurality of chambers, and, if present, said channel or thermal cycling chamber or port to said channel, or the thermal cycling chamber is located around the central valve and has a selective fluid connection with a channel in the specified central valve, and the specified central valve is configured to accommodate a piston capable of drawing liquid into the chamber or from the chamber when in fluid connection with the specified central valve.

[0039] Embodiment 23: The method of any one of embodiments 11-22, wherein said cartridge, during use, comprises:

[0040] the first chamber containing the sample;

[0041] a second chamber containing a solution of guanidine thiocyanate-ethanol (GTC-EtOH);

[0042] a third chamber containing a bisulfite reagent;

[0043] a fourth chamber containing a buffer;

[0044] the fifth chamber containing the wash solution; and

[0045] the sixth chamber containing the elution/desulfurization reagent.

[0046] Embodiment 24: The method of Embodiment 23 wherein the first chamber contains said sample in the GTC-EtOH-Tween extraction/precipitation reagent.

[0047] Embodiment 25: The method of any one of embodiments 23-24 wherein the GTC-EtOH-Tween buffer is added at or near the time the sample is placed in the cartridge.

[0048] Embodiment 26: The method of any of embodiments 23-25 wherein said bisulfite reagent is added at or near the time the sample is placed in the cartridge.

[0049] Embodiment 27: The method of Embodiment 23 wherein the GTC-EtOH-Tween buffer is provided as a component of the cartridge.

[0050] Embodiment 28: The method of any one of Embodiments 23-25 wherein the bisulfite reagent is provided as a component of the cartridge.

[0051] Embodiment 29: The method of any of embodiments 11-28, wherein said cartridge includes a seventh chamber containing PCR primers and/or probes and/or PCR enzymes.

[0052] Embodiment 30: The method of any of embodiments 11-29, wherein said cartridge includes an eighth chamber also containing PCR primers and/or probes and/or PCR enzymes.

[0053] Embodiment 31: The method of Embodiments 29-30 wherein said PCR primers and/or probes and/or enzymes are presented on beads.

[0054] Embodiment 32: The method of any of embodiments 1-31, wherein said biological sample includes one or more samples selected from the group consisting of a cell, a tissue, and a biological fluid containing a nucleic acid.

[0055] Embodiment 33: The method of Embodiment 32, wherein said biological sample comprises a biological fluid selected from the group consisting of whole blood, plasma, serum, saliva, mucus, urine, sputum, pancreatic juice, and cerebrospinal fluid.

[0056] Embodiment 34: The method of Embodiment 32, wherein said biological sample comprises a sample selected from the group consisting of tissue sample, formalin-fixed and paraffin-embedded tissue sample (FFPE), fresh frozen tissue, fine needle aspiration biopsy (FNA) and core biopsy.

[0057] Embodiment 35: The method of any one of embodiments 1-34, wherein said method comprises contacting said biological sample with a lyse.

[0058] Embodiment 36: The method of Embodiment 35, wherein said method includes locating said sample in said sample receiving chamber and contacting said sample with an extraction/precipitation solution.

[0059] Embodiment 37: The method of any one of Embodiments 1-36, wherein said matrix material comprises a column material selected from the group consisting of glass or silica, ion exchange resin, cellulose, and hydroxyapatite.

[0060] Embodiment 38: The method of Embodiment 37, wherein said matrix material comprises glass.

[0061] Embodiment 39: The method of any one of Embodiments 1-38, wherein said bisulfite ion is a compound selected from the group consisting of ammonium bisulfite, sodium metabisulfite, potassium bisulfite, cesium bisulfite, and 1,4- diazabicyclo[2.2.2]-octane (DABSO).

[0062] Embodiment 40: The method of Embodiment 39 wherein said bisulfite ion is ammonium bisulfite.

[0063] Embodiment 41: The method of any one of embodiments 1-40 wherein said bisulfite is present in a reactant mixture containing scavengers to prevent oxidation of sulfites and/or catalysts.

[0064] Embodiment 42: The method of Embodiment 41 wherein said bisulfite is present in a reactant mixture containing scavengers selected from the group consisting of Trolox and hydroquinone.

[0065] Embodiment 43: The method of any of embodiments 41-42 wherein said bisulfite is present in a reactant mixture containing polyamines as catalysts.

[0066] Embodiment 44: The method of any of embodiments 1-43, wherein said elution of bound DNA comprises eluting and denaturing said DNA using a low concentration of potassium hydroxide or other base.

[0067] Embodiment 45: The method of Embodiment 44, wherein said eluting the bound DNA comprises eluting and denaturing said DNA with an alkaline solution with a pH higher than about pH 10.5.

[0068] Embodiment 46: The method of Embodiment 44, wherein said eluting the bound DNA comprises eluting and denaturing said DNA with an alkaline solution with a pH higher than about pH 12.

[0069] Embodiment 47: The method of Embodiments 45-46 wherein said alkaline solution is a 10-15 mM KOH solution.

[0070] Embodiment 48: The method of any one of Embodiments 1-47, wherein said incubating the eluted DNA with bisulfite ions to produce a deaminated nucleic acid comprises incubating the DNA in an ammonium bisulfite solution that has concentrations ranging from about 6 M up to about 7 M.

[0071] Embodiment 49: The method of Embodiment 48, wherein said incubating the eluted DNA with bisulfite ions to produce a deaminated nucleic acid comprises incubating the DNA in an ammonium bisulfite solution that has a concentration of about 6.5M.

[0072] Embodiment 50: The method of Embodiment 49 wherein said incubation comprises transferring DNA in a concentrated bisulfite solution inside a temperature controlled channel or chamber in said cartridge and heating said mixture.

[0073] Embodiment 51: The method of Embodiment 50 wherein said incubation comprises thermal cycling a concentrated bisulfite solution at about 60°C to about 95°C.

[0074] Embodiment 52: The method of any one of Embodiments 1-51, wherein said contacting said deaminated nucleic acid with a second template material comprises mixing a DNA bisulfite solution with freshly prepared GTC-EtOH and distributing said solution over said second template material. material.

[0075] Embodiment 53: The method of Embodiment 52, wherein said method comprises washing the DNA in said second template material with freshly prepared GTC-EtOH and then with a wash solution.

[0076] Embodiment 54: The method of Embodiment 53 wherein said wash solution contains PEG200.

[0077] Embodiment 55: The method of any of embodiments 1-54, wherein said desulfurization of the bound deaminated nucleic acid comprises eluting the DNA from said second column with a high pH desulfurization buffer and incubating said solution.

[0078] Embodiment 56: The method of Embodiment 55, wherein said incubation lasts for a period of time ranging from about 1 minute to about 1 hour, or from about 5 minutes to about 30 minutes, or from about 10 minutes to about 20 minutes, or for about 15 minutes.

[0079] Embodiment 57: The method of Embodiments 55-56 wherein said high pH desulfurization/elution buffer contains KOH.

[0080] Embodiment 58: The method of any one of embodiments 55-57, wherein said incubation occurs in a chamber that previously contained said high pH desulfurization buffer (eg, chamber 10).

[0081] Embodiment 59: The method of any one of embodiments 1-58 wherein, after incubation with bisulfite ions, the temperature-controlled channel or chamber is washed with buffer to remove residual bisulfite and neutralize the pH.

[0082] Embodiment 60: The method of any one of Embodiments 1-59, wherein a highly accurate melting curve (HRM) analysis of said bisulfite-converted nucleic acid is performed to determine the methylation of said nucleic acid.

[0083] Embodiment 61: The method of any of embodiments 1-60, wherein said bisulfite-converted nucleic acid is sequenced to determine the methylation of said nucleic acid.

[0084] Embodiment 62: The method of any one of Embodiments 1-60, wherein a methylation-specific PCR is performed to determine the methylation of the nucleic acid sequences of interest.

[0085] Embodiment 63: The method of Embodiment 62, wherein said methylation-specific PCR (MSP) is performed using primers specific for methylated sequences and/or primers specific for non-methylated sequences.

[0086] Embodiment 64: The method of Embodiment 62, wherein said methylation-specific PCR includes the MetyLight protocol.

[0087] Embodiment 65: The method of Embodiment 62, wherein TaqMan PCR is performed using primers specific for bisulfite-converted methylated and/or unmethylated sequences.

[0088] Embodiment 66: The method of any one of embodiments 62-65, wherein said MSP uses one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences. sequences.

[0089] Embodiment 67: The method of Embodiment 66, wherein said fluorescent probes comprise a fluorescent reporter dye and a quenching dye, wherein the probe generates a cleavage signal through the 5'-3' nuclease activity of Taq DNA polymerase.

[0090] Embodiment 68: The method of any one of embodiments 66-67, wherein the methylation signal is determined from a combined signal from a plurality of probes, each specific for a different methylation site in the amplified region of interest.

[0091] Embodiment 69: The method of any one of embodiments 66-67 wherein the methylation signal is determined using multiple probes specific for the same methylated sites in the amplified region of interest.

[0092] Embodiment 70: The method of any one of embodiments 66-67, wherein said plurality of probes comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more probes.

[0093] Embodiment 71: The method of any one of embodiments 66-67 wherein the methylation signal is determined with a single probe in the amplified region of interest.

[0094] Implementation 72: The method of any one of embodiments 66-71, wherein said probes are used in simplex or multiplex format.

[0095] Embodiment 73: The method of any one of embodiments 66-71, wherein said probes are used in a multiplex format.

[0096] Embodiment 74: The method of any one of embodiments 66-73, wherein said probes are used for nested PCR.

[0097] Embodiment 75: The method of any one of embodiments 66-74, wherein said PCR reaction mixture contains a bisulfite contamination control sample in which, if bisulfite is present in the reaction mixture, bisulfite-driven cleavage occurs during PCR.

[0098] Embodiment 76: The method of any one of embodiments 1-75, wherein the PCR is performed on one or more mutated genes.

[0099] Embodiment 77: The method of any one of Embodiments 1-76 wherein PCR is performed on unconverted DNA as a control.

[0100] Embodiment 78: The method of any one of Embodiments 1-77 wherein PCR is performed on the converted DNA as a control.

[0101] Embodiment 79: The method of Embodiment 77 wherein PCR is performed on unconverted DNA and the unconverted DNA is the target in said method.

[0102] Embodiment 80: The method of any one of Embodiments 1-79, wherein the reaction with bisulfite and PCR, or the reaction with desulfurization and PCR, or the reaction with bisulfite, the reaction with desulphurization, and PCR are carried out together in the same reaction tube, or camera.

[0103] Embodiment 81: The method of any one of Embodiments 1-80, wherein said contacting a biological sample containing a nucleic acid with a first template material comprises contacting an RNA containing sample with said first template material, wherein said template material binds said RNA and thus results in purification of the RNA.

[0104] Embodiment 82: The method of Embodiment 81, wherein said method comprises eluting said RNA from said template material substantially independently of DNA.

[0105] Embodiment 83: The method of Embodiment 82, wherein said RNA is eluted from said first template material using Tris buffer elution.

[0106] Embodiment 84: The method of any one of embodiments 81-83 wherein said RNA is eluted and stored in a chamber.

[0107] Embodiment 85: The method of any one of embodiments 81-84, wherein said RNA is subjected to reverse transcription (RT) and real-time PCR (qRT-PCR) to determine expression levels of target RNA sequences.

[0108] Embodiment 86: The method of any one of embodiments 82-85, wherein an RNA fraction is used to elute the bisulfite-converted nucleic acid from said second template material and mixed with the bisulfite-converted DNA, or mixed with the eluted bisulfite-converted DNA.

[0109] Embodiment 87: The method of Embodiment 86 wherein RT is performed on said RNA before or after combining with bisulfite-converted DNA.

[0110] Embodiment 88: The method of any one of embodiments 86-87, wherein qRT-PCR is performed on RT RNA in the mixture to determine expression levels of target RNA sequences, and methylation-specific PCR is performed on the mixture with the purpose of determining the methylation of DNA target sequences.

[0111] Embodiment 89: The method of any one of Embodiments 1-88, which determines the methylation of the promoter region of a gene selected from the group consisting of MGMT. RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1 and AKR1B1.

[0112] Embodiment 90: The method of any one of embodiments 81-89, wherein said RNA expression level is determined for methyltransferase.

[0113] Embodiment 91: The method of Embodiment 90, wherein said RNA expression level is determined for a methyltransferase selected from the group consisting of DNMT1, DNMT2, DNMT3A, DNMT3B, and TNMT3L.

[0114] Embodiment 92: a cartridge for determining the methylation status of a nucleic acid, comprising: a column including a first matrix material, a sample receiving chamber, a temperature controlled channel or chamber, a plurality of chambers containing reagents and/or buffers, and in the process of using at least one of said chambers contains a bisulfite reagent, and at least one of said chambers contains a desulfurization/elution buffer, and said cartridge optionally includes a second column that contains said second matrix material.

[0115] Embodiment 93: The cartridge of Embodiment 92, wherein said cartridge, during use, includes a chamber that contains a guanidine thiocyanate-ethanol (GTC-EtOH) reagent.

[0116] Embodiment 94: The cartridge of any one of Embodiments 92-93 that lacks said second column.

[0117] Embodiment 95: The cartridge of any one of embodiments 92-93, wherein said second column is present.

[0118] Embodiment 96: The cartridge of any one of embodiments 92-95, wherein said temperature controlled channel or chamber is a thermal cycling channel or chamber.

[0119] Embodiment 97: The cartridge of any one of embodiments 92-96, wherein said cartridge further comprises a second heating channel or chamber.

[0120] Embodiment 98: The cartridge of any one of Embodiments 92-97, wherein said bisulfite reagent contains a compound selected from the group consisting of ammonium bisulfite, sodium metabisulfite, potassium bisulfite, cesium bisulfite, and 1,4-diazabicyclo[2.2 .2]-octane (DABSO).

[0121] Embodiment 99: The cartridge of Embodiment 98, wherein said bisulfite reagent contains ammonium bisulfite.

[0122] Embodiment 100: The cartridge of any one of Embodiments 92-99 wherein said bisulfite is present in a reactant mixture containing scavengers to prevent oxidation of sulfites and/or catalysts.

[0123] Embodiment 101: The cartridge of Embodiment 100 wherein said bisulfite is present in a reactant mixture containing scavengers selected from the group consisting of Trolox and hydroquinone.

[0124] Embodiment 102: The cartridge of any one of Embodiments 100-101 wherein said bisulfite is present in a reactant mixture containing polyamines as catalysts.

[0125] Embodiment 103: The cartridge of any one of embodiments 92-102, wherein said first matrix material and/or said second matrix material, if present, contains a material selected from the group consisting of glass or silica, ionic exchange resin and hydroxyapatite.

[0126] Embodiment 104: The cartridge of any one of embodiments 92-103, wherein said cartridge includes one or more chambers containing one or more reagents selected from the group consisting of methylation-specific PCR primers, methylation-specific probes for PCR, PCR enzyme(s) and PCR reaction buffer.

[0127] Embodiment 105: The cartridge of Embodiment 104, wherein said cartridge includes at least two chambers containing one or more reagents selected from the group consisting of methylation-specific PCR primers, methylation-specific PCR probes, enzyme(s) for PCR; and reaction buffer for PCR.

[0128] Embodiment 106: The cartridge of any one of embodiments 92-105, wherein said cartridge includes at least one chamber containing primers and probes for detecting forward strand methylation of the converted DNA.

[0129] Embodiment 107: The cartridge of any one of embodiments 92-106, wherein said cartridge includes at least one chamber containing primers and probes for detecting reverse strand methylation of the converted DNA.

[0130] Embodiment 108: The cartridge of any one of embodiments 104-107 wherein said PCR primers and/or probes and/or enzymes are presented on beads.

[0131] Embodiment 109: The cartridge of any one of embodiments 92-108, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature controlled heating channel or chamber have a fluid selective connection.

[0132] Embodiment 110: The cartridge of Embodiment 109, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature controlled channel or chamber are fluidly selectively connected by microfluidic channels and valves.

[0133] Embodiment 111: The cartridge of Embodiment 109, wherein said sample receiving chamber, said column(s), said plurality of chambers, and said temperature controlled channel or chamber, or a port in said temperature controlled channel or chamber are arranged around a central valves and have a selective fluid connection with a channel in said central valve, wherein said central valve is configured to receive a piston capable of withdrawing liquid into or out of the chamber when in fluid communication with said central valve.

[0134] Embodiment 112: The cartridge of any one of embodiments 92-111, wherein said cartridge is configured to, during use, said cartridge include:

[0135] the first chamber containing the sample;

[0136] a second chamber containing a solution of guanidine thiocyanate-ethanol (GTC-EtOH);

[0137] a third chamber containing a bisulfite reagent;

[0138] a fourth chamber containing a buffer;

[0139] the fifth chamber containing the wash solution; and

[0140] the sixth chamber containing the elution/desulfurization reagent.

[0141] Embodiment 113: The cartridge of Embodiment 112, wherein said first chamber contains said sample in a GTC-EtOH-Tween extraction/precipitation reagent.

[0142] Embodiment 114: The cartridge of any one of embodiments 92-113, wherein said cartridge is configured to add a bisulfite reagent to the cartridge at or near the time the sample is placed in the cartridge.

[0143] Embodiment 115: The cartridge of any one of Embodiments 92-113, wherein said bisulfite reagent is provided as a component of the cartridge.

[0144] Embodiment 116: The cartridge of any one of embodiments 92-115, wherein said cartridge is configured to add GTC-ETOH-Tween buffer at or near the time the sample is placed in the cartridge.

[0145] Embodiment 117: The cartridge of any one of Embodiments 92-115, wherein said GTC-ETOH-Tween buffer is provided as a component of the cartridge.

[0146] Embodiment 118: The cartridge of any one of embodiments 92-117, wherein said cartridge includes a seventh chamber containing PCR primers and/or probes and/or PCR enzymes.

[0147] Embodiment 119: The cartridge of any one of embodiments 92-118, wherein said cartridge includes an eighth chamber also containing PCR primers and/or probes and/or PCR enzymes.

[0148] Embodiment 120: The cartridge of any one of embodiments 92-119, wherein said cartridge includes one or more chambers containing primers specific for bisulfite-converted methylated and/or unmethylated sequences.

[0149] Embodiment 121: The cartridge of any of embodiments 92-120, wherein said cartridge includes one or more chambers containing TaqMan PCR reagents.

[0150] Embodiment 122: The cartridge of any one of Embodiments 92-121, wherein said cartridge includes one or more chambers containing one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes , which are markers for amplified unmethylated sequences.

[0151] Embodiment 123: The cartridge of Embodiment 122, wherein said probes contain a fluorescent reporter dye and a quench dye, wherein the probe generates a cleavage signal through the 5'-3' nuclease activity of Taq DNA polymerase.

[0152] Embodiment 124: The cartridge of any one of embodiments 122-123, wherein said cartridge contains a plurality of probes, each specific for a different methylated site in the amplified region of interest.

[0153] Embodiment 125: The cartridge of any one of embodiments 122-123, wherein said cartridge contains a single probe specific for a single methylated site in the amplified region of interest.

[0154] Embodiment 126: The cartridge of any one of embodiments 122-123, wherein said cartridge contains a plurality of probes, each specific for the same methylated site within the amplified region of interest.

[0155] Embodiment 127: The cartridge of any one of Embodiments 92-126, wherein said cartridge contains primers and/or probes for determining methylation of a promoter region of a gene selected from the group consisting of MGMT, RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1 and AKR1B1.

[0156] Embodiment 128: The cartridge of any one of embodiments 92-126, wherein said cartridge contains one or more of the primers shown in Tables 5, 9, or 10 and/or one or more probes shown in Tables 5, 9 or 10.

[0157] Embodiment 129: The cartridge of Embodiment 128, wherein said cartridge contains the following probes and primers to determine MGMT methylation using nested PCR:

[0158] outer forward primer (248b) containing the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO: 263);

[0159] outer reverse primer (249b) containing the nucleotide sequence: AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO: 265);

[0160] internal forward primer (250) containing the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO: 266);

[0161] internal reverse primer (251) containing the nucleotide sequence GCACTCTTCCGAAAACGAAACG (SEQ ID NO: 267); and

[0162] probe (252a) containing the nucleotide sequence of fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAC blocker (SEQ ID NO: 268).

[0163] Embodiment 130: The cartridge of any one of embodiments 128-129, wherein said cartridge contains the following probes and primers to determine ASTB methylation (e.g., as a control) using nested PCR:

[0164] outer forward primer (102) containing the nucleotide sequence: GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0165] outer reverse primer (103) containing the nucleotide sequence: CCAATAAAAACSTACCSTSSTTAA (SEQ ID NO: 104);

[0166] internal forward primer (148) containing the nucleotide sequence: GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0167] internal reverse primer (149) containing the nucleotide sequence: CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0168] a probe (178) containing the nucleotide sequence: fluorophore-CCACCASSCAACACA(N*)CAA(T*)AACAAAACAC-blocker (SEQ ID NO: 179).

[0169] Embodiment 131: The cartridge of any one of embodiments 92-130, wherein said cartridge is configured to determine the expression level of methyltransferase RNA.

[0170] Embodiment 132: The cartridge of Embodiment 131 wherein said methyltransferase is selected from the group consisting of DNMT1, DNMT2, DNMT3A, DNMT3B, and TNMT3L.

[0171] Embodiment 133: A system for determining nucleic acid methylation in a biological sample, comprising: a housing configured to accommodate one or more sample processing modules, where each sample processing module is configured to attach a removable cartridge according to any one of embodiments 92- 132; wherein said system is configured to control sample processing modules to perform sample processing to determine the methylation of one or more target nucleic acids and optionally to determine the level of one or more target DNA sequences within a respective removable sample cartridge, said processing the sample inside the respective removable cartridge is carried out by the method according to any of the implementation options 1-91.

[0172] Embodiment 134: The system of Embodiment 133, wherein said system is configured to accommodate one sample processing module.

[0173] Embodiment 135: The system of Embodiment 133, wherein said system is configured to accommodate at least two sample processing modules, or at least 4 sample processing modules, or at least 8 sample processing modules, or at least 12 sample processing modules, or at least 16 sample processing modules, or at least 20 sample processing modules, or at least 24 sample processing modules, or at least 28 sample processing modules, or at least 32 sample processing modules, or at least 64 sample processing modules, or at least 128 sample processing modules.

[0174] Embodiment 136: The system of any one of embodiments 133-135, wherein said modules include one or more heating plates for heating a temperature controlled chamber or conduit in said cartridge.

[0175] Embodiment 137: The system of any one of embodiments 133-136, wherein said modules include a fan configured to cool a temperature controlled channel or chamber in said cartridge.

[0176] Embodiment 138: The system of any one of embodiments 133-137, wherein said modules include an electronic board for transmitting information (eg, optical information) to a computer for analysis.

[0177] Embodiment 139: The system of any one of embodiments 133-138, wherein said modules include optical units to excite and/or detect one or more optical signals generated by reactions in said cartridge.

[0178] Embodiment 140: The system of any one of embodiments 133-139, wherein said system is configured to control said cartridge to perform the method of any one of embodiments 1-91.

[0179] Embodiment 141: The system of any one of embodiments 133-139, wherein said system is configured to control said cartridge to: bind a sample to a column; eluting the DNA from the column and combining said DNA with a conversion reagent; heating the DNA/conversion reagent solution in a reaction chamber or tube to obtain converted DNA; binding the converted DNA on the column; desulfurization and elution of DNA from the column; and performing PCR with the eluted desulfurized DNA in a reaction chamber or tube.

[0180] Embodiment 142: The system of Embodiment 141 wherein said PCR is performed in the same reaction chamber or tube and the DNA/conversion reagent solution is preheated.

[0181] Embodiment 143: a sample preparation cartridge comprising: a channel or chamber containing an affinity template that binds DNA, a plurality of chambers located around a central valve assembly and having a selective fluid connection with said central valve assembly, wherein said node the central valve is configured to receive a piston capable of drawing fluid into or out of the chamber when in fluid communication with said central valve; moreover, the specified set of chambers includes: a chamber configured to receive a sample solution up to about 5 ml, inclusive, or up to about 4 ml, inclusive; a chamber containing PEG; a chamber containing GTC-EtOH; a chamber containing an alkaline solution; and a camera containing a buffer.

[0182] Embodiment 144: The cartridge of Embodiment 143, wherein said plurality of chambers further includes a chamber containing a bisulfite reagent.

[0183] Embodiment 145: The cartridge of any of embodiments 143-144, wherein said plurality of chambers includes a chamber containing a GTC-ethanol wash solution.

[0184] Embodiment 146: The cartridge of Embodiment 145 wherein said GTC-ethanol wash solution contains guanidine thiocyanate 1.25 M, Tris 25 mM pH 7.0, and 50% ethanol.

[0185] Embodiment 147: The cartridge of any one of Embodiments 143-146 wherein said PEG contains PEG200.

[0186] Embodiment 148: The cartridge of any one of Embodiments 143-147, wherein said caustic solution contains KOH.

[0187] Embodiment 149: The cartridge of any one of Embodiments 143-148, wherein said buffer contains Tris.

[0188] Embodiment 150: The cartridge of any of embodiments 143-149, wherein said plurality of chambers includes a chamber containing beads containing one or more PCR primers and/or probes.

[0189] Embodiment 151: The cartridge of any one of embodiments 143-150, wherein said PEG-containing chamber contains approximately 1 ml of PEG.

[0190] Embodiment 152. The cartridge of any one of Embodiments 143-151, wherein said caustic solution containing chamber contains approximately 500 μl of solution.

[0191] Embodiment 153: The cartridge of any one of Embodiments 143-152, wherein said chamber containing GTC-EtOH contains approximately 2 ml of GTC-EtOH.

[0192] Embodiment 154: The cartridge of any one of Embodiments 143-153, wherein said buffer containing chamber contains approximately 2 ml of buffer.

[0193] Embodiment 155: in high volume sample preparation (HVSP), said cartridge includes: a channel or chamber containing an affinity template that binds DNA, a plurality of chambers located around a central valve assembly and having a selective fluid connection with said central valve assembly, wherein said central valve assembly is configured to accommodate a piston capable of drawing fluid into or out of the chamber when fluidly connected to said central valve, said plurality of chambers including: at least two distinct chambers configured to receive about 4 .5 ml sample solution; a chamber containing PEG; a chamber containing an alkaline solution; and a camera containing a buffer.

[0194] Embodiment 156: The cartridge of Embodiment 155, wherein said plurality of chambers includes at least three different chambers, each capable of holding up to 4 ml of sample solution.

[0195] Embodiment 157: The cartridge of any one of embodiments 155-156 wherein said PEG contains PEG200.

[0196] Embodiment 158: The cartridge of any one of Embodiments 155-157 wherein said base solution contains KOH.

[0197] Embodiment 159: The cartridge of any one of embodiments 155-158, wherein said buffer contains Tris.

[0198] Embodiment 160: The cartridge of any one of embodiments 155-159, wherein said plurality of chambers includes a chamber containing a wash solution.

[0199] Embodiment 161: The cartridge of Embodiment 160 wherein said wash solution contains guanidine thiocyanate 1.25 M, Tris 25 mM pH 7.0, and 50% ethanol.

[0200] Embodiment 162: The cartridge of any one of embodiments 155-161, wherein said cartridge includes a chamber capable of withdrawing a processed sample.

[0201] Embodiment 163: The cartridge of any one of embodiments 155-162, wherein said sample chambers contain sample solution, GTC, and isopropanol during use.

[0202] Embodiment 164: The cartridge of Embodiment 163, wherein said sample chambers contain sample solution, GTC, and isopropanol in substantially equal volumes during use.

[0203] Embodiment 165: The cartridge of any one of embodiments 155-164, wherein said cartridge, during use, contains 4 ml of sample solution placed in each of said sample-receiving chambers.

[0204] Embodiment 166: The cartridge of any one of embodiments 155-165, wherein said cartridge provides DNA or RNA extraction that is substantially linear with sample volume, from 0.5 ml to about 4 ml.

[0205] Embodiment 167: The cartridge of any one of embodiments 155-166, wherein said cartridge contains or is configured to receive a conversion reagent.

[0206] Embodiment 168: The cartridge of Embodiment 167, wherein said cartridge undergoes a bisulfite conversion of DNA during use.

[0207] Embodiment 169: A lysing solution for obtaining a DNA sample from serum or plasma, containing: GTC, a buffer, a detergent, and optionally an antifoam agent.

[0208] Embodiment 170: The lyse of Embodiment 169, wherein said serum or plasma lyse contains GTC, Tris pH 7.0, Tween 20, and antifoam agent SE15.

[0209] Embodiment 171: The lyse of Embodiment 170, wherein said serum or plasma lyse contains about 4.5 M GTC, about 45 mM Tris at pH 7.0, about 1% Tween20, and about 0 antifoam SE15 .01%.

[0210] Embodiment 172: lysis solution for obtaining a DNA sample from a FFPE sample.

[0211] Embodiment 173: The lyse solution of Embodiment 172, wherein said FFPE sample lyse contains buffer, detergent, NaCl, MgCl ₂ , complexing agent, antifoam agent SE15, and sodium azide.

[0212] Embodiment 174: The lyse of Embodiment 173, wherein said FFPE sample lyse contains about 1% Tween 20, about 400 mM NaCl, about 25 mM EDTA, about 10 mM MgCl ₂ , about 50 mM HEPES with pH 7.2, about 0.01% defoamer SE15 and about 0.01% sodium azide.

[0213] Embodiment 175: DNA methylation detection kit, comprising: a container containing a nucleic acid methylation status cartridge according to any one of embodiments 92-136.

[0214] Embodiment 176: The kit of Embodiment 175, wherein said kit further includes a container containing a lyse solution.

[0215] Embodiment 177: The kit of Embodiment 176, wherein said lyse is the serum or plasma lyse of any of Embodiments 169-171.

[0216] Embodiment 178: The kit of Embodiment 176, wherein said lyse is the FFPE Sample Lyse of any of Embodiments 172-174.

[0217] Embodiment 179: The kit of any one of Embodiments 175-178, wherein said kit includes a container containing proteinase K.

[0218] Embodiment 180: The kit of any one of embodiments 175-179, wherein said kit contains a conversion reagent in said cartridge or in a container separate from the cartridge.

[0219] Embodiment 181: A kit according to Embodiment 180, wherein said kit contains said conversion reagent in a container separate from the cartridge.

[0220] Embodiment 182: A kit according to Embodiment 180, wherein said kit contains said conversion reagent that is housed in the chamber of the cartridge.

[0221] Embodiment 183: The kit of any one of Embodiments 180-182, wherein said conversion reagent comprises a compound selected from the group consisting of sodium metabisulphite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and 1,4-diazabicyclo[ 2.2.2]-octane (DABSO).

[0222] Embodiment 184: The kit of Embodiment 183, wherein said conversion reagent contains ammonium bisulfite.

[0223] Embodiment 185: The kit of any of embodiments 175-184, wherein said kit includes a container containing a sample processing reagent.

[0224] Embodiment 186: The kit of Embodiment 185, wherein said sample processing reagent contains guanidine thiocyanate.

[0225] Embodiment 187: The kit of any one of Embodiments 185-186, wherein said sample treatment reagent contains ethanol.

[0226] Embodiment 188: The kit of any one of embodiments 175-187, wherein said kit includes a container containing a sample preparation cartridge of any one of embodiments 155-166.

[0227] Embodiment 189: The kit of any one of embodiments 175-188, wherein said kit contains instructional materials for training in the use of said DNA methylation cartridge.

[0228] Embodiment 190: A cartridge for detecting cancer marker methylation, which includes: a plurality of chambers and a thermal cycling channel or chamber, said plurality of chambers and a port to said thermal cycling channel or chamber located around a central valve assembly and having a selective fluid connection with said central valve assembly, wherein said central valve assembly is configured to receive a piston capable of drawing fluid into or out of a chamber or port when fluidly connected to said central valve, said plurality of chambers including: a sample receiving chamber; a chamber containing or configured to receive a bisulfite reagent; a chamber containing a wash solution; a chamber containing a Tris buffer; a chamber containing an alkaline solution containing KOH; a chamber containing beads on which the master mix for PCR is placed; and a chamber containing beads that place PCR primers and probes for determining the methylation of one or more promoters of genes whose methylation status is a cancer marker.

[0229] Embodiment 191: The cartridge of Embodiment 190, wherein said plurality of chambers includes a chamber provided for receiving waste solutions.

[0230] Embodiment 192: The cartridge of any one of Embodiments 190-191, wherein said bisulfite reagent contains a compound selected from the group consisting of sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and 1,4-diazabicyclo[2.2 .2]-octane (DABSO).

[0231] Embodiment 193: The cartridge of Embodiment 192, wherein said bisulfite reagent contains ammonium bisulfite.

[0232] Embodiment 194: The cartridge of any one of Embodiments 190-193, wherein said wash solution contains GTC 1.25 M, Tris 25 mM pH 7.0, and 50% ethanol.

[0233] Embodiment 195: The cartridge of any one of embodiments 190-194, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining methylation of one or more promoters of genes whose methylation status is a cancer marker selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer and lung cancer.

[0234] Embodiment 196: The cartridge of Embodiment 195, wherein said chamber, containing beads that accommodate PCR primers and probes for determining methylation of one or more gene promoters, contains beads that provide PCR primers and nested PCR probes .

[0235] Embodiment 197: The cartridge of Embodiment 196 wherein said nested PCR comprises a first PCR reaction specific for converted DNA and a second PCR reaction specific for methylated CpGs.

[0236] Embodiment 198: The cartridge of any one of embodiments 190-197, wherein said chamber containing beads that place PCR primers and probes contains beads that place PCR primers and probes for detecting forward strand methylation of the converted DNA .

[0237] Embodiment 199: The cartridge of any one of embodiments 190-198, wherein said chamber containing beads that place PCR primers and probes contains beads that place PCR primers and probes to detect reverse strand methylation of the converted DNA .

[0238] Embodiment 200: The cartridge of any one of embodiments 190-199, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting promoter methylation of one or more genes selected from the group consisting of RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, TM6SF1, BRCA1, BNC1, ADAMTS1, CDO1, SOX17, TAC1, HOXA7 and MGMT.

[0239] Embodiment 201: The cartridge of any one of embodiments 190-200, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining the methylation of one or more promoters of genes whose methylation status is a marker for pancreatic cancer.

[0240] Embodiment 202: The cartridge of Embodiment 201, wherein said chamber containing beads that place PCR primers and probes for methylation of one or more gene promoters contains beads that place PCR primers and probes for methylation ADAMTS1 and/or BNC1 promoters.

[0241] Embodiment 203: The cartridge of embodiment 202, wherein said chamber containing beads that place PCR primers and probes for methylation of one or more gene promoters contains beads that place PCR primers and probes for methylation ADAMTS1 promoter.

[0242] Embodiment 204: The cartridge of any one of embodiments 202-203, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the BNC1 promoter.

[0243] Embodiment 205: A cartridge according to embodiment 202, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place one or more PCR primers and/ or probes for ADAMTS1 and/or BNC presented in tables 5 or 10.

[0244] Embodiment 206: The cartridge of any one of embodiments 190-200, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining the methylation of one or more promoters of genes whose methylation status is a marker of breast cancer.

[0245] Embodiment 207: The cartridge of embodiment 206, wherein said chamber containing beads that place PCR primers and probes for methylation of one or more gene promoters contains beads that place PCR primers and probes for methylation promoters for one, two, three, four, five or all of the genes selected from the group consisting of BRCA1, RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2 and TM6SF1.

[0246] Embodiment 208: The cartridge of Embodiment 207, wherein said chamber containing beads that place PCR primers and probes for methylation of one or more gene promoters contains beads that place PCR primers and probes for methylation BRCA1 promoter.

[0247] Embodiment 209: The cartridge of any one of embodiments 207-208, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the RASSF1A promoter.

[0248] Embodiment 210: The cartridge of any one of embodiments 207-209, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the AKR1B1 promoter.

[0249] Embodiment 211: The cartridge of any one of embodiments 207-210, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the HOXB4 promoter.

[0250] Embodiment 212: The cartridge of any one of embodiments 207-211, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the HIST1H3C promoter.

[0251] Embodiment 213: The cartridge of any one of embodiments 207-212, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the RASGRF2 promoter.

[0252] Embodiment 214: The cartridge of any one of embodiments 207-213, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the TM6SF1 promoter.

[0253] Embodiment 215: The cartridge of any one of embodiments 207-214, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place one or more primers for PCR and/or one or more PCR probes shown in Tables 5 or 9.

[0254] Embodiment 216: The cartridge of embodiment 206, wherein said chamber, containing beads that place PCR primers and probes to detect methylation of one or more gene promoters, contains beads that place PCR primers and probes for methylation BRCA1 promoters.

[0255] Embodiment 217: The cartridge of any one of embodiments 190-200, wherein said chamber, containing beads that place PCR primers and probes for detecting methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining the methylation of one or more promoters of genes whose methylation status is a marker of lung cancer.

[0256] Embodiment 218: The cartridge of Embodiment 217, wherein said chamber containing beads that place PCR primers and probes for methylation of one or more gene promoters contains beads that place PCR primers and probes for methylation promoters of one, two, three or all genes selected from the group consisting of CDO1, SOX17, TAC1 and HOXA7.

[0257] Embodiment 219: The cartridge of Embodiment 218, wherein said chamber containing beads that place PCR primers and probes for methylation of one or more gene promoters contains beads that place PCR primers and probes for methylation the CDO1 promoter.

[0258] Embodiment 220: The cartridge of any one of embodiments 218-219, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the SOX17 promoter.

[0259] Embodiment 221: The cartridge of any one of embodiments 218-220, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the TAC1 promoter.

[0260] Embodiment 222: The cartridge of any one of embodiments 218-221, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the HOXA7 promoter.

[0261] Embodiment 223: The cartridge of any one of embodiments 190-200, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining the methylation of one or more promoters of genes whose methylation status is a marker of brain cancer.

[0262] Embodiment 224: The cartridge of Embodiment 223, wherein said chamber containing beads that place PCR primers and probes for methylation of one or more gene promoters contains beads that place PCR primers and probes for methylation MGMT promoter.

[0263] Embodiment 225: A cartridge according to embodiment 224, wherein said chamber containing beads that place PCR primers and probes for determining methylation of one or more gene promoters contains beads that place one or more PCR primers and/ or probes for MGMT presented in tables 5 or 10.

[0264] Embodiment 226: The cartridge of Embodiment 225, wherein said cartridge contains the following probes and primers to determine MGMT methylation using nested PCR:

[0265] outer forward primer (248b) containing the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO: 263);

[0266] outer reverse primer (249b) containing the nucleotide sequence AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO: 265);

[0267] internal forward primer (250) containing the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO: 266);

[0268] internal reverse primer (251) containing the nucleotide sequence GCACTCTTCCGAAAACGAAACG (SEQ ID NO: 267); and

[0269] probe (252a) containing the nucleotide sequence of fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAC blocker (SEQ ID NO: 268).

[0270] Embodiment 227: The cartridge of any one of embodiments 225-226, wherein said cartridge contains the following probes and primers to determine ASTB methylation (e.g., as a control) using nested PCR:

[0271] outer forward primer (102) containing the nucleotide sequence GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0272] outer reverse primer (103) containing the nucleotide sequence CCAATAAAAACSTACCSTSSTTAA (SEQ ID NO: 104);

[0273] internal forward primer (148) containing the nucleotide sequence GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0274] internal reverse primer (149) containing the nucleotide sequence CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0275] a probe (178) containing the nucleotide sequence of the fluorophore-CCACCASSCAACACA(N*)CAA(T*)AACAAAACAC blocker (SEQ ID NO: 179).

[0276] Embodiment 228: A method for preparing a DNA sample from serum or plasma, which includes:

[0277] mixing a serum or plasma sample treated with proteinase K with a lyse solution according to any of the embodiments of 169-171 and with alcohol to form a sample solution;

[0278] loading said sample solution into a cartridge sample receiving chamber according to any one of embodiments 143-154 or into a cartridge sample receiving chamber according to any one of embodiments 155-168; and

[0279] operating said cartridge to bind DNA in said sample to said affinity matrix and then wash and isolate said DNA from said matrix.

[0280] Embodiment 229: The method of Embodiment 228 wherein said pooling of proteinase K treated serum or plasma sample comprises combining said sample, lyse, and alcohol in ratios corresponding to up to about 1.3 ml proteinase K treated serum or plasma , 2.2 ml of lyse solution and approximately 1.5 ml of alcohol.

[0281] Embodiment 230: The method of any one of embodiments 228-229, wherein said alcohol comprises isopropanol.

[0282] Embodiment 231: The method of any one of embodiments 228-230, wherein said sample contains serum.

[0283] Embodiment 232: The method of any one of embodiments 228-231, wherein said sample contains plasma.

[0284] Embodiment 233: The method of any one of embodiments 228-232, wherein said sample contains serum.

[0285] Embodiment 234: The method of any one of embodiments 228-233, wherein operating said cartridge includes placing said cartridge inside a sample processing module in the system of any one of embodiments 133-139.

[0286] Embodiment 235: The method of any one of embodiments 228-234, wherein said method further comprises operating said cartridge to convert said DNA to determine methylation.

[0287] Embodiment 236: The method of any one of embodiments 228-235, wherein said method further comprises operating said cartridge to perform one or more PCRs using said DNA or converted DNA as a template.

[0288] Embodiment 237: The method of any one of embodiments 228-234, wherein said loading comprises loading said sample solution within one or more sample receiving chambers in a cartridge of any one of embodiments 155-165.

[0289] Embodiment 238: The method of Embodiment 237, wherein said method further comprises transferring the isolated DNA to a second methylation and/or PCR cartridge.

[0290] Embodiment 239: The method of Embodiment 238, wherein said second cartridge is the cartridge of any one of Embodiments 92-132.

[0291] Embodiment 240: The method of any one of embodiments 238-239, wherein said method further comprises operating said second cartridge to convert said DNA to determine methylation.

[0292] Embodiment 241: The method of any one of embodiments 238-240, wherein said method further comprises operating said second cartridge to perform one or more PCRs using said DNA or converted DNA as a template.

[0293] Embodiment 242: The method of any one of embodiments 238-241, wherein said controlling the second cartridge includes placing said second cartridge inside a sample preparation module in the system of any one of embodiments 133-139.

[0294] Embodiment 243: A method for obtaining DNA from a FFPE sample, comprising:

[0295] combining a formalin-fixed and paraffin-embedded sample with a lyse solution according to any one of embodiments 172-174;

[0296] heating said lysis solution containing said sample; adding alcohol to said sample to form a sample solution; loading said sample solution into a sample receiving chamber in a cartridge according to any one of embodiments 143-154, or into a sample receiving chamber in a cartridge according to any one of embodiments 155-168; and

[0297] operating said cartridge to bind DNA in said sample to said affinity matrix and then washing and isolating said DNA from said matrix.

[0298] Embodiment 244: The method of Embodiment 243, wherein said heating comprises adding proteinase K to said sample and heating said sample.

[0299] Embodiment 245: The method of Embodiment 244, wherein said heating comprises adding about 50 µl of proteinase K to about 1.2 ml of FFPE lyse containing the FFPE sample.

[0300] Embodiment 246: The method of any one of embodiments 243-245, wherein said heating comprises heating said lyse solution to a temperature in the range of about 50°C to about 60°C.

[0301] Embodiment 247: The method of Embodiment 246 wherein said heating comprises heating said lyse to a temperature of about 56°C.

[0302] Embodiment 248: The method of any one of embodiments 243-247, wherein said heating is carried out for a period of time ranging up to about 4 hours, or up to about 5 hours, or up to about 6 hours.

[0303] Embodiment 249: The method of Embodiment 248, wherein said heating is carried out for about 4 hours.

[0304] Embodiment 250: The method of any one of embodiments 243-249, wherein said alcohol comprises ethanol.

[0305] Embodiment 251: The method of any one of embodiments 243-250, wherein said method comprises adding alcohol to said lyse in a lyse:alcohol volume ratio of about 1:1.

[0306] Embodiment 252: The method of any one of embodiments 243-251 wherein operating said cartridge includes placing said cartridge inside a sample processing module in the system of any one of embodiments 133-139.

[0307] Embodiment 253: The method of any one of embodiments 243-252, wherein said method further comprises operating said cartridge to convert said DNA to determine methylation.

[0308] Embodiment 254: The method of any one of embodiments 243-253, wherein said method further comprises operating said cartridge to perform one or more PCRs using said DNA or converted DNA as a template.

[0309] Embodiment 255: The method of any one of embodiments 243-251, wherein said loading comprises loading said sample solution within one or more sample receiving chambers in a cartridge of any one of embodiments 155-165.

[0310] Embodiment 256: The method of Embodiment 255, wherein the method further comprises transferring the isolated DNA to a second methylation and/or PCR cartridge.

[0311] Embodiment 257: The method of Embodiment 256, wherein said second cartridge is the cartridge of any one of Embodiments 92-132.

[0312] Embodiment 258: The method of any one of embodiments 256-257, wherein said method further comprises operating said second cartridge to convert said DNA to determine methylation.

[0313] Embodiment 259: The method of any one of embodiments 256-258, wherein said method further comprises operating said second cartridge to perform one or more PCRs using said DNA or converted DNA as a template.

[0314] Embodiment 260: The method of any one of embodiments 256-259, wherein said operating the second cartridge includes placing said second cartridge within a sample processing module in the system of any one of embodiments 133-139.

[0315] Embodiment 261: A method for detecting (detecting) cancer and/or determining the extent of cancer and/or detecting a predisposition to cancer in a subject, which includes:

[0316] obtaining a biological sample from the specified subject, and the specified biological sample contains DNA;

[0317] the use of a cartridge according to any one of paragraphs. 190-225 to determine the methylation of one or more gene promoters in the specified DNA, the methylation status of which is a marker of cancer, while an increase in methylation of the specified one or more gene promoters is an indicator of the presence of cancer, or a predisposition to cancer, or at the stage of cancer or a precancerous condition.

[0318] Embodiment 262: The method of Embodiment 261, wherein said subject is a human.

[0319] Embodiment 263: The method of any one of embodiments 261-262, wherein said cancer is a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, lung cancer, B -cell lymphoma, bronchial cancer, colorectal cancer, stomach cancer, ovarian cancer, bladder cancer, brain or central nervous system cancer, cancer of the peripheral nervous system, esophageal cancer, cervical cancer, melanoma, uterine or endometrial cancer, oral cavity cancer, or pharynx, liver cancer, kidney cancer, bile duct cancer, cancer of the small intestine or appendix, salivary gland cancer, thyroid cancer, adrenal cancer, osteosarcoma, chondrosarcoma, liposarcoma, testicular cancer, and malignant fibrous histiocytoma.

[0320] Embodiment 264: The method of any one of embodiments 261-262, wherein said cancer is a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, lung cancer.

[0321] Embodiment 265: The method of any one of embodiments 261-264, wherein said sample comprises a serum or plasma sample.

[0322] Implementation 266: The method of any one of embodiments 261-264, wherein said sample includes a FFPE sample.

[0323] Embodiment 267: The method of any one of embodiments 261-266, wherein said one or more promoters of a gene include promoters of one or more genes selected from the group consisting of RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, TM6SF1, BRCA1, BNC1, ADAMTS1, CDO1, SOX17, TAC1, HOXA7 and MGMT.

[0324] Embodiment 268: The method of any one of embodiments 261-266, wherein said cancer is pancreatic cancer and said one or more gene promoters include promoters of one, two, three, or four genes selected from the group consisting of from ADAMTS1 and BNC1.

[0325] Embodiment 269: The method of Embodiment 268, wherein said one or more promoters of the gene include ADAMTS1 promoters.

[0326] Embodiment 270: The method of any one of embodiments 268-269, wherein said one or more promoters of the gene include BNC1 promoters.

[0327] Embodiment 271: The method of any one of embodiments 261-266 wherein said cancer is breast cancer and said one or more gene promoters include promoters for one, two, three, four, five, or all of the genes selected from the group consisting of BRCA1, RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2 and TM6SF1.

[0328] Embodiment 272: The method of Embodiment 271, wherein said one or more promoters of the gene include BRCA1 promoters.

[0329] Embodiment 273: The method of any one of embodiments 271-272, wherein said one or more promoters of the gene include RASSF1A promoters.

[0330] Embodiment 274: The method of any one of embodiments 271-273, wherein said one or more promoters of the gene include AKR1B1 promoters.

[0331] Embodiment 275: The method of any one of embodiments 271-274, wherein said one or more promoters of the gene include HOXB4 promoters.

[0332] Embodiment 276: The method of any one of embodiments 271-275, wherein said one or more promoters of the gene include the HIST1H3C promoters.

[0333] Embodiment 277: The method of any one of embodiments 271-276, wherein said one or more promoters of the gene include RASGRF2 promoters.

[0334] Embodiment 278: The method of any one of embodiments 271-277, wherein said one or more promoters of the gene include TM6SF1 promoters.

[0335] Embodiment 279: The method of any one of embodiments 261-266, wherein said cancer is breast cancer and said one or more gene promoters include BRCA1 promoters.

[0336] Embodiment 280: The method of any one of embodiments 261-266 wherein said cancer is lung cancer and said one or more gene promoters include promoters for one, two, three or all of the genes selected from the group consisting of CDO1, SOX17, TAC1 and HOXA7.

[0337] Embodiment 281: The method of Embodiment 280, wherein said one or more promoters of the gene include CDO1 promoters.

[0338] Embodiment 282: The method of any one of embodiments 280-281, wherein said one or more promoters of the gene include SOX17 promoters.

[0339] Embodiment 283: The method of any one of embodiments 280-282, wherein said one or more promoters of the gene include TAC1 promoters.

[0340] Embodiment 284: The method of any one of embodiments 280-283, wherein said one or more promoters of the gene include the HOXA7 promoters.

[0341] Embodiment 285: The method of any one of embodiments 261-266, wherein said cancer is brain cancer and said one or more promoters of the gene include MGMT promoters.

[0342] Embodiment 286: Method for converting cytosine residues to uracil in DNA while leaving 5-methylcytosine residues substantially unaffected; said method includes:

[0343] contacting a sample containing DNA with 1,4-diazabicyclo[2.2.2]-octane (DABSO) to convert said DNA;

[0344] desulfurizing the converted DNA to produce DNA in which cytosine residues are modified to uracil but 5-methylcytosine residues are substantially unaffected.

[0345] Embodiment 287: The method of Embodiment 286, wherein said contacting comprises contacting said DNA with DABSO at a concentration ranging from about 2M to about 5M, inclusive.

[0346] Embodiment 288: The method of embodiment 286 wherein said contacting comprises contacting said DNA with DABSO at a concentration of about 2.5 M.

[0347] Embodiment 289: The method of any one of embodiments 286-288 wherein said DABSO is dissolved in an aqueous alkaline solution.

[0348] Embodiment 290: The method of Embodiment 289 wherein said DABSO is dissolved in a solution containing KOH.

[0349] Embodiment 291: The method of any one of embodiments 286-290, wherein said contacting comprises heating the DABSO/DNA solution to a temperature in the range of about 55°C to about 90°C.

[0350] Embodiment 292: The method of any one of embodiments 286-291, wherein said DABSO is contacted with DNA for a period of time ranging from about 15 minutes to about 90 minutes, inclusive.

[0351] Embodiment 293: The method of any one of embodiments 286-292, wherein said desulfurization comprises contacting said converted DNA with an alkaline reagent.

[0352] Embodiment 294: The method of Embodiment 293, wherein said alkaline reagent contains KOH.

[0353] Embodiment 295: The method of any one of embodiments 286-294, wherein said conversion and/or desulfurization is performed on DNA bound to a column.

[0354] Embodiment 296: The method of any one of embodiments 286-294, wherein said conversion and/or desulfurization is performed with DNA in solution.

[0355] Embodiment 297: A method for analyzing DNA methylation, comprising:

[0356] providing a DNA sample;

[0357] the conversion of DNA in the specified sample according to any of the implementation options 286-296; and

[0358] performing methylation-specific PCR and/or nucleic acid sequencing and/or high precision melting curve analysis (HRM) on the converted nucleic acid to determine the methylation of said nucleic acid.

[0359] Embodiment 298: The method of Embodiment 297, wherein said obtaining a DNA sample comprises preparing a sample according to any of Embodiments 228-234 or any of Embodiments 243-252.

[0360] Embodiment 299: DNA methylation status kit, comprising:

[0361] a container containing a conversion reagent containing 1,4-diazabicyclo[2.2.2]-octane (DABSO); and

[0362] A container containing a desulfurization reagent.

[0363] Implementation 300: a set according to implementation 299, where said set contains a column containing an affine matrix.

[0364] Embodiment 301: The kit of any one of embodiments 299-300, wherein said kit includes a container containing a binding buffer.

[0365] Embodiment 302: The kit of any one of embodiments 299-301, wherein said kit includes a container containing an elution buffer.

[0366] Embodiment 303: The kit of any one of embodiments 299-302, wherein said kit includes a container containing a wash buffer.

[0367] Embodiment 304: The kit of any one of embodiments 299-303, wherein said kit includes a container containing a lyse of any of embodiments 169-171 and/or a container containing a lyse of any of embodiments 172-174 .

[0368] Embodiment 305: A kit of any one of embodiments 299-304, wherein said kit comprises a cartridge of any of embodiments 143-155 and/or a cartridge of any of embodiments 155-166.

[0369] Embodiment 306: The kit of any one of embodiments 299-305, including instructional materials for training in the use of said nucleic acid conversion kit to determine the methylation status of said nucleic acid.

[0370] Embodiment 307: A primer and probe kit for MGMT methylation detection using nested PCR, wherein said kit contains the following primers and probes:

[0371] an outer forward primer containing the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO: 263);

[0372] an outer reverse primer containing the nucleotide sequence AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO: 265);

[0373] an internal forward primer containing the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO: 266);

[0374] an internal reverse primer containing the nucleotide sequence GCACTCTTCCGAAAACGAAACG (SEQ ID NO: 267); and

[0375] a probe containing the nucleotide sequence of a fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAC blocker (SEQ ID NO: 268).

[0376] Embodiment 308: A set of primers and probes for determining ASTB methylation (for example, as a control) using a nested PCR, in which the specified set contains the following primers and probes:

[0377] outer forward primer (102) containing the nucleotide sequence GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0378] outer reverse primer (103) containing the nucleotide sequence CCAATAAAAACSTACCSTSSTTAA (SEQ ID NO: 104);

[0379] internal forward primer (148) containing the nucleotide sequence GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0380] internal reverse primer (149) containing the nucleotide sequence CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0381] probe (178) containing the nucleotide sequence of the fluorophore-SSACCASSCAACACA(N*)CAA(T*)AACAAAACAC blocker (SEQ ID NO: 179).

[0382] Embodiment 309: Primer and probe kit for MGMT methylation using nested PCR with ACTV methylation as control, containing primers and probes according to Embodiment 307 and primers and probes according to Embodiment 308.

[0383] Embodiment 310: A method for determining MGMT methylation using methylation-specific PCR, which includes:

[0384] obtaining converted (for example, converted by bisulfite) DNA containing the promoter region of the MGMT gene;

[0385] performing a methylation-specific PCR for MGMT methylation using a nested PCR containing the following primers and probes:

[0386] an outer forward primer containing the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO: 263);

[0387] an outer reverse primer containing the nucleotide sequence AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO: 265);

[0388] an internal forward primer containing the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO: 266);

[0389] an internal reverse primer containing the nucleotide sequence GCACTCTTCCGAAAACGAAACG (SEQ ID NO: 267); and

[0390] a probe containing the nucleotide sequence of a fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAAC blocker (SEQ ID NO: 268); and

[0391] detecting and/or quantifying the PCR amplification product to determine the methylation of said MGMT gene.

[0392] Embodiment 311: The method of Embodiment 310, wherein said method further comprises:

[0393] obtaining converted (eg, converted with bisulfite) DNA containing the ACTV gene promoter region (eg, as a control);

[0394] performing a methylation-specific PCR for ASTB methylation using a nested PCR containing the following primers and probes:

[0395] an outer forward primer containing the nucleotide sequence GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0396] an outer reverse primer containing the nucleotide sequence CCAATAAAAASSTACCSTSSTTAA (SEQ ID NO: 104);

[0397] an internal forward primer containing the nucleotide sequence GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0398] an internal reverse primer containing the nucleotide sequence CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0399] a probe containing the nucleotide sequence of a fluorophore-CCACCASSCAACACA(N*)CAA(T*)AACAAAACAC-blocker (SEQ ID NO: 179); and

[0400] detecting and/or quantifying the PCR amplification product to determine the methylation of said ACTV gene.

[0401] Embodiment 312: The method of any one of embodiments 310-311, wherein said methylation-specific PCR for MGMT methylation and said methylation-specific PCR for ASTB methylation are performed as a single multiplex PCR.

[0402] Embodiment 313: The method of any of embodiments 310-312, wherein said methylation-specific PCR is performed using the cartridge of any of embodiments 92-132.

[0403] Embodiment 314: The method of embodiment 313, wherein said obtaining converted DNA containing MGMT gene promoter regions comprises introducing unconverted DNA containing MGMT gene promoter regions into said cartridge and operating said cartridge to convert said DNA in said cartridge using a conversion reagent; and/or said production of converted DNA containing ACTB gene promoter regions includes introducing unconverted DNA containing ACTB gene promoter regions into said cartridge and operating said cartridge to convert said DNA in said cartridge using a conversion reagent.

[0404] Embodiment 315: The method of Embodiment 314, wherein said conversion reagent comprises a compound selected from the group consisting of ammonium bisulfite, sodium metabisulfite, potassium bisulfite, cesium bisulfite, and 1,4-diazabicyclo[2.2.2] -octane (DABSO).

[0405] Embodiment 316: The method of any one of embodiments 313-315, wherein said operating said cartridge includes heating said DNA and said conversion reagent in a thermal cycling channel or chamber, which is then used to perform said nested PCR.

[0406] Embodiment 317: Nucleic acid methylation status cartridge kit, comprising:

[0407] a sample receiving chamber;

[0408] a column containing the first matrix material;

[0409] a channel or chamber with temperature control;

[0410] a sampling chamber; and

[0411] a plurality of chambers containing reagents and/or buffers, where during use at least one of said chambers contains a bisulfite reagent; and

[0412] the second cartridge containing:

[0413] a sample receiving chamber;

[0414] a column containing a second matrix material;

[0415] a channel or chamber with temperature control; and

[0416] a plurality of chambers containing reagents and/or buffers, where during use at least one of said chambers contains a reagent for desulfurization and/or elution.

[0417] Embodiment 318: A set of cartridges according to embodiment 317, wherein said temperature controlled channel or chamber in said first cartridge is a thermal cycling channel or chamber.

[0418] Embodiment 319: The cartridge set of any one of embodiments 317-318, wherein said temperature controlled channel or chamber in said second cartridge is a thermal cycling channel or chamber.

[0419] Embodiment 320: The cartridge kit of any one of embodiments 317-319, wherein said bisulfite reagent contains a compound selected from the group consisting of ammonium bisulfite, sodium metabisulfite, potassium bisulfite, cesium bisulfite, and 1,4-diazabicyclo[ 2.2.2]-octane (DABSO).

[0420] Embodiment 321: A set of cartridges according to embodiment 320 wherein said bisulfite reagent contains ammonium bisulfite.

[0421] Embodiment 322: The cartridge kit of any one of embodiments 317-321 wherein said bisulfite is present in a reactant mixture containing scavengers to prevent the oxidation of sulfites and/or catalysts.

[0422] Embodiment 323: A set of cartridges according to embodiment 322 wherein said bisulfite is present in a reactant mixture containing scavengers selected from the group consisting of Trolox and hydroquinone.

[0423] Embodiment 324: The cartridge kit of any of embodiments 322-323 wherein said bisulfite is present in a reactant mixture containing polyamines as catalysts.

[0424] Embodiment 325: A set of cartridges as in any one of embodiments 317-324 wherein said first cartridge is configured to add a bisulfite reagent to the cartridge at or near the time the sample is placed in the cartridge.

[0425] Embodiment 326: The cartridge set of any one of embodiments 317-325 wherein said bisulfite reagent is present as a component in one of said plurality of chambers in said first cartridge.

[0426] Implementation 327: a set of cartridges according to any one of paragraphs. 317-326, wherein said first matrix material and/or said second matrix material independently comprise a material selected from the group consisting of glass or silica, ion exchange resin, and hydroxyapatite.

[0427] Embodiment 328: A set of cartridges according to embodiment 327, wherein said first matrix material comprises glass fiber.

[0428] Implementation 329: a set of cartridges according to any one of paragraphs. 327-328, wherein said second matrix material comprises glass fiber.

[0429] Embodiment 330: A set of cartridges as in any one of embodiments 317-329, wherein said first cartridge includes two sample receiving chambers.

[0430] Implementation 331: a set of cartridges according to any one of paragraphs. 317-330, wherein at least one chamber comprising a plurality of chambers in said second cartridge contains PCR primers and/or PCR probes and/or PCR master mix.

[0431] Implementation 332: a set of cartridges according to any one of paragraphs. 317-331, wherein if said cartridge is in use, then the chamber containing the plurality of chambers in said first cartridge contains GTC-EtOH in buffer.

[0432] Implementation 333: a set of cartridges according to any one of paragraphs. 317-332, wherein if said cartridge is in use, then the chamber containing the plurality of chambers in said second cartridge contains GTC-EtOH in buffer.

[0433] Implementation 334: a set of cartridges according to any one of paragraphs. 332-333, wherein said first cartridge is configured to be added to the GTC-ETOH buffer at or near the time the sample is placed in the cartridge.

[0434] Implementation 335: a set of cartridges according to any one of paragraphs. 332-333, wherein said GTC-ETOH in buffer is present as a component in a chamber containing a plurality of chambers of the first cartridge.

[0435] Implementation 336: a set of cartridges according to any one of paragraphs. 332-335 wherein said second cartridge is configured to add GTC-ETOH to the buffer at or near the time the sample is placed in the cartridge.

[0436] Implementation 337: a set of cartridges according to any one of paragraphs. 332-336, in which the specified GTC-ETOH in buffer is presented as a component in a chamber containing a plurality of chambers of the second cartridge.

[0437] Embodiment 338: The cartridge kit of any one of embodiments 317-337, wherein said second cartridge includes one or more chambers containing one or more reagents selected from the group consisting of methylation-specific PCR primers specific for methylation of PCR probes, PCR enzyme(s) and PCR reaction buffer.

[0438] Embodiment 339: A set of cartridges according to embodiment 338, wherein said second cartridge includes at least two chambers containing one or more reagents selected from the group consisting of methylation-specific PCR primers, methylation-specific probes for PCR, PCR enzyme(s) and PCR reaction buffer.

[0439] Embodiment 340: The cartridge kit of any one of embodiments 317-339, wherein said second cartridge includes at least one chamber containing primers and probes for detecting forward strand methylation of the converted DNA.

[0440] Embodiment 341: The cartridge kit of any one of embodiments 317-340, wherein said second cartridge contains at least one chamber containing primers and probes for detecting reverse strand methylation of the converted DNA.

[0441] Embodiment 342: The cartridge kit of any one of embodiments 338-341 wherein said PCR primers and/or probes and/or enzymes are presented on beads.

[0442] Embodiment 343: The cartridge kit of any one of embodiments 317-342, wherein:

[0443] in said first cartridge, said sample receiving chamber, said column, said plurality of chambers, said sample withdrawal chamber, and said temperature controlled heating channel or chamber have a selective fluid connection; and/or

[0444] In said second cartridge, said sample receiving chamber, said column, said plurality of chambers, and said temperature controlled heating channel or chamber have a fluid selective connection.

[0445] Embodiment 344: A set of cartridges according to Embodiment 343, in which

[0446] in said first cartridge, said sample receiving chamber, said column, said plurality of chambers, said sample withdrawal chamber, and said temperature controlled channel or chamber are fluidly selectively connected by microfluidic channels and valves; and/or

[0447] In said second cartridge, said sample receiving chamber, said column, said plurality of chambers, and said temperature-controlled heating channel or chamber are fluidly selectively connected by microfluidic channels and valves.

[0448] Embodiment 345: A set of cartridges according to Embodiment 343, in which

[0449] in said first cartridge, said sample receiving chamber, said column, said plurality of chambers, said sample withdrawal chamber, and said temperature-controlled channel or chamber, or a port in said temperature-controlled channel or chamber, are located around a central valve and are selectively connected along a fluid with a channel in said central valve, wherein said central valve is configured to receive a piston capable of drawing fluid into or out of the chamber when in fluid communication with said central valve; and/or

[0450] in said second cartridge, said sample receiving chamber, said column, said plurality of chambers, and said temperature-controlled heating channel or chamber, or a port in said temperature-controlled channel or chamber, are located around a central valve and have a selective fluid connection with a channel in said central valve, wherein said central valve is configured to receive a piston capable of withdrawing liquid into or out of the chamber when in fluid communication with said central valve.

[0451] Embodiment 346: A set of cartridges as in any one of embodiments 317-345, wherein said first cartridge is configured to, during use, include:

[0452] the first chamber containing the sample;

[0453] a second chamber containing a solution of guanidine thiocyanate-ethanol (GTC-EtOH);

[0454] a third chamber containing a bisulfite reagent;

[0455] a fourth chamber containing Tris buffer;

[0456] a fifth chamber containing polyethylene glycol (PEG); and

[0457] the sixth chamber containing KOH.

[0458] Embodiment 347: A set of cartridges according to embodiment 346 wherein said first chamber in said first cartridge contains said sample in the GTC-EtOH-Tween extraction/precipitation reagent.

[0459] Embodiment 348: The cartridge kit of any of embodiments 346-347, wherein said second chamber containing guanidine thiocyanate-ethanol (GTC-EtOH) solution contains GTC-Tris (pH 7), ethanol.

[0460] Embodiment 349: A set of cartridges as in any one of embodiments 317-336, wherein said second cartridge is configured to, during use, include:

[0461] the first chamber containing the sample;

[0462] a second chamber containing a solution of guanidine thiocyanate-ethanol (GTC-EtOH);

[0463] a third chamber containing a bisulfite reagent;

[0464] a fourth chamber containing polyethylene glycol (PEG);

[0465] the fifth chamber containing KOH; and

[0466] the sixth chamber containing the PCR enzyme bead.

[0467] Embodiment 350: A set of cartridges according to embodiment 349, wherein said second cartridge comprises a seventh chamber containing a Tris bead and an enzyme bead.

[0468] Embodiment 351: The cartridge kit of any of embodiments 349-350 wherein said second chamber containing guanidine thiocyanate-ethanol (GTC-EtOH) solution contains GTC-Tris (pH 7), ethanol.

[0469] Embodiment 352: The cartridge kit of any one of embodiments 317-351, wherein said second cartridge includes a chamber containing PCR primers and/or probes and/or PCR enzymes.

[0470] Embodiment 353: The cartridge kit of any one of embodiments 317-352, wherein said second cartridge contains an eighth chamber also containing PCR primers and/or probes and/or PCR enzymes.

[0471] Embodiment 354: The cartridge kit of any one of embodiments 317-353, wherein said second cartridge includes one or more chambers containing primers specific for bisulfite-converted methylated and/or unmethylated sequences.

[0472] Embodiment 355: The cartridge kit of any one of embodiments 317-354, wherein said second cartridge includes one or more chambers containing TaqMan PCR reagents.

[0473] Embodiment 356: The cartridge kit of any one of embodiments 317-355, wherein said second cartridge includes one or more chambers containing one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences.

[0474] Embodiment 357: A set of cartridges according to embodiment 356 wherein said probes contain a fluorescent reporter dye and a quench dye, wherein the probe generates a cleavage signal via the 5'-3' nuclease activity of Taq DNA polymerase.

[0475] Embodiment 358: The cartridge set of any one of embodiments 356-357, wherein said second cartridge contains a plurality of probes, each specific for a different methylated site in the amplified region of interest.

[0476] Embodiment 359: The cartridge set of any one of embodiments 356-357, wherein said second cartridge contains one probe specific for one methylated site in the amplified region of interest.

[0477] Embodiment 360: A set of cartridges as in any one of embodiments 356-357, wherein said second cartridge contains a plurality of probes, each specific for the same methylated site in the amplified region of interest.

[0478] Embodiment 361: A set of cartridges according to any one of embodiments 317-360, wherein said second cartridge contains primers and/or probes for determining the methylation of the promoter region of a gene selected from the group consisting of MGMT, RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1 and AKR1B1.

[0479] Embodiment 362: A set of cartridges according to any one of embodiments 317-360, wherein said second cartridge contains one or more of the primers shown in Tables 5, 9, or 10 and/or one or more probes shown in Tables 5 , 9 or 10.

[0480] Embodiment 363: The cartridge kit of Embodiment 362, wherein said second cartridge contains the following probes and primers to determine MGMT methylation using nested PCR:

[0481] outer forward primer (248b) containing the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO: 263);

[0482] outer reverse primer (249b) containing the nucleotide sequence: AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO: 265);

[0483] internal forward primer (250) containing the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO: 266);

[0484] internal reverse primer (251) containing the nucleotide sequence GCACTCTTCCGAAAACGAAACG (SEQ ID NO: 267); and

[0485] probe (252a) containing the nucleotide sequence of fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAC-blocker (SEQ ID NO: 268).

[0486] Embodiment 364: The cartridge kit of any of embodiments 362-363, wherein said second cartridge contains the following probes and primers to determine ASTB methylation (e.g., as a control) using nested PCR:

[0487] outer forward primer (102) containing the nucleotide sequence GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0488] outer reverse primer (103) containing the nucleotide sequence CCAATAAAAACSTACCSTSSTTAA (SEQ ID NO: 104);

[0489] internal forward primer (148) containing the nucleotide sequence GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0490] internal reverse primer (149) containing the nucleotide sequence CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO: 150); and

[0491] probe (178) containing the nucleotide sequence of the fluorophore-CCACCACCCAACACA(N*)CAA(T*)AACAAAACAC-blocker (SEQ ID NO: 179).

[0492] Embodiment 365: A set of cartridges as in any one of embodiments 317-360, wherein said second cartridge includes one or more chambers containing beads that place PCR primers and probes to determine methylation of one or more gene promoters.

[0493] Embodiment 366: A set of cartridges according to embodiment 365, wherein said second cartridge includes one or more chambers containing beads that place PCR primers and probes to determine the methylation of one or more promoters of genes whose methylation status is a cancer marker selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer and lung cancer.

[0494] Embodiment 367: A set of cartridges according to any one of embodiments 365-366, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining methylation of one or more promoters of genes whose methylation status is a cancer marker selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, and lung cancer.

[0495] Embodiment 368: A set of cartridges according to embodiment 367, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and nested probes. PCR.

[0496] Embodiment 369: The cartridge kit of Embodiment 368, wherein said nested PCR comprises a first PCR specific for converted DNA and a second PCR specific for methylated CpGs.

[0497] Embodiment 370: A set of cartridges according to any one of embodiments 349-369, wherein said chamber, containing beads that place PCR primers and probes, contains beads that place PCR primers and probes for detecting forward strand methylation of the converted DNA.

[0498] Embodiment 371: A set of cartridges according to any one of embodiments 349-370, wherein said chamber, containing beads that accommodate PCR primers and probes, contains beads that carry PCR primers and probes for detecting reverse strand methylation of the converted DNA.

[0499] Embodiment 372: A set of cartridges according to any one of embodiments 349-371, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting promoter methylation of one or more genes selected from the group consisting of RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, TM6SF1, BRCA1, BNC1, ADAMTS1, CDO1, SOX17, TAC1, HOXA7, and MGMT.

[0500] Embodiment 373: A set of cartridges according to any one of embodiments 349-372, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining the methylation of one or more promoters of genes whose methylation status is a marker of pancreatic cancer.

[0501] Embodiment 374: A set of cartridges according to embodiment 373, wherein said chamber, containing beads that place PCR primers and probes for detecting methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting methylation of ADAMTS1 and/or BNC1 promoters.

[0502] Embodiment 375: A set of cartridges according to embodiment 374, wherein said chamber, containing beads that place PCR primers and probes for detecting methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting methylation of the ADAMTS1 promoter.

[0503] Embodiment 376: A set of cartridges according to any one of embodiments 374-375, wherein said chamber containing beads that place PCR primers and probes for determining methylation of one or more gene promoters contains beads that place PCR primers and probes to determine the methylation of the BNC1 promoter.

[0504] Embodiment 377: A set of cartridges according to embodiment 374, wherein said chamber containing beads that place PCR primers and probes for determining methylation of one or more gene promoters contains beads that place one or more PCR primers and /or probes for ADAMTS1 and/or BNC1, which are presented in tables 5 or 10.

[0505] Embodiment 378: A set of cartridges according to any one of embodiments 349-372, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining the methylation of one or more promoters of genes whose methylation status is a marker of breast cancer.

[0506] Embodiment 379: A set of cartridges according to embodiment 378, wherein said chamber, containing beads that place PCR primers and probes for detecting methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting methylation of promoters of one, two, three, four, five or all genes selected from the group consisting of BRCA1, RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2 and TM6SF1.

[0507] Embodiment 380: A set of cartridges according to embodiment 379, wherein said chamber, containing beads that place PCR primers and probes for detecting methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting methylation of the BRCA1 promoter.

[0508] Embodiment 381: A set of cartridges as in any one of embodiments 379-380, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to detect methylation of the RASSF1A promoter.

[0509] Embodiment 382: A set of cartridges according to any one of embodiments 379-381, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to detect methylation of the AKR1B1 promoter.

[0510] Embodiment 383: A set of cartridges according to any one of embodiments 379-382, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to detect methylation of the HOXB4 promoter.

[0511] Embodiment 384: A set of cartridges according to any one of embodiments 379-383, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting methylation of the HIST1H3C promoter.

[0512] Embodiment 385: A set of cartridges according to any one of embodiments 379-384, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to detect methylation of the RASGRF2 promoter.

[0513] Embodiment 386: A set of cartridges according to any one of embodiments 379-385, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the TM6SF1 promoter.

[0514] Embodiment 387: A set of cartridges according to any one of embodiments 379-386, wherein said chamber, containing beads that accommodate PCR primers and probes for determining methylation of one or more gene promoters, contains beads that accommodate one or more primers for PCR and/or one or more probes for PCR, which are presented in tables 5 or 9.

[0515] Embodiment 388: A set of cartridges according to embodiment 378, wherein said chamber, containing beads that place PCR primers and probes for detecting methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting methylation of BRCA1 promoters.

[0516] Embodiment 389: A set of cartridges according to any one of embodiments 349-372, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining the methylation of one or more promoters of genes whose methylation status is a marker of lung cancer.

[0517] Embodiment 390: A set of cartridges according to embodiment 389, wherein said chamber, containing beads that place PCR primers and probes for detecting methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting methylation of the promoters of one, two, three or all genes selected from the group consisting of CDO1, SOX17, TAC1 and HOXA7.

[0518] Embodiment 391: A set of cartridges according to embodiment 390, wherein said chamber, containing beads that place PCR primers and probes for detecting methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting methylation of the CDO1 promoter.

[0519] Embodiment 392: A set of cartridges according to any one of embodiments 390-391, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes to determine the methylation of the SOX17 promoter.

[0520] Embodiment 393: A set of cartridges according to any one of embodiments 390-392, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining methylation of the TAC1 promoter.

[0521] Embodiment 394: A set of cartridges according to any one of embodiments 390-393, wherein said chamber containing beads that place PCR primers and probes for determining methylation of one or more gene promoters contains beads that place PCR primers and probes for detecting methylation of the HOXA7 promoter.

[0522] Embodiment 395: A set of cartridges according to any one of embodiments 349-372, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place PCR primers and probes for determining the methylation of one or more promoters of genes whose methylation status is a marker of brain cancer.

[0523] Embodiment 396: A set of cartridges according to embodiment 395, wherein said chamber, containing beads that place PCR primers and probes for detecting methylation of one or more gene promoters, contains beads that place PCR primers and probes for detecting methylation of the MGMT promoter.

[0524] Embodiment 397: A set of cartridges according to embodiment 396, wherein said chamber, containing beads that place PCR primers and probes for determining methylation of one or more gene promoters, contains beads that place one or more PCR primers and /or MGMT probes presented in tables 5 or 10.

[0525] Embodiment 398: A set of cartridges according to embodiment 397, wherein said cartridge contains the following probes and primers to determine MGMT methylation using nested PCR:

[0526] outer forward primer (248b) containing the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO: 263);

[0527] outer reverse primer (249b) containing the nucleotide sequence AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO: 265);

[0528] internal forward primer (250) containing the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO: 266);

[0529] internal reverse primer (251) containing the nucleotide sequence GCACTCTTCCGAAAACGAAACG (SEQ ID NO: 267); and

[0530] probe (252a) containing the nucleotide sequence of fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAC blocker (SEQ ID NO: 268).

[0531] Embodiment 399: The cartridge kit of any of embodiments 397-398, wherein said cartridge contains the following probes and primers to determine ASTB methylation (e.g., as a control) using nested PCR:

[0532] outer forward primer (102) containing the nucleotide sequence:

[0533] GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 103);

[0534] outer reverse primer (103) containing the nucleotide sequence:

[0535] CCAAAAAAASTASSSSTSSSTTAA (SEQ ID NO: 104);

[0536] internal forward primer (148) containing the nucleotide sequence:

[0537] GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO: 149);

[0538] internal reverse primer (149) containing the nucleotide sequence:

[0539] CSTTAAAAAATTASAAAAAACCACAAC (SEQ ID NO: 150); and

[0540] probe (178) containing the nucleotide sequence:

[0541] Fluorophore-CCACCASSCAACACA(N*)CAA(T*)AACAAAACAC blocker (SEQ ID NO: 179).

[0542] Embodiment 400: a system for determining nucleic acid methylation in a biological sample, which includes:

[0543] a housing configured to receive one or more sample processing modules, where each sample processing module is configured to attach a removable first cartridge and/or second cartridge of said set of cartridges according to any one of embodiments 317-399;

[0544] wherein said system is configured to:

[0545] control of the sample processing modules to perform sample processing to control the first cartridge from the specified set of cartridges to ensure the bisulfite conversion of the nucleic acid in the sample that is introduced into the specified first cartridge and/or

[0546] performing desulfurization and determining methylation of one or more target nucleic acids within an appropriate removable sample cartridge.

[0547] Embodiment 401: The system of Embodiment 400, wherein said system is configured to accommodate one sample processing module.

[0548] Embodiment 402: The system of embodiment 400, wherein said system is configured to accommodate one or more sample processing modules, or at least 4 sample preparation modules, or at least 8 sample processing modules, or at least 12 modules sample processing modules, or at least 16 sample processing modules, or at least 20 sample processing modules, or at least 24 sample preparation modules, or at least 28 sample processing modules, or at least 32 sample preparation modules, or at least 64 sample preparation modules, or at least 128 sample processing modules.

[0549] Embodiment 403: The system of any one of embodiments 400-402, wherein said modules include one or more heating plates for heating a temperature controlled chamber or conduit in said cartridge.

[0550] Embodiment 404: The system of any one of embodiments 400-403, wherein said modules include a fan configured to cool a temperature controlled channel or chamber in said cartridge.

[0551] Embodiment 405: The system of any one of embodiments 400-404, wherein said modules include an electronic board for transmitting information (eg, optical information) to a computer for analysis.

[0552] Embodiment 406: The system of any one of embodiments 400-405, wherein said modules include optical units to excite and/or detect one or more optical signals generated by reactions in said cartridge.

[0553] Embodiment 407: The system of any one of embodiments 400-406, wherein said system is configured to control said first cartridge of said set of cartridges to:

[0554] sample binding on the column;

[0555] eluting the DNA from the column and combining said DNA with a conversion reagent;

[0556] heating the DNA solution/reagent to convert the solution in the reaction chamber or tube to obtain converted DNA; and

[0557] transferring the converted DNA to the sampling chamber in the first cartridge.

[0558] Embodiment 408: The system of any one of embodiments 400-407, wherein said system is configured to control said second cartridge in said set of cartridges to:

[0559] binding the converted DNA on the column;

[0560] washing, washing and eluting the converted DNA;

[0561] elution of DNA from the column; and

[0562] desulfurization of the converted DNA.

[0563] Embodiment 409: The system of embodiment 408, wherein said system is configured to control said second cartridge in said set of cartridges to perform PCR on the eluted desulfurized DNA in a reaction chamber or tube.

[0564] Embodiment 410: A method for determining the methylation status of a nucleic acid, which includes: placing a biological sample in a sample chamber of a first cartridge in said set of cartridges according to any one of embodiments 317-399; and managing said first cartridge to:

[0565] binding the DNA in said sample to said first template material;

[0566] washes of bound DNA; eluting the bound DNA from the template material; combining the eluted DNA with the specified bisulfite reagent;

[0567] heating a mixture of DNA and a bisulfite reagent in said temperature-controlled channel or chamber to perform a bisulfite conversion of said DNA; and

[0568] transferring the bisulfite-converted DNA into the sample withdrawal chamber of said first cartridge.

[0569] Embodiment 411: The method of Embodiment 410, wherein said method further comprises:

[0570] placing the bisulfite-converted DNA in the sample chamber of the second cartridge in the cartridge set of any one of embodiments 317-399; and

[0571] managing said second cartridge to:

[0572] linking said bisulfite-converted DNA to said second template material;

[0573] washes of bound bisulfite-converted DNA;

[0574] eluting the washed bisulfite-converted DNA from said second template material; and

[0575] desulfurization of bisulfite-converted DNA.

[0576] Embodiment 412: The method of Embodiment 411 wherein said second cartridge is operated to elute bisulfite-converted DNA from said second template material prior to desulfurization.

[0577] Embodiment 413: The method of Embodiment 411 wherein said second cartridge is operated to elute bisulfite-converted DNA from said second template material after or during desulfurization.

[0578] Embodiment 414: The method of any one of embodiments 411-413, wherein said method comprises operating said second cartridge to perform methylation-specific PCR and/or nucleic acid sequencing and/or high fidelity melt curve analysis (HRM) said nucleic acid to determine the methylation of said nucleic acid.

[0579] Embodiment 415: The method of any one of embodiments 410-414, wherein said sample includes one or more samples selected from the group consisting of cell, tissue, and body fluid containing nucleic acid.

[0580] Embodiment 416: The method of embodiment 415, wherein said biological sample comprises a biological fluid selected from the group consisting of whole blood, plasma, serum, saliva, mucus, urine, sputum, pancreatic juice, and cerebrospinal fluid.

[0581] Embodiment 417: The method of embodiment 415, wherein said biological sample comprises a sample selected from the group consisting of formalin-fixed, paraffin-embedded (FFPE) tissue sample, fresh frozen tissue, fine needle aspiration biopsy (FNA), and core needle biopsy. biopsy.

[0582] Embodiment 418: The method of any one of embodiments 410-417, wherein said method comprises contacting said biological sample with a lyse.

[0583] Embodiment 419: The method of any one of embodiments 410-418, wherein operating said first cartridge includes placing said first cartridge inside a sample processing module in the system of any one of embodiments 400-409.

[0584] Embodiment 420: The method of any one of embodiments 410-419, wherein operating said second cartridge includes placing said second cartridge inside a sample processing module in the system of any one of embodiments 400-409.

[0585] Embodiment 421: The method of any one of embodiments 410-420, wherein said placing a biological sample in a sample chamber of a first cartridge comprises loading a sample within one or more sample receiving chambers in said first cartridge.

[0586] Embodiment 422: The method of any one of embodiments 410-421, wherein said placing the bisulfite-converted DNA in the sample chamber of the second cartridge comprises transferring the bisulfite-converted DNA from the sample withdrawal chamber of said first cartridge to the inside of the sample receiving chamber of said second cartridge.

[0587] Embodiment 423: The method of any one of embodiments 410-422, wherein said eluting bound DNA in said first cartridge comprises eluting and denaturing said DNA using a low concentration of potassium hydroxide or other base.

[0588] Embodiment 424: The method of embodiment 423, wherein said eluting the bound DNA in said first cartridge comprises eluting and denaturing said DNA with an alkaline solution with a pH greater than about pH 10.5.

[0589] Embodiment 425: The method of embodiment 423, wherein said eluting the bound DNA in said first cartridge comprises eluting and denaturing said DNA with an alkaline solution with a pH greater than about pH 12.

[0590] Embodiment 426: The method of Embodiment 424-425 wherein said alkaline solution is a 10-15 mM KOH solution.

[0591] Embodiment 427: The method of any one of embodiments 410-426, wherein said combining the eluted DNA with a bisulfite reagent in said first cartridge comprises incubating the DNA in a solution of ammonium bisulfite at a concentration of about 6M to about 7M.

[0592] Embodiment 428: The method of embodiment 427 wherein said combining the eluted DNA with a bisulfite reagent in said first cartridge comprises incubating the DNA in an ammonium bisulfite solution having a concentration of about 6.5M.

[0593] Embodiment 429: The method of embodiment 428, wherein said combining eluted DNA with a bisulfite reagent in said first cartridge comprises transferring the DNA in a concentrated bisulfite solution into a temperature controlled channel or chamber in said first cartridge and heating said mixture.

[0594] Embodiment 430: The method of Embodiment 429, wherein said incubation comprises thermal cycling a concentrated bisulfite solution at a temperature of about 60°C to about 95°C.

[0595] Embodiment 431: The method of any one of embodiments 411-430, wherein said coupling bisulfite-converted DNA to a second template material comprises mixing a solution of DNA-bisulfite with freshly prepared GTC-EtOH in said second column, and dispensing the solution into said second matrix material.

[0596] Embodiment 432: The method of Embodiment 431, wherein said method comprises washing the DNA in said second template material with freshly prepared GTC-EtOH and then washing solution.

[0597] Embodiment 433: The method of Embodiment 432 wherein said wash solution contains PEG200.

[0598] Embodiment 434: The method of any one of embodiments 411-433, wherein said desulfurizing the converted DNA comprises eluting the DNA from said second template material along with a high pH desulfurization buffer and incubating said solution.

[0599] Embodiment 435: The method of embodiment 434, wherein said incubation lasts for a period of time ranging from about 1 minute to about 1 hour, or from about 5 minutes to about 30 minutes, or from about 10 minutes to about 20 minutes, or for about 15 minutes.

[0600] Embodiment 436: The method of Embodiments 434-435 wherein said high pH desulfurization/elution buffer contains KOH.

[0601] Embodiment 437: The method of any one of embodiments 411-436, wherein said method includes operating said second cartridge to perform one or more PCRs using said converted DNA as a template.

[0602] Embodiment 438: The method of Embodiment 437, wherein methylation-specific PCR is performed to determine methylation of a target nucleic acid sequence.

[0603] Embodiment 439: The method of embodiment 438, wherein said methylation-specific PCR (MSP) is performed using primers specific for methylated sequences and/or primers specific for unmethylated sequences.

[0604] Embodiment 440: The method of Embodiment 438, wherein said methylation-specific PCR includes the MethyLight protocol.

[0605] Embodiment 441: The method of Embodiment 438 wherein TaqMan PCR is performed using primers specific for bisulfite-converted methylated and/or unmethylated sequences.

[0606] Embodiment 442: The method of any one of embodiments 438-441 wherein said methylation-specific PCR (MSP) uses one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences.

[0607] Embodiment 443: The method of embodiment 442, wherein said fluorescent probes comprise a fluorescent reporter dye and a quenching dye, wherein the probe generates a cleavage signal through the 5'-3' nuclease activity of Taq DNA polymerase.

[0608] Embodiment 444: The method of any one of embodiments 442-443, wherein the methylation signal is determined from the combined signal of a plurality of probes, each specific for a different methylated site in the amplified region of interest.

[0609] Embodiment 445: The method of any one of embodiments 442-443 wherein the methylation signal is determined using multiple probes specific for the same methylated sites in the amplified region of interest.

[0610] Embodiment 446: The method of any one of embodiments 442-443, wherein said plurality of probes includes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more probes.

[0611] Embodiment 447: The method of any one of embodiments 442-443 wherein the methylation signal is measured with a single probe in the amplified region of interest.

[0612] Implementation 448: The method of any one of embodiments 442-447, wherein said probes are used in conventional or multiplex format.

[0613] Implementation 449: The method of any one of embodiments 442-447, wherein said probes are used in a multiplex format.

[0614] Embodiment 450: The method of any one of embodiments 442-449, wherein said probes are used for nested PCR.

[0615] Embodiment 451: The method of any one of embodiments 442-450, wherein said PCR reaction mixture contains a bisulfite contamination control sample in which, if bisulfite is present in the reaction mixture, bisulfite-driven cleavage occurs during PCR.

[0616] Embodiment 452: The method of any one of embodiments 411-451 wherein PCR is performed on one or more mutated genes.

[0617] Embodiment 453: The method of any one of embodiments 411-452 wherein PCR is performed on unconverted DNA as a control.

[0618] Embodiment 454: The method of any one of embodiments 411-453 wherein PCR is performed on the converted DNA as a control.

[0619] Embodiment 455: The method of Embodiment 453, wherein PCR is performed on unconverted DNA and the unconverted DNA is the target in said method.

[0620] Embodiment 456: The method of any one of embodiments 410-455, wherein methylation is determined for a promoter region of a gene selected from the group consisting of MGMT. RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1 and AKR1B1.

[0621] Embodiment 457: A method for detecting cancer or a predisposition to cancer in a subject, which includes:

[0622] obtaining a biological sample from the specified subject, while the specified biological sample contains DNA;

[0623] using the cartridge set of any one of embodiments 317-399, wherein said first cartridge of said cartridge set is used to perform a bisulfite conversion of said DNA; and said second cartridge of said set of cartridges is used to desulfurize the converted DNA and determine the methylation of one or more gene promoters in said DNA whose methylation status is a cancer marker, wherein an increase in methylation of said one or more gene promoters is an indicator of the presence of cancer, or a predisposition to cancer , or the stage of the cancer or precancerous condition.

[0624] Implementation 458: The method according to implementation 457, wherein said subject is a human.

[0625] Embodiment 459: The method of any one of embodiments 457-458, wherein said cancer is a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, lung cancer, B -cell lymphoma, bronchial cancer, colorectal cancer, stomach cancer, ovarian cancer, bladder cancer, brain or central nervous system cancer, cancer of the peripheral nervous system, esophageal cancer, cervical cancer, melanoma, uterine or endometrial cancer, oral cavity cancer, or pharynx, liver cancer, kidney cancer, bile duct cancer, cancer of the small intestine or appendix, salivary gland cancer, thyroid cancer, adrenal cancer, osteosarcoma, chondrosarcoma, liposarcoma, testicular cancer, and malignant fibrous histiocytoma.

[0626] Embodiment 460: The method of any one of embodiments 457-458, wherein said cancer is a cancer selected from the group consisting of breast cancer, pancreatic cancer, prostate cancer, brain cancer, lung cancer.

[0627] Embodiment 461: The method of any one of embodiments 457-460, wherein said sample includes a serum or plasma sample.

[0628] Implementation 462: The method of any one of embodiments 457-460, wherein said sample includes an FFPE sample.

[0629] Embodiment 463: The method of any one of embodiments 457-462, wherein said one or more gene promoters include promoters of one or more genes selected from the group consisting of RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, TM6SF1, BRCA1, BNC1, ADAMTS1, CDO1, SOX17, TAC1, HOXA7 and MGMT.

[0630] Embodiment 464: The method of any one of embodiments 457-462, wherein said cancer is pancreatic cancer and said one or more gene promoters include promoters of one, two, three, or four genes selected from the group consisting of from ADAMTS1 and BNC1.

[0631] Embodiment 465: The method of Embodiment 464, wherein said one or more promoters of the gene include ADAMTS1 promoters.

[0632] Embodiment 466: The method of any one of embodiments 464-465, wherein said one or more promoters of the gene include BNC1 promoters.

[0633] Embodiment 467: The method of any one of embodiments 457-462, wherein said cancer is breast cancer and said one or more gene promoters include promoters for one, two, three, four, five, or all of the genes selected from the group consisting of BRCA1, RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2 and TM6SF1.

[0634] Embodiment 468: The method of Embodiment 467, wherein said one or more promoters of the gene include BRCA1 promoters.

[0635] Embodiment 469: The method of any one of embodiments 467-468, wherein said one or more promoters of the gene include RASSF1A promoters.

[0636] Embodiment 470: The method of any one of embodiments 467-469, wherein said one or more promoters of the gene include AKR1B1 promoters.

[0637] Embodiment 471: The method of any one of embodiments 467-470, wherein said one or more promoters of the gene include HOXB4 promoters.

[0638] Embodiment 472: The method of any one of embodiments 467-471, wherein said one or more promoters of the gene include the HIST1H3C promoters.

[0639] Embodiment 473: The method of any one of embodiments 467-472, wherein said one or more promoters of the gene include RASGRF2 promoters.

[0640] Embodiment 474: The method of any one of embodiments 467-473, wherein said one or more promoters of the gene include TM6SF1 promoters.

[0641] Embodiment 475: The method of any one of embodiments 457-462, wherein said cancer is breast cancer and said one or more gene promoters include BRCA1 promoters.

[0642] Embodiment 476: The method of any one of embodiments 457-462, wherein said cancer is lung cancer and said one or more gene promoters include promoters for one, two, three or all of the genes selected from the group consisting of CDO1, SOX17, TAC1 and HOXA7.

[0643] Embodiment 477: The method of Embodiment 476 wherein said one or more promoters of the gene include CDO1 promoters.

[0644] Embodiment 478: The method of any one of embodiments 476-477, wherein said one or more promoters of the gene include SOX17 promoters.

[0645] Embodiment 479: The method of any one of embodiments 476-478, wherein said one or more promoters of the gene include TAC1 promoters.

[0646] Embodiment 480: The method of any one of embodiments 476-479, wherein said one or more promoters of the gene include the HOXA7 promoters.

[0647] Embodiment 481: The method of any one of embodiments 457-462, wherein said cancer is brain cancer and said one or more promoters of the gene include MGMT promoters.

[0648] Embodiment 482: DNA methylation kit, comprising: a container containing the first cartridge and/or the second cartridge of the cartridge set of any one of embodiments 317-399.

[0649] Embodiment 483: A kit according to embodiment 482, wherein said first cartridge and said second cartridge are located in the same container.

[0650] Embodiment 484: A kit according to embodiment 482, wherein said first cartridge and said second cartridge are located in separate containers.

[0651] Embodiment 485: A kit according to embodiment 482, wherein said kit further includes a container containing a lyse solution.

[0652] Embodiment 486: The kit of Embodiment 485, wherein said lyse is a serum or plasma lyse.

[0653] Embodiment 487: A kit according to Embodiment 485, wherein said lyse is a FFPE sample lyse.

[0654] Embodiment 488: The kit of any one of embodiments 482-487, wherein said kit includes a container containing proteinase K.

[0655] Embodiment 489: The kit of any one of embodiments 482-488, wherein said kit contains a conversion reagent in said cartridge or in a container separate from the cartridge.

[0656] Embodiment 490: A kit according to embodiment 489, wherein said kit contains said conversion reagent in a container separate from the cartridge.

[0657] Embodiment 491: A kit according to embodiment 489, wherein said kit containing said conversion reagent is housed in a chamber of the cartridge.

[0658] Embodiment 492: The kit of any one of embodiments 489-491, wherein said conversion reagent comprises a compound selected from the group consisting of sodium metabisulphite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and 1,4-diazabicyclo[ 2.2.2]-octane (DABSO).

[0659] Embodiment 493: A kit according to embodiment 492 wherein said conversion reagent contains ammonium bisulfite.

[0660] Embodiment 494: The kit of any one of embodiments 482-493, wherein said kit includes a container containing a sample processing reagent.

[0661] Embodiment 495: A kit according to embodiment 494 wherein said sample processing reagent contains guanidine thiocyanate.

[0662] Embodiment 496: The kit of any one of embodiments 494-495, wherein said sample treatment reagent contains ethanol.

[0663] Embodiment 497: The kit of any one of embodiments 482-496, wherein said kit contains instructional material for training in the use of said DNA methylation cartridge.

[0664] In some embodiments, the methods and/or cartridges explicitly exclude magnetic materials, including magnetic beads, magnetic hydroxyapatite, and magnetic matrix material. In some embodiments, the methods and/or cartridges explicitly exclude magnetic DNA isolation materials.

BRIEF DESCRIPTION OF THE DRAWINGS

[0665] Figure 1A shows the main components of a cartridge (eg, a GENEXPERT® cartridge) suitable for use in the methods described herein. In FIG. 1B is a top view of the cartridge showing the chambers around the central valve. In FIG. 1C is an explanatory diagram of DNA methylation determination using a reaction cartridge.

[0666] Figure 2, panels A-C, depicts one embodiment of a GENEXPERT® cartridge suitable for determining DNA methylation as described herein.

[0667] Figures 3A-3C depict illustrative, but non-limiting, implementations of modules and systems (eg, devices) for determining DNA methylation. In FIG. 3A shows a GENEXPERT® cartridge control module. In FIG. 3B depicts some of the components of one embodiment of a cartridge control module for DNA methylation analysis. In FIG. 3C depicts a system (eg, device) including a plurality of modules.

[0668] Figures 4A-4D show various strategies for using MethyLight protocols to detect/quantify DNA phosphorylation. In FIG. 4A is a schematic of MethyLight technology modified from Eads et al. 92000) nucleic acids. Res., 28(8): e32). DNA is modified with sodium bisulfite, resulting in differences in methyl-dependent sequences, for example, in CpG dinucleotides - by converting unmethylated cytosine residues (positions indicated by white circles) to uracil, while methylated cytosine residues (positions indicated by black circles) are preserved in the form of cytosine. Fluorescence-based PCR is then carried out using primers that either overlap methylation sites or do not overlap any methylation sites. Sequence discrimination can occur either at the level of the PCR amplification process (panel D), or at the level of the probe hybridization process (panel B), or both (panel D). Primers and probes are used to discriminate the sequence at the level of the PCR amplification process (panel D), or primers alone (panel C) to cover potential methylation sites (eg, in CpG dinucleotides). Only two types (fully methylated (M) and fully unmethylated (U)) of the many theoretical methylation permutations are shown. The MethyLight method can also be designed such that no sequence discrimination occurs during PCR amplification. If neither primers nor probes overlap methylation sites (eg, in CpG dinucleotides) (panel A), no methylation-dependent sequence discrimination occurs at the level of PCR amplification or probe hybridization. This reaction is an amplification of the converted genomic DNA without a systemic shift (without bias) to the methylation status, which can serve as a control of the amount of DNA introduced. If only the probe spans methylation sites (panel B), then sequence discrimination can occur during probe hybridization. In FIG. 4B shows the MethyLight method using a single, eg, methylation-specific probe (PR3) together with methylation-specific forward (FW) and reverse (RV) primers. In FIG. 4C shows the MethyLight method using multiple probes (PR1 to PR5) each targeting a different area. In FIG. 4D shows the MethyLight method using multiple probes (PR1…PR5), each targeting the same area but signaling different methylation patterns.

[0669] Figure 5 shows the results of a representative GeneXpert experiment on 300 ng of human genomic DNA showing the ASTB qPCR curve and the HMBS qPCR curve.

[0670] Figures 6A and 6B show titration results for bisulfite-converted ACTB using human genomic DNA (hgDNA) in 15 cycle nested qPCR (FIG. 6A) and 20 cycle nested qPCR (FIG. 6B).

[0671] Figures 7A-7C show the results of 20 rounds of nested qPCR (inside the cartridge) for six methylated targets (AKR1B1, HOXB4, TM6SF1, RAASGRF2, and RASSF1A). In FIG. 7A shows the results for 25 ng HS DNA or 5000 cells without bisulfite conversion. In FIG. 7B shows the results for 20 rounds of nested qPCR on bisulfite-converted methylated targets using DNA from MBA-453 cells. In FIG. 7C shows the results of 20 rounds of nested qPCR on bisulfite-converted methylated targets using DNA from MBA-453 cells in vehicle (1 ug SS and 10 ng HSDNA). Fluorescence jumps (fallouts) occur at about 25-50 copies or about 100 cells.

[0672] The figure 8 depicts the results of determining the effectiveness of the conversion. The conversion efficiency is approximately 66% (~1 Ct) of the difference between unconverted HMBS and converted ASTB.

[0673] Figure 9 shows the increase in specificity for converted DNA obtained from nested qPCR.

[0674] Figure 10 shows the specificity of the methylation cartridge. There is no 'priming off' operation of unconverted DNA (top panel) or unmethylated DNA (bottom panel) except for HIST1H3C.

[0675] Figures 11 depict illustrative, but non-limiting, methylation assay schemes using a cartridge (eg, a GENEXPERT® cartridge). The figure above shows one of the schemes for the analysis of DNA methylation in a sample from serum or plasma. The figure below shows one of the schemes for the analysis of DNA methylation in a tissue section (for example, in a frozen or formalin-fixed and paraffin-embedded (FFPE) section).

[0676] Figure 12 depicts FFPE cell clot results for converted ALU (leftmost curve) and methylated RASSF1A (rightmost curve).

[0677] Figure 13A is a schematic diagram of a cartridge, Figure 13B is a diagram of the protocol used in Example 4.

[0678] Figure 14 shows an experiment in which some samples were contaminated with bisulfite.

[0679] Figure 15A shows the results for 1000 MBA-453 cells with bisulfite conversion (with HOXB4 giving the strongest signal). Figure 15B shows the results for a 25 ng HS DNA control sample (with only HIST1H3C giving a detectable signal).

[0680] Figure 16 shows the structure of DABSO (1,4-diazoniabicyclo[2.2.2]octane-1,4-disulfinate).

[0681] Figure 17 shows one embodiment with a cf-DNA sample preparation cartridge. The cartridge is effective for both DNA and RNA isolation. The cartridge contains three washes with GTC-ethanol (GTC-ethanol wash solution is usually 1.25 M guanidine thiocyanate, 25 mM Tris pH 7.0, 50% ethanol), a PEG200 wash, and eluting with 15 mM KOH.

[0682] Figure 18 shows cfDNA extraction controls.

[0683] Figure 19A shows a comparison of cf-DNA production using a sample acquisition cartridge as described herein versus that using a standard tubefill protocol (i.e. using a tube-based kit) (leftmost curve) . The output obtained using the cartridge is very close to that obtained using the "tubefill" method (rightmost curve). Figure 19B shows a comparison of the amount of extracted DNA detected using cartridge-based DNA purification versus a standard tubefill protocol as a function of the amount of DNA. The cartridge method is well within the 1 Ct tubefill method and is expected to be even more similar at high DNA concentrations.

[0684] Figure 20A depicts one embodiment of a high volume (e.g., up to and including 12 ml) sample preparation (HVSP) cartridge that can be used in conjunction with an qPCR cartridge and/or in conjunction with a methylation cartridge. Figure 20B is a schematic of one embodiment of a process diagram in an HVSP cartridge when used in combination with a qPCR cartridge for methylation analysis.

[0685] Figure 21 depicts two-cartridge purification detection of HBMS or β-globin using a high volume sample preparation cartridge (see, for example, Figure 20), with the sample transferred from the high volume cartridge to the PCR assay cartridge. , compared to detection using a sample placed in a single CPR cartridge, resulting in a smaller sample volume.

[0686] Figure 22 depicts the results of a bisulfite conversion using multiple heating cycles (bottom panel) versus a single heating cycle (top panel).

[0687] Figure 23A depicts cycles and times for performing methylation analysis using the Qiagen Standard DNA Purification Kit in conjunction with the Zymo DNA Methylation Kit (right) compared to performing methylation analysis using the methylation assay frame described herein. Figure 23B shows a comparison of the results obtained using two different methods.

[0688] Figure 24 shows a comparison of DNA conversion using 1,4-diazabicyclo[2.2.2]-octane (DABSO) as conversion reagent versus DNA conversion using Zymo's bisulfite conversion reagent.

[0689] Figure 25, panels A and B, shows the sensitivity of methylated DNA detection. Panel A shows a dilution series of methylated DNA (MGMT) (curves going from highest concentrations on the left to lower concentrations on the right). Panel B shows the sensitivity of detection of pancreatic methylated markers.

[0690] Figure 26 shows the results for reverse complement multiplex analysis for both strands (curves from highest to lowest fluorescence: top panel - BNC1_2, BNC1_2, BG, ADAMTS1_1/ADAMTS1_2; bottom panel - BNC1_2, BNC1_2, ADAMTS1_1/ADAMTS1_2, BG, ADAMTS1_1/ADAMTS1_2).

[0691] Figure 27A depicts detection in the same cartridge of both methylated DNA and mutations. The top panel shows single cartridge detection of methylated DNA and the Kras G12D mutation, and the bottom panel shows single cartridge detection of methylated DNA and wild-type Kras. Figure 27B depicts detection in the same cartridge of methylated DNA and I mutations for two pancreatic cancer cell lines: PANC-1 cells (top panel) and MIA-PaCa cells (bottom panel).

[0692] Figure 28 shows the temperature optimization in a multiplex analysis of ADAMTS1 and BNC1 forward (top) and reverse (bottom) methylation of bisulfite-converted DNA.

[0693] Figure 29 shows multiplex analysis capability with an MSP set of primers and probes for BNC1, ADAMTS1, and the ACTV control gene. The probes were combined into two sets based on preferred conditions.

[0694] Figure 30 depicts one set of primers and probes that is used to determine MGMT methylation: internal straight 22150 (SEQ ID NO: 266); outer straight 22422 (SEQ ID NO: 263); probe 22419 (SEQ ID NO: 268), internal return 22151 (SEQ ID NO: 267); external reverse 22423 (SEQ ID NO: 265); matrix (SEQ ID NO: 1).

[0695] Figure 31 depicts the results of a comparison between bisulfite pyrosequencing and MGMT methylation cartridge for extracted DNA (top) and for a FFPE sample (bottom).

[0696] Figure 32 shows the ΔCt optimization between methylated and unmethylated converted DNA for the BRCA1 primer and probe set.

[0697] Figure 33 shows a single target methylation analysis of BRCA1 when tested with ACTB as a control gene. According to the picture, eight different cell lines were examined and the effect of adding NH ₄ was compared.

[0698] Figure 34 shows the results of the analysis of methylation of genes with three targets, methylation of which is associated with lung cancer (SOX17, CDO1, TAC1), in the plasma of a healthy subject and in cell lines with three different types of lung cancer.

[0699] Figure 35 shows the results of a dual cartridge methylation assay for BNC1 and ACTV.

[0700] Figure 36 depicts the results of a bisulfite conversion analysis for urine samples from a healthy subject.

[0701] Figure 37 depicts the results of methylation analysis for sputum samples from a healthy subject and sputum from cancer.

Definitions

[0702] To facilitate understanding of the present invention, the following is a definition for a number of terms and phrases:

[0703] In the context of the present description, the terms "detect" ("determine"), "detection" ("detection") or "detection" ("detection") can describe either the general act of detecting or determining, or the specific detection of a composition with a detectable label.

[0704] As used herein, the term "detectably different" or "spectroscopically distinct" refers to a set of labels (such as dyes/fluorophores) that can be detected and distinguished simultaneously.

[0705] DNA methylation refers to the covalent addition of a methyl group (CH ₃ ) to a cytosine (C) base, typically in the 5'-CpG-3' dinucleotide. The term CpG refers to a cytosine (C) base linked by a phosphate bond to a guanine (G) base in the DNA nucleotide sequence.

[0706] The term "conversion reagent" refers to a reagent that deaminates cytosine to uracil in single-stranded DNA while leaving 5-MeC essentially unaffected. Exemplary conversion reagents include bisulfites (e.g., sodium metabisulphite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.) and/or compounds from which bisulfite can be prepared under appropriate reaction conditions (e.g., 1,4- diazabicyclo[2.2.2]-octane (DABSO)).

[0707] The phrase “gene methylation determination” generally refers to the determination of cytosine methylation, primarily at CpG islands, in the promoter region of a gene.

[0708] In the context of the present description, the terms "patient" and "subject" are generally used interchangeably with respect to a person. In some embodiments, the methods provided herein can be applied to samples from non-human animals, such as non-human primates, canines, equines, felines, porcine, bovine, lagomorphs, and the like.

[0709] In the context of the present description, the terms "oligonucleotide", "polynucleotide", "nucleic acid molecule" and the like refer to nucleic acid-containing molecules, including, but not limited to, DNA. These terms cover sequences that include any known base analogs of DNA and RNA, including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl)uracil, 5-fluorouracil, 5 -bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethyl-guanine, 2-methyladenine , 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyamino-methyl-2-thiouracil, beta-D-mannosylqueuosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-hydroxyacetic acid methyl ester, uracil-5-hydroxyacetic acid, oxybutoxosine, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil , 5-methyluracil, N-uracil-5-hydroxyacetic acid methyl ester ota, uracil-5-hydroxyacetic acid, pseudouracil, queuosine, 2-thiocytosine and 2,6-diaminopurine.

[0710] In the context of the present description, the term "oligonucleotide" refers to single-stranded polynucleotides, mostly containing less than 500 nucleotides. In some embodiments, the oligonucleotide is 8 to 200, 8 to 100, 12 to 200, 12 to 100, 12 to 75, or 12 to 50 nucleotides in length. Oligonucleotides may be designated based on their length, for example, an oligonucleotide with 24 residues may be designated "24-mer".

[0711] In the context of the present description, the term "complementary" to the target gene (or target region) and the percentage of "complementarity" of the probe sequence to the target gene sequence is the percentage expression of "identity" with respect to the target gene sequence or to complement of the target gene sequence. In establishing the degree of "complementarity" between the probes used in the compositions described herein (or portions thereof) and target genes such as those disclosed herein, the degree of "complementarity" is expressed as the percentage identity between the sequence of the probe (or its site) and the sequence of the target gene or the complementary sequence of the target gene, which aligns with it to the greatest extent. The percentage is calculated by counting the number of corresponding bases that are identical in the specified 2 sequences, divided by the total number of consecutive nucleotides in the probe and multiplied by 100. When using the term "complementary", the oligonucleotide in question is at least 90% complementary to the target molecule, except when where indicated otherwise. In some embodiments, the oligonucleotide in question is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least at least 97%, at least 98%, at least 99%, or 100% complementary to the target molecule.

[0712] The terms "primer" or "probe" as used herein refer to an oligonucleotide that contains a region that is complementary to a sequence of at least 8 contiguous nucleotides of a target nucleic acid molecule, such as a target gene. In some embodiments, the primer or probe comprises a region complementary to a sequence of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least at least 26, at least 27, at least 28, at least 29, at least 29, at least 30, at least 319, at least 32, at least 33, at least 34, at least at least 35, at least 36, at least 37, at least 38, at least 39, or at least 40 contiguous nucleotides of the target molecule. If the primer or probe contains a region "complementary to at least x contiguous nucleotides of the target molecule", then the primer or probe is at least 95% complementary to at least x contiguous nucleotides of the target molecule. In some embodiments, a given primer or probe is at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a given target molecule.

[0713] The term "nucleic acid amplification" encompasses any methods by which at least a portion of at least one target nucleic acid can be reproduced, typically depending on the template, including, without limitation, a wide range of methods for amplifying nucleic acid sequences such as linearly and exponentially. Exemplary methods for performing the amplification step include polymerase chain reaction (PCR), ligase chain reaction (LCR), ligase detection reaction (LDR), multiplex ligase dependent probe amplification (MLPA), ligation followed by Q replicase amplification, primer extension , Strand Displacement Amplification (SDA), Hyperbranched Displacement Amplification, Multiple Strand Displacement Amplification (MDA), Nucleic Acid Sequence Based Amplification (NASBA), Two-Step Multiplex Amplifications, Rolling Ring Amplification (RCA) and the like , including their multiplex versions and combinations, such as but not limited to OLA/PCR, PCR/OLA, LDR/PCR, PCR/PCR/LDR, PCR/LDR, LCR/PCR, PCR/LCR (also known as combined chain --CCR reaction), digital amplification, and the like. A description of such methods can be found, among other sources, in Ausbel et al.; PCR Primer: A Laboratory Manual, Diffenbach, Ed., Cold Spring Harbor Press (1995); The Electronic Protocol Book, Chang Bioscience (2002); Msuih et al., J. Clin. micro. 34:501-07 (1996); The Nucleic Acid Protocols Handbook, R. Rapley, ed., Humana Press, Totowa, N.J. (2002); Abramson et al., Curr Opin Biotechnol. February 1993; 4(1): 41-7, US Pat. No. 6,027,998; US patent No. 6605451, Barany et al., PCT publication No. WO 97/31256; Wenz et al., PCT Publication No. WO 01/92579; Day et al., Genomics, 29(1): 152-162 (1995), Ehrlich et al., Science 252: 1643-50 (1991); Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press (1990); Favis et al., Nature Biotechnology 18: 561-64 (2000); and Rabenau et al., Infection 28: 97-102 (2000); Belgrader, Barany, and Lubin, Development of a Multiplex Ligation Detection Reaction DNA Typing Assay, Sixth International Symposium on Human Identification, 1995 (available on the World Wide Web at: promega.com/geneticidproc/ussymp6proc/blegrad.html); LCR Kit Instruction Manual, Cat. #200520, Rev. #050002, Stratagene, 2002; Barany, Proc. Natl. Acad. sci. USA 88: 188-93 (1991); Bi and Sambrook, Nucl. Acids Res. 25: 2924-2951 (1997); Zirvi et al., Nucl. Acid Res. 27: e40i-viii (1999); Dean et al., Proc Natl Acad Sci USA 99: 5261-66 (2002); Barany and Gelfand, Gene 109: 1-11 (1991); Walker et al., Nucl. Acid Res. 20:1691-96 (1992); Polstra et al., BMC Inf. Dis. 2:18-(2002); Lage et al., Genome Res. February 2003; 13(2): 294-307, and Landegren et al., Science 241: 1077-80 (1988), Demidov, V., Expert Rev Mol Diagn. November 2002; 2(6): 542-8., Cook et al., J Microbiol Methods. May 2003; 53(2): 165-74, Schweitzer et al., Curr Opin Biotechnol. February 2001; 12(1): 21-7, U.S. Patent No. 5,830,711, U.S. Patent No. 6,027,889, U.S. Patent No. 5,686,243, PCT Publication No. W00056927 A3 and PCT Publication No. W09803673 A1.

[0714] In some embodiments, amplification includes at least one cycle of sequential procedures: annealing at least one primer with complementary or substantially complementary sequences in at least one target nucleic acid; synthesizing at least one nucleotide chain in a template-dependent manner using a polymerase; and denaturing the newly formed nucleic acid duplex to separate the strands. The cycle may or may not be repeated. Amplification may include thermal cycling or, in some embodiments, may be performed isothermally.

[0715] The term "hybridization" as used herein primarily refers to "specific hybridization", which is the binding, duplexing, or hybridization of a nucleic acid molecule predominantly to a specific nucleotide sequence, in some embodiments, under stringent conditions. The term "stringent conditions" refers to conditions under which the probe hybridizes preferentially to the target sequence and less or not hybridizes to other sequences. "Stringent hybridization" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization are sequence dependent and differ under different environmental conditions. Detailed guidance on nucleic acid hybridization is found, for example, in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I, Ch. 2, "Overview of principles of hybridization and the strategy of nucleic acid probe assays," Elsevier, NY ("Tijssen"). In general, extremely stringent hybridization and wash conditions for filter hybridization are chosen to be about 5° C. lower than the melting point (T _m ) for a specific sequence at a given ionic strength and pH. T _m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a fully matched probe. In some embodiments, extremely stringent conditions are chosen to be T _m for a particular probe. The dependence of hybridization stringency on buffer composition, temperature, and probe length is well known to those skilled in the art (see, e.g., Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual (3rd ed.) Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor Press, NY).

[0716] "Sample" in the context of the present description generally refers to a biological sample, including biological fluids (for example, blood or blood fractions, serum, plasma, pancreatic juice, cerebrospinal fluid, oral fluid, lymph, intraocular fluid, and the like) and /or tissue samples, including, but not limited to, biopsy specimens, frozen tissue samples, formalin-fixed and paraffin-embedded (FFPE) sample from various tissues, including, but not limited to, breast tissue, cervical canal tissue, vaginal tissue, tissues colon/rectum, throat tissue, and other types of tissue from human specimens such as blood, stool, and biopsy specimens. The term "sample" also includes diluted and/or buffered forms of the above samples, for example, a buffer in which the sample was placed when taking a swab, a urine sample to which buffer was added, and the like.

[0717] In the context of the present description, the phrase "indicating the presence of cancer or a predisposition to cancer" means that a particular result generally indicates that cancer is or is likely to be present and/or a precancerous condition is present. This phrase does not imply an unequivocal statement that a given condition is present. An unequivocal determination can be made on the basis of additional examination or research, which the practitioner considers appropriate. Furthermore, this phrase does not imply that this determination is made in relation to the condition that may be present, only on the basis of this particular result. Rather, by itself, it implies that a positive result will be evaluated in the light of another examination or additional results will be obtained in the differential diagnosis.

[0718] The term "tubefill procedure" refers to a procedure that is carried out using standard laboratory equipment predominantly on a cassette (eg, predominantly with GENEXPERT® or with a modified GENEXPERT® cartridge presented in the present description).

DETAILED DESCRIPTION

[0719] In various embodiments, the devices and methods are presented in such a way as to facilitate the rapid detection and/or characterization of methylation in DNA samples. In some embodiments, automatic reaction cartridges are provided with methods that use automatic reaction cartridge(s) to provide a methylation analysis of a DNA sample and optionally measure mRNA levels in conjunction with DNA methylation determination. In various embodiments, DNA methylation is determined by bisulfite conversion and analysis of bisulfite-converted DNA (eg, by methylation-specific PCR, nucleic acid sequencing, melting point analysis, and the like). In some embodiments, the cartridge performs all or part of the bisulfite conversion of the DNA and all or part of the analysis of the bisulfite converted DNA. In some embodiments, the cartridge performs all of the steps inherent in bisulfite conversion and all or part of the analysis of bisulfite-converted DNA. In some embodiments, the cartridge performs all of the steps inherent in bisulfite conversion and all or part of the analysis of bisulfite-converted DNA. In some embodiments, the cartridge additionally performs isolation and purification of the DNA to be analyzed.

[0720] Automation of methylation analysis has several advantages, including, for example, reduced processing time, improved efficiency, reduced user error and variability, minimizing stage-to-stage waste, and increasing the ability to use less sample. The use of the cartridge-based process as described herein allows for quick and easy analysis of not only many sample types, but also the evaluation of changes in methylation seen in several different types of cancers, including, but not limited to, breast cancer, colorectal cancer. , prostate cancer and lung cancer.

[0721] Based on the cartridge methods described in the present description, additionally allow the measurement of mRNA obtained from the same sample. Measurement of the relevant upstream and/or downstream mRNAs involved in DNA methylation may be important for understanding the mechanism and action of epigenetic modification. For example, mRNA measurement of DNA methyltransferases (DNMTs) has been studied in conjunction with DNA methylation for several types of cancers (see Table 1).

[0722] Often, separate independent extractions of DNA or RNA are performed to study and measure genes and transcripts. Co-detection when preparing from the same sample is ideal for minimizing sample preparation as well as inter-run, inter-sample, and inter-cell variability.

Bisulfite conversion of DNA using a cartridge

[0723] In some embodiments, DNA extraction, bisulfite conversion, and methylation-specific PCR are performed entirely in a cartridge. In one exemplary embodiment, the user adds the sample to the lyse/binding reagent, the reagent is then briefly shaken/vortexed, and then the sample is added to the sample port or chamber in the cartridge. An illustrative, but non-limiting, example of a lysing reagent (including reagents particularly suitable for FFPE sections) is described in PCT Patent Publication No: WO/2014/052551 (PCT/US2013/061863), which is incorporated herein by reference for reagents, given in this document.

[0724] Additional examples of lysing reagents for serum or plasma and for formalin-fixed and paraffin-embedded (FFPE) samples are provided in the example (Tables 13 and 14, respectively).

[0725] In some embodiments, the cartridge is placed inside the working module, and the analysis is initiated by performing in the software that controls the processing module, a series of clicks with the desired selection (see, for example, Fig. 11A and 11B). Further, the process of bisulfite conversion and analysis of DNA converted by bisulfite takes place in the cartridge. In some embodiments, mRNA is also determined. While in some embodiments all operations are performed on the cartridge, in other embodiments only a subset of the various operations are performed on the cartridge as described below.

[0726] The sample may include any biological sample that contains DNA whose methylation status is being evaluated. Examples of samples include, but are not limited to, isolated DNA and/or isolated all nucleic acids, a cell, a tissue, a biological fluid containing a nucleic acid, and the like. In some embodiments, the biological sample contains a biological fluid selected from the group consisting of plasma, serum, amniotic fluid, saliva, mucus, urine, pancreatic juice, and cerebrospinal fluid. In some embodiments, the sample comprises a tissue sample from healthy tissue or a tissue sample from diseased tissue. In some embodiments, the tissue sample is obtained from a fetus, neonate, child; teenager or adult. In some embodiments, the tissue sample contains a tumor cell and/or is obtained from a tumor biopsy (e.g., breast cancer, prostate cancer, brain cancer, cervical cancer, ovarian cancer, pancreatic cancer, colon cancer, gastric cancer, hepatocellular cancer). etc). In some embodiments, the sample contains fixed tissue, such as a formalin-fixed tissue sample. In some embodiments, the sample comprises an immersed tissue sample (eg, formalin-fixed and paraffin-embedded (FFPE) tissue sample).

[0727] Bisulfite conversion of DNA typically includes the following four steps:

[0728] 1) DNA purification;

[0729] 2) DNA denaturation;

[0730] 3) DNA conversion (eg, bisulfite deamination) and

[0731] 4) alkaline desulfurization.

[0732] Typically, DNA conversion (eg, using a conversion reagent such as bisulfite) involves: 1) sulfonation: adding bisulfite to the 5-6 double bond in cytosine; and 2) hydrolytic deamination: hydrolytic deamination of the resulting cytosine bisulfite derivative to obtain a uracil bisulfite derivative. This is followed by alkaline desulfurization: Removal of the sulfo group by treatment with alkali affords uracil as above.

[0733] As noted above, in some embodiments, DNA purification may be performed prior to placing the sample in the cartridge, or alternatively, may be performed in the cartridge itself. Accordingly, in some embodiments, the sample is added directly to the reaction cartridge, while in other embodiments, the sample is mixed with one or more reagents. In some embodiments, DNA preparation typically includes obtaining substantially isolated DNA. This may include leasing cells to release DNA, removing particles and debris from broken cells, and/or removing protein components, resulting in a sample containing substantially pure nucleic acids (eg, substantially pure DNA and/or a combination of substantially pure DNA and RNA). In one illustrative but non-limiting embodiment, the sample (eg, a tissue sample) is added to the lyse reagent, mixed, and then placed inside the cartridge for further processing.

[0734] In some embodiments, all of the reagents needed to perform the bisulfite conversion of DNA are provided in the cartridge. In some embodiments, to prevent degradation of the reagents in the cartridge over time, certain reagents may be added to the cartridge just prior to use. Thus, for example, in some embodiments, this implies that the conversion reagent can be loaded into the cartridge (e.g., bisulfite reagent) and/or guanidine thiocyanate reagent (e.g., GTC-EtOH-Tween) at or near the time when the sample is loaded into the cartridge. In some embodiments, the guanidine thiocyanate reagent (eg, GTC-EtOH-Tween) is combined with the sample and added to the cartridge in the sample receiving chamber (eg, chamber 2 in the GENEXPE RT® cartridge).

[0735] In some embodiments, when performing a bisulfite conversion of DNA using a reaction cartridge (e.g., a GENEXPERT® cartridge), the method includes:

[0736] i) bringing the biological sample containing the nucleic acid into contact with a first matrix material entering a first column or filter, where said matrix material binds and/or filters the nucleic acid in said sample and thereby purifies the DNA;

[0737] ii) eluting the bound DNA from the first template material (eg, using an alkaline solution) and denaturing the DNA to obtain eluted denatured DNA;

[0738] iii) heating the eluted DNA in the presence of a conversion reagent (eg, a reagent providing bisulfite ions) to produce a converted (eg, deaminated) nucleic acid;

[0739] iv) contacting the converted nucleic acid with a second matrix material included in the second column to bind said deaminated nucleic acid to said second matrix material (it should be noted that in some embodiments, the second column may be a column other than the first column, or in other implementations, the same column is used a second time);

[0740] v) desulfurizing the bound deaminated nucleic acid and/or simultaneously eluting and desulfurizing the nucleic acid by contacting the deaminated nucleic acid with an alkaline solution to produce a converted (eg, bisulfite-converted) nucleic acid; and

[0741] vi) elution of the converted nucleic acid from said second template material, wherein at least steps iv) to vi) are carried out in a single reaction cartridge.

[0742] In some embodiments, the method further comprises analyzing the converted DNA. Accordingly, in some embodiments, the method further comprises:

[0743] vii) performing methylation-specific PCR and/or nucleic acid sequencing, and/or highly accurate melting curve (HRM) analysis of said converted nucleic acid to determine nucleic acid methylation, wherein at least steps iv) to vi) carried out in one reaction cartridge.

[0744] In some embodiments, at least steps iii) through vi) are carried out in a single reaction cartridge.

[0745] In some embodiments, at least steps ii) through vi) are carried out in a single reaction cartridge.

[0746] In some embodiments, at least steps i) through vi) are carried out in a single reaction cartridge.

[0747] In some embodiments, at least steps i) through vii) are carried out in a single reaction cartridge.

[0748] It should be noted that the first column and, if present, the second column may mean separate columns. However, especially when integrated into a reaction cartridge, the "column" may simply be a matrix material placed in a chamber or channel in the cartridge. In various embodiments, the "columns" function as filters and/or an affinity column that binds nucleic acids. Accordingly, in some embodiments, the column contains a matrix material that binds nucleic acids (eg, DNA and/or RNA). Examples of matrix materials include, but are not limited to, glass (silicon dioxide), ion exchange resin, hydroxyapatite, and the like. It should be understood that the matrix materials may take several forms. Thus, in some embodiments, the matrix material comprises fibrous material, particulate material (eg, microbeads, nanobeads, etc.), structured material (eg, baffle system, serpentine channel, and the like). In some embodiments, the first column and the second column are different columns (chambers or channels). In other embodiments, the first column and the second column are the same column (channel or chamber) that is used twice (eg, the first time and the second time).

[0749] In some implementations, the use of one or more additional filters is implied, for example, cleaning the initial sample before bringing it into contact with the first matrix material. Thus, for example, in some embodiments, a filter matrix (e.g., a polycarbonate filter, a nylon filter, a polypropylene filter, a polyester filter, a nylon filter, a ceramic filter, a PTFE filter, and the like) is placed in the sample receiving chamber or "downstream chamber" from sample receiving chamber and in front of the first "column". It should also be understood that, in some embodiments, the sample may be lysed and/or filtered prior to being placed within the sample receiving chamber.

[0750] In certain illustrative, but non-limiting embodiments, the methods described herein can be performed using a GENEXPERT® cartridge (Cepheid, Inc., Sunnyvale, CA) or variants thereof. In various embodiments, sample extraction and/or amplification and/or DNA conversion and/or detection can all be performed within a given stand-alone "cartridge lab" (see, for example, US Pat. and 6818185, the contents of which are fully incorporated into the present description by reference). In various embodiments, cartridge components may include, but are not limited to, working chambers containing reagents, filters, and information gathering tools suitable for use in extraction, purification, and amplification of target nucleic acids. The valve provides fluid transfer from one chamber to another and contains components for nucleic acid lysis and filtration. The optical window allows real-time optical detection (for example, PCR amplification products). A reaction vial can be placed that allows for very rapid heating and/or thermal cycling.

[0751] In some embodiments, an exemplary GENEXPERT® cartridge comprises a plurality of chambers located around a central valve assembly and having selective fluid communication with the central valve assembly, wherein the central valve assembly is configured to receive a piston capable of drawing fluid into or out of the chamber. chambers in fluid communication with the central valve. The rotation of the valve assembly determines which chamber will be in fluid communication with the center valve. One example of a GENEXPERT® cartridge is shown in Figure 1A showing the cartridge, process/reagent chambers, reaction tube (e.g. heating and/or thermal cycling tube), optional optical windows, and a valve that allows liquid to be transferred from one chamber to another. .

[0752] Figure 1B shows an example cartridge layout that includes a top view of the cartridge with individual chamber numbering. In one illustrative, but non-limiting embodiment, the components of the chambers included in the cartridge are shown in Table 2. It should be understood that the location of the reagents and chambers is illustrative and not restrictive. Other reagent arrangements and/or other chamber configurations may be available to those skilled in the art using the guidance provided herein.

[0753] One implementation with a step-by-step diagram of the process for determining DNA methylation using such a cartridge is depicted in Figure 1C. In this cartridge configuration, there are five chambers that, during use (for example, when the cartridge is used to determine DNA methylation) contain reagents and buffers (for example, chambers 3, 4, 5, 8 and 10), one chamber, which contains a user-added sample (e.g. chamber 2) and one or two (or more) chambers that contain assay reagents (e.g. MSP reagents such as enzyme mixture, template specific reaction and/or 200 mM Tris pH 7.0, e.g. in the form of beads) (e.g. chambers 9 and 11). In some embodiments, the reagents (eg, polymerase, reverse transcriptase, primer, probe) are provided as a solution. In some embodiments, the reagents are provided as a lyophilized powder. In some embodiments, the reagents are presented as lyophilisate beads. The beads may additionally contain agents that enhance the stability of the reagents and/or their activity (see, for example, US Patent Publication No: 2006/0068399, which is incorporated herein by reference with respect to the beads, the manufacture of the beads, and the composition of the beads.

[0754] In some embodiments, the cartridge as-is contains all of the reagents needed to operate the cartridge, and only the sample (eg, sample in buffer/lyse/precipitate) is added to the cartridge. In some embodiments, the cartridge is provided without GTC-EtOH and/or bisulfite reagents, and one or both are added during operation (use). Thus, in some embodiments, the GTC-EtOH reagent is added to the cartridge during operation, in some embodiments, the bisulfite reagent (in addition to the sample) is added to the chamber during operation, and in some embodiments, both GTC-EtOH and the bisulfite reagent (in addition to the sample) is added to the cartridge during operation. In some embodiments, these reagents are added directly to the desired chamber (see, for example, Table 2). In some embodiments, there are ports for loading reagents, and these ports are configured to deliver the reagent(s) to the desired chambers.

[0755] At the beginning of the assay, the cartridge sends the sample from, for example, chamber 2 over a glass fiber column (eg, the first column) into the cartridge. DNA is eluted from the column and simultaneously denatured with an alkaline solution, such as low concentration potassium hydroxide, from chamber 10 to a concentrated bisulfite reagent (for example, concentrated ammonium bisulfite) in chamber 4. In some embodiments, the DNA is eluted with an alkaline solution of KOH with a pH higher than than about 10.5, or a pH greater than about pH 12. In some embodiments, the DNA is eluted with 10-15 mM KOH.

[0756] As above, the DNA is eluted (optionally with a pulse of ultrasound) into the bisulfite reagent. In various embodiments, the conversion reagent (e.g., bisulfite reagent) is present at a concentration in the range of about 4 M to about 10 M, or about 5 M to about 8 M, or about 6 M, or about 7 M. In some embodiments, implementation of the bisulfite solution contains sodium metabisulfite, or potassium bisulfite, or ammonium bisulfite, or cesium bisulfite, or DABSO (1,4-diazoniabicyclo[2.2.2]octane-1,4-disulfinate, see, for example, Fig. 16). In some embodiments, the conversion reagent (e.g., bisulfite reagent) contains radical scavengers, including, but not limited to, one or more chemicals to prevent the oxidation of sulfite to sulfate (TROLOX and hydroquinone), and/or catalysts (polyamines).

[0757] The DNA-bisulfite mixture (DNA/conversion reagent) is then introduced into the temperature-controlled chamber or channel and incubated at a temperature in the range of about 40°C to about 95°C. In some embodiments, the mixture is incubated at a constant temperature, while in other embodiments, for example, where the temperature-controlled chamber or channel is a thermal cycling chamber or channel (e.g., the smartcycler tube at the back of the cartridge), the mixture is thermally cycled (e.g., between 60°C and 95°C). The mixture is incubated until the DNA is converted (eg, deaminated). In some embodiments, the incubation lasts for a period of time that is from about 5 minutes to about 4 hours, or preferably from about 15 minutes to about 45 minutes.

[0758] After incubation, the DNA solution/conversion reagent (eg, DNA bisulfite) is mixed with freshly prepared guanidine thiocyanate-EtOH solution, eg from chamber 3, and distributed throughout the matrix material. In some embodiments, the first column is reused because there is only one column, and the second and first columns are the same column. In some embodiments, the second column is a separate column that is different from the first column.

[0759] The DNA bound to the second column matrix material is washed with freshly prepared GTC-EtOH (eg from chamber 3) and washed (eg with a PEG 200 wash, eg from chamber 8). The DNA is then desulfurized on a column or simultaneously eluted and desulfurized by contacting the deaminated nucleic acid with an alkaline solution (e.g., KOH from chamber 10 to produce bisulfite-converted nucleic acid. In some embodiments, the incubation lasts for a period of time ranging from about 1 minute up to about 1 hour, or from about 5 minutes to about 30 minutes, or from about 10 minutes to about 20 minutes, or for about 15 minutes.

[0760] If the initial incubation took place in a thermocycling chamber, which is used later, then the thermal cycling chamber or channel is washed with buffer to remove residual bisulfite and neutralize the pH. Interestingly, it appears that incubation with a conversion reagent (e.g., bisulfite reagent) and/or desulfurization can be performed in a channel or chamber, which is then used to perform PCR substantially without affecting subsequent PCR(s) with bisulfite contamination.

[0761] The eluted desulfurized bisulfite-converted DNA can be mixed with a suitable buffer and analyzed for methylation. In some embodiments, the converted DNA is mixed with concentrated Tris, a mixture of enzymes, and template specific beads (e.g., beads containing primers and/or probes for PCR or nested NPR) in chambers 9 and 11, and the final mixture is sucked in. thermocycling tubes or chambers for performing methylation-specific quantitative PCR.

[0762] Bisulfite contamination during the qPCR step may be the primary failure mode of the methylation cartridge. Residual bisulfite may be present from either direct contamination of the PCR reaction tube (eg, during the bisulfite conversion step) or indirect contamination (eg, cross-contamination during liquid transfer of bisulfite between chambers). Residual bisulfite contamination, if present, can be measured by bisulfite-mediated probe cleavage during the qPCR step, resulting in an increase in fluorescence during early cycles of qPCR (cycles 1-10), typically used for background subtraction. Accordingly, in some embodiments, the cartridge contains beads that provide one or more probes that are cleavable during PCR in the presence of bisulfite. The results of the analysis in the presence of bisulfite contamination are presented in Figure 14.

[0763] Although the above methods (and in Example 4, see e.g. FIG. 13A) are described with respect to specific chambers in the GENEXPERT® cartridge, it should be understood that specific reagent/chamber distributions may vary depending on the particular assay protocol employed. methylation.

[0764] Thus, for example, the operation of a methylation assay cartridge (e.g., a GENEXPERT® cartridge can be generally described by a diagram (see, for example, Figures 1C and 13B). In the illustrative but non-limiting embodiment depicted in Figure 13B, the DNA sample is presented in a binding buffer (e.g., a buffer containing GTC-EtOH, in some embodiments, after the sample has been treated with proteinase K and/or lyse.) In some embodiments, the sample is obtained from a sample preparation cartridge as described in this document (see, for example, figure 20).

[0765] The sample in the binding buffer is injected into the sample receiving chamber in the cartridge. During operation, the cartridge is controlled to deliver the sample solution to the matrix ("column") that binds the DNA. The bound DNA is then eluted from the column using an alkaline reagent (e.g., KOH solution) combined with a bisulfite reagent and transferred to a heating tube (usually a PNR reaction tube) in a cartridge where the bisulfite is reacted (e.g., at about 50°C or about 60°C to about 90°C for about 45 minutes (or up to and including about 90 minutes), in this illustrative protocol). DNA is combined with binding buffer (e.g. 2.25 M guanidine thiocyanate, 22.5 mM Tris pH c 7.0, 0.5% Tween 20, 50% ethanol and SE-15 defoamer 0.005% (10% emulsion of active silicone defoamer and non-ionic emulsifiers)) and transferred to the same column or to a different column, where it is again bound to the column matrix. Reacted DNA is washed with GTC-EtOH, washed with PEG (eg PEG 200) and eluted again from the column using an alkaline reagent (eg KOH) which also desulfurizes the DNA. During DNA desulfurization, the reaction tube (eg, PCR reaction tube) is heated and washed (eg, washed 10 times) to completely remove the bisulfite reagent. The eluted DNA (or a portion thereof) can be transferred to a PCR and/or nested PCR reaction tube.

[0766] It should be understood that these operations can be performed completely with all or part of the DNA sample. In the latter case, a portion of the sample may be stored in one or more chambers and used as a control, or may be subjected to various analysis/procedures.

Combined purification and detection together with RNA expression and DNA methylation

[0767] In some embodiments, methods are provided for co-purifying and detecting altered RNA expression of genes in conjunction with DNA methylation (MSP) in a cartridge-based assay (eg, using a GENEXPERT® cartridge). In some embodiments, this assay can identify altered expression of, for example, DNMT associated with tumor-specific methylation from the same prepared sample. In some embodiments, this assay can be used to verify expression and methylation status.

[0768] We have demonstrated the possibility of elution of nucleic acids from the column using Tris buffer, while part of the nucleic acid remains on the column. In one exemplary embodiment, the RNA fraction is eluted and left, for example, in a cartridge chamber using a Tris solution.

[0769] After the isolation of the RNA fraction, an elution with NaOH or KOH is carried out, which desorbs the column, eluting and denaturing the DNA, which passes into bisulfite for conversion as described above. Then, either using an RNA fraction to elute from the bisulfite-converted DNA column or using a mixture after KOH eluting, these two fractions (RNA and converted DNA) are mixed to perform qRT-PCR with RNA and bisulfite-converted DNA. This includes adding a reverse transcription (RT) RNA and MSP (or other analytical method) step in the same tube from the same sample. Alternative methods include, but are not limited to, independently performing a RT step prior to mixing with DNA (combining cDNA and DNA) for qPCR, or DNA PCR or RNA RT can be performed independently/sequentially using a single thermal cycling tube/chamber, or simultaneously using multiple tubes/thermocycling chambers in a cartridge.

Converted DNA analysis

[0770] A variety of analytical methods can be used to assess DNA methylation in a cartridge. Alternatively, in some embodiments, the cartridge may be combined with another device and/or system for further analysis of the converted (eg, bisulfite or DABSO converted) DNA. Example methods include, but are not limited to, methylation-specific PCR (MSP), direct sequencing, high-precision melting curve analysis (HRM), pyrosequencing (sequencing by addition), base-specific cleavage method (e.g., base-specific MALDI- TOF), and the like.

Methylation specific PCR (MSP).

[0771] In various embodiments, methylation-specific PCR can be used to assess the methylation status of a target DNA. MSP uses primer and/or probe sets designed to be "methylation specific" by including sequences complementary exclusively to unconverted 5-methylcytosine, or conversely "methylated site specific" complementary to thymine converted from unmethylated cytosine. Next, methylation is determined by the ability of a specific primer to achieve amplification. This method is particularly effective for examining CpG islets in areas of high methylation density because the increased number of unconverted methylcytosines within the amplification target increases the specificity of the PCR. In some embodiments, placing CpG pairs at the 3' end of the primer also improves specificity.

[0772] In some embodiments, methylation is measured using the MethyLight method. The MethyLight method is based on MSP but allows quantitation using quantitative PCR (see e.g. Eades et al. (2000) Nucleic Acids Res., 28(8): E32. doi:10.1093/nar/28.8.e32) . Methylation-specific primers and methylation-specific fluorescent reporter probes are used, which are annealed to the amplified region. Alternatively, primers or probes can be designed without methylation specificity if discrimination between CpG pairs within affected sequences is desired. Quantitative measurement can be performed in relation to the reference methylated DNA. One modification to this protocol to increase the PCR specificity for successfully bisulfite-converted DNA (ConLight-MSP) uses an additional probe to bisulfite-unconverted DNA to quantify this non-specific amplification (see, e.g., Rand et al. (2002) Methods 27(2): 114-120).

[0773] In various embodiments, MethyLight methods use TAQMAN® technology, which is based on cleavage of a doubly labeled fluorescent hybridization probe by the 5'-nuclease activity of Taq polymerase during PCR amplification (Eads et al. (1999) Cancer Res ., 59: 2302-2306; Livak et al. (1995) PCR Meth. Appl, 4: 357-362; Lee et al. (1993) Nucleic Acids Res., 21: 3761-3766; Fink et al. (1998 ) Nat. Med, 4: 1329-1333). The use of three different oligonucleotides (forward and reverse PCR primers and fluorescence hybridization probes) in TAQMAN® technology allows for multiple sequence detection strategies.

[0774] For example, sequence discrimination can occur at the level of the PCR amplification process (see, for example, Fig. 4A, panel C) and / or at the level of fluorescence hybridization of the probe (see, for example, Fig. 4A, panel B). In both steps, discrimination is based on the difference in annealing of perfectly matched oligonucleotides versus non-matched oligonucleotides. In MethyLight technology, sequence discrimination at the PCR amplification level occurs by designing primers and probes, or primers only, or probes only, to cover potential DNA methylation sites (eg, CpG dinucleotides). One approach is simply a fluorescence-based version of the MSP technique (Herman et al. (1996) Proc. Natl. Acad. Sci. USA, 93: 9821-9826). Each oligonucleotide (primers and probes) can cover anywhere from zero to multiple CpG dinucleotides. Each CpG dinucleotide after bisulfite conversion can result in two different sequence variants depending on whether the particular site was methylated (mCpG) or unmethylated (UpG). For example, if an oligonucleotide spans two CpG dinucleotides, then the number of possible sequence variants in the genomic DNA, within the region covered by that oligonucleotide, will be 2x2=4. If both primers and probe each span two CpGs, then the total number of variants included in the sequence covered by this oligonucleotide is 4x4x4=64. In theory, a separate PCR could be designed to analyze appropriate amounts of each of these potential 64 sequence variants. However, significant information about methylation can be obtained from the analysis of a much smaller number of variants by developing reactions for fully methylated and fully unmethylated molecules, which represent the two most extreme variants of the sequence of this hypothetical example. The ratio between these two reactions, or the ratio between the methylated response and the control response, provides a measure of the proportion of methylated modules at a given locus.

[0775] The MethyLight technology can also be modified to eliminate sequence discrimination at the PCR amplification level. If neither the primers nor the probes cross any CpG dinucleotides, then the reaction is an unbiased amplification and can serve as a control of the amount of DNA introduced. One exemplary usable control reaction is one in which the entire amplicon is stripped of CpG dinucleotides in the unconverted genomic sequence. If the probe is designed to cross over a CpG dinucleotide, then sequence discrimination occurs solely at the level of probe hybridization. In this version, all sequence variants from the sodium bisulfite conversion step are amplified with equal efficiency, provided that there is no bias amplification (see, for example, Wamecke et at. (1997) Nucleic Acids Res., 25 : 4422-1426). In this case, the design of separate probes for each of the various sequence variants associated with a particular methylation pattern (2x2=4 probes in the case of two CpGs) allows for the quantification of the relative proportion of each sequence permutation in the mixture of PCR products.

[0776] In some embodiments, the analysis methods also involve PCR specific for unconverted DNA. This PCR can be directed to SNPs, mutations, and/or translocations, etc. To this end, it should be noted that the detection of mutations and methylation in one cartridge is given in Example 12 (see, for example, Fig. 27A and 27B). Detection of SNPs, mutations, translocations, etc. can be easily combined with the inclusion of sets of primers and probes specific for the detection of these targets.

Analysis by nested PCR and multiplex PCR.

[0777] In some embodiments, methylated DNA can be detected using PCR methods known to those skilled in the art. In some embodiments, nested PCR is used to determine target methylation. In one illustrative, but non-limiting, implementation (see, for example, Example 4), a nested PCR protocol can be applied if the first 15-20 cycle PCR is not specific for methylation, but only for converted DNA sequences (i.e. have no intersections with CpG, or in cases where there are intersections, R = purine or Y = pyrimidine are used to account for both methylated and unmethylated sequences of the template). The second qPCR (eg, 45 cycle qPCR) may include primers and probes primarily specific for 2-3 methylated CpGs.

[0778] It should be noted that in some embodiments, the MethyLight assay is performed using a single probe (see, for example, Figure 4B). In this approach, using one, for example, methylation-specific probe (PR3) together with methylation-specific forward (FW) and reverse (RV) primers, methylation-specific PCR for the probe (PR3) initiates a signal dependent on methylation and bisulfite conversion of the FW, RV and PR3 sequences.

[0779] In various embodiments, we are talking about multiplex PCR analysis. As an example, Figure 4C shows the MethyLight technique using multiple probes (PR1, PR2, ... PR5), each targeting a different area. The combined signal from all probes (PR1, PR2, PR3, PR4 and PR5) is a measure of the amount/degree of methylation. In some embodiments, each probe has its own specific dye/fluorescent agent so that it will be detected independently of other probes. Thus, even where only one unmethylated target is present, the signal will still be detected (detected), for example, if PR3 is not methylated, then the signal from the remaining probes will be absent / weaker. In FIG. 4D shows the MethyLight technique using multiple probes (PR1…PR5), each targeting the same area but generating signals for different methylation patterns. While the methodology shown in Fig. 4C can provide detection over a longer region, this multiple probe technique on a single shorter region can be performed with sequence-specific primers or probes to examine the extent of methylation across the entire sequence after bisulfite conversion.

[0780] In some implementations, reverse complement multiplex analysis for both strands can be applied (see, for example, FIG. 26). After bisulfite conversion, both strands lose complementarity. Thus, sets of primers and probes can be designed for one strand or the other, and result in unique amplicons. In addition, to provide "greater opportunities" for detection, this approach can potentially improve specificity (at the lower limit of detection (LOD), if only one or the other strand ends up in the tube, then this technique will allow you to capture the signal). This technique allows you to expand the multiplex analysis for the detection of different CpGs in the same promoter region. Reverse complement multiplex analysis provides more opportunities to detect target methylation and distinguish heterogeneous methylation.

[0781] The above methods are illustrative and non-limiting. Using the guidance provided herein, many variations of the MSP and/or MethyLight assay may be available to those skilled in the art, which may be implemented in the reaction cartridge, for example, as described herein.

Direct sequencing

[0782] In some embodiments, DNA methylation status can be determined using direct sequencing techniques. In some embodiments, the method may employ PCR and standard Sanger DNA sequencing to directly detect nucleotides resistant to bisulfite conversion (see, e.g., Frommer et al. (1992) Proc. Natl. Acad. Sci. USA, 89 (5) : 1827-1831). In various embodiments, primers are designed to be specific for the target as well as bisulfite (e.g., primers containing CpG-free cytosines so that they are not complementary to non-bisulfite-treated DNA), flanking (but not involving) methylation of the site of interest. Thus, amplification of both methylated and unmethylated sequences will occur, as opposed to methylation-specific PCR. All sites with unmethylated cytosines are represented by thymine in the resulting amplified coding strand sequence and by adenine in the amplified non-coding strand. In some embodiments, nested PCR techniques may be used to increase the amount of product to be sequenced.

[0783] In some embodiments, sequencing may be performed in a cartridge. In other embodiments, the cartridge may be coupled (eg, fluidly coupled) to a sequencing device to perform a sequencing analysis. Alternatively, in some embodiments, the amplification product may be manually transferred from the cartridge to the sequencing system.

High precision melt curve analysis (HRM)

[0784] In some embodiments, high-precision melt curve analysis (HRM) can be used to differentiate between bisulfite-converted and non-bisulfite-converted DNA. HRM is a quantitative PCR technique in which PCR amplicons are analyzed directly by temperature ramping and subsequent release of an intercalating fluorescent dye during melting (see e.g. Wojdacz and Dobrovic (2007) Nucleic Acids Res. 35(6) : e41). The degree of methylation, as represented by the C/T content of the amplicon, determines the rate of melting and subsequent yield of the dye. This method allows direct quantitative measurement, however, the assessment of methylation in the amplified region is carried out in general, and not at specific CpG sites.

Pyrosequencing

[0785] In some embodiments, pyrosequencing (sequencing by synthesis) can be used to analyze bisulfite-treated DNA without using methylation-specific PCR (see, for example, Colella et al. (2003). BioTechniques 35(1): 146- 150; Tost et al (2003) BioTechniques 35(1): 152-156; and the like). Synthetic sequencing differs from Sanger sequencing in that it uses detection of phosphate release upon addition of nucleotides rather than end-of-chain with dideoxynucleotides. The DNA sequence can be determined from the light that is emitted when the next complementary nucleotide is inserted, based on the fact that usually only one of the four possible A/T/C/G nucleotides has been added and is available at a given time, so only one type of nucleotide (letter ) can be embedded in a single stranded template (which is a sequence to be determined).

[0786] Pyrosequencing can be applied after PCR amplification of the region of interest to determine the bisulfite-converted sequence in a specific region (eg, CpG regions). In some embodiments, the C/T ratio in individual regions can be quantified based on the amount of C and T introduced during sequencing.

[0787] In a modification of this technique, allele-specific primers can be used that introduce single nucleotide polymorphisms (SNPs) into the sequence of the sequencing primer(s), thus allowing separate analysis of maternal and paternal alleles (see, e.g., Wong et al. ( 2006) BioTechniques 41(6): 734-739). This modification is particularly useful for genomic imprinting analysis.

Base-Specific Cleavage Analysis

[0788] In some embodiments, the use of base-specific /MALDI-TOF cleavage allows full use of bisulfite conversion by introducing a base-specific cleavage step to gain additional information about nucleotide change (Enrich et al. (2005) Proc Natl Acad Sci USA 102 (44): 15785-15790). By first conducting in vitro transcription of the region of interest within the RNA (by adding the RNA polymerase promoter region to the PCR primer when amplifying), RNase A can be used to cleave the RNA transcript at base-specific sites. RNase A specifically cleaves RNA on ribonucleotides with cytosine and uracil, and base specificity is achieved by incorporating cleavage-resistant dTTP if cytosine-specific (C-specific) cleavage is desired, and by incorporating dCTP if uracil-specific (U-specific) cleavage is desired. The cleaved fragments can then be analyzed using MALDI-TOF or other method. Treatment with bisulfite results in either the insertion/departure of a cleavage site upon conversion of C to U, or a change in the mass of the fragment upon conversion of G to A in the amplified reverse chain. A C-specific cleavage will occur specifically at all methylated CpG sites. By analyzing the size of the resulting fragments (eg, using MALDI-TOF, capillary electrophoresis, microarray electrophoresis, and the like), it is possible to determine specific DNA methylation patterns at CpG sites within a region, rather than the overall degree of region methylation.

Methylation-sensitive single-strand conformational analysis (MS-SSCA).

[0789] Methylation-sensitive single-strand conformational analysis (MS-SSCA) is based on the single-strand conformational polymorphism analysis (SSCA) method, which was developed for single nucleotide polymorphism (SNP) analysis (Bianco et al. (1999) Hum. Mutat. 14(4) : 289-293). SSCA distinguishes single-stranded DNA fragments of identical size but differing sequence based on different migration on non-denaturing electrophoresis. In MS-SSCA, this is used to distinguish between bisulfite-treated PCR-amplified regions containing the CpG regions of interest. Although SSCA lacks sensitivity when there is only a single nucleotide difference, in most areas of interest, some amount of C/T conversion often occurs with bisulfite treatment, and as a result, sensitivity can be high. In some embodiments, MS-SSCA can also provide a semi-quantitative analysis of the degree of DNA methylation, based on the intensity ratio of the bands. Typically, however, MS-SSCA assesses all CpG regions in the region of interest rather than individual region methylation.

methylation targets.

[0790] As noted above, DNA methylation is of interest in a wide range of cases. In some embodiments, the amount of DNA methylation is of clinical interest, especially in oncology. Abberant patterns of DNA methylation (hypermethylation and hypomethylation when compared with healthy tissues) have been associated with a large number of human malignancies. Hypermethylation usually occurs on CpG islands in the promoter region and is associated with gene inactivation. Decreased levels of DNA methylation in leukocytes are associated with many types of cancer (Zhang et al. (2011) Epigenetics, 6(3): 293-299). Global hypomethylation is also implicated in the development and progression of cancer through various mechanisms. Hypermethylation of tumor suppressor genes and hypomethylation of oncogenes are predominantly present (see, for example, Lund et al. (2004) J. Biol. Chem. 279(28): 29147-29154).

[0791] To this end, it should be noted that DNA methylation is a prognostic indicator of stage 1 non-small cell lung cancer (NSCLC). In particular, hypermethylation of five genes was found to be significantly associated with shorter disease-free survival (RFS) in stage 1 NSCLC: HIST1H4F, PCDHGB6, NPBWR1, ALX1, and HOXA9. A signature based on the number of hypermethylation events separates patients at high and low risk for stage 1 NSCLC (see, for example, Sandoval et al. (2013) J. Clin. Oncol, 4140-4147).

[0792] It was also found that in malignant glioma, the MGMT gene is inactivated due to methylation of its promoter region. The preliminary conclusion drawn from the results of this study is that when the MGMT gene is methylated, a better response to chemotherapy is possible (since the tumor does not have the means to repair DNA damage caused by alkylating agents). In glioma, MGMT promoter methylation is a favorable prognostic marker for both radiotherapy and chemotherapy (see, for example, //neurosurgery.ucsd.edu/brain-tumor-research-mgmt/).

[0793] As an additional example, Table 3 shows various genes that are hypermethylated in certain cancers.

[0794] In various illustrative, but non-limiting embodiments, the measurement of methylation of any one or more of the promoters of the following genes is considered: TM6SF1, AKR1B1, HIST1H4F, PCDHGB6, NPBWR1, ALX1 and HOXA9.

Pancreas cancer

[0795] In some embodiments, methylation status is determined for one or more promoters whose methylation status is a marker for the presence and/or prediction of pancreatic cancer. It has been determined that the methylation frequency of one or more of ADAMTS1 or BNC1 can be used to detect and/or grade pancreatic cancer. Thus, illustrative but non-limiting methylation markers for pancreatic cancer include, but are not limited to, ADAMTS1 and/or BNC1. Examples of primers and probes for detecting methylation in the promoters of these genes are shown in Table 4 below (with reference to Table 5 for specific sequences) and Table 12 in Example 4). In some embodiments, primers and probes are provided to detect forward strand methylation of the converted DNA and/or to detect reverse strand methylation of the converted DNA.

Mammary cancer.

[0796] In some embodiments, methylation status is determined for one or more promoters whose methylation status is a marker for the presence and/or prognosis of breast cancer. Examples of methylation markers for breast cancer include, but are not limited to, RASSF1A and/or AKR1B1 and/or HOXB4 and/or HIST1H3C and/or RASGRF2 and/or TM6SF1. Examples of primers and probes for detecting methylation in the promoters of these genes are shown in Table 4 below (with reference to Table 5 for specific sequences) and in Table 11 in Example 4.

[0797] In some embodiments, methylation status is determined for one or more promoters whose methylation status is a marker for the presence or likelihood of lung cancer. Examples of methylation markers for lung cancer include, but are not limited to, CDO1, SOX17, TAC1, and/or HOXA7.

[0798] The methods provided herein are not limited to determining the methylation of the promoters of these genes. When using the methods presented in the present description, it is possible to evaluate the methylation, in most cases, of any investigated target.

[0799] However, it should be noted that the measurement of DNA methylation should not be limited to the measurement of methylation of CPG islands in promoters. For example, it has been shown that methylation of the translated region (gene body) can also alter gene expression and represent a therapeutic target in cancer (see, for example, Yang et al. (2014) Cancer Cell, 26(4): 577-590).

[0800] Additionally, the measurement of DNA methylation has prognostic/therapeutic applications in pathologies other than cancer. For example, aberrant methylation at chromosome regions 13, 18, 21, X, and Y can be used to diagnose Down syndrome (see, e.g., Patsalis et al. (2012) Exp. Opin. Biol. Ther. 12 (Suppl. 1) : S155-S161). Because fetal DNA and maternal DNA are methylated differently, extracellular DNA in maternal plasma may represent a source of fetal DNA that can be non-invasively obtained and used to assess the methylation status of the aforementioned chromosomes (or other chromosomes or genes).

[0801] As noted above, in some embodiments, the cartridges and methods provided herein are also used to determine mRNA levels, for example, to determine the expression of various methyltransferases. In some embodiments, the level of RNA expression is determined for a methyltransferase selected from the group consisting of DNMT1, DNMT2, DNMT3A, DNMT3B, and TNMT3L.

Primers/Probes and multiplex analysis

[0802] In various embodiments, the methods provided herein may include nested PCRs, and the cartridges provided herein may contain reagents (eg, primers and probes) for such nested PCRs. For example, in some embodiments, methylation is determined for one, two, three, four, five, or six genes (gene promoters). Since bisulfite conversion of DNA converts cytosine residues to uracil, but does not affect 5-methylcytosine residues, the forward and reverse strand of the converted (bisulfite-converted) DNA will no longer be complementary. Accordingly, it is possible to test the forward and reverse chains independently (eg in multiplex PCR), providing additional specificity and sensitivity for methylation determination. In such cases, a single target assay may include a duplex multiplex analysis, and an assay for two, three, four, five, or six target genes may include a quad multiplex, 6 multiplex, 8 multiplex, 10 -x multiplex or 12x multiplex. In some embodiments, the assay may be split into two multiplex reactions, such as independent forward and reverse chain assays. However, it should be understood that when split into multiple multiplex assays, there is no need to group them forward or reverse, but may simply include the primer/probe kits that are most compatible with the conditions of a particular PCR.

[0803] As noted above, many cancers can be identified and/or staged and/or predicted by detecting/analyzing methylation status on forward and/or reverse chain gene promoters whose methylation status (or lack thereof) ) is associated with cancer. Examples of target genes (promoters) associated with various cancers are described above and shown below in Table 4. It should be understood that methylation (forward and/or reverse) of one or more of the genes shown in Table 4 for each type of cancer , may be determined for the purpose of identifying and/or staging and/or determining prognosis for a given type of cancer. In some embodiments, the methylation status of all genes presented for a particular type of cancer (forward and/or reverse chain) can be determined in a single multiplex PCR.

[0804] Examples of primers and probes for determining promoter methylation of various genes are shown in Table 5 below and in Tables 11 and 12 in Example 4. In some embodiments, these primers and/or probes are particularly suitable for use in multiplex amplification.

[0805] It should be noted that these primers and probes identify the position of various fluorophores and quenchers. However, it should be understood that certain fluorophores and quenchers are illustrative and non-limiting, and a variety of amplification and/or detection strategies may be applied in the cartridge provided herein. Accordingly, in various embodiments, the methods and devices provided herein may employ a variety of different nucleic acid hybridization probes. Typically, probes use a change in the fluorescence of a fluorophore due to a change in its interaction with another molecule or moiety, caused by a change in the distance between the fluorophore and the interacting molecule or moiety, to generate a signal. Alternatively, other methods for detecting polynucleotides in a sample involve the use of, including but not limited to, radioactively labeled probes.

[0806] Fluorescence-based analysis relies primarily on fluorescence resonance energy transfer or "FRET" for signal generation, whereby a change in fluorescence is caused by a change in distance separating a fluorophore from an interacting resonance energy acceptor, either another fluorophore, or a quencher . Combinations of a fluorophore and an interacting molecule or moiety, including quencher molecules or moieties, are known as "FRET pairs". The mechanism of interaction of FRET pairs mainly requires that the absorption spectrum of one member of the pair overlaps the emission spectrum of the other member, the first fluorophore. If the interacting molecule or fragment is a quencher, then its absorption spectrum largely overlaps the emission spectrum of the fluorophore (see, e.g., Stryer (1978) Ann. Rev. Biochem. 47: 819-846; Selvin (1995) Meth. Enzymol. 246 : 300-335; and the like). Effective interaction in FRET is achieved mainly when the absorption and emission spectra of the pair have a large degree of overlap. The effectiveness of the interaction at FRET is directly proportional to the overlap. Generally, a high signal amplitude (ie, a high degree of overlap) is desirable. Thus, according to this principle, FRET pairs are selected, including fluorophore-quencher pairs.

[0807] Numerous probe-labeled nucleic acid hybridization and detection methods are known that use FRET and FRET pairs. One such scheme is described by Cardullo et al. (1988) Proc. Natl. Acad. sci. USA, 85: 8790-8794 and Heller et al. EP 0070685. It uses a probe containing a pair of oligonucleotides complementary to the contiguous stretch of the target DNA strand. One probe molecule contains a fluorescent label, a fluorophore, at the 5' end, and the other probe molecule contains a different fluorescent label, also a fluorophore, at the 3' end. When the probe hybridizes to the target sequence, the two tags converge very close to each other. When the sample is stimulated with light of the proper frequency, there is a resonant transfer of fluorescence energy from one label to another. FRET results in a measurable change in the spectral response from the tags, signaling the presence of targets. One of the labels may be a "quencher", which may be, among other things, interacting (interactive) fragment (or molecule), which releases the absorbed energy in the form of heat.

[0808] Another kind of nucleic acid hybridization probe method using FRET pairs is the "TaqMan®" method described in Gelfand et al. US Patent No. 5210015 and Livakef al. US Patent No. 5538848. The probe is typically a single stranded oligonucleotide labeled with a FRET pair. In the TaqMan® method, DNA polymerase releases one or more nucleotides by cleaving an oligonucleotide probe upon hybridization to a target strand. This release provides a way to separate the quencher tag and the fluorophore tag from the FRET pair.

[0809] In some embodiments, non-FRET fluorescent probes can be used, such as those described, for example, in Tyagi et al., US Pat. No. 6,150,097. For example, in Tiyagi et al. described how changes in the absorption spectra of pairs of labels can be used as a detectable signal as an alternative to a change in fluorescence. When using a change in absorbance, a pair of labels can include any two chromophores, which are fluorophores, quenchers, and other chromophores. A pair of labels can even be represented by the same chromophores.

[0810] In some embodiments, dyes and other agents, such as quenchers, are incorporated into primers and/or probes that are used in the methods and cartridges described herein. In some embodiments, such dyes and quenchers include, but are not limited to, dyes (fluorophores) suitable for use as FRET probes. In some embodiments, the dyes and/or quenchers contain modified nucleotides. "Modified nucleotide" refers to nucleotides that are chemically modified but still perform the function of a nucleotide. In some embodiments, the modified nucleotide has a chemical moiety, such as a dye or quencher, covalently linked, which can be introduced into the polynucleotide, for example, by solid phase synthesis of the polynucleotide. In some embodiments, the modified nucleotide contains one or more reactive groups that react with a dye or quencher before, during, or after the introduction of the modified nucleotide into the nucleic acid. In some embodiments, the modified nucleotide is an amino-modified nucleotide, i. a nucleotide that has been modified to have a reactive amino group. In some embodiments, the modified nucleotide contains a modified base moiety, such as uridine, adenosine, guanosine, and/or cytosine. In some embodiments, the amino-modified nucleotide is selected from 5-(3-aminoallyl)-UTP; 8-[(4-amino)butyl]-amino-ATP and 8-[(6-amino)butyl]-amino-ATP; N6-(4-amino)butyl-ATP, N6-(6-amino)butyl-ATP, N4-[2,2-hydroxy-bis-(ethylamine)]-TP; N6-(6-Amino)hexyl-ATP; 8-[(6-Amino)hexyl]-amino-ATP; 5-propargylamino-STR, 5-propargylamino-UTP. In some embodiments, nucleotides with different nucleobase fragments are similarly modified, for example, 5-(3-aminoallyl)-GTP instead of 5-(3-aminoallyl)-UTP. Many amino-modified nucleotides are commercially available from, for example, Applied Biosystems, Sigma, Jena Bioscience and TriLink. An illustrative, but non-limiting, list of suitable fluorophores is provided in Table 6.

[0811] In the event that the assay method is designed to detect a single target DNA sequence, then only one fluorescence hybridization probe is required for use and, in some embodiments, FAM, TET, or HEX (or one of their alternatives shown in Table 7) will be the optimal fluorophore as a probe label. These fluorophores can be easily excited and detected in various spectrophotometric thermal cyclers. In addition, due to the availability of amidophosphite derivatives of these fluorophores and the availability of porous glass columns with quencher-linked control-, fluorescence hybridization probes with these labels can be fully synthesized during automatic DNA synthesis, which is an advantage consisting at a relatively lower cost and less labor in obtaining the probe.

[0812] In some embodiments, multiple target genes are detected in a single multiplex reaction. In some embodiments, each probe specific for a particular gene is spectrally distinguishable (detectable different) from other probes used in the multiplex reaction. Those skilled in the art are aware of combinations of probes suitable for multiplex detection. For example, exemplary combinations of detectably different fluorophores in four-target multiplex systems include, but are not limited to:

[0813] 1) FAM, TMR, Texas red and Cy5;

[0814] 2) FAM, TET, TMR and Texas Red;

[0815] 3) FAM, HEX, Texas red and Cy5; and

[0816] 4) FAM, Cy3, Texas red and Cy5.

[0817] An example of a combination of detectably different fluorophores in five-target multiplex systems is FAM, TET, TMR, Texas Red, and Cy5. Examples of combinations of detectably different fluorophores in six-target multiplex systems include, but are not limited to:

[0818] 1) FAM, TET, HEX, TMR, ROX and Texas red; and

[0819] 2) FAM, HEX, LC red 610, LC red 640, LC red 670 and LC red 705.

[0820] It should be understood that these combinations of fluorophores are illustrative and non-limiting, and various other fluorophores are available to those skilled in the art.

[0821] As noted above, to design fluorescence hybridization probes that use fluorescence resonance energy transfer (FRET), fluorophore-quencher pairs should be selected that have sufficient spectral overlap. Fluorophores with maximum emission lengths between 500 and 550 nm, such as FAM, TET, and HEX, are best quenched by quenchers with maximum absorption lengths between 450 and 550 nm, such as dabcyl, BHQ-1, and the like (see, for example, Table 8 with examples of quench marks). Fluorophores with maximum emission lengths above 550 nm, such as rhodamines (including TMR, ROX and Texas red) and Cy dyes (including Cy3 and Cy5) are effectively quenched by quenchers with absorption maximums above 550 nm (including BHQ-2).

[0822] For the design of fluorescent hybridization probes that use contact quenching, any non-fluorescent quencher can serve as the desired energy acceptor from the fluorophore. For example, Cu3 and Cu5 are effectively extinguished by BHQ-1 and BHQ-2 quenchers.

[0823] In some embodiments, the nucleotides can quench the fluorescence of fluorophores, where guanosine is the more effective quencher, followed by adenosine, cytidine, and thymidine. In general, fluorophores with excitation wavelengths between 500 and 550 nm are more efficiently quenched by nucleotides than fluorophores with longer excitation wavelengths. When designing fluorescence hybridization probes to provide stronger fluorescence signals from a fluorophore, it may be desirable to avoid placing the fluorescent label directly next to the guanosine.

[0824] The stabilizing effect of certain fluorophore-quencher pairs that interact in contact quenching can have important implications for the design of hybridization probes (see, for example, Marras et al. (2002) Nucleic Acids Res. 30: e122; Johansson et al. (2002) J. Am. Chem. Soc. 124: 6950-6956). For example, hybridization probes labeled with a fluorophore that quenched either BHQ-1 or BHQ-2 have been found to increase the hybridization melting point by about 4°C compared to hybridization probes with the same probe sequences but labeled with fluorophores. which are extinguished with DABCYL. A high affinity was also noted between the Cy, Cy3, and Cy5 dyes and the Black Hole, BHQ-1, and BHQ-2 quenchers.

[0825] Based on the foregoing, and in view of the examples and recommendations provided herein, it is understood that many primer/probe combinations are available for use in the methods and cartridges provided herein.

Cartridge, modules and systems for DNA methylation analysis

[0826] In some embodiments, cartridges are provided for performing the methods described herein (eg, determining DNA methylation and optionally RNA expression). In some embodiments, the cartridge includes a column containing a first matrix material, a sample receiving chamber, a temperature-controlled channel or chamber, a plurality of chambers containing reagents and/or buffers, and during use, at least one of these chambers contains a DNA conversion reagent. (e.g., 1,4-diazabicyclo[2.2.2]-octane (DABSO)) and/or bisulfite reagent), and at least one of said chambers contains a desulfurization/elution buffer, wherein said cartridge optionally contains a second column containing the specified second matrix material. In some embodiments, the cartridge is configured so that during use the cartridge includes a chamber containing a reagent containing guanidine thiocyanate - ethanol (GTC-EtOH). In some embodiments, the second column is not present, while in other embodiments, the second column is present. In some embodiments, the temperature controlled channel or chamber may simply be a heating channel or chamber, or may be a thermal cycling channel or chamber. In some embodiments, the cartridge further comprises a second heating channel or chamber (eg, a second thermal cycling channel or chamber). In some embodiments, the cartridge is configured to have the DNA conversion step (eg, bisulfite incubation) and/or the desulfurization step occur in the same reaction tube or chamber in which one or more PCRs later take place.

[0827] In some embodiments, the bisulfite reagent is provided as a component of the cartridge. In certain other embodiments, the cartridge is configured to add the bisulfite reagent to the cartridge at or near the time the sample is placed in the cartridge. Optionally, the bisulfite reagent is added directly to the inside of the chamber in the cartridge, while in other embodiments, the bisulfite reagent is injected into a loading port on the cartridge (eg, sample port) to introduce the bisulfite reagent into the cartridge. In some embodiments, the bisulfite reagent is injected into the cartridge by a cartridge management system (eg, operating module) during operation of the cartridge to determine DNA methylation.

[0828] In some embodiments, a reagent containing guanidine thiocyanate (eg, GTC-EtOH) is provided as a component of the cartridge. In certain other embodiments, the cartridge is configured to add a guanidine thiocyanate containing reagent to the cartridge at or near the time the sample is placed in the cartridge. In some cases, the guanidine thiocyanate containing reagent is added directly to the inside of the chamber in the cartridge, while in other embodiments, the guanidine thiocyanate containing reagent is injected into a loading port on the cartridge (e.g., sample port) to introduce the bisulfite reagent into the inside of the cartridge. In some embodiments, the guanidine thiocyanate-containing reagent is injected into the cartridge by a cartridge control system (eg, operating module) during operation of the cartridge to determine DNA methylation.

[0829] In various illustrative, but non-limiting embodiments, the conversion reagent (e.g., bisulfite reagent) contains a compound selected from the group consisting of sodium metabisulfite, potassium bisulfite, cesium bisulfite, 1,4-diazabicyclo[2.2.2]-octane (DABSO) and ammonium bisulfite. In some embodiments, the bisulfite is present in a reactant mixture containing scavengers (eg, Trolox, hydroquinone, etc.) to prevent oxidation of sulfites and/or catalysts. In some embodiments, the bisulfite is present in a reactant mixture containing polyamines as catalysts.

[0830] In various embodiments, the first matrix material and/or said second matrix material, if present, comprises a material selected from the group consisting of glass or silica, an ion exchange resin, and hydroxyapatite.

[0831] In various embodiments, the cartridge includes one or more chambers (for example, 1 chamber, 2 chambers, 3 chambers, 4 chambers, etc.), each of which contains one or more reagents selected from the group consisting of specific with respect to methylation of PCR primers, methylation-specific PCR probes, PCR enzyme(s) (eg polymerase), reverse transcriptase and PCR reaction buffer.

[0832] In some embodiments, the cartridge includes one or more chambers that contain primers specific for bisulfite-converted methylated and/or unmethylated sequences. In some embodiments, the cartridge includes one or more chambers that contain primers and probes for the MethyLight PCR technique. In some embodiments, the cartridge includes one or more chambers that contain TaqMan PCR reagents. In some embodiments, the cartridge includes one or more chambers containing one or more fluorescent probes that are markers for amplified methylated sequences and/or one or more fluorescent probes that are markers for amplified unmethylated sequences. In some embodiments, the probes contain a fluorescent reporter dye and a quenching dye, wherein the probe generates a cleavage signal through the 5'-3' nuclease activity of Taq DNA polymerase. In some embodiments, the cartridge contains a plurality of probes, each specific to a different methylated site in the amplified region of interest. In some embodiments, the cartridge contains a single probe specific for a single methylated site in the amplified region of interest. In some embodiments, the cartridge contains a plurality of probes, each specific for the same methylated site in the amplified region of interest.

[0833] Examples of primers and probes include, but are not limited to, primers and/or probes for determining the methylation of the promoter region of a gene selected from the group consisting of APC, ARF, CDKN2B, CDKN2A, BRCA1, VLH, hMLH1, MGMT. RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1, AKR1B1, HIST1H4F, PCDHGB6, NPBWR1, ALX1 and HOXA9. In some embodiments, primers and/or probes are selected to determine the methylation of the promoter region of a gene selected from the group consisting of MGMT, RASSF1A, ADAMTS1, BNC1, HIST1H3C, HOXB4, RASGRF2, TM6SF1, and AKR1B1. In various embodiments, PCR primers and/or probes and/or enzymes are presented on beads (beads), for example, as described in US patent publication No: 2006/0068399, which is incorporated herein by reference with respect to beads and composition. balls.

[0834] In various embodiments, the cartridge is configured to have the sample receiving chamber, said column(s), the plurality of chambers, and the temperature controlled channel or chamber have a selective fluid connection. In some embodiments, the selective fluid connection is provided by microfluidic channels and valves. In some embodiments, a selective fluid connection is provided by placing a sample receiving chamber, said column(s), said plurality of chambers, a heating channel or chamber, or a port within a channel or chamber located around a central valve and having a selective fluid connection. with a channel in the specified central valve.

[0835] In some embodiments, the cartridge is configured to, during use, the cartridge comprises: a first chamber containing a sample; a second chamber containing a solution of guanidine thiocyanate-ethanol (GTC-EtOH); a third chamber containing a bisulfite reagent; a fourth chamber containing a buffer; a fifth chamber containing the wash solution; and a sixth chamber containing an elution/desulfurization reagent. In some embodiments, the cartridge contains a seventh chamber containing PCR primers and/or probes and/or PCR enzymes. In some embodiments, the cartridge contains an eighth chamber also containing PCR primers and/or probes and/or PCR enzymes.

[0836] Figures 1A, 1B, and 2 depict one of the cartridges suitable for practicing the methods described herein. The presented cartridges are based on the GENEXPERT® cartridge (Cepheid, Inc., Sunnyvale, CA). Referring to Figure 2, panel A, cartridge 200 includes a cartridge body 202 containing a plurality of reactant chambers and/or buffers 208. The chambers are arranged around a central syringe barrel 206 that is in fluid communication with valve body 210 ( panel B and Figure 1B) and sealed with a seal 204. The valve body 210 may include a plug 212 and the entire cartridge body may be secured to the cartridge base 226. A "piston" (not shown) may be actuated to move fluid into the interior of the syringe barrel 206, and rotation of syringe barrel 206 and associated valve body 212 provides selective fluid communication between cavities 214 of chambers 208, which may contain matrix material as described herein and function as a column. In various embodiments, the cartridge further includes one or more temperature controlled channels or chambers 216, which may, in some embodiments, function as thermal cycling chambers. Temperature controlled channels or chambers also have selective fluid communication with cavity 214 and/or chambers 208. Referring to FIG. bases in sequencing operations and the like.

[0837] In some embodiments, the cartridge 200 is configured to receive the reaction module 300, for example, in accordance with the image in figure 3A. As shown in Figure 3B, the module is configured to receive a cartridge 200. In some embodiments, the reaction module is provided with heating plates 308 to heat the temperature controlled chamber or conduit. Optionally, the module further includes a fan 304 to provide cooling if the temperature controlled duct or chamber is a thermal cycling duct or chamber. An electronic board 302 may be installed to transfer information (eg, optical information) to a computer for analysis. , 4 or more) optical signals representing, for example, various nucleic acid targets. In various implementations, an electrical connector 312 may be installed to interface the module with a system (for example, a system controller or a discrete analysis/controller unit. As shown in Figure 3B, a sample may be introduced into the cartridge using a pipette 310.

[0838] In some embodiments, the module also includes a controller that controls the piston in the syringe barrel and the rotation of the valve body.

[0839] In some embodiments, a system (eg, device) is represented. One illustrative, but non-limiting, implementation is depicted in Figure 3C. In some embodiments, the device includes a compartment configured to receive one or more work modules, where each work module is configured to attach and manage a removable cartridge as described herein. In some embodiments, the system is configured to control operating modules to perform sample processing to determine the methylation of one or more target nucleic acids and optionally to determine the level of one or more target RNA/DNA sequences within a respective removable sample cartridge, said sample processing inside an appropriate removable sample cartridge, the method is operated as described herein. In some embodiments, the system is configured to accommodate one sample processing module. In some embodiments, the system is configured to accommodate one or more sample processing modules, or at least 4 sample processing modules, or at least 8 sample processing modules, or at least 12 sample processing modules, or at least 16 modules sample processing modules, or at least 20 sample processing modules, or at least 24 sample processing modules, or at least 28 sample processing modules, or at least 32 sample processing modules, or at least 64 sample processing modules, or at least 128 sample processing modules. In some embodiments, the system is provided with a user interface that allows the user to enter operating instructions and/or monitor the operation of the cartridges to determine DNA methylation.

[0840] In addition to the fact that the methods presented herein are primarily described in relation to the GENEXPERT® cartridge from Cepheid Inc. (Sunnyvale, CA) (see, for example, figure 1A), it should be understood that in view of the recommendations presented herein, the methods can be implemented based on other cartridge/microfluidic systems. Such cartridge/microfluidic systems may include, for example, microfluidic systems implemented using light lithography, micro/nano-fabricated microfluidic systems implemented using hard lithography, and the like.

High Volume Sample Preparation (HVSP) Cartridge

[0841] In various embodiments, high volume sample cartridges are provided. In some embodiments, the sample preparation cartridges include GENEXPERT® cartridges modified for high volume sample preparation (eg, as depicted in Figure 20). In some embodiments, for example, if the cartridge is made on the basis of the GENEXPERT® cartridge, then it includes one or more channels or chambers containing an affinity matrix that binds DNA, a plurality of chambers located around the central valve assembly and having selective fluid connection with said central valve assembly, wherein the central valve assembly is configured to accommodate a piston capable of drawing liquid into or out of the chamber when fluidly connected to said central valve, where said plurality of chambers includes at least two different chambers, each of which configured to receive up to and including about 4 ml (or up to and including about 5 ml) of sample solution (in some embodiments, chamber 2 has a maximum volume of about 4 ml, while chamber 3 has a maximum volume of about 4.5 ml), a chamber containing PEG (for example, PEG200), a chamber containing an alkaline solution (eg KOH solution) and a chamber containing a buffer (eg Tris). In some embodiments, the plurality of chambers includes at least three different chambers, each of which is configured to receive up to and including about 4 ml (or up to and including about 5 ml) of sample solution. In some embodiments, the plurality of chambers includes a chamber containing a wash solution (eg, GTC-ethanol wash solution, which is typically guanidine thiocyanate 1.25 M, Tris 25 mM, pH 7.0, 50% ethanol). In some embodiments, the cartridge includes a chamber configured to withdraw a spent sample. In some embodiments, the sample chambers contain sample solution, GTC, and alcohol (eg, isopropanol) during use. In some embodiments, the sample chambers during use contain sample solution, GTC, and alcohol in substantially equal volumes. In some embodiments, the cartridge during use contains 4 ml of the sample solution, GTC and isopropanol, which are located in each of these chambers configured to receive the sample. In some embodiments, the cartridge provides DNA or RNA recovery that is substantially linear with sample volume, from 0.5 ml to about 4 ml.

[0842] In some embodiments, the HVSP cartridge is configured to perform a DNA conversion (eg, a bisulfite conversion) to perform a methylation assay. Accordingly, in some embodiments, the HVSP cartridge is configured to be placed or received directly in the process or shortly before the use of the conversion reagent (e.g., bisulfite reagent, 1,4-diazabicyclo[2.2.2]-octane (DABSO), etc. .). In some embodiments, the HVSP cartridge may also be configured to accommodate reagents for desulfurizing the converted DNA and allowing for desulfurization. Alternatively, in some embodiments, the conversion is performed in an HSVP cartridge, and desulfurization and methylation analysis (eg, PCR) are performed in a second cartridge (eg, as depicted in the process diagram of Figure 20B).

Dual Cartridge Methylation Assay

[0843] In various embodiments, the methylation assay methods provided herein are performed using a two-cartridge system (a set of two cartridges such as a "first" cartridge (e.g., a high-volume sample preparation cartridge) and a "second" cartridge (e.g., a qPCR cartridge). )), for example, as shown in Figure 20B. As depicted in this figure, in some embodiments, sample preparation and bisulfite conversion may be performed in the first cartridge. Then the converted DNA is transferred to the second cartridge, where it is washed and desulfurized. In some embodiments, the implementation of the second cartridge is additionally involved in the analysis of the converted (or unconverted) DNA, for example, using PCR (eg, PCR, specific for methylation).

[0844] In some embodiments, the first cartridge may be a high sample volume cartridge as described above, wherein the sample preparation cartridge contains a bisulfite conversion reagent as described herein. In some embodiments, the high volume sample cartridge is provided with a high volume sample chamber or multiple sample chambers to allow purification and conversion of large amounts of DNA.

[0845] In some embodiments, the first cartridge of the dual cartridge kit includes a sample receiving chamber, a "column" containing a first matrix material, a temperature controlled channel or chamber, a sample withdrawal chamber, and a plurality of chambers containing reagents and/or buffers. Typically, during use, at least one of the chambers contains a bisulfite reagent (eg, as described herein). In some embodiments, the second cartridge of the dual cartridge kit includes a sample receiving chamber, a "column" containing matrix material, a temperature controlled channel or chamber, a plurality of chambers containing reagents and/or buffers. Typically, during use, at least one of the plurality of chambers in the second cartridge contains a desulfurization and/or elution reagent. In some embodiments, the second cartridge contains reagents for PCR amplification (eg, specific for PCR methylation) and detection of amplification products.

[0846] In certain illustrative but non-limiting embodiments, the first cartridge is used for sample preparation (e.g., binding DNA to a first template material (e.g., glass fiber), washing and eluting the bound DNA) and bisulfite conversion of the washed DNA. In some embodiments, the bisulfite conversion comprises combining the washed DNA with a bisulfite reagent and heating the mixture in a temperature controlled channel or chamber. The resulting converted DNA is then mixed with wash buffer (e.g. 1.25 M GTC, 25 mM Tris pH 7.0, 50% ethanol) and moved inside the sample collection chamber (e.g. Chamber 2) from where it can be removed (e.g. withdrawn with a pipette, syringe or syringe pump, etc.).

[0847] In some embodiments, bisulfite-converted DNA in wash buffer is introduced into the sample receiving chamber of the second cartridge. The second cartridge functions to bind the DNA to a second matrix material (eg, a glass fiber "column"), wash and elute the bound DNA, and desulfurize the DNA. In some embodiments, the DNA is desulfurized on the column or after it has been eluted from the second matrix material. In some embodiments, the DNA is desulfurized after removal from the second template material. In some embodiments, the desulfurized DNA is then mixed with, for example, enzyme beads and primer/probe beads in a second cartridge. In some embodiments, the desulfurized DNA is withdrawn and injected into a third cartridge or other reaction system for further analysis (eg, sequencing).

[0848] In some embodiments, in the first cartridge, the sample receiving chamber, the column, the plurality of chambers, the sample withdrawal chamber, and the heating channel or temperature controlled chamber are fluidly selectively connected (eg, via microfluidic channels and/or valves); and/or, in the second cartridge, the sample receiving chamber, the column, the plurality of chambers, and the heating channel or temperature control chamber are fluidly selectively connected (eg, via microfluidic channels and/or valves).

[0849] In some embodiments, in the first cartridge, the sample receiving chamber, the column, the plurality of chambers, the sample withdrawal chamber, and the temperature controlled channel or chamber, or a port to the temperature controlled channel or chamber, are located around a central valve and have a selective fluid connection with one or more channels in the central valve. The central valve may be configured to accommodate a piston capable of withdrawing fluid into or out of the chamber(s) when in fluid communication with the central valve. In some embodiments in the second cartridge, the sample receiving chamber, column, plurality of chambers, and channel or temperature controlled chamber or port to the channel or temperature controlled chamber are located around the central valve and are in selective fluid communication with one or more channels in the central valve. . In some embodiments, the central valve is configured to receive a piston capable of withdrawing fluid into or from one or more chambers when in fluid communication with the central valve.

[0850] In some embodiments, the first cartridge and/or the second cartridge is a GENEXPERT® cartridge or a modified GENEXPERT® cartridge (eg, as depicted in Figures 1A, 1B, 2, 13A, 17, and 20A). In certain illustrative but non-limiting embodiments, the first cartridge is configured according to Table 9. In some embodiments, the chamber numbering corresponds to the chamber numbering shown in Figure 1B.

[0851] In certain illustrative, but non-limiting embodiments, the second cartridge is configured according to Table 10. In some embodiments, the chamber numbering corresponds to the chamber numbering depicted in Figure 1B.

[0852] In some embodiments, the second cartridge is configured to use one or more of the following genes as a control gene: MYOD1, COL2A1, NONO, and/or TUBB.

[0853] In some embodiments, the use of a two-cartridge format is possible, among other things, to perform non-nested PCR or methylation-specific pre-amplification in the 2nd cartridge.

[0854] The above configurations are illustrative and non-limiting. Many other two-cartridge formats may be available to those skilled in the art using the guidance provided herein.

[0855] As an example, figures 35, 36 and 37 show data with the results of analysis in a two-cartridge format for urine and sputum samples. In particular, figure 35 shows the analysis of methylation of BNC1 and ACTV in a two-cartridge format. Serum was loaded with 0, 25, 50 and 100 copies of 100% methylated control DNA and processed in the 1st sample preparation cartridge (see, for example, Table 9), and then qPCR was performed in the second cartridge with a sample of the extracted converted DNA (See, for example, Table 10), which contained primer and probe sets for the methylated BNC1 promoter and a methylation-independent primer and probe set for the ACTB promoter.

[0856] Figure 36 shows the results of a bisulfite conversion analysis of urine samples from a healthy subject. 2.0 ml of urine from a healthy subject was mixed with 1.5 ml of lysis buffer [4.5 M GTC, 1% Tween 20] and 0.5 ml of ethanol under Conditions #6. 1.5 ml of urine from a healthy subject was mixed with 1.25 ml of lysis buffer and 1.25 ml of ethanol in Conditions No. 7. These 4.0 ml samples were pipetted into the Chamber 2 methylation assay cartridge 2 and converted ASTB (right) and unconverted HMBS (left) were analyzed.

[0857] The figure 37 presents the results of the analysis of methylation of sputum samples from a healthy subject and with cancer. Seven sputum samples were tested for SOX17, TAC1 and HOXA7 methylation using the GENEXPERT® methylation cartridge (C) and comparative analysis (M). This figure shows both the direct values of Ct and deltaCt (for ASTV).

[0858] The above configurations are illustrative and non-limiting. Many other two-cartridge formats may be available to those skilled in the art using the guidance provided herein.

cf-DNA Sample Preparation Cartridge.

[0859] In some embodiments, a sample preparation cartridge is provided that is particularly well suited for the preparation (and, if necessary, analysis) of nucleic acid from plasma or serum. One illustrative, but non-limiting, implementation is shown in Figure 17. As shown in some embodiments, the cartridge comprises a channel or chamber containing an affinity template that binds DNA, a plurality of chambers located around the central valve assembly and having a selective fluid connection. with a central valve assembly, wherein the central valve assembly is configured to accommodate a piston capable of taking liquid into or out of the chamber when fluidly connected to said central valve, the plurality of chambers including: a chamber configured to receive up to and including about 5 ml or up to and including about 4 ml of sample solution; a chamber containing PEG (eg PEG200); a chamber containing GTC-EtOH; a chamber containing an alkaline solution (eg KOH); and a chamber containing a buffer (eg Tris). In some embodiments, the plurality of chambers further includes a chamber containing a conversion reagent (eg, a bisulfite reagent). In some embodiments, the plurality of chambers includes a chamber containing a wash solution (eg, GTC-ethanol wash solution (typically 1.25 M guanidine thiocyanate, 25 mM Tris pH 7.0, 50% ethanol)). In some embodiments, the plurality of chambers includes a chamber containing beads containing one or more PCR primers and/or probes. In some embodiments, the PEG-containing chamber contains about 1 ml of PEG. In some embodiments, the chamber containing the alkaline solution contains about 500 μl of the solution. In some embodiments, the chamber containing GTC-EtOH contains about 2 ml of GTC-EtOH. In some embodiments, the chamber containing the buffer contains approximately 2 ml of buffer.

[0860] It should be understood that this configuration is illustrative, and many other preparation cartridge configurations may be available to those skilled in the art using the guidance provided herein.

Using DABSO as an alternative to bisulfite

[0861] Surprisingly, it was found that DABSO can be used to perform DNA conversion in a manner similar to the use of bisulfites for DNA conversion and methylation detection. Accordingly, in some embodiments, methods are provided for using DABSO to convert DNA cytosine residues to uracil while leaving 5-methylcytosine residues substantially unaffected. In some embodiments, the methods include contacting a sample containing DNA with DABSO to convert DNA and desulfurizing the converted DNA to produce DNA in which cytosine residues are converted to uracil but 5-methylcytosine residues are substantially unaffected. In some embodiments, DABSO is present in concentrations ranging from about 2M to about 5M, inclusive. In some embodiments, the DABSO is present at a concentration of about 2.5M. In some embodiments, the DABSO is dissolved in an aqueous alkaline solution (eg, a KOH solution). In some embodiments, the DABSO containing reagent contains DABSO dissolved in a solution containing KOH.

[0862] In some embodiments, the methods include heating the DABSO/DNA solution to a temperature in the range of about 55°C to about 90°C. In some embodiments, DABSO is contacted with DNA for a period of time ranging from about 15 minutes to about 90 minutes, inclusive. Following conversion, the DNA is desulfurized (e.g., by contacting the converted DNA with an alkaline reagent (e.g., KOH solution). In some embodiments, the conversion and/or desulfurization is performed on the DNA bound on the column, while in other embodiments, the conversion and/or desulfurization is performed with DNA in solution.

[0863] Methods for analyzing DNA methylation are also provided, which include obtaining a DNA sample, converting the DNA in the sample using a DABSO reagent, for example, as described above, and performing methylation-specific PCR and/or nucleic acid sequencing, and/or high precision analysis. melting curves (HRM) of the converted nucleic acid to determine the methylation of said nucleic acid. In some embodiments, obtaining a DNA sample includes sample preparation as described herein (e.g., using lyses and/or preparation cartridges as described herein.

Sets

Methylation Kits

[0864] In some embodiments, kits are provided for performing the methods described herein. In one exemplary embodiment, the kits include a container containing a reaction cartridge as described herein, a container containing a sample processing reagent as described herein, and a container containing a conversion reagent (e.g., a bisulfite reagent) as described herein. as described in this document. In some embodiments, the bisulfite reagent is present in the chamber of the cartridge. In some embodiments, the bisulfite reagent is provided in a container separate from the cartridge. In some embodiments, the sample processing reagent is present in the chamber of the cartridge. In some embodiments, especially where the sample treatment reagent contains guanidine thiocyanate, the sample treatment reagent is provided in a container separate from the cartridge.

[0865] In some embodiments, kits may include cartridges for a two-cartridge kit as described herein. Thus, in some embodiments, kits may include a "first" cartridge, which is a sample preparation cartridge configured to prepare a sample and perform a bisulfite conversion of DNA on the sample (see, for example, Figure 20B, left panel), and a "second »cartridge configured for desulfurized converted DNA and, in some embodiments, to perform a subsequent analysis (eg, methylation-specific PCR) (see, for example, Figure 20B, panel on the right). In some embodiments, the first cartridge and the second cartridge in the set are presented as separate containers, while in other embodiments, the first cartridge and the second cartridge are presented in the same container. In some embodiments, the two-cartridge kit may include devices (eg, funnels, pipette tips, etc.) for transferring the sample from the sample withdrawal chamber of the first cartridge to the sample receiving chamber of the second cartridge.

[0866] In addition, the kits optionally include labels and/or training materials containing instructions (i.e., protocols) for using the cartridges provided herein to determine DNA methylation and, optionally, RNA expression.

[0867] In some embodiments, a DNA methylation detection kit is provided that includes a container containing a cartridge for determining the methylation status of a nucleic acid as described herein. In some embodiments, the kit further comprises a lyse as described herein (e.g., serum or plasma lyse, such as described in Table 13, and/or FFPE sample lyse, such as described in Table 14 ). In some embodiments, the kit includes a container containing proteinases K. In some embodiments, the kit contains a conversion reagent (eg, a bisulfite reagent) in a cartridge or in a container separate from the cartridge. In some embodiments, the self-contained container may contain a pre-measured volume of conversion reagent sufficient for one "cycle" of the cartridge. In some embodiments, the conversion reagent contains a compound selected from the group consisting of sodium metabisulphite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and 1,4-diazabicyclo[2.2.2]-octane (DABSO). In some embodiments, the kit includes a container containing a sample processing reagent. In some embodiments, the sample treatment reagent contains guanidine thiocyanate and/or ethanol.

[0868] In various embodiments, the kit may further comprise a sample preparation cartridge as described herein (eg, as shown in Figure 20).

[0869] In some embodiments, the kit contains instructional materials for training in the use of the DNA methylation cartridge. If the kit includes a sample preparation cartridge, then the kit may additionally contain instructional materials for training in the use and operation of the sample preparation cartridge.

Kits for DNA conversion with DABSO and methylation detection.

[0870] In some embodiments, kits are provided using DABSO as a conversion reagent, for example, in detecting DNA methylation status. In some embodiments, the kits include a container containing a conversion reagent containing DABSO and a container containing a desulfurization reagent. In some embodiments, the kit includes a column containing an affinity matrix (eg, a silica matrix material). In some embodiments, the kits include a container containing a binding buffer and/or a container containing an elution buffer. In some embodiments, the kit includes a container containing a wash buffer.

[0871] In some embodiments, the kit further includes a lyse as described herein (e.g., serum or plasma lyse, such as described in Table 13, and/or FFPE sample lyse, such as described in table 14). In some embodiments, the kit includes a container containing proteinases K.

[0872] In various embodiments, the kit may further include a sample preparation cartridge as described herein (eg, as shown in Figure 20).

[0873] In some embodiments, the kit contains instructional materials for training on the use of the nucleic acid conversion kit to determine nucleic acid methylation.

[0874] While the instructional materials described above in the kit are typically included in written and printed form, they are not limited to such. The present invention contemplates any storage medium for storing such instructions and transmitting them to the end user. Such media include, but are not limited to, electronic media (eg, magnetic disks, film, cartridges, chips), optical media (eg, CD ROM), and the like. Such media may include links to Internet sites that provide such instructional materials.

EXAMPLES

[0875] For the purpose of explanation, but not limitation of the claimed invention, the following examples are presented.

Example 1

[0876] For method validation, human genomic DNA (HG-DNA) was used as a starting sample to monitor sample preparation, bisulfite conversion, sample purification, and methylation-specific qPCR in a Cepheid GENEXPERT® cartridge. In order to measure the efficiency of the bisulfite conversion, half of the DNA-bisulfite mixture was loaded and heated in a 50 µl cartridge tube during the bisulfite conversion step. Thus, under optimal conversion conditions, approximately half of the HG DNA was converted, while the other half remained unconverted.

[0877] Taqman primers and probes for the qPCR step were designed for one unconverted gene (HMBS (hydroxymethylbilane synthase constitutive gene)) and one converted gene (ACTB (beta-actin)), and then the conversion efficiency was quantified by comparing the cycle threshold (Ct) values . Both ASTV and HMBS are widely used as single reference genes in ultra-low amounts, and thus we would expect similar copy numbers per ng of HG-DNA.

[0878] A representative run of GENEXPERT® from 300 ng HG-DNA is shown in Figure 5 below, with a green qPCR curve for ASTB and a blue qPCR curve for HMBS qPCR. qPCR was performed for 45 cycles with 3 temperature cycles at 96°C for 5 seconds, at 60°C for 15 seconds and at 72°C for 15 seconds. When manually setting the threshold line to 20 fluorescence units, we observed a Ct of 31.7 for the converted ACTV gene and a Ct of 32.7 for the unconverted HMBS gene. Importantly, this result indicates that we are able to achieve near-optimal bisulfite conversion of HG-DNA in our cartridge at the physiologically similar concentrations of DNA present in FFPE tissue sections and plasma/serum samples. Additional specificity for fully converted sequences can be achieved by nested qPCR or by heating the entire sample. However, methylation-specific qPCR in GENEXPERT® does not require either of these options at all, as primer and probe sets are designed to amplify only converted sequences. Thus, the remaining unconverted DNA sequences will act as carrier DNA, which is particularly often added during bisulfite conversion, DNA isolation and PCR methods.

Example 2

[0879] Figures 6A and 6B show a linear relationship for converted ASTB. In particular, in FIG. 6A shows the results of nested 15 cycle qPCR for ASTV using hg-DNA. As seen in the panel on the right, the signal (Ct value) is essentially linear between about 25,000 copies and about 100 copies. In FIG. 6B shows the results of nested 20 cycle qPCR for ASTV using hg-DNA. These graphs show the sensitivity of the cartridge to hg-DNA. "Dropouts" (dropouts) begin to appear at about 20-50 copies with a sensitivity of about 25 copies of the converted DNA.

[0880] Figures 7A, 7B, and 7C show qPCR results for six methylated targets (AKR1B1, HOXB4, TM6SF1, RASGRF2, and RASSF1A). In FIG. 7A shows the results of nested qPCR with 20 cycles for the control (25 ng HS-DNA and 5000 MBA-453 cells whose DNA was converted with bisulfite). In FIG. 7B shows the results of a 20 cycle nested qPCR for six methylated targets using DNA from MBA-453 cells that was converted with bisulfite. A strong signal was noted for all targets. HIST1H3C was not reliably detected. In FIG. 7C shows the results of a 20 cycle nested qPCR for six methylated targets using DNA from MBA-453 cells converted with bisulfite and mounted on a carrier containing 1 μg SS and 10 ng HS DNA. "Dipouts" (dropouts) were observed at about 100 cells or less, however, with the carrier there were significantly fewer such decreases.

Example 3

[0881] The figure 8 presents the results of determining the effectiveness of the conversion. The conversion efficiency is approximately 66% (~1 Ct) of the difference between unconverted HMBS and converted ASTB. The ideal Ct at 100% binding/elution, 100% conversion and 100% binding/elution is about 24-25. These experiments generally showed 50% binding/elution, 50-66% conversion and 50% binding/elution at a 10-fold reduction and a Ct of about 27.

[0882] Figure 9 shows the increase in specificity for converted DNA obtained from nested qPCR. Nested PCR appears to increase specificity for converted DNA, increase specificity for methylated DNA, and reduce contamination problems.

[0883] Figure 10 shows the specificity of the methylation cartridge. There is no specificity for unconverted DNA (top panel) or unmethylated DNA (bottom panel), except for HIST1H3C.

[0884] Figures 11A and 11B are some illustrative, but non-limiting, process flow diagrams for methylation analysis using a cartridge (eg, a GENEXPERT® cartridge). In FIG. 11A depicts one process flow for DNA methylation analysis in a serum sample. As shown in this scheme, the serum is added to the lyse tube and mixed with a stirrer/vortex. The sample is then injected into the sample port on the cartridge. The cartridge is placed in the system for analysis.

[0885] FIG. 11A depicts one flow diagram for analyzing DNA methylation in a tissue section (eg, frozen or formalin-fixed and paraffin-embedded (FFPE) section). As shown herein, in one embodiment, a tissue slice is provided (eg, a 4 µm FFPE slice). A lysing agent is added to the FFPE (see, for example, PCT/US2013/061863 (WO/2014/052551) for examples of lysing reagents) and the mixture may be heated. Ethanol may be added and the mixture is then vortexed. The sample is then injected into the sample port in the cartridge. The cartridge is placed in the system for analysis.

[0886] Figure 12 shows FFPE cell clot results for converted ALU and methylated RASSF1A.

Example 4

Detection of markers for breast cancer monitoring

Materials and methods:

[0887] 1000 MBA-453 cells or 25 ng DNA from human sperm (HS) were added to 2.5 ml binding buffer (2.25 M guanidine thiocyanate, 22.5 mM Tris pH 7.0, 0.5% Tween 20, 50% ethanol and 0.005% defoamer SE-15). 2.5 ml of cell or DNA solution was added to chamber 2 of the Cepheid methylation cartridge (layout in Figure 13A). The remaining chambers in the methylation cartridge were filled as follows: Chamber 3-3.2 ml wash buffer (1.25 M guanidine thiocyanate, 25 mM Tris pH 7.0, 50% ethanol), Chamber 4-90 μl 7 M bisulfite ammonium, Chamber 5-4 ml 50 mM Tris pH 8.5, Chamber 8 1 ml PEG200 for washing, Chamber 9 balls for quantitation, including EZR (Taq) and TSR (6 multiplex breast cancer targets RASSF1A, AKR1B1, HOXB4, HIST1H3C, RASGRF2, TM6SF1, see Table 11 below), Chamber 10-500 µl 15 mM KOH and Chamber 11 nested PCR beads including EZR (Taq) and TSR (6 RASSF1A breast cancer multiplex targets, AKR1B1, HOXB4, HIST1H3C, RASGRF2 TM6SF1). The methylation cartridge was then installed in the Cepheid GeneXpert and a complete methylation analysis was performed in the GeneXpert first DNA sample preparation, bisulfite conversion, second DNA sample preparation after conversion, desulfurization and nested 20 cycle qPCR.

[0888] A diagram depicting the methylation technique is shown in Figure 13B. It is noted that PEG200 was added to Waste Chamber 8, and once analysis began, PEG200 moved to Chamber 1. PEG200 is a viscous liquid that cannot be easily and directly loaded into the small Chamber 1. Additionally, Chamber 1 functions as a chamber for communication with atmosphere when the cartridge is first loaded before it becomes a PEG200 Chamber. Thus, the analysis starts when Chamber 1 = filled with air and Chamber 8 = PEG200, and after loading the cartridge there is a quick change - Chamber 1 = PEG200 and Chamber 8 = waste.

[0889] The numbers in the "Initial Volume" column in Figure 13A refer only to the volume of liquid. In this case, only 2 beads are present in Chamber 11 - 1x TSR bead (primer and probes for 6 targets) and 1x EZR bead (Phoenix Taq). These beads are intended for final qPCR. Similarly, there are 3 beads in Chamber 9 - 1x TSR bead (primers for 6 targets), 1x Tris bead (for KOH quenching) and 1x EZR bead (Phoenix Taq). These beads are intended for the first PCR with 15-20 cycles.

[0890] It is also noted that Chamber 6 is for communication with the atmosphere during the entire analysis and never fills up. Chamber 7 is used as a gateway for the PCR tube in the back of the cartridge. It is not filled to start the analysis, but is filled during the analysis in 3 cases before loading into the tube -1) DNA-bisulfite mixture, which is heated in the tube for conversion 2) PCR with 15-20 cycles and 3) final qPCR.

[0891] The primers shown in Table 11 represent five sequences for each gene - two elongation primers and 2 qPCR primers for each nested amplification and one probe. The first PCR with 15-20 cycles is not specific for methylation, but only for converted DNA sequences (i.e., have no intersections with CpG nucleotides, and in some examples, when intersections exist, use R = purine or Y = pyrimidine to account for both methylated and unmethylated DNA). The second 45 cycle qPCR includes both primers and probes specific mainly for 2-3 methylated CpGs.

Results:

[0892] A methylation cartridge was run using 1000 MBA-453 cells in the presence and absence of bisulfite (Figure 15A-15B) and 25 ng of HS-DNA with bisulfite (Figure 15C) that was initially unmethylated in every gene promoter except HIST1H3C. There was no or little amplification of any of these targets in control reactions, either with bisulfite or unmethylated HS-DNA (Figure 15A, 15C). When bisulfite was added to the methylation cartridge, high levels of methylation were recorded on a variety of gene promoters from 1000 MBA-453 Cells, especially AKR1B1, RASSF1A, HOXB4 and RASGRF2.

[0893] The primers shown in Table 11 are illustrative and non-limiting. Many other primers and nested primer kits are available to those skilled in the art. By way of example, Table 12 lists exemplary primers for determining the methylation of the ADAMTS1 and BNC1 genes that are associated with pancreatic cancer and for determining the methylation of the MGMT gene that is associated with glioma.

Example 5

Sample preparation from plasma and FFPE samples

[0894] Figure 17 depicts one cartridge configuration that can be used to prepare a DNA sample for PCR and/or methylation detection. Serum or plasma derived sample or FFPE sample can be easily introduced into the sample chamber in the cartridge (e.g. Chamber 3) and operating the cartridge as described in this document ensures that the sample is ready for PCR and/or determination. methylation.

Sample preparation

[0895] In one illustrative but non-limiting embodiment, a serum or plasma sample is prepared (e.g., for cf-DNA analysis) by proteinase K treatment of the serum or plasma. The proteinase K treated serum/plasma is then mixed with a lyse solution containing guanidine thiocyanate (GTC), a buffer (eg Tris pH 7.0), a detergent (eg Tween 20) and optionally an antifoam (eg SE15 antifoam). An alcohol (eg, isopropanol) is added to the solution, which is then injected into the sample preparation cartridge. In one embodiment, the composition of the lyse is shown in Table 13. Proteinase K treated serum/plasma is mixed with lyse and alcohol in a ratio corresponding to 1.3 ml of proteinase K treated serum/plasma, 2.2 ml of lyse and 1.5 ml of alcohol. In some embodiments, the serum/plasma sample is treated with proteinase K for about 15 minutes. The lyse solution is added cold and held/mixed for about 10 minutes. Isopropanol is then added to the mixture, which is then loaded into the treatment cartridge.

[0896] As noted above, for serum/plasma, alcohol precipitation (eg, isopropanol) is typically performed at room temperature, and is preferably not performed in "saline" solutions. In some embodiments, a longer room temperature settling time may be used.

[0897] In other illustrative, but non-limiting embodiments, a formalin-fixed and paraffin-embedded (FFPE) sample is prepared by combining the FFPE sample with proteinase K and a lysing solution containing a buffer (e.g., HEPES), a chelating agent (e.g., EDTA), NaCl, MgCl ₂ , and optionally sodium azide and/or defoamer. The solution is heated (for example, at a temperature of from 70°C to 90°C) for a period of time in the range, for example, from about 10 minutes to about 4 hours, inclusive. Alcohol is added to the solution, and then the solution is injected into the sample processing cartridge. In one embodiment, the composition of the lyse is shown in Table 14. In one illustrative but non-limiting embodiment, 1.2 ml of the lyse shown in Table 14 was added to the FFPE slice(s). Added proteinase K and heated the mixture, for example, at 80°C for about 15 minutes. In some embodiments, the heating was carried out at 56°C for 2 hours, then 90°C for 30 minutes. Then, 1.2 ml of ethanol was added to the mixture, and the mixture was loaded into the sample chamber in the treatment cartridge.

Cartridge operation and extraction performance

[0898] When preparing cf-DNA, in some embodiments, it is possible to include a control sample to monitor the quality of the DNA preparation. As shown in figure 18, there are two different sets of balls. One set of beads contains endogenous HMBS primer and SAC (assay control) probe set and exogenous BG primer and SPC (preparation control) probe set. The other contains the endogenous Beta-globin PP kit for SAC (as well as BG SPC).

[0899] In addition, it was found that the use of GTC in the cartridge may be less important for serum samples than plasma samples. Without being bound to any particular theory, it is believed that this may be due to the fact that whey contains less protein. Accordingly, in some embodiments, the cartridge may contain less GTC or no GTC.

[0900] Figures 19A and 19B compare the results of cf-DNA preparation performed using the cartridge as described herein with respect to the results obtained using the traditional tubefill procedure. As the qPCR results shown in Figure 19A show, the binding and elution efficiency of the cartridge is very close (within one Ct) to that of the tubefill protocol. As shown in Figure 19B, the titer of the sample concentrations indicates that the cartridge preparation is within one 1 Ct margin of the tubefill preparation when the sample concentration is reduced to about 10 pg. The cartridge preparation is considered to be even closer to the tubefill protocol at higher sample concentrations.

Example 6

High Volume Sample Preparation Cartridge Test

[0901] In some embodiments, high volume sample preparation (HSVP) cartridges are provided for obtaining high volume samples (eg, up to and including about 12-15 ml). This is particularly suitable for use when the sample contains DNA at low concentrations (eg cf-DNA in serum or plasma). One such cartridge is shown schematically in Figure 20A. As shown, the cartridge is provided with three chambers (Chambers 2, 3 and 5) that can be used to receive a sample. In exemplary embodiments, each of these chambers can receive approximately 4 ml of sample, and, in some embodiments, the sample contains 4 ml of plasma/serum combined with 4 ml of GTC and 4 ml of alcohol (eg, isopropanol).

[0902] The sample is introduced into these chambers and the cartridge functions as described herein to prepare the sample for PCR and/or methylation analysis. By way of example, in some embodiments, the operation of a given cartridge may include binding DNA on an affinity column (eg, for purification) and eluting the DNA. In some embodiments, when a methylation assay is performed, operation of the cartridge may further include combining the DNA with a conversion reagent (eg, bisulfite as described herein) and heating the DNA conversion mixture. In some embodiments, the HSVP cartridge may also be configured to desulfurize the converted DNA. In other embodiments, the DNA may be desulfurized in a second (eg, qPCR) cartridge, as shown schematically in Figure 20B. A methylation assay (eg, qPCR assay) may also be performed in the second cartridge.

[0903] Figure 21 compares the results of preparing a DNA sample from plasma and serum using a one- or two-cartridge technique using primers HMBS or beta-globin and a set of probes. As shown, there is a linear increase in DNA recovery between 0.5 ml and 4 ml of serum or plasma. In addition, there was very little or no loss when using a single preparation and analysis cartridge or when using separate preparation and analysis cartridges.

Example 7

Bisulfite Conversion Optimization

[0904] In some embodiments, when using a methylation assay cartridge as described herein, one potential goal is to optimize elution efficiency while using the smallest possible volumes. Working with low elution volumes is most easy when using spin columns. This problem can be solved by using a multiple heating step for processing large volume samples.

[0905] When heating a large sample volume (eg, at least 100 μl) using a small (eg, 50 μl) heating tube or chamber, a second technical issue arises. In some cases, the creation of excess pressure between the stages of heating can interfere with the reproducibility of the suction and distribution volumes. Second, the absence of excess pressure can lead to volume change and bubbles, especially at higher temperatures. Thirdly, there is the possibility of air intake between heated and unheated samples during the change of ports between heating stages.

[0906] A study of this optimization of bisulfite conversion was performed in a 50 μl tube using a single and double heating step. This experiment was performed as follows:

Sampling 75-80 µl of bisulfite-DNA; heating 95°C - 10 s, 65°C - 300 s x8;

Withdrawal of the remaining amount + 5-10 µl; creation of excessive pressure; heating 95°C - 480s, 65°C - 1800s x1.

[0907] The results for 0.5 ml of serum are presented in Figure 22, where the top panel shows a single heat (converted DNA - 33.0, unconverted - 34.4) N=4, and the bottom panel shows a two-time heat (converted DNA - 31.9, unconverted - 36.1) N=4.

[0908] There is an increase of about 1 Ct in the signal for the converted ASTB when going from heating once to heating twice. This suggests that almost all of the DNA is converted. This is supported by the fact that there is also a signal loss from the unconverted HMBS of about 2 Ct. An increase of 1 Ct is logical, since the authors carried out heating first with 50/100 µl and then with 100/100 µl of the DNA-bisulfite sample.

Example 8

Comparison of the DNA methylation cartridge with commercial tube-based kits

[0909] Figure 23A compares user-assisted steps required when performing a methylation assay using a cartridge as described herein (left) versus steps required when using commercial kits (QIAamp MinElute Virus Spin Kit (Qiagen, Inc. .) and EZ DNA Methylation -Lightning™ Kit (Zymo Research, Inc.)) to perform the same assay. As can be easily seen, cartridge-based methylation assays require far fewer user steps with a labor time of approximately 5 minutes compared to the 2-3 hours labor required with these kits.

[0910] To compare the results obtained by these different methods, 200 μl of serum was purified using the Qiagen kit. DNA was converted using a Zymo kit, then purified using a second spin column and eluted with 10 μl. All 10 µl were loaded using converted unmethylated primers and probes (TSR) for ASTB. For comparison, 200 μl of serum was loaded into a methylation cartridge as described in this document. The results are presented in Figure 23B. It is clear that the cartridge method produced results very similar to those obtained with commercial kits. However, this required much less labor and time.

Example 9

Application of DABSO for DNA Conversion

[0911] Initially, an attempt was made to dissolve 5 g of DABSO in 5 ml of H2O. Finally, a few ml of KOH 10M and one ml of water were added and heating was performed to dissolve the DABSO and to raise the pH to between about pH 5 and pH 5.5 at an approximate final DABSO concentration of ~2.5 M.

[0912] Figure 24 is a graph of tubefill data for 750 ng of DNA converted with DABSO or Zymo Conversion Reagent. Materials were heated externally (offboard) (1 µg) in a thermal cycler, purified on spin columns, and loaded according to the tubefill protocol. 3 different experiments were carried out:

1) 120 µl DABSO/30 µl DNA;

2) 120 µl Zymo/30 µl DNA; and

3) 70 µl Zymo/30 µl DNA (current ratio in the cartridge).

[0913] In accordance with the image in figure 24, the use of DABSO provided a proper conversion, almost comparable to that obtained using the Zymo reagent.

Example 10

Sensitivity of DNA methylation detection

[0914] To evaluate the sensitivity of DNA methylation detection using the cartridge as described herein, the converted ACTV gene promoter was detected based on copy number. The aim was to detect less than 25 copies of the converted unmethylated DNA. As shown before, jumps (fallouts) were detected at about 10-50 copies (1 emission each). Similar sensitivity was observed for targets with methylated DNA in the background of serum.

[0915] Figure 25, panel A, shows the detection of methylated DNA in a dilution series (MGMT (O-6-methylguanine-DNA-methyltransferase gene)). As shown, MGMT was detected up to a level of 78 pg.

[0916] Detection of methylated breast cancer markers RASSF1A and AKR1B1 in MBA-453 cells is shown in Figure 25, panel B. As shown, breast cancer markers were detected up to a level of 100 cells.

[0917] Detection of methylated pancreatic cancer markers ASTB, BNC1, and ADAMTS1 in a dilution series is shown in Figure 25, panel C. As shown, pancreatic markers were detected up to a level of 25 copies.

[0918] Table 15 shows the performance score (of detection for the pancreatic cancer markers BNC1 and ADAMTS1 as a function of concentration. As indicated in the table, these markers can be detected below 120 pg. It should be noted that a positive "performance score" " hit count") is the amplification of any of these genes per repeat.

Table 15 shows the efficiency for the detection of pancreatic markers depending on the concentration.

Example 11

Multiplex analysis with reverse complement for both chains

[0919] Figure 26 shows the results of reverse complement multiplex analysis for both strands of DNA. After bisulfite conversion, both strands lose their complementarity. Thus, a set of primers and probes must be designed for one strand or the other, resulting in unique amplicons. In addition, this approach has the potential to increase sensitivity to provide “greater opportunities” (at the lower limit of detection, if only one or the other circuit ends up being present in the tube, then this technique will provide the ability to capture the signal).

[0920] Multiplex analysis allows the detection of different CpGs at the same site of the promoter. Reverse complement multiplex analysis provides more data on the target and makes it possible to distinguish between heterogeneous methylation.

Example 12

Detection of DNA methylation and mutations in one cartridge

[0921] In some embodiments, multiplex PCR may include primers and probes that provide mutation detection in the same cartridge, in addition to methylation. Figure 27A depicts the detection of BNC1 and ADAMTS1 methylation together with the KRAS G12D mutation together with the HD control (top panel) and the detection of BNC1 and ADAMTS1 methylation together with wild-type KRAS along with the HD control (bottom panel).

[0922] Figure 27B shows the simultaneous detection of BNC1 and ADAMTS1 methylation in PANC-1 cells (top panel) and MIA-PaCa cells (bottom panel) in association with the KRAS G12D mutation.

Example 13

Multiplex optimization for pancreatic cancer

[0923] Analysis of the methylation of ADAMTS1, BNC1 (and certain other genes) has been found to provide cancer detection and/or staging of pancreatic cancer. Accordingly, the initial multiplex analysis for BNC1 and ADAMTS1 was optimized to improve the insertion of probes on other genes. For optimization, the temperature gradients of this method were examined by extrinsic and intrinsic forward/reverse bisulfite-converted chain PCR. Conventional, non-multiplex experiments (straight/sample for each gene) were performed at external temperatures of 56°C, 58°C, and 60°C and internal temperatures of 64°C, 66°C, and 68°C (see e.g. figure 28). In some embodiments, the assay procedures were designed as two 4-channel multiplexes for BNC1 and ADAMTS1 and two other genes, one 4-channel multiplex for forward chain methylation assay and one 4-channel multiplex for reverse chain methylation assay.

[0924] The probes were combined in two sets (see, figure 29) based on the preferred reaction conditions (conditions with salts 40 mm (LS), 60 mm (MS), 80 mm (HS) KCl. 15 mm NH ₄ SO ₄ ) and optimized for specificity. The final salt regimen for multiplex 1 included 80 mM KCl, 5 mM MgCl ₂ , 20 mM Tris pH 8.5, and 10 mM NH ₄ and for multiplex 2 included 62 mM KCl, 4 mM MgCl ₂ , 20 mM Tris pH 8 ,5 and 10 mM NH ₄ .

Example 14

MGMT methylation detection

[0925] The O(6)-methylguanine-DNA methyltransferase (MGMT) gene encodes a DNA repair enzyme that can inhibit the action of alkylating chemotherapy drugs such as temozolomide. If the MGMT gene is active, then the damage is quickly repaired. It is believed that in malignant gliomas, the MGMT gene may be inactivated due to methylation of its promoter region. A methylated MGMT gene is a predictive indicator for a MORE EFFECTIVE response to chemotherapy (because the tumor lacks the means to repair DNA damage caused by alkylating agents).

[0926] Primers and probes were designed to detect MGMT methylation as shown in Figure 30 and summarized in Table 16 below. In particular, Figure 30 shows the converted template with CPGs (as determined from pyrosequencing), which is highlighted in grey. As depicted, after bisulfite conversion, the forward and reverse strands are no longer complementary, allowing separate analysis for each strand.

[0927] To evaluate the detection sensitivity of MGMT, a series of dilutions (from 5 ng to 78 pg of MGMT DNA in the background of 20 ng of HS DNA) was examined using ASTV as a control. In an exemplary experiment for 78 pg methylated MGMT DNA, Ct was located only about 10 cycles lower than Ct for unmethylated HS DNA.

[0928] In accordance with the image in figure 31 compared the results obtained using the methylation cartridge presented in the present description, for the detection of MGMT methylation, in relation to the results obtained when pyrosequencing the extracted DNA (Fig. 31, top) and the FFPE sample (Fig. 31, bottom). Pyrosequencing typically uses a threshold of 10-15% to establish patient stratification. We used an arbitrarily chosen threshold of 12.5 (between ASTV and MGMT) so that we could match pyrosequencing results as closely as possible. Accordingly, in this example, the threshold was set at ΔCt=12.5 and calculated agreement with >15% methylation. The analysis of the extracted DNA in the cartridge showed a sensitivity of 90% and a specificity of 86%, while the analysis of the FFPE sample in the cartridge showed a sensitivity of 88% and a specificity of 95%.

[0929] It is noted that the specificity can be increased in two ways: 1) by increasing the annealing temperature, since the annealing temperature of 62°C was quite low. Additionally, methylation probes that coat 3 (or more) CpG can be used.

Example 15

BRCA1 methylation detection

BRCA1 is a "protective" (caretaker) gene responsible for DNA repair. BRCA1 is believed to be involved in homologous recombination, nonhomologous end joining, and nucleotide excision repair. Women with an aberrant BRCA1 gene had an 80% chance of developing breast cancer.

[0930] Without being bound to any particular theory, BRCA1 methylation is believed to be a potential predictive marker of response to chemotherapy in patients with triple negative breast cancer. A study in NSCLC patients receiving cisplatin found that those with low BRCA1 expression had higher survival rates. High levels reduced the effectiveness of chemotherapy by repairing damage done to cancer cells.

[0931] Considering these and other observations, cartridges and methods of application have been developed to determine methylation of BRCA1. In particular, the PCR conditions were optimized as follows: 1) The external temperature was estimated between 56-62°C, and we settled on a 3-stage PCR technique with annealing at 56°C; 2) The internal temperature was estimated between 64°C-70°C, and we settled on a 3-step PCR technique with annealing at 68°C. The results are shown in figure 32.

[0932] For BRCA1, a single target analysis was performed using ACTB as a control gene. Eight different cell lines were examined and the effect of NH ₄ addition was compared (see Figure 33). BRCA1 methylation was expected to be detected in the 3199 cell line.

Example 16

Detection of methylation of genes associated with lung cancer.

[0933] A three-target gene methylation analysis was performed for genes whose methylation is associated with lung cancer (SOX17, CD01, TAC1) together with ACTB as a control gene. The data presented in Figure 34 shows that, as predicted, 3 targets are not detected in the control plasma of a healthy subject, but are present to some extent in three different cancer cell lines.

[0934] It should be understood that the examples and embodiments presented herein are for illustrative purposes only, and in light of the examples and embodiments, various modifications or changes may be proposed by those skilled in the art, which should be considered as being included in scope of the spirit and scope of the present application and the scope of the appended claims. All publications, patents and patent applications referred to in this document are incorporated herein by reference in their entirety for all purposes.

--->

SEQUENCE LIST

<110> CEPHEID

<120> COMBINED PURIFICATION AND MEASUREMENT OF DNA METHYLATION WITH JOINT

MEASUREMENT OF MUTATIONS AND/OR LEVELS OF mRNA EXPRESSION IN AUTOMATED

REACTION CARTRIDGE

<130> CPHDP011WO

<140> PCT/US2017/065905

<141> 2017-12-12

<150> 62/433.165

<151> 2016-12-12

<160> 390

<170> PatentIn version 3.5

<210> 1

<211> 162

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic polynucleotide"

<400> 1

cgcgtttcgg atatgttggg atagttcgcg tttttagaac gttttgcgtt tcgacgttcg 60

120

gaagagtgcg gagttttttt tcgggacggt ggtagtttcg ag 162

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 2

gcgttgaagt cggggttc 18

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 3

cccgtacttc gctaacttta aacg 24

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 4

acaaacgcga accgaacgaa acca 24

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 5

ttagggtaga ttgtggatat tag 23

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 6

atactaacaa ctatccaata caac 24

<210> 7

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 7

caggttgaaa ttagtatgtg ttatttttggt atgg 34

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 8

aatagttcgt aagtttatcg gcg 23

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 9

cttcacgcca ccgataaccg a 21

<210> 10

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 10

tacttacgcg aaactttacc gccga 25

<210> 11

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 11

gatttagagt tggatgtgtg gat 23

<210> 12

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 12

accaccatac taataatcaa atcta 25

<210> 13

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 13

aaatatcact catcaccaaa taaatccaa 29

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 14

gtaagaagac ggtcgaggcg 20

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 15

acaactctac tcgccctcga a 21

<210> 16

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 16

aacgaaccac ttctcgtacc aacga 25

<210> 17

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 17

tgtatgagtt tgtggtgaat aatg 24

<210> 18

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 18

aactcaccat caaacacttt ccc 23

<210> 19

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 19

tacaaaccca acatcctcta tctattc 27

<210> 20

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 20

gcgcgttaat cgtaggcgtt t 21

<210> 21

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 21

cccaatacga tacgacctta ac 22

<210> 22

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 22

cgtaccttta aataacccgt aaaatcga 28

<210> 23

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 23

tttgttgatg ttttgtggaa gtaag 25

<210> 24

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 24

attcatcaat actttcaaat aacaca 26

<210> 25

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 25

caaatacatt atcctaccac taacaataca 30

<210> 26

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 26

cgggattttg ggttttcgtc g 21

<210> 27

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 27

cgacgaataa cgacgcaaaa ac 22

<210> 28

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 28

aaccgaacga taacgaaaac gacgaa 26

<210> 29

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 29

gttagttttg tagtgtattg agtat 25

<210> 30

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 30

catcttccac aataaacttc caatt 25

<210> 31

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 31

taactccacc tattctacct accattt 27

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 32

cgtttagcgg gatgcggtga 20

<210> 33

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 33

acacgaaaac cccgataacc g 21

<210> 34

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 34

aaacactcat cgcaaccgcc gcg 23

<210> 35

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 35

ttagatgttg attggttgtg tttg 24

<210> 36

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 36

atcatcataa aactcaacaa tcaatt 26

<210> 37

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 37

ccaaacatca aatctttaac ttttaccaa 29

<210> 38

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 38

aggttgaaat tagtatgtgt tattttggta tgg 33

<210> 39

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 39

aggttgaaat tagtatgtgt tattttggta tgg 33

<210> 40

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 40

aggttgaaat tagtatgtgt tattttggta tgg 33

<210> 41

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 41

gttttatagt ttttgtattt agg 23

<210> 42

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 42

aactcaataa actcaaactc cc 22

<210> 43

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 43

gtgtgtgttt ttattgtaaa tgg 23

<210> 44

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 44

ataaaatttc ttcacrccac c 21

<210> 45

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 45

gagggagtta gttgggttat 20

<210> 46

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 46

ccctccaaaaa atacataccc 20

<210> 47

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 47

gtgtaattaa ttagaaggtt tttt 24

<210> 48

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 48

aacacctacc ttccaaatac 20

<210> 49

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 49

ttagaggyga gagagtagtt 20

<210> 50

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 50

aaactactac taaccrcctc 20

<210> 51

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 51

aggagataty gttgagggga 20

<210> 52

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 52

tcactcatac taaaccrcca a 21

<210> 53

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 53

ttagggtaga ttgtggatat tagatagg 28

<210> 54

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 54

taatactaac aactatccaa tacaacac 28

<210> 55

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 55

ccgataaccg aaacgctctt ac 22

<210> 56

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 56

gcgttaatcg taggcgttt 19

<210> 57

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 57

gtttagcggg atgcggtg 18

<210> 58

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 58

acacgaaaac cccgataac 19

<210> 59

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 59

gygtaattaa ttagaaggtt tttt 24

<210> 60

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 60

tcgtacgaag taaatagttc gtaag 25

<210> 61

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 61

ggatttttga aatattatag gattaattag 30

<210> 62

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 62

gttttatagt ttttgtattt agg 23

<210> 63

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (11)..(11)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 63

acaaacgcga naccgaacga aacca 25

<210> 64

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 64

ctggtttcgt tcggttcgcg 20

<210> 65

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 65

caggttgaaa ttagtatgtg ttatttttggt atgg 34

<210> 66

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 66

caaactactt acgcgaaact ttaccgcc 28

<210> 67

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (21)..(21)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 67

aaatatcact catcaccaaa ntaaatccaa 30

<210> 68

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 68

aaacgaacca cttctcgtac caacgac 27

<210> 69

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 69

caaacccaac atcctctatc tattc 25

<210> 70

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (13)..(13)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 70

acgcgtacct ttnaaataac ccgtaaaatc g 31

<210> 71

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 71

acgcgtacct ttaaataacc cgtaaaatcg 30

<210> 72

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 72

caaatacatt atcctaccac taacaataca 30

<210> 73

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 73

aaccgaacga taacgaaaac gacga 25

<210> 74

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (21)..(21)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 74

taactccacc tattctacct naccatt 28

<210> 75

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 75

caaacatcaa atctttaact tttac 25

<210> 76

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 76

cacgcgtacc tttaaataac ccgtaaaatc g 31

<210> 77

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (19)..(19)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 77

aaccgaacga taacgaaana cgacgaa 27

<210> 78

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 78

aaacactcat cgcaaccgcc gcg 23

<210> 79

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 79

taaccaccac ccaacacaca ataac 25

<210> 80

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 80

cccaactact taaaaaacta aaac 24

<210> 81

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 81

cacctaaaat caaaaattta aaacc 25

<210> 82

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 82

caaataattc tcctacctca acctc 25

<210> 83

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 83

cttaactcac tacaacctct acc 23

<210> 84

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 84

caaaccgaac gacgcgcaca aacac 25

<210> 85

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 85

gtatatagggt tggggaagtt tg 22

<210> 86

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 86

aactatactc aaccaataaa acc 23

<210> 87

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 87

tgttatttag gttggagtgt ag 22

<210> 88

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 88

taataactca tacctataat ccc 23

<210> 89

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 89

ggttggagtg tagtggtata attttag 27

<210> 90

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 90

taataactca tacctataat cccaacac 28

<210> 91

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 91

gtagagatag ggttttatta tgttg 25

<210> 92

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 92

ggttttatta tgttggttag gttgg 25

<210> 93

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 93

gtattttgggg aggttaaggt ag 22

<210> 94

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 94

atcttactct tattacccaa ac 22

<210> 95

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 95

ggttaaggta ggtagattat ttgagg 26

<210> 96

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 96

atcttactct tattacccaa actaaaatac 30

<210> 97

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 97

gttatttaggg aggttgaggt ag 22

<210> 98

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 98

gaggtaggag aattatttga atttagg 27

<210> 99

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 99

atttgagatt tttgagttgg 20

<210> 100

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 100

aaccctactc cctatctacg 20

<210> 101

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 101

gcgcgcgttt ttttttgaag 20

<210> 102

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 102

ggcgtagata gggagtaggg tt 22

<210> 103

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 103

gtgatggagg aggtttagta agtt 24

<210> 104

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 104

ccaataaaac ctactcctcc cttaa 25

<210> 105

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 105

ccataccaaa ataacacatc taatttcaac ct 32

<210> 106

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 106

caaatacatt atcctaccac taacaataca 30

<210> 107

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 107

cacgcgtacc tttaaataac ccgtaaaatc g 31

<210> 108

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 108

cacgcgtacc tttaaataac ccgtaaaatc g 31

<210> 109

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 109

ctaacaaaca caaaccaaac aaaacca 27

<210> 110

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 110

ctaacaaaca caaaccaaac aaaacca 27

<210> 111

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (20)..(20)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 111

aactacttac acaaaacttn taccaccaa 29

<210> 112

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 112

aactacttac acaaaacttt accac 25

<210> 113

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 113

aaacaaacca cttctcatac caacaac 27

<210> 114

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 114

cacatacctt taaataaccc ataaaatcaa c 31

<210> 115

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 115

cacatacctt taaataaccc ataaaatcaa c 31

<210> 116

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (24)..(24)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 116

caacaaaaac ccaaaatccc aacnaaacca ca 32

<210> 117

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 117

caaaatccca acaaaccaca taaca 25

<210> 118

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 118

aaacactcat cacaaccacc acacc 25

<210> 119

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 119

tggtgtgtta attgtaggtg tttt 24

<210> 120

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic ligonucleotide"

<400> 120

cccaatacaa tacaacctta acc 23

<210> 121

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 121

gtggtgtgta ttgtgtagtg tta 23

<210> 122

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 122

caaaccaaac aataacaaaa acaac 25

<210> 123

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 123

tgtttagtgg gatgtggtga ag 22

<210> 124

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 124

acacaaaaac cccaataacc aca 23

<210> 125

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 125

gtttaaagtt agtgaagtat gggttt 26

<210> 126

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 126

tgtatgaagt aaatagtttg taagtttatt gg 32

<210> 127

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 127

tttgttgatg ttttgtggaa gtaag 25

<210> 128

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 128

attcatcaat actttcaaat aacaca 26

<210> 129

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 129

aaacgaacca cttctcgtac caacgac 27

<210> 130

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 130

caaacccaac atcctctatc tattc 25

<210> 131

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 131

aaacactcat cgcaaccgcc gcg 23

<210> 132

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 132

ccaaacatca aatctttaac ttttaccaa 29

<210> 133

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 133

aaacactcat cgcaaccgcc gcg 23

<210> 134

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 134

ggtgttgaag ttggggtttg 20

<210> 135

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 135

cccatacttc actaacttta aac 23

<210> 136

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 136

gtaaatagtt tgtaagttta ttggtg 26

<210> 137

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 137

tttcttcaca ccaccaataa ccaa 24

<210> 138

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 138

gagtaagaag atggttgagg tg 22

<210> 139

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 139

caacaactct actcaccctc aa 22

<210> 140

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 140

tcccaactac ttaaaaaact aaaac 25

<210> 141

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 141

tcccaactac ttaaaaaact aaaac 25

<210> 142

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 142

tcccaactac ttaaaaaact aaaac 25

<210> 143

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 143

tcccaactac ttaaaaaact aaaac 25

<210> 144

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 144

tcccaactac ttaaaaaact aaaac 25

<210> 145

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 145

ggataagatt tttgatattg tattttttaa gg 32

<210> 146

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 146

catattcaaa ctccttaata aacaaacttt tctc 34

<210> 147

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 147

ccgaacaaaa aaaacctaaa taaatccctt c 31

<210> 148

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 148

ccaccaccca acacacaata acaaacac 28

<210> 149

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 149

ggtttagtaa gttttttggga ttgtg 25

<210> 150

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 150

ccttaaaaat tacaaaaacc acaac 25

<210> 151

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 151

ccaccaccca acacacaata acaaacac 28

<210> 152

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (13)..(13)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 152

ccaccacca acnacacaat aacaaacac 29

<210> 153

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (16)..(16)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 153

ccaccacca acacancaat aacaaacac 29

<210> 154

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 154

ttcagtgccg gttggtaatg taa 23

<210> 155

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 155

caacaacttt aatacctgtt tcaagga 27

<210> 156

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 156

ggtatttttg tatttgttgg tgttg 25

<210> 157

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 157

catacataca ccaaacaatt cattc 25

<210> 158

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 158

gtatggtggt atttttgtat ttgttg 26

<210> 159

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 159

cacacataca tacaccaaac aattc 25

<210> 160

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (18)..(18)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 160

aagatccgat tcacaganca agctccgtca 30

<210> 161

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (18)..(18)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 161

aagatccgat tcacaganca agctccgtca 30

<210> 162

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 162

caaaatcatt tccttcacaa atacactc 28

<210> 163

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 163

ccaaatacca taaccatttt attaataaca c 31

<210> 164

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (19)..(19)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 164

aaaatcattt ccttcacana atacactc 28

<210> 165

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (18)..(18)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 165

ccaaatacca taaccatntt tattaataac ac 32

<210> 166

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 166

ccctagtatg ctaggtctct tgctggga 28

<210> 167

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 167

cagcctctct gagggtttaa gccca 25

<210> 168

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 168

tcagcctatc tgacaccccg gg 22

<210> 169

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 169

gactcctgag gagaagtctg ccgtta 26

<210> 170

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 170

ccttgatacc aacctgccca ggg 23

<210> 171

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 171

aggtgaacgt ggatgaagtt ggtggtg 27

<210> 172

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 172

caacatcgcg caagagcacg g 21

<210> 173

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 173

cgtttccttc acgagtacgc tctccga 27

<210> 174

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 174

accggcgaat acagagatac cg 22

<210> 175

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (13)..(13)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 175

ccaccacca acnacacaat aacaaacac 29

<210> 176

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 176

gttggtgttg gagagtgtat ttg 23

<210> 177

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 177

ggagagtgta tttgtgaagg aaatg 25

<210> 178

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 178

ggaaatgatt ttttttatga gatgagtg 28

<210> 179

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (16)..(16)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 179

ccaccacca acacancaat aacaaacac 29

<210> 180

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (16)..(16)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 180

ccaccacca acacancaat aacaaacac 29

<210> 181

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 181

ccaccaccca acacacaata acaaacac 28

<210> 182

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 182

gatggaggag gtttagtaag ttttt 25

<210> 183

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 183

aataaaacct actcctccct taaaaa 26

<210> 184

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (18)..(18)

<223> Universal Purine

<400> 184

cttaccataa ctactacnct cc 22

<210> 185

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 185

cttaccataa ctactacrct cc 22

<210> 186

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 186

gtgtgtgttt ttattgtaaa tggt 24

<210> 187

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (4)..(4)

<223> Universal Purine

<220>

<221> modified base

<222> (10)..(10)

<223> Universal Purine

<400> 187

aacnataacn ataaaatttc ttcac 25

<210> 188

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 188

aacrataacr ataaaatttc ttcac 25

<210> 189

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(7)..(7)

<223> Universal Pyrimidine

<400> 189

gtttgtnggg attttgggt 19

<210> 190

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 190

gtttgtyggg attttgggt 19

<210> 191

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (3)..(3)

<223> Universal Purine

<220>

<221> modified base

<222> (10)..(10)

<223> Universal Purine

<400> 191

ccnaactccn aaaaaaaaac c 21

<210> 192

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 192

ccraactccr aaaaaaaaac c 21

<210> 193

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (10)..(10)

<223> Universal Pyrimidine

<220>

<221> modified base

<222> (12)..(12)

<223> Universal Pyrimidine

<400> 193

ggtattaagn gnggtttttt g 21

<210> 194

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 194

ggtattaagy gyggtttttt g 21

<210> 195

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (3)..(3)

<223> Universal Pyrimidine

<400> 195

gtngtttagt ttggattttg g 21

<210> 196

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 196

gtygtttagt ttggattttg g 21

<210> 197

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 197

tttcgaaggg taagcgttaa g 21

<210> 198

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (14)..(14)

<223> Universal Purine

<400> 198

aacataaata accnaaataa cc 22

<210> 199

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 199

aacataaata accraaataa cc 22

<210> 200

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 200

cggttttttg agtaagaaga cggtc 25

<210> 201

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (17)..(17)

<223> Universal Purine

<400> 201

tacctttaaa taacccntaa aatcgacaa 29

<210> 202

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 202

tacctttaaa taacccrtaa aatcgacaa 29

<210> 203

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (17)..(17)

<223> Universal Purine

<400> 203

ataacaaact acttacncga aactttac 28

<210> 204

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 204

ataacaaact acttacrcga aactttac 28

<210> 205

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(9)..(9)

<223> Universal Purine

<220>

<221> modified base

<222> (19)..(19)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 205

aacaaaccna acgataacna aaac 24

<210> 206

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (19)..(19)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 206

aacaaaccra acgataacna aaac 24

<210> 207

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (19)..(19)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 207

cacattctaa taaaaaacna accacttc 28

<210> 208

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (5)..(5)

<223> Universal Purine

<400> 208

aaccnaacga aaccacaaaa c 21

<210> 209

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 209

aaccraacga aaccacaaaa c 21

<210> 210

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (15)..(15)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 210

caaaaacact catcncaacc gcc 23

<210> 211

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 211

acaaccctcc aaaaaataca ta 22

<210> 212

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 212

ccaaatacca taaccatttt attaataaca c 31

<210> 213

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 213

ccaaatacca taaccatttt attaataaca c 31

<210> 214

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (4)..(4)

<223> Universal Pyrimidine

<220>

<221> modified base

<222> (15)..(15)

<223> Universal Pyrimidine

<400> 214

tttngaaggg taagngttaa g 21

<210> 215

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 215

tttygaaggg taagygttaa g 21

<210> 216

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(7)..(7)

<223> Universal Purine

<220>

<221> modified base

<222> (16)..(16)

<223> Universal Purine

<400> 216

caacacnaaa accccnata 19

<210> 217

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 217

caacacraaa accccrata 19

<210> 218

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 218

cctgctgaaa atgactgaat ataaccgcta agaacctctc ggtcagctga t 51

<210> 219

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 219

cctgctgaaa atgactgaat ataaagtctc attataatcg ttcgagctgt t 51

<210> 220

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 220

cctgctgaaa atgactgaat ataagcagac ttggcggtag gtccgagctt g 51

<210> 221

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 221

cctgctgaaa atgactgaat ataagtatcc tgagcacggt tgcgagctgc t 51

<210> 222

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (15)..(15)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 222

ctcttgccta cgccnccgct aagaacctct cggtc 35

<210> 223

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (15)..(15)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 223

ctcttgccta cgccnagtct cattataatc gttcg 35

<210> 224

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (15)..(15)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 224

ctcttgccta cgccngcaga cttggcggta ggtcc 35

<210> 225

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (15)..(15)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 225

ctcttgccta cgccngtatc ctgagcacgg ttgcg 35

<210> 226

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 226

ccaccaccca acacacaata acaaacac 28

<210> 227

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 227

cccrcaaacc rcgaaaacct c 21

<210> 228

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 228

gtttttttty gggagaggta aata 24

<210> 229

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 229

crcctccraa actaaaacaa c 21

<210> 230

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 230

gggttattgt aaagttaggg tg 22

<210> 231

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(6)..(6)

<223> Universal Pyrimidine

<220>

<221> modified base

<222> (15)..(15)

<223> Universal Pyrimidine

<400> 231

gaggtngtgg ttttngtaga t 21

<210> 232

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (5)..(5)

<223> Universal Purine

<400> 232

aaacnccaaa aaacttcaaa ac 22

<210> 233

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (19)..(19)

<223> Universal Pyrimidine

<400> 233

ttttgttgggg ataagaagng ttt 23

<210> 234

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 234

accaaaaact attacaaaac caaa 24

<210> 235

<211> 13

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 235

ccgacgaccg acg 13

<210> 236

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 236

gggagaggta aatatcgata c 21

<210> 237

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 237

cgcgaaaatt aatacctaac g 21

<210> 238

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 238

ttagggtgcg ttatcggac 19

<210> 239

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 239

cggaggtgtt tgttttcgtc 20

<210> 240

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 240

cgaaaaaaac aaacaccgac acg 23

<210> 241

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 241

cgttttcggggttgaggtaa c 21

<210> 242

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 242

ccaaaatacg ctaccgaacg a 21

<210> 243

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (16)..(16)

<223> Universal Purine

<400> 243

aaaatatcta ccccncc 18

<210> 244

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 244

tattactcac tctactcaaa actctcc 27

<210> 245

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 245

atatctttta ccaacaaata ccttcaaa 28

<210> 246

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(6)..(6)

<223> Universal Pyrimidine

<400> 246

gttttngttt tggttgcgat gttgt 25

<210> 247

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (18)..(18)

<223> Universal Pyrimidine

<400> 247

ggattttttt agaagagngg t 21

<210> 248

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (15)..(15)

<223> Universal Purine

<400> 248

tactcactaa taacnaaaac tac 23

<210> 249

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (18)..(18)

<223> Universal Pyrimidine

<400> 249

ggttttgtgt tttattgngg ag 22

<210> 250

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<220>

<221> modified base

<222>(7)..(7)

<223> Universal Purine

<400> 250

cctaacnaac tacaccaata caa 23

<210> 251

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (17)..(17)

<223> Universal Pyrimidine

<400> 251

gagaggggat tttttgngtt t 21

<210> 252

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (3)..(3)

<223> Universal Purine

<400> 252

ccnaaaacca attctaaact aatc 24

<210> 253

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 253

tttttagaag agcggtcggc 20

<210> 254

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 254

ctaataacga aaactacgac gacg 24

<210> 255

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 255

ttgtgtttta ttgcggagtg c 21

<210> 256

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 256

aaccacatat cgatcacgta cg 22

<210> 257

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 257

gcgttttcgg attttagggt c 21

<210> 258

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<400> 258

aactaatcgc cttaaataaa ataccg 26

<210> 259

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(6)..(6)

<223> Universal Purine

<220>

<221> modified base

<222> (17)..(17)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 259

ccctccnaacc ttataanaaa taatccc 27

<210> 260

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(7)..(7)

<223> Universal Purine

<220>

<221> modified base

<222> (17)..(17)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 260

aaaaacnccc taatccncat ccaac 25

<210> 261

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 261

cacttaactt cctctccaaa aatctaaac 29

<210> 262

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (11)..(11)

<223> Universal Pyrimidine

<220>

<221> modified base

<222> (18)..(18)

<223> Universal Pyrimidine

<400> 262

gtttttagaa ngttttgngt tt 22

<210> 263

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 263

gtttttagaa ygttttgygt tt 22

<210> 264

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (11)..(11)

<223> Universal Purine

<400> 264

aaaaaactcc ncactcttcc 20

<210> 265

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 265

aaaaaactcc rcactcttcc 20

<210> 266

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 266

tttcgacgtt cgtaggtttt cgc 23

<210> 267

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 267

gcactcttcc gaaaacgaaa cg 22

<210> 268

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (19)..(19)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 268

ccaaacactc accaaatcnc aaac 24

<210> 269

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (19)..(19)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 269

ccaaacactc accaaatcnc aaac 24

<210> 270

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 270

atatctttta ccaacaaata ccttcaaa 28

<210> 271

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(6)..(6)

<223> Universal Pyrimidine

<400> 271

gttttngttt tggttgcgat gttgt 25

<210> 272

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(9)..(9)

<223> Universal Pyrimidine

<400> 272

ggagataang ggttttttgg 20

<210> 273

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (19)..(19)

<223> Universal Purine

<400> 273

cactaaaaat ataccaacna cc 22

<210> 274

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 274

ggagagttat ttaagaaagg tgg 23

<210> 275

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(9)..(9)

<223> Universal Purine

<220>

<221> modified base

<222> (11)..(11)

<223> Universal Purine

<400> 275

aaaattacnc naaacccac 19

<210> 276

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 276

cgtgttcgta gggttttttc gttttc 26

<210> 277

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 277

ccaacgaccc tcgaaaaaaa aacg 24

<210> 278

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 278

gattttgcgg gtacggttta cgc 23

<210> 279

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 279

gatccctaaa acgccgaaaa caacg 25

<210> 280

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 280

cgttattttt tttggggtggt ttttcg 26

<210> 281

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (2)..(2)

<223> Universal Purine

<400> 281

cnaaaaacca cccaaaaaaa ataac 25

<210> 282

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

Synthetic oligonucleotide"

<220>

<221> modified base

<222> (11)..(11)

<223> Universal Pyrimidine

<400> 282

ggataaatat ngtaaggtat tgag 24

<210> 283

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 283

cgaaatacta aatttctcta attcctc 27

<210> 284

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (19)..(19)

<223> Universal Pyrimidine

<400> 284

gagtttttttt ggttttttng ag 22

<210> 285

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (15)..(15)

<223> Universal Purine

<400> 285

ctaaaataaa taccncaaaa cac 23

<210> 286

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 286

cgcgttcgga ttttttttttc ggc 23

<210> 287

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 287

aaatttctct aattcctccg aacgcacg 28

<210> 288

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 288

gcgtacgttg gtcgtttcgt attttc 26

<210> 289

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 289

gcaaaacact aaaaaacga aaaaacgcg 29

<210> 290

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(9)..(9)

<223> Universal Pyrimidine

<220>

<221> modified base

<222> (17)..(17)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 290

gtagttatng agagtgngga gcgattag 28

<210> 291

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(7)..(7)

<223> Universal Purine

<220>

<221> modified base

<222> (20)..(20)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 291

ctaatcnctc cgcactctcn ataactac 28

<210> 292

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(9)..(9)

<223> Universal Pyrimidine

<400> 292

gtttggagng ttatgagtag 20

<210> 293

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (13)..(13)

<223> Universal Purine

<400> 293

cttcatatcc ccnataaaac tc 22

<210> 294

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 294

gggtttttag tcggtttagt g 21

<210> 295

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(8)..(8)

<223> Universal Purine

<220>

<221> modified base

<222> (17)..(17)

<223> Universal Purine

<400> 295

ctaaaacnta aaactcnaac c 21

<210> 296

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 296

gatttagagc gcgttgttcg c 21

<210> 297

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 297

catatccccg ataaaactca acgactcg 28

<210> 298

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 298

gtcggtttag tgatattgcg ggc 23

<210> 299

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 299

ccacgaccta aacgtaaacc taacg 25

<210> 300

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222>(7)..(7)

<223> Universal Pyrimidine

<400> 300

gatggtnggg ttgggttttt gtttttgg 28

<210> 301

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 301

ccaaaaacaa aaacccaacc cgaccatc 28

<210> 302

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (11)..(11)

<223> Universal Pyrimidine

<220>

<221> modified base

<222> (20)..(20)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 302

cgtatatttt nggttttttn gggtttcg 28

<210> 303

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (2)..(2)

<223> Universal Purine

<220>

<221> modified base

<222> (18)..(18)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 303

cnaaacccga aaaaaccnaa aatatac 27

<210> 304

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (10)..(10)

<223> Universal Pyrimidine

<400> 304

ggtagttgtn gtcgggaagg aggttcg 27

<210> 305

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (2)..(2)

<223> Universal Purine

<220>

<221> modified base

<222> (18)..(18)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 305

cnaacctcct tcccgacnac aactacc 27

<210> 306

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 306

ggtttttttt gtatagatgt ggttaatgg 29

<210> 307

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 307

ccattaacca catctataca aaaaaaacc 29

<210> 308

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (15)..(15)

<223> Universal Pyrimidine

<400> 308

ggtttggttt atagngtatt tagg 24

<210> 309

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 309

gaggtttagt aagttttttg gattgtg 27

<210> 310

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 310

cccttaaaaa ttacaaaaac cacaac 26

<210> 311

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 311

gtagattggg tggttaattt agg 24

<210> 312

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (12)..(12)

<223> Universal Purine

<220>

<221> modified base

<222> (14)..(14)

<223> Universal Purine

<400> 312

ctataattcc cncncttttc 20

<210> 313

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 313

ggtggttaat ttagagtttc gagagac 27

<210> 314

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 314

cgttacccg aaaaccaaaa aactaccg 28

<210> 315

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 315

gatttcgtat tttgagaggt tgttgtttag 30

<210> 316

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 316

ctaaacaaca acctctcaaa atacgaaatc 30

<210> 317

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 317

ggtagattgg gtggttaatt tagag 25

<210> 318

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 318

ccaaaaaatc tcaacraact c 21

<210> 319

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 319

gggtggttaa tttagagttt cgagagac 28

<210> 320

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 320

accacgaaaa ccaaaaaact accg 24

<210> 321

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 321

gggattttgt ttaagtatgt taaagg 26

<210> 322

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 322

cctaccttac ctctaaatac caacc 25

<210> 323

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 323

gtatgttaaa gggttgttgt aagttaagg 29

<210> 324

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 324

cctctaaata ccaaccccaa acc 23

<210> 325

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 325

ccaactactc caaaaaactt ccaaaaacc 29

<210> 326

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 326

ccaactactc caaaaaactt ccaaaaacc 29

<210> 327

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 327

gtatgttaaa gggttgttgt aagttaagg 29

<210> 328

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 328

cctctaaata ccaaccccaa acc 23

<210> 329

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 329

ccaccaccca acacacaata acaaacac 28

<210> 330

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 330

ccaccaccca acacacaata acaaacac 28

<210> 331

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 331

atttagagcg cgttgttcgc 20

<210> 332

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 332

atatccccga taaaactcaa cgactcg 27

<210> 333

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 333

tatccccgat aaaactcaac gactcg 26

<210> 334

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 334

atccccgata aaactcaacg actcg 25

<210> 335

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 335

gcgttcggat ttttttttcg gc 22

<210> 336

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 336

tttctctaat tcctccgaac gcacg 25

<210> 337

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 337

ctctaattcc tccgaacgca cg 22

<210> 338

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 338

gtgacgatta gagttagatt tagagcgc 28

<210> 339

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 339

gtagttatcg agagtgcgga gcgattag 28

<210> 340

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 340

ccaacccgac catcaccgcg aacaac 26

<210> 341

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 341

ggagagtgta tttgtgaagg aaatg 25

<210> 342

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 342

catacataca ccaaacaatt cattc 25

<210> 343

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 343

ccaaatacca taaccatttt attaataaca c 31

<210> 344

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 344

ccaaatacca taaccatttt attaataaca c 31

<210> 345

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 345

ggtttygttg gggatttg 18

<210> 346

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 346

accrctcttc taaaaaatcc 20

<210> 347

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 347

aggttttttc ggttagttgc gc 22

<210> 348

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 348

aacgtcgacc gcaaaaaaac g 21

<210> 349

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 349

cgcgatttcg gggattttag g 21

<210> 350

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 350

cctaaaatcc ccgaaatcgc 20

<210> 351

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 351

gaagtagttg tgtaattygt tgg 23

<210> 352

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 352

caccctaacr aactacacc 19

<210> 353

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 353

tgcggattag ggcgtttttt attttc 26

<210> 354

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 354

tacaaccaca tatcgatcac gtacg 25

<210> 355

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 355

ggagttcgtc gattggttgg g 21

<210> 356

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 356

cccaaccaat cgacgaactc c 21

<210> 357

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 357

gagtttttyg gagggttata g 21

<210> 358

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 358

caaactacaa aaaacattca atcc 24

<210> 359

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 359

gcgtttgggt ttttcggtg tc 22

<210> 360

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 360

atcgccgcaa ttaaaaaacc cg 22

<210> 361

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 361

ggttcgcgtt ttaattttta ggtattg 27

<210> 362

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 362

caatacctaa aaattaaaac gcgaacc 27

<210> 363

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 363

gttatggatt yggaygttag 20

<210> 364

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 364

ctccracraa caatcactc 19

<210> 365

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 365

gtttggtgtt tagtcgttcg tc 22

<210> 366

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 366

cactcgaaat aaacgaaaac acg 23

<210> 367

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 367

ggtagtagcg gtagcgtttt tattg 25

<210> 368

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 368

caataaaaac gctaccgcta ctacc 25

<210> 369

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 369

ggygtagttt atttyggtt 19

<210> 370

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 370

attaaccra ctcraccaac 20

<210> 371

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 371

gtatgtttcg cggtttcgta gttc 24

<210> 372

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 372

actaaaccta acgttcgaaa cg 22

<210> 373

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 373

cgttcgttcg gtgtattttt ttttcgg 27

<210> 374

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 374

ccgaaaaaaa aatacaccga acgaac 26

<210> 375

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 375

gtttgagttg ttttgatttt agtg 24

<210> 376

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 376

ctccaacctc aactctaaac 20

<210> 377

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 377

gattttagtg tcgcgtattt tggttc 26

<210> 378

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 378

ctaaactaaa tcccgcgaac ctcg 24

<210> 379

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (17)..(17)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 379

ggttttttg ggggttnatt tcgggtag 28

<210> 380

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<220>

<221> modified base

<222> (21)..(21)

<223> a, c, t, g, unknown or other

<220>

<221> source

<223> /note="Detailed description of substitutions and preferred

implementation options, see the filed application"

<400> 380

ctacccgaaa taacccccaa ntaaaacc 28

<210> 381

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 381

ggtttttagt atttttayga aggt 24

<210> 382

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 382

cratacraaa acctactctc ta 22

<210> 383

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 383

tttggatttt gttcgtcgtt agtgc 25

<210> 384

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 384

ctactctcta aacccgcgaa cg 22

<210> 385

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 385

ggttttagtc gtcgcggacg atgt 24

<210> 386

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 386

acatcgtccg cgacgactaa aacc 24

<210> 387

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 387

gagttagatt tagagcgcgt tgttc 25

<210> 388

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 388

gagcgcgttc ggatttttttttc 23

<210> 389

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 389

tggygggggt agatatttt 19

<210> 390

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Description of the artificial sequence:

synthetic oligonucleotide"

<400> 390

tctactcaaa actctcccct ctcc 24

<---

Claims (74)

1. A set of cartridges for determining the status of nucleic acid methylation, where the specified set of cartridges contains: first cartridge containing: sample receiving chamber; a column containing a first matrix material configured to bind nucleic acids in the sample; channel or chamber with temperature control; sampling chamber; and a plurality of chambers containing reagents and/or buffers, wherein at least one of said chambers is configured to contain a bisulfite reagent; and second cartridge containing: sample receiving chamber; a column containing a second matrix material configured to bind bisulfite-converted DNA; channel or chamber with temperature control; and a plurality of chambers containing reagents and/or buffers, wherein at least one of said chambers is configured to contain a reagent for desulfurization and/or elution. 2. A set of cartridges as claimed in claim 1, wherein said temperature controlled channel or chamber in said first cartridge is a thermal cycling channel or chamber. 3. A set of cartridges according to any one of claims 1 to 2, wherein said temperature controlled channel or chamber in said second cartridge is a thermal cycling channel or chamber. 4. A set of cartridges according to any one of claims 1 to 3, wherein said bisulfite reagent contains a compound selected from the group consisting of ammonium bisulfite, sodium metabisulfite, potassium bisulfite, cesium bisulfite and 1,4-diazabicyclo[2.2.2]- octane (DABSO). 5. The cartridge set of claim 4, wherein said bisulfite reagent contains ammonium bisulfite. 6. A set of cartridges according to any one of claims 1 to 5, wherein said bisulfite reagent is present in a reagent mixture that contains scavengers to prevent the oxidation of sulfites and/or catalysts. 7. The cartridge set of claim 6, wherein said bisulfite reagent is present in a reagent mixture containing scavengers selected from the group consisting of Trolox and hydroquinone. 8. A set of cartridges according to any one of claims 6 to 7, wherein said bisulfite reagent is present in a reagent mixture containing polyamines as catalysts. 9. A set of cartridges according to any one of claims 1 to 8, wherein said first cartridge is configured to add a bisulfite reagent to the cartridge by a user. 10. A set of cartridges according to any one of claims 1 to 9, wherein said bisulfite reagent is present as a component in one of said plurality of chambers in said first cartridge. 11. A set of cartridges according to any one of claims 1 to 10, wherein at least one chamber of the plurality of chambers in said second cartridge contains polymerase chain reaction (PCR) primers and/or PCR probes and/or a master mix for PCR. 12. A set of cartridges according to any one of claims 1 to 11, wherein the plurality of chambers in said second cartridge comprises one or more chambers containing one or more reagents selected from the group consisting of methylation-specific PCR primers, methylation-specific probes for PCR, PCR enzyme(s) and PCR reaction buffer. 13. The cartridge set of claim 12, wherein the plurality of chambers in said second cartridge comprises at least two chambers containing one or more reagents selected from the group consisting of methylation-specific PCR primers, methylation-specific PCR probes, enzyme(s) for PCR; and reaction buffer for PCR. 14. A set of cartridges according to any one of claims 1 to 13, wherein the plurality of chambers in said second cartridge comprises at least one chamber containing primers and probes for detecting forward strand methylation of the converted DNA. 15. A set of cartridges according to any one of claims 1-14, wherein the plurality of chambers in said second cartridge comprises at least one chamber containing primers and probes for detecting reverse strand methylation of the converted DNA. 16. Cartridge kit according to any one of claims 12 to 15, wherein said PCR primers and/or probes and/or enzymes are presented on beads. 17. A set of cartridges according to any one of claims 1-16, in which the specified second cartridge contains one or more primers presented in tables 5, 11 or 12, and/or one or more probes presented in tables 5, 11 or 12. 18. The cartridge set of claim 17, wherein said second cartridge contains the following probes and primers to determine methylation of the O-6-methylguanine-DNA methyltransferase gene using nested PCR: outer forward primer (248b) containing the nucleotide sequence GTTTT(T*)AGAAYG(T*)TTTGYGTTT (SEQ ID NO:263); outer reverse primer (249b) containing the nucleotide sequence: AAAAAAC(T*)CCRCACTCTTCC (SEQ ID NO:265); internal forward primer (250) containing the nucleotide sequence TTTCGACGTTCGTAGGTTTTCGC (SEQ ID NO:266); internal reverse primer (251) containing the nucleotide sequence GCACTCTTCCGAAAACGAAACG (SEQ ID NO:267); and probe (252a) containing the nucleotide sequence of fluorophore-CCAAACAC(T*)CACCAAATC(N*)CAAAC blocker (SEQ ID NO:268). 19. A set of cartridges according to any one of claims 17-18, wherein said second cartridge contains the following probes and primers for determining beta-actin gene methylation using a nested PCR reaction: outer forward primer (102) containing the nucleotide sequence GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO:103); outer reverse primer (103) containing the nucleotide sequence CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO:104); internal forward primer (148) containing the nucleotide sequence GGTTTAGTAAGTTTTTTGGATTGTG (SEQ ID NO:149); internal reverse primer (149) containing the nucleotide sequence CCTTAAAAATTACAAAAACCACAAC (SEQ ID NO:150); and probe (178) containing the nucleotide sequence of fluorophore-CCACCACCCAACACA(N*)CAA(T*)AACAAAACAC blocker (SEQ ID NO:179). 20. A system for determining nucleic acid methylation in a biological sample, including: a housing configured to receive one or more sample processing modules, where each sample processing module is configured to attach a removable first cartridge and/or a second cartridge from said set of cartridges according to any one of claims 1 to 19; wherein said system is configured to: control of the sample processing modules, ensuring that the sample processing is performed to control the first cartridge from the specified set of cartridges, ensuring that the nucleic acid bisulfite conversion is performed in the sample introduced into the specified first cartridge and/or performing desulfurization and determining methylation of one or more target nucleic acids within a respective removable sample cartridge. 21. A method for obtaining bisulfite-converted DNA, including: providing a biological sample in the sample chamber of a first cartridge in a set of cartridges according to any one of claims 1 to 19 and operating said first cartridge to: binding the DNA in said sample to said first template material which is configured to bind nucleic acids in the sample; washing associated DNA; eluting the bound DNA from the template material; combining the eluted DNA with the specified bisulfite reagent; heating the mixture of DNA and the bisulfite reagent in said temperature-controlled channel or chamber to perform a bisulfite conversion of said DNA; and delivering the bisulfite-converted DNA to the sample withdrawal chamber of said first cartridge. 22. The method of claim 21, wherein said method further comprises: providing bisulfite-converted DNA in the sample chamber of the second cartridge in the cartridge set of any one of claims 1-19; and management of the specified second cartridge providing: linking said bisulfite-converted DNA to said second template material configured to bind bisulfite-converted DNA; washing the bound bisulfite-converted DNA; eluting the washed bisulfite-converted DNA from said second template material; and desulfurization of bisulfite-converted DNA. 23. The method of claim 22, wherein said second cartridge is operated to elute the bisulfite-converted DNA from said second template material prior to desulfurization. 24. The method of claim 22, wherein said second cartridge is operated to elute bisulfite-converted DNA from said second template material after or during desulfurization. 25. The method according to any one of claims 22-24, wherein said method comprises operating said second cartridge to perform methylation-specific PCR and/or nucleic acid sequencing and/or high-precision melting curve analysis (HRM) for said converted DNA with determining the methylation of said DNA. 26. A method for detecting cancer in a subject, including: providing a biological sample from said subject, wherein said biological sample contains DNA; using a cartridge set according to any one of claims 1 to 19, wherein said first cartridge of said cartridge set is used to perform a bisulfite conversion of said DNA; and said second cartridge of said set of cartridges is used to desulfurize the converted DNA and determine the methylation of one or more promoters of a gene in said DNA whose methylation status is a marker of cancer, wherein an increase in methylation of said one or more promoters of a gene is indicative of the presence of cancer or the stage of cancer or precancerous states. 27. A method for detecting a predisposition to cancer in a subject, including: providing a biological sample from said subject, wherein said biological sample contains DNA; using a cartridge set according to any one of claims 1 to 19, wherein said first cartridge of said cartridge set is used to perform a bisulfite conversion of said DNA; and said second cartridge of said set of cartridges is used to desulfurize the converted DNA and determine the methylation of one or more gene promoters in said DNA whose methylation status is a cancer marker, wherein an increase in methylation of said one or more gene promoters is an indicator of cancer predisposition. 28. A kit for determining DNA methylation, including: a container containing the first cartridge and/or the second cartridge from the set of cartridges according to any one of claims 1 to 19. 29. The kit of claim 28, wherein said kit contains a conversion reagent in said cartridge or in a container separate from the cartridge. 30. The kit of claim 29, wherein said kit contains said conversion reagent in a container separate from the cartridge. 31. The kit of claim 29, wherein said kit contains said conversion reagent in the chamber of the cartridge. 32. The kit according to any one of claims 29-31, wherein said conversion reagent contains a compound selected from the group consisting of sodium metabisulphite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, and 1,4-diazabicyclo[2.2.2]- octane (DABSO).

Images