RU2777115C2 - RECOMBINANT pMHC MOLECULES OF CLASS II - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, specifically to an isolated heterodimer containing the first polypeptide with SEQ ID NO: 53 or 54 and the second polypeptide with SEQ ID NO: 51 or 52; it can be used in medicine.

EFFECT: obtained heterodimer, where one of the first and the second polypeptides of the heterodimer contains α-domain of MHC of class II, and the other one of the first and the second polypeptides contains β-domain of MHC of class II, can be conjugated with a nanoparticle to form a heterodimer-nanoparticle conjugate and can be used for the regulation of an immune response and effective treatment of an autoimmune disease.

43 cl, 16 dwg, 19 tbl, 12 ex

Description

Link to related applications

[01] This application claims priority under U.S. Provisional Application Serial No. 62/419,947, filed Nov. 9, 2016, which is incorporated herein in its entirety.

Sequence listing

[02] This application contains a sequence listing that has been filed electronically in ASCII format and is hereby incorporated by reference in its entirety. The specified ASCII copy, created on October 31, 2017, is named 42363-711_601_SL.txt and is 242369 bytes in size.

Background of the Invention

[03] Major histocompatibility complex (MHC) class II molecules are typically found on antigen presenting cells where they present the antigen for recognition by CD4+ T cells, helping to regulate immune responses. Class II MHC molecules are formed by dimerization of the alpha and beta chains and are stabilized in the presence of a polypeptide antigen that binds in the binding cavity formed by the alpha and beta chains. However, the production of MHC class II in engineered in vitro systems has been problematic due to intrinsic instability of the protein heterodimers, even in the presence of the polypeptide.

Brief summary of the present invention

[04] Disclosed herein are isolated and purified antigen-MHC heterodimers and effective methods for their preparation. Heterodimers are designed to facilitate production and isolation. Several methods are used to increase the production of isolated heterodimers. First, the alpha and beta chains are individually fused to a portion of the IgG heavy chain, then the IgG is constructed in a ridge-to-cavity architecture (with one of the IgG alpha or beta chains consisting of a ridge and the opposite alpha or beta -an IgG chain containing a pit). In some cases, the heterodimer can be further stabilized with a cysteine trap between the antigen and the remainder of the class II MHC binding cavity. To use a cysteine trap, the antigen may contain an endogenous or engineered cysteine that forms a disulfide bond with the engineered cysteine on the alpha or beta chain of the MHC molecule that is in close proximity to the binding cavity. This cysteine trap can further enhance the stability of the MHC peptide molecule. Surprisingly, the ridge-to-trough architecture has been found to work in the absence of the heterologous dimerization domains that have been used previously. In fact, the heterologous dimerization domain has been found to be detrimental to the formation of heterodimers.

[05] Provided herein in one aspect are isolated heterodimers comprising at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that is located in an engineered cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC β1 domain class II, a class II MHC β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, a class II MHC α2 domain, or a combination thereof. In some embodiments, the overhang contains one or more non-naturally occurring amino acid residues. In some embodiments, the overhang contains one or more naturally occurring amino acid residues. In some embodiments, the protrusion contains one or more amino acids selected from phenylalanine, arginine, tyrosine, tryptophan, and cysteine. In some embodiments, the protrusion contains an arginine residue. In some embodiments, the protrusion contains a phenylalanine residue. In some embodiments, the protrusion contains a tyrosine residue. In some embodiments, the protrusion contains a tryptophan residue. In some embodiments, the protrusion contains a cysteine residue. In some embodiments, the protrusion contains a cysteine residue and a tryptophan residue. In some embodiments, the cavity contains a non-naturally occurring amino acid residue. In some embodiments, the cavity contains a naturally occurring amino acid residue. In some embodiments, the cavity contains one or more amino acids selected from alanine, serine, threonine, valine, and cysteine. In some embodiments, the cavity contains an alanine residue. In some embodiments, the cavity contains a serine residue. In some embodiments, the cavity contains a threonine residue.

[06] In some embodiments, the cavity contains a valine residue. In some embodiments, the cavity contains a cysteine residue. In some embodiments, the cavity contains a cysteine residue, a serine residue, an alanine residue, and a valine residue. In some embodiments, the first polypeptide and the second polypeptide interact through the C _H 3 domain of the antibody. In some embodiments, the C _H 3 domain is derived from IgG. In some embodiments, the IgG is of the IgG1 subtype. In some embodiments, the first polypeptide and/or the second polypeptide further comprise a C-terminal cysteine residue. In some embodiments, the first polypeptide and/or the second polypeptide further comprise a biotinylation site. In some embodiments, the first polypeptide and/or the second polypeptide further comprise a Strep tag. In some embodiments, the isolated heterodimer comprises at least one polypeptide encoded by SEQ ID NO: 1. In some embodiments, the isolated heterodimer comprises at least one polypeptide encoded by SEQ ID NO: 2. In some embodiments, the isolated heterodimer comprises at least one polypeptide encoded by SEQ ID NO: 3. In some embodiments, the isolated heterodimer comprises at least one polypeptide encoded by SEQ ID NO: 4. In some embodiments, the isolated heterodimer comprises at least one polypeptide encoded by any of SEQ ID NO: 5-8. In some embodiments, the isolated heterodimer comprises at least one polypeptide encoded by a DNA sequence comprising any of SEQ ID NOs: 1-26, 64, or 65. In some embodiments, the isolated heterodimer comprises at least one polypeptide containing the amino acid sequence of any of SEQ ID NO: 27-63 or fragment thereof.

[07] Provided herein in another aspect are multimers comprising two or more of the isolated heterodimers described herein. In some embodiments, the multimer further comprises avidin.

[08] In some embodiments, each of the two or more heterodimers is linked to avidin. In some embodiments, the multimer further comprises a polymer backbone, with two or more heterodimers each connected to a polymer backbone. In some embodiments, the polymer backbone is dextran or polyethylene glycol (PEG).

[09] Provided herein in another aspect are polypeptides comprising an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and at least one engineered ridge. In some embodiments, the at least one engineered protrusion is not located in an α1 MHC class II domain or in an α2 MHC class II domain. In some embodiments, the engineered protrusion is located in the C _H 3 domain of an antibody fused to a polypeptide. In some embodiments, the polypeptide optionally comprises an antibody C _H 2 domain located between an MHC class II α2 domain and an engineered overhang C _H 3 domain. In some embodiments, the polypeptide comprises an antibody C _H 3 domain and the antibody C _H 3 domain contains at least one mutation selected from the list consisting of S354C, T366W, and both S354C and T366W (EU numbering).

[010] Provided herein in another aspect are polypeptides comprising an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and at least one engineered ridge. In some embodiments, the at least one engineered ridge is not located in the class II MHC β1 domain or in the class II MHC β2 domain. In some embodiments, the engineered protrusion is located in the C _H 3 domain of an antibody fused to a polypeptide. In some embodiments, the polypeptide optionally comprises an antibody C _H 2 domain located between an MHC class II β2 domain and an engineered overhang C _H 3 domain. In some embodiments, the polypeptide comprises an antibody C _H 3 domain and the antibody C _H 3 domain contains at least one mutation selected from the list consisting of S354C, T366W, and both S354C and T366W (EU numbering).

[011] In some embodiments, the overhang contains one or more non-naturally occurring amino acid residues. In some embodiments, the overhang contains one or more naturally occurring amino acid residues. In some embodiments, the protrusion contains one or more amino acids selected from phenylalanine, arginine, tyrosine, tryptophan, and cysteine. In some embodiments, the protrusion contains an arginine residue. In some embodiments, the protrusion contains a phenylalanine residue. In some embodiments, the protrusion contains a tyrosine residue. In some embodiments, the protrusion contains a tryptophan residue. In some embodiments, the protrusion contains a cysteine residue. In some embodiments, the protrusion contains a cysteine residue and a tryptophan residue.

[012] Provided herein in another aspect are polypeptides comprising an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and at least one engineered cavity. In some embodiments, the at least one engineered cavity is not located in an α1 MHC class II domain or in an α2 MHC class II domain. In some embodiments, the engineered cavity is located in the C _H 3 domain of an antibody fused to a polypeptide. In some embodiments, the polypeptide optionally comprises an antibody C _H 2 domain located between an MHC class II α2 domain and an engineered cavity C _H 3 domain. In some embodiments, the polypeptide comprises an antibody C _H 3 domain and the antibody C _H 3 domain contains at least one mutation selected from a list consisting of Y349C, T366S, L368A, Y407V (EU numbering) and combinations thereof.

[013] Provided herein in another aspect are polypeptides comprising an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and at least one engineered cavity. In some embodiments, the at least one engineered cavity is not located in the β1 domain of the MHC class II or in the β2 domain of the MHC class II. In some embodiments, the engineered cavity is located in the C _H 3 domain of an antibody fused to a polypeptide. In some embodiments, the polypeptide optionally comprises an antibody C _H 2 domain located between an MHC class II β2 domain and an engineered cavity C _H 3 domain. In some embodiments, the polypeptide comprises an antibody C _H 3 domain and the antibody C _H 3 domain contains at least one mutation selected from a list consisting of Y349C, T366S, L368A, Y407V (EU numbering) and combinations thereof.

[014] In some embodiments, the cavity contains a non-naturally occurring amino acid residue. In some embodiments, the cavity contains a naturally occurring amino acid residue. In some embodiments, the cavity contains one or more amino acids selected from alanine, serine, threonine, valine, and cysteine. In some embodiments, the cavity contains an alanine residue. In some embodiments, the cavity contains a serine residue. In some embodiments, the cavity contains a threonine residue. In some embodiments, the cavity contains a valine residue. In some embodiments, the cavity contains a cysteine residue. In some embodiments, the cavity contains a cysteine residue, a serine residue, an alanine residue, and a valine residue.

[015] In some embodiments, the overhang is located in the C _H 3 constant domain of the antibody. In some embodiments, the cavity is located in the C _H 3 constant domain of the antibody. In some embodiments, the polypeptide further comprises a C-terminal cysteine residue.

[016] Provided herein in another aspect are polypeptides encoded by a DNA sequence comprising any of SEQ ID NOs: 1-26, 64, or 65.

[017] Provided herein in another aspect are polypeptides comprising the amino acid sequence of any of SEQ ID NOs: 27-63 or a fragment thereof.

[018] Provided herein in another aspect are heterodimer-nanoparticle conjugates comprising at least one heterodimer as described herein and a nanoparticle, wherein the nanoparticle is non-liposomal and/or contains a hard core. In some embodiments, the hard core is a gold or iron oxide core. In some embodiments, at least one heterodimer is covalently or non-covalently linked to the nanoparticle. In some embodiments, at least one heterodimer is covalently linked to the nanoparticle via a linker. In some embodiments, the linker contains polyethylene glycol.

[019] Provided herein, according to another aspect, are methods for producing a heterodimer comprising a first polypeptide and a second polypeptide, wherein the first polypeptide and the second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that fits into an engineered cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC β1 domain class II, a class II MHC β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, a class II MHC α2 domain, or a combination thereof; comprising the following steps: (a) culturing a host cell containing a nucleic acid encoding a first polypeptide and a second polypeptide, including their contact surfaces, wherein the nucleic acid encoding the contact surface of the first polypeptide has been changed from the nucleic acid encoding the original contact surface of the first polypeptide to encode a protrusion, or the nucleic acid encoding the interface of the second polypeptide has been changed from the nucleic acid encoding the original interface of the second polypeptide to encode a cavity, or both, and wherein the culture is such that the first polypeptide and the second polypeptide is expressed; and (b) recovering the heterodimer from the host cell culture.

[020] In some embodiments, a nucleic acid encoding a first polypeptide has been altered from the original nucleic acid to encode a bulge, and a nucleic acid encoding a second polypeptide has been altered from the original nucleic acid to encode a cavity.

[021] In some embodiments, step (a) is preceded by a step in which each of the one or more nucleic acids encoding the original amino acid residue at the interface of the first polypeptide is replaced with a nucleic acid encoding the import amino acid residue, wherein the overhang contains one or more import leftovers. In some embodiments, the import moiety is selected from phenylalanine, arginine, tyrosine, tryptophan, and cysteine. In some embodiments, the import residue is arginine. In some embodiments, the import residue is phenylalanine.

[022] In some embodiments, the import residue is tyrosine. In some embodiments, the import residue is tryptophan. In some embodiments, the import residue is a cysteine.

[023] In some embodiments, step (a) is preceded by a step in which each of the one or more nucleic acids encoding the original amino acid residue at the contact surface of the second polypeptide is replaced with a nucleic acid encoding the imported amino acid residue, wherein the cavity contains one or more imported leftovers. In some embodiments, the import residue is selected from cysteine, alanine, serine, threonine, or valine. In some embodiments, the import residue is a cysteine. In some embodiments, the import residue is alanine. In some embodiments, the import residue is serine. In some embodiments, the import residue is threonine. In some embodiments, the import residue is valine.

[024] In some embodiments, each first polypeptide and second polypeptide comprise an antibody constant domain. In some embodiments, the antibody constant domain is a C _H 3 domain. In some embodiments, the antibody constant domain is derived from IgG. In some embodiments, the IgG is human IgG1. In some embodiments, the antibody constant domain is a _CH 2 and _CH 3 domain. In some embodiments, the _CH 3 further comprises an engineered protrusion or cavity (trough).

[025] In another aspect, provided herein are methods for preparing a heterodimer-nanoparticle conjugate comprising linking at least one heterodimer described herein to a nanoparticle, wherein the nanoparticle is non-liposomal and/or contains a hard core. In some embodiments, the hard core is a gold or iron oxide core. In some embodiments, the linking step includes covalently or non-covalently linking at least one heterodimer to the nanoparticle. In some embodiments, the linking step includes covalently linking at least one heterodimer to the nanoparticle via a linker. In some embodiments, the linker contains polyethylene glycol.

[026] In another aspect, provided herein is an isolated heterodimer comprising at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and the second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that is located in an engineered cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof; or (ii) the first polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof. In some embodiments, the overhang contains one or more non-naturally occurring amino acid residues. In some embodiments, the protrusion contains one or more amino acids selected from phenylalanine, arginine, tyrosine, tryptophan, and cysteine. In some embodiments, the first or second polypeptide of the isolated heterodimer comprises an amino acid sequence that is at least 80% identical to the amino acid sequence shown in SEQ ID NO: 53. In certain embodiments, the first or second polypeptide of the isolated heterodimer comprises an amino acid sequence of at least 80% identical to the sequence of SEQ ID NO: 54. In some embodiments, the first or second polypeptide of the isolated heterodimer contains a C _H 3 domain, and the C _H 3 domain contains at least one mutation selected from a list consisting of S354C, T366W and both S354C and T366W (EU numbering). In certain embodiments, the cavity contains a non-naturally occurring amino acid residue. In certain embodiments, the cavity contains one or more amino acids selected from alanine, serine, threonine, valine, and cysteine. In some embodiments, the first or second polypeptide of the isolated heterodimer comprises an amino acid sequence that is at least 80% identical to the amino acid sequence shown in SEQ ID NO: 51. In certain embodiments, the first or second polypeptide of the isolated heterodimer comprises an amino acid sequence of at least 80% identical to the amino acid sequence shown in SEQ ID NO: 52. In some embodiments, the first or second polypeptide of the isolated heterodimer contains a C _H 3 domain, and the C _H 3 domain contains at least one mutation selected from the list consisting of Y349C, T366S, L368A, Y407V (EU numbering) and their combinations.

[027] In certain embodiments, one or both of the first polypeptide or the second polypeptide does not contain a heterologous dimerization domain. In certain embodiments, one or both of the first polypeptide or the second polypeptide does not contain a leucine zipper. In certain embodiments, one or both of the first polypeptide or the second polypeptide does not contain a site-specific biotinylation site. In some embodiments, the isolated heterodimer further comprises an autoimmune disease related antigen. In some embodiments, the disease antigen comprises a polypeptide of at least 11 amino acids in length. In some embodiments, the autoimmune disease antigen is connected to the MHC class II .alpha.1 domain or class II MHC .beta.1 domain by a flexible linker. In some embodiments, the antigen is covalently linked to the MHC class II α1 domain or MHC class II β1 domain by a disulfide bond formed between the cysteine amino acid associated with the antigenic peptide and the cysteine amino acid of the MHC class II α1 domain or MHC class II β1 domain. In some embodiments, the amino acid cysteine from an MHC class II α1 domain or an MHC class II β1 domain is within 10 amino acids of a residue that forms part of the MHC class II binding groove. In some embodiments, the cysteine residue of the α1 MHC class II domain or β1 of the MHC class II domain is within 3 amino acids of the residue that forms part of the MHC class II binding groove. In some embodiments, the amino acid cysteine from an MHC class II α1 domain or MHC class II β1 domain has been introduced into the natural sequence of an MHC class II α1 domain or MHC class II β1 domain. In certain embodiments, the isolated heterodimer is for use in the treatment of an individual diagnosed or suspected of having an autoimmune disease. In certain embodiments, the isolated heterodimer is encoded by a polynucleotide encoding the first or second polypeptide described herein. In certain embodiments, the host cell contains a polynucleotide. In certain embodiments, the polynucleotide is stably integrated into the genome. In some embodiments, at least one heterodimer is conjugated to a nanoparticle to form a heterodimer-nanoparticle conjugate, wherein the nanoparticle is non-liposomal and/or contains a hard core. In certain embodiments, the hard core is a gold, iron, or iron oxide core. In certain embodiments, the solid core is less than 100 nanometers in diameter. In certain embodiments, at least one heterodimer is covalently linked to the nanoparticle. In some embodiments, at least one heterodimer is covalently linked to the nanoparticle via a polyethylene glycol (PEG) containing linker. In certain embodiments, polyethylene glycol is functionalized with maleimide. In certain embodiments, the polyethylene glycol is less than 5 kDa. In some embodiments, a pharmaceutical composition comprising a heterodimer-nanoparticle conjugate is formed with a pharmaceutical excipient, stabilizer, or diluent. In certain embodiments, the isolated heterodimer or pharmaceutical composition is for use in a method of treating an autoimmune disease or inflammatory condition. In some embodiments, a method for treating an autoimmune disease or inflammatory condition comprises administering an isolated heterodimer-nanoparticle conjugate or a pharmaceutical composition to an individual.

[028] According to another aspect, this document describes a method for obtaining a heterodimer containing a first polypeptide and a second polypeptide, wherein the first polypeptide and the second polypeptide meet at the contact surface, and the contact surface of the first polypeptide contains an engineered protrusion that is located in an engineered cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof; or (ii) the first polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof; comprising the steps of: (a) culturing a host cell containing a nucleic acid encoding a first polypeptide and a second polypeptide, including their contact surfaces, wherein the nucleic acid encoding the contact surface of the first polypeptide has been changed from the nucleic acid encoding the original contact surface of the first the nucleic acid encoding the second polypeptide interface has been changed from the nucleic acid encoding the original interface of the second polypeptide to encode a cavity, or both, and the culture is such that the first polypeptide and the second polypeptide expressed; and (b) recovering the heterodimer from the host cell culture. In certain embodiments, the nucleic acid encoding the first polypeptide and the second polypeptide is stably integrated into the genome of the host cell. In certain embodiments, the host cell comprises a Chinese Hamster Ovary (CHO) cell. In some embodiments, recovering a heterodimer from a host cell culture or cultures of host cells comprises applying a liquid containing the heterodimer to a liquid chromatography column. In some embodiments, the liquid chromatography column contains protein A, protein G, protein L, or a combination thereof.

[029] According to another aspect, this document describes a method for obtaining a heterodimer containing a first polypeptide and a second polypeptide, wherein the first polypeptide and the second polypeptide meet at the contact surface, and the contact surface of the first polypeptide contains an engineered protrusion that is located in an engineered cavity on the contact surface of the second polypeptide ; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC β1 domain class II, a class II MHC β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, a class II MHC α2 domain, or a combination thereof; comprising the steps of: (a) culturing a first host cell containing a nucleic acid encoding a first polypeptide; (b) culturing a second host cell containing a nucleic acid encoding a second polypeptide; (c) isolating the polypeptides from host cell cultures; and (d) forming a heterodimer by incubating the first and second polypeptides together; wherein the nucleic acid encoding the contact surface of the first polypeptide has been changed from the nucleic acid encoding the original contact surface of the first polypeptide to encode a protrusion, or the nucleic acid encoding the contact surface of the second polypeptide has been changed from the nucleic acid encoding the original contact surface of the second polypeptide, to encode the cavity, or both. In certain embodiments, the nucleic acid encoding the first polypeptide and the second polypeptide is stably integrated into the genome of the host cell. In certain embodiments, the first and second host cells comprise Chinese Hamster Ovary (CHO) cells. In some embodiments, the method further comprises recovering the heterodimer or polypeptides from the host cell culture or host cell cultures and comprising applying a liquid containing the heterodimer or polypeptides to a liquid chromatography column. In some embodiments, the liquid chromatography column contains protein A, protein G, protein L, or a combination thereof.

[030] Provided herein in one aspect are isolated heterodimers comprising at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that is located in the designed cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain corresponding to S354C and T366W (EU numbering) ; and (ii) the second polypeptide comprises an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the cavity is formed by mutations in the IgG C _H 3 domain corresponding to Y349C, T366S, L368A, and Y407V (EU numbering).

[031] Provided herein in one aspect are isolated heterodimers comprising at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that is located in the designed cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain corresponding to S354C and T366W (EU numbering) ; and (ii) the second polypeptide comprises an MHC class II α1 domain, a class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the cavity is formed by mutations in the IgG C _H 3 domain corresponding to Y349C, T366S, L368A, and Y407V (EU numbering).

Brief description of graphic materials

[032] In FIG. 1A-B shows the lentiviral vector in both linearized (A) and circular (B) forms.

[033] In FIG. 2 shows an example of pMHC construction using a leucine zipper.

[034] In FIG. 3 schematically shows pMHC ridge-to-cavity designs (with and without leucine zipper).

[035] FIG. 4A-C. In FIG. 4A shows a flow cytometric analysis of eGFP expression in CHO cells transduced with lentiviruses encoding pMHC BDC2.5mi/IA ^g7 -trough-in-trough with or without a leucine zipper (left) or without it (right). In FIG. 4B and FIG. 4C shows protein G affinity chromatography elution profiles of culture supernatants from CHO cells expressing ridge-to-trough pMHC without leucine zipper (FIG. 4B) and with leucine zipper (FIG. 4C).

[036] In FIG. 5 shows the electrophoretic mobility of pMHC based on the ledge-to-trough without lightning by native (left) and denaturing (right) SDS-PAGE.

[037] In FIG. 6 shows FACS staining profiles of BDC2.5-CD4+ T cells using tetramers made with conventional pMHC monomers (left panel) or a no-zipper ridge-in-trough design (middle and right panels).

[038] In FIG. 7 shows non-denaturing (left) and denaturing (right) SDS-PAGE gel images of PFM nanoparticles conjugated to pMHC BDC2.5mi/IA ^g7 in a no-zipper ledge-in-trough pattern.

[039] In FIG. Figure 8 shows T cell responses in mice treated with 2.5mi/IA ^g7 nanoparticles based on a ledge-in-trough without zipper (left) or conventional (not ledge-in-trough based) 2.5mi/IA ^g7 nanoparticles with zippers (right). ). Mice were treated with 10 doses (2 doses per week for 5 weeks), after which spleen T cells were isolated, sorted into 2.5 mi/IA ^g7 tetramer positive and negative fractions, and challenged with anti-CD3/anti-CD28 monoclonal antibody-coated beads. mRNA was analyzed for the presence of transcripts corresponding to TR ₁ cells from tetramer-positive and negative fractions.

[040] In FIG. 9A-B show the release of cytokines from T cells isolated from mice treated as in FIG. 8. Mice were treated with either 2.5mi/IA ^g7 ridge-to-cavity nanoparticles without zipper (A) or conventional 2.5mi/IA ^g7 ridge-to-cavity nanoparticles (B) with zipper (B).

[041] In FIG. 10 shows the purification profile of the mono-Q protein BDC-PEG-biotin. Fractions numbered 19 to 38 were collected for biotin screening by ELISA and SDS-PAGE analysis.

[042] In FIG. 11 shows the SDS-PAGE profiles of the purified mono-Q fractions. The lanes are labeled with the number of each FPLC fraction. 20 μl of each fraction was applied to the gel.

[043] In FIG. 12 shows Western blot analysis of fractions 22-25 (lanes 5-9) which showed the presence of biotin exclusively in the alpha chain of the pMHC monomer compared to the pMHC BDC2.5mi/IA ^g7 monomer carrying the biotinylation sequence in the alpha chain and biotinylated with using the BirA enzyme (lane 1). Fractions 25-29 were pooled and used to prepare pMHC tetramers. Lanes 11-17 show fractions 30-36.

[044] In FIG. 13 shows the flow cytometry profile of BDC2.5-CD4+ T cells stained with tetramers prepared using BDC2.5mi/IA ^g7 -maleimide-PEG2-biotin.

[045] In FIG. 14A and FIG. 14B shows FPLC elution profiles, FIG. 14C and FIG. 14D shows SDS-PAGE analysis of the eluted fractions indicated in FIG. 14A and FIG. 14V.

[046] In FIG. 15A-D show flow cytometry of GFP-labeled JURMA cells expressing the DR-specific TCR in complex with the IGRP _13-25 polypeptide. In FIG. 15A shows the cell line alone; in fig. 15B shows a cell line incubated with PE labeled with DR3 IGRP _13-25 prepared by standard leucine zipper dimerization technology; in fig. 15C shows a cell line incubated with PE-labeled DR3 IGRP _13-25 made using ridge-to-trough and cis-trap dimerization technology, without the leucine zipper; in fig. 15D shows a cell line incubated with irrelevant PE labeled class II MHC heterodimers.

[047] In FIG. 16A and FIG. 16B shows stimulation of JURMA cells expressing a DR-specific TCR complexed with a nanoparticle-conjugated IGRP _13-25 polypeptide.

Detailed description of the present invention

[048] Various embodiments are described below. It should be noted that specific embodiments are not intended to be an exhaustive description or to limit the broader aspects discussed herein. One aspect described in connection with a particular embodiment is not necessarily limited to that embodiment and may be practiced with any other embodiment(s).

[049] Provided herein, in one aspect, are isolated heterodimers comprising at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that is located in an engineered cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC β1 domain class II, a class II MHC β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, a class II MHC α2 domain, or a combination thereof. The first polypeptide, the second polypeptide, or both may comprise a C _H 3 antibody domain fused to the polypeptide. Optionally, either the first polypeptide or the second polypeptide, or both, comprises an antibody C _H 2 domain located between the MHC (α or β chain) and the C _H 3 domain. In some embodiments, the first polypeptide comprises an antibody C _H 3 domain, and the C _H 3 domain of the antibody contains at least one mutation selected from the list consisting of S354C, T366W and both S354C and T366W (EU numbering). In some embodiments, the second polypeptide comprises the C _H 3 domain of the antibody, and the C _H 3 domain of the antibody contains at least one mutation selected from the list consisting of Y349C, T366S, L368A, Y407V (EU numbering) and combinations thereof. In other embodiments, the isolated heterodimer comprises an autoimmune or inflammatory disease peptide optionally covalently linked to the first or second polypeptide. Optionally, the autoimmune or inflammatory disease peptide contains a cysteine residue that interacts with a cysteine residue in either the first or second polypeptide to form a cysteine trap.

[050] In one aspect, one heterodimer polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and at least one engineered overhang. In some embodiments, the at least one engineered protrusion is not located in an α1 MHC class II domain or in an α2 MHC class II domain. In some embodiments, the engineered protrusion is located in the C _H 3 domain of an antibody fused to a polypeptide. In some embodiments, the polypeptide optionally comprises an antibody C _H 2 domain located between an MHC class II α2 domain and an engineered overhang C _H 3 domain. In some embodiments, the polypeptide comprises an antibody C _H 3 domain and the antibody C _H 3 domain contains at least one mutation selected from the list consisting of S354C, T366W, and both S354C and T366W (EU numbering). In other embodiments, the polypeptide comprises a peptide related to an autoimmune or inflammatory disease. Optionally, the autoimmune or inflammatory disease peptide contains a cysteine residue that interacts with a cysteine residue in the α1 or β1 domain of the MHC to form a cysteine trap.

[051] In one aspect, one heterodimer polypeptide comprises an MHC class II β1 domain, a class II MHC β2 domain, or a combination thereof, and at least one engineered overhang. In some embodiments, the at least one engineered protrusion is not located in the class II MHC β1 domain or in the class II MHC β2 domain. In some embodiments, the engineered protrusion is located in the C _H 3 domain of an antibody fused to a polypeptide. In some embodiments, the polypeptide optionally comprises an antibody C _H 2 domain located between an MHC class II β2 domain and an engineered overhang C _H 3 domain. In some embodiments, the polypeptide comprises an antibody C _H 3 domain and the antibody C _H 3 domain contains at least one mutation selected from the list consisting of S354C, T366W, and both S354C and T366W (EU numbering). In other embodiments, the polypeptide comprises a peptide related to an autoimmune or inflammatory disease. Optionally, the autoimmune or inflammatory disease peptide contains a cysteine residue that interacts with a cysteine residue in the α1 or β1 domain of the MHC to form a cysteine trap.

[052] In one aspect, one heterodimer polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and at least one engineered cavity. In some embodiments, the at least one engineered cavity is not located in an α1 MHC class II domain or in an α2 MHC class II domain. In some embodiments, the engineered cavity is located in the C _H 3 domain of an antibody fused to a polypeptide. In some embodiments, the polypeptide optionally comprises an antibody C _H 2 domain located between an MHC class II α2 domain and an engineered cavity C _H 3 domain. In some embodiments, the polypeptide comprises an antibody C _H 3 domain and the antibody C _H 3 domain contains at least one mutation selected from a list consisting of Y349C, T366S, L368A, Y407V (EU numbering) and combinations thereof. In other embodiments, the polypeptide comprises a peptide related to an autoimmune or inflammatory disease. Optionally, the autoimmune or inflammatory disease peptide contains a cysteine residue that interacts with a cysteine residue in the α1 or β1 domain of the MHC to form a cysteine trap.

[053] In one aspect, one heterodimer polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and at least one engineered cavity. In some embodiments, at least one engineered cavity is not located in the β1 domain of the MHC class II or in the β2 domain of the MHC class II. In some embodiments, the engineered cavity is located in the C _H 3 domain of an antibody fused to a polypeptide. In some embodiments, the polypeptide optionally comprises an antibody C _H 2 domain located between an MHC class II β2 domain and an engineered cavity C _H 3 domain. In some embodiments, the polypeptide comprises an antibody C _H 3 domain and the antibody C _H 3 domain contains at least one mutation selected from a list consisting of Y349C, T366S, L368A, Y407V (EU numbering) and combinations thereof. In other embodiments, the polypeptide comprises a peptide related to an autoimmune or inflammatory disease. Optionally, the autoimmune or inflammatory disease peptide contains a cysteine residue that interacts with a cysteine residue in the α1 or β1 domain of the MHC to form a cysteine trap.

[054] As used herein, the term "approximately" will be understood by those skilled in the art and will vary to some extent depending on the context in which it is used. If there are uses of a term that are not understood by those skilled in the art, given the context in which they are used, "about" will mean up to plus or minus 10% of the particular term.

[055] The use of terms in the singular and plural and similar references in the context of the description of the elements (especially in the context of the following claims) should be interpreted both in the singular and in the plural, unless otherwise specified herein or clearly contrary to the context. The listing of ranges of values in this document is merely intended to serve as a concise way of individually referring to each individual value falling within that range, unless otherwise noted herein, and each individual value is included in the description as if it were separately specified. in this document. All of the methods described herein may be performed in any suitable order, unless otherwise indicated herein or otherwise expressly contradicted by the context. The use of any and all examples or illustrative language (eg, "such as") provided herein is merely intended to better illuminate the embodiments and is not intended to limit the scope of the claims unless otherwise indicated. No wording in the description should be construed as indicating an optional element as essential.

[056] As used herein, the term "heterodimer" refers to a molecule comprising a first polypeptide and a second polypeptide, the second polypeptide differing in amino acid sequence from the first polypeptide by at least one amino acid residue. "Multimer" refers to a molecule containing two or more heterodimers or containing four or more polypeptides disclosed herein.

[057] As used herein, "individual" is synonymous with "subject". The individual may be diagnosed with a disease. An individual may be suspected of having a particular disease based on the manifestation of at least one symptom of said disease, the presence of a family history of said disease, the presence of a genotype corresponding to the definition of risk for said disease, or the performance of one of the phenotypic "laboratory tests" with a level or approximate level that would mean that the individual is at risk of disease. The individual may be a mammal such as a horse, cat, dog, pig, cow, goat, or sheep. An individual may, in certain instances, be a human.

[058] As used herein, the term "polypeptide" generally refers to peptides and proteins containing more than ten amino acids.

[059] As used herein, the term "first polypeptide" is any polypeptide that is to be linked to a second polypeptide. The first and second polypeptide meet at "contact surfaces" (defined below). In addition to the contact surface, the first polypeptide may contain one or more additional domains, such as "binding domains" (for example, a ligand-binding domain) or antibody constant domains (or parts thereof), including C _H 2, C _H 1 domains and C _L . In some embodiments, the first polypeptide contains at least one domain that is derived from an antibody. In additional embodiments, the domain is typically a constant domain, such as the C _H 3 domain of an antibody. In still other embodiments, the domain forms the contact surface of the first polypeptide.

[060] As used herein, a "second polypeptide" is any polypeptide that is to be linked to a first polypeptide via a "contact surface". In addition to the contact surface, the second polypeptide may contain additional domains such as a "binding domain" (e.g., a ligand-binding domain) or antibody constant domains (or portions thereof), including the C _H 2, C _H 1, and C _L domains. . In some embodiments, the second polypeptide contains at least one domain that is derived from an antibody. In other embodiments, the domain is typically a constant region, such as the C _H 3 domain of an antibody. In yet other embodiments, the domain forms the contact surface of the second polypeptide.

[061] As used herein, the term "binding domain" includes any region of a polypeptide that is responsible for selective binding to a molecule of interest (eg, an antigen).

[062] As used herein, the term "binding groove" refers to a molecular pocket or cleft that exists in an MHC class II heterodimer formed between the α1 MHC class II domain and the β2 domain of the MHC class II. It is the portion of the class II MHC heterodimer that interacts with antigens. The antigens are typically polypeptide antigens, but may be further modified with lipid moieties, glycol moieties, or glycolipid moieties. The residues that make up the binding groove show polymorphism and explain the differences in antigen binding between different HLA alleles. An important feature of the binding groove for class II MHC molecules is that the ends of the groove are open and allow the antigen to flow beyond one or both sides of the binding groove.

[063] As used herein, the term "contact" includes those "contact" amino acid residues in the first polypeptide that interact with one or more "contact" amino acid residues on the interface of the second polypeptide. In some embodiments, the contact surface comprises an immunoglobulin C _H 3 domain. In other embodiments, the immunoglobulin is derived from an IgG antibody. An IgG antibody may be an IgG1, IgG2, IgG3 or IgG4 isotype. In other embodiments, the immunoglobulin is derived from a human IgG1 antibody.

[064] As used herein, the term "protrusion" refers to at least one amino acid side chain that protrudes from the contact surface of the first polypeptide and, therefore, can be located in the compensatory cavity in the adjacent contact surface (i.e., the contact surface of the second polypeptide ) to stabilize the heterodimer and thereby promote the formation of the heterodimer, for example with respect to the formation of the homodimer. The protrusion may exist in the original contact surface or may be introduced synthetically (eg, by altering the nucleic acid encoding the contact surface). The "engineered ledge" is injected synthetically. In some embodiments, the nucleic acid encoding the interface of the first polypeptide is altered to encode a protrusion. To achieve this goal, the nucleic acid encoding at least one "original" amino acid residue on the contact surface of the first polypeptide is replaced with a nucleic acid encoding at least one "import" amino acid residue that has a larger side chain than the original amino acid residue. It is understood that there may be more than one original and corresponding import balance. In some embodiments, the upper limit for the number of original residues replaced is the total number of residues on the contact surface of the first polypeptide. In some embodiments, the import residues to form the overhang are typically naturally occurring amino acid residues. In some embodiments, import residues are selected from arginine (R), cysteine (C), phenylalanine (F), tyrosine (Y), and tryptophan (W). In some embodiments, import residues are selected from arginine (R), phenylalanine (F), tyrosine (Y), and tryptophan (W). In some embodiments, the import residues are tryptophan and tyrosine. In some embodiments, the import residues are tryptophan and cysteine. In some embodiments, the initial ledge residue has a small side chain volume, such as alanine, asparagine, aspartic acid, glycine, serine, threonine, or valine. In some embodiments, the serine residue is replaced with cysteine and the threonine residue is replaced with tryptophan. In some embodiments, the serine at position 354 is replaced with another amino acid residue to form part or all of the overhang. In some embodiments, the threonine at position 366 is replaced with another amino acid residue to form part or all of the overhang. In other embodiments, the amino acid substitutions comprise S354C and T366W (EU numbering). All numbering is according to Edelman, Gerald M. et al. PNAS 63(1) (1969): 78-85.

[065] As used herein, the term "cavity" refers to at least one amino acid side chain that is recessed from the interface of the second polypeptide and therefore accommodates a corresponding protrusion in the adjacent interface of the first polypeptide. The cavity may exist in the original contact surface or may be introduced synthetically (eg, by altering the nucleic acid encoding the contact surface). The "engineered cavity" is injected synthetically. In some embodiments, the nucleic acid encoding the interface of the second polypeptide is altered to encode the cavity. To achieve this, the nucleic acid encoding at least one "original" amino acid residue at the contact surface of the second polypeptide is replaced with DNA encoding at least one "import" amino acid residue that has a smaller side chain than the original amino acid residue. It is understood that there may be more than one original and corresponding import balance. The upper limit for the number of original residues to be replaced is the total number of residues on the contact surface of the second polypeptide. In some embodiments, the imported residues for cavity formation are typically naturally occurring amino acid residues. In some embodiments, import residues are selected from alanine (A), cysteine (C), serine (S), threonine (T), and valine (V). In some embodiments, import residues are selected from alanine (A), serine (S), threonine (T), and valine (V). In some embodiments, import residues are selected from alanine (A), cysteine (C), serine (S), and valine (V). In some embodiments, the import residues are serine, alanine, or threonine. In some embodiments, the import residues are alanine (A), cysteine (C), serine (S), and valine (V). In some embodiments, the tyrosine at position 349 is replaced with another amino acid residue to form part or all of the cavity. In some embodiments, the threonine at position 366 is replaced with another amino acid residue to form part or all of the cavity. In some embodiments, the leucine at position 368 is replaced with another amino acid residue to form part or all of the cavity. In some embodiments, the tyrosine at position 407 is replaced with another amino acid residue to form part or all of the cavity. In some embodiments, the initial cavity residue has a high side chain volume, such as tyrosine, arginine, phenylalanine, or tryptophan. In other embodiments, the starting residue is selected from tyrosine, threonine, and leucine. In some embodiments, one or more tyrosine residues are replaced with cysteine or valine, a threonine residue is replaced with serine, and a leucine residue is replaced with alanine. In other embodiments, the amino acid substitutions comprise Y349C, T366S, L368A, and Y407V (EU numbering). All numbering is according to Edelman, Gerald M. et al. PNAS 63(1) (1969): 78-85.

[066] As used herein, the term "original" amino acid residue is a residue that has been replaced by an "import" residue, which may have a smaller or larger side chain than the original residue. The import amino acid residue may be a naturally occurring or non-naturally occurring amino acid residue, but is preferably occurring. "Naturally occurring" amino acid residues are residues encoded by the genetic code. By "non-naturally occurring" amino acid residue is meant a residue that is not encoded by the genetic code, but which is capable of covalently linking adjacent amino acid residue(s) in the polypeptide chain. Examples of non-naturally occurring amino acid residues are norleucine, ornithine, norvaline, homoserine, and other analogs of amino acid residues such as those described in Ellman et al., Meth. enzyme. 202:301-336 (1991), for example. To obtain such non-naturally occurring amino acid residues, the procedures of Noren et al. Science 244: 182 (1989) and Ellman et al., see above. Briefly, this involves the chemical activation of a suppressor tRNA with a non-naturally occurring amino acid residue, followed by in vitro transcription and translation of the RNA. The method of the present invention includes the replacement of at least one original amino acid residue, but you can replace more than one original residue. Typically, no more than all of the residues on the contact surface of the first or second polypeptide will contain the original amino acid residues that are replaced. The preferred original residues for replacement are "submerged". By "immersed" is meant that the residue is substantially inaccessible to the solvent. In some embodiments, the import residue is not a cysteine to prevent possible oxidation or misbinding of disulfide bonds.

[067] The protrusion "sets" in the cavity, which means that the spatial arrangement of the protrusion and the cavity at the contact surface of the first polypeptide and the second polypeptide, respectively, and the dimensions of the protrusion and cavity are such that the protrusion can be located in the cavity without significant disruption of normal association the first and second polypeptides on the contact surface. Since ridges containing one of several amino acids, such as, but not limited to, Cys, Tyr, Phe, and Trp, generally do not run perpendicular to the axis of the contact surface and have preferred conformations, alignment of the ridge with the corresponding cavity depends on modeling the ridge/cavity pair. based on a three-dimensional structure such as that obtained by X-ray crystallography or nuclear magnetic resonance (NMR). This can be achieved using methods conventional in the art.

[068] A "parent nucleic acid" is a nucleic acid encoding a polypeptide of interest that can be "altered" (i.e., genetically modified or mutated) to encode a protrusion or cavity. The parent or starting nucleic acid may be a naturally occurring nucleic acid or may contain a nucleic acid that has been subjected to prior modification (eg, a fragment of a humanized antibody). By "changing" a nucleic acid is meant that the original nucleic acid is mutated by insertion, deletion or substitution of at least one codon encoding the amino acid residue of interest. Typically, the codon encoding the original residue is replaced by the codon encoding the import residue. Methods for genetically modifying DNA in this manner have been reviewed in Mutagenesis: a Practical Approach, M. J. McPherson, Ed., (IRL Press, Oxford, UK. (1991) and include site-directed mutagenesis, cassette mutagenesis, and polymerase chain reaction (PCR) mutagenesis. , for example.

[069] The protrusion or cavity can be “introduced” into the contact surface of the first or second polypeptide by synthetic means, for example, using recombinant technologies, in vitro peptide synthesis, those methods of introducing non-naturally occurring amino acid residues that have been described previously, by enzymatic or a chemical combination of peptides, or some combination of these methods. Accordingly, the protrusion or cavity that is "introduced" is "non-naturally occurring" or "non-native", meaning that it does not exist in nature or in the parent polypeptide (eg, a humanized monoclonal antibody).

[070] Preferably, the imported protrusion amino acid residue contains a relatively small amount of "rotamers" (eg, about 3-6). "Rotamer" is an energetically favorable amino acid side chain conformation. The number of rotamers of various amino acid residues is given in Ponders and Richards, J. Mol. Biol. 193: 775-791 (1987).

[071] As used herein, the term “protrusion-in-cavity” refers to a polypeptide architecture requiring a protrusion at the contact surface of the first polypeptide and a corresponding cavity (or “cavity”) at the contact surface of the second polypeptide, so that the protrusion can be located in the cavity to promote heterodimer formation. Overhangs can be created by replacing small amino acid side chains at the contact surface of the first polypeptide with larger side chains (eg, phenylalanine or tyrosine). Cavities of identical or similar size to the bumps can be created on the contact surface of the second polypeptide by replacing large amino acid side chains with smaller ones (eg, alanine or threonine). The protrusions and cavities can be produced by synthetic means, such as by altering the nucleic acid encoding the polypeptides, or by synthesizing peptides using routine methods by one skilled in the art. In some embodiments, the interface of the first polypeptide is located in the Fc domain in the first polypeptide, and the interface of the second polypeptide is located in the Fc domain in the second polypeptide. Ridge-to-bottom heterodimers and methods for making and using them are described in US Pat. Nos. 5,731,168; 5807706; 5821333; 7642228; 7695936; 8216805 and 8679785; and Merchant et al. , Nature Biotechnology, 1998, 16: 677-681, all of which are incorporated herein by reference in their entirety.

[072] As used herein, the term "isolated" heterodimer means a heterodimer that has been identified and separated and/or recovered from a component of its natural cell culture medium. Contaminant components of its natural environment are materials that will interfere with the diagnostic or therapeutic use of the heterodimer and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutions. In preferred embodiments, the heterodimer will be purified to (1) greater than 95 wt% protein as determined by the Lowry method, and most preferably greater than 99 wt%, (2) sufficient to produce at least 15 N- terminal or internal amino acid sequence using a rotating dish sequencer, or (3) to homogeneity with SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or silver staining.

[073] By "nanosphere", "NP", or "nanoparticle", as used herein, is meant a small, discrete particle that is administered individually or in multiples to a subject, cell sample, or tissue sample, as the case may be. In certain embodiments, the term "nanoparticle" as used herein includes any layers around the core of the nanoparticle. In certain embodiments, the nanoparticles are characterized by a substantially spherical shape. In certain embodiments, the nanoparticle is not a liposome or a viral particle. In other embodiments, the nanoparticle is comprised of any suitable material, such as a solid, a solid core, a metal, a dendrimer, a polymeric micelle, a metal oxide or protein or fragment, or combinations thereof. As used herein, the term "substantially spherical" means that the shape of the particles does not deviate from a sphere by more than 10%. Various known antigenic or peptide complexes of the present invention can be applied to the particles. The nanoparticles of the present invention are characterized by a size of from about 1 nm to about 1 μm, from about 1 nm to about 500 nm, or alternatively from about 1 nm to about 100 nm, or alternatively from about 1 nm to about 50 nm, or , alternatively, from about 5 nm to about 100 nm, and in some aspects refers to the average or average diameter of a plurality of nanoparticles when a plurality of nanoparticles is intended. Smaller nanosized particles can be obtained, for example, using a fractionation process, whereby larger particles can settle in an aqueous solution. The top of the solution is then recovered by methods known to those skilled in the art. This upper part is enriched with smaller particles. The process can be repeated until the desired average size is obtained. The term "nanostructure" is generally used to describe structures smaller than 1 µm.

[074] An antigen-MHC-nanoparticle complex ("NP-complex" or "complex" or pMHC-NP or "nanoparticle complex") refers to the presentation of a peptide, carbohydrate, lipid, or other antigenic segment, fragment, or epitope of an antigenic molecule or protein ( i.e., autopeptide or autoantigen) on a surface, such as the core of a nanoparticle.

[075] A "core of nanoparticles" is a substrate of nanoparticles that includes or does not include layers or coatings. The nanoparticle complex contains a core with at least an antigen-MHC complex associated with the core.

[076] "Density", when referring to pMHC per nanoparticle, is calculated as the surface area of the core of the nanoparticle with or without outer layers, which may also include linkers. The surface area is the total available surface area of the structure being used. In one aspect, when a PEG linker is used, it can increase the overall core diameter of the nanoparticle by about 20 nm ^{2 of} the nanoparticle, which increases the surface area corresponding to the total available surface area of the nanoparticle. In other words, this is the final surface area of the nanoparticle without the addition of one or more of the pMHC, costimulatory molecules, and/or cytokines.

[077] "Antigen" as used herein refers to the entire portion, fragment, or segment of a molecule that can induce an immune response in a subject or the expansion of an immune cell, preferably a T or B cell.

[078] As used herein, the term "disease-related" antigen refers to an antigen or fragment thereof selected to treat a selected disease and involved in the disease process. For example, a diabetes related antigen is an antigen or fragment thereof which, when presented, elicits an immune response that serves to treat diabetes mellitus; thus, a diabetes related antigen having such an effect is chosen for the treatment of diabetes mellitus. An antigen related to multiple sclerosis (MS) is chosen for the treatment of MS. The diabetes related antigen will not be selected for the treatment of MS. Similarly, an autoimmunity-related antigen is an antigen that is related to an autoimmune disease and cannot be selected to treat a disorder or disease other than autoimmunity, such as cancer. Non-limiting illustrative disease-related antigens are disclosed herein, and furthermore, such antigens can be determined for a particular disease based on techniques, mechanisms, and methods documented in the literature.

Class II MHC Heterodimers and the Ridge-in-The-Trough Architecture

[079] Expression of MHC class II molecules has been hampered because the secreted α- and β-chains of MHC class II, lacking transmembrane and cytoplasmic domains, do not form stable heterodimers even in the presence of a peptide ligand. The transmembrane regions of the α- and β-chains of MHC class II facilitate the correct assembly of the αβ heterodimer presumably through the interaction of two α-helical transmembrane segments.

[080] Currently, the state of the art is to obtain recombinant class II pMHC molecules for the production of pMHC tetramers using a leucine zipper. This is also true for the NIH tetramer facility and commercial suppliers of pMHC tetramers.

[081] This approach, however, offers its own limitations as a platform for constructing class II pMHC monomers for the production of disease-related class II pMHC nanoparticle compounds: 1) the likelihood that jun/fos sequences can be recognized as "foreign" and are thus immunogenic in individuals treated with pMHC nanoparticles, which may potentially limit therapeutic activity, especially after repeated administration; 2) chromatographic separation of pMHC complexes from eukaryotic cell culture supernatants (ie, Chinese hamster ovary -CHO-) is difficult if affinity separation marks are not introduced into the pMHC complex; and 3) affinity tags are also problematic due to the antigenicity of affinity tags such as FLAG or 6xHIS. Because of the potential for antigenicity and their potential wide application in the purification of various proteins, these labels are not suitable for use with human therapeutics. Unfortunately, the addition of affinity tags to these proteins can induce the production of anti-drug antibodies (ADA).

[082] Provided herein, in one aspect, are isolated heterodimers comprising at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that is located in an engineered cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC β1 domain class II, a class II MHC β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, a class II MHC α2 domain, or a combination thereof.

[083] According to another aspect, provided herein are isolated heterodimers comprising a first polypeptide and a second polypeptide, wherein the first polypeptide and the second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that can be located in an engineered cavity on the contact surface. the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC β1 domain class II, a class II MHC β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, a class II MHC α2 domain, or a combination thereof.

[084] According to another aspect, provided herein are isolated heterodimers comprising a first polypeptide and a second polypeptide, wherein the first polypeptide and the second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that is located in an engineered cavity on the contact surface of the second polypeptide ; and (i) the first polypeptide comprises an MHC class II α1 domain and an MHC class II α2 domain, and the second polypeptide comprises an MHC class II β1 domain and an MHC class II β2 domain or (ii) the first polypeptide comprises an MHC class II β1 domain and an MHC β2 domain class II, and the second polypeptide contains the α1 MHC class II domain and the α2 MHC class II domain.

[085] In some embodiments, each first polypeptide and second polypeptide comprise the C _H 3 domain of the antibody and interact through the C _H 3 domains. In some embodiments, the first polypeptide and the second polypeptide each comprise the C _H 2 domain of the antibody and interact through the C H 3 domains _H 2. In some embodiments, each first polypeptide and second polypeptide comprise a C _H 2 domain and a C _H 3 domain of the antibody and interact through C _H 2 domains, C _H 3 domains, or a combination thereof. In some embodiments, the first polypeptide and the second polypeptide each comprise a C _H 2 domain and a C _H 3 domain of the antibody and interact through the C _H 3 domains. In some embodiments, the C _H 3 domain is derived from IgG. In some embodiments, the C _H 2 domain is derived from IgG. IgG may be of the subtype IgG1, IgG2, IgG3 or IgG4. In some embodiments, the IgG is of the IgG1 subtype.

[086] In some embodiments, the first polypeptide and/or the second polypeptide further comprise a C-terminal cysteine residue. In some embodiments, the first polypeptide and the second polypeptide further comprise a C-terminal cysteine residue. In some embodiments, the first polypeptide or second polypeptide further comprises a C-terminal cysteine residue. In some embodiments, the first polypeptide further comprises a C-terminal cysteine residue. In some embodiments, the second polypeptide further comprises a C-terminal cysteine residue.

[087] Biotinylation of pMHC through BirA is a technique commonly used to obtain biotinylated pMHC monomers suitable for tetramerization using streptavidin. Such pMHC tetramers and their higher order derivatives (pentamers, dextramers, or other multimers) are useful as reagents capable of enumerating the frequency of antigen-specific T cells in biological samples. In some embodiments, the first polypeptide and/or the second polypeptide further comprise a biotinylation site. In some embodiments, the first polypeptide and the second polypeptide further comprise a biotinylation site. In some embodiments, the first polypeptide or second polypeptide further comprises a biotinylation site. In some embodiments, the first polypeptide further comprises a biotinylation site. In some embodiments, the second polypeptide further comprises a biotinylation site.

[088] In some embodiments, the first polypeptide and/or the second polypeptide further comprise a Strep tag. In some embodiments, the first polypeptide and the second polypeptide further comprise a Strep tag. In some embodiments, the first polypeptide or second polypeptide further comprises a Strep tag. In some embodiments, the first polypeptide further comprises a Strep tag. In some embodiments, the second polypeptide further comprises a Strep tag.

[089] In some embodiments, the isolated heterodimer further comprises a leucine zipper. In some embodiments, the first polypeptide contains a C-Jun fragment and the second polypeptide contains a C-Fos fragment. In some embodiments, the isolated heterodimer does not contain a leucine zipper.

[090] In some embodiments, the isolated heterodimer is devoid of extraneous protein sequences that can be targeted by immunoreactivity, such as a biotinylation sequence that is targeted by the BirA enzyme to attach a biotin molecule or an epitope/affinity/purification tag (e.g., c-Myc, FLAG , V5, polyhistidine, 6xHIS, etc.). Often, MHC dimers are prepared using heterologous dimerization domains. Some examples include leucine zippers (Fos/Jun, Acid-p1/Base-p1 or GCN4 dimers), E9/E9-DNase colicin immunity protein dimers, or Kv1.2 T1 domain dimers. In some embodiments, the isolated heterodimer is devoid of a dimerization domain other than a ridge-to-trough architecture. In some embodiments, the isolated heterodimer lacks the leucine zipper dimerization domain. In some embodiments, the isolated heterodimer lacks c-FOS/c-JUN dimerization domains.

[091] In some embodiments, the α1 MHC class II domain and the α2 MHC class II domain and the β1 MHC class II domain and the β2 MHC class II domain of the heterodimer are derived from a leukocyte antigen (HLA) molecule, such as HLA-DR, HLA- DQ or HLA-DP. In some embodiments, the α1 MHC class II domain and the α2 MHC class II domain are derived from DRA, DQA1, or DPA1. In certain embodiments, the class II MHC α1 domain or class II MHC α2 domain is derived from DRA, DQA1, or DPA1. In some embodiments, the MHC class II β1 domain and class II β2 MHC are derived from HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQB1, or HLA-DPB1. In some embodiments, the MHC class II β1 or class II β2 MHC domain is derived from HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQB1, or HLA-DPB1.

[092] In some embodiments, two or more heterodimers are covalently linked to each other through a polymer backbone to form a multimer. In some embodiments, the polymer backbone is dextran or polyethylene glycol. In some embodiments, each of the polypeptides in the heterodimer is attached to a polymer backbone. In some embodiments, each of the polypeptides in the heterodimer is attached to the polymer backbone through a terminal cysteine residue on each of the polypeptides. In some embodiments, each of the polypeptides in the heterodimer is attached to the polymer backbone via a biotinylation site on each of the polypeptides.

[093] In some embodiments, two heterodimers are covalently linked to each other via avidin to form a multimer.

Antigens

[094] In certain embodiments, the heterodimers described herein further comprise an antigen. In certain embodiments, the antigen is a polypeptide antigen that is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29, 30 or more amino acids in length, and in some embodiments no more than 50, 60, 70, 80, 90 or 100 amino acids in length. In certain embodiments, the antigen is a disease-related antigen. In some embodiments, the antigen is an antigen related to an autoimmune disease. In certain embodiments, the antigen is an inflammatory disease antigen. The antigens described herein are fused to the N-terminus of an MHC class IIα or MHC class IIβ polypeptide. In certain embodiments, the antigens are connected by a flexible peptide linker. The linker may, for example, be a polypeptide linker and contain glycine and serine.

[095] In certain embodiments, the antigen is an antigen related to an autoimmune disease. In some embodiments, the autoimmune disease antigen is type I diabetes mellitus, multiple sclerosis, celiac disease, primary biliary cirrhosis, autoimmune hepatitis, primary sclerosing cholangitis, pemphigus, pemphigus foliaceus, pemphigus vulgaris, optic neuromyelitis with spectral disorder, arthritis (including rheumatoid arthritis), allergic asthma, inflammatory bowel disease (including Crohn's disease and ulcerative colitis), systemic lupus erythematosus, atherosclerosis, chronic obstructive pulmonary disease, emphysema, psoriasis, autoimmune hepatitis, uveitis, Sjögren's syndrome, scleroderma , antiphospholipid syndrome, ANCA-associated vasculitis, or antigen stiffness syndrome. In a further aspect, the disease antigen is a tumor or cancer antigen. In some embodiments, the autoimmune disease antigen is an antigen related to type I diabetes mellitus. In some embodiments, the autoimmune disease antigen is an antigen related to multiple sclerosis. In some embodiments, the autoimmune disease antigen is an antigen related to rheumatoid arthritis. In some embodiments, the autoimmune disease antigen is a Crohn's disease antigen. In some embodiments, the autoimmune disease antigen is an antigen associated with ulcerative colitis. In some embodiments, the autoimmune disease antigen is a celiac disease antigen. In some embodiments, the autoimmune disease antigen is an antigen related to an autoimmune disease of the hepatobiliary system. In some embodiments, an antigen related to an autoimmune disease of the hepatobiliary system is an antigen related to primary biliary cirrhosis, autoimmune hepatitis, or primary sclerosing cholangitis. In certain embodiments, the antigen is derived from a gastrointestinal microbe. In some embodiments, the antigen derived from a gastrointestinal microbe is flagellin, Fla-2, Fla-X, uncharacterized E. coli protein (YIDX), or bacteroid integrase. In certain embodiments, the antigen is a food antigen. In certain embodiments, the food antigen is gliadin. In certain embodiments, the food antigen is ovalbumin. In certain embodiments, the food antigen is a peanut-derived antigen.

cysteine trapping

[096] A cysteine trap can be used to stabilize the heterodimer described herein. Cysteine trapping involves the formation of covalently linked polypeptide complexes from unbound polypeptide partners. In some embodiments, cysteine trapping involves introducing a cysteine at a strategically selected position in the interaction region of the polypeptide partners to form a stabilized polypeptide complex. In some embodiments, cysteine trapping may stabilize the polypeptide complex to promote a particular conformation and prevent dissociation. Cysteine trapping is also called disulfide trapping and disulfide crosslinking. Examples of cysteine trapping methods and applications are discussed in Kufareva, et al. , Methods Enzymol. 570: 389-420 (2016). In the context of MHC, a cysteine is inserted into a polypeptide known or suspected to bind in the binding groove of the class II MHC dimer. The cysteine is then introduced at or near the binding groove so that when the polypeptide binds to the binding groove, the cysteine of the binding groove can approach and form a disulfide bond with the cysteine of the polypeptide.

[097] The use of a cysteine trap requires that two cysteines be inserted into polypeptides that constitute heterodimers. The first cysteine is the "binding sulcus cysteine" which is found within or adjacent to the class II MHC sulcus. The cysteine of the binding furrow can be within 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids of the binding furrow. Cysteine can be located on either the alpha or beta chains, or at the N- or C-terminus of the binding groove. The second cysteine is a "polypeptide cysteine", which is located within or near the antigenic polypeptide that binds in the binding groove. The cysteine of the polypeptide may be within 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids of the antigenic polypeptide. The cysteine of the polypeptide may be at the N- or C-terminus of the antigenic polypeptide. Typically, the antigenic polypeptide is attached to either the alpha chain or the beta chain by a flexible linker, and a cysteine is located between the linker and the antigenic polypeptide. In some embodiments, the polypeptide chain structure is an antigenic polypeptide-polypeptide cysteine-MHC class II α1 linker domain, MHC class II α2 domain. In some embodiments, the polypeptide chain structure is an antigenic polypeptide-polypeptide cysteine-MHC class II β1 linker domain, MHC class II β2 domain. In some embodiments, the polypeptide chain structure is a polypeptide cysteine-antigenic polypeptide-MHC class II α1 linker domain, MHC class II α2 domain. In some embodiments, the polypeptide chain structure is polypeptide cysteine-antigenic polypeptide-MHC class II β1 linker domain, MHC class II β2 domain. These MHC class II polypeptides may further comprise an engineered overhang C _H 2 and C _H 3 domain on one polypeptide and a recessed C _H 2 and C _H 3 domain on the other polypeptide. In some cases, the antigenic polypeptide may contain a naturally occurring cysteine, eliminating the need to add a cysteine residue.

[098] In some embodiments, the polypeptides of the heterodimers described herein contain one or more mutations to introduce cysteine. In some embodiments, the mutation may be in the MHC class II alpha chain. In some embodiments, the mutation may be in the MHC class II beta chain. In some embodiments, the mutation may be in the α1 domain of MHC class II. In some embodiments, the mutation may be in the β1 domain of the MHC class II. In some embodiments, the mutation may be adjacent to a binding groove that is formed between the α1 and β1 chains of MHC class II on one or both of the alpha and beta chains. In some embodiments, the mutation may be in a polypeptide antigen that is associated with a binding groove. In some embodiments, the mutation may be at the N-terminus of the antigenic polypeptide that binds to the binding groove. In some embodiments, the mutation may occur at the C-terminus of the antigenic polypeptide that binds to the binding groove. In some embodiments, a cysteine trap can be formed between a cysteine residue at the N-terminus of an antigenic peptide that binds in an MHC binding groove and an N-terminal residue of a binding groove located on the MHC class II alpha chain. In some embodiments, a cysteine trap can be formed between a cysteine residue at the N-terminus of the antigenic peptide that binds in the MHC binding groove and a residue at the C-terminus of the binding groove located on the MHC class II alpha chain. In some embodiments, a cysteine trap may be formed between a cysteine residue at the C-terminus of the antigenic peptide that binds in the MHC binding groove and a residue at the N-terminus of the binding groove located on the MHC class II alpha chain. In some embodiments, a cysteine trap can be formed between a cysteine residue at the C-terminus of an antigenic peptide that binds in an MHC binding groove and a residue at the C-terminus of a binding groove located on the MHC class II alpha chain. In some embodiments, a cysteine trap can be formed between a cysteine residue at the N-terminus of an antigenic peptide that binds in an MHC binding groove and an N-terminal residue of a binding groove located in the MHC class II beta chain. In some embodiments, a cysteine trap can be formed between a cysteine residue at the N-terminus of an antigenic peptide that binds in an MHC binding groove and a residue at the C-terminus of a binding groove located on the MHC class II beta chain. In some embodiments, a cysteine trap can be formed between a cysteine residue at the C-terminus of an antigenic peptide that binds in an MHC binding groove and a residue at the N-terminus of a binding groove located on the MHC class II beta chain. In some embodiments, a cysteine trap can be formed between a cysteine residue at the C-terminus of an antigenic peptide that binds in an MHC binding groove and a residue at the C-terminus of a binding groove located on the MHC class II beta chain. In some embodiments, the mutation may be in a binding core polypeptide. In some embodiments, the mutation comprises changing an amino acid residue to a cysteine. In some embodiments, the mutation comprises the addition of a cysteine residue in frame with other residues.

[099] Non-limiting examples of polypeptides that contain a cysteine trap include, but are not limited to, the polypeptides shown in SEQ ID NOs: 60 and 61. In some embodiments, the cysteine trap polypeptides contain an amino acid sequence with an identity of at least 80 , 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% of the polypeptides listed in any of the SEQ ID NOs: 60 and 61. In some embodiments, the cysteine mutation may occur at any one or more of the polypeptide residues set forth in SEQ ID NOs: 62 and 63. In some embodiments, the cysteine trap polypeptides contain an amino acid sequence with an identity of at least least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% of the polypeptides specified in any of SEQ ID NOs: 62 and 63. According to some in embodiments, the cysteine mutation may be at any one or more of the polypeptide residues set forth in SEQ ID NOS: 62 and 63.

Heterodimer-nanoparticle conjugates

[0100] In another aspect, provided herein are heterodimer-nanoparticle conjugates comprising at least one heterodimer as described herein and a nanoparticle, wherein the nanoparticle is non-liposomal and/or contains a hard core. In certain embodiments, the solid core may be a metal or a metal oxide. In certain embodiments, the hard core may be iron, iron oxide, or gold. The hard core may be a high density core such that the density is greater than about 2.0 g/cm ³ , about 3.0 g/cm ³ , about 4.0 g/cm ³ , about 5.0 g/cm ³ , about 6.0 g/cm ³ or approximately 7.0 g/cm ³ . In some embodiments, the density of the solid core is from about 4.0 g/cm ³ to about 8.0 g/cm ³ . In some embodiments, the density of the solid core is from about 5.0 g/cm ³ to about 8.0 g/cm ³ . In some embodiments, the density of the solid core is from about 5.0 g/cm ³ to about 7.0 g/cm ³ . In some embodiments, the density of the solid core is from about 5.0 g/cm ³ to about 6.0 g/cm ³ .

[0101] In another aspect, provided herein are heterodimer-nanoparticle conjugates comprising at least one heterodimer described herein and a nanoparticle, the nanoparticle being non-liposomal and containing an iron oxide core.

[0102] In another aspect, provided herein are heterodimer-nanoparticle conjugates comprising at least one heterodimer described herein and a nanoparticle, the nanoparticle being non-liposomal and containing a gold core.

[0103] In another aspect, provided herein are heterodimer-nanoparticle conjugates comprising at least one heterodimer described herein and a nanoparticle, the nanoparticle being non-liposomal and containing an iron oxide core; and at least one heterodimer is covalently linked to the nanoparticle via a linker.

[0104] In another aspect, provided herein are heterodimer-nanoparticle conjugates comprising at least one heterodimer as described herein and a nanoparticle, wherein the nanoparticle is non-liposomal and contains an iron oxide core; and at least one heterodimer is covalently linked to the nanoparticle via a linker containing polyethylene glycol. In some embodiments, the heterodimer-nanoparticle conjugate comprises at least one heterodimer as described herein and a nanoparticle, wherein the nanoparticle is non-liposomal and contains an iron oxide core; and at least one heterodimer is covalently linked to the nanoparticle through a linker containing polyethylene glycol with a molecular weight of less than 500 daltons. In some embodiments, the polyethylene glycol has a molecular weight of less than 1 kDa, 2 kDa, 3 kDa, 4 kDa, 5 kDa, 6 kDa, 7 kDa, 8 kDa, 9 kDa, or 10 kDa. In some embodiments, polyethylene glycol is functionalized with maleimide. In some embodiments, the polyethylene glycol has a molecular weight of from about 1 kDa to about 5 kDa, from about 2 kDa to about 5 kDa, from about 3 kDa to about 5 kDa. In some embodiments, polyethylene glycol is functionalized with maleimide. In some embodiments, the end of the linker that is in contact with the solid core is embedded in the solid core.

[0105] According to some aspects, the core of the nanoparticle is characterized by a diameter selected from the group from about 1 nm to about 100 nm; from about 1 nm to about 75 nm; from about 1 nm to about 50 nm; from about 1 nm to about 25 nm; from about 1 nm to about 25 nm; from about 5 nm to about 100 nm; from about 5 nm to about 50 nm; from about 5 nm to about 25 nm, from about 15 nm to about 25 nm, or from about 5 nm to about 20 nm. In some embodiments, the nanoparticle core is characterized by a diameter of from about 25 nm to about 60 nm, from about 25 nm to about 50 nm, from about 20 nm to about 40 nm, from about 15 nm to about 50 nm, from about 15 nm to about 40 nm, about 15 nm to about 35 nm, about 15 nm to about 30 nm, or about 15 nm to about 25 nm, alternatively about 15 nm, about 20 nm, about 25 nm, about 30 nm about 35 nm or approximately 40 nm.

[0106] In some aspects, the amount of pMHC per nanoparticle core (referred to herein as the "valency" of the nanoparticle complex) can vary from about 1 pMHC complex per nanoparticle core to about 6000 pMHC complexes per nanoparticle core, alternatively from about 10:1 up to about 6000:1, alternatively from about 11:1 to about 6000:1, alternatively from about 12:1 to about 6000:1, alternatively at least 2:1, alternatively at least 8:1, alternatively at least 9:1, alternatively at least 10:1, alternatively at least 11:1, or alternatively at least 12:1. In some embodiments, the amount of pMHC per nanoparticle core is from about 10:1 to about 6000:1, from about 20:1 to about 5500:1, alternatively from about 10:1 to about 5000:1, alternatively from about 10 :1 to 4000:1 alternatively 10:1 to 3500:1 alternatively 10:1 to 3000:1 alternatively 10:1 to 2500:1 alternatively 10:1 to about 2000: 1 alternatively about 10:1 to about 1500:1 alternatively about 10:1 to 1000:1 alternatively about 10:1 to about 500:1 alternatively about 10:1 to about 100 :1, alternatively from about 20:1 to about 50:1, alternatively from about 25:1 to about 60:1; alternatively about 30:1 to about 50:1, alternatively about 35:1 to about 45:1, or alternatively about 40:1. In some embodiments, the amount of pMHC per nanoparticle core is about 10:1 to about 100:1, about 10:1 to about 110:1, about 10:1 to about 120:1, about 10:1 to about 130:1, about 10:1 to about 140:1, about 10:1 to about 150:1, or about 10:1 to about 160:1. In some embodiments, the amount of pMHC per nanoparticle core is about 30:1 to about 100:1, about 30:1 to about 110:1, about 30:1 to about 120:1, about 30:1 to about 130:1, about 30:1 to about 140:1, about 30:1 to about 150:1, or about 30:1 to about 160:1. In some embodiments, the amount of pMHC per nanoparticle core is from about 32:1 to about 100:1, from about 32:1 to about 110:1, from about 32:1 to about 120:1, from about 30:1 to about 130:1, about 32:1 to about 140:1, about 32:1 to about 150:1, or about 32:1 to about 160:1.

[0107] In some aspects, the core of nanoparticles is characterized by a certain valence per surface area of the core, also referred to herein as "density". According to these aspects, the pMHC density per nanoparticle is from about 0.025 pMHC/100 nm ² to about 100 pMHC/100 nm ² surface area of the nanoparticle core, alternatively from about 0.406 pMHC/100 nm ² to about 50 pMHC/100 nm ² or alternatively , from about 0.05 pMHC/100 nm ² to about 25 pMHC/100 nm ² . In certain aspects, the pMHC density per nanoparticle is from about 0.4 pMHC/100 nm ² to about 25 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to about 20 pMHC/100 nm ² , from about 0, 4 pMHC/100 nm ² to about 15 pMHC/100 nm ² , about 0.4 pMHC/100 nm ² to about 14 pMHC/100 nm ² , about 0.4 pMHC/100 nm ² to about 13 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to about 12 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to about 11.6 pMHC/100 nm ² , from about 0.4 pMHC/ 100 nm ² to about 11.5 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to about 11 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to 10 μM/100 nm ² , from about 0.4 µM/100 nm ² to about 9 µM/100 nm ² , from about 0.4 µM/100 nm ² to about 8 µM/100 nm ² , from about 0.4 µM/100 nm ² to approximately 7 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to about 6 pMHC/100 nm ² from about 0.4 pMHC/100 nm ² to about 5 pMHC/100 nm ² from about 0.4 pMHC/100 nm ² to about 4 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to about 3 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to about 2.5 pMHC/100 nm ² , from about 0 4 pMHC/100 nm ² to about 2 pMHC/100 nm ² or from about 0.4 pMHC/100 nm ² to about 1.5 pMHC/100 nm ² .

[0108] According to another aspect, the nanoparticle may have a pMHC density from about 0.22 pMHC/100 nm ² to about 10 pMHC/100 nm ² , from about 0.22 pMHC/100 nm ² to about 9 pMHC/100 nm ² , from about 0.22 pMHC/100 nm ² to about 8 pMHC/100 nm ² , from about 0.22 pMHC/100 nm ² to about 7 pMHC/100 nm ² , from about 0.22 pMHC/100 nm ² to about 6 pMHC/100 nm ² , from about 0.22 pMHC/100 nm ² to about 5 pMHC/100 nm ² , from about 0.22 pMHC/100 nm ² to about 4 pMHC/100 nm ² , from about 0.22 pMHC /100 nm ² to about 3 pMHC/100 nm ² , from about 0.22 pMHC/100 nm ² to about 2 pMHC/100 nm ² or from about 0.22 pMHC/100 nm ² to about 1.5 pMHC/100 nm ² . In some aspects, the nanoparticle has a pMHC density from about 0.22 pMHC/100 nm ² to about 10 pMHC/100 nm ² , from about 0.24 pMHC/100 nm ² to about 9 pMHC/100 nm ² , from about 0.26 pMHC/100 nm ² to about 8 pMHC/100 nm ² , from about 0.28 pMHC/100 nm ² to about 7 pMHC/100 nm ² , from about 0.24 pMHC/100 nm ² to about 4 pMHC/100 nm ² , from about 0.5 pMHC/100 nm ² to about 3 pMHC/100 nm ² or from about 0.6 pMHC/100 nm ² to about 1.5 pMHC/100 nm ² . According to a further aspect, the nanoparticle is characterized by a pMHC density from about 0.4 pMHC/100 nm ² to about 1.3 pMHC/100 nm ² , alternatively from about 0.5 pMHC/100 nm ² to about 0.9 pMHC/100 nm ² or, alternatively, from about 0.6 pMHC/100 nm ² to about 0.8 pMHC/100 nm ² .

[0109] In some embodiments, the nanoparticle may have a pMHC density of approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 .0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2 , 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3 .5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7 , 4.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7 .0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2 , 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9 .5, 9.6, 9.7, 9.8, 9.9, 10.0, 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7 , 10.8, 10.9, 11.0, 11.1, 11.2, 11.3, 11.4, 11.5, 11.6, 11.7, 11.8, 11.9 or 12 .0 pMHC/100 nm ² . In specific embodiments, the nanoparticle may have a pMHC density from about 0.4 pMHC/100 nm ² to about 1.5 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to about 2.5 pMHC/100 nm ² , from about 0.4 pMHC/100 nm ² to about 6 pMHC/100 nm ² or from about 0.4 pMHC/100 nm ² to about 12 pMHC/100 nm ² .

[0110] According to another aspect, the nanoparticle has a pMHC density, as defined herein, from about 0.4 pMHC/100 nm ² to about 1.3 pMHC/100 nm ² , alternatively from about 0.5 pMHC/100 nm ² to about 0.9 pMHC/100 nm ² or, alternatively, from about 0.6 pMHC/100 nm ² to about 0.8 pMHC/100 nm ² and, in addition, the core of the nanoparticle is in diameter from about 25 nm to approximately 60 nm, approximately 25 nm to approximately 50 nm, approximately 20 nm to approximately 40 nm, approximately 15 nm to approximately 50 nm, approximately 15 nm to approximately 40 nm, approximately 15 nm to approximately 35 nm , about 15 nm to about 30 nm, about 15 nm to about 25 nm, alternatively about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, or about 40 nm, or about 50 nm .

Components of a costimulatory molecule

[0111] In certain aspects, the NPs further comprise or alternatively consist essentially of, or furthermore consist of, at least one costimulatory molecule. Costimulatory molecules are molecules that produce a secondary signal in vivo that serves to activate naïve T cells into antigen-specific T cells capable of inducing an immune response against cells having said specific antigen. The present disclosure is not limited to any particular costimulatory molecule. Various costimulatory molecules are well known in the art. Some non-limiting examples of costimulatory molecules are 4-IBBL, OX40L, CD40, IL-15/IL-15Ra, CD28, CD80, CD86, CD30L, and ICOSL. Only one particular costimulatory molecule may be associated with one nanoparticle, or multiple costimulatory molecules may be associated with the same nanoparticle. In some embodiments, the costimulatory molecule is a protein, such as an antibody, that is capable of acting as an agonist for a costimulatory receptor on a T cell. In this case, the antibody is able to induce a co-stimulatory signal, which is necessary to activate naive T cells and induce an immune response in an antigen-specific manner. Additionally or alternatively, as used herein, the term "costimulatory molecule" may also refer to an agent capable of producing a costimulatory signal by agonizing a native costimulatory signaling molecule, such as an anti-CD28 or CD28 ligand that produces a costimulatory CD28 response.

[0112] According to specific embodiments, the co-stimulatory molecules of the present invention may be any one or more of the following molecules B7-1/CD80, BTLA, B7-2/CD86, CD28, B7-H1/PD-L1, CTLA-4, B7 -H2, Gi24/VISTA/B7-H5, B7-H3, ICOS, B7-H4, PD-1, B7-H6, PD-L2/B7-DC, B7-H7, PDCD6, LILRA3/CD85e, LILRB2/CD85d /ILT4, LILRA4/CD85g/ILT7, LILRB3/CD85a/ILT5, LILRB1/CD85j/ILT2, LILRB4/CD85k/ILT3, 4-1BB/TNFRSF9/CD137, GITR/TNFSF18 ligand, 4-1BB/TNFSF9 ligand, HVEM/TNFRSF14 , BAFF/BLyS/TNFSF13B, LIGHT/TNFSF14, BAFF R/TNFRSF13C, lymphotoxin-alpha/TNF-beta, CD27/TNFRSF7, OX40/TNFRSF4, CD27/TNFSF7 ligand, OX40/TNFSF4 ligand, CD30/TNFRSF8, RELT/TNFRSF19L, CD30/TNFSF8 ligand, TACI/TNFRSF13B, CD40/TNFRSF5, TL1A/TNFSF15, CD40/TNFSF5 ligand, TNF-alpha, DR3/TNFRSF25, TNF RII/TNFRSF1B, GITR/TNFRSF18, 2B4/CD244/SLAMF4, CD84/SLAMF5, BLAME /SLAMF8, CD229/SLAMF3, CD2, CRACC/SLAMF7, CD2F-10/SLAMF9, NTB-A/SLAMF6, CD48/SLAMF2, SLAM/CD150, CD58/LFA-3, CD7, DPPIV/CD26, CD96, EphB6, CD160 , integrin alpha 4 beta 1, CD200, integrin alpha 4 beta 7/LPAM-1, CD300a/LMIR1, LAG-3, CRTAM, TIM-1/KIM-1/HAVCR, DAP12, TIM-4, dectin-1/CLEC7A, TSLP R, ICOSL and/or their biological equivalents.

[0113] The costimulatory molecule can be linked to the nanoparticle in the same manner as the pMHC complex. According to one embodiment of the present invention, the co-stimulatory molecule and the antigen/MHC complex are separately attached to the nanoparticle. According to another embodiment of the present disclosure, the co-stimulatory molecule and the pMHC complex are first complexed together and then subsequently complexed with the nanoparticle. Several costimulatory molecules may be associated with the nanoparticle; they may be multiples of the same costimulatory molecule or multiple different costimulatory molecules. Typically, polypeptide complexes are added to nanoparticles to produce nanoparticles with adsorbed or bound polypeptide complexes having a ratio of costimulatory molecules to nanoparticles of from about 1 to 6000 molecules per nanoparticle, or alternatively at least about or at most about 0.1, 0 .5, 1, 10, 100, 500, 1000, 2000, 3000, 4000, 5000, 6000 or more to 1, and typically ranges from about 0.1:1 to about 50:1. In another aspect, the ratio of co-stimulatory molecule to pMHC complex may be from about 0.1, 0.5, 1, 2, 5, 10, 50 or more to 1, preferably a ratio of 1:1, 1:2, 1:9 is obtained, 1:10, 1:100, 2:1, 9:1, 10:1 or 100:1 anti-pMHC costimulatory molecule complex. Similarly, the density of costimulatory molecules relative to the surface area of the nanoparticles can be calculated using the same relative formula as for pMHC complexes. In some embodiments, the density of the costimulatory molecule per unit surface area of the nanoparticle is from about 0.0022 costimulatory molecules/100 nm ² to about 13.26 costimulatory molecules/100 nm ² . In some embodiments, the density range of the co-stimulatory molecules may be the same or different from the density range for pMHC complexes.

[0114] In some embodiments where the nanoparticle contains one or more costimulatory molecules and does not contain the pMHC complex, the nanoparticle has a costimulatory density of about 0.2 costimulatory molecules/100 ^nm2 to about 6.5 costimulatory molecules/100 nm2 ^. from about 0.2 co-stimulatory molecules/100 nm ² to about 6 co-stimulatory molecules/100 nm ² from about 0.2 co-stimulatory molecules/100 nm ² to about 5.8 co-stimulatory molecules/100 nm ² from about 0.2 co-stimulatory molecules/100 nm ² to about 5.75 co-stimulatory molecules/100 nm ² , from about 0.2 co-stimulatory molecules/100 nm ² to about 5.5 co-stimulatory molecules/100 nm ² , from about 0.2 co-stimulatory molecules/100 nm ² to about 5 co-stimulatory molecules/100 nm ² , from about 0.2 co-stimulatory molecules/100 nm ² to about 4.5 co-stimulatory molecules/100 nm ² , from about 0.2 co-stimulatory molecules/100 nm ² to about 4 co-stimulatory molecules/100 nm ² from about 0.2 co-stimulatory molecules/100 nm ² to about 3.5 co-stimulatory molecules/100 nm ² from about 0.2 co-stimulatory molecules molecules/100 ^nm2 to about 3 costimulatory molecules/100 ^nm2 , from about 0.2 costimulatory molecules/100 ^nm2 to about 2.5 costimulatory molecules/100 ^nm2 , from about 0.2 costimulatory molecules/100 ^nm2 to approximately ² costimulatory molecules/100 nm2, from approximately 0.2 costimulatory molecules/100 ^nm2 to approximately 1.5 costimulatory molecules/100 ^nm2 , from approximately 0.2 costimulatory molecules/100 ^nm2 to approximately 1.25 costimulatory molecules /100 nm ² , from about 0.2 costimulatory molecule/100 nm ² to about 1 costimulatory molecule/100 nm ² or from about 0.2 costimulatory molecule/100 nm ² to about 0.75 costimulatory molecule ul/100 nm ² .

[0115] According to another aspect, the nanoparticle may have a density of costimulatory molecules from about 0.11 costimulatory molecules/100 nm ² to about 5 costimulatory molecules/100 nm ² , from about 0.11 costimulatory molecules/100 nm ² to about 4.5 costimulatory molecules molecules/100 nm ² , from about 0.11 co-stimulatory molecules/100 nm ² to about 4 co-stimulatory molecules/100 nm ² , from about 0.11 co-stimulatory molecules/100 nm ² to about co-stimulatory molecules/100 nm ² , from about 0 11 costimulatory molecules/100 ^nm2 to about 3 costimulatory molecules/100 ^nm2 , from about 0.11 costimulatory molecules/100 ^nm2 to about 2.5 costimulatory molecules/100 ^nm2 , from about 0.11 costimulatory molecules/100 nm ² to about 2 co-stimulatory molecules/100 nm ² , from about 0.11 co-stimulatory molecules/100 nm ² to about 1.5 co-stimulatory molecules/100 nm ² , from about 0.11 co-stimulatory molecule/100 nm ² to about 1 pMHC/100 nm ² or from about 0.11 co-stimulatory molecule/100 nm ² to about 0.75 co-stimulatory molecule/100 nm ² . In some aspects, the nanoparticle core has a density of co-stimulatory molecules from about 0.11 co-stimulatory molecules/100 nm ² to about 5 co-stimulatory molecules/100 nm ² , from about 0.12 co-stimulatory molecules/100 nm ² to about 4.5 co-stimulatory molecules/100 nm ² , from about 0.13 co-stimulatory molecules/100 nm ² to about 4 co-stimulatory molecules/100 nm ² , from about 0.14 co-stimulatory molecules/100 nm ² to about 3.5 co-stimulatory molecules/100 nm ² , from about 0 12 costimulatory molecules/100 nm2 to about ² costimulatory molecules/100 ^nm2 , from about 0.25 costimulatory molecules/100 ^nm2 to about 1.5 costimulatory molecules/100 ^nm2 , or from about 0.3 costimulatory molecules/100 nm ² to about 0.75 costimulatory molecule/100 nm ² . In a further aspect, the core of the nanoparticles has a density of co-stimulatory molecules from about 0.2 co-stimulatory molecule/100 nm ² to about 0.65 co-stimulatory molecule/100 nm ² , alternatively from about 0.25 co-stimulatory molecule/100 nm ² to about 0.45 co-stimulatory molecule/100 nm ² or alternatively from about 0.3 co-stimulatory molecule/100 nm ² to about 0.4 co-stimulatory molecule/100 nm ² .

[0116] In some embodiments where the nanoparticle comprises a pMHC complex and one or more co-stimulatory molecules, the nanoparticle has a density of co-stimulatory molecules from about 0.4 co-stimulatory molecules/100 nm ² to about 13 co-stimulatory molecules/100 nm ² , from about 0 .4 costimulatory molecules/100 ^nm2 to about 12 costimulatory molecules/100 ^nm2 , from about 0.4 costimulatory molecules/100 ^nm2 to about 11.6 costimulatory molecules/100 ^nm2 , from about 0.4 costimulatory molecules/100 nm ² to about 11.5 costimulatory molecules/100 ^nm2 , from about 0.4 costimulatory molecules/100 ^nm2 to about 11 costimulatory molecules/100 ^nm2 , from about 0.4 costimulatory molecules/100 ^nm2 to about 10 costimulatory molecules/100 nm ² , from approx. 0.4 co-stimulatory molecule/100 nm ² approx ^. positively 0.4 co-stimulatory molecules/100 nm ² to about 8 co-stimulatory molecules/100 nm ² , from about 0.4 co-stimulatory molecules/100 nm ² to about 7 co-stimulatory molecules/100 nm ² , from about 0.4 co-stimulatory molecules/100 nm ² to about 6 co-stimulatory molecules/100 nm ² , from about 0.4 co-stimulatory molecules/100 nm ² to about 5 co-stimulatory molecules/100 nm ² , from about 0.4 co-stimulatory molecules/100 nm ² to about 4 co-stimulatory molecules/ 100 nm ² , from about 0.4 co-stimulatory molecules/100 nm ² to about 3 co-stimulatory molecules/100 nm ² , from about 0.4 co-stimulatory molecules/100 nm ² to about 2.5 co-stimulatory molecules/100 nm ² , from about 0.4 co-stimulatory molecules/100 nm ² to about 2 co-stimulatory molecules/100 nm ² or from about 0.4 co-stimulatory molecules/100 nm ² to about 1.5 co-stimulatory molecules/100 nm ² .

[0117] According to another aspect, the nanoparticle may have a density of costimulatory molecules from about 0.22 costimulatory molecules/100 nm ² to about 10 costimulatory molecules/100 nm ² , from about 0.22 costimulatory molecules/100 nm ² to about 9 costimulatory molecules/ 100 nm ² , from about 0.22 co-stimulatory molecules/100 nm ² to about 8 co-stimulatory molecules/100 nm ² , from about 0.22 co-stimulatory molecules/100 nm ² to about 7 co-stimulatory molecules/100 nm ² , from about 0, 22 costimulatory molecules/100 ^nm2 to about 6 costimulatory molecules/100 ^nm2 , from about 0.22 costimulatory molecules/100 ^nm2 to about 5 costimulatory molecules/100 ^nm2 , from about 0.22 costimulatory molecules/100 ^nm2 to about 4 co-stimulatory molecules/100 nm ² , from about 0.22 co-stimulatory molecules/100 nm ² to about 3 co-stimulatory molecules/100 nm ² , from about 0.22 costimulatory molecules/100 nm ² to about 2 costimulatory molecules/100 nm ² or from about 0.22 costimulatory molecules/100 nm ² to about 1.5 costimulatory molecules/100 nm ² . In some aspects, the nanoparticle core has a density of co-stimulatory molecules from about 0.22 co-stimulatory molecules/100 nm ² to about 10 co-stimulatory molecules/100 nm ² , 0.24 co-stimulatory molecules/100 nm ² to about 9 co-stimulatory molecules/100 nm ² , from about 0.26 co-stimulatory molecule/100 nm ² to about 8 co-stimulatory molecules/100 nm ² , from about 0.28 co-stimulatory molecule/100 nm ² to about 7 co-stimulatory molecules/100 nm ² , from about 0.24 co-stimulatory molecule/100 nm ² to about 4 co-stimulatory molecules/100 nm ² , from about 0.5 co-stimulatory molecule/100 nm ² to about 3 co-stimulatory molecules/100 nm ² or from about 0.6 co-stimulatory molecule/100 nm ² to about 1.5 co-stimulatory molecules/100 nm ² . In a further aspect, the nanoparticle has a density of costimulatory molecules from about 0.4 costimulatory molecule/100 nm ² to about 1.3 costimulatory molecules/100 nm ² , alternatively from about 0.5 costimulatory molecule/100 nm ² to about 0.9 costimulatory molecule/100 nm 2 molecules/100 nm ² or alternatively from about 0.6 co-stimulatory molecule/100 nm ² to about 0.8 co-stimulatory molecule/100 nm ² .

[0118] In one aspect, the nanoparticle contains a costimulatory molecule and does not contain any peptide-MHC component. In some embodiments, this costimulatory molecule nanoparticle complex is mixed with the peptide-MHC nanoparticle complex to form a composition that contains two different populations of nanoparticles, one containing only the costimulatory molecules and the other containing only the peptide-MHC. These two populations may be mixed in any suitable ratio including 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8 or 1:9 containing co-stimulating nanoparticle molecules to peptide-MHC containing nanoparticles or 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9 peptide-MHC containing nanoparticles to nanoparticles containing costimulatory molecules.

Cytokines

[0119] According to certain aspects, the NPs further comprise or alternatively consist essentially of or further consist of at least one cytokine molecule. As used herein, the term "cytokine" encompasses small molecule proteins secreted by various cells of the immune system that act as signaling molecules to regulate a wide range of biological processes in the body at the molecular and cellular levels. "Cytokines" includes individual immunomodulatory proteins that belong to the class of lymphokines, interleukins, or chemokines.

[0120] Non-limiting examples are disclosed herein: for example, IL-1A and IL-1B are two different members of the human interleukin-1 (IL-1) family. Mature IL-1A is an 18 kDa protein, also known as fibroblast activating factor (FAF), lymphocyte activating factor (LAF), B cell activating factor (BAF), leukocyte endogenous mediator (LEM), etc. IL-4 is a cytokine that induces T-helper-2 (Th2) cell differentiation and is closely related to IL-13 and performs similar functions. IL-5 is produced by Th2 cells and mast cells. It stimulates the growth of B cells and increases the secretion of immunoglobulin. It is also involved in the activation of eosinophils. IL-6 is an interleukin that can act as a pro-inflammatory or anti-inflammatory cytokine. It is secreted by T cells and macrophages to stimulate the immune response to injury or other tissue damage leading to inflammation. IL-6 is also produced by muscles in response to muscle contraction. IL-8 is a chemokine produced by macrophages and other cell types such as epithelial cells and endothelial cells and acts as an important mediator of the immune response in the innate immune system response. IL-12 is involved in the differentiation of naive T cells into T helper (Th1 or Th2) cells. As a heterodimeric cytokine, IL-12 is formed after two subunits encoded by two separate genes, IL-12A (p35) and IL-12B (p40), dimerize after protein synthesis. IL-12p70 indicates this heterodimeric composition. IL-13, a cytokine secreted by many cell types, especially Th2 cells, is an important mediator of allergic inflammation and disease. IL-17 is a cytokine produced by T helper cells and is induced by IL-23, resulting in devastating tissue damage in delayed-type reactions. IL-17 functions as a pro-inflammatory cytokine that responds to the invasion of extracellular pathogens into the immune system and causes destruction of the pathogen's cellular matrix. IP-10 or interferon-gamma-induced protein 10 is also known as chemokine 10 C-X-C motif (CXCL10) or low inducible cytokine B10. As a small cytokine belonging to the CXC family of chemokines, IP-10 is secreted by several cell types (including monocytes, endothelial cells and fibroblasts) in response to IFN-γ. Macrophage inflammatory proteins (MIPs) belong to the chemokine family. There are two main forms of human MIP, MIP-1α and MIP-1β, which are also known as chemokine (C-C motif) ligand 3 (CCL3) and CCL4, respectively. Both are produced by macrophages after stimulation with bacterial endotoxins. Granulocyte colony stimulating factor (G-CSF or GCSF), also known as colony stimulating factor 3 (CSF 3), is a colony stimulating factor hormone. G-CSF is a glycoprotein, growth factor and cytokine produced by a number of different tissues to stimulate the bone marrow to form granulocytes and stem cells. G-CSF also stimulates the survival, proliferation, differentiation, and function of neutrophil progenitors and mature neutrophils. Epidermal growth factor or EGF is a growth factor that plays an important role in the regulation of cell growth, proliferation and differentiation by binding with high affinity to its EGFR receptor. Vascular endothelial growth factor (VEGF) is a family of growth factors that are important signaling proteins involved in both vasculogenesis (formation of the de novo embryonic circulatory system) and angiogenesis (growth of blood vessels from a pre-existing vascular system).

[0121] The cytokine or cytokines can be associated with the nanoparticle in the same manner as the pMHC complex. According to one embodiment of the present disclosure, the cytokine or cytokines and the pMHC complex are separately attached to the nanoparticle. According to another embodiment of the present disclosure, the cytokine or cytokines molecule and the pMHC complex are first complexed together and then subsequently complexed with the nanoparticle. Multiple cytokines can be associated with the nanoparticle; they may be many of the same cytokines or different cytokines.

[0122] In some embodiments, the cytokine is complexed with an anti-cytokine antibody to form a cytokine/anti-cytokine antibody complex, which subsequently forms a complex with the nanoparticle. In some embodiments, the cytokine/anti-cytokine antibody complex includes, without limitation, IL-2/anti-IL-2 complexes. IL-2/anti-IL-2 complexes may have agonistic properties or antagonistic properties.

[0123] In some embodiments, the cytokine forms a complex with a cytokine receptor to form a cytokine/cytokine receptor complex, which subsequently forms a complex with the nanoparticle. In some embodiments, the cytokine/cytokine receptor complex includes, without limitation, IL15/IL-15Ra and/or IL-1/IL-2Ra. In some embodiments, the IL15/IL-15Ra complex may function as a costimulator.

[0124] Typically, polypeptide complexes are added to nanoparticles to produce nanoparticles with adsorbed or bound polypeptide complexes having a ratio of cytokines to nanoparticles of from about 1 to 5999 molecules per nanoparticle, or alternatively at least about or a maximum of about 0.1 , 0.5, 1, 10, 100, 500, 1000, 2000, 3000, 4000, 5000, 6000 or more to 1 and vary from, for example, about 0.1:1 to about 50:1. In other aspects, the ratio of cytokine to antigen/MHC complex may be from about 0.1, 0.5, 1, 2, 5, 10, 50 or more to 1, preferably a ratio of 1:1, 1:2, 1:9 is obtained. , 1:10, 1:100, 2:1, 9:1, 10:1, or 100:1 cytokine to antigen/MHC complex. Similarly, the density of cytokines relative to the surface area of the nanoparticles can be calculated using the same relative formula as for antigen/MHC complexes. In some embodiments, the cytokine density per unit surface area of the nanoparticle is from about 0.0022 cytokines/100 nm ² to about 13.26 cytokines/100 nm ² . In some embodiments, the cytokine density range may be the same as or different from the antigen/MHC complex density range.

[0125] In one aspect, the nanoparticle contains a cytokine molecule and does not contain any peptide-MHC component. In some embodiments, the cytokine nanoparticle complex is mixed with the peptide-MHC nanoparticle complex to form a composition that includes two different populations of nanoparticles, one containing only cytokine molecules and the other containing only the peptide-MHC. These two populations may be mixed in any suitable ratio including 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9 containing cytokine molecules of nanoparticles to nanoparticles containing peptide-MHC or: 1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9 containing peptide-MHC nanoparticles to nanoparticles containing cytokine molecules.

NP synthesis

[0126] Nanoparticles can be formed by contacting an aqueous phase containing co-stimulatory molecule(s), pMHC complex and/or cytokine, and a polymer, and a non-aqueous phase, followed by evaporation of the non-aqueous phase to cause particle fusion from the aqueous phase, as described in US Pat. No. 4,589,330 or 4,818,542. Specific polymers for such preparations are natural or synthetic copolymers or polymers which include gelatin, agar, starch, arabinogalactan, albumin, collagen, polyglycolic acid, polylactic acid, glycolide-L(-), lactide , poly(epsilon-caprolactone), poly(epsilon-caprolactone-CO-lactic acid), poly(epsilon-caprolactone-CO-glycolic acid), poly(β-hydroxybutyric acid), poly(ethylene oxide), polyethylene, poly (alkyl-2-cyanoacrylate), poly(hydroxyethyl methacrylate), polyamides, poly(amino acids), poly(2-hydroxyethyl DL-aspartame), poly(urea ester), poly(L-phenylalanine/ethylene glycol/1,6-diisocyanatohexane ) and poly(methyl methacrylate). In particular, certain polymers are polyesters such as polyglycolic acid, polylactic acid, glycolide-L(-), lactide, poly(epsilon-caprolactone), poly(epsilon-caprolactone-CO-lactic acid) and poly(epsilon-caprolactone -CO-glycolic acid). Solvents useful for dissolving the polymer include: water, hexafluoroisopropanol, methylene chloride, tetrahydrofuran, hexane, benzene, or hexafluoroacetone sesquihydrate.

[0127] Gold nanoparticles (GNPs) are synthesized using chemical reduction of gold chloride with sodium citrate as described (Perrault, SD et al. (2009) Nano Lett 9: 1909-1915). Briefly, 2 ml of 1% HAuCl ₄ (Sigma Aldrich) is added to 100 ml of H ₂ O with vigorous stirring and the solution is heated in an oil bath. Six (for 14 nm GNP) or two ml (for 40 nm GNP) 1% Na citrate is added to a refluxing HAuCl ₄ solution, which is stirred for an additional 10 minutes and then cooled to room temperature. GNPs are stabilized by adding 1 μM thiol-PEG linkers (Nanocs, MA) functionalized with -COOH or -NH ₂ groups as MHC acceptors. PEGylated GNPs are washed with water to remove free thiol-PEG, concentrated and stored in water for further analysis. The NP density is determined by spectrophotometry and calculated according to Beer's law.

[0128] A series of SFP NP with iron oxide (SFP IONP) can also be prepared by thermal decomposition of iron acetate in organic solvents in the presence of surfactants, and then converting the solvent into aqueous buffers by pegylation (Xie, J. et al . (2007 ) Adv Mater 19:3163; Xie, J. et al . (2006) Pure Appl Chem. 78:1003-1014; Xu, C. et al . (2007) Polymer International 56:821-826). Briefly, 2 mM Fe(acac) ₃ (Sigma Aldrich, Oakville, ON) is dissolved in a mixture of 10 ml of benzyl ether and oleylamine and heated to 100°C for 1 hour, then at 300°C for 2 hours under reflux. protection of the nitrogen layer. The synthesized NPs are precipitated by adding ethanol and resuspended in hexane. For IONP pegylation, 100 mg of various 3.5 kDa DPA-PEG linkers (JenKem Tech USA) are dissolved in a mixture of CHCl ₃ and HCON(CH ₃ ) ₂ (dimethylformamide (DMF)). Then the NP solution (20 mg Fe) was added to the DPA-PEG solution and stirred for 4 hours at room temperature. Pegylated SFP NPs are precipitated overnight by adding hexane and then resuspended in water. Trace aggregates are removed by high speed centrifugation (20,000 μg, 30 min) and monodisperse SFP NPs are stored in water for further characterization and pMHC conjugation. The iron concentration in the IONP products is determined by spectrophotometry at A410 in 2N. HCL. Based on the molecular structure and diameter of SFP NP (Fe ₃ O ₄ ; diameter 8 ± 1 nm) (Xie, J. et al . (2007) Adv Mater 19:3163; Xie, J. et al . (2006) Pure Appl. Chem. 78:1003-1014), Applicant estimates that SFP solutions containing 1 mg of iron contain 5 x 10 ¹⁴ NP.

[0129] Nanoparticles can also be obtained by thermal decomposition or heating of the nanoparticle precursor. In one embodiment, the nanoparticle is a metal or metal oxide nanoparticle. In one embodiment, the nanoparticle is an iron oxide nanoparticle. In one embodiment, the nanoparticle is a gold nanoparticle. According to one embodiment, the present document presents nanoparticles obtained in accordance with the present technology. According to one embodiment, the present document provides a method for producing iron oxide nanoparticles, comprising a thermal decomposition reaction of iron acetylacetonate. According to one embodiment, the resulting iron oxide nanoparticle is water soluble. In one aspect, the iron oxide nanoparticle is suitable for protein conjugation. According to one embodiment, the method includes a one-step thermal decomposition reaction.

[0130] According to one aspect, thermal decomposition occurs in the presence of functionalized PEG molecules.

[0131] According to one aspect, thermal decomposition includes heating iron acetylacetonate. In one embodiment, thermal decomposition comprises heating iron acetylacetonate in the presence of functionalized PEG molecules. In one embodiment, thermal decomposition comprises heating iron acetylacetonate in the presence of benzyl ether and functionalized PEG molecules.

[0132] Without being limited by theory, according to one embodiment, functionalized PEG molecules are used as reducing agents and as surfactants. The method provided herein for the manufacture of nanoparticles simplifies and improves on conventional methods that use surfactants that are difficult to displace or that are not displaced to completion by PEG molecules to make the particles water soluble. Typically, surfactants can be expensive (eg phospholipids) or toxic (eg oleic acid or oleylamine). According to another aspect, without being limited by theory, the method of obtaining nanoparticles eliminates the need for conventional surfactants, thereby achieving a high degree of molecular purity and solubility in water.

[0133] In one embodiment, the thermal decomposition comprises ferrous acetylacetonate and benzyl ether, and in the absence of conventional surfactants other than those used herein.

[0134] According to one embodiment, the temperature for thermal decomposition is from about 80°C to about 300°C, or from about 80°C to about 200°C, or from about 80°C to about 150°C, or from about 100 °C to about 250°C, or from about 100°C to about 200°C, or from about 150°C to about 250°C, or from about 150°C to about 250°C. According to one embodiment, thermal decomposition occurs within about 1 to 2 hours.

[0135] According to one embodiment, the method for making iron oxide nanoparticles includes a purification step, for example, using a Miltenyi Biotec LS magnetic column.

[0136] In one embodiment, the nanoparticles are stable at approximately 4° C. in phosphate buffered saline (PBS) without any appreciable degradation or aggregation. According to one embodiment, the nanoparticles are stable for at least 6 months.

[0137] In one aspect, provided herein is a method for preparing nanoparticle complexes, comprising contacting pMHC with iron oxide nanoparticles provided herein. Without being limited by theory, pMHC encodes a cysteine at its carboxy-terminal end that can be reacted with a maleimide group in a functionalized PEG at a temperature of about 6.2 to about 6.5 for about 12 to about 14 hours.

[0138] According to one aspect, the method for obtaining complexes of nanoparticles includes a purification step, for example, using a Miltenyi Biotec LS magnetic column.

Disease related antigens

[0139] The pMHC complex in pMHC-NP is selected for use based on the disease being treated. For example, a diabetes mellitus antigen is an antigen or fragment thereof that is expressed in a cell, tissue, or organ that is targeted in that autoimmune disease and that is exposed to the immune system when the cell, tissue, or organ is damaged by the autoimmune response, even if the antigen is not a trigger of the disease process or a key player in its pathogenesis and, when present, elicits an immune response that serves to treat diabetes mellitus; thus, a diabetes antigen meeting this definition is selected for the treatment of diabetes mellitus. The MS-related antigen is chosen for the treatment of MS. The diabetes related antigen will not be selected for the treatment of MS. A cancer or tumor related antigen will treat the cancer and/or tumors. Non-limiting illustrative disease-related antigens are disclosed herein, and furthermore, such antigens can be determined for a particular disease based on techniques, mechanisms, and methods well documented in the literature.

[0140] In certain aspects, the disease-related antigen contained in the antigen-MHC complex is selected from an autoimmune disease antigen, an inflammation-related antigen, or an allergic disease-related antigen. In further aspects, the immune inflammation antigen is selected from the following group: asthma antigen, diabetes mellitus antigen, prediabetes antigen, multiple sclerosis antigen, allergic asthma antigen, primary biliary cirrhosis antigen, cirrhosis antigen related to neuromyelitis of the optic nerve with a spectrum disorder (Devic's disease, NMO) antigen related to autoimmune encephalitis antigen related to autoantibody-mediated neurological syndromes antigen related to muscle stiffness syndrome antigen related to paraneoplastic diseases antigen related to other diseases of the central and peripheral nervous system pemphigus vulgaris antigen inflammatory bowel disease (IBD) antigen Crohn's disease antigen ulcerative colitis antigen lithu antigen related to arthritis antigen related to rheumatoid arthritis antigen related to systemic lupus erythematosus (SLE) antigen related to celiac disease antigen related to psoriasis antigen related to alopecia areata antigen related to acquired thrombocytopenic purpura antigen related to autoimmune cardiomyopathy, idiopathic dilated cardiomyopathy (IDCM) antigen, myasthenia gravis antigen, uveitis antigen, ankylosing spondylitis antigen, Graves disease antigen, Hashimoto thyroiditis antigen, immune mediated myopathies antigen, antiphospholipid syndrome (ANCA+) antigen related to atherosclerosis antigen related to scleroderma antigen related to autoimmune hepatitis antigen related to dermatomyositis antigen related to chronic obstructive pulmonary disease antigen related to spinal cord injury antigen, traumatic injury antigen, tobacco-induced lung destruction antigen, chronic obstructive pulmonary disease (COPD) antigen, emphysema antigen, sclerosing cholangitis antigen, peripheral neuropathy antigen, narcolepsy-related antigen, Goodpasture syndrome-related antigen, Kawasaki disease-related antigen, autoimmune uveitis antigen, colitis-related antigen, emphysema-related antigen, pemphigus-related antigen, pemphigus leaf antigen, arthritis-related antigen, Sjögren's syndrome antigen related to ANCA-associated vasculitis antigen related to primary sclerosing cholangitis antigen related to adipose tissue inflammation/diabetes mellitus type II antigen or related to obesity-related adipose tissue inflammation/insu linresistance antigen.

[0141] In certain aspects, the disease-related antigen is derived from one or more of the following group: PPI, IGRP, GAD, peripherin, aGlia, PDC-E2, insulin, DG1EC2, DG3, AQP4, PLP, MOG, MBP, CII, DERP1, DERP2, OVA, BacInt, CBir, Fla-X, Fla-2, YIDX, AChR, thyroid peroxidase, thyroid receptor, phospholipid antigen, H4, H2B, H1, DNA, ApoB, ApoE, NMDAR, voltage-gated potassium channel , elastin, arrestin, myoroperoxidase PERM_HUMAN, myeloblastin PRTN3_HUMAN, cytochrome CP4D6_HUMAN P450 2D6, SPCS_HUMAN O-phosphoseryl-tRNA(Sec) selenium transferase, antimicrobial peptide cathelicidin CAMP_HUMAN, DNA topoisomerase I, CENP-C, beta-2-glycoprotein 1, APOH_HUMAN RO60_HUMAN 60 kDa SS-A/Ro ribonucleoprotein, Lupus La protein LA_HUMAN, IRBP, myosin, CD1d-binding lipid antigens, Cap18, CP2D6, SPCS, RO60, RO52, LA, APOH, MPO, PRTN3, or HSP.

[0142] In some embodiments, the disease-related antigen is:

a) a diabetes mellitus antigen and derived from an antigen selected from one or more of the following group: preproinsulin (PPI), islet-specific glucose-6-phosphatase (IGRP), glutamate decarboxylase (GAD), islet cell autoantigen-2 ( ICA2), insulin, proinsulin, or a fragment or equivalent of each;

b) an antigen related to multiple sclerosis and derived from an antigen selected from one or more of the following group myelin basic protein, myelin-associated glycoprotein, myelin oligodendrocyte protein, proteolipid protein, oligodendrocyte myelin oligoprotein, myelin-associated oligodendrocyte basic protein specific to oligodendrocyte protein, heat shock proteins, oligodendrocyte-specific proteins, NOGO A, Po glycoprotein, peripheral myelin protein 22, 2'3'-cyclic nucleotide-3'-phosphodiesterase, or a fragment or equivalent of each;

c) an antigen related to celiac disease and derived from gliadin or a fragment or equivalent thereof;

d) an antigen related to primary biliary cirrhosis and derived from PDC-E2 or a fragment or equivalent thereof;

e) a pemphigus leaf antigen and/or a pemphigus vulgaris antigen and derived from an antigen selected from one or more of the following group: DG1, DG3, or a fragment or equivalent of each;

f) an antigen related to neuromyelitis of the optic nerve with spectral disorder and derived from AQP4 or a fragment or equivalent thereof;

g) an arthritis-related antigen and derived from an antigen selected from one or more of the following group: heat shock proteins, immunoglobulin-binding protein, heterogeneous nuclear RNPs, annexin V, calpastatin, collagen type II, glucose-6-phosphate isomerase, factor human cartilage elongation gp39, mannose-binding lectin, citrullinated vimentin, collagen type II, fibrinogen, alpha-enolase, anti-carbamylated protein (anti-CarP), peptidylarginine deminase type 4 (PAD4), BRAF, fibrinogen gamma chain, inter -alpha-trypsin, alpha-1 antitrypsin, C1 plasma protease inhibitor, gelsolin, alpha-1-B glycoprotein, ceruloplasmin, inter-alpha-trypsin inhibitor heavy chain H4, complement factor H, alpha-2 macroglobulin, serum amyloid, C-reactive protein, serum albumin, fibrogen beta chain, serotransferin, alpha 2 HS glycoprotein, vimentin, complement C3, or a fragment or equivalent of each;

h) related to allergic asthma antigen and derived from an antigen selected from one or more of the following group: DERP1, DERP2 or a fragment or equivalent of each of them;

i) an inflammatory bowel disease antigen and derived from an antigen selected from one or more of the following group: flagellin, Fla-2, Fla-X, YIDX, bacteroid integrase, or a fragment or equivalent of each;

j) an antigen related to systemic lupus erythematosus and derived from an antigen selected from one or more of the following group: double-stranded (ds)DNA, ribonucleoprotein (RNP), Smith (Sm), Sjögren's syndrome-associated antigen A (SS-A)/ Ro, Sjögren's syndrome-associated antigen B (SS-B)/La, RO60, RO52, histones, or a fragment or equivalent of each;

k) an antigen related to atherosclerosis and derived from an antigen selected from one or more of the following group: ApoB, ApoE, or a fragment or equivalent of each;

l) a COPD-related antigen and/or an emphysema-related antigen and derived from elastin or a fragment or equivalent thereof;

m) a psoriasis-related antigen and derived from an antigen selected from one or more of the following group: Cap18, ADMTSL5, ATL5, or a fragment or equivalent thereof;

n) an antigen related to autoimmune hepatitis and derived from an antigen selected from one or more of the following group: CYP2D6, SLA, or a fragment or equivalent of each;

o) an antigen related to uveitis and derived from arrestin or a fragment or equivalent thereof;

p) an antigen related to Sjögren's syndrome and derived from an antigen selected from one or more of the following group: (SS-A)/Ro, (SS-B)/La, MR3, RO60, RO52, or a fragment or equivalent of each of them;

q) related to scleroderma antigen and derived from an antigen selected from one or more of the following group: CENP-C, TOP 1, RNA polymerase III, or a fragment or equivalent of each of them;

r) an antiphospholipid syndrome related antigen and derived from APOH or a fragment or equivalent thereof;

s) an antigen related to ANCA-associated vasculitis and derived from an antigen selected from one or more of the following group: MPO, PRTN3, or a fragment or equivalent of each of them; or

t) a stiffness syndrome related antigen and derived from GAD or a fragment or equivalent thereof.

Diabetes related antigens

[0143] Related to diabetes antigens include, without limitation, antigens derived from PPI, IGRP, GAD, islet cell autoantigen-2 (ICA2), and/or insulin. Autoreactive diabetes antigenic peptides include, without limitation, those listed in the following Table 1, in addition to the peptides and proteins disclosed in US Publication 2005/0202032, which is incorporated herein by reference in its entirety, as well as equivalents and/or combinations of each.

Table 1. Peptide Peptide hInsB _10-18 HLVEALYLV Proinsulin _L2-10 ALWMRLLPL hIGRP _228-236 LNIDLLWSV Proinsulin _L3-11 LWMRLLPLL hIGRP _265-273 VLFGLGFAI Proinsulin _L6-14 RLLPLLALL IGRP _206-214 VYLKTNVFL Proinsulin _B5-14 HLCGSHLVEA hIGRP _206-214 VYLKTNLFL Proinsulin _B10-18 HLVEALYLV NRP-A7 KYNKANAFL Proinsulin _B14-22 ALYLVCGER NRP-I4 KYNIANVFL Proinsulin _B15-24 LYLVCGERGF NRP-V7 KYNKANVFL Proinsulin _B17-25 LVCGERGFF ^YAI /Db FQDENYLYL Proinsulin _B18-27 VCGERGFFYT INS B _15–23 LYLVCGERG Proinsulin _B20-27 GERGFFYT PPI _{76-90 (K88S)} SLQPLALEGSLQSRG Proinsulin _B21-29 ERGFFYTPK IGRP _13-25 QHLQKDYRAYYTF Proinsulin _B25-C1 FYTPKTRRE GAD _555-567 NFFRMVISNPAAT Proinsulin _B27-C5 TPKTRREAEDL GAD _{555-567(557I)} NFIRMVISNPAAT Proinsulin _C20-28 SLQPLALEG IGRP _23-35 YTFLNFMSNVGDP Proinsulin _C25-33 ALEGSLQKR B ₂₄ -C ₃₆ FFYTPKTRREAED Proinsulin _C29-A5 SLQKRGIVEQ PPI _76-90 SLQPLALEGSLQKRG Proinsulin _A1-10 GIVEQCCTSI INS-I9 LYLVCGERI Proinsulin _A2-10 IVEQCCTSI TUM KYQAVTTTL Proinsulin _A12-20 SLYQLENYC G6Pase KYCLITIFL

MS related antigens

[0144] Antigens of the present disclosure include antigens associated with multiple sclerosis. Such antigens include, for example, antigens disclosed in US Patent Application Publication No. 2012/0077686 and antigens derived from myelin basic protein, myelin-associated glycoprotein, myelin oligodendrocyte protein, proteolipid protein, oligodendrocyte myelin oligoprotein, myelin-associated oligodendrocyte basic protein, oligodendrocyte-specific protein, heat shock proteins, oligodendrocyte-specific NOGO A proteins, Po glycoprotein, peripheral myelin protein 22, or 2'3'-cyclic nucleotide-3'-phosphodiesterase. In some embodiments, the antigen is derived from myelin oligodendrocyte glycoprotein (MOG).

[0145] According to additional aspects, peptide antigens for the treatment of MS and MS-related disorders include, without limitation, those listed in Table 2, as well as equivalents and/or combinations of each of them:

Table 2. Peptide Peptide MOG _35-55 MEVGWYRSPFSRVVHLYRNGK MOG _97-109 TCFFRDHSYQEEA MOG _36-55 EVGWYRSPFSRVVHLYRNGK MOG _{97-109(E107S)} TCFFRDHSYQEEA MAG _287-295 SLLLELEEV MOG _{97-109(E107S)} TCFFRDHSYQSEA MAG _509-517 LMWAKIGPV MBP _89-101 VHFFKNIVTPRTP MAG _556-564 VLFSSDFRI PLP _175-192 YIYFNTWTTCQSIAFPSK MBP _110-118 SLSRFSWGA PLP _94-108 GAVRQIFGDYKTTIC MOG _114-122 KVEDPFYWV MBP _86-98 PVVHFFKNIVTPR MOG _166-175 RTFDPHFLRV PLP _54-68 NYQDYEYLINVIHAF MOG _172-180 FLRVPCWKI PLP _249-263 ATLVSLLTFMIATY MOG _179-188 KITLVIVPV MOG _156-170 LVLLAVLPVLLLQIT MOG _188-196 VLGPLVALI MOG _201-215 FLRVPCWKITLFVIV MOG _181-189 TLFVIVPVL MOG _38-52 RHPIRALVGDEVELP MOG _205-214 RLAGQFLEEL MOG _203-217 RVPCWKITLFVIVPV PLP _80-88 FLYGALLLA PLP _250-264 TLVSLLTFMIAATYN MAG _287-295 SLLLELEEV MPB _13-32 KYLATASTMDHARHGFLPRH MAG _509-517 LMWAKIGPV MPB _83-99 ENPVVHFFKNIVTPRTP MAG _556-564 VLFSSDFRI MPB _111-129 LSRFSWGAEGQRPGFGYGG

Celiac disease (CD) related antigens

[0146] Related to celiac disease antigens include, without limitation, antigens derived from gliadin. In some embodiments, non-limiting types of gliadin include alpha/beta gliadin, γ-gliadin, or ω-gliadin. Other non-limiting illustrative celiac related antigens include the antigens listed in Table 3, as well as their equivalents and/or combinations.

Table 3 Peptide aGlia _57-68 QLQPFPQPELPY aGlia _62-72 PQPELPYPQPE aGlia _217-229 SGEGSFQPSQQNP

Primary biliary cirrhosis (PBC) antigens

[0147] Related to primary biliary cirrhosis antigens include, without limitation, antigens derived from PDC-E2. Non-limiting examples of illustrative antigens include those listed in Table 4 as well as equivalents and/or combinations of each.

Table 4 Peptide Peptide PDC-E2 _122-135 GDLIAEVETDKATV PDC-E2 _422-436 DIPISNIRRVIAQRL PDC-E2 _249-262 GDLLAEIETDKATI PDC-E2 _629-643 AQWLAEFRKYLEKPI PDC-E2 _249-263 GDLLAEIETDKATIG PDC-E2 _80-94 SPGRRYYSLPHQKV PDC-E2 _629-643 AQWLAEFRKYLEKPI PDC-E2 _353-367 GRVFVSPLAKKLAVE PDC-E2 _72-86 RLLLQLLGSPGRRYY PDC-E2 _535-549 ETIANDVVSLATKAR PDC-E2 _353-367 GRVFVSPLAKKLAVE

Pemphigus foliaceus (PF) and Pemphigus vulgaris (PV) related antigens

[0148] Related to PF and PV antigens include, without limitation, antigens derived from desmoglein 3 (DG3) and/or desmoglein 1 (DG1). Non-limiting examples include those listed in Table 5 as well as equivalents and/or combinations of each.

Table 5 Peptide Peptide _{DG1 216-229} GEIRTMNNFLDREI DG3 _438-452 DSKTAEIKFVKNMNR DG3 _97-111 FGIFVVDKNTGDINI _{DG1 48-62} KREWIKFAAAACREGE DG3 _251-265 CECNIKVKDVNDNFP _{DG1 206-222} MFIINRNTGEIRTMN DG3 _351-365 NKAEFHQSVISRYRV _{DG1 363-377} SQYKLKASAISVTVL DG3 _453-467 DSTFIVNKTITAEVL DG1 _3-17 WSFFRVVAMLFIFLV DG3 _540-554 SITTLNATSALLRAQ DG1 _192-206 SKIAFKIIRQEPSDS DG3 _280-294 ILSSELLRFQVTDLD _{DG1 326-340} TNVGILKVVKPLDYE DG3 _326-340 EGILKVVKALDYEQL DG1 _1-15 MDWSFFRVVAMLFIF DG3 _367-381 STPVTIQVINVREGI DG1 _35-49 KNGTIKWHSIRRQKR DG3 _13-27 AIFVVVILVHGELRI _{DG1 325-339} RTNVGILKVVKPLDY DG3 _323-337 RTNEGILKVVKALDY

Optic neuromyelitis with spectrum disorder (NMO) antigens

[0149] NMO-related antigens include, without limitation, antigens derived from AQP4 or aquaporin 4. Non-limiting examples include those listed in Table 6, as well as equivalents and/or combinations of each.

Table 6 Peptide Peptide AQP4 _129-143 GAGILYLVTPPSVVG AQP4 _129-143 GAGILYLVTPPSVVG AQP4 _284-298 RSQVETDDLILKPGV AQP4 _39-53 TAEFLAMLIFVLLS AQP4 _63-76 EKPLPVDMVLISLC

Arthritis related antigens

[0150] Arthritis-related antigens include, without limitation, antigens derived from heat shock proteins, immunoglobulin-binding protein, heterogeneous nuclear RNPs, annexin V, calpastatin, type II collagen, glucose-6-phosphate isomerase, elongation factor human cartilage gp39, mannose-binding lectin, citrullinated vimentin, collagen type II, fibrinogen, alpha-enolase, anti-carbamylated protein (anti-CarP), peptidylarginine deiminase type 4 (PAD4), BRAF, fibrinogen gamma chain, inter-alpha heavy chain -trypsin H1, alpha-1 antitrypsin, C1 plasma protease inhibitor, gelsolin, alpha-1-B glycoprotein, ceruloplasmin, alpha-trypsin inhibitor heavy chain H4, complement factor H, alpha-2-macroglobulin, serum amyloid, C-reactive protein, serum albumin, fibrogen beta chain, serotransferin, alpha 2 HS glycoprotein, vimentin, complement C3, or a fragment or equivalent of each.

Antigens related to allergic asthma

[0151] Related to allergic asthma antigens include, without limitation, antigens derived from DERP1 and DERP2. Non-limiting examples include those listed in Table 7 as well as equivalents and/or combinations of each.

Table 7 Peptide Peptide DERP-1 _16-30 LRQMRTVTPIRMQGG DERP-2 _26-40 PCIIHRGKPFQLEAV DERP-1 _171-185 AVNIVGYSNAQGVDY DERP-2 _107-121 TVKVMGDDGVLACAI DERP-1 _110-124 RFGISNYCQIYPPNV

Antigens related to inflammatory bowel disease

[0152] Inflammatory bowel disease-related antigens include, without limitation, Crohn's disease-related antigens and ulcerative colitis-related antigens. In some embodiments, antigens related to inflammatory bowel disease include, but are not limited to, antigens derived from bacteroid integrase, flagellin, flagellin 2 (Fla-2/Fla-X), or uncharacterized E. coli protein (YIDX). Non-limiting examples include those listed in Table 8 as well as equivalents and/or combinations of each.

Table 8 Peptide Peptide bacteroid inegrase antigen _183-197 EAINQGYMHADAYPF Fla-2/Fla-X _1-15 MVVQHNLRAMNSNRM bacteroid _inegrase antigen 146-160 KDLTYTFLRDFEQYL Fla-2/Fla-X _51-65 KMRKQIRGLSQASLN bacteroid _inegrase antigen 175-189 RQLRTLVNEAINQGY Fla-2/Fla-X _269-283 GAYKLIQKELGLASS bacteroid inegrase antigen _1-15 MDKIRYRLVYNRQNT Fla-2/Fla-X _4-18 QHNLRAMNSNRMLGI bacteroid inegrase antigen _183-197 EAINQGYMHADAYPF Fla-2/Fla-X _271-285 YKLIQKELGLASSIG bacteroid inegrase antigen _30-44 LNQRKIYLKTNVYLK YIDX _78-92 ADDIVKMLNDPALNR bacteroid inegrase antigen _70-84 EYILYLQGIELGYWK YIDX _93-107 HNIQVADDARFVLNA bacteroid _inegrase antigen 337-351 TCATLLIHQGVAITT YIDX _98-112 ADDARFVLNAGKKKF bacteroid inegrase antigen _171-185 AKHMRQLRTLVNEAI YIDX _23-37 GCISYALVSHTAKGS bacteroid inegrase antigen _4-18 IRYRLVYNRQNTLNR YIDX _78-92 ADDIVKMLNDPALNR bacteroid _inegrase antigen 256-270 ENFIRINGKRWLYFK YIDX _195-209 LPVTVTLDIITAPLQ Fla-2/Fla-X _366-380 TGAAATYAIDSIADA YIDX _22-36 SGCISYALVSHTAKG Fla-2/Fla-X _164-178 NATFSMDQLKFGDTI YIDX _80-94 DIVKMLNDPALNRHN Fla-2/Fla-X _261-275 DRTVVSSIGAYKLIQ YIDX _101-115 ARFVLNAGKKKFTGT

Systemic lupus erythematosus (SLE) related antigens

[0153] SLE-related antigens include, but are not limited to, antigens derived from H4, H2B, H1', dsDNA, RNP, Smith (Sm), Sjögren Syndrome-associated A (SS-A)/Ro Sjögren's syndrome antigen B (SS-B) / La and / or histones. In some embodiments, SS-A includes, without limitation, RO60 and RO52. In some embodiments, histones include, without limitation, H4, H2B, H1'. Non-limiting examples include those listed in Table 9 as well as equivalents and/or combinations of each.

Table 9 Peptide Peptide H4 _71-94 TYTEHAKRKTVTAMDVVYALKRQG H4 _80-94 TVTAMDVVYALKRQ H4 _74-88 EHARKRKTVTAMDVVY H2B _10-24 PKKGSKKAVTKAQKK H4 _76-90 AKRKTVTAMDVVYAL H2B _16-30 KAVTKAQKKDGKKRK H4 _75-89 HAKRKTVTAMDVVYA H1´ _22-42 STDHPKYSDMIVAAIQAEKNR H4 _78-92 RKTVTAMDVVYALKR H1´ _27-41 KYSDMIVAAIQAEKN

Antigens related to atherosclerosis

[0154] Atherosclerosis-related antigens include, without limitation, antigens derived from apolipoprotein B (ApoB) or apolipoprotein E (ApoE). Non-limiting examples include those listed in Table 10 as well as equivalents and/or combinations of each.

Table 10 Peptide Peptide ApoB _3501-3516 SQEYSGGSVANEANVY ApoB _210A KTTKQSFDLSVKAQYKKNKH ApoB _1952-1966 SHSLPYESSISTALE ApoB _210B KTTKQSFDLSVKAQY ApoB _978-993 TGAYSNASSTESASY ApoB _210C TTKQSFDLSVKAQYK ApoB _3498-3513 SFLSQEYSGSVANEA

Antigens related to chronic obstructive pulmonary disease (COPD) and/or emphysema

[0155] Related to COPD and/or emphysema antigens include, without limitation, derived from elastin. Non-limiting examples include those listed in Table 11 as well as equivalents and/or combinations of each.

Table 11 Peptide Peptide elastin _89-103 GALVPGGVADAAAAY elastin _563-577 VAAKAQLRAAAGLGA elastin _698-712 AAQFGLVGAAGLGGL elastin _558-572 KSAAKVAAKAQLRAA elastin _8-22 APRPGVLLLLSILH elastin _698-712 AAQFGLVGAAGLGGL elastin _94-108 GGVADAAAAYKAAKA elastin _566-580 KAQLRAAAGLGAGIP elastin _13-27 VLLLLSILHPSRPG elastin _645-659 VPGALAAAKAAKYGA elastin _695-709 AAKAAQFGLVGAAGL

Antigens related to psoriasis

[0156] Related to psoriasis antigens include, without limitation, listed in the following table 12, as well as their equivalents and/or combinations. Other non-limiting exemplary psoriasis-related antigens can be derived from human adamis-like protein 5 (ATL5), cathelicidin antimicrobial peptide (CAP18), and/or ADAMTS-like protein 5 (ADMTSL5).

Table 12 Peptide Peptide Cap18 _64-78 RPTMDGDPDTTPKPVS ADMTSL5 _372-386 RLLHYCGSDDFVFQAR Cap18 _34-48 SYKEAVLRAIDGINQ ADMTSL5 _289-303 HDLLLQVLLQEPNPG Cap18 _47-61 NQRSSDANLYRLLDL ADMTSL5 _396-410 ETRYEVRIQLVYKNR Cap18 _151-165 KRIVQRIKDFLRNLV ADMTSL5 _433-447 HRDYLMAVQRLVSPD Cap18 _149-163 EFKRIVQRIKDFLRN ADMTSL5 _142-156 EGHAFYHSFGRVLDG Cap18 _152-166 RIVQRIKDFLRNLVP ADMTSL5 _236-250 RNHLALMGGDGRYVL Cap18 _131-145 RFALLGDFRKSKEK ADMTSL5 _301-315 NPGIEFEFWLPRERY Cap18 _24-38 QRIKDFLRNLVPRTE ADMTSL5 _203-217 VQRVFRDAGAFAGYW ADMTSL5 _245-259 DGRYVLNGHWVVSPP ADMTSL5 _404-418 QLVYKNRSPLRAREY ADMTSL5 _267-281 THVVYTRDTGPQETL

Antigens related to autoimmune hepatitis

[0157] Related to autoimmune hepatitis antigens include, without limitation, the antigens disclosed in Table 13 below, as well as their equivalents and/or combinations. Other non-limiting exemplary autoimmune hepatitis antigens may be derived from microsomal cytochrome P450IID6 (CYP2D6) and/or soluble liver antigen (SLA).

Table 13 Peptide Peptide CYP2D6 _193-207 RRFEYDDPRFLRLLD SLA _334-348 YKKLLKERKEMFSYL CYP2D6 _76-90 TPVVVLNGLAAVREA SLA _196-210 DELRTDLKAVEAKVQ CYP2D6 _293-307 ENLRIVVADLFSAGM SLA _115-129 NKITNSLVLDIIKLA CYP2D6 _313-332 TLAWGLLLMILHPDVQRRVQ SLA _373-386 NRLDRCLKAVRKER CYP2D6 _393-412 TTLITNLSSVLKDEAVWEKP SLA _186-197 LIQQGARVGRID CYP2D6 _199-213 DPRFLRLLDLAQEGL SLA _317-331 SPSLDVLITLLSGS CYP2D6 _450-464 RMELFLFFTSLLQHF SLA _171-185 DQKSCFKSMITAGFE CYP2D6 _301-315 DLFSAGMVTTSTTLA SLA _417-431 YTFRGFMSHTNNYPC CYP2D6 _452-466 ELFLFFTSLLQHFSF SLA _359-373 YNERLLHTPHNPISL CYP2D6 _59-73 DQLRRRFGDVFSLQL SLA _215-229 DCILCIHSTTSCFAP CYP2D6 _130-144 EQRRFSVSTLRNLGL SLA _111-125 SSLLNKITNSLVLDI CYP2D6 _193-212 RRFEYDDPRFLRLLDLAQEG SLA _110-124 GSSLLNKITNSLVLD CYP2D6 _305-324 AGMVTTSTTLAWGLLLMILH SLA _299-313 NDSFIQEISKMYPGR CYP2D6 _131-145 QRRFSVSTLRNLGLG SLA _342-356 KEMFSYLSNQIKKLS CYP2D6 _216-230 ESGFLREVLNAVPVL SLA _49-63 STLELFLHELAIMDS CYP2D6 _238-252 GKVLRFQKAFLTQLD SLA _119-133 NSLVLDIIKLAGVHT CYP2D6 _199-213 DPRFLRLLDLAQEGL SLA _260-274 SKCMHLIQQGARVGR CYP2D6 _235-252 GKVLRFQKAFLTQLD SLA _26-40 RSHEHLIRLLLEKGK CYP2D6 _293-307 ENLRIVVADLFSAGM SLA _86-100 RRHYRFIHGIGRSGD CYP2D6 _381-395 DIEVQGFRIPKGTTL SLA _331-345 SNGYKKLLKERKEMF CYP2D6 _429-443 KPEAFLPFSAGGRAC

Uveitis related antigens

[0158] Related to uveitis antigens include, without limitation, the antigens disclosed in Table 14 below, as well as their equivalents and/or combinations thereof. Other non-limiting exemplary uveitis-related antigens can be derived from arrestin, human retinal S antigen, and/or retinoid interforeceptor binding protein (IRBP).

Table 14 Peptide Peptide arrestin _199-213 QFFMSDKPLHLAVSLN arrestin _102-116 STPTKLQESLLKKLG arrestin _77-91 DVIGLTFRRDLYFSR arrestin _59-73 KKVYVTTLTCAFRYGQ arrestin _250-264 NVVLYSSDYYVKPVA arrestin _280-294 KTLTLLPLLANNRER arrestin _172-186 SSVRLLIRKVQHAPL arrestin _291-306 NRERRGIALDGKIKHE arrestin _354-368 EVPFRLMHPQPEDPA arrestin _195-209 EAAWQFFMSDKPLHL arrestin _239-253 KKIKAFVEQVANVVL arrestin _200-214 QFFMSDKPLHLAVSL

Antigens related to Sjögren's syndrome

[0159] Related to Sjögren's syndrome antigens include, without limitation, the antigens disclosed in the following table 15, as well as their equivalents and/or combinations. Other non-limiting exemplary Sjögren's syndrome related antigens can be derived from (SS-A)/Ro, (SS-B)/La, RO60, RO52 and/or muscarinic receptor 3 (MR3).

Tables 15. Peptide Peptide RO60 _127-141 TFIQFKKDLKESMKC LA _101-115 TDEYKNDVKNRSVYI RO60 _523-537 DTGALDVIRNFTLDDM L.A. _153-167 SIFVVFDSIESAKKF RO60 _243-257 EVIHLIEEEHRLVREH L.A. _178-192 TDLLILFKDDYFAKK RO60 _484-498 REYRKKMDIPAKLIV L.A. _19-33 HQIEYYFGDFNLPRD RO60 _347-361 EEILKALDAAFYKTF LA _37-51 KEQIKLDEGWVPLEI RO60 _369-383 KRFLLAVDVSASMNQ L.A. _133-147 DKGQVLNIQMRRTLH RO60 _426-440 TDMTLQQVLMAMSQI LA _50-64 EIMIKFNRLNRLTTD RO60 _267-281 EVWKALLQEMPLTAL LA _32-46 RDKFLKEQIKLDEGW RO60 _178-192 SHKDLLRLSHLKPSS L.A. _153-167 SIFVVFDSIESAKKF RO60 _358-372 YKTFKTVEPTGKRFL L.A. _83-97 SEDKTKIRRSPSKPL RO60 _221-235 ETEKLLKYLEAVEKV LA _136-150 QVLNIQMRRTLHKAF RO60 _318-332 RIHPFHILIALETYK L.A. _297-311 RNKEVTWEVLEGEVE RO60 _407-421 EKDSYVVAFSDEMVP LA _59-73 NRLTTDFNVIVEALS RO60 _459-473 TPADVFIVFTDNETF L.A. _151-165 KGSIFVVFDSIESAK RO60 _51-65 QKLGLENAEALIRLI LA _86-100 KTKIRRSPSKPLPEV RO60 _312-326 KLLKKARIHPFHILI L.A. _154-168 IFVVFDSIESAKKFV L.A. _241-255 DDQTCREDLHILFSN

Scleroderma related antigens

[0160] Related to scleroderma antigens include, without limitation, the antigens disclosed in Table 16 below, as well as their equivalents and/or combinations. Non-limiting illustrative scleroderma-related antigens can be derived from centromeric centromeric autoantigen protein C (CENP-C), DNA topoisomerase I (TOP1), and/or RNA polymerase III.

Table 16 Peptide Peptide TOP1 _346-360 KERIANFKIEPPGLF CENP-C _857-871 KVYKTLDTPFFSTGK TOP1 _420-434 QGSIKYIMLNPSSRI CENP-C _887-901 QDILVFYVNFGDLLC TOP1 _750-764 QREKFAWAIDMADED CENP-C _212-226 KVMLKKIEIDNKVSD TOP1 _419-433 IQGSIKYIMLNPSSR CENP-C _643-657 EDNIMTAQNVPLKPQ TOP1 _591-605 YNASITLQQQLKELT CENP-C _832-846 TREIILMDLVRPQDT TOP1 _695-709 EQLMKLEVQATDREE CENP-C _167-181 TSVSQNVIPSSAQKR TOP1 _305-319 SQYFKAQTEARKQMS CENP-C _246-260 RIRDSEYEIQRQAKK TOP1 _346-360 KERIANFKIEPPGLF CENP-C _846-860 TYQFFVKHGELKVYK TOP1 _419-433 IQGSIKYIMLNPSSR CENP-C _149-163 DEEFYLSVGSPSVLL TOP1 _425-439 YIMLNPSSRIKGEKD CENP-C _833-847 REIILMDLRPQDTY TOP1 _614-628 KILSYNRANRAVAIL CENP-C _847-861 YQFFVKHGELKVYKT CENP-C _297-311 KLIEDEFIIDESDQS

antiphospholipid syndrome related antigens

[0161] Related to antiphospholipid syndrome antigens include, without limitation, the antigens disclosed in Table 17 below, as well as their equivalents and/or combinations. Non-limiting illustrative antiphospholipid syndrome related antigens can be derived from beta-2-glycoprotein 1 (BG2P1 or APOH).

Table 17 Peptide Peptide APOH _235-249 HDGYSLDGPEEIECT APOH _295-309 KVSFFCKNKEKKCSY APOH _306-320 KCSYTEDAQCIDGTI APOH _49-63 YSCKPGYVSRGGMRK APOH _237-251 GYSLDGPEIECTKL APOH _269-283 KKATVVYQGERVKIQ APOH _295-309 KVSFFCKNKEKKCSY APOH _295-309 KVSFFCKNKEKKCSY APOH _28-42 DLPFSTVVPLKTFYE APOH _321-355 EVPKCFKEHSSLAFW APOH _173-187 ECLPQHAMFGNDTIT APOH _322-336 VPKCFKEHSSLAFWK APOH _264-278 CKVPVKKATVVYQGE APOH _324-338 KCFKEHSSLAFWKTD

Antigens related to ANCA-associated vasculitis

[0162] Related to ANCA-associated vasculitis antigens include, without limitation, the antigens disclosed in Table 18 below, as well as their equivalents and/or combinations. Non-limiting exemplary antigens related to ANCA-associated vasculitis can be derived from myeloperoxidase (MPO), proteinase (PRTN3), or bacterial permeability enhancing factor (BPI).

Table 18 Peptide Peptide MPO _506-520 QPFMFRLDNRYQPME PRTN3 _44-58 SLQMRGNPGSHFCGG MPO _302-316 RIKNQADCIPFFRSC PRTN3 _234-248 TRVALYVDWIRSTLR MPO _7-21 SSLRCMVDLGPCWAG PRTN3 _59-73 TLIHPSFVLTAAHCL MPO _689-703 QQRQALAQISLPRII PRTN3 _117-131 NDVLLIQLSSPANLS MPO _248-262 RSLMFMQWGQLLDHD PRTN3 _164-178 DPPAQVLQELNVTVV MPO _444-458 QEARKIVGAMVQIIT PRTN3 _71-85 HCLRDIPQRLVNVVL MPO _513-527 DNRYQPMEPNPRVPL PRTN3 _241-255 DWIRSTLRRVEAKGR MPO _97-111 ELLSYFKQPVAATRT PRTN3 _59-73 TLIHPSFVLTAAHCL MPO _616-630 QLGTVLRNLKLARKL PRTN3 _183-197 RPHNICTFVPRRKAG MPO _462-476 YLPLVLGPTAMRKYL PRTN3 _62-76 HPSFVLTAAHCLRDI MPO _617-631 LGTVLRNLKLARKLM PRTN3 _118-132 DVLLIQLSSPANLSA MPO _714-728 KNNIFMSNSYPRDFV PRTN3 _239-253 YVDWIRSTLRRVEAK

Stiffness related antigens

[0163] Related to the syndrome of muscle stiffness antigens include, without limitation, the antigens disclosed in the following table 14, as well as their equivalents and/or combinations. Non-limiting exemplary stiffness antigens may be derived from glutamate decarboxylase (GAD). In some embodiments, GAD includes, without limitation, GAD65.

Table 19 Peptide GAD _212-226 EYVTLKKMREIIGWP GAD _555-569 NFFRMVISNPAATHQ GAD _297-311 DSVILIKCDERGKMI

[0164] Compositions of the present disclosure are expected to contain from about 0.001 mg to about 10 mg of total protein per ml of composition. Thus, the concentration of protein in the composition may be about, at least about, or at most about 0.001, 0.010, 0.050, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0, 7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 50, 100 µg/ml or mg/ml or more (or any range derived from it). Of this, approximately, at least approximately, or maximum approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 , 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 , 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94 95, 96%, 97%, 98%, 99% or 100% may be a peptide/MHC/nanoparticle complex.

[0165] The present disclosure includes administering a peptide/MHC/nanoparticle complex for diagnosis, treatment, or prophylactic therapy against the development of a disease or condition associated with autoimmune reactions or cancer.

[0166] In addition, US Pat. No. 4,554,101 (Hopp), which is incorporated herein by reference, describes the identification and generation of epitopes from primary amino acid sequences based on hydrophilicity. Through the methods disclosed in Hopp, one skilled in the art will be able to identify potential epitopes from an amino acid sequence and confirm their immunogenicity. Numerous scientific publications have also been devoted to secondary structure prediction and epitope identification from amino acid sequence analysis (Chou & Fasman, 1974a,b; 1978a,b; 1979). Any of these may be used if desired, in addition to Hopp's ideas in US Pat. No. 4,554,101.

Other antigenic components

[0167] Molecules other than peptides can be used as antigens or antigenic fragments in complex with MHC molecules. Such molecules include, without limitation, carbohydrates, lipids, small molecules, and the like. Carbohydrates are the main components of the outer surface of various cells. Certain carbohydrates are characteristic of different stages of differentiation, and very often these carbohydrates are recognized by specific antibodies. Expression of individual carbohydrates may be restricted to certain cell types. Autoantibody responses to endometrial and serum antigens have been shown to be a common feature of endometriosis. Serum autoantibody responses in endometriosis to a number of previously identified antigens have been described, including 2-Heremans-Schmid glycoprotein and carbonic anhydrase, which is specific for a carbohydrate epitope.

Non-limiting exemplary antigen-MHC complexes

[0168] In certain embodiments, specific combinations of antigen and MHC may be optimized for the treatment of a particular disease. Non-limiting examples include, without limitation, the following examples.

[0169] For the treatment of type I diabetes mellitus, the pMHC complex antigen can be derived from the group antigen: PPI _76-90(K88S) , IGRP _13-25 , GAD _555-567 , GAD _{555-567(557I)} , IGRP _23-35 , B ₂₄ -C ₃₆ , PPI _76-90 or a fragment or equivalent of each, and the MHC of the pMHC complex contains the entire polypeptide or part of the polypeptide of the group: HLA-DRB1*0401/DRA, HLA-DRB1*0301/DRA or a fragment or equivalent of each of them.

[0170] In some embodiments, the pMHC antigen comprises:

a) a diabetes-related antigen and derived from an antigen selected from one or more of the following group: preproinsulin (PPI), islet-specific glucose-6-phosphatase (IGRP), glutamate decarboxylase (GAD), islet cell autoantigen-2 ( ICA2), insulin, proinsulin, or a fragment or equivalent of each;

b) an antigen related to multiple sclerosis and derived from an antigen selected from one or more of the following group: myelin basic protein, myelin-associated glycoprotein, myelin oligodendrocyte protein, proteolipid protein, oligodendrocyte myelin oligoprotein, myelin-associated oligodendrocyte basic protein specific to oligodendrocyte protein, heat shock proteins, oligodendrocyte-specific proteins, NOGO A, Po glycoprotein, peripheral myelin protein 22, 2'3'-cyclic nucleotide-3'-phosphodiesterase, or a fragment or equivalent of each;

c) an antigen related to celiac disease and derived from gliadin or a fragment or equivalent thereof;

d) a primary antigen related to biliary cirrhosis and derived from PDC-E2 or a fragment or equivalent thereof;

e) a pemphigus leaf antigen and/or a pemphigus vulgaris antigen and derived from an antigen selected from one or more of the following group: DG1, DG3, or a fragment or equivalent of each;

f) an antigen related to neuromyelitis of the optic nerve with spectral disorder and derived from AQP4 or a fragment or equivalent thereof;

g) an arthritis-related antigen and derived from an antigen selected from one or more of the following group: heat shock proteins, immunoglobulin-binding protein, heterogeneous nuclear RNPs, annexin V, calpastatin, collagen type II, glucose-6-phosphate isomerase, factor human cartilage elongation gp39, mannose-binding lectin, citrullinated vimentin, collagen type II, fibrinogen, alpha-enolase, anti-carbamylated protein (anti-CarP), peptidylarginine deminase type 4 (PAD4), BRAF, fibrinogen gamma chain, inter -alpha-trypsin, alpha-1 antitrypsin, C1 plasma protease inhibitor, gelsolin, alpha-1-B glycoprotein, ceruloplasmin, inter-alpha-trypsin inhibitor heavy chain H4, complement factor H, alpha-2 macroglobulin, serum amyloid, C-reactive protein, serum albumin, fibrogen beta chain, serotransferin, alpha 2 HS glycoprotein, vimentin, complement C3, or a fragment or equivalent of each;

h) related to allergic asthma antigen and derived from an antigen selected from one or more of the following group: DERP1, DERP2 or a fragment or equivalent of each of them;

i) an inflammatory bowel disease antigen and derived from an antigen selected from one or more of the following group: flagellin, Fla-2, Fla-X, YIDX, bacteroid integrase, or a fragment or equivalent of each;

j) an antigen related to systemic lupus erythematosus and derived from an antigen selected from one or more of the following group: double-stranded (ds)DNA, ribonucleoprotein (RNP), Smith (Sm), Sjögren's syndrome-associated antigen A (SS-A)/ Ro, Sjögren's syndrome-associated antigen B (SS-B)/La, RO60, RO52, histones, or a fragment or equivalent of each;

k) an antigen related to atherosclerosis and derived from an antigen selected from one or more of the following group: ApoB, ApoE, or a fragment or equivalent of each;

l) a COPD-related antigen and/or an emphysema-related antigen and derived from elastin or a fragment or equivalent thereof;

m) a psoriasis-related antigen and derived from an antigen selected from one or more of the following group: Cap18, ADMTSL5, ATL5, or a fragment or equivalent thereof;

n) an antigen related to autoimmune hepatitis and derived from an antigen selected from one or more of the following group: CYP2D6, SLA, or a fragment or equivalent of each;

o) an antigen related to uveitis and derived from arrestin or a fragment or equivalent thereof;

p) an antigen related to Sjögren's syndrome and derived from an antigen selected from one or more of the following group: (SS-A)/Ro, (SS-B)/La, MR3, RO60, RO52, or a fragment or equivalent of each of them;

q) related to scleroderma antigen and derived from an antigen selected from one or more of the following group: CENP-C, TOP 1, RNA polymerase III, or a fragment or equivalent of each of them;

r) an antiphospholipid syndrome related antigen and derived from APOH or a fragment or equivalent thereof;

s) an antigen related to ANCA-associated vasculitis and derived from an antigen selected from one or more of the following group: MPO, PRTN3, or a fragment or equivalent of each of them; or

t) a stiffness syndrome related antigen and derived from GAD or a fragment or equivalent thereof.

[0171] In some embodiments, the pMHC complex MHC protein comprises all or part of a classic MHC class I protein, a non-classical MHC class I protein, a classic MHC class II protein, a non-classical MHC class II protein, MHC dimers (Fc fusions), MHC tetramers, or polymeric forms of the MHC protein, wherein the MHC protein optionally comprises a ridge-to-trough MHC-alpha-Fc/MHC-beta-Fc heterodimer or multimer.

[0172] In some embodiments, the pMHC complex MHC protein comprises all or part of a group polypeptide: HLA DR, HLA DQ, HLA DP, HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G , CD1d, or fragment or equivalent of each.

[0173] In some embodiments, the pMHC complex MHC protein comprises all or part of a polypeptide of the group: HLA-DR, HLA-DQ, HLA-DP, or a fragment or equivalent of each.

[0174] In some embodiments, the pMHC complex MHC protein comprises all or part of a group polypeptide: HLA-DRB1/DRA, HLA-DRB3/DRA, HLA-DRB4/DRA, HLA-DRB5/DRA, HLA-DQA1/HLA-DQB1, HLA-DPB1/HLA-DPA1 or fragment or equivalent of each.

[0175] In certain aspects, the pMHC complex comprises:

a) a diabetes related antigen derived from an antigen selected from one or more of the group: hInsB _10-18 , hIGRP _228-236 , hIGRP _265-273 , IGRP _206-214 , hIGRP _206-214 , NRP-A7, NRP -I4, NRP-V7, YAI/D ^b , INS B _15-23 , PPI _{76-90 (K88S)} , IGRP _13-25 , GAD _555-567 , GAD _{555-567(557I)} , IGRP _23-35 , B ₂₄ -C ₃₆ , PPI _76-90 , INS-I9, TUM, G6Pase, proinsulin _L2-10 , proinsulin _L3-11 , proinsulin _L6-14 , proinsulin _B5-14 , proinsulin _B10-18 , proinsulin _B14-22 , proinsulin _{B15 -24} , proinsulin _B17-25 , proinsulin _B18-27 , proinsulin _B20-27 , proinsulin _B21-29 , proinsulin _B25-C1 , proinsulin _B27-C5 , proinsulin _C20-28 , proinsulin _C25-33 , proinsulin _C29-A5 , proinsulin _{A1 -10} , proinsulin _A2-10 , proinsulin _A12-20 , or a fragment or equivalent of each;

b) a multiple sclerosis antigen derived from an antigen selected from one or more of the following groups: MOG _35-55 , MOG _{36-55 ,} MAG _287-295 , MAG _509-517 , MAG _556-564 , MBP _110-118 , MOG _114-122 , MOG _166-175 , MOG _172-180 , MOG _179-188 , _{MOG 188-196} , _{MOG 181-189} , _{MOG 205-214 556-564} , MOG _97-109 MOG _{97-109(E107S)} , MBP _89-101 , PLP _175-192 , PLP _94-108 , MBP _86-98 , PLP _54-68 , PLP _249-263 , MOG _156-170 , _{MOG 201-215} , _{MOG 38-52} , _{MOG 203-217} , _{PLP 250-264} , _{MPB 13-32} , PLP _88-102 , PLP _139-154 or fragment or equivalent of each of them;

c) related to celiac disease antigen derived from an antigen selected from one or more of the group: aGlia _57-68 , aGlia _62-72 , aGlia _217-229 or a fragment or equivalent of each of them;

d) an antigen related to primary biliary cirrhosis derived from an antigen selected from one or more of the group: PDC-E2 _122-135 , PDC-E2 _249-262 , PDC-E2 _249-263 , PDC-E2 _629-643 , PDC -E2 _72-86 , PDC-E2 _353-367 , PDC-E2 _422-436 , PDC-E2 _629-643 , PDC-E2 _80-94 , PDC-E2 _353-367 , PDC-E2 _535-549 or fragment or the equivalent of each;

e) a pemphigus leaf antigen and/or a pemphigus vulgaris antigen, each derived from an antigen selected from one or more of the group: _{DG1 216-229} , DG3 _97-111 , DG3 _251-265 , DG3 _441-455 ,DG3 _351-365 , DG3 _453-467 , DG3 _540-554 , DG3 _280-294 , DG3 _326-340 , DG3 _367-381 , DG3 _13-27 , DG3 _323-337 , DG3 _438-452 , _{DG1 48-62} , _{DG1 206-222} , _{DG1 363-377} , DG1 _3-17 , DG1 _192-206 , _{DG1 326-340} , DG1 _1-15 , DG1 _35-49 , _{DG1 325-339} , or a fragment or equivalent of each of them;

f) an antigen related to neuromyelitis of the optic nerve with a spectral disorder derived from an antigen selected from one or more of the group: AQP4 _129-143 , AQP4 _284-298 , AQP4 _63-76 , AQP4 _129-143 , AQP4 _39-53 or a fragment or the equivalent of each;

g) an allergic asthma antigen derived from an antigen selected from one or more of the group: DERP1 _16-30 , DERP1 _171-185 , DERP1 _110-124 , DERP-2 _26-40 , DERP-2 _{107-121 ,} or a fragment or the equivalent of each;

h) an inflammatory bowel disease antigen derived from an antigen selected from one or more of the group: bacterioid _183-197 integrase antigen, bacterioid _146-160 integrase antigen, bacterioid _175-189 integrase antigen, bacterioid _1-15 integrase antigen, antigen bacterioid integrase _183-197 , bacterioid integrase antigen _30-44 , bacterioid integrase antigen _70-84 , bacterioid integrase antigen _337-351 , bacterioid integrase antigen _171-185 , bacterioid integrase antigen _4-18 , bacterioid integrase antigen _256-270 , Fla- 2/Fla-X _366-380 , Fla-2/Fla-X _164-178 , Fla-2/Fla-X _261-275 , Fla-2/Fla-X _1-15 , Fla-2/Fla-X _{51 -65} Fla-2/Fla-X _269-283 Fla-2/Fla-X _4-18 Fla-2/Fla-X _271-285 YIDX _78-92 YIDX _93-107 YIDX _98-112 , YIDX _23-37 , YIDX _78-92 , YIDX _195-209 , YIDX _22-36 , YIDX _80-94 , YIDX _101-115 or a fragment or equivalent of each;

i) a systemic lupus erythematosus antigen derived from an antigen selected from one or more of the group: H4 _71-94 , H4 _74-88 , H4 _76-90 , H4 _75-89 , H4 _78-92 , H4 _80-94 , H2B _10-24 , H2B _16-30 , H1´ _22-42 , H1´ _27-41 or fragment or equivalent of each of them;

j) an atherosclerotic antigen derived from an antigen selected from one or more of the group: ApoB _3501-3516 , ApoB _1952-1966 , ApoB _978-993 , ApoB _3498-3513 , ApoB _210A , ApoB _210B , ApoB _210C or a fragment, or the equivalent of each;

k) a COPD-related antigen and/or an emphysema-related antigen, each derived from an antigen selected from one or more of the group: elastin _89-103 , elastin _698-712 , elastin _8-22 , elastin _94-108 , elastin _13-27 , elastin _695-709 , elastin _563-577 , elastin _558-572 , elastin _698-712 , elastin _566-580 , elastin _645-659 , or a fragment or equivalent of each;

l) a psoriasis-related antigen derived from an antigen selected from one or more of the group: Cap18 _64-78 , Cap18 _34-48 , Cap18 _47-61 , Cap18 _151-165 , Cap18 _149-163 , Cap18 _152-166 , Cap18 _{ADMTSL5 267-281 _ _ _ _ _ _ _ _ _ -315} , ADMTSL5 _203-217 , ADMTSL5 _404-418 , or fragment or equivalent of each;

m) an _antigen related to _{autoimmune hepatitis derived} from an _{antigen selected} from one or more of the group: ₂₁₃ , CYP2D6 _450-464 , CYP2D6 _301-315 , CYP2D6 _452-466 , CYP2D6 _59-73 , CYP2D6 _130-144 , CYP2D6 _193-212 , CYP2D6 _305-324 , CYP2D6 _131-145 , CYP2D6 _{216-230-230-230 238- 252} , CYP2D6 _199-213 , CYP2D6 _235-252 , CYP2D6 _293-307 , CYP2D6 _381-395 , CYP2D6 _429-443 , SLA _334-348 , SLA _196-210 , SLA _115-129 , _{SLA 37.38 197} SLA _317-331 SLA _171-185 SLA _417-431 SLA _359-373 SLA _215-229 SLA _{111-125 SLA 110-124 SLA 299-313 63} , SLA _119-133 , SLA _260-274 , SLA _26-40 , SLA _86-100 , SLA _331-345 , or a fragment or equivalent of each;

n) a uveitis-related antigen derived from an antigen selected from one or more of the group: arrestin _199-213 , arrestin _77-91 , arrestin _250-264 , arrestin _172-186 , arrestin _354-368 , arrestin _239-253 , arrestin _102-116 , arrestin _59-73 , arrestin _280-294 , arrestin _291-306 , arrestin _195-209 , arrestin _200-214 , or a fragment or equivalent of each;

o) an _{antigen related} to _Sjögren 's _{syndrome derived} from an _antigen selected from one or more of the group: _{RO60 426-440 , RO60 267-281 _ _ _ _ _} LA _241-255 , LA _101-115 , LA _153-167 , LA _178-192 , LA _19-33 , LA _37-51 , LA _133-147 , LA _50-64 , LA _32-46 , LA _153-167 , LA _83-97 , LA _136-150 , LA _297-311 , LA _59-73 , LA _151-165 , LA _86-100 , LA _154-168 or a fragment or equivalent of each;

p) a scleroderma-related antigen derived from an antigen selected from one or more of the group: TOP1 _346-360 , TOP1 _420-434 , TOP1 _750-764 , TOP1 _419-433 , TOP1 _591-605 , TOP1 _695-709 , TOP1 _305-319 TOP1 _{346-360 TOP1 419-433 TOP1 425-439 TOP1 614-628} CENP-C _297-311 CENP-C _857-871 CENP-C _887-901 CENP-C _{212- 226} , CENP-C _643-657 , CENP-C _{832-846 ,} CENP-C _{167-181 ,} CENP- _{C 246-260} , CENP-C _847-861 , or a fragment or equivalent of each;

q) an antiphospholipid syndrome related antigen derived from an antigen selected from one or more of the group: APOH _235-249 , APOH _306-320 , APOH _237-251 , APOH _295-309 , APOH _28-42 , APOH _173-187 , APOH _264-278 , APOH _295-309 , APOH _49-63 , APOH _269-283 , APOH _295-309 , APOH _321-355 , APOH _322-336 , APOH _324-338 or a fragment or equivalent of each;

r) an ANCA-associated vasculitis antigen derived from an antigen selected from one or more of the group: MPO _506-520 , MPO _302-316 , MPO _7-21 , MPO _689-703 , MPO _248-262 , MPO _{444- 458} , MPO _513-527 , MPO _97-111 , MPO _616-630 , _{MPO 462-476} , _{MPO 617-631 , MPO 714-728 131} , PRTN3 _164-178 , PRTN3 _71-85 , PRTN3 _241-255 , PRTN3 _59-73 , PRTN3 _183-197 , PRTN3 _62-76 , PRTN3 _118-132 , PRTN3 _239-253 or fragment or equivalent of each or

s) a stiffness related antigen derived from an antigen selected from one or more of the group: GAD _212-226 , GAD _555-569 , GAD _297-311 or a fragment or equivalent of each.

[0176] In certain aspects, the pMHC complex comprises:

a) a diabetes related antigen derived from an antigen selected from one or more of the group: hInsB _10-18 , hIGRP _228-236 , hIGRP _265-273 , IGRP _206-214 , hIGRP _206-214 , NRP-A7, NRP -I4, NRP-V7, YAI/D ^b , INS B _15-23 , PPI _{76-90 (K88S)} , IGRP _13-25 , GAD _555-567 , GAD _{555-567(557I)} , IGRP _23-35 , B ₂₄ -C ₃₆ , PPI _76-90 , INS-I9, TUM, G6Pase, proinsulin _L2-10 , proinsulin _L3-11 , proinsulin _L6-14 , proinsulin _B5-14 , proinsulin _B10-18 , proinsulin _B14-22 , proinsulin _{B15 -24} , proinsulin _B17-25 , proinsulin _B18-27 , proinsulin _B20-27 , proinsulin _B21-29 , proinsulin _B25-C1 , proinsulin _B27-C5 , proinsulin _C20-28 , proinsulin _C25-33 , proinsulin _C29-A5 , proinsulin _{A1 -10} , proinsulin _A2-10 , proinsulin _A12-20 or a fragment or equivalent of each, and the MHC protein of the pMHC complex contains all or part of HLA-DR or a fragment or equivalent thereof;

b) a multiple sclerosis antigen derived from an antigen selected from one or more of the group: MOG _35-55 , MOG _{36-55 ,} MAG _287-295 , MAG _509-517 , MAG _556-564 , MBP _110-118 , MOG _114-122 MOG _166-175 MOG _172-180 MOG _179-188 MOG _188-196 MOG _181-189 MOG _205-214 PLP _80-88 MAG _287-295 MAG _509-517 MAG _556-564 , MOG _97-109 MOG _{97-109(E107S)} , MBP _89-101 , PLP _175-192 , PLP _94-108 , MBP _86-98 , PLP _54-68 , PLP _249-263 , MOG _{156- 170} , MOG _201-215 , MOG _38-52 , MOG _203-217 , PLP _250-264 , MPB _13-32 , MPB _83-99 , MPB _111-129 , MPB _146-170 , MOG _223-237 , MOG _{6- 20} , PLP _88-102 , PLP _139-154 , or a fragment or equivalent of each, and the MHC protein of the pMHC complex contains all or part of HLA-DR, or a fragment or equivalent thereof;

c) a celiac disease antigen derived from an antigen selected from one or more of the group: aGlia _57-68 , aGlia _62-72 , aGlia _217-229 or a fragment or equivalent of each, and the MHC protein of the pMHC complex contains all or a portion of HLA-DR or a fragment or equivalent thereof;

d) an antigen related to primary biliary cirrhosis derived from an antigen selected from one or more of the group: PDC-E2 _122-135 , PDC-E2 _249-262 , PDC-E2 _249-263 , PDC-E2 _629-643 , PDC -E2 _72-86 , PDC-E2 _353-367 , PDC-E2 _422-436 , PDC-E2 _629-643 , PDC-E2 _80-94 , PDC-E2 _353-367 , PDC-E2 _535-549 or fragment or the equivalent of each, and the MHC protein of the pMHC complex contains all or part of HLA-DR, or a fragment or equivalent thereof;

e) a pemphigus leaf antigen and/or a pemphigus vulgaris antigen, each derived from an antigen selected from one or more of the group: _{DG1 216-229} , DG3 _97-111 , DG3 _251-265 , DG3 _441-455 ,DG3 _351-365 , DG3 _453-467 , DG3 _540-554 , DG3 _280-294 , DG3 _326-340 , DG3 _367-381 , DG3 _13-27 , DG3 _323-337 , DG3 _438-452 , _{DG1 48-62} , _{DG1 206-222} , _{DG1 363-377} , DG1 _3-17 , DG1 _192-206 , _{DG1 326-340} , DG1 _1-15 , DG1 _35-49 , _{DG1 325-339} or fragment or equivalent of each, and protein The MHC of the pMHC complex contains all or part of HLA-DR, or a fragment or equivalent thereof;

f) an antigen related to neuromyelitis of the optic nerve with a spectral disorder derived from an antigen selected from one or more of the group: AQP4 _129-143 , AQP4 _284-298 , AQP4 _63-76 , AQP4 _129-143 , AQP4 _39-53 or a fragment or an equivalent of each, and the MHC protein of the pMHC complex contains all or part of HLA-DR, or a fragment or equivalent thereof;

g) an allergic asthma antigen derived from an antigen selected from one or more of the group: DERP1 _16-30 , DERP1 _171-185 , DERP1 _110-124 , DERP-2 _26-40 , DERP-2 _107-121 or a fragment or an equivalent of each, and the pMHC complex MHC protein contains all or part of a polypeptide of the group: HLA-DR, HLA-DP, or a fragment or equivalent of each;

h) an inflammatory bowel disease antigen derived from an antigen selected from one or more of the group: bacterioid _183-197 integrase antigen, bacterioid _146-160 integrase antigen, bacterioid _175-189 integrase antigen, bacterioid _1-15 integrase antigen, antigen bacterioid integrase _183-197 , bacterioid integrase antigen _30-44 , bacterioid integrase antigen _70-84 , bacterioid integrase antigen _337-351 , bacterioid integrase antigen _171-185 , bacterioid integrase antigen _4-18 , bacterioid integrase antigen _256-270 , Fla- 2/Fla-X _366-380 , Fla-2/Fla-X _164-178 , Fla-2/Fla-X _261-275 , Fla-2/Fla-X _1-15 , Fla-2/Fla-X _{51 -65} Fla-2/Fla-X _269-283 Fla-2/Fla-X _4-18 Fla-2/Fla-X _271-285 YIDX _78-92 YIDX _93-107 YIDX _98-112 , YIDX _23-37 , YIDX _78-92 , YIDX _195-209 , YIDX _22-36 , YIDX _80-94 , YIDX _101-115 , or a fragment or equivalent of each, and the pMHC complex MHC protein contains all or part of HLA-DR or a fragment or equivalent thereof;

i) a systemic lupus erythematosus antigen derived from an antigen selected from one or more of the group: H4 _71-94 , H4 _74-88 , H4 _76-90 , H4 _75-89 , H4 _78-92 , H4 _80-94 , H2B _10-24 , H2B _16-30 , H1´ _22-42 , H1´ _27-41 or a fragment or equivalent of each, and the MHC protein of the pMHC complex contains all or part of the group polypeptide: IA _d , HLA-DR or a fragment or the equivalent of each;

j) an atherosclerotic antigen derived from an antigen selected from one or more of the group: ApoB _3501-3516 , ApoB _1952-1966 , ApoB _978-993 , ApoB _3498-3513 , ApoB _210A , ApoB _210B , ApoB _210C or a fragment, or the equivalent of each, and the MHC protein of the pMHC complex contains all or part of IA _b or a fragment or equivalent thereof;

k) a COPD-related antigen and/or an emphysema-related antigen, each derived from an antigen selected from one or more of the group: elastin _89-103 , elastin _698-712 , elastin _8-22 , elastin _94-108 , elastin _13-27 , elastin _695-709 , elastin _563-577 , elastin _558-572 , elastin _698-712 , elastin _566-580 , elastin _645-659 , or a fragment or equivalent of each, and the MHC protein of the pMHC complex contains all or part HLA-DR or fragment or equivalent;

l) a psoriasis-related antigen derived from an antigen selected from one or more of the group: Cap18 _64-78 , Cap18 _34-48 , Cap18 _47-61 , Cap18 _151-165 , Cap18 _149-163 , Cap18 _152-166 , Cap18 _{ADMTSL5 267-281 _ _ _ _ _ _ _ _ _ -315} , ADMTSL5 _203-217 , ADMTSL5 _404-418 or a fragment or equivalent of each, and the MHC protein of the pMHC complex contains all or part of HLA-DR or a fragment or equivalent thereof;

m) an _antigen related to _{autoimmune hepatitis derived} from an _{antigen selected} from one or more of the group: ₂₁₃ , CYP2D6 _450-464 , CYP2D6 _301-315 , CYP2D6 _452-466 , CYP2D6 _59-73 , CYP2D6 _130-144 , CYP2D6 _193-212 , CYP2D6 _305-324 , CYP2D6 _131-145 , CYP2D6 _{216-230-230-230 238- 252} , CYP2D6 _199-213 , CYP2D6 _235-252 , CYP2D6 _293-307 , CYP2D6 _381-395 , CYP2D6 _429-443 , SLA _334-348 , SLA _196-210 , SLA _115-129 , _{SLA 37.38 197} SLA _317-331 SLA _171-185 SLA _417-431 SLA _359-373 SLA _215-229 SLA _{111-125 SLA 110-124 SLA 299-313 63} , SLA _119-133 , SLA _260-274 , SLA _26-40 , SLA _86-100 , SLA _331-345 , or a fragment or equivalent of each, and the MHC protein from the pMHC complex contains all or part of HLA-DR or a fragment thereof or equivalent;

n) a uveitis-related antigen derived from an antigen selected from one or more of the group: arrestin _199-213 , arrestin _77-91 , arrestin _250-264 , arrestin _172-186 , arrestin _354-368 , arrestin _239-253 , arrestin _102-116 , arrestin _59-73 , arrestin _280-294 , arrestin _291-306 , arrestin _195-209 , arrestin _200-214 or a fragment or equivalent of each, and the MHC protein of the pMHC complex contains all or part of HLA-DR or its fragment or equivalent;

o) an _{antigen related} to _Sjögren 's _{syndrome derived} from an _antigen selected from one or more of the group: _{RO60 426-440 , RO60 267-281 _ _ _ _ _} LA _241-255 , LA _101-115 , LA _153-167 , LA _178-192 , LA _19-33 , LA _37-51 , LA _133-147 , LA _50-64 , LA _32-46 , LA _153-167 , LA _83-97 , LA _136-150 , LA _297-311 , LA _59-73 , LA _151-165 , LA _86-100 , LA _154-168 , or a fragment or equivalent of each, and the pMHC complex MHC protein contains all or part of a group polypeptide: HLA-DR, HLA-DP, or a fragment or equivalent of each;

p) a scleroderma-related antigen derived from an antigen selected from one or more of the group: TOP1 _346-360 , TOP1 _420-434 , TOP1 _750-764 , TOP1 _419-433 , TOP1 _591-605 , TOP1 _695-709 , TOP1 _305-319 TOP1 _{346-360 TOP1 419-433 TOP1 425-439 TOP1 614-628} CENP-C _297-311 CENP-C _857-871 CENP-C _887-901 CENP-C _{212- 226} , CENP-C _643-657 , CENP-C _{832-846 ,} CENP-C _{167-181 ,} CENP- _{C 246-260} , CENP-C _847-861 or a fragment or equivalent of each of them, as well as the MHC protein of the pMHC complex contains all or part of HLA-DR or a fragment or equivalent thereof;

q) an antiphospholipid syndrome related antigen derived from an antigen selected from one or more of the group: APOH _235-249 , APOH _306-320 , APOH _237-251 , APOH _295-309 , APOH _28-42 , APOH _173-187 , APOH _264-278 , APOH _295-309 , APOH _49-63 , APOH _269-283 , APOH _295-309 , APOH _321-355 , APOH _322-336 , APOH _324-338 or fragment or equivalent of each, and MHC protein the pMHC complex contains all or part of HLA-DR, or a fragment or equivalent thereof;

r) an ANCA-associated vasculitis antigen derived from an antigen selected from one or more of the group: MPO _506-520 , MPO _302-316 , MPO _7-21 , MPO _689-703 , MPO _248-262 , MPO _{444- 458} , MPO _513-527 , MPO _97-111 , MPO _616-630 , _{MPO 462-476} , _{MPO 617-631 , MPO 714-728 and _ _ _ _ _ _ _ _} the MHC protein of the pMHC complex contains all or part of HLA-DR, or a fragment or equivalent thereof, or

s) an antigen related to muscle stiffness syndrome derived from an antigen selected from one or more of the group: GAD _212-226 , GAD _555-569 , GAD _297-311 , and the MHC protein of the pMHC complex contains all or part of the polypeptide of the group: HLA- DR, HLA-DQ, or a fragment or equivalent of each.

[0177] According to certain aspects, the pMHC complex is intended for the treatment of:

a) type I diabetes mellitus, and the pMHC complex is selected from the group: PPI _76-90(K88S) -HLA-DRB1*0401/DRA, IGRP _13-25 -HLA-DRB1*0301/DRA, GAD _555-567 -HLA- DRB1*0401/DRA, GAD _{555-567(557I)} -HLA-DRB1*0401/DRA, IGRP _23-35 -HLA-DRB1*0401/DRA, B ₂₄ -C ₃₆ -HLA-DRB1*0301/DRA or PPI _76-90 -HLA-DRB1*0401/DRA;

b) multiple sclerosis, and the pMHC complex is selected from the group: MBP _86-98 -HLA-DRB1*1501/DRA, MBP _89-101 -HLA-DRB5*0101/DRA, MOG _38-52 -HLA-DRB4*0101/DRA , MOG _{97-109(E107S)} -HLA-DRB1*0401/DRA, MOG _203-217 -HLA-DRB3*0101/DRA, PLP _54-68 -HLA-DRB3*0101/DRA, PLP _94-108 -HLA- DRB1*0301/DRA, PLP _250-264 -HLA-DRB4*0101/DRA, MPB _13-32 -HLA-DRB5*0101/DRA, MPB _83-99 -HLA-DRB5*0101/DRA, MPB _111-129 - HLA-DRB5*0101/DRA, MPB _146-170 -HLA-DRB5*0101/DRA, MOG _223-237 -HLA-DRB3*0202/DRA, MOG _6-20 -HLA-DRB5*0101/DRA, PLP _{88- 102} -HLA-DRB3*0202/DRA or PLP _139-154 -HLA-DRB5*0101/DRA;

c) celiac disease, and the pMHC complex is selected from the group: aGlia _57-68 - HLA-DQA1*0501/HLA-DQB1*0201, aGlia _62-72 - HLA-DQA1*0501/HLA-DQB1*0201, aGlia _217-229 - HLA-DQA1*0501/HLA-DQB1*0302 or aGlia _217-229 -HLA-DQA1*03/ HLA-DQB1*0302;

d) primary biliary cirrhosis, and the pMHC complex is selected from the group: PDC-E2 _122-135 -HLA-DRB4*0101/DRA, PDC-E2 _249-262 -HLA-DRB4*0101/DRA, PDC-E2 _249-263 - HLA-DRB1*0801/DRA, PDC-E2 _629-643 -HLA-DRB1*0801/DRA, PDC-E2 _72-86 -HLA-DRB3*0202/DRA, PDC-E2 _353-367 -HLA-DRB3*0202 /DRA, PDC-E2 _422-436 -HLA-DRB3*0202/DRA, PDC-E2 _629-643 -HLA-DRB4*0101/DRA, PDC-E2 _80-94 -HLA-DRB5*0101/DRA, PDC- E2 _353-367 -HLA-DRB5*0101/DRA, or PDC-E2 _535-549 -HLA-DRB5*0101/DRA, mPDC-E2 _166-181 -IA _g7 or mPDC-E2 _82-96 -IA _g7 ;

e) pemphigus foliaceus and/or pemphigus vulgaris and the pMHC complex is selected from the group: _{DG1 216-229} -HLA-DRB1*0101/DRA, _{DG1 216-229} -HLA-DRB1*0102/DRA, DG3 _97-111 -HLA- DRB1*0402/DRA, DG3 _251-265 -HLA-DRB1*0402/DRA, DG3 _251-265 -HLA-DRB1*0401/DRA, DG3 _441-455 -HLA-DRB1*0402/DRA, DG3 _351-365 - HLA-DRB3*0202/DRA, DG3 _453-467 -HLA-DRB3*0202/DRA, DG3 _540-554 -HLA-DRB3*0202/DRA, DG3 _280-294 -HLA-DRB4*0101/DRA, DG3 _{326- 340} -HLA-DRB4*0101/DRA, DG3 _367-381 -HLA-DRB4*0101/DRA, DG3 _13-27 -HLA-DRB5*0101/DRA, DG3 _323-337 -HLA-DRB5*0101/DRA, DG3 _438-452 -HLA-DRB5*0101/DRA, _{DG1 48-62} -HLA-DRB3*0202/DRA, _{DG1 206-222} -HLA-DRB3*0202/DRA, _{DG1 363-377} -HLA-DRB3*0202/DRA , DG1 _3-17 -HLA-DRB4*0101/DRA, DG1 _192-206 -HLA-DRB4*0101/DRA, _{DG1 326-340} -HLA-DRB4*0101/DRA, DG1 _1-15 -HLA-DRB5*0101 /DRA, DG1 _35-49 -HLA-DRB5*0101/DRA or _{DG1 325-339} -HLA-DRB5*0101/DRA;

f) neuromyelitis of the optic nerve with spectral disorder, and the pMHC complex is selected from the group: AQP4 _129-143 -HLA-DRB1*0101/DRA, AQP4 _284-298 -HLA-DRB1*0301/DRA, AQP4 _63-76 -HLA-DRB1 *0301/DRA, AQP4 _129-143 -HLA-DRB1*0401/DRA or AQP4 _39-53 -HLA-DRB1*1501/DRA;

g) allergic asthma, and the pMHC complex is selected from the group: DERP-1 _16-30 -HLA-DRB1*0101/DRA, DERP-1 _16-30 -HLA-DRB1*1501/DRA, DERP _1171-185 - HLA-DRB1 *1501/DRA, DERP-1 _110-124 -HLA-DPB1*0401/DRA, DERP-2 _26-40 -HLA-DRB1*0101/DRA; DERP-2 _26-40 -HLA-DRB1*1501/DRA or DERP-2 _107-121 -HLA-DRB1*0301/DRA;

h) inflammatory bowel disease, and the pMHC complex is selected from the group: bacteroid integrase antigen_183-197- HLA-DRB3*0101/DRA, bacteroid integrase antigen_146-160- HLA-DRB3*0101/DRA, bacteroid integrase antigen_175-189- HLA-DRB3*0101/DRA, bacteroid integrase antigen_1-15- HLA-DRB5*0101/DRA, bacteroid integrase antigen_183-197- HLA-DRB5*0101/DRA, bacteroid integrase antigen_183-197-HLA-DRB3*0101/DRA, bacteroid integrase antigen_30-44- HLA-DRB5*0101/DRA, bacteroid integrase antigen_70-84- HLA-DRB4*0101/DRA, bacteroid integrase antigen_337-351- HLA-DRB4*0101/DRA, bacteroid integrase antigen_171-185- HLA-DRB4*0101/DRA, bacteroid integrase antigen_4-18-HLA-DRB3*0202/DRA, bacteroid integrase antigen_171-185-HLA-DRB3*0202/DRA, bacteroid integrase antigen_256-270-HLA-DRB3*0202/DRA, Fla-2/Fla-X_366-380- HLA-DRB3*0101/DRA, Fla-2/Fla-X_164-178- HLA-DRB3*0101/DRA, Fla-2/Fla-X_261-275- HLA-DRB5*0101/DRA, Fla-2/Fla-X_1-15- HLA-DRB5*0101/DRA, Fla-2/Fla-X_51-65- HLA-DRB4*0101/DRA, Fla-2/Fla-X_269-283- HLA-DRB4*0101/DRA, Fla-2/Fla-X_4-18-HLA-DRB3*0202/DRA, Fla-2/Fla-X_261-275-HLA-DRB3*0202/DRA, Fla-2/Fla-X_271-285-HLA-DRB3*0202/DRA, YIDX_78-92– HLA-DRB3*0101/DRA, YIDX_78-92- HLA-DRB4*0101/DRA, YIDX_93-107- HLA-DRB3*0101/DRA, YIDX_98-112- HLA-DRB5*0101/DRA, YIDX_23-37- HLA-DRB5*0101/DRA, YIDX_78-92- HLA-DRB4*0101/DRA, YIDX_195-209- HLA-DRB4*0101/DRA, YIDX_22-36-HLA-DRB3*0202/DRA, YIDX_80-94-HLA-DRB3*0202/DRA or YIDX_101-115-HLA-DRB3*0202/DRA;

i) COPD and/or emphysema and pMHC complex selected from the group: elastin _89-103 -HLA-DRB3*0101/DRA, elastin _698-712 -HLA-DRB5*0101/DRA, elastin _8-22 -HLA-DRB5* 0101/DRA, elastin _94-108 -HLA-DRB5*0101/DRA, elastin _13-27 -HLA-DRB4*0101/DRA, elastin _695-709 -HLA-DRB4*0101/DRA, elastin _563-577 -HLA- DRB4*0101/DRA, elastin _558-572 -HLA-DRB4*0101/DRA, elastin _698-712 -HLA-DRB5*0101/DRA, elastin _566-580 -HLA-DRB3*0202/DRA or elastin _645-659 - HLA-DRB3*0202/DRA;

j) psoriasis, and the pMHC complex is selected from the group: Cap18 _64-78 -HLA-DRB3*0101/DRA, Cap18 _34-48 -HLA-DRB3*0101/DRA, Cap18 _47-61 -HLA-DRB3*0101/DRA, Cap18 _151-165 -HLA -DRB4*0101/DRA, Cap18 _149-163 -HLA-DRB5*0101/DRA, Cap18 _152-166 -HLA-DRB5*0101/DRA, Cap18 _131-145 -HLA-DRB5*0101/ DRA, Cap _1824-38 -HLA-DRB3*0202/DRA, ADMTSL5 _245-259 -HLA-DRB3*0101/DRA, ADMTSL5 _267-281 -HLA-DRB3*0101/DRA, ADMTSL5 _372-386 -HLA-DRB3* 0101/DRA, ADMTSL5 _289-303 -HLA-DRB4*0101/DRA, ADMTSL5 _396-410 -HLA-DRB4*0101/DRA, ADMTSL5 _433-447 -HLA-DRB4*0101/DRA, ADMTSL5 _142-156 -HLA- DRB5*0101/DRA, ADMTSL5 _236-250 -HLA-DRB5*0101/DRA, ADMTSL5 _301-315 -HLA-DRB5*0101/DRA, ADMTSL5 _203-217 -HLA-DRB3*0202/DRA, ADMTSL5 _404-418 - HLA-DRB3*0202/DRA or ADMTSL5 _433-447 -HLA-DRB3*0202/DRA;

k) autoimmune hepatitis, and the pMHC complex is selected from the group: CYP2D6 _193-207 -HLA-DRB1*0301/DRA, CYP2D6 _76-90 -HLA-DRB1*0301/DRA, CYP2D6 _293-307 -HLA-DRB1*0301/DRA , CYP2D6 _313-332 -HLA-DRB1*0301/DRA, CYP2D6 _393-412 -HLA-DRB1*0301/DRA, CYP2D6 _199-213 -HLA-DRB1*0401/DRA, CYP2D6 _450-464 -HLA-DRB1*0401 /DRA, CYP2D6 _301-315 -HLA-DRB1*0401/DRA, CYP2D6 _452-466 -HLA-DRB1*0701/DRA, CYP2D6 _59-73 -HLA-DRB1*0701/DRA, CYP2D6 _130-144 -HLA-DRB1 *0701/DRA, CYP2D6 _193-212 -HLA-DRB1*0701/DRA, CYP2D6 _305-324 -HLA-DRB1*0701/DRA, CYP2D6 _131-145 -HLA-DRB3*0202/DRA, CYP2D6 _216-230 -HLA -DRB3*0202/DRA, CYP2D6 _238-252 -HLA-DRB3*0202/DRA, CYP2D6 _199-213 -HLA-DRB4*0101/DRA, CYP2D6 _235-252 -HLA-DRB4*0101/DRA, CYP2D6 _293-307 -HLA-DRB4*0101/DRA, CYP2D6 _238-252 -HLA-DRB5*0101/DRA, CYP2D6 _381-395 -HLA-DRB5*0101/DRA, CYP2D6 _429-443 -HLA-DRB5*0101/DRA, SLA _{334 -348} -HLA-DRB1*0301/DRA, SLA _196-210 -HLA-DRB1*0301/DRA, SLA _115-129 -HLA-DRB1*0301/DRA, SLA _373-386 -HLA-DRB1*0301/DRA, SLA _186-197 -HLA-DRB1*0301/DRA, SLA _317-331 -HLA-DRB1*0401/DRA, SLA _171-185 -HLA-DRB1*0401/DRA, SLA _417-431 -HLA-DRB1*0401/DRA, SLA _359-373 -HLA-DRB1*0701/DRA, SLA _{215 -229} -HLA-DRB1*0701/DRA, SLA _111-125 -HLA-DRB1*0701/DRA, SLA _110-124 -HLA-DRB3*0202/DRA, SLA _299-313 -HLA-DRB3*0202/DRA, SLA _342-356 -HLA-DRB3*0202/DRA, SLA _49-63 -HLA-DRB4*0101/DRA, SLA _119-133 -HLA-DRB4*0101/DRA, SLA _260-274 -HLA-DRB4*0101/ DRA, SLA _26-40 -HLA-DRB5*0101/DRA, SLA _86-100 -HLA-DRB5*0101/DRA or SLA _331-345 -HLA-DRB5*0101/DRA;

l) uveitis, and the pMHC complex is selected from the group: arrestin _199-213 -HLA-DRB3*0101/DRA, arrestin _77-91 -HLA-DRB3*0101/DRA, arrestin _250-264 -HLA-DRB3*0101/DRA, arrestin _172-186 -HLA-DRB4*0101/DRA, arrestin _354-368 -HLA-DRB4*0101/DRA, arrestin _239-253 -HLA-DRB4*0101/DRA, arrestin _102-116 -HLA-DRB5*0101/ DRA, arrestin _59-73 -HLA-DRB5*0101, arrestin _280-294 -HLA-DRB5*0101, arrestin _291-306 -HLA-DRB1*0301/DRA, arrestin _195-209 -HLA-DRB3*0202/DRA, arrestin _199-213 -HLA-DRB3*0202/DRA or arrestin _200-214 -HLA-DRB3*0202/DRA;

m) Sjögren's syndrome, and the pMHC complex is selected from the group: RO60_127-141-HLA-DRB1*0301/DRA, RO60_523-537-HLA-DRB1*0301/DRA, RO60_243-257-HLA-DRB1*0301/DRA, RO60_484-498-HLA-DRB3*0101/DRA, RO60_347-361-HLA-DRB3*0101/DRA, RO60_369-383-HLA-DRB3*0101/DRA, RO60_426-440-HLA-DRB4*0101/DRA, RO60_267-281-HLA-DRB4*0101/DRA, RO60_178-192-HLA-DRB4*0101/DRA, RO60_358-372-HLA-DRB5*0101/DRA, RO60_358-372-HLA-DRB4*0101/DRA, RO60_221-235-HLA-DRB5*0101/DRA, RO60_221-235-HLA-DRB4*0101/DRA, RO60_318-332-HLA-DRB5*0101/DRA, RO60_318-332-HLA-DRB4*0101/DRA, RO60_407-421-HLA-DRB4*0101/DRA, RO60_407-421-HLA-DQA1*0501/HLA-DQB1*0201, RO60_459-473-HLA-DRB4*0101/DRA, RO60_459-473-HLA-DQA1*0501/HLA-DQB1*0201, RO60_318-332-HLA-DQA1*0501/HLA-DQB1*0201, RO60_51-65-HLA-DRB3*0202/DRA, RO60_312-326-HLA-DRB3*0202/DRA, RO60_347-361-HLA-DRB3*0202/DRA, LA_241-255-HLA-DRB1*0301/DRA, LA_101-115-HLA-DRB1*0301/DRA, LA_153-167-HLA-DRB1*0301/DRA, LA_178-192-HLA-DRB3*0101/DRA, LA_19-33-HLA-DRB3*0101/DRA, LA_37-51-HLA-DRB3*0101/DRA, LA_133-147-HLA-DRB4*0101/DRA, LA_50-64-HLA-DRB4*0101/DRA, LA_32-46-HLA-DRB4*0101/DRA, LA_153-167-HLA-DRB5*0101/DRA, LA_83-97-HLA-DRB5*0101/DRA, LA_136-150-HLA-DRB5*0101/DRA, LA_297-311-HLA-DQA1*0501/HLA-DQB1*0201, LA_59-73-HLA-DQA1*0501/HLA-DQB1*0201, LA_59-73-HLA-DRB4*0101/DRA, LA_151-165-HLA-DQA1*0501/HLA-DQB1*0201, LA_151-165-HLA-DRB4*0101/DRA, LA_297-311-HLA-DRB4*0101/DRA, LA_50-64-HLA-DRB3*0202/DRA, LA_86-100-HLA-DRB3*0202/DRA or LA_154-168-HLA-DRB3*0202/DRA;

n) scleroderma, and the pMHC complex is selected from the group: TOP1 _346-360 -HLA-DRB3*0101/DRA, TOP1 _420-434 -HLA-DRB3*0101/DRA, TOP1 _750-764 -HLA-DRB3*0101/DRA, TOP1 _419-433 -HLA-DRB4*0101/DRA, TOP1 _591-605 -HLA-DRB4*0101/DRA, TOP1 _695-709 -HLA-DRB4*0101/DRA, TOP1 _305-319 -HLA-DRB5*0101/ DRA, TOP1 _346-360 -HLA-DRB5*0101/DRA, TOP1 _419-433 -HLA-DRB5*0101/DRA, TOP1 _420-434 -HLA-DRB3*0202/DRA, TOP1 _425-439 -HLA-DRB3* 0202/DRA, TOP1 _614-628 -HLA-DRB3*0202/DRA, CENP-C _297-311 -HLA-DRB3*0101/DRA, CENP-C _857-871 -HLA-DRB3*0101/DRA, CENP-C _887-901 -HLA-DRB3*0101/DRA, CENP-C _212-226 -HLA-DRB4*0101/DRA, CENP-C _643-657 -HLA-DRB4*0101/DRA, CENP-C _832-846 -HLA -DRB4*0101/DRA, CENP-C _167-181 -HLA-DRB5*0101/DRA, CENP-C _246-260 -HLA-DRB5*0101/DRA, CENP-C _846-860 -HLA-DRB5*0101/ DRA, CENP-C _149-163 -HLA-DRB3*0202/DRA, CENP-C _833-847 -HLA-DRB3*0202/DRA or CENP-C _847-861 -HLA-DRB3*0202/DRA;

o) antiphospholipid syndrome, and the pMHC complex is selected from the group: APOH _235-249 -HLA-DRB3*0101/DRA, APOH _306-320 -HLA-DRB3*0101/DRA, APOH _237-251 -HLA-DRB3*0101/DRA _{APOH 295-309} -HLA-DRB3*0101/DRA, APOH _{28-42 -HLA} -DRB4*0101/DRA /DRA, APOH _295-309 -HLA-DRB4*0101/DRA, APOH _49-63 -HLA-DRB5*0101/DRA, APOH _269-283 -HLA-DRB5*0101/DRA, APOH _295-309 -HLA-DRB5 *0101/DRA, APOH _321-355 -HLA-DRB3*0202/DRA, APOH _322-336 -HLA-DRB3*0202/DRA or APOH _324-338 -HLA-DRB3*0202/DRA;

p) ANCA-associated vasculitis, and the pMHC complex is selected from the group: MPO _506-520 -HLA-DRB3*0101/DRA, MPO _302-316 -HLA-DRB3*0101/DRA, MPO _7-21 -HLA-DRB3*0101 /DRA, MPO _689-703 -HLA-DRB4*0101/DRA, MPO _248-262 -HLA-DRB4*0101/DRA, MPO _444-458 -HLA-DRB4*0101/DRA, MPO _513-527 -HLA-DRB5 *0101/DRA, MPO _97-111 -HLA-DRB5*0101/DRA, MPO _616-630 -HLA-DRB5*0101/DRA, MPO _462-476 -HLA-DRB3*0202/DRA, MPO _617-631 -HLA -DRB3*0202/DRA, MPO _714-728 -HLA-DRB3*0202/DRA, PRTN3 _44-58 -HLA-DRB3*0101/DRA, PRTN3 _234-248 -HLA-DRB3*0101/DRA, PRTN3 _59-73 -HLA DRB3*0101/DRA, PRTN3 _59-73 -HLA-DRB5*0101/DRA, PRTN3 _117-131 -HLA-DRB4*0101/DRA, PRTN3 _164-178 -HLA-DRB4*0101/DRA, PRTN3 _{71- 85} -HLA-DRB4*0101/DRA, PRTN3 _241-255 -HLA-DRB5*0101/DRA, PRTN3 _183-197 -HLA-DRB5*0101/DRA, PRTN3 _62-76 -HLA-DRB3*0202/DRA, PRTN3 _118-132 -HLA-DRB3*0202/DRA or PRTN3 _239-253 -HLA-DRB3*0202/DRA, or

q) stiffness syndrome, and the pMHC complex is selected from the group: GAD _212-226 -HLA-DRB1*0801/DRA, GAD _555-569 -HLA-DRB1*0801/DRA or GAD _297-311 -HLA-DRB1*0301/ DRA.

[0178] In some aspects, the pMHC complex is for the treatment of:

a) type I diabetes mellitus, and the pMHC complex is selected from the group: PPI _76-90(K88S) -HLA-DRB1*0401/DRA, IGRP _13-25 -HLA-DRB1*0301/DRA, GAD _555-567 -HLA- DRB1*0401/DRA, GAD _{555-567(557I)} -HLA-DRB1*0401/DRA, IGRP _23-35 -HLA-DRB1*0401/DRA or PPI _76-90 -HLA-DRB1*0401/DRA;

b) multiple sclerosis, and the pMHC complex is selected from the group: MBP _86-98 -HLA-DRB1*1501/DRA, MBP _89-101 -HLA-DRB5*0101/DRA, MOG _38-52 -HLA-DRB4*0101/DRA , MOG _{97-109(E107S)} -HLA-DRB1*0401/DRA, MOG _203-217 -HLA-DRB3*0101/DRA, PLP _54-68 -HLA-DRB3*0101/DRA, PLP _94-108 -HLA- DRB1*0301/DRA, PLP _250-264 -HLA-DRB4*0101/DRA, MPB _13-32 -HLA-DRB5*0101/DRA, MPB _83-99 -HLA-DRB5*0101/DRA, MPB _111-129 - HLA-DRB5*0101/DRA, MPB _146-170 -HLA-DRB5*0101/DRA, MOG _223-237 -HLA-DRB3*0202/DRA, MOG _6-20 -HLA-DRB5*0101/DRA, PLP _{88- 102} -HLA-DRB3*0202/DRA or PLP _139-154 -HLA-DRB5*0101/DRA;

c) celiac disease, and the pMHC complex is selected from the group: aGlia _57-68 - HLA-DQA1*0501/HLA-DQB1*0201, aGlia _62-72 - HLA-DQA1*0501/HLA-DQB1*0201 or aGlia _217-229 - HLA-DQA1*0501/HLA-DQB1*0302;

d) primary biliary cirrhosis, and the pMHC complex is selected from the group: PDC-E2 _122-135 -HLA-DRB4*0101/DRA, PDC-E2 _249-262 -HLA-DRB4*0101/DRA, PDC-E2 _249-263 - HLA-DRB1*0801/DRA, PDC-E2 _629-643 -HLA-DRB1*0801/DRA, PDC-E2 _72-86 -HLA-DRB3*0202/DRA, PDC-E2 _353-367 -HLA-DRB3*0202 /DRA, PDC-E2 _422-436 -HLA-DRB3*0202/DRA, PDC-E2 _629-643 -HLA-DRB4*0101/DRA, PDC-E2 _80-94 -HLA-DRB5*0101/DRA, PDC- E2 _353-367 -HLA-DRB5*0101/DRA or PDC-E2 _535-549 -HLA-DRB5*0101/DRA;

e) Pemphigus foliaceus and/or Pemphigus vulgaris and the pMHC complex is selected from the group: _{DG1 216-229} -HLA-DRB1*0101/DRA, DG3 _97-111 -HLA-DRB1*0402/DRA, DG3 _251-265 -HLA- DRB1*0401/DRA, DG3 _441-455 -HLA-DRB1*0402/DRA, DG3 _351-365 -HLA-DRB3*0202/DRA, DG3 _453-467 -HLA-DRB3*0202/DRA, DG3 _540-554 - HLA-DRB3*0202/DRA, DG3 _280-294 -HLA-DRB4*0101/DRA, DG3 _326-340 -HLA-DRB4*0101/DRA, DG3 _367-381 -HLA-DRB4*0101/DRA, DG3 _{13- 27} -HLA-DRB5*0101/DRA, DG3 _323-337 -HLA-DRB5*0101/DRA, DG3 _438-452 -HLA-DRB5*0101/DRA, _{DG1 48-62} -HLA-DRB3*0202/DRA, DG1 _206-222 -HLA-DRB3*0202/DRA, _{DG1 363-377} -HLA-DRB3*0202/DRA, DG1 _3-17 -HLA-DRB4*0101/DRA, DG1 _192-206 -HLA-DRB4*0101/DRA , _{DG1 326-340} -HLA-DRB4*0101/DRA, DG1 _1-15 -HLA-DRB5*0101/DRA, DG1 _35-49 -HLA-DRB5*0101/DRA or _{DG1 325-339} -HLA-DRB5*0101 /DRA;

f) neuromyelitis of the optic nerve with spectral disorder, and the pMHC complex is selected from the group: AQP4 _284-298 -HLA-DRB1*0301/DRA, AQP4 _63-76 -HLA-DRB1*0301/DRA, AQP4 _129-143 -HLA-DRB1 *0401/DRA or AQP4 _39-53 -HLA-DRB1*1501/DRA;

g) allergic asthma, and the pMHC complex is selected from the group: DERP-1 _16-30 -HLA-DRB1*0101/DRA, DERP-1 _16-30 -HLA-DRB1*1501/DRA, DERP _1171-185 - HLA-DRB1 *1501/DRA, DERP-1 _110-124 -HLA-DPB1*0401/DRA, DERP-2 _26-40 -HLA-DRB1*0101/DRA; DERP-2 _26-40 -HLA-DRB1*1501/DRA or DERP-2 _107-121 -HLA-DRB1*0301/DRA;

h) inflammatory bowel disease, and the pMHC complex is selected from the group: bacteroid integrase antigen_1-15- HLA-DRB5*0101/DRA, bacteroid integrase antigen_183-197-HLA-DRB3*0101/DRA, bacteroid integrase antigen_70-84- HLA-DRB4*0101/DRA, bacteroid integrase antigen_4-18-HLA-DRB3*0202/DRA, bacteroid integrase antigen_171-185-HLA-DRB3*0202/DRA, bacteroid integrase antigen_256-270-HLA-DRB3*0202/DRA, Fla-2/Fla-X_366-380- HLA-DRB3*0101/DRA, Fla-2/Fla-X_261-275- HLA-DRB5*0101/DRA, Fla-2/Fla-X_51-65- HLA-DRB4*0101/DRA, Fla-2/Fla-X_4-18-HLA-DRB3*0202/DRA, Fla-2/Fla-X_261-275-HLA-DRB3*0202/DRA, Fla-2/Fla-X_271-285-HLA-DRB3*0202/DRA, YIDX_78-92-HLA-DRB3*0101/DRA, YIDX_78-92- HLA-DRB4*0101/DRA, YIDX_98-112- HLA-DRB5*0101/DRA, YIDX_22-36-HLA-DRB3*0202/DRA, YIDX_80-94-HLA-DRB3*0202/DRA or YIDX_101-115-HLA-DRB3*0202/DRA;

i) emphysema, and the pMHC complex is selected from the group: elastin _89-103 -HLA-DRB3*0101/DRA, elastin _698-712 -HLA-DRB5*0101/DRA, elastin _558-572 -HLA-DRB4*0101/DRA, elastin _566-580 -HLA-DRB3*0202/DRA or elastin _645-659 -HLA-DRB3*0202/DRA;

j) psoriasis, and the pMHC complex is selected from the group: Cap18 _64-78 -HLA-DRB3*0101/DRA, Cap18 _34-48 -HLA-DRB3*0101/DRA, Cap18 _47-61 -HLA-DRB3*0101/DRA, Cap18 _151-165 -HLA -DRB4*0101/DRA, Cap18 _149-163 -HLA-DRB5*0101/DRA, Cap18 _152-166 -HLA-DRB5*0101/DRA, Cap18 _131-145 -HLA-DRB5*0101/ DRA, Cap _1824-38 -HLA-DRB3*0202/DRA, ADMTSL5 _245-259 -HLA-DRB3*0101/DRA, ADMTSL5 _267-281 -HLA-DRB3*0101/DRA, ADMTSL5 _372-386 -HLA-DRB3* 0101/DRA, ADMTSL5 _289-303 -HLA-DRB4*0101/DRA, ADMTSL5 _396-410 -HLA-DRB4*0101/DRA, ADMTSL5 _433-447 -HLA-DRB4*0101/DRA, ADMTSL5 _142-156 -HLA- DRB5*0101/DRA, ADMTSL5 _236-250 -HLA-DRB5*0101/DRA, ADMTSL5 _301-315 -HLA-DRB5*0101/DRA, ADMTSL5 _203-217 -HLA-DRB3*0202/DRA, ADMTSL5 _404-418 - HLA-DRB3*0202/DRA or ADMTSL5 _433-447 -HLA-DRB3*0202/DRA;

k) autoimmune hepatitis, and the pMHC complex is selected from the group: CYP2D6 _193-207 -HLA-DRB1*0301/DRA, CYP2D6 _76-90 -HLA-DRB1*0301/DRA, CYP2D6 _293-307 -HLA-DRB1*0301/DRA , CYP2D6 _313-332 -HLA-DRB1*0301/DRA, CYP2D6 _393-412 -HLA-DRB1*0301/DRA, CYP2D6 _199-213 -HLA-DRB1*0401/DRA, CYP2D6 _450-464 -HLA-DRB1*0401 /DRA, CYP2D6 _301-315 -HLA-DRB1*0401/DRA, CYP2D6 _452-466 -HLA-DRB1*0701/DRA, CYP2D6 _59-73 -HLA-DRB1*0701/DRA, CYP2D6 _130-144 -HLA-DRB1 *0701/DRA, CYP2D6 _193-212 -HLA-DRB1*0701/DRA, CYP2D6 _305-324 -HLA-DRB1*0701/DRA, CYP2D6 _131-145 -HLA-DRB3*0202/DRA, CYP2D6 _216-230 -HLA -DRB3*0202/DRA, CYP2D6 _238-252 -HLA-DRB3*0202/DRA, CYP2D6 _199-213 -HLA-DRB4*0101/DRA, CYP2D6 _235-252 -HLA-DRB4*0101/DRA, CYP2D6 _293-307 -HLA-DRB4*0101/DRA, CYP2D6 _238-252 -HLA-DRB5*0101/DRA, CYP2D6 _381-395 -HLA-DRB5*0101/DRA, CYP2D6 _429-443 -HLA-DRB5*0101/DRA, SLA _{334 -348} -HLA-DRB1*0301/DRA, SLA _196-210 -HLA-DRB1*0301/DRA, SLA _115-129 -HLA-DRB1*0301/DRA, SLA _373-386 -HLA-DRB1*0301/DRA, SLA _186-197 -HLA-DRB1*0301/DRA, SLA _317-331 -HLA-DRB1*0401/DRA, SLA _171-185 -HLA-DRB1*0401/DRA, SLA _417-431 -HLA-DRB1*0401/DRA, SLA _359-373 -HLA-DRB1*0701/DRA, SLA _{215 -229} -HLA-DRB1*0701/DRA, SLA _111-125 -HLA-DRB1*0701/DRA, SLA _110-124 -HLA-DRB3*0202/DRA, SLA _299-313 -HLA-DRB3*0202/DRA, SLA _342-356 -HLA-DRB3*0202/DRA, SLA _49-63 -HLA-DRB4*0101/DRA, SLA _119-133 -HLA-DRB4*0101/DRA, SLA _260-274 -HLA-DRB4*0101/ DRA, SLA _26-40 -HLA-DRB5*0101/DRA, SLA _86-100 -HLA-DRB5*0101/DRA or SLA _331-345 -HLA-DRB5*0101/DRA;

l) uveitis, and the pMHC complex is selected from the group: arrestin _199-213 -HLA-DRB3*0101/DRA, arrestin _77-91 -HLA-DRB3*0101/DRA, arrestin _250-264 -HLA-DRB3*0101/DRA, arrestin _172-186 -HLA-DRB4*0101/DRA, arrestin _354-368 -HLA-DRB4*0101/DRA, arrestin _239-253 -HLA-DRB4*0101/DRA, arrestin _102-116 -HLA-DRB5*0101/ DRA, arrestin _59-73 -HLA-DRB5*0101, arrestin _280-294 -HLA-DRB5*0101, arrestin _291-306 -HLA-DRB1*0301/DRA, arrestin _195-209 -HLA-DRB3*0202/DRA, arrestin _199-213 -HLA-DRB3*0202/DRA or arrestin _200-214 -HLA-DRB3*0202/DRA;

m) Sjögren's syndrome, and the pMHC complex is selected from the group: RO60_127-141-HLA-DRB1*0301/DRA, RO60_523-537-HLA-DRB1*0301/DRA, RO60_243-257-HLA-DRB1*0301/DRA, RO60_484-498-HLA-DRB3*0101/DRA, RO60_347-361-HLA-DRB3*0101/DRA, RO60_369-383-HLA-DRB3*0101/DRA, RO60_426-440-HLA-DRB4*0101/DRA, RO60_267-281-HLA-DRB4*0101/DRA, RO60_178-192-HLA-DRB4*0101/DRA, RO60_358-372-HLA-DRB5*0101/DRA, RO60_221-235-HLA-DRB5*0101/DRA, RO60_318-332-HLA-DRB5*0101/DRA, RO60_51-65-HLA-DRB3*0202/DRA, RO60_312-326-HLA-DRB3*0202/DRA, RO60_347-361-HLA-DRB3*0202/DRA, LA_241-255-HLA-DRB1*0301/DRA, LA_101-115-HLA-DRB1*0301/DRA, LA_153-167-HLA-DRB1*0301/DRA, LA_178-192-HLA-DRB3*0101/DRA, LA_19-33-HLA-DRB3*0101/DRA, LA_37-51-HLA-DRB3*0101/DRA, LA_133-147-HLA-DRB4*0101/DRA, LA_50-64-HLA-DRB4*0101/DRA, LA_32-46-HLA-DRB4*0101/DRA, LA_153-167-HLA-DRB5*0101/DRA, LA_83-97-HLA-DRB5*0101/DRA, LA_136-150-HLA-DRB5*0101/DRA, LA_50-64-HLA-DRB3*0202/DRA, LA_86-100-HLA-DRB3*0202/DRA or LA_154-168-HLA-DRB3*0202/DRA;

n) scleroderma, and the pMHC complex is selected from the group: TOP1 _346-360 -HLA-DRB3*0101/DRA, TOP1 _420-434 -HLA-DRB3*0101/DRA, TOP1 _750-764 -HLA-DRB3*0101/DRA, TOP1 _419-433 -HLA-DRB4*0101/DRA, TOP1 _591-605 -HLA-DRB4*0101/DRA, TOP1 _695-709 -HLA-DRB4*0101/DRA, TOP1 _305-319 -HLA-DRB5*0101/ DRA, TOP1 _346-360 -HLA-DRB5*0101/DRA, TOP1 _419-433 -HLA-DRB5*0101/DRA, TOP1 _420-434 -HLA-DRB3*0202/DRA, TOP1 _425-439 -HLA-DRB3* 0202/DRA, TOP1 _614-628 -HLA-DRB3*0202/DRA, CENP-C _297-311 -HLA-DRB3*0101/DRA, CENP-C _857-871 -HLA-DRB3*0101, CENP-C _{887- 901} -HLA-DRB3*0101, CENP-C _212-226 -HLA-DRB4*0101/DRA, CENP-C _643-657 -HLA-DRB4*0101/DRA, CENP-C _832-846 -HLA-DRB4*0101 /DRA, CENP-C _167-181 -HLA-DRB5*0101/DRA, CENP-C _246-260 -HLA-DRB5*0101/DRA, CENP-C _846-860 -HLA-DRB5*0101/DRA, CENP- C _149-163 -HLA-DRB3*0202/DRA, CENP-C _833-847 -HLA-DRB3*0202/DRA or CENP-C _847-861 -HLA-DRB3*0202/DRA;

o) antiphospholipid syndrome, and the pMHC complex is selected from the group: APOH _235-249 -HLA-DRB3*0101/DRA, APOH _306-320 -HLA-DRB3*0101/DRA, APOH _237-251 -HLA-DRB3*0101/DRA _{APOH 295-309} -HLA-DRB3*0101/DRA, APOH _{28-42 -HLA} -DRB4*0101/DRA /DRA, APOH _295-309 -HLA-DRB4*0101/DRA, APOH _49-63 -HLA-DRB5*0101/DRA, APOH _269-283 -HLA-DRB5*0101/DRA, APOH _295-309 -HLA-DRB5 *0101/DRA, APOH _321-355 -HLA-DRB3*0202/DRA, APOH _322-336 -HLA-DRB3*0202/DRA or APOH _324-338 -HLA-DRB3*0202/DRA;

p) ANCA-associated vasculitis, and the pMHC complex is selected from the group: MPO _506-520 -HLA-DRB3*0101/DRA, MPO _302-316 -HLA-DRB3*0101/DRA, MPO _7-21 -HLA-DRB3*0101 /DRA, MPO _689-703 -HLA-DRB4*0101/DRA, MPO _248-262 -HLA-DRB4*0101/DRA, MPO _444-458 -HLA-DRB4*0101/DRA, MPO _513-527 -HLA-DRB5 *0101/DRA, MPO _97-111 -HLA-DRB5*0101/DRA, MPO _616-630 -HLA-DRB5*0101/DRA, MPO _462-476 -HLA-DRB3*0202/DRA, MPO _617-631 -HLA -DRB3*0202/DRA, MPO _714-728 -HLA-DRB3*0202/DRA, PRTN3 _44-58 -HLA-DRB3*0101/DRA, PRTN3 _234-248 -HLA-DRB3*0101/DRA, PRTN3 _59-73 -HLA DRB3*0101/DRA, PRTN3 _59-73 -HLA-DRB5*0101/DRA, PRTN3 _117-131 -HLA-DRB4*0101/DRA, PRTN3 _164-178 -HLA-DRB4*0101/DRA, PRTN3 _{71- 85} -HLA-DRB4*0101/DRA, PRTN3 _241-255 -HLA-DRB5*0101/DRA, PRTN3 _183-197 -HLA-DRB5*0101/DRA, PRTN3 _62-76 -HLA-DRB3*0202/DRA, PRTN3 _118-132 -HLA-DRB3*0202/DRA or PRTN3 _239-253 -HLA-DRB3*0202/DRA or

q) stiffness syndrome, and the pMHC complex is selected from the group: GAD _212-226 -HLA-DRB1*0801/DRA, GAD _555-569 -HLA-DRB1*0801/DRA, or GAD _297-311 -HLA-DRB1*0301 /DRA.

[0179] The choice of co-stimulatory molecule or molecules to be associated with the pMHC/NP complex can also be optimized in a similar manner and will largely depend on the nature of the immune cell population in need of differentiation or expansion. For example, if the goal is to increase or differentiate populations of T regulatory cells, appropriate combinations may include, but are not limited to, costimulatory molecules and cytokines such as IL15-IL15Ra, IL-2, IL-10, IL-35, ICOS- L, IL2 complex/anti-IL2 monoclonal antibody, TGF-beta, IL-21, ITE, or ICOSL. On the contrary, according to certain variants of implementation, such as in certain types of cancer, the increase in the number and/or differentiation of the T-regulatory phenotype may not be the desired response. Thus, alternative co-stimulatory molecules and cytokines will be optimized for a particular treatment.

Polypeptides

[0180] In another aspect, provided herein are polypeptides comprising an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and at least one engineered ridge. In some embodiments, the α1 MHC class II domain and the α2 MHC class II domain are derived from a leukocyte antigen (HLA) molecule, such as HLA-DR, HLA-DQ, or HLA-DP. In some embodiments, the α1 MHC class II domain and the α2 MHC class II domain are derived from DRA, DQA1, or DPA1. In some embodiments, the α1 MHC class II domain or the α2 MHC class II domain is derived from DRA, DQA1, or DPA1.

[0181] In another aspect, provided herein are polypeptides comprising an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and at least one engineered ridge. In some embodiments, the MHC class II β1 domain and class II MHC β2 domain are derived from a leukocyte antigen (HLA) molecule, such as HLA-DR, HLA-DQ, or HLA-DP. In some embodiments, the MHC class II β1 domain and class II β2 MHC are derived from HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQB1, or HLA-DPB1. In some embodiments, the MHC class II β1 or class II β2 MHC domain is derived from HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQB1, or HLA-DPB1.

[0182] In another aspect, provided herein are polypeptides comprising an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and at least one engineered cavity.

[0183] In another aspect, provided herein are polypeptides comprising an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and at least one engineered cavity.

[0184] In another aspect, provided herein are polypeptides comprising an MHC class II α1 domain and an MHC class II α2 domain and at least one engineered ridge.

[0185] In another aspect, provided herein are polypeptides comprising an MHC class II β1 domain and an MHC class II β2 domain and at least one engineered ridge.

[0186] In another aspect, provided herein are polypeptides comprising an MHC class II α1 domain and an MHC class II α2 domain and at least one engineered cavity.

[0187] In another aspect, provided herein are polypeptides comprising an MHC class II β1 domain and an MHC class II β2 domain and at least one engineered cavity.

[0188] In some embodiments, the polypeptide further comprises a C-terminal cysteine residue. In some embodiments, the polypeptide further comprises a biotinylation site. In some embodiments, the polypeptide further comprises a Strep tag.

[0189] In some embodiments, a polypeptide provided herein is encoded by a DNA sequence comprising any of SEQ ID NO: 1-26, 64, or 65. In some embodiments, a polypeptide is encoded by a DNA sequence comprising SEQ ID NO: 1. In some embodiments, In some embodiments, the polypeptide is encoded by a DNA sequence containing SEQ ID NO: 2. In some embodiments, the polypeptide is encoded by a DNA sequence containing SEQ ID NO: 3. In some embodiments, the polypeptide is encoded by a DNA sequence containing SEQ ID NO: 4. In some embodiments, the polypeptide is encoded by a DNA sequence containing SEQ ID NO: 25. In some embodiments, the polypeptide is encoded by a DNA sequence containing SEQ ID NO: 26.

[0190] In some embodiments, a polypeptide provided herein is encoded by any of SEQ ID NOs: 1-8. In some embodiments, the polypeptide is encoded by SEQ ID NO: 1. In some embodiments, the polypeptide is encoded by SEQ ID NO: 2. In some embodiments, the polypeptide is encoded by SEQ ID NO: 3. In some embodiments, the polypeptide is encoded by SEQ ID NO: 4. In some embodiments, the polypeptide is encoded by SEQ ID NO: 4. embodiments provided herein, the polypeptide is encoded by any of SEQ ID NOS: 5-6. In some embodiments, a polypeptide provided herein is encoded by any of SEQ ID NOs: 5-8.

[0191] In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 80% identity to any of SEQ ID NOs: 1-26, 64, or 65. This includes an identity of at least 81, 82, 83 , 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% relative to any of SEQ ID NOs: 1-8. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96 , 97, 98, or 99% with respect to any of SEQ ID NOs: 1-26, 64, or 65. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with an identity of at least 80, 81, 82, 83, 84 , 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% of SEQ ID NO: 1. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% with respect to SEQ ID NO: 2. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with an identity of at least 80, 81, 82, 83, 8 4, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% of SEQ ID NO: 3. In some embodiments, the polypeptide is encoded by a DNA sequence, containing a DNA sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% with respect to to SEQ ID NO: 4. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93%, 94%, 95%, 96%, 97%, 98%, or 99% relative to any of SEQ ID NOs: 5-6. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96 , 97, 98 or 99% with respect to any of SEQ ID NOs: 5-8.

[0192] In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 85% identity to any of SEQ ID NOs: 1-26, 64, or 65. In some embodiments, the polypeptide is encoded by a DNA sequence containing the sequence DNA with at least 85% identity with respect to SEQ ID NO: 1. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 85% identity with respect to SEQ ID NO: 2. In some embodiments, the polypeptide encoded by a DNA sequence containing a DNA sequence with at least 85% identity with respect to SEQ ID NO: 3. In some embodiments, the polypeptide is encoded with a DNA sequence containing a DNA sequence with at least 85% identity with respect to SEQ ID NO: 4 .According to some variants there implementation, the polypeptide is encoded by a DNA sequence containing a DNA sequence with an identity of at least 85% with respect to any of SEQ ID NO: 5-6. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 85% identity to any of SEQ ID NOs: 5-8.

[0193] In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 90% identity to any of SEQ ID NOs: 1-26, 64, or 65. In some embodiments, the polypeptide is encoded by a DNA sequence containing the sequence DNA with at least 90% identity with respect to SEQ ID NO: 1. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 90% identity with respect to SEQ ID NO: 2. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 90% identity with respect to SEQ ID NO: 3. In some embodiments, the polypeptide is encoded with a DNA sequence containing a DNA sequence with at least 90% identity with respect to SEQ ID NO: 4 .According to some variants there implementation, the polypeptide is encoded by a DNA sequence containing a DNA sequence with an identity of at least 90% with respect to any of SEQ ID NO: 5-6. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 90% identity to any of SEQ ID NOs: 5-8.

[0194] In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 95% identity to any of SEQ ID NOs: 1-26, 64, or 65. In some embodiments, the polypeptide is encoded by a DNA sequence containing the sequence DNA with at least 95% identity to SEQ ID NO: 1. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 95% identity to SEQ ID NO: 2. In some embodiments, the polypeptide encoded by a DNA sequence containing a DNA sequence with at least 95% identity with respect to SEQ ID NO: 3. In some embodiments, the implementation of the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 95% identity with respect to SEQ ID NO: 4 .According to some variants there implementation, the polypeptide is encoded by a DNA sequence containing a DNA sequence with an identity of at least 95% with respect to any of SEQ ID NO: 5-6. In some embodiments, the polypeptide is encoded by a DNA sequence containing a DNA sequence with at least 95% identity to any of SEQ ID NOs: 5-8.

[0195] In some embodiments, a polypeptide provided herein is a polypeptide comprising the amino acid sequence of any of SEQ ID NOs: 27-63, or a fragment thereof. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 35-50 or a fragment thereof. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 51 or a fragment thereof. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 52 or a fragment thereof. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 53 or a fragment thereof. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 54 or a fragment thereof. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NOs: 55-59 or a fragment thereof. As used herein, a "fragment" of an amino acid sequence or polypeptide contains at least 5 amino acids. In some embodiments, the fragment comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof. In some embodiments, the fragment comprises an α1 MHC class II domain, an α2 MHC class II domain, an engineered ridge as described herein, or any combination thereof. In some embodiments, the fragment comprises an MHC class II α1 domain, a class II MHC α2 domain, an engineered cavity as described herein, or any combination thereof. In some embodiments, the fragment comprises an MHC class II β1 domain, an MHC class II β2 domain, an engineered ridge as described herein, or any combination thereof. In some embodiments, the fragment comprises an MHC class II β1 domain, an MHC class II β2 domain, an engineered cavity as described herein, or any combination thereof.

[0196] In some embodiments, the fragment comprises an α1 MHC class II domain, an α2 MHC class II domain, and an engineered ridge as described herein. In some embodiments, the fragment comprises an α1 MHC class II domain, an α2 MHC class II domain, and the engineered cavity described herein. In some embodiments, the fragment comprises an MHC class II β1 domain, a class II MHC β2 domain, and an engineered ridge as described herein. In some embodiments, the fragment comprises an MHC class II β1 domain, an MHC class II β2 domain, and an engineered cavity as described herein.

[0197] In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 80% identity with the amino acid sequence of any of SEQ ID NOs: 27-63 or a fragment thereof. This includes at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identity with respect to any from SEQ ID NO: 27-63. In some embodiments, the polypeptide comprises an amino acid sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% with respect to the amino acid sequence of any of SEQ ID NOs: 35-50 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% with respect to the amino acid sequence of SEQ ID NO: 51 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% relative to the amino acid sequence of SEQ ID NO: 52 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% relative to the amino acid sequence of SEQ ID NO: 53 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% relative to the amino acid sequence of SEQ ID NO: 54 or a fragment thereof. In some embodiments, a polypeptide provided herein comprises an amino acid sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96 , 97, 98 or 99% relative to the amino acid sequence of any of SEQ ID NOs: 55-59 or a fragment thereof.

[0198] In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 85% identity with respect to the amino acid sequence of any of SEQ ID NOs: 27-63, or a fragment thereof. In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 85% identity with respect to the amino acid sequence of any of SEQ ID NOs: 35-50, or a fragment thereof. In some embodiments, the polypeptide contains an amino acid sequence with at least 85% identity with respect to the amino acid sequence of SEQ ID NO: 51 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with at least 85% identity to the amino acid sequence of SEQ ID NO: 52 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with at least 85% identity to the amino acid sequence of SEQ ID NO: 53 or a fragment thereof. In some embodiments, the polypeptide contains an amino acid sequence with at least 85% identity with respect to the amino acid sequence of SEQ ID NO: 54 or a fragment thereof. In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 85% identity with the amino acid sequence of any of SEQ ID NOs: 55-59, or a fragment thereof.

[0199] In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 90% identity with the amino acid sequence of any of SEQ ID NOs: 27-63 or a fragment thereof. In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 90% identity with respect to the amino acid sequence of any of SEQ ID NOs: 35-50, or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with at least 90% identity to the amino acid sequence of SEQ ID NO: 51 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with at least 90% identity to the amino acid sequence of SEQ ID NO: 52 or a fragment thereof. In some embodiments, the polypeptide contains an amino acid sequence with at least 90% identity with respect to the amino acid sequence of SEQ ID NO: 53 or a fragment thereof. In some embodiments, the polypeptide contains an amino acid sequence with at least 90% identity with respect to the amino acid sequence of SEQ ID NO: 54 or a fragment thereof. In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 90% identity with the amino acid sequence of any of SEQ ID NOs: 55-59, or a fragment thereof.

[0200] In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 95% identity with the amino acid sequence of any of SEQ ID NOs: 27-63 or a fragment thereof. In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 95% identity with respect to the amino acid sequence of any of SEQ ID NOs: 35-50, or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 51 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 52 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 53 or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 54 or a fragment thereof. In some embodiments, a polypeptide provided herein comprises an amino acid sequence with at least 95% identity with the amino acid sequence of any of SEQ ID NOs: 55-59, or a fragment thereof.

[0201] In some embodiments, a polypeptide provided herein is a polypeptide comprising the amino acid sequence of any of SEQ ID NOs: 60-61, or a fragment thereof. In some embodiments, the polypeptide comprises an amino acid sequence with an identity of at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% with respect to the amino acid sequence of any of SEQ ID NOs: 60-61 or a fragment thereof.

[0202] In some embodiments, four or more of the polypeptides described herein are covalently attached to a polymer backbone to form a multimer. In some embodiments, the polymer backbone is dextran or polyethylene glycol. In some embodiments, each of the polypeptides is attached to the polymer backbone through a terminal cysteine residue on each of the polypeptides. In some embodiments, each of the polypeptides is attached to the polymer backbone via a biotinylation site on each of the polypeptides.

[0203] In some embodiments, four or more polypeptides are covalently attached to avidin to form a multimer.

Protrusion and/or cavity

[0204] In some embodiments, the polypeptide comprises an engineered protrusion. In some embodiments, the overhang contains one or more non-naturally occurring amino acid residues. In some embodiments, the overhang contains one or more naturally occurring amino acid residues. In some embodiments, the protrusion contains one or more amino acids selected from phenylalanine, arginine, tyrosine, tryptophan, and cysteine. In some embodiments, the protrusion contains a phenylalanine residue. In some embodiments, the protrusion contains an arginine residue. In some embodiments, the protrusion contains a tyrosine residue. In some embodiments, the protrusion contains a tryptophan residue. In some embodiments, the protrusion contains a cysteine residue. In some embodiments, the protrusion contains a cysteine residue and a tryptophan residue.

[0205] In some embodiments, the polypeptide comprises an engineered cavity. In some embodiments, the cavity contains one or more non-naturally occurring amino acid residues. In some embodiments, the cavity contains one or more naturally occurring amino acid residues. In some embodiments, the cavity contains one or more amino acids selected from alanine, serine, threonine, valine, and cysteine. In some embodiments, the cavity contains an alanine residue. In some embodiments, the cavity contains a serine residue. In some embodiments, the cavity contains a threonine residue. In some embodiments, the cavity contains a valine residue. In some embodiments, the cavity contains a cysteine residue. In some embodiments, the cavity contains a cysteine residue, a serine residue, an alanine residue, and a valine residue.

[0206] In some embodiments, the projection or cavity is not located in the class II MHC domain on the polypeptide. In some embodiments, a protrusion or cavity is located in the C _H 3 constant domain of an antibody on a polypeptide. In some embodiments, the overhang is located in the C _H 3 constant domain of an antibody on a polypeptide. In some embodiments, the cavity is located in the C _H 3 constant domain of an antibody on a polypeptide.

[0207] In some embodiments, the cavity contains a nucleotide sequence with at least 80% identity to the nucleotide sequence shown in SEQ ID NO: 25. In some embodiments, the cavity contains a nucleotide sequence with at least 85% identity to the nucleotide sequence shown in SEQ ID NO: 25. In some embodiments, the cavity contains a nucleotide sequence with at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 25. In some embodiments, the cavity contains a nucleotide sequence with the identity at least 95% with respect to the nucleotide sequence shown in SEQ ID NO: 25. In some embodiments, the cavity contains a nucleotide sequence with at least 98% identity with respect to the nucleotide sequence after the sequence shown in SEQ ID NO: 25. In some embodiments, the cavity contains the nucleotide sequence shown in SEQ ID NO: 25. In some embodiments, the cavity contains a nucleotide sequence with an identity of at least 81, 82, 83, 84, 85, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% relative to the nucleotide sequence shown in SEQ ID NO: 25.

[0208] In certain embodiments, the cavity contains an amino acid sequence with at least 80% identity with respect to the amino acid sequence shown in SEQ ID NO: 51. In certain embodiments, the cavity contains an amino acid sequence with at least 85% identity with respect to the amino acid sequence shown in SEQ ID NO: 51. In certain embodiments, the cavity contains an amino acid sequence with at least 90% identity with respect to the amino acid sequence shown in SEQ ID NO: 51. In certain embodiments, the cavity contains an amino acid sequence with an identity at least 95% with respect to the amino acid sequence shown in SEQ ID NO: 51. In certain embodiments, the cavity contains an amino acid sequence with at least 98% identity with respect to the amino acid sequence shown in SEQ ID NO: 51. In certain embodiments, the cavity contains the amino acid sequence shown in SEQ ID NO: 51. In some embodiments, the cavity contains a nucleotide sequence with an identity of at least 81, 82, 83 , 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% of the amino acid sequence shown in SEQ ID NO: 51.

[0209] In certain embodiments, the cavity is embedded in the C _H 2 or C _H 3 domain of an immunoglobulin molecule. In certain embodiments, the cavity is embedded in the C _H 3 domain of an immunoglobulin molecule. In certain embodiments, the cavity is inserted into the C _H 3 domain of the immunoglobulin molecule and contains an amino acid sequence with at least 80% amino acid sequence identity with respect to the amino acid sequence shown in SEQ ID NO: 52. In certain embodiments, the cavity is inserted into the C _H domain 3 immunoglobulin molecules and contains an amino acid sequence with at least 90% identity with respect to the amino acid sequence shown in SEQ ID NO: 52. In certain embodiments, the cavity is inserted into the C _H 3 domain of the immunoglobulin molecule and contains an amino acid sequence with at least 95% with respect to the amino acid sequence shown in SEQ ID NO: 52. In certain embodiments, the cavity is inserted into the C _H 3 domain of an immunoglobulin molecule and contains an amino acid sequence with an identity of at least at least 98% with respect to the amino acid sequence shown in SEQ ID NO: 52. In certain embodiments, the cavity is inserted into the C _H 3 domain of the immunoglobulin molecule and contains the amino acid sequence shown in SEQ ID NO: 52. In certain embodiments, the cavity is inserted into the C _H 3 domain of an immunoglobulin molecule and contains an amino acid sequence with an identity of at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% relative to the amino acid sequence shown in SEQ ID NO: 52.

[0210] In certain embodiments, the protrusion comprises a nucleotide sequence with at least 80% identity with respect to the nucleotide sequence shown in SEQ ID NO: 26. In certain embodiments, the protrusion comprises a nucleotide sequence with at least 80% identity with respect to the nucleotide sequence shown in SEQ ID NO: 26. In certain embodiments, the protrusion contains a nucleotide sequence with at least 90% identity with respect to the nucleotide sequence shown in SEQ ID NO: 26. In certain embodiments, the protrusion contains a nucleotide sequence with the identity at least 95% with respect to the nucleotide sequence shown in SEQ ID NO: 26. In some embodiments, the overhang contains a nucleotide sequence with at least 98% identity with respect to the nucleotide th sequence set forth in SEQ ID NO: 26. In certain embodiments, the ledge comprises the nucleotide sequence set forth in SEQ ID NO: 26. In certain embodiments, the ledge comprises a nucleotide sequence with an identity of at least 81, 82, 83, 84, 85 , 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% relative to the nucleotide sequence shown in SEQ ID NO: 26.

[0211] In certain embodiments, the protrusion comprises an amino acid sequence with at least 80% identity with respect to the amino acid sequence shown in SEQ ID NO: 53. In certain embodiments, the protrusion comprises an amino acid sequence with at least 80% identity with respect to the amino acid sequence shown in SEQ ID NO: 53. In certain embodiments, the protrusion contains an amino acid sequence with at least 90% identity with respect to the amino acid sequence shown in SEQ ID NO: 53. In certain embodiments, the protrusion contains an amino acid sequence with the identity at least 95% with respect to the amino acid sequence shown in SEQ ID NO: 53. In certain embodiments, the overhang contains an amino acid sequence with at least 98% identity from bearing to the amino acid sequence shown in SEQ ID NO: 53. In certain embodiments, the protrusion contains the amino acid sequence shown in SEQ ID NO: 53. In some embodiments, the protrusion contains an amino acid sequence with an identity of at least 81, 82, 83, 84 , 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% of the amino acid sequence shown in SEQ ID NO: 53.

[0212] In certain embodiments, the protrusion is embedded in the C _H 2 or C _H 3 domain of an immunoglobulin molecule. In certain embodiments, the protrusion is integrated into the C _H 3 domain of an immunoglobulin molecule. In certain embodiments, the projection is inserted into the C _H 3 domain of the immunoglobulin molecule and contains an amino acid sequence with at least 80% identity with the amino acid sequence shown in SEQ ID NO: 54. In certain embodiments, the projection is inserted into the C _H 3 domain of the molecule immunoglobulin and contains an amino acid sequence with at least 90% identity with respect to the amino acid sequence shown in SEQ ID NO: 54. In certain embodiments, the protrusion is inserted into the C _H 3 domain of the immunoglobulin molecule and contains an amino acid sequence with at least 95% identity with respect to the amino acid sequence shown in SEQ ID NO: 54. In certain embodiments, the protrusion is inserted into the C _H 3 domain of the immunoglobulin molecule and contains an amino acid sequence with at least 98% identity with respect to the amino acid the sequence shown in SEQ ID NO: 54. In certain embodiments, the projection is inserted into the C _H 3 domain of the immunoglobulin molecule and contains the amino acid sequence shown in SEQ ID NO: 54. In some embodiments, the projection is inserted into the C _H 3 domain of the immunoglobulin molecule and contains an amino acid sequence with an identity of at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% with respect to the amino acid the sequence shown in SEQ ID NO: 54.

[0213] The protrusion and cavity can be constructed by a specific mutation in the C _H 3 domain of IgG ₁ fused to the MHC class II alpha or beta domain. In certain embodiments, the protrusion contains the S354C (EU antibody numbering scheme) mutation in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the protrusion contains a T366W (EU antibody numbering scheme) mutation in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the overhang contains the S354C and T366W (EU antibody numbering scheme) mutations in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the overhang contains the S354C and T366W (EU antibody numbering scheme) mutations in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the overhang consists of the S354C and T366W mutation (EU antibody numbering scheme) in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the cavity contains a Y349C (EU antibody numbering scheme) mutation in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the cavity contains a T366S (EU antibody numbering scheme) mutation in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the cavity contains the L368A (EU antibody numbering scheme) mutation in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the cavity contains a Y407V (EU antibody numbering scheme) mutation in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the cavity contains mutations Y349C, T366S, L368A, and Y407V (EU antibody numbering scheme) in the C _H 3 region of the IgG ₁ molecule. In certain embodiments, the cavity consists of the Y349C, T366S, L368A, and Y407V (EU antibody numbering scheme) mutation in the C _H 3 region of the IgG ₁ molecule.

[0214] In one embodiment, the isolated heterodimers comprise at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that fits into the engineered cavity on contact surfaces of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, a class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain, and (ii) the second polypeptide comprises a domain class II MHC β1 domain, class II MHC β2 domain, IgG C _H 2 domain and IgG C _H 3 domain, wherein the cavity is formed by mutations in the C _H 3 domain of IgG.

[0215] In one embodiment, the isolated heterodimers comprise at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that fits into the engineered cavity on contact surfaces of the second polypeptide; and (i) the first polypeptide comprises an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain; and (ii) the second polypeptide comprises an MHC class II α1 domain, class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the cavity is formed by mutations in the IgG C _H 3 domain.

[0216] In one embodiment, the isolated heterodimers comprise at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that fits into the engineered cavity on contact surfaces of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain corresponding to S354C and T366W (EU numbering) ; and (ii) the second polypeptide comprises an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the cavity is formed by mutations in the IgG C _H 3 domain corresponding to Y349C, T366S, L368A, and Y407V (EU numbering).

[0217] In one embodiment, the isolated heterodimers comprise at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that fits into the engineered cavity on contact surfaces of the second polypeptide; and (i) the first polypeptide comprises an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain corresponding to S354C and T366W (EU numbering) ; and (ii) the second polypeptide comprises an MHC class II α1 domain, a class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the cavity is formed by mutations in the IgG C _H 3 domain corresponding to Y349C, T366S, L368A, and Y407V (EU numbering).

[0218] In one embodiment, the isolated heterodimers comprise at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and the second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that fits into the engineered cavity on contact surfaces of the second polypeptide; and (i) the first polypeptide consists of an MHC class II α1 domain, a class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain, and (ii) the second polypeptide consists of from an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the cavity is formed by mutations in the C _H 3 domain of IgG.

[0219] In one embodiment, the isolated heterodimers comprise at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and the second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that fits into the engineered cavity on contact surfaces of the second polypeptide; and (i) the first polypeptide is composed of an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain; and (ii) the second polypeptide consists of an MHC class II α1 domain, a class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the cavity is formed by mutations in the IgG C _H 3 domain.

[0220] In one embodiment, the isolated heterodimers comprise at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that fits into the engineered cavity on contact surfaces of the second polypeptide; and (i) the first polypeptide consists of an MHC class II α1 domain, a class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain corresponding to S354C and T366W (EU numbering ); and (ii) the second polypeptide consists of an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the cavity is formed by mutations in the IgG C _H 3 domain corresponding to Y349C, T366S, L368A, and Y407V (EU numbering).

[0221] In one embodiment, the isolated heterodimers comprise at least one first polypeptide and at least one second polypeptide, wherein the first polypeptide and second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that fits into the engineered cavity on contact surfaces of the second polypeptide; and (i) the first polypeptide consists of an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the overhang is formed by mutations in the IgG C _H 3 domain corresponding to S354C and T366W (EU numbering ); and (ii) the second polypeptide consists of an MHC class II α1 domain, class II MHC α2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the cavity is formed by mutations in the IgG C _H 3 domain corresponding to Y349C, T366S, L368A, and Y407V (EU numbering).

How to get

[0222] According to another aspect, provided herein are methods for preparing the heterodimer described herein. The present disclosure contemplates methods for producing heterodimers wherein the heterodimers comprise a first polypeptide comprising an MHC class II α1 domain and an MHC class II α2 domain and a second polypeptide comprising an MHC class II β1 domain and a class II β2 MHC domain. In some embodiments, each polypeptide further comprises a C _H 2 and a C _H 3 domain. In some embodiments, the _CH 3 domain further comprises either an engineered protrusion or an engineered cavity (cavity). If the protrusion is associated with a polypeptide containing the α1 and α2 MHC class II domain, then the trough is associated with a polypeptide containing the β1 and β2 domain of MHC class II. The configuration can be switched with a ridge associated with a polypeptide containing an MHC class II β1 and β2 domain and a trough associated with a polypeptide containing an MHC class II α1 and α2 domain. The heterodimer also contains an immunologically relevant polypeptide bound in a binding groove that forms between the alpha and beta chains of MHC class II. The polypeptide may be part of any of the first or second polypeptide chain associated with a flexible amino acid linker.

[0223] In some embodiments, heterodimer polypeptides are encoded by polynucleotides that are introduced into a eukaryotic cell line. In some embodiments, the eukaryotic cell line is a mammalian cell line. In some embodiments, the eukaryotic cell line is a CHO (Chinese Hamster Ovary) cell line. The polynucleotide can be introduced by methods known in the art, such as viral transduction (retroviral or lentiviral) or by generating a stable cell line that contains a copy of the polynucleotide integrated into the genome. After expression, the heterodimers are assembled in the cell and secreted into the culture medium. At this stage, the culture medium is subjected to at least one additional purification step. In certain embodiments, this purification step includes any one or more of centrifugation, ultracentrifugation, dialysis, filtration, chromatography, or column chromatography. In certain embodiments, since the polypeptides contain a human immunoglobulin C _H 2 and C _H 3 domain, the chromatography step includes affinity chromatography using Protein A, Protein G, Protein L, or any combination thereof. In certain embodiments, the chromatography step includes protein A affinity chromatography. In certain embodiments, the chromatography step includes protein G affinity chromatography. In certain embodiments, the chromatography step includes protein A/G affinity chromatography. In certain embodiments, the chromatography step consists of Protein A affinity chromatography. In certain embodiments, the chromatography step consists of Protein G affinity chromatography. In certain embodiments, the chromatography step consists of Protein A/G affinity chromatography. In certain embodiments, the chromatography step does not use an affinity reagent other than protein A, protein G, protein L, or a combination thereof (this does not include non-affinity chromatography steps such as desalting or size exclusion chromatography).

[0224] According to some embodiments, methods are provided for making a heterodimer comprising a first polypeptide and a second polypeptide, wherein the first polypeptide and the second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that can be located in an engineered cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC class II β1 domain II, an MHC class II β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof; comprising the steps of: (a) culturing a host cell containing a nucleic acid encoding a first polypeptide and a second polypeptide, including their contact surfaces, wherein the nucleic acid encoding the contact surface of the first polypeptide has been changed from the nucleic acid encoding the original contact surface of the first the nucleic acid encoding the second polypeptide interface has been changed from the nucleic acid encoding the original interface of the second polypeptide to encode a cavity, or both, and wherein the culture is such that the first polypeptide is expressed and the second polypeptide; and (b) recovering the heterodimer from the host cell culture. In some embodiments, a nucleic acid encoding a first polypeptide has been altered from the original nucleic acid to encode a bulge, and a nucleic acid encoding a second polypeptide has been altered from the original nucleic acid to encode a cavity. In some embodiments, step (a) is preceded by a step in which each of one or more nucleic acids encoding the original amino acid residue from the interface of the first polypeptide is replaced with a nucleic acid encoding an import amino acid residue, wherein the overhang contains one or more import residues. In additional embodiments, one or more import residues have a larger side chain than the original amino acid residue. In some embodiments, step (a) is preceded by a step in which each of the one or more nucleic acids encoding the original amino acid residue at the contact surface of the second polypeptide is replaced with a nucleic acid encoding the import amino acid residue, the cavity containing one or more import residues. In additional embodiments, one or more import residues have a smaller side chain than the original amino acid residue.

[0225] In some embodiments, the import moiety is selected from phenylalanine, arginine, tyrosine, tryptophan, alanine, serine, threonine, valine, and cysteine. In some embodiments, the import residue is arginine. In some embodiments, the import residue is phenylalanine. In some embodiments, the imported residue is tyrosine. In some embodiments, the import residue is tryptophan. In some embodiments, the import residue is alanine. In some embodiments, the import residue is serine. In some embodiments, the import residue is threonine. In some embodiments, the import residue is valine. In some embodiments, the import residue is not a cysteine. In some embodiments, the import residue is a cysteine. In some embodiments, the import residues are cysteine and tryptophan. In some embodiments, the import residues are cysteine, serine, alanine, and valine.

[0226] According to another aspect, provided herein are methods for preparing the heterodimer-nanoparticle conjugate described herein. In some embodiments, the methods include linking at least one heterodimer described herein to a nanoparticle, wherein the nanoparticle is non-liposomal and/or contains a hard core. In some embodiments, the methods include linking at least one heterodimer described herein to a nanoparticle, wherein the nanoparticle is non-liposomal and contains a hard core. In some embodiments, the methods include linking at least one heterodimer described herein to a nanoparticle, wherein the nanoparticle is non-liposomal or contains a hard core. In some embodiments, the methods include coupling at least one heterodimer described herein to a nanoparticle, wherein the nanoparticle is non-liposomal and contains a solid gold core. In some embodiments, the methods include linking at least one heterodimer described herein to a nanoparticle, the nanoparticle being non-liposomal and comprising a solid core of iron oxide. In some embodiments, the methods include coupling at least one heterodimer described herein to a nanoparticle, wherein the nanoparticle is non-liposomal and contains an iron oxide core; and the linking step includes covalently linking at least one heterodimer to the nanoparticle via a linker.

Ways to treat diseases

[0227] According to another aspect, provided herein are methods of treating a disease using compositions containing, consisting of, or consisting essentially of heterodimers disclosed herein and/or heterodimer-nanoparticle conjugates disclosed herein. In some embodiments, the disease is an autoimmune disease or disorder.

[0228] The isolated heterodimers or isolated heterodimer-nanoparticle complexes of the present invention are useful for reprogramming/differentiating autoreactive T cells into T regulatory or TR1 cells. In certain embodiments, TR1 cells express IL-10. In certain embodiments, TR1 cells secrete IL-10. In certain embodiments, TR1 cells express CD49b. In certain embodiments, TR1 cells express LAG-3. T cells that have these phenotypic characteristics are useful in the treatment of inflammatory or autoimmune conditions in individuals.

[0229] "Autoimmune disease or disorder" includes diseases or disorders arising from and directed against a person's own tissues or organs, or their manifestations or conditions resulting therefrom. In one embodiment, it refers to a condition that results from or is exacerbated by the production of T cells that react with normal body tissues and antigens. Examples of autoimmune diseases or disorders include, without limitation, arthritis (rheumatoid arthritis such as acute arthritis, chronic rheumatoid arthritis, gout or gouty arthritis, acute gouty arthritis, acute immunological arthritis, chronic inflammatory arthritis, degenerative arthritis induced by collagen type II arthritis, infectious arthritis, Lyme arthritis, proliferative arthritis, psoriatic arthritis, Still's disease, arthritis of the spine and juvenile rheumatoid arthritis, osteoarthritis, chronic progressive arthritis, arthritis deformans, primary chronic polyarthritis, reactive arthritis and ankylosing spondylitis), inflammatory hyperproliferative skin diseases, psoriasis (such as plaque psoriasis, guttate psoriasis, pustular psoriasis, and nail psoriasis), atopy (including atopic diseases such as hay fever and Job syndrome), dermatitis (including contact dermatitis, chronic contact dermatitis, exfo dermatitis liative, allergic dermatitis, allergic contact dermatitis, dermatitis herpetiformis, nummular dermatitis, seborrheic dermatitis, non-specific dermatitis, primary irritant contact dermatitis and atopic dermatitis), X-linked hyper-IgM syndrome, allergic intraocular inflammatory diseases, urticaria (such as chronic allergic urticaria and chronic idiopathic urticaria, including chronic autoimmune urticaria), myositis, polymyositis/dermatomyositis, juvenile dermatomyositis, toxic epidermal necrolysis, scleroderma (including systemic scleroderma), sclerosis (such as systemic sclerosis; multiple sclerosis (MS) such as spinoptic MS, primary progressive MS (PPMS) and reciprocating MS (RRMS); progressive systemic sclerosis, atherosclerosis, arteriosclerosis, multiple sclerosis, and ataxic sclerosis), neuromyelitis of the optic nerve with spectrum disorder (NMO, also known as Devic's disease or Devick's syndrome), inflammatory bowel disease (IBD) (eg, Crohn's disease; autoimmune medico-intestinal diseases such as ulcerative colitis, microscopic colitis, collagenous colitis, polyposis colitis, necrotizing enterocolitis and transmural colitis and autoimmune response-mediated inflammatory bowel disease), inflammatory bowel disease, pyoderma gangrenosum, erythema nodosum, primary sclerosing cholangitis, acute respiratory distress syndrome (including adult or acute respiratory failure syndrome (ARDS)), meningitis, inflammation of all or part of the choroid, iritis, choroiditis, autoimmune hematological disorder, rheumatoid spondylitis, rheumatoid synovitis, hereditary angioedema, damage to the che pruritus scroti, autoimmune premature ovarian failure, sudden hearing loss due to an autoimmune condition, IgE-mediated diseases such as anaphylaxis and allergic and atopic rhinitis, encephalitis such as Rasmussen encephalitis and limbic and/or stem encephalitis, uveitis (such as anterior uveitis, acute anterior uveitis, granulomatous uveitis, non-granulomatous uveitis, phacoantigenic uveitis, posterior uveitis, or autoimmune uveitis), glomerulonephritis (GN) with and without nephrotic syndrome (such as chronic or acute glomerulonephritis such as primary GN, immune-mediated GN, membranous GN (membranous nephropathy), idiopathic membranous GN or idiopathic membranous nephropathy, membranous or membranous proliferative GN (MPGN), including types I and II, and rapidly progressive GN or proliferative nephritis), autoimmune polyglandular endocrine insufficiency, balanitis, including plasmacellular balanitis, balanoposthitis, erythema centrifugus annulare, persistent dyschromic erythema, erythema multiforme, anular granuloma, lichen brilliant, lichen sclerosus, lichen simplex chronic, lichen spinulosa, lichen planus, lamellar ichthyosis, epidermolytic ichthyosis, precancerous malignant keratosis, pyoderma gangrenosum, allergic conditions and reactions, allergic reaction, eczema (including allergic or atopic eczema, asteatotic eczema, dyshidrotic eczema and vesicular palmoplantar eczema), asthma (such as bronchial asthma, autoimmune asthma), conditions including T-cell infiltration and chronic inflammatory responses, immune responses against foreign antigens such as fetal ABO blood types during pregnancy, chronic inflammatory lung disease, autoimmune myocarditis, leukocyte adhesion deficiency, lupus (including lupus nephritis, systemic lupus erythematosus encephalitis, lupus infantile, non-renal lupus, extrarenal lupus, discoid lupus and discoid lupus erythematosus, alopecia, systemic lupus erythematosus (SLE) such as cutaneous SLE or subacute cutaneous SLE, neonatal lupus syndrome (NLE), and disseminated lupus erythematosus), type I diabetes mellitus, type II diabetes mellitus, and latent autoimmune diabetes mellitus in adults (or type 1.5 diabetes mellitus). Immune reactions associated with acute and delayed hypersensitivity mediated by cytokines and T-lymphocytes, sarcoidosis, granulomatosis (including lymphomatoid granulomatosis, Wegener's granulomatosis or agranulocytosis), vasculitis (including vasculitis, vasculitis involving large vessels (including polymyalgia rheumatica and polyascular vascular disease and nonspecific giant cell aortoarteritis (Takayasu)), vasculitis with lesions of medium vessels (including Kawasaki disease and polyarteritis nodosa/panarteria nodosa), microscopic polyarteritis, immunovasculitis, CNS vasculitis, cutaneous vasculitis, hypersensitivity vasculitis , necrotizing vasculitis, such as systemic necrotizing vasculitis, as well as ANCA-associated vasculitis (such as vasculitis or Churg-Strauss syndrome (CSS) and ANCA-associated small vessel vasculitis), temporal arteritis, aplastic anemia, autoimmune aplastic anemia, an Coombs-positive anaemia, Diamond-Blackfan anemia, hemolytic anemia, immune hemolytic anemia, including autoimmune hemolytic anemia (AIHA), Addison's disease, autoimmune neutropenia, pancytopenia, leukopenia, leukocyte diapedesis disorders, CNS inflammatory diseases, Alzheimer's disease , Parkinson's disease, multiple organ syndrome (eg, secondary to sepsis, trauma, or hemorrhage), antigen-antibody complex-mediated diseases, anti-glomerular basement membrane disease, antiphospholipid syndrome, allergic neuritis, Behçet's disease/syndrome, syndrome Castleman's syndrome, Goodpasture's syndrome, Raynaud's syndrome, Sjögren's syndrome, Stevens-Johnson syndrome, pemphigoid such as bullous pemphigoid and cutaneous pemphigoid, pemphigus (including pemphigus vulgaris, pemphigus foliaceus, mucosal membrane pemphigus and pemphigus erythematosus), autoimmune polyendocrinopathy, disease or Reiter's syndrome, heat injury, preeclampsia, immune complex disease such as immune complex induced nephritis, antibody mediated nephritis, polyneuropathy, chronic neuropathy such as IgM polyneuropathy or IgM mediated neuropathy, autoimmune or immune mediated thrombocytopenia such as idiopathic thrombocytopenic purpura (ITP) , including chronic or acute ITP, acquired thrombocytopenic purpura, scleritis such as idiopathic ceratoimmune scleritis, episcleritis, autoimmune disease of the testes and ovaries, including autoimmune orchitis and oophoritis, primary hypothyroidism, hypoparathyroidism, autoimmune endocrine diseases (including thyroiditis (such as autoimmune thyroiditis, Hashimoto's disease, chronic thyroiditis (Hashimoto's thyroiditis) or subacute thyroiditis), autoimmune thyroid disease, idiopathic hypothyroidism, or Graves' disease), polyglandular syndromes such as AU immune polyglandular syndromes (or polyglandular endocrinopathy syndromes), paraneoplastic syndromes, including neurological paraneoplastic syndromes such as Lambert-Eaton myasthenic syndrome or Eaton-Lambert syndrome, muscle stiffness syndrome or stiff person syndrome, encephalomyelitis such as allergic encephalomyelitis or experimental allergic encephalomyelitis (EAE), myasthenia gravis such as thymoma-associated myasthenia gravis, cerebellar degeneration, neuromyotonia, opsoclonus or opso-myoclonal syndrome (OMS), sensory neuropathy, multifocal motor neuropathy, Sheehan's syndrome, autoimmune hepatitis, chronic hepatitis, lupus hepatitis, congenital giant cell hepatitis, chronic active hepatitis, autoimmune chronic active hepatitis, lymphoid interstitial pneumonitis (LIP), bronchiolitis obliterans (non-graft) vs. NSIP, Guillain-Barré syndrome, Berger's disease (IgA nephropathy), idiopathic kaya IgA nephropathy, linear IgA dermatosis, acute febrile neutrophilic dermatosis, subcorneal pustular dermatosis, transient acantholytic dermatosis, cirrhosis such as primary biliary cirrhosis and pneumocirrhosis, autoimmune enteropathy syndrome, celiac disease or celiac disease, celiac sprue (gluten enteropathy), refractory sprue, idiopathic sprue, cryoglobulinemia, amylotrophic lateral sclerosis (ALS; Lou Gehrig's disease), ischemic heart disease, autoimmune ear disease such as autoimmune inner ear disease (AIED), autoimmune hearing loss, polychondritis such as refractory or relapsing polychondritis, pulmonary alveolar proteinosis, Cogan's syndrome/non-syphilitic interstitial keratitis, Bell's palsy, Sweet's disease/syndrome, autoimmune rosacea, herpes zoster-related pain, amyloidosis, nonmalignant lymphocytosis, primary lymphocytosis that includes monoclonal B-cell lymphocytosis (eg, benign monoclonal gammopathy and monoclonal gammopathy of uncertain significance, MGUS), peripheral neuropathy, paraneoplastic syndrome, channelopathies such as epilepsy, migraine, arrhythmia, muscle disorders, deafness, blindness, periodic paralysis, CNS channelopathies, autism, inflammatory myopathy, focal or segmental or focal segmental glomerulosclerosis (FSGS), endocrine ophthalmopathy, uveoretinitis, x orioretinitis, autoimmune hepatological disease, fibromyalgia, polyendocrine insufficiency, Schmidt's syndrome, adrenal inflammation, gastric atrophy, presenile dementia, demyelinating diseases such as autoimmune demyelinating diseases and chronic inflammatory demyelinating polyneuropathy, Dressler's syndrome, alopecia areata, alopecia totalis, CREST (calcinosis) syndrome , Raynaud's phenomenon, esophageal dyskinesia, sclerodactyly, and telangiectasia), male and female autoimmune infertility (eg, due to antisperm antibodies), mixed connective tissue disease, Chagas disease, rheumatic fever, recurrent abortion, farmer's lung, erythema multiforme, postcardiotomy syndrome, Cushing's syndrome, poultry pulmonary allergy, allergic granulomatous angiitis, benign lymphocytic angiitis, Alport's syndrome, alveolitis such as allergic alveolitis and fibrosing alveolitis, interstitial disease of the lung transfusion reaction, leprosy, malaria, parasitic diseases such as leishmaniasis, trypanosomiasis, schistosomiasis, ascariasis, aspergillosis, Sumpter's syndrome, Kaplan's syndrome, dengue, endocarditis, endomyocardial fibrosis, diffuse interstitial pulmonary fibrosis, interstitial pulmonary fibrosis, pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, endophthalmitis, persistent elevated erythema, fetal erythroblastosis, eosinophilic fasciitis, Shulman's syndrome, Felty's syndrome, flariasis, cyclitis such as chronic cyclitis, heterochronic cyclitis, iridocyclitis (acute or chronic) or Fuchs cyclitis, Henoch-Schonlein purpura, human immunodeficiency virus (HIV) infection, SCID, acquired immunodeficiency syndrome (AIDS), echovirus infection, sepsis, endotoxemia, pancreatitis, thyrotoxicosis, parvovirus infection, rubella virus infection, post-vaccination syndromes, Epstein-Barr virus infection, mumps, Evan's syndrome, autoimmune gonadal insufficiency, chorus ey Sydenham, post-streptococcal nephritis, thromboangiitis obliterans, thyrotoxicosis, tabesa spinalis, choroiditis, polymyalgia giant cell, chronic allergic pneumonitis, keratoconjunctivitis sicca, epidemic keratoconjunctivitis, idiopathic nephrotic syndrome, minimal change in nephropathy, benign familial and ischemia-reperfusion organ transplantation, transplantations, retinal autoimmunity, joint inflammation, bronchitis, chronic obstructive airway/pulmonary disease, silicosis, aphthae, aphthous stomatitis, arteriosclerotic disorders, asperniogenesis, autoimmune hemolysis, Beck's disease, cryoglobulinemia, Dupuytren's contracture, phacoanaphylactica endophthalmitis, allergic enteritis, erythema nodosum, idiopathic leprosy facial paralysis, chronic fatigue syndrome, rheumatic fever, Hamman-Rich disease, sensorineural hearing loss, paroxysmal hemoglobinuria, hypogonadism, regional ileitis, leukopenia, infectious mononucleosis, transverse myelitis, primary idiopathic myxedema, nephrosis, sympathetic ophthalmia, granulomatous orchitis, pancreatitis, acute polysciatica, pyoderma gangrenosum, Kerwen's thyroiditis, acquired splenic atrophy, non-malignant thymoma, vitiligo, toxic shock syndrome, food poisoning, conditions including include T cell infiltration, impaired leukocyte adhesion, immune responses associated with acute and delayed hypersensitivity mediated by cytokines and T lymphocytes, diseases associated with diapedesis of leukocytes, multiple organ damage syndrome, diseases mediated by the antigen-antibody complex, antiglomerular disease basement membrane, allergic neuritis, autoimmune polyendocrinopathy, oophoritis, primary myxedema, autoimmune atrophic gastritis, sympathetic ophthalmia, rheumatic diseases, mixed connective tissue diseases, nephrotic syndrome, insulitis, polyendocrine failure, autoimmune polyglandular syndrome type I, acquired idiopathic hypoparathyroidism (AOIH), cardiopathy such as dilated cardiomyopathy, hypophysopathy, acquired epidermolysis bullosa (EBA), hemochromatosis, myocarditis, nephrotic syndrome, primary sclerosing cholangitis, purulent or non-purulent sinusitis, acute or chronic sinusitis, ethmoiditis, frontal sinusitis, sinusitis or sphinoidal sinusitis, disorders associated with eosinophils, such as eosinophilia, eosinophilic lung infiltrate, eosinophilia-myalgia syndrome, Loeffler's syndrome, chronic eosinophilic pneumonia, tropical pulmonary eosinophilia, bronchopneumonic aspergillosis, aspergilloma or granulomas containing eosinophils, anaphylaxis, seronegative spondyloarthritis, polyendocrine autoimmune disease, sclerosing cholangitis, sclera, episclera, chronic mucocutaneous candidiasis, Bruton's syndrome, transient hypogammaglobulinemia in children, Wiskott-Aldrich syndrome, ataxia-telangie syndrome ctasia, angiectasia, autoimmune disorders associated with collagen disease, rheumatism, neurological disease, lymphadenitis, low blood pressure, vascular dysfunction, tissue damage, cardiovascular ischemia, hyperalgesia, renal ischemia, cerebral ischemia and disease accompanying vascularization, allergic reaction, glomerulonephritis, reperfusion injury, ischemic reperfusion disorder, reperfusion injury of the myocardium or other tissues, lymphomatous tracheobronchitis, inflammatory dermatitis, dermatosis with acute inflammatory components, multiple organ failure, bullous diseases, necrosis of the renal cortex, acute purulent meningitis or other inflammatory diseases of the central nervous system, eye and orbital inflammatory diseases, granulocyte transfusion syndromes, cytokine-induced toxicity, narcolepsy, acute severe inflammation, chronic intractable inflammation, pyelitis, endarteritis hyperplasia, gastric ulcer, valvulitis, emphysema, alopecia areata, adipose tissue inflammation/type II diabetes mellitus, adipose tissue inflammation associated obesity/insulin resistance, and endometriosis.

[0230] In some embodiments, the autoimmune disorder or disease may include, without limitation, type I and II diabetes mellitus, prediabetes, transplant rejection, multiple sclerosis, multiple sclerosis-associated disorder, premature ovarian failure, scleroderma, Sjögren's disease/syndrome , lupus, vitiligo, alopecia (baldness), polyglandular insufficiency, Graves' disease, hypothyroidism, polymyositis, pemphigus, Crohn's disease, colitis, autoimmune hepatitis, hypopituitarism, myocarditis, Addison's disease, autoimmune skin diseases, uveitis, pernicious anemia, hypoparathyroidism and/or rheumatoid arthritis. Other indications of interest include, but are not limited to, bronchial asthma, allergic asthma, primary biliary cirrhosis, cirrhosis of the liver, neuromyelitis of the optic nerve with spectral disorder (Devic's disease, spinal optic multiple sclerosis (OSMS)), pemphigus vulgaris, inflammatory bowel disease (IBD), arthritis, rheumatoid arthritis, systemic lupus erythematosus (SLE), celiac disease, psoriasis, autoimmune cardiomyopathy, idiopathic dilated cardiomyopathy (IDCM), myasthenia gravis, uveitis, ankylosing spondylitis, immune-mediated myopathies, prostate cancer, antiphospholipid syndrome ( ANCA+), atherosclerosis, dermatomyositis, chronic obstructive pulmonary disease (COPD), emphysema, spinal cord injury, traumatic injury, tobacco-induced lung destruction, ANCA-associated vasculitis, psoriasis, sclerosing cholangitis, primary sclerosing cholangitis, and diseases of the central and peripheral nervous system stems.

[0231] In some embodiments, the autoimmune disorder or disease may include, without limitation, type I diabetes mellitus, multiple sclerosis, celiac disease, primary biliary cirrhosis, pemphigus, pemphigus foliaceus, pemphigus vulgaris, neuromyelitis optic nerve with spectral disorder, arthritis (including rheumatoid arthritis), allergic asthma, inflammatory bowel disease (including Crohn's disease and ulcerative colitis), systemic lupus erythematosus, atherosclerosis, chronic obstructive pulmonary disease, emphysema, psoriasis, autoimmune hepatitis, uveitis, Sjögren's syndrome, scleroderma, antiphospholipid syndrome, ANCA-associated vasculitis, and stiffness syndrome. In a further aspect, the disease antigen is a tumor or cancer antigen.

[0232] In certain embodiments, the isolated heterodimers or isolated heterodimer-nanoparticle complexes of the present invention are included in a pharmaceutical composition containing one or more pharmaceutically acceptable excipients, carriers, and diluents. In certain embodiments, the isolated heterodimers or isolated heterodimer-nanoparticle complexes of the present invention are administered suspended in a sterile solution. In certain embodiments, the solution contains 0.9% NaCl. In certain embodiments, the solution further comprises one or more of: buffers, eg, acetate, citrate, histidine, succinate, phosphate, bicarbonate, and hydroxymethylaminomethane (tris); surfactants such as polysorbate 80 (Tween 80), polysorbate 20 (Tween 20) and poloxamer 188; polyol/disaccharide/polysaccharides, eg glucose, dextrose, mannose, mannitol, sorbitol, sucrose, trehalose and dextran 40; amino acids, for example glycine or arginine; antioxidants, eg ascorbic acid, methionine; or chelating agents such as EGTA or EGTA. In certain embodiments, the isolated heterodimers or isolated heterodimer-nanoparticle complexes of the present invention are supplied/stored lyophilized and reconstituted prior to administration. In certain embodiments, the lyophilized isolated heterodimers or isolated formulations of the heterodimer-nanoparticle complexes contain an excipient such as mannitol, sorbitol, sucrose, trehalose, or dextran 40. The lyophilized formulation may be contained in a glass vial. Isolated heterodimers or isolated heterodimer-nanoparticle complexes, when formulated, whether or not they have been reduced, can be buffered at a specific pH, typically less than 7.0. In some embodiments, the pH may be 4.5 to 6.5, 4.5 to 6.0, 4.5 to 5.5, 4.5 to 5.0, or 5.0 to 6, 0. In certain embodiments, isolated heterodimers or isolated heterodimer-nanoparticle complexes can be formulated for intravenous administration. In certain embodiments, isolated heterodimers or isolated heterodimer-nanoparticle complexes can be formulated for oral administration. In certain embodiments, isolated heterodimers or isolated heterodimer-nanoparticle complexes can be formulated for parenteral, intramuscular, or intradermal administration. In certain embodiments, isolated heterodimers or isolated heterodimer-nanoparticle complexes can be formulated and/or administered without any immunological adjuvant or other compound or polypeptide designed to increase or decrease an immune response.

[0233] In another aspect, provided herein are methods for detecting and/or monitoring a population of immune cells, preferably T cells, comprising administering a labeled antigen-MHC complex, wherein the subject has received the heterodimers disclosed herein and/or the heterodimer conjugates disclosed herein. - nanoparticle.

[0234] In certain aspects, provided herein are methods for detecting a population of T _R 1 cells and/or effector T cells in an antigen-specific manner in a subject who has received heterodimers and/or heterodimer-nanoparticle conjugates disclosed herein. The method comprises, alternatively, consists, or additionally further consists essentially of contacting a sample suspected of containing T _R 1 cells with an effective amount of a labeled pMHC complex to form a multimeric complex and detect any multimeric complex, thereby detecting a population of T _R 1 -cells. In some embodiments, the method further comprises, alternatively, further consists of, or further further consists essentially of, staining any population of T cells using a labeled multimeric complex. In some embodiments, the step of detecting the T _R 1 cell population includes flow cytometry to detect any multimeric complex. In some embodiments, the method further comprises or alternatively consists of or further consists essentially of administering the complex or composition to the subject.

[0235] In certain aspects, provided herein are methods for detecting a population of T _R 1 cells and/or effector T cells in an antigen-specific manner in a subject who has received the heterodimers disclosed herein and/or the heterodimer-nanoparticle conjugates disclosed herein. . The method comprises, alternatively, consists of or further consists essentially of any of the following assays: an ELISPOT cytokine assay, a multimer-targeted epitope assay, or a multimer co-precipitation assay. In some embodiments, the method further comprises, alternatively, further consists of, or further further consists essentially of administering the heterodimers disclosed herein and/or the heterodimer-nanoparticle conjugates disclosed herein.

[0236] In other aspects, provided herein are methods for monitoring an increase in a population of antigen-specific T _R 1 and/or effector T cells in a subject. The method comprises, alternatively, consists of, or further consists essentially of: a) administering to the subject an effective amount of the heterodimers disclosed herein and/or the heterodimer-nanoparticle conjugates disclosed herein, wherein the disease-related antigen of the pMHC complex is selected to increase the number of antigen-specific T _R 1 and/or effector T cells; b) isolating a suitable sample from the subject suspected of containing the population; c) contacting the sample with an effective amount of the labeled pMHC complex to form a multimeric complex and detecting any multimeric complex; and d) quantifying the amount of antigen-specific T _R 1 and/or effector T cells in the population. In some embodiments, the method further comprises, alternatively, further consists of, or further consists essentially of, staining any multimeric complex. In some embodiments, the step of quantifying antigen-specific T _R 1 and/or effector T cells includes flow cytometry and/or ELISA. In some embodiments, the method further comprises, alternatively, further consists of, or further further consists essentially of administering the heterodimers disclosed herein and/or the heterodimer-nanoparticle conjugates disclosed herein.

[0237] There are many types of immunoassays that can be implemented. Immunoassays covered by this disclosure include, without limitation, those described in US Pat. No. 4,367,110 (double monoclonal antibody sandwich assay) and US Pat. Other assays include labeled ligand immunoprecipitation and both in vitro and in vivo immunocytochemistry.

[0238] One way to quantify the number of circulating antigen-specific immune cells is assay using tetramers. In this assay, a specific epitope is associated with synthetic multimeric forms of fluorescently labeled MHC molecules. Because immune cells recognize antigens in the form of short peptides associated with MHC molecules, cells with an appropriate T cell receptor will bind to labeled tetramers and can be quantified by flow cytometry. Although this method takes less time than the ELISPOT analysis, the multivariate analysis only measures binding and not function. Not all cells that bind a particular antigen necessarily become activated. However, a correlation has been demonstrated between ELISPOT, multimeric and cytotoxic assays.

[0239] Immunoassays are typically binding assays. Several immunoassays are known in the art, including various types of enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), or binary assays such as Luminex® technology. Immunohistochemical detection using tissue sections is also applicable.

[0240] In one example of an ELISA, antibodies or antigens are immobilized on a selected surface, such as a well in a polystyrene microtiter plate, a dipstick, or a column support. Then, the test composition is added to the wells, presumably containing the desired antigen or antibody, for example, a clinical specimen. After binding and washing to remove non-specifically bound immune complexes, bound antigen or antibody can be detected. Detection is typically achieved by adding another antibody specific for the desired antigen or antibody that is associated with a detectable label. This type of ELISA is known as "sandwich ELISA". Detection can also be achieved by adding a second antibody specific for the desired antigen, followed by the addition of a third antibody that has a binding affinity for the second antibody, the third antibody bound to a detectable label. Variations on ELISA methods are known to those skilled in the art.

[0241] Competitive ELISAs are also possible, in which test samples compete for binding to known amounts of labeled antigens or antibodies. The number of reactive particles in an unknown sample is determined by mixing the sample with known labeled particles prior to or during incubation with coated wells. The presence of reactive particles in the sample reduces the number of labeled particles available for binding to the well and thus reduces the marginal signal.

[0242] Regardless of the format used, ELISAs share some common features such as coating, incubation or binding, washing to remove non-specifically bound particles, and detection of bound immune complexes.

[0243] The antigen or antibodies can also be bound to a solid support, such as in the form of a plate, bead, probe, membrane, or column matrix, and the sample to be analyzed is applied to the immobilized antigen or antibody. When coating a plate with an antigen or antibody, the wells of the plate are typically incubated with a solution of the antigen or antibody, either overnight or for a specified period. The wells of the plate are then washed to remove incompletely adsorbed material. Any remaining accessible well surfaces are then "coated" with a non-specific protein that is antigenically neutral to the antiserum under test. These include bovine serum albumin (BSA), casein and powdered milk solutions. The coating makes it possible to block non-specific adsorption sites on the immobilizing surface and thus reduce the background caused by non-specific binding of antiserum on the surface.

[0244] In ELISA, it is more common to use secondary or tertiary means of detection rather than a direct procedure. Thus, after antigen or antibody has been bound to a well coated with a non-reactive material to reduce background and washed to remove unbound material, the immobilizing surface is contacted with a clinical or biological specimen under conditions effective to form an immune complex (antigen/antibody). A labeled secondary binding ligand or antibody, or a secondary binding ligand or antibody in combination with a labeled tertiary antibody or third binding ligand, is then required to detect the immune complex.

[0245] In addition, flow cytometry can be used to detect and quantify specific cell subtypes according to cell surface markers. Conventional methods for detection and quantification by flow cytometry include the use of fluorescently labeled beads that bind to cell surface markers specific to each immune cell subtype, such as CD 4 specific beads, to select for CD 4+ T cells, etc. .

[0246] The compositions described herein can generally be administered parenterally, by injection, for example, intravenously, subcutaneously, or intramuscularly. Compositions for intravenous administration may include stabilizers, excipients and preservatives. The pMHC nanoparticle compositions can be suspended in sterile saline, buffered saline, or phosphate buffered saline. In addition, in certain embodiments, intravenous formulations contain dextrose, glucose, mannitol, pH buffers, or sodium bicarbonate. Additional formulations that are suitable for other routes of administration include oral formulations. Oral formulations include commonly used excipients such as, for example, mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. pharmaceutical grade. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain from about 10% to about 95% of the active ingredient, preferably from about 25% to about 70%. The preparation of an aqueous composition that contains an antigen-MHC-nanoparticle complex that modifies the immune state of a subject will be known to those skilled in the art in light of the present disclosure. In certain embodiments, the composition may be administered by inhalation (eg, US Pat. No. 6,651,655, which is specifically incorporated by reference in its entirety). In one embodiment, the antigen-heterodimer-nanoparticle complex (ie, antigen-pMHC-NP complex) is administered systemically. In specific embodiments, the pMHC-NP complex described herein or compositions containing a plurality of pMHC-NP complexes described herein are administered intravenously.

EXAMPLES

Example 1 Expression of peptide-MHC (pMHC) complexes with leucine zipper.

[0247] For expression of pMHC complexes in CHO-S cells, DNA fragments encoding the pMHC complex (in various configurations, see Figure 2) are cloned into the pLV/CMV-GW lentiviral expression vector (Figures 1A and 1B). Both alpha and beta chains of the pMHC complex are encoded by a single ORF, either as two separate chains separated by a P2A escape sequence (FIG. 2, top) or as two separate chains cloned in two different vectors (FIG. 2 , at the bottom). The pMHC encoding fragment is cloned before the IRES-EGFP cassette. The expressed beta chain product consists of a leader sequence, an epitope sequence, a GS linker, followed by a beta chain extracellular domain and a C-Jun fragment (40 amino acids). The expressed alpha chain contains a leader sequence, an alpha chain extracellular domain, a C-fos fragment (40 amino acids), a BirA biotinylation site (14 amino acids), and 6X-histidine and/or Strep tags with a C-terminal cysteine. The preferred vector design (FIG. 2, bottom) encodes both strands on separate plasmids.

Example 2 Heterodimerization of pMHC based on a ridge-to-trough basis.

[0248] The following experiments describe attempts to develop pMHC heterodimers that are intended for clinical use in humans with improved safety, efficacy, and regulation; and are amenable to purification in large quantities required for such clinical applications. Current biologics that include standard epitope tags (eg, FLAG, 6xHIS) are not clinically appropriate because the epitope tag can trigger the production of antibodies to the drug. This is especially true when different drugs carry the same label or the same drug requires subsequent administration. For example, injection into a patient with drug A purified using an epitope X tag can result in an immune response against the X epitope tag such that any subsequent administration of the same drug or another drug with the same epitope tag will be neutralized by an antibody response that was obtained with the first administration of drug A. Purification without an epitope tag poses a problem for in vitro isolation of soluble α-β MHC class II heterodimers. This is because the methods for chromatographic separation of MHC polypeptides do not allow the purification of large amounts of high purity protein.

[0249] Therefore, an attempt was made to develop recombinant MHC class II molecules that facilitate the purification of recombinant pMHC: a) with increased secretion from CHO cells; b) without the need to apply purification labels; and c) enabling the biotinylation of the monomers to produce a tetramer without the need to introduce biotinylation labels into the sequence. Initially, an attempt was made to obtain stable class II MHC heterodimers bearing a heterodimerizing leucine zipper but fused to a ridge-by-trough version of the human IgG1 protein, resulting in recombinant pMHC heterodimers amenable to purification from culture supernatants using protein A or protein affinity chromatography. protein G. A version lacking the leucine zipper was prepared as a control (FIG. 3, shown on the right) and was expected to produce unstable pMHC heterodimers. The constructs described in Example 1 above (FIGS. 1A, 1B and 2) were chosen for expression in which the alpha and beta chains of the MHC complex are encoded by a single ORF encoding two separate chains separated by a P2A ribosome escape sequence. Also included was the BirA biotinylation site (14 amino acids) (for routine enzyme-based biotinylation), histidine and streptococcus 6X tags (to further improve the purity of the preparations if needed), and a C-terminal cysteine (to allow conjugation to maleimide-functionalized nanoparticles). However, it should be noted that the presence of a biotinylation site, 6X-histidine and streptavidin tags is optional and can be omitted to allow purification of heterodimers using protein A/G/L.

[0250] Briefly, mouse BDC2.5mi/IA ^g7 or human IGRP _13-25 /DRB1*0301 pMHC class II alpha chains with and without leucine zipper were linked to the Fc region of human IgG ₁ modified to contain the polypeptide "ledge". Similarly, the MHC peptide-beta chain construct (with and without a leucine zipper) was linked to a human IgG ₁ Fc region modified to contain the polypeptide "trough". SEQ ID NOs: 1-8 and 27-34 show the DNA and amino acid sequences of the respective pMHC coding cassettes, respectively.

[0251] To express these pMHC constructs, plasmids containing the pMHC genes were first transfected into 293T cells along with plasmids encoding the HIV viral core and envelope proteins for viral packaging. The packaged viral particles were then used to transduce CHO-S cells. Transduced CHO-S cells expressing the highest levels of eGFP were then selected by cell sorting by FACS. The high EGFP cells were further increased, stored and then used as a pMHC production cell line.

[0252] Efforts have focused on the BDC2.5mi/IA ^g7 encoding mouse construct with or without C-Jun/C-Fos leucine zipper. Both CHO cell lines transduced with these constructs expressed the transgenic RNA as evidenced by the expression of high levels of eGFP (measured by flow cytometry) in the respective cell lines. In FIG. 4A shows CHO cells transduced with constructs encoding BDC2.5mi/IA ^g7 with or without C-Jun/C-Fos 402 leucine zipper or C-Jun/C-Fos 404 leucine zipper compared to 401 and 403 negative control CHO cells, respectively. Supernatants from CHO-S cells were concentrated and purified using dialysis. pMHC in concentrated medium was subjected to protein G affinity chromatography and eluted at acidic pH. In FIG. 4C shows that, unexpectedly, despite messenger RNA expression, the CHO cell line expressing leucine zipper-containing pMHC with ridge-in-gap produced extremely low levels of pMHC. See peak 406 from the protein G elution profile (FIG. 4C). Most surprisingly, as shown in Fig. 4B was that a cell line expressing ridge-in-gap pMHC without the leucine zipper expressed copious amounts of G protein binding material. See peak 405 from the protein G elution profile (FIG. 4B).

[0253] The zipperless pMHC material collected by protein G affinity chromatography was quantified and analyzed for its purity by electrophoresis on both native and denaturing SDS-PAGE. In FIG. 5 shows that zipperless pMHC material collected by protein G affinity chromatography ran as one band under non-reducing conditions (to the left of the marker) and that, as expected, these molecular species ran as three separate bands in denaturing SDS-PAGE, a pattern remarkably similar to that seen with pMHC expressed using conventional C-Jun/C-Fos leucine zipper constructs. See 501 and 502 for single bands under non-reducing conditions and 503 for three bands under denaturing conditions (FIG. 5).

Example 3 Binding of pMHC complexes to cognate T cells.

[0254] To test the ability of the purified pMHC zipperless complex to specifically bind to cognate T cells, the purified complex was biotinylated in vitro and then purified by anion exchange chromatography. Biotinylated fractions were pooled, dialyzed and used to prepare pMHC tetramers using fluorochrome-conjugated streptavidin. These reagents were then tested for their ability to specifically bind to cognate T cells in vitro . Spleen CD4+ T cells from a transgenic mouse expressing the BDC2.5mi-specific T cell receptor were used, in which most CD4+ T cells have the same antigenic specificity (in contrast to the highly polyclonal TCR antigen repertoire). As a positive control, a tetramer made using pMHC monomers expressed using the C-Jun/C-Fos leucine zipper constructs described in FIG. 2. As shown in FIG. 6, a pMHC-based lip-to-trough non-zipper tetramer designed substantially similar to its Fc-fusion-free zipper counterpart demonstrated the feasibility of this novel approach.

Example 4 Zipperless pMHC Binding to Maleimide-Functionalized Nanoparticles.

[0255] To investigate whether this zipperless version of pMHC could productively couple to maleimide-functionalized nanoparticles with C-terminal free cysteine, PF-Mal nanoparticles were incubated with purified protein and then purified to remove conjugates from free pMHC using magnetic columns Miltenyi-Biotec. In the left panel in Fig. 7 shows native gel image of free pMHC (lane N1: 2.5mi-trough-to-trough at 6 μg) compared to pMHC-conjugated nanoparticles (lane N2: 2.5mi-trough-to-trough-PFM-031716 at 6 .4 µl and lane N3: 2.5mi-protrusion-in-trough-PFM-031716 for 3.2 µl). The figure shows that most of the pMHC in the preparations is associated with nanoparticles that do not enter the gel. In the right panel in Fig. 7 shows an image of an SDS-PAGE gel in which the same preparations were run under denaturing conditions (10% SDS-PAGE) that separate the pMHC from the surface of the nanoparticles. Lane 1 contained a set of marker proteins, and lane 2 contained a 2.5mi ridge-to-trough at 6 μg. Lane 3 contained 2.5mi-protrusion-in-trough-PFM-031716 at 6.4 µl and lane 4 contained 2.5mi-protrusion-in-trough-PFM-031716 at 3.2 µl. The image clearly shows that both non-zippered pMHC chains are productively bound to the surface of the nanoparticles. Valency quantification of pMHC showed that there were 42 pMHC per nanoparticle, a valency comparable to that obtained with conventional pMHC monomers without a zipper.

Example 5 Increasing Autoregulatory T Cells Using pMHC Nanoparticles Without Zips.

[0256] The ability of non-zippered pMHC-coated nanoparticles to trigger the formation and expansion of cognate autoregulatory CD4+ T cells (T-regulatory type 1, TR ₁ ) in vivo has been established, as is the case with their conventional pMHC counterparts (not overhang). - hollow) with lightning. As shown in FIG. 8, cognate (tetramer+) CD4+ T cells increase in vivo in response to treatment with this compound, express TR ₁ -relevant mRNA markers compared to their non-cognate (tetramer-negative) counterparts, as determined by quantitative real-time PCR. In FIG. 9A and FIG. 9B shows that, consistent with this, (tetramer+) CD4+ T cells increase in vivo, unlike their tetramer-negative counterparts, secrete TR ₁ -relevant cytokines when stimulated with anti-CD3 and anti-CD28 monoclonal antibodies ex vivo . Thus, these non-zipper ridge-to-gap pMHC heterodimers have similar biological activity compared to conventional zippered pMHC.

Example 6 Site-directed biotinylation of non-zipper pMHC heterodimers lacking a biotinylation tag (BirA).

[0257] In pMHC obtained for therapeutic purposes, there should be no extraneous protein sequences that can be the target of immunoreactivity, such as a biotinylation sequence that is targeted by the BirA enzyme to attach a biotin molecule. Biotinylation of pMHC via BirA is a technique commonly used to obtain biotinylated pMHC monomers suitable for tetramerization using streptavidin. Such pMHC tetramers and their higher order derivatives (pentamers, dextramers, etc., collectively referred to as "multimers") are useful as reagents capable of enumerating the frequency of antigen-specific T cells in biological samples. Described herein below is a method that allows the production of pMHC multimers from pMHC monomers without biotinylation marks, thus allowing the use of pMHC monomers prepared for therapeutic purposes (e.g., for delivery via nanoparticles) to obtain their diagnostic derivatives.

[0258] This was achieved by attaching one molecule of biotin to the carboxy-terminal cysteine of the BDC2.5mi/IA ^g7 monomers via a biotin-coupled polyethylene glycol (PEG) spacer that is functionalized with maleimide. Briefly, pMHC and biotin-PEG-maleimide linkers of various lengths were incubated overnight and then subjected to extensive dialysis through membranes with a cut-off molecular weight of 12-14 kDa to remove free biotin-PEG-maleimide. The resulting mixture was subjected to anion exchange chromatography on monoQ columns (FIG. 10) to identify eluted fractions containing biotinylated pMHC molecules by ELISA. See peak UV absorbance at 1001 in FIG. 10. Positive fractions were then analyzed on SDS-PAGE denaturing gels. As shown in FIG. 11, fractions 25, 27, 28, 29, 30, 31, 32, 33 and 34 contained the highest concentration of biotinylated pMHC. As shown in FIG. 12, Western blotting for the MHC alpha chain confirmed that fractions 25, 27, 28, 29, 30, 31, 32, 33 and 34 contained a biotinylated MHC heterodimer. The pMHC molecules contained in these fractions were then replaced with buffer and used to prepare pMHC tetramers using fluorochrome-conjugated streptavidin. These pMHC tetramers were then examined for their ability to bind to transgenic CD4+ T cells of the BDC2.5 T cell receptor using flow cytometry (FIG. 13).

[0259] Initial experiments with PEGs of various lengths were unsuccessful. Surprisingly, experiments using low molecular weight biotin-PEG-maleimide, containing only two PEG units, gave successful results, suggesting that the presence of even small amounts of free non-conjugated biotin-PEG-maleimide molecules is sufficient to prevent tetramer formation.

Example 7 Synthesis of PEGylated Fe Nanoparticles (HP) by Thermal Decomposition Method (PFM).

[0260] Materials for synthesis included iron (III) acetylacetonate {Fe(acac) ₃ , Fe(C ₅ H ₇ O ₂ ) ₃ }, M.m. 353.17, (Sigma-Aldrich, cat. no. 517003-50G); benzyl ether {(C ₆ H ₅ CH ₂ ) ₂ O}, M.m. 198.26 (Sigma-Aldrich, cat. no. 108014-1KG); hexane, CH ₃ (CH ₂ ) ₄ CH ₃ , M.m. 86.18 (Sigma-Aldrich, cat. no. 34859-1L); FeCl ₃ .6H ₂ O, M.m. 270.3 (Sigma-Aldrich, cat. no. 44944-50G); mPEG2000-maleimide, (JenKem Tech USA, cat. no. A3214-10);

Hemispherical fabric heating mantle, 50 ml (Safety Emporium, Lab & Consumables, P/N: 20310); Power Management DigiTril II, (Safety Emporium, Lab & Consumables, Item No: 20010); 50 ml round bottom digester flask (VWR, cat. no. 89091-464, connection 24/40); spiral condenser (VWR, catalog # 89053-932, 24/40 connection); swivel centrifuge, (Beckman Coulter, Allegra 25R centrifuge); high speed centrifuge (Sorvall RC-6 Plus, Thermo Scientific) with SS5 rotor; 30 ml glass centrifuge tubes (Corex, #8445) with SS5 rotor adapters; LS columns and magnets (Miltenyi Biotech, p/n 130-042-041); transmission electron microscope (H7650, Hitachi); THERMOMIXER®, (Eppendorf, 24-well); spectrophotometer (UV-2550, SHIMADZU) and microcuvette for spectrophotometry (100 µl).

Reaction protocol:

[0261] A 50 ml boiling flask is placed on a heating mantle on a stirrer. The heating mantle is connected to the DigiTril II power controller. PEG2000-maleimide (1.5 g) is added to the boiling flask. The temperature is set to 80° C. by heating the PEG material until the PEG material is completely melted. Under stirring, benzyl ether (3.5 ml) and Fe(acac) ₃ (353 mg) are added to the boiling flask. The mixture is dehydrated at 110° C. for 1 hour. A spiral condenser is attached to a boiling flask. The mixture is heated to a temperature of 260°C. The color of the mixture turns from black to dark brown. The temperature of the mixture is maintained at 260°C for 2 hours under reflux, after which the mixture is gradually cooled to room temperature. Endotoxin-free water (20 ml) was added to the mixture. The mixture is transferred into one 50 ml conical tube and shaken vigorously for 2 minutes. The mixture is centrifuged at 4000 rpm for 20 minutes using a tabletop centrifuge. The pellets are discarded. Hexane (15 ml) was added to the mixture and the mixture was shaken vigorously for 2 minutes. The mixture is centrifuged at 4000 rpm for 10 minutes using a tabletop centrifuge. The black aqueous fraction (low fraction) from each tube is collected and transferred to a 50 ml conical tube. Washing with hexane is repeated three times. The black solution is transferred into two 30 ml glass centrifuge tubes. Each tube is centrifuged at 20,000 rpm for 20 minutes using a high speed centrifuge. The black solution is transferred to a 50 ml conical tube and the pellets are discarded. The black solution is purified using an LS column (for example, the black solution (2-3 ml) is loaded for purification, the solution is decanted through the column and the column is washed 3 times with 5 ml of water). Purified NP PFMs are collected by pushing the NPs retained in the LS column into a clean 50 ml conical tube. The NP PFM solution is sterilized by passing through a series of syringe filter devices with pore sizes of 0.45 µm, 0.2 µm and 0.1 µm.

Product Feature:

1. Particle size and monodispersity:

1a. Iron oxide core size of individual PFM nanoparticles: analysis by transmission electron microscopy (TEM).

[0262] Sample preparation for TEM analysis: NP PFM solution (20 µl) is diluted in water (40 µl) and the diluted NP PFM solution (10 µl) is dropped onto the surface of a copper grid coated with polyvinylformavar (Electron Microscopy Sciences, catalog # FF300 -Cu) or carbon film (Electron Microscopy Sciences, catalog # CF300-Cu). The residual solution is removed with filter paper.

[0263] TEM analysis is performed using H7650 (Hitachi) at magnification from 10,000 to 40,000 X. Size 30-50 NP PFM is measured to obtain an average size (average size of NP PFM nuclei is expected in the range of 18-20 nm).

1b. Hydrodynamic size NP PFM:

Dynamic light scattering (DLS) analysis.

[0264] The NP PFM solution (20 μl) is diluted in 1 ml of water in a DLS cuvette and examined using the Zeta NanoSizer (Melvern, UK) to determine the size of the DLS NP PFM in solution. A single peak is expected at ~45-50 nm.

2. Iron concentration (spectrophotometric analysis):

2a. Fe concentration standard:

[0265] A 2 mg Fe/ml standard solution is prepared by dissolving FeCl ₃ .6H ₂ O (48.3 mg) in deionized H ₂ O (5 ml). The standard solution (20 µl) is added to 6N. HCl (400 µl) in microtube 1. The diluted standard solution (200 µl) from microtube 1 is transferred to microtube 2 containing 200 µl of 6N. HCl. The diluted standard solution (200 µl) from microtube 2 is transferred to microtube 3 containing 6N. HCl (200 µl). The dilutions are repeated 4 more times.

2b. Sample solution :

[0266] NP PFM solution (20 µl) is added to 6N. HCl (400 µl) in microtube S1 and mix. The diluted NP PFM solution (200 µl) from microtube S1 is transferred to microtube S2 containing 6N. HCl (200 µl). The diluted NP PFM solution (200 µl) from microtube S2 is transferred to microtube S3 containing 6N. HCl (200 µl). The dilution of the NP PFM solution is repeated 3 more times.

2s. Sample heating:

[0267] Microtubes containing serially diluted Fe and NP PFM standard solutions are heated to 60°C for 30 minutes and then cooled to room temperature.

2d. Spectrophotometry:

[0268] The absorbance of Fe and NP PFM standard solutions at A410 (λ=410 nm) is measured using a spectrophotometer with a micro cuvette (100 μl).

2e. Calculations:

[0269] A standard curve is built. Calculate the iron concentration in the NP PFM solution.

3. Surface charge and chemistry

3a. Surface charge NP PFM: Zeta potential measurement.

[0270] The NP PFM solution (100 μl) is diluted with deionized water (1 ml) in a capillary cell. The NP PFM zeta potential was determined using a Zeta NanoSizer device (Melvern, UK).

3b. Analysis of surface exposing functional groups: Fourier transform infrared spectroscopic analysis (FT-IR).

[0271] Control samples: mPEG-Mal samples are placed on an ATR (attenuated total reflection) plate.

[0272] NP PFM samples: NP PFM solution (10 μl) is placed on an ATR plate and air dried.

[0273] FT-IR analysis: FT-IR spectra of the control PEG and PEG fixed on the surface of the PFM-NP are produced by a Nicolet FT-IR spectrophotometer in ATR (attenuated total reflection) mode. Each of the spectra is recorded as the average of 256 scans at a spectral resolution of 4 cm ^-1 .

Example 8 Preparation of pMHC-Nanoparticle (pMHC-PFM) Conjugates.

[0274] Materials for synthesis included phosphate buffer solution (PBS), pH 7.2-7.4; 200 mM phosphate buffer, pH 6.2; pMHC-Cys protein in PBS (1-6 mg/ml, one cysteine residue added to the C-terminus of the pMHC alpha chain via molecular engineering); 1 M sodium chloride solution; 0.5 M EDTA solution, pH 8.0; NP PFM solution (1-3 mg Fe/ml); columns and magnets LS (Miltenyi Biotech, catalog no. 130-042-041); transmission electron microscope (H7650, Hitachi); THERMOMIXER®, (Eppendorf, 24-well); spectrophotometer (UV-2550, SHIMADZU) and a microcuvette for spectrophotometry (100 µl).

Conjugation Reaction Protocol:

[0275] pMHC-cys protein (M.m. ~ 55 kDa) and NP PFM (18-20 nm, approximately 1×10 ¹⁴ NP/mg Fe) are mixed at a molar ratio of 100:1 in 40 mm phosphate buffer, pH 6 ,2 containing 150 mM NaCl and 2 mM EDTA. The total volume of the reaction solution (containing NP PFM equivalent to 1-5 mg Fe) is 10 ml. Recovery rates are expected to be 40-50% for both pMHC protein and PFM-NP. Phosphate buffer, pH 6.2 (2.0 ml) is added to a 15 ml conical tube. Add 0.5 M EDTA solution (0.04 ml) and 1 M sodium chloride solution to bring the final concentration to 150 mm. Water is added to bring the final reaction volume to 10 ml, including the volume of the protein and NP PFM solutions. Add protein pMHC (3 mg). The reaction mixture is incubated overnight at room temperature with gentle shaking. The reaction solution was transferred to a 50 ml conical tube and PBS (30 ml) was added. The reaction solution is incubated for 30 minutes at room temperature with gentle shaking. The reaction solution is purified using an LS column (for example, the reaction solution (5 ml) is charged for purification, the solution is discharged through the column, and the column is washed 3 times with 5 ml PBS). Purified NP PFMs are collected by pushing the NPs retained in the LS column into a 15 ml conical tube. The purified pMHC-PFM NP solution is sterilized by passing through a syringe filter device with a pore size of 0.45 μm. The pMHC-PFM NP solution is stored at 4°C.

Product:

[0276] pMHC-PFM NP with pMHC valence ~ 50 pMHC/NP in PBS, pH 7.4.

Example 9 Biotinylation of pMHC Monomers with Biotin PEG Maleimide.

Biotinylation reaction

[0277] Protein (pMHC class II containing free cysteine in the tail) (5.0 mg) is dissolved in 40 mm phosphate buffer pH 6.2 (2.0 ml) with 2 mm EDTA. PBS (190 μl) was added to EZ-link maleimide-PEG2-biotin (2.0 mg) to make a 20 mM stock solution. (Thermo Scientific: Cat # 21902BID, Description: EZ-Link®, Maleimide-PEG2-Biotin, No-Weigh™ format, 8×2 mg) (prepared fresh each time). The stock solution (78.12 μl) was quickly added to the protein solution (this gives a 20-fold molar excess of maleimide-PEG2-biotin relative to protein). The reaction tube is covered with aluminum foil to protect from light and kept overnight at room temperature with gentle shaking. Excess maleimide-PEG2-biotin is removed by buffer exchange with 20 mM Tris, pH 8.0 using a amicon 10KD ultracentrifugal device (Millipore: catalog # UFC801024) at least 5 times. To ensure that excess maleimide-PEG2-biotin is removed, the protein solution is dialyzed using a 12-14 kDa cut-off membrane (Spectra/Por®: Cat# 132678) in 20 mM Tris, pH 8.0 overnight. (Contamination of excess maleimide-PEG2-biotin may interfere with purification and biotin-specific ELISA screening.) A protein sample is collected for mono-Q purification.

Purification - Mono-Q Ion Exchange Chromatography

[0278] Line A is placed in buffer A [20 mM Tris, pH 8.0], and line B is placed in buffer B [20 mM Tris + 400 mM NaCl]. ddH ₂ O (10-20 ml) is injected into the sampling loop and all but ~0.5 ml is injected manually to flush the sampling loop. The Mono-Q column and flow restrictor adapter (FR902) are attached to the FPLC. The column is equilibrated with buffer A. The protein biotinylation reaction volume is increased with 20 mM Tris, pH 8.0 to 5-10 ml. The mixture is injected with a syringe into a super loop (INV-900). A sample is injected to bind to the column, unbound protein is washed out, and bound protein is eluted with a buffer B gradient. All elution fractions associated with chromatogram peaks are collected. The column was washed after each run according to the manufacturer's protocol, with a wash rate of 0.5 ml/min minimum: 2 ml 2 M NaCl, 4 ml 1 M NaOH and 2 ml 2 M NaCl again. The column is washed with water until the baseline is stable (minimum 2 ml). The column is inverted for cleaning as needed. Lines A and B are placed in 20% ethanol followed by a PumpWash followed by a wash to wash the storage column. The column and flow restrictor are then removed and the sampling loop is cleared of any residual protein.

ELISA for identification of biotinylated monomer

[0279] The ELISA plate is covered with 2-20 µl (depending on the intensity of the peak) of each elution fraction, collected in total up to 100 µl with PBS per well, in duplicate. The plate is incubated at 37°C for 1-2 hours. The positive control is a 1:200 dilution of anti-mouse Kd-biotin. The negative control is PBS. The plates are washed 3 times with 150 μl of 0.05% Tween-20 in PBS. 100 µl HRP-Extravidin (Sigma: Cat # E2886-1ML), 1:2000 dilution in blocking buffer (1% BSA, 0.02% NaN ₃ in PBS) is added per well and the plate is incubated at room temperature for 30 min. The plate is washed 3 times with 150 μl of 0.05% Tween-20 in PBS. Pre-warmed TMB substrate (100 µl) is added per well and the plate is incubated for 15-30 minutes (depending on color change) at room temperature in the dark. 2 n. H ₂ SO ₄ (50 µl) is added per well to stop the reaction. The plates are evaluated at OD _450-570nm . The negative control should have an OD _450-570nm ~ 0.005. A positive control should have an OD _450-570nm ~ 3. A good positive sample has an OD _450-570nm reading of 2 to 3.

SDS-PAGE and Western blotting for the identification of biotinylated monomer

[0280] SDS-PAGE is run for each mono-Q purification fraction (10-20 μl/well, depending on peak intensity) to identify protein fractions with the desired band profile. For Western blotting: run another SDS-PAGE with 2 µg of each fraction per well. The gel is incubated in transfer buffer for 15 minutes (transfer buffer: 25 mM Tris, 190 mM glycine, 20% methanol, pH 8.3). The transfer sandwich is assembled and transferred at a constant voltage of 18 V for 15 minutes. The membrane is incubated with blocking buffer for 1 hour to overnight (blocking buffer: 3% BSA in 20 mM Tris buffer with 150 mM sodium chloride pH 7.5). The membrane is incubated in HRP-extravidin (1:2000 diluted in blocking buffer) for 1 hour at room temperature. The membrane was washed with TBST 5 times (TBST: 20 mM Tris, 150 mM NaCl, 0.1% Tween 20, pH 7.5). The image is obtained by adding a chemiluminescent substrate (Thermo Scientific: cat. no. 34087) (expected to have one band at the alpha chain position).

Collection of biotinylated monomer:

[0281] Depending on the analysis of ELISA, SDS-PAGE and Western blotting, the desired fractions are pooled and buffer exchange with PBS is carried out using an amicon 10KD ultracentrifugal device. The concentration of biotinylated monomer is measured by the Bradford method and aliquoted into several clearly labeled tubes.

[0282] The pMHC tetramer was prepared using streptavidin-PE to stain cognate CD4+ T cells, presumably because the free unconjugated biotin-PEG-maleimide molecules that were in excess could not be properly removed and thus prevent tetramer formation. The material is stored at -80°C.

Example 10 Ridge-in-trough pMHC heterodimers without a cis-trap leucine zipper stabilize pMHC heterodimers.

[0283] For some MHC class II peptide heterodimers, a ridge-to-trough architecture is sufficient. However, some heterodimers require additional stabilization. The HLA DR3 heterodimers complexed with the IGRP _13-25 polypeptide could not be expressed when they were designed with a ridge-in-the-hole design and lacked the leucine zipper, as indicated by the absence of an elution peak in the FPLC 1401 profile in FIG. 14A and an SDS-PAGE gel of the eluted fraction shown in FIG. 14C. When a cysteine was introduced at the C-terminus of IGRP _13-25 between the spacer that connects the IGRP polypeptide to the trough-beta domain (SEQ ID NO: 61) and is expressed by the tang-alpha domain (SEQ ID NO: 60), stable heterodimers. See elution peaks 1402 in FIG. 14B and SDS-PAGE in FIG. 14D.

Example 11 IGRP _13-25 /DR3 pMHC Heterodimers Bind to Cell Lines Expressing Cognate TCR

[0284] The ability of non-zipper cis-trap IGRP _13-25 pMHC-DR3 heterodimers to bind to the T cell receptor was then examined. For this, a reporter cell line expressing the alpha and beta chain of the human T cell receptor specific for IGRP _13-25 pMHC-DR3 was used.

JURMA-hCD4 cell line transduction protocol with a retrovirus encoding IGRP-TCR

[0285] Creation of the GP+EnvAM12 packaging cell line. The present inventors transfected 293T cells with an IGRP-TCR expressing retrovirus and a GFP reporter, as well as gag/pol and VSV packaging constructs. Three days later, the VSV pseudo-typed enriched supernatants were collected, aliquoted and frozen. These aliquots were used to transduce the amphotrophic packaging cell line GP+envAm12 (ATCC CRL-9641) by infection by centrifugation (2700 rpm, 1 h). After 5 infections by centrifugation, the transduced GP+envAm12 was sorted for GFP expression if needed.

Transduction of the JURMA-hCD4 cell line with a retrovirus encoding IGRP-TCR

[0286] Three million transduced and sorted GP+envAm12 were seeded per well of a 6-well plate in a final volume of 3 ml. The next day, 100,000 JURMA-hCD4 were co-cultured with pre-coated transduced GP+envAm12 in a final volume of 3 ml supplemented with 8 μg/ml polybrene. This co-culture was maintained for two weeks, changing medium every 2 or 3 days. After co-culture, JURMA-hCD4 cells were harvested, analyzed by flow cytometry, and sorted for high expression of the transgene. Cells were then stained with PE labeled heterodimers. In FIG. 15A shows unstained cells as a negative control, FIG. 15D shows cells stained with an irrelevant tetramer, FIG. 15B depicts staining with tetramers derived from heterodimers expressed using cis-trap and leucine zipper technology, FIG. 15C depicts tetramers made from heterodimers expressed using cis-trap and trough-to-trough technology without the leucine zipper. Coloring between heterodimers obtained using any technology was stable. These data demonstrate that heterodimers made using cis-trap zipperless technology can bind the T cell receptor.

Example 12 Ridge-in-trough pMHC IGRP13-25/DR3 heterodimers stimulate reporter cell lines in vitro.

[0287] The ability of stabilized cis-trap and ridge-to-trough heterodimers, when attached to iron oxide nanoparticles, to stimulate T-cell signaling was investigated using Jurma cells expressing human TCR IGRP _13-25 and luciferase under the control of the NFAT promoter . These results, shown in FIG. 16A and FIG. 16B show that piss-trap stabilized heterodimers when attached to iron oxide nanoparticles are able to induce T-cell signaling.

[0288] While some embodiments have been illustrated and described, it should be understood that changes and modifications may be made to them in accordance with ordinary skill in the art without departing from the technology in its broader aspects as defined in the following claims.

[0289] The embodiments illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "consisting", etc. should be read broadly and without limitation. In addition, the terms and expressions used herein have been used as terms of description and not limitation, and the use of such terms and expressions is not intended to exclude any equivalents of the features or parts shown and described, but it is recognized that various modifications are possible in within the scope of the claimed technology. In addition, the phrase "consisting essentially of" will be understood to include those elements that are specifically indicated and those additional elements that do not significantly affect the main and new characteristics of the claimed technology. The phrase "consisting of" excludes any element not specified.

[0290] This disclosure should not be limited in terms of specific embodiments described in this application. Many modifications and changes can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and compositions within the scope of this disclosure, in addition to those listed herein, will be apparent to those skilled in the art from the foregoing description. Such modifications and variations are intended to fall within the scope of the appended claims. The present disclosure is to be limited only by the terms of the appended claims, as well as the full scope of the equivalents to which such claims are entitled. It should also be understood that the terminology used herein is only intended to describe specific embodiments and is not intended to be limiting.

[0291] In addition, when features or aspects of the present disclosure are described in terms of Markush groups, those skilled in the art will appreciate that the disclosure is also thus described in terms of any individual member or subgroup of members of the Markush group.

[0292] As will be appreciated by one of ordinary skill in the art, for any and all purposes, especially in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of their subranges. Any of the listed ranges can be easily recognized as being sufficiently descriptive and allowing one and the same range to be broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be easily broken down into lower third, middle third, and upper third, and so on. As will be appreciated by one of skill in the art, all expressions such as "up to", "at least", "more than", "less than" and the like include the number given and refer to ranges that can be further subdivided. into subranges as discussed above. Finally, as will be appreciated by those skilled in the art, the range includes each individual member.

[0293] All publications, patent applications, granted patents, and other documents referred to in this specification are incorporated herein by reference as if each individual publication, patent application, patent granted, or other document were specifically and individually cited for full inclusion by reference. Definitions that are contained in the text incorporated by reference are excluded to the extent that they conflict with the definitions in this disclosure.

[0294] Other embodiments are set forth in the following claims.

--->

SEQUENCE LIST

<110> UTIAI LIMITED PARTNERSHIP

<120> RECOMBINANT PMHC CLASS II MOLECULES

<130> 42363-711.601

<140>

<141>

<150> 62/419.947

<151> 2016-11-09

<160> 65

<170> PatentIn version 3.5

<210> 1

<211> 3171

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 1

atgggttctc tgcaaccgct ggccaccttg tacctgctgg gtatgctggt cgctagcagc 60

ctcggacagc acctgcagaa ggactacaga gcctactaca ccttcggagg tggaggcggc 120

tcaggaggtg gaagcggcgg ctctggggac acccgaccac gtttcttgga gtactctacg 180

tctgagtgtc atttcttcaa tgggacggag cgggtgcggt acctggacag atacttccat 240

aaccaggagg agaacgtgcg cttcgacagc gacgtggggg agttccggggc ggtgacggag 300

ctggggcggc ctgatgccga gtactggaac agccagaagg acctcctgga gcagaagcgg 360

ggccgggtgg acaactactg cagacacaac tacggggttg tggagagctt cacagtgcag 420

cggcgagtcc atcctaaggt gactgtgtat ccttcaaaga cccagcccct gcagcaccat 480

aacctcctgg tctgttctgt gagtggtttc tatccaggca gcattgaagt caggtggttc 540

cggaatggcc aggaagagaa gactggggtg gtgtccacag gcctgatcca caatggagac 600

tggaccttcc agaccctggt gatgctggaa acagttcctc ggagtggaga ggtttacacc 660

tgccaagtgg agcacccaag cgtgacaagc cctctcacag tggaatggag agcacggtct 720

gaatctgcac agagcaagtc cggaggcggga ggcggacgga tcgctcggct agaggaaaaa 780

gtgaaaacct tgaaagcgca aaactccgag ctggcgtcca cggccaacat gctcagggaa 840

caggtggcac agcttaagca gaaagtcatg aaccacgaca aaactcacac atgcccaccg 900

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 960

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 1020

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 1080

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1140

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1200

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1260

tgcaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gagctgcgcg 1320

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1380

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctcgtcagc 1440

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1500

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc cggcggctcc 1560

ggagccacga acttctctct gttaaagcaa gcaggagacg tggaagaaaa ccccggtccc 1620

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcatcaa agaagaacat 1680

gtgatcatcc aggccgagtt ctatctgaat cctgaccaat caggcgagtt tatgtttgac 1740

tttgatggtg atgagatttt ccatgtggat atggcaaaga aggagacggt ctggcggctt 1800

gaagaatttg gacgatttgc cagctttgag gctcaaggtg cattggccaa catagctgtg 1860

gacaaagcca acctggaaat catgacaaag cgctccaact atactccgat caccaatgta 1920

1980

atctgtttca tagacaagtt caccccacca gtggtcaatg tcacgtggct tcgaaatgga 2040

aaacctgtca ccacaggagt gtcagagaca gtcttcctgc ccagggaaga ccaccttttc 2100

2160

gagcactggg gcttggatga gcctcttctc aagcactggg agtttgatgc tccaagccct 2220

2280

acagatcaac ttgaagacga gaagtctgcg ttgcagaccg agattgccaa tctactgaaa 2340

gagaaggaaa aactggagtt tattttggca gcccacgaca aaactcacac atgcccaccg 2400

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 2460

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 2520

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 2580

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 2640

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 2700

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 2760

tacaccctgc ccccatgccg ggatgagctg accaagaacc aggtcagcct gtggtgcctg 2820

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 2880

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 2940

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 3000

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc gggcggtagt 3060

ggtagtggta gtggatctct gggtggtatc ttcgaggcta tgaagatgga gctgcgcgat 3120

caccatcacc atcaccataa ctggagccac cctcagttcg agaagtgttg a 3171

<210> 2

<211> 2931

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide "

<400> 2

atgggttctc tgcaaccgct ggccaccttg tacctgctgg gtatgctggt cgctagcagc 60

ctcggacagc acctgcagaa ggactacaga gcctactaca ccttcggagg tggaggcggc 120

tcaggaggtg gaagcggcgg ctctggggac acccgaccac gtttcttgga gtactctacg 180

tctgagtgtc atttcttcaa tgggacggag cgggtgcggt acctggacag atacttccat 240

aaccagggagg agaacgtgcg cttcgacagc gacgtggggg agttccgggc ggtgacggag 300

ctggggcggc ctgatgccga gtactggaac agccagaagg acctcctgga gcagaagcgg 360

ggccgggtgg acaactactg cagacacaac tacggggttg tggagagctt cacagtgcag 420

cggcgagtcc atcctaaggt gactgtgtat ccttcaaaga cccagcccct gcagcaccat 480

aacctcctgg tctgttctgt gagtggtttc tatccaggca gcattgaagt caggtggttc 540

cggaatggcc aggaagagaa gactggggtg gtgtccacag gcctgatcca caatggagac 600

tggaccttcc agaccctggt gatgctggaa acagttcctc ggagtggaga ggtttacacc 660

tgccaagtgg agcacccaag cgtgacaagc cctctcacag tggaatggag agcacggtct 720

gaatctgcac agagcaagtc cggaggcggga ggcggagaca aaactcacac atgcccaccg 780

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 840

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 900

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 960

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1020

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1080

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1140

tgcaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gagctgcgcg 1200

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1260

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctcgtcagc 1320

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1380

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc cggcggctcc 1440

ggagccga acttctctct gttaaagcaa gcaggagacg tggaagaaaa ccccggtccc 1500

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcatcaa agaagaacat 1560

gtgatcatcc aggccgagtt ctatctgaat cctgaccaat caggcgagtt tatgtttgac 1620

1680

gaagaatttg gacgatttgc cagctttgag gctcaaggtg cattggccaa catagctgtg 1740

gacaaagcca acctggaaat catgacaaag cgctccaact atactccgat caccaatgta 1800

cctccagagg taactgtgct cacaaacagc cctgtggaac tgagagagcc caacgtcctc 1860

atctgtttca tagacaagtt caccccacca gtggtcaatg tcacgtggct tcgaaatgga 1920

aaacctgtca ccacaggagt gtcagagaca gtcttcctgc ccagggaaga ccaccttttc 1980

cgcaagttcc actatctccc cttcctgccc tcaactgagg acgtttacga ctgcagggtg 2040

gagcactggg gcttggatga gcctcttctc aagcactggg agtttgatgc tccaagccct 2100

ctcccagaga ctacagagtc cggaggcggga ggcggagaca aaactcacac atgcccaccg 2160

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 2220

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 2280

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 2340

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 2400

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 2460

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 2520

tacaccctgc ccccatgccg ggatgagctg accaagaacc aggtcagcct gtggtgcctg 2580

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 2640

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 2700

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 2760

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc gggcggtagt 2820

ggtagtggta gtggatctct gggtggtatc ttcgaggcta tgaagatgga gctgcgcgat 2880

caccatcacc atcaccataa ctggagccac cctcagttcg agaagtgttg a 2931

<210> 3

<211> 3168

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 3

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcagatc tgcccaccat 60

cccatctggg cccgaatgga cgccgggaggt ggaggctcac tagtgccccg aggctctgga 120

ggtggaggct ctggagactc cgaaaggcat ttcgtgcacc agttcaaggg cgagtgctac 180

ttcaccaacg ggacgcagcg catacggctc gtgaccagat acatctacaa ccgggaggag 240

tacctgcgct tcgacagcga cgtgggcgag taccgcgcgg tgaccgagct ggggcggcac 300

tcagccgagt actacaataa gcagtacctg gagcgaacgc gggccgagct ggacacggcg 360

tgcagacaca actacgagga gacggaggtc cccacctccc tgcggcggct tgaacagccc 420

aatgtcgcca tctccctgtc caggacagag gccctcaacc accacaacac tctggtctgt 480

tcggtgacag atttctaccc agccaagatc aaagtgcgct ggttcaggaa tggccaggag 540

gagacagtgg gggtctcatc cacacagctt attaggaatg gggactggac cttccaggtc 600

ctggtcatgc tggagatgac ccctcatcag ggagaggtct atacctgcca tgtggagcat 660

cccagcctga agagccccat cactgtggag tggagggcac agtccgagtc tgcccggagc 720

aagtccggag gcggaggcgg acggatcgct cggctagagg aaaaagtgaa aaccttgaaa 780

gcgcaaaact ccgagctggc gtccacggcc aacatgctca gggaacaggt ggcacagctt 840

aagcagaaag tcatgaacca cgacaaaact cacacatgcc caccgtgccc agcacctgaa 900

ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 960

tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc 1020

aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 1080

gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 1140

ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 1200

aaaaccatct ccaaagccaa aggcagccc cgagaaccac aggtgtgcac cctgccccca 1260

tcccgggatg agctgaccaa gaaccaggtc agcctgagct gcgcggtcaa aggcttctat 1320

cccagcgaca tcgccgtgga gtggggagagc aatgggcagc cggagaacaa ctacaagacc 1380

acgcctcccg tgctggactc cgacggctcc ttcttcctcg tcagcaagct caccgtggac 1440

aagagtaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1500

aaccactaca cacagaagag cctctccctg tctcccggcg gctccggagc cacgaacttc 1560

tctctgttaa agcaagcagg agacgtggaa gaaaaccccg gtcccatggc tatcatctac 1620

ctcatcctcc tgttcaccgc tgtgcggggc gaagacgaca ttgaggccga ccacgtaggc 1680

ttctatggta caactgttta tcagtctcct ggagacattg gccagtacac acatgaattt 1740

gatggtgatg agttgttcta tgtggacttg gataagaaga aaactgtctg gaggcttcct 1800

gagtttggcc aattgatact ctttgagccc caaggtggac tgcaaaacat agctgcagaa 1860

aaacacaact tgggaatctt gactaagagg tcaaatttca ccccagctac caatgaggct 1920

cctcaagcga ctgtgttccc caagtcccct gtgctgctgg gtcagcccaa cacccttatc 1980

tgctttgtgg acaacatctt cccacctgtg atcaacatca catggctcag aaatagcaag 2040

tcagtcacag acggcgttta tgagaccagc ttcctcgtca accgtgacca ttccttccac 2100

aagctgtctt atctcacctt catcccttct gatgatgaca tttatgactg caaggtggag 2160

cactggggcc tggaggagcc ggttctgaaa cactgggaac ctgagattcc agcccccatg 2220

tcagagctga cagagtccgg aggcggaggc ggactgacag atacactcca agcggagaca 2280

gatcaacttg aagacgagaa gtctgcgttg cagaccgaga ttgccaatct actgaaagag 2340

aaggaaaaac tggagtttat tttggcagcc cacgacaaaa ctcacacatg cccaccgtgc 2400

ccagcacctg aactcctggggggaccgtca gtcttcctct tccccccaaa acccaaggac 2460

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 2520

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 2580

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 2640

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 2700

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 2760

accctgcccc catgccggga tgagctgacc aagaaccagg tcagcctgtg gtgcctggtc 2820

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 2880

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag 2940

ctcaccgtgg acaagagtag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat 3000

gaggctctgc acaaccacta cacacagaag agcctctccc tgtctccggg cggtagtggt 3060

agtggtagtg gatctctggg tggtatcttc gaggctatga agatggagct gcgcgatcac 3120

catcaccatc accataactg gagccaccct cagttcgaga agtgttga 3168

<210> 4

<211> 2928

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 4

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcagatc tgcccaccat 60

cccatctggg cccgaatgga cgccgggaggt ggaggctcac tagtgccccg aggctctgga 120

ggtggaggct ctggagactc cgaaaggcat ttcgtgcacc agttcaaggg cgagtgctac 180

ttcaccaacg ggacgcagcg catacggctc gtgaccagat acatctacaa ccgggaggag 240

tacctgcgct tcgacagcga cgtgggcgag taccgcgcgg tgaccgagct ggggcggcac 300

tcagccgagt actacaataa gcagtacctg gagcgaacgc gggccgagct ggacacggcg 360

tgcagacaca actacgagga gacggaggtc cccacctccc tgcggcggct tgaacagccc 420

aatgtcgcca tctccctgtc caggacagag gccctcaacc accacaacac tctggtctgt 480

tcggtgacag atttctaccc agccaagatc aaagtgcgct ggttcaggaa tggccaggag 540

gagacagtgg gggtctcatc cacacagctt attaggaatg gggactggac cttccaggtc 600

ctggtcatgc tggagatgac ccctcatcag ggagaggtct atacctgcca tgtggagcat 660

cccagcctga agagccccat cactgtggag tggagggcac agtccgagtc tgcccggagc 720

aagtccggag gcggaggcgg agacaaaact cacacatgcc caccgtgccc agcacctgaa 780

ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 840

tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc 900

aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 960

gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 1020

ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 1080

aaaaccatct ccaaagccaa agggcagccc cgagaaccac aggtgtgcac cctgccccca 1140

tcccgggatg agctgaccaa gaaccaggtc agcctgagct gcgcggtcaa aggcttctat 1200

cccagcgaca tcgccgtgga gtggggagagc aatgggcagc cggagaacaa ctacaagacc 1260

acgcctcccg tgctggactc cgacggctcc ttcttcctcg tcagcaagct caccgtggac 1320

aagagtaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1380

aaccactaca cacagaagag cctctccctg tctcccggcg gctccggagc cacgaacttc 1440

tctctgttaa agcaagcagg agacgtggaa gaaaaccccg gtcccatggc tatcatctac 1500

ctcatcctcc tgttcaccgc tgtgcggggc gaagacgaca ttgaggccga ccacgtaggc 1560

ttctatggta caactgttta tcagtctcct ggagacattg gccagtacac acatgaattt 1620

gatggtgatg agttgttcta tgtggacttg gataagaaga aaactgtctg gaggcttcct 1680

gagtttggcc aattgatact ctttgagccc caaggtggac tgcaaaacat agctgcagaa 1740

aaacacaact tgggaatctt gactaagagg tcaaatttca ccccagctac caatgaggct 1800

cctcaagcga ctgtgttccc caagtcccct gtgctgctgg gtcagcccaa cacccttatc 1860

tgctttgtgg acaacatctt cccacctgtg atcaacatca catggctcag aaatagcaag 1920

tcagtcacag acggcgttta tgagaccagc ttcctcgtca accgtgacca ttccttccac 1980

aagctgtctt atctcacctt catcccttct gatgatgaca tttatgactg caaggtggag 2040

cactggggcc tggaggagcc ggttctgaaa cactgggaac ctgagattcc agcccccatg 2100

tcagagctga cagagtccgg aggcgggaggc ggagacaaaa ctcacacatg cccaccgtgc 2160

ccagcacctg aactcctggggggaccgtca gtcttcctct tccccccaaa acccaaggac 2220

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 2280

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 2340

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 2400

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 2460

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 2520

accctgcccc catgccggga tgagctgacc aagaaccagg tcagcctgtg gtgcctggtc 2580

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 2640

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag 2700

ctcaccgtgg acaagagtag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat 2760

gaggctctgc acaaccacta cacacagaag agcctctccc tgtctccggg cggtagtggt 2820

agtggtagtg gatctctggg tggtatcttc gaggctatga agatggagct gcgcgatcac 2880

catcaccatc accataactg gagccaccct cagttcgaga agtgttga 2928

<210> 5

<211> 3168

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 5

atgggttctc tgcaaccgct ggccaccttg tacctgctgg gtatgctggt cgctagcagc 60

ctcggacagc acctgcagaa ggactacaga gcctactaca ccttcggagg tggaggcggc 120

tcaggaggtg gaagcggcgg ctctggggac acccgaccac gtttcttgga gtactctacg 180

tctgagtgtc atttcttcaa tgggacggag cgggtgcggt acctggacag atacttccat 240

aaccagggagg agaacgtgcg cttcgacagc gacgtggggg agttccgggc ggtgacggag 300

ctggggcggc ctgatgccga gtactggaac agccagaagg acctcctgga gcagaagcgg 360

ggccgggtgg acaactactg cagacacaac tacggggttg tggagagctt cacagtgcag 420

cggcgagtcc atcctaaggt gactgtgtat ccttcaaaga cccagcccct gcagcaccat 480

aacctcctgg tctgttctgt gagtggtttc tatccaggca gcattgaagt caggtggttc 540

cggaatggcc aggaagagaa gactggggtg gtgtccacag gcctgatcca caatggagac 600

tggaccttcc agaccctggt gatgctggaa acagttcctc ggagtggaga ggtttacacc 660

tgccaagtgg agcacccaag cgtgacaagc cctctcacag tggaatggag agcacggtct 720

gaatctgcac agagcaagtc cggaggcgga ggcggacgga tcgctcggct agaggaaaaa 780

gtgaaaacct tgaaagcgca aaactccgag ctggcgtcca cggccaacat gctcagggaa 840

caggtggcac agcttaagca gaaagtcatg aaccacgaca aaactcacac atgcccaccg 900

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 960

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 1020

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 1080

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1140

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1200

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1260

tacaccctgc ccccatgccg ggatgagctg accaagaacc aggtcagcct gtggtgcctg 1320

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1380

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 1440

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1500

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc gggcggctcc 1560

ggagccacga acttctctct gttaaagcaa gcaggagacg tggaagaaaa ccccggtccc 1620

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcatcaa agaagaacat 1680

gtgatcatcc aggccgagtt ctatctgaat cctgaccaat caggcgagtt tatgtttgac 1740

tttgatggtg atgagatttt ccatgtggat atggcaaaga aggagacggt ctggcggctt 1800

gaagaatttg gacgatttgc cagctttgag gctcaaggtg cattggccaa catagctgtg 1860

gacaaagcca acctggaaat catgacaaag cgctccaact atactccgat caccaatgta 1920

1980

atctgtttca tagacaagtt caccccacca gtggtcaatg tcacgtggct tcgaaatgga 2040

aaacctgtca ccacaggagt gtcagagaca gtcttcctgc ccagggaaga ccaccttttc 2100

2160

gagcactggg gcttggatga gcctcttctc aagcactggg agtttgatgc tccaagccct 2220

ctcccagaga ctacagagtc cggaggcgga ggcggactga cagatacact ccaagcggag 2280

acagatcaac ttgaagacga gaagtctgcg ttgcagaccg agattgccaa tctactgaaa 2340

gagaaggaaa aactggagtt tattttggca gcccacgaca aaactcacac atgcccaccg 2400

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 2460

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 2520

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 2580

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 2640

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 2700

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 2760

tgcaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gagctgcgcg 2820

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 2880

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctcgtcagc 2940

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 3000

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc cggcggtagt 3060

ggtagtggta gtggatctct gggtggtatc ttcgaggcta tgaagatgga gctgcgcgat 3120

caccatcacc atcaccataa ctggagccac cctcagttcg agaagtgt 3168

<210> 6

<211> 2928

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 6

atgggttctc tgcaaccgct ggccaccttg tacctgctgg gtatgctggt cgctagcagc 60

ctcggacagc acctgcagaa ggactacaga gcctactaca ccttcggagg tggaggcggc 120

tcaggaggtg gaagcggcgg ctctggggac acccgaccac gtttcttgga gtactctacg 180

tctgagtgtc atttcttcaa tgggacggag cgggtgcggt acctggacag atacttccat 240

aaccagggagg agaacgtgcg cttcgacagc gacgtggggg agttccgggc ggtgacggag 300

ctggggcggc ctgatgccga gtactggaac agccagaagg acctcctgga gcagaagcgg 360

ggccgggtgg acaactactg cagacacaac tacggggttg tggagagctt cacagtgcag 420

cggcgagtcc atcctaaggt gactgtgtat ccttcaaaga cccagcccct gcagcaccat 480

aacctcctgg tctgttctgt gagtggtttc tatccaggca gcattgaagt caggtggttc 540

cggaatggcc aggaagagaa gactggggtg gtgtccacag gcctgatcca caatggagac 600

tggaccttcc agaccctggt gatgctggaa acagttcctc ggagtggaga ggtttacacc 660

tgccaagtgg agcacccaag cgtgacaagc cctctcacag tggaatggag agcacggtct 720

gaatctgcac agagcaagtc cggaggcggga ggcggagaca aaactcacac atgcccaccg 780

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 840

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 900

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 960

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1020

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1080

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1140

tacaccctgc ccccatgccg ggatgagctg accaagaacc aggtcagcct gtggtgcctg 1200

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1260

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 1320

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1380

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc gggcggctcc 1440

ggagccga acttctctct gttaaagcaa gcaggagacg tggaagaaaa ccccggtccc 1500

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcatcaa agaagaacat 1560

gtgatcatcc aggccgagtt ctatctgaat cctgaccaat caggcgagtt tatgtttgac 1620

1680

gaagaatttg gacgatttgc cagctttgag gctcaaggtg cattggccaa catagctgtg 1740

gacaaagcca acctggaaat catgacaaag cgctccaact atactccgat caccaatgta 1800

cctccagagg taactgtgct cacaaacagc cctgtggaac tgagagagcc caacgtcctc 1860

atctgtttca tagacaagtt caccccacca gtggtcaatg tcacgtggct tcgaaatgga 1920

aaacctgtca ccacaggagt gtcagagaca gtcttcctgc ccagggaaga ccaccttttc 1980

cgcaagttcc actatctccc cttcctgccc tcaactgagg acgtttacga ctgcagggtg 2040

gagcactggg gcttggatga gcctcttctc aagcactggg agtttgatgc tccaagccct 2100

ctcccagaga ctacagagtc cggaggcggga ggcggagaca aaactcacac atgcccaccg 2160

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 2220

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 2280

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 2340

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 2400

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 2460

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 2520

tgcaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gagctgcgcg 2580

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 2640

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctcgtcagc 2700

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 2760

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc cggcggtagt 2820

ggtagtggta gtggatctct gggtggtatc ttcgaggcta tgaagatgga gctgcgcgat 2880

caccatcacc atcaccataa ctggagccac cctcagttcg agaagtgt 2928

<210> 7

<211> 3165

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 7

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcagatc tgcccaccat 60

cccatctggg cccgaatgga cgccgggaggt ggaggctcac tagtgccccg aggctctgga 120

ggtggaggct ctggagactc cgaaaggcat ttcgtgcacc agttcaaggg cgagtgctac 180

ttcaccaacg ggacgcagcg catacggctc gtgaccagat acatctacaa ccgggaggag 240

tacctgcgct tcgacagcga cgtgggcgag taccgcgcgg tgaccgagct ggggcggcac 300

tcagccgagt actacaataa gcagtacctg gagcgaacgc gggccgagct ggacacggcg 360

tgcagacaca actacgagga gacggaggtc cccacctccc tgcggcggct tgaacagccc 420

aatgtcgcca tctccctgtc caggacagag gccctcaacc accacaacac tctggtctgt 480

tcggtgacag atttctaccc agccaagatc aaagtgcgct ggttcaggaa tggccaggag 540

gagacagtgg gggtctcatc cacacagctt attaggaatg gggactggac cttccaggtc 600

ctggtcatgc tggagatgac ccctcatcag ggagaggtct atacctgcca tgtggagcat 660

cccagcctga agagccccat cactgtggag tggagggcac agtccgagtc tgcccggagc 720

aagtccggag gcggaggcgg acggatcgct cggctagagg aaaaagtgaa aaccttgaaa 780

gcgcaaaact ccgagctggc gtccacggcc aacatgctca gggaacaggt ggcacagctt 840

aagcagaaag tcatgaacca cgacaaaact cacacatgcc caccgtgccc agcacctgaa 900

ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 960

tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc 1020

aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 1080

gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 1140

ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 1200

aaaaccatct ccaaagccaa aggcagccc cgagaaccac aggtgtacac cctgccccca 1260

tgccgggatg agctgaccaa gaaccaggtc agcctgtggt gcctggtcaa aggcttctat 1320

cccagcgaca tcgccgtgga gtggggagagc aatgggcagc cggagaacaa ctacaagacc 1380

acgcctcccg tgctggactc cgacggctcc ttcttcctct acagcaagct caccgtggac 1440

aagagtaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1500

aaccactaca cacagaagag cctctccctg tctccgggcg gctccggagc cacgaacttc 1560

tctctgttaa agcaagcagg agacgtggaa gaaaaccccg gtcccatggc tatcatctac 1620

ctcatcctcc tgttcaccgc tgtgcggggc gaagacgaca ttgaggccga ccacgtaggc 1680

ttctatggta caactgttta tcagtctcct ggagacattg gccagtacac acatgaattt 1740

gatggtgatg agttgttcta tgtggacttg gataagaaga aaactgtctg gaggcttcct 1800

gagtttggcc aattgatact ctttgagccc caaggtggac tgcaaaacat agctgcagaa 1860

aaacacaact tgggaatctt gactaagagg tcaaatttca ccccagctac caatgaggct 1920

cctcaagcga ctgtgttccc caagtcccct gtgctgctgg gtcagcccaa cacccttatc 1980

tgctttgtgg acaacatctt cccacctgtg atcaacatca catggctcag aaatagcaag 2040

tcagtcacag acggcgttta tgagaccagc ttcctcgtca accgtgacca ttccttccac 2100

aagctgtctt atctcacctt catcccttct gatgatgaca tttatgactg caaggtggag 2160

cactggggcc tggaggagcc ggttctgaaa cactgggaac ctgagattcc agcccccatg 2220

tcagagctga cagagtccgg aggcggaggc ggactgacag atacactcca agcggagaca 2280

gatcaacttg aagacgagaa gtctgcgttg cagaccgaga ttgccaatct actgaaagag 2340

aaggaaaaac tggagtttat tttggcagcc cacgacaaaa ctcacacatg cccaccgtgc 2400

ccagcacctg aactcctggggggaccgtca gtcttcctct tccccccaaa acccaaggac 2460

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 2520

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 2580

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 2640

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 2700

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtgc 2760

accctgcccc catcccggga tgagctgacc aagaaccagg tcagcctgag ctgcgcggtc 2820

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 2880

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct cgtcagcaag 2940

ctcaccgtgg acaagagtag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat 3000

gaggctctgc acaaccacta cacacagaag agcctctccc tgtctcccgg cggtagtggt 3060

agtggtagtg gatctctggg tggtatcttc gaggctatga agatggagct gcgcgatcac 3120

catcaccatc accataactg gagccaccct cagttcgaga agtgt 3165

<210> 8

<211> 2925

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 8

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcagatc tgcccaccat 60

cccatctggg cccgaatgga cgccgggaggt ggaggctcac tagtgccccg aggctctgga 120

ggtggaggct ctggagactc cgaaaggcat ttcgtgcacc agttcaaggg cgagtgctac 180

ttcaccaacg ggacgcagcg catacggctc gtgaccagat acatctacaa ccgggaggag 240

tacctgcgct tcgacagcga cgtgggcgag taccgcgcgg tgaccgagct ggggcggcac 300

tcagccgagt actacaataa gcagtacctg gagcgaacgc gggccgagct ggacacggcg 360

tgcagacaca actacgagga gacggaggtc cccacctccc tgcggcggct tgaacagccc 420

aatgtcgcca tctccctgtc caggacagag gccctcaacc accacaacac tctggtctgt 480

tcggtgacag atttctaccc agccaagatc aaagtgcgct ggttcaggaa tggccaggag 540

gagacagtgg gggtctcatc cacacagctt attaggaatg gggactggac cttccaggtc 600

ctggtcatgc tggagatgac ccctcatcag ggagaggtct atacctgcca tgtggagcat 660

cccagcctga agagccccat cactgtggag tggagggcac agtccgagtc tgcccggagc 720

aagtccggag gcggaggcgg agacaaaact cacacatgcc caccgtgccc agcacctgaa 780

ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 840

tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc 900

aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 960

gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 1020

ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 1080

aaaaccatct ccaaagccaa aggcagccc cgagaaccac aggtgtacac cctgccccca 1140

tgccgggatg agctgaccaa gaaccaggtc agcctgtggt gcctggtcaa aggcttctat 1200

cccagcgaca tcgccgtgga gtggggagagc aatgggcagc cggagaacaa ctacaagacc 1260

acgcctcccg tgctggactc cgacggctcc ttcttcctct acagcaagct caccgtggac 1320

aagagtaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1380

aaccactaca cacagaagag cctctccctg tctccgggcg gctccggagc cacgaacttc 1440

tctctgttaa agcaagcagg agacgtggaa gaaaaccccg gtcccatggc tatcatctac 1500

ctcatcctcc tgttcaccgc tgtgcggggc gaagacgaca ttgaggccga ccacgtaggc 1560

ttctatggta caactgttta tcagtctcct ggagacattg gccagtacac acatgaattt 1620

gatggtgatg agttgttcta tgtggacttg gataagaaga aaactgtctg gaggcttcct 1680

gagtttggcc aattgatact ctttgagccc caaggtggac tgcaaaacat agctgcagaa 1740

aaacacaact tgggaatctt gactaagagg tcaaatttca ccccagctac caatgaggct 1800

cctcaagcga ctgtgttccc caagtcccct gtgctgctgg gtcagcccaa cacccttatc 1860

tgctttgtgg acaacatctt cccacctgtg atcaacatca catggctcag aaatagcaag 1920

tcagtcacag acggcgttta tgagaccagc ttcctcgtca accgtgacca ttccttccac 1980

aagctgtctt atctcacctt catcccttct gatgatgaca tttatgactg caaggtggag 2040

cactggggcc tggaggagcc ggttctgaaa cactgggaac ctgagattcc agcccccatg 2100

tcagagctga cagagtccgg aggcgggaggc ggagacaaaa ctcacacatg cccaccgtgc 2160

ccagcacctg aactcctggggggaccgtca gtcttcctct tccccccaaa acccaaggac 2220

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 2280

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 2340

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 2400

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 2460

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtgc 2520

accctgcccc catcccggga tgagctgacc aagaaccagg tcagcctgag ctgcgcggtc 2580

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 2640

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct cgtcagcaag 2700

ctcaccgtgg acaagagtag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat 2760

gaggctctgc acaaccacta cacacagaag agcctctccc tgtctcccgg cggtagtggt 2820

agtggtagtg gatctctggg tggtatcttc gaggctatga agatggagct gcgcgatcac 2880

catcaccatc accataactg gagccaccct cagttcgaga agtgt 2925

<210> 9

<211> 1554

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 9

atgggttctc tgcaaccgct ggccaccttg tacctgctgg gtatgctggt cgctagcagc 60

ctcggacagc acctgcagaa ggactacaga gcctactaca ccttcggagg tggaggcggc 120

tcaggaggtg gaagcggcgg ctctggggac acccgaccac gtttcttgga gtactctacg 180

tctgagtgtc atttcttcaa tgggacggag cgggtgcggt acctggacag atacttccat 240

aaccagggagg agaacgtgcg cttcgacagc gacgtggggg agttccgggc ggtgacggag 300

ctggggcggc ctgatgccga gtactggaac agccagaagg acctcctgga gcagaagcgg 360

ggccgggtgg acaactactg cagacacaac tacggggttg tggagagctt cacagtgcag 420

cggcgagtcc atcctaaggt gactgtgtat ccttcaaaga cccagcccct gcagcaccat 480

aacctcctgg tctgttctgt gagtggtttc tatccaggca gcattgaagt caggtggttc 540

cggaatggcc aggaagagaa gactggggtg gtgtccacag gcctgatcca caatggagac 600

tggaccttcc agaccctggt gatgctggaa acagttcctc ggagtggaga ggtttacacc 660

tgccaagtgg agcacccaag cgtgacaagc cctctcacag tggaatggag agcacggtct 720

gaatctgcac agagcaagtc cggaggcggga ggcggacgga tcgctcggct agaggaaaaa 780

gtgaaaacct tgaaagcgca aaactccgag ctggcgtcca cggccaacat gctcagggaa 840

caggtggcac agcttaagca gaaagtcatg aaccacgaca aaactcacac atgcccaccg 900

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 960

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 1020

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 1080

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1140

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1200

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1260

tgcaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gagctgcgcg 1320

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1380

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctcgtcagc 1440

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1500

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc cggc 1554

<210> 10

<211> 1554

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 10

atgggttctc tgcaaccgct ggccaccttg tacctgctgg gtatgctggt cgctagcagc 60

ctcggacagc acctgcagaa ggactacaga gcctactaca ccttcggagg tggaggcggc 120

tcaggaggtg gaagcggcgg ctctggggac acccgaccac gtttcttgga gtactctacg 180

tctgagtgtc atttcttcaa tgggacggag cgggtgcggt acctggacag atacttccat 240

aaccagggagg agaacgtgcg cttcgacagc gacgtggggg agttccgggc ggtgacggag 300

ctggggcggc ctgatgccga gtactggaac agccagaagg acctcctgga gcagaagcgg 360

ggccgggtgg acaactactg cagacacaac tacggggttg tggagagctt cacagtgcag 420

cggcgagtcc atcctaaggt gactgtgtat ccttcaaaga cccagcccct gcagcaccat 480

aacctcctgg tctgttctgt gagtggtttc tatccaggca gcattgaagt caggtggttc 540

cggaatggcc aggaagagaa gactggggtg gtgtccacag gcctgatcca caatggagac 600

tggaccttcc agaccctggt gatgctggaa acagttcctc ggagtggaga ggtttacacc 660

tgccaagtgg agcacccaag cgtgacaagc cctctcacag tggaatggag agcacggtct 720

gaatctgcac agagcaagtc cggaggcggga ggcggacgga tcgctcggct agaggaaaaa 780

gtgaaaacct tgaaagcgca aaactccgag ctggcgtcca cggccaacat gctcagggaa 840

caggtggcac agcttaagca gaaagtcatg aaccacgaca aaactcacac atgcccaccg 900

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 960

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 1020

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 1080

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1140

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1200

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1260

tacaccctgc ccccatgccg ggatgagctg accaagaacc aggtcagcct gtggtgcctg 1320

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1380

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 1440

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1500

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc gggc 1554

<210> 11

<211> 1434

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 11

atggctatca tctacctcat ccctctgttc accgctgtgc ggggcatcaa agaagaacat 60

gtgatcatcc aggccgagtt ctatctgaat cctgaccaat caggcgagtt tatgtttgac 120

tttgatggtg atgagatttt ccatgtggat atggcaaaga aggagacggt ctggcggctt 180

gaagaatttg gacgatttgc cagctttgag gctcaaggtg cattggccaa catagctgtg 240

gacaaagcca acctggaaat catgacaaag cgctccaact atactccgat caccaatgta 300

cctccagagg taactgtgct cacaaacagc cctgtggaac tgagagagcc caacgtcctc 360

atctgtttca tagacaagtt caccccacca gtggtcaatg tcacgtggct tcgaaatgga 420

aaacctgtca ccacaggagt gtcagagaca gtcttcctgc ccagggaaga ccaccttttc 480

cgcaagttcc actatctccc cttcctgccc tcaactgagg acgtttacga ctgcagggtg 540

gagcactggg gcttggatga gcctcttctc aagcactggg agtttgatgc tccaagccct 600

ctcccagaga ctacagagtc cggaggcgga ggcggactga cagatacact ccaagcggag 660

acagatcaac ttgaagacga gaagtctgcg ttgcagaccg agattgccaa tctactgaaa 720

gagaaggaaa aactggagtt tattttggca gcccacgaca aaactcacac atgcccaccg 780

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 840

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 900

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 960

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1020

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1080

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1140

tacaccctgc ccccatgccg ggatgagctg accaagaacc aggtcagcct gtggtgcctg 1200

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1260

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 1320

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1380

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc gggc 1434

<210> 12

<211> 1434

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 12

atggctatca tctacctcat ccctctgttc accgctgtgc ggggcatcaa agaagaacat 60

gtgatcatcc aggccgagtt ctatctgaat cctgaccaat caggcgagtt tatgtttgac 120

tttgatggtg atgagatttt ccatgtggat atggcaaaga aggagacggt ctggcggctt 180

gaagaatttg gacgatttgc cagctttgag gctcaaggtg cattggccaa catagctgtg 240

gacaaagcca acctggaaat catgacaaag cgctccaact atactccgat caccaatgta 300

cctccagagg taactgtgct cacaaacagc cctgtggaac tgagagagcc caacgtcctc 360

atctgtttca tagacaagtt caccccacca gtggtcaatg tcacgtggct tcgaaatgga 420

aaacctgtca ccacaggagt gtcagagaca gtcttcctgc ccagggaaga ccaccttttc 480

cgcaagttcc actatctccc cttcctgccc tcaactgagg acgtttacga ctgcagggtg 540

gagcactggg gcttggatga gcctcttctc aagcactggg agtttgatgc tccaagccct 600

ctcccagaga ctacagagtc cggaggcgga ggcggactga cagatacact ccaagcggag 660

acagatcaac ttgaagacga gaagtctgcg ttgcagaccg agattgccaa tctactgaaa 720

gagaaggaaa aactggagtt tattttggca gcccacgaca aaactcacac atgcccaccg 780

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 840

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 900

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 960

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1020

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1080

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1140

tgcaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gagctgcgcg 1200

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1260

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctcgtcagc 1320

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1380

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc cggc 1434

<210> 13

<211> 1434

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 13

atgggttctc tgcaaccgct ggccaccttg tacctgctgg gtatgctggt cgctagcagc 60

ctcggacagc acctgcagaa ggactacaga gcctactaca ccttcggagg tggaggcggc 120

tcaggaggtg gaagcggcgg ctctggggac acccgaccac gtttcttgga gtactctacg 180

tctgagtgtc atttcttcaa tgggacggag cgggtgcggt acctggacag atacttccat 240

aaccagggagg agaacgtgcg cttcgacagc gacgtggggg agttccgggc ggtgacggag 300

ctggggcggc ctgatgccga gtactggaac agccagaagg acctcctgga gcagaagcgg 360

ggccgggtgg acaactactg cagacacaac tacggggttg tggagagctt cacagtgcag 420

cggcgagtcc atcctaaggt gactgtgtat ccttcaaaga cccagcccct gcagcaccat 480

aacctcctgg tctgttctgt gagtggtttc tatccaggca gcattgaagt caggtggttc 540

cggaatggcc aggaagagaa gactggggtg gtgtccacag gcctgatcca caatggagac 600

tggaccttcc agaccctggt gatgctggaa acagttcctc ggagtggaga ggtttacacc 660

tgccaagtgg agcacccaag cgtgacaagc cctctcacag tggaatggag agcacggtct 720

gaatctgcac agagcaagtc cggaggcggga ggcggagaca aaactcacac atgcccaccg 780

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 840

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 900

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 960

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1020

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1080

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1140

tgcaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gagctgcgcg 1200

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1260

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctcgtcagc 1320

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1380

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc cggc 1434

<210> 14

<211> 1434

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 14

atgggttctc tgcaaccgct ggccaccttg tacctgctgg gtatgctggt cgctagcagc 60

ctcggacagc acctgcagaa ggactacaga gcctactaca ccttcggagg tggaggcggc 120

tcaggaggtg gaagcggcgg ctctggggac acccgaccac gtttcttgga gtactctacg 180

tctgagtgtc atttcttcaa tgggacggag cgggtgcggt acctggacag atacttccat 240

aaccagggagg agaacgtgcg cttcgacagc gacgtggggg agttccgggc ggtgacggag 300

ctggggcggc ctgatgccga gtactggaac agccagaagg acctcctgga gcagaagcgg 360

ggccgggtgg acaactactg cagacacaac tacggggttg tggagagctt cacagtgcag 420

cggcgagtcc atcctaaggt gactgtgtat ccttcaaaga cccagcccct gcagcaccat 480

aacctcctgg tctgttctgt gagtggtttc tatccaggca gcattgaagt caggtggttc 540

cggaatggcc aggaagagaa gactggggtg gtgtccacag gcctgatcca caatggagac 600

tggaccttcc agaccctggt gatgctggaa acagttcctc ggagtggaga ggtttacacc 660

tgccaagtgg agcacccaag cgtgacaagc cctctcacag tggaatggag agcacggtct 720

gaatctgcac agagcaagtc cggaggcggga ggcggagaca aaactcacac atgcccaccg 780

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 840

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 900

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 960

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1020

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1080

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1140

tacaccctgc ccccatgccg ggatgagctg accaagaacc aggtcagcct gtggtgcctg 1200

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1260

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 1320

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1380

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc gggc 1434

<210> 15

<211> 1314

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 15

atggctatca tctacctcat ccctctgttc accgctgtgc ggggcatcaa agaagaacat 60

gtgatcatcc aggccgagtt ctatctgaat cctgaccaat caggcgagtt tatgtttgac 120

tttgatggtg atgagatttt ccatgtggat atggcaaaga aggagacggt ctggcggctt 180

gaagaatttg gacgatttgc cagctttgag gctcaaggtg cattggccaa catagctgtg 240

gacaaagcca acctggaaat catgacaaag cgctccaact atactccgat caccaatgta 300

cctccagagg taactgtgct cacaaacagc cctgtggaac tgagagagcc caacgtcctc 360

atctgtttca tagacaagtt caccccacca gtggtcaatg tcacgtggct tcgaaatgga 420

aaacctgtca ccacaggagt gtcagagaca gtcttcctgc ccagggaaga ccaccttttc 480

cgcaagttcc actatctccc cttcctgccc tcaactgagg acgtttacga ctgcagggtg 540

gagcactggg gcttggatga gcctcttctc aagcactggg agtttgatgc tccaagccct 600

ctcccagaga ctacagagtc cggaggcggga ggcggagaca aaactcacac atgcccaccg 660

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 720

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 780

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 840

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 900

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 960

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1020

tacaccctgc ccccatgccg ggatgagctg accaagaacc aggtcagcct gtggtgcctg 1080

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1140

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctctacagc 1200

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1260

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc gggc 1314

<210> 16

<211> 1314

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 16

atggctatca tctacctcat ccctctgttc accgctgtgc ggggcatcaa agaagaacat 60

gtgatcatcc aggccgagtt ctatctgaat cctgaccaat caggcgagtt tatgtttgac 120

tttgatggtg atgagatttt ccatgtggat atggcaaaga aggagacggt ctggcggctt 180

gaagaatttg gacgatttgc cagctttgag gctcaaggtg cattggccaa catagctgtg 240

gacaaagcca acctggaaat catgacaaag cgctccaact atactccgat caccaatgta 300

cctccagagg taactgtgct cacaaacagc cctgtggaac tgagagagcc caacgtcctc 360

atctgtttca tagacaagtt caccccacca gtggtcaatg tcacgtggct tcgaaatgga 420

aaacctgtca ccacaggagt gtcagagaca gtcttcctgc ccagggaaga ccaccttttc 480

cgcaagttcc actatctccc cttcctgccc tcaactgagg acgtttacga ctgcagggtg 540

gagcactggg gcttggatga gcctcttctc aagcactggg agtttgatgc tccaagccct 600

ctcccagaga ctacagagtc cggaggcggga ggcggagaca aaactcacac atgcccaccg 660

tgcccagcac ctgaactcct ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 720

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 780

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 840

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 900

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 960

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1020

tgcaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gagctgcgcg 1080

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1140

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctcgtcagc 1200

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1260

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc cggc 1314

<210> 17

<211> 1539

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 17

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcagatc tgcccaccat 60

cccatctggg cccgaatgga cgccgggaggt ggaggctcac tagtgccccg aggctctgga 120

ggtggaggct ctggagactc cgaaaggcat ttcgtgcacc agttcaaggg cgagtgctac 180

ttcaccaacg ggacgcagcg catacggctc gtgaccagat acatctacaa ccgggaggag 240

tacctgcgct tcgacagcga cgtgggcgag taccgcgcgg tgaccgagct ggggcggcac 300

tcagccgagt actacaataa gcagtacctg gagcgaacgc gggccgagct ggacacggcg 360

tgcagacaca actacgagga gacggaggtc cccacctccc tgcggcggct tgaacagccc 420

aatgtcgcca tctccctgtc caggacagag gccctcaacc accacaacac tctggtctgt 480

tcggtgacag atttctaccc agccaagatc aaagtgcgct ggttcaggaa tggccaggag 540

gagacagtgg gggtctcatc cacacagctt attaggaatg gggactggac cttccaggtc 600

ctggtcatgc tggagatgac ccctcatcag ggagaggtct atacctgcca tgtggagcat 660

cccagcctga agagccccat cactgtggag tggagggcac agtccgagtc tgcccggagc 720

aagtccggag gcggaggcgg acggatcgct cggctagagg aaaaagtgaa aaccttgaaa 780

gcgcaaaact ccgagctggc gtccacggcc aacatgctca gggaacaggt ggcacagctt 840

aagcagaaag tcatgaacca cgacaaaact cacacatgcc caccgtgccc agcacctgaa 900

ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 960

tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc 1020

aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 1080

gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 1140

ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 1200

aaaaccatct ccaaagccaa aggcagccc cgagaaccac aggtgtgcac cctgccccca 1260

tcccgggatg agctgaccaa gaaccaggtc agcctgagct gcgcggtcaa aggcttctat 1320

cccagcgaca tcgccgtgga gtggggagagc aatgggcagc cggagaacaa ctacaagacc 1380

acgcctcccg tgctggactc cgacggctcc ttcttcctcg tcagcaagct caccgtggac 1440

aagagtaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1500

aaccactaca cacagaagag cctctccctg tctcccggc 1539

<210> 18

<211> 1539

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 18

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcagatc tgcccaccat 60

cccatctggg cccgaatgga cgccgggaggt ggaggctcac tagtgccccg aggctctgga 120

ggtggaggct ctggagactc cgaaaggcat ttcgtgcacc agttcaaggg cgagtgctac 180

ttcaccaacg ggacgcagcg catacggctc gtgaccagat acatctacaa ccgggaggag 240

tacctgcgct tcgacagcga cgtgggcgag taccgcgcgg tgaccgagct ggggcggcac 300

tcagccgagt actacaataa gcagtacctg gagcgaacgc gggccgagct ggacacggcg 360

tgcagacaca actacgagga gacggaggtc cccacctccc tgcggcggct tgaacagccc 420

aatgtcgcca tctccctgtc caggacagag gccctcaacc accacaacac tctggtctgt 480

tcggtgacag atttctaccc agccaagatc aaagtgcgct ggttcaggaa tggccaggag 540

gagacagtgg gggtctcatc cacacagctt attaggaatg gggactggac cttccaggtc 600

ctggtcatgc tggagatgac ccctcatcag ggagaggtct atacctgcca tgtggagcat 660

cccagcctga agagccccat cactgtggag tggagggcac agtccgagtc tgcccggagc 720

aagtccggag gcggaggcgg acggatcgct cggctagagg aaaaagtgaa aaccttgaaa 780

gcgcaaaact ccgagctggc gtccacggcc aacatgctca gggaacaggt ggcacagctt 840

aagcagaaag tcatgaacca cgacaaaact cacacatgcc caccgtgccc agcacctgaa 900

ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 960

tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc 1020

aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 1080

gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 1140

ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 1200

aaaaccatct ccaaagccaa aggcagccc cgagaaccac aggtgtacac cctgccccca 1260

tgccgggatg agctgaccaa gaaccaggtc agcctgtggt gcctggtcaa aggcttctat 1320

cccagcgaca tcgccgtgga gtggggagagc aatgggcagc cggagaacaa ctacaagacc 1380

acgcctcccg tgctggactc cgacggctcc ttcttcctct acagcaagct caccgtggac 1440

aagagtaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1500

aaccactaca cacagaagag cctctccctg tctccggggc 1539

<210> 19

<211> 1446

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 19

atggctatca tctacctcat ccctctgttc accgctgtgc ggggcgaaga cgacattgag 60

gccgaccacg taggcttcta tggtacaact gtttatcagt ctcctggaga cattggccag 120

tacacacatg aatttgatgg tgatgagttg ttctatgtgg acttggataa gaagaaaact 180

gtctggaggc ttcctgagtt tggccaattg atactctttg agccccaagg tggactgcaa 240

aacatagctg cagaaaaaca caacttggga atcttgacta agaggtcaaa tttcacccca 300

gctaccaatg aggctcctca agcgactgtg ttccccaagt cccctgtgct gctgggtcag 360

cccaacaccc ttatctgctt tgtggacaac atcttcccac ctgtgatcaa catcacatgg 420

ctcagaaata gcaagtcagt cacagacggc gtttatgaga ccagcttcct cgtcaaccgt 480

gaccattcct tccacaagct gtcttatctc accttcatcc cttctgatga tgacatttat 540

gactgcaagg tggagcactg gggcctggag gagccggttc tgaaacactg ggaacctgag 600

attccagccc

ctccaagcgg agacagatca acttgaagac gagaagtctg cgttgcagac cgagattgcc 720

aatctactga aagagaagga aaaactggag tttattttgg cagcccacga caaaactcac 780

acatgcccac cgtgcccagc acctgaactc ctggggggac cgtcagtctt cctcttcccc 840

ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg 900

gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 960

cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 1020

gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 1080

aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 1140

gaaccacagg tgtacaccct gcccccatgc cgggatgagc tgaccaagaa ccaggtcagc 1200

ctgtggtgcc tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 1260

gggcagccgg agaacaacta caagaccacg cctcccgtgc tggactccga cggctccttc 1320

ttcctctaca gcaagctcac cgtggacaag agtaggtggc agcaggggaa cgtcttctca 1380

tgctccgtga tgcatgaggc tctgcacaac cactacacac agaagagcct ctccctgtct 1440

ccgggc 1446

<210> 20

<211> 1446

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 20

atggctatca tctacctcat ccctctgttc accgctgtgc ggggcgaaga cgacattgag 60

gccgaccacg taggcttcta tggtacaact gtttatcagt ctcctggaga cattggccag 120

tacacacatg aatttgatgg tgatgagttg ttctatgtgg acttggataa gaagaaaact 180

gtctggaggc ttcctgagtt tggccaattg atactctttg agccccaagg tggactgcaa 240

aacatagctg cagaaaaaca caacttggga atcttgacta agaggtcaaa tttcacccca 300

gctaccaatg aggctcctca agcgactgtg ttccccaagt cccctgtgct gctgggtcag 360

cccaacaccc ttatctgctt tgtggacaac atcttcccac ctgtgatcaa catcacatgg 420

ctcagaaata gcaagtcagt cacagacggc gtttatgaga ccagcttcct cgtcaaccgt 480

gaccattcct tccacaagct gtcttatctc accttcatcc cttctgatga tgacatttat 540

gactgcaagg tggagcactg gggcctggag gagccggttc tgaaacactg ggaacctgag 600

attccagccc

ctccaagcgg agacagatca acttgaagac gagaagtctg cgttgcagac cgagattgcc 720

aatctactga aagagaagga aaaactggag tttattttgg cagcccacga caaaactcac 780

acatgcccac cgtgcccagc acctgaactc ctggggggac cgtcagtctt cctcttcccc 840

ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg 900

gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 960

cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 1020

gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 1080

aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 1140

gaaccacagg tgtgcaccct gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc 1200

ctgagctgcg cggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 1260

gggcagccgg agaacaacta caagaccacg cctcccgtgc tggactccga cggctccttc 1320

ttcctcgtca gcaagctcac cgtggacaag agtaggtggc agcaggggaa cgtcttctca 1380

tgctccgtga tgcatgaggc tctgcacaac cactacacac agaagagcct ctccctgtct 1440

cccggc 1446

<210> 21

<211> 1419

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 21

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcagatc tgcccaccat 60

cccatctggg cccgaatgga cgccgggaggt ggaggctcac tagtgccccg aggctctgga 120

ggtggaggct ctggagactc cgaaaggcat ttcgtgcacc agttcaaggg cgagtgctac 180

ttcaccaacg ggacgcagcg catacggctc gtgaccagat acatctacaa ccgggaggag 240

tacctgcgct tcgacagcga cgtgggcgag taccgcgcgg tgaccgagct ggggcggcac 300

tcagccgagt actacaataa gcagtacctg gagcgaacgc gggccgagct ggacacggcg 360

tgcagacaca actacgagga gacggaggtc cccacctccc tgcggcggct tgaacagccc 420

aatgtcgcca tctccctgtc caggacagag gccctcaacc accacaacac tctggtctgt 480

tcggtgacag atttctaccc agccaagatc aaagtgcgct ggttcaggaa tggccaggag 540

gagacagtgg gggtctcatc cacacagctt attaggaatg gggactggac cttccaggtc 600

ctggtcatgc tggagatgac ccctcatcag ggagaggtct atacctgcca tgtggagcat 660

cccagcctga agagccccat cactgtggag tggagggcac agtccgagtc tgcccggagc 720

aagtccggag gcggaggcgg agacaaaact cacacatgcc caccgtgccc agcacctgaa 780

ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 840

tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc 900

aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 960

gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 1020

ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 1080

aaaaccatct ccaaagccaa agggcagccc cgagaaccac aggtgtgcac cctgccccca 1140

tcccgggatg agctgaccaa gaaccaggtc agcctgagct gcgcggtcaa aggcttctat 1200

cccagcgaca tcgccgtgga gtggggagagc aatgggcagc cggagaacaa ctacaagacc 1260

acgcctcccg tgctggactc cgacggctcc ttcttcctcg tcagcaagct caccgtggac 1320

aagagtaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1380

aaccactaca cacagaagag cctctccctg tctcccggc 1419

<210> 22

<211> 1419

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 22

atggctatca tctacctcat cctcctgttc accgctgtgc ggggcagatc tgcccaccat 60

cccatctggg cccgaatgga cgccgggaggt ggaggctcac tagtgccccg aggctctgga 120

ggtggaggct ctggagactc cgaaaggcat ttcgtgcacc agttcaaggg cgagtgctac 180

ttcaccaacg ggacgcagcg catacggctc gtgaccagat acatctacaa ccgggaggag 240

tacctgcgct tcgacagcga cgtgggcgag taccgcgcgg tgaccgagct ggggcggcac 300

tcagccgagt actacaataa gcagtacctg gagcgaacgc gggccgagct ggacacggcg 360

tgcagacaca actacgagga gacggaggtc cccacctccc tgcggcggct tgaacagccc 420

aatgtcgcca tctccctgtc caggacagag gccctcaacc accacaacac tctggtctgt 480

tcggtgacag atttctaccc agccaagatc aaagtgcgct ggttcaggaa tggccaggag 540

gagacagtgg gggtctcatc cacacagctt attaggaatg gggactggac cttccaggtc 600

ctggtcatgc tggagatgac ccctcatcag ggagaggtct atacctgcca tgtggagcat 660

cccagcctga agagccccat cactgtggag tggagggcac agtccgagtc tgcccggagc 720

aagtccggag gcggaggcgg agacaaaact cacacatgcc caccgtgccc agcacctgaa 780

ctcctggggg gaccgtcagt cttcctcttc cccccaaaac ccaaggacac cctcatgatc 840

tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc 900

aagttcaact ggtacgtgga cggcgtggag gtgcataatg ccaagacaaa gccgcgggag 960

gagcagtaca acagcacgta ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg 1020

ctgaatggca aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag 1080

aaaaccatct ccaaagccaa aggcagccc cgagaaccac aggtgtacac cctgccccca 1140

tgccgggatg agctgaccaa gaaccaggtc agcctgtggt gcctggtcaa aggcttctat 1200

cccagcgaca tcgccgtgga gtggggagagc aatgggcagc cggagaacaa ctacaagacc 1260

acgcctcccg tgctggactc cgacggctcc ttcttcctct acagcaagct caccgtggac 1320

aagagtaggt ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac 1380

aaccactaca cacagaagag cctctccctg tctccggggc 1419

<210> 23

<211> 1326

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 23

atggctatca tctacctcat ccctctgttc accgctgtgc ggggcgaaga cgacattgag 60

gccgaccacg taggcttcta tggtacaact gtttatcagt ctcctggaga cattggccag 120

tacacacatg aatttgatgg tgatgagttg ttctatgtgg acttggataa gaagaaaact 180

gtctggaggc ttcctgagtt tggccaattg atactctttg agccccaagg tggactgcaa 240

aacatagctg cagaaaaaca caacttggga atcttgacta agaggtcaaa tttcacccca 300

gctaccaatg aggctcctca agcgactgtg ttccccaagt cccctgtgct gctgggtcag 360

cccaacaccc ttatctgctt tgtggacaac atcttcccac ctgtgatcaa catcacatgg 420

ctcagaaata gcaagtcagt cacagacggc gtttatgaga ccagcttcct cgtcaaccgt 480

gaccattcct tccacaagct gtcttatctc accttcatcc cttctgatga tgacatttat 540

gactgcaagg tggagcactg gggcctggag gagccggttc tgaaacactg ggaacctgag 600

attccagccc ccatgtcaga gctgacagag tccggaggcg gaggcggaga caaaactcac 660

acatgcccac cgtgcccagc acctgaactc ctggggggac cgtcagtctt cctcttcccc 720

ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg 780

gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 840

cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 900

gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 960

aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 1020

gaaccacagg tgtacaccct gcccccatgc cgggatgagc tgaccaagaa ccaggtcagc 1080

ctgtggtgcc tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 1140

gggcagccgg agaacaacta caagaccacg cctcccgtgc tggactccga cggctccttc 1200

ttcctctaca gcaagctcac cgtggacaag agtaggtggc agcaggggaa cgtcttctca 1260

tgctccgtga tgcatgaggc tctgcacaac cactacacac agaagagcct ctccctgtct 1320

ccgggc 1326

<210> 24

<211> 1326

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 24

atggctatca tctacctcat ccctctgttc accgctgtgc ggggcgaaga cgacattgag 60

gccgaccacg taggcttcta tggtacaact gtttatcagt ctcctggaga cattggccag 120

tacacacatg aatttgatgg tgatgagttg ttctatgtgg acttggataa gaagaaaact 180

gtctggaggc ttcctgagtt tggccaattg atactctttg agccccaagg tggactgcaa 240

aacatagctg cagaaaaaca caacttggga atcttgacta agaggtcaaa tttcacccca 300

gctaccaatg aggctcctca agcgactgtg ttccccaagt cccctgtgct gctgggtcag 360

cccaacaccc ttatctgctt tgtggacaac atcttcccac ctgtgatcaa catcacatgg 420

ctcagaaata gcaagtcagt cacagacggc gtttatgaga ccagcttcct cgtcaaccgt 480

gaccattcct tccacaagct gtcttatctc accttcatcc cttctgatga tgacatttat 540

gactgcaagg tggagcactg gggcctggag gagccggttc tgaaacactg ggaacctgag 600

attccagccc ccatgtcaga gctgacagag tccggaggcg gaggcggaga caaaactcac 660

acatgcccac cgtgcccagc acctgaactc ctggggggac cgtcagtctt cctcttcccc 720

ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg 780

gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 840

cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 900

gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 960

aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 1020

gaaccacagg tgtgcaccct gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc 1080

ctgagctgcg cggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 1140

gggcagccgg agaacaacta caagaccacg cctcccgtgc tggactccga cggctccttc 1200

ttcctcgtca gcaagctcac cgtggacaag agtaggtggc agcaggggaa cgtcttctca 1260

tgctccgtga tgcatgaggc tctgcacaac cactacacac agaagagcct ctccctgtct 1320

cccggc 1326

<210> 25

<211> 678

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 25

gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60

ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120

tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180

ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac 240

cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 300

tgcaaagtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa 360

gggcagcccc gagaaccaca ggtgtgcacc ctgcccccat cccgggatga gctgaccaag 420

aaccaggtca gcctgagctg cgcggtcaaa ggcttctatc ccagcgacat cgccgtggag 480

tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 540

gacggctcct tcttcctcgt cagcaagctc accgtggaca agagcaggtg gcagcagggg 600

aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac acagaagagc 660

ctctccctgt ctcccggc 678

<210> 26

<211> 678

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polynucleotide"

<400> 26

gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60

ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120

tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180

ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac 240

cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 300

tgcaaagtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa 360

gggcagcccc gagaaccaca ggtgtacacc ctgcccccat gccgggatga gctgaccaag 420

aaccaggtca gcctgtggtg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480

tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 540

gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600

aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac acagaagagc 660

ctctccctgt ctccggggc 678

<210> 27

<211> 1056

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 27

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Phe Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Arg Ile Ala Arg

245 250 255

Leu Glu Glu Lys Val Lys Thr Leu Lys Ala Gln Asn Ser Glu Leu Ala

260 265 270

Ser Thr Ala Asn Met Leu Arg Glu Gln Val Ala Gln Leu Lys Gln Lys

275 280 285

Val Met Asn His Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

290 295 300

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

305 310 315 320

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

325 330 335

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

340 345 350

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

355 360 365

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

370 375 380

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

385 390 395 400

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

405 410 415

Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys

420 425 430

Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe Tyr Pro Ser Asp

435 440 445

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

450 455 460

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Val Ser

465 470 475 480

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

485 490 495

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

500 505 510

Leu Ser Leu Ser Pro Gly Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu

515 520 525

Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Ile Ile

530 535 540

Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Ile Lys Glu Glu His

545 550 555 560

Val Ile Ile Gln Ala Glu Phe Tyr Leu Asn Pro Asp Gln Ser Gly Glu

565 570 575

Phe Met Phe Asp Phe Asp Gly Asp Glu Ile Phe His Val Asp Met Ala

580 585 590

Lys Lys Glu Thr Val Trp Arg Leu Glu Glu Phe Gly Arg Phe Ala Ser

595 600 605

Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile Ala Val Asp Lys Ala Asn

610 615 620

Leu Glu Ile Met Thr Lys Arg Ser Asn Tyr Thr Pro Ile Thr Asn Val

625 630 635 640

Pro Pro Glu Val Thr Val Leu Thr Asn Ser Pro Val Glu Leu Arg Glu

645 650 655

Pro Asn Val Leu Ile Cys Phe Ile Asp Lys Phe Thr Pro Pro Val Val

660 665 670

Asn Val Thr Trp Leu Arg Asn Gly Lys Pro Val Thr Thr Gly Val Ser

675 680 685

Glu Thr Val Phe Leu Pro Arg Glu Asp His Leu Phe Arg Lys Phe His

690 695 700

Tyr Leu Pro Phe Leu Pro Ser Thr Glu Asp Val Tyr Asp Cys Arg Val

705 710 715 720

Glu His Trp Gly Leu Asp Glu Pro Leu Leu Lys His Trp Glu Phe Asp

725 730 735

Ala Pro Ser Pro Leu Pro Glu Thr Thr Glu Ser Gly Gly Gly Gly Gly

740 745 750

Leu Thr Asp Thr Leu Gln Ala Glu Thr Asp Gln Leu Glu Asp Glu Lys

755 760 765

Ser Ala Leu Gln Thr Glu Ile Ala Asn Leu Leu Lys Glu Lys Glu Lys

770 775 780

Leu Glu Phe Ile Leu Ala Ala His Asp Lys Thr His Thr Cys Pro Pro

785 790 795 800

Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro

805 810 815

Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr

820 825 830

Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn

835 840 845

Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg

850 855 860

Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val

865 870 875 880

Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser

885 890 895

Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys

900 905 910

Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp

915 920 925

Glu Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe

930 935 940

Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu

945 950 955 960

Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe

965 970 975

Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly

980 985 990

Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr

995 1000 1005

Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Gly

1010 1015 1020

Ser Gly Ser Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu Leu

1025 1030 1035

Arg Asp His His His His His His Asn Trp Ser His Pro Gln Phe

1040 1045 1050

Glu Lys Cys

1055

<210> 28

<211> 976

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 28

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Phe Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His

245 250 255

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

260 265 270

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

275 280 285

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

290 295 300

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

305 310 315 320

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

325 330 335

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

340 345 350

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

355 360 365

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro

370 375 380

Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala

385 390 395 400

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

405 410 415

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

420 425 430

Asp Gly Ser Phe Phe Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg

435 440 445

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

450 455 460

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser

465 470 475 480

Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu

485 490 495

Asn Pro Gly Pro Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala

500 505 510

Val Arg Gly Ile Lys Glu Glu His Val Ile Ile Gln Ala Glu Phe Tyr

515 520 525

Leu Asn Pro Asp Gln Ser Gly Glu Phe Met Phe Asp Phe Asp Gly Asp

530 535 540

Glu Ile Phe His Val Asp Met Ala Lys Lys Glu Thr Val Trp Arg Leu

545 550 555 560

Glu Glu Phe Gly Arg Phe Ala Ser Phe Glu Ala Gln Gly Ala Leu Ala

565 570 575

Asn Ile Ala Val Asp Lys Ala Asn Leu Glu Ile Met Thr Lys Arg Ser

580 585 590

Asn Tyr Thr Pro Ile Thr Asn Val Pro Pro Glu Val Thr Val Leu Thr

595 600 605

Asn Ser Pro Val Glu Leu Arg Glu Pro Asn Val Leu Ile Cys Phe Ile

610 615 620

Asp Lys Phe Thr Pro Pro Val Val Asn Val Thr Trp Leu Arg Asn Gly

625 630 635 640

Lys Pro Val Thr Thr Gly Val Ser Glu Thr Val Phe Leu Pro Arg Glu

645 650 655

Asp His Leu Phe Arg Lys Phe His Tyr Leu Pro Phe Leu Pro Ser Thr

660 665 670

Glu Asp Val Tyr Asp Cys Arg Val Glu His Trp Gly Leu Asp Glu Pro

675 680 685

Leu Leu Lys His Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro Glu Thr

690 695 700

Thr Glu Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro

705 710 715 720

Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro

725 730 735

Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr

740 745 750

Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn

755 760 765

Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg

770 775 780

Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val

785 790 795 800

Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser

805 810 815

Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys

820 825 830

Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp

835 840 845

Glu Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe

850 855 860

Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu

865 870 875 880

Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe

885 890 895

Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly

900 905 910

Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr

915 920 925

Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Gly Ser

930 935 940

Gly Ser Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu Leu Arg Asp

945 950 955 960

His His His His His His Asn Trp Ser His Pro Gln Phe Glu Lys Cys

965 970 975

<210> 29

<211> 1055

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 29

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Arg

1 5 10 15

Ser Ala His His Pro Ile Trp Ala Arg Met Asp Ala Gly Gly Gly Gly

20 25 30

Ser Leu Val Pro Arg Gly Ser Gly Gly Gly Gly Ser Gly Asp Ser Glu

35 40 45

Arg His Phe Val His Gln Phe Lys Gly Glu Cys Tyr Phe Thr Asn Gly

50 55 60

Thr Gln Arg Ile Arg Leu Val Thr Arg Tyr Ile Tyr Asn Arg Glu Glu

65 70 75 80

Tyr Leu Arg Phe Asp Ser Asp Val Gly Glu Tyr Arg Ala Val Thr Glu

85 90 95

Leu Gly Arg His Ser Ala Glu Tyr Tyr Asn Lys Gln Tyr Leu Glu Arg

100 105 110

Thr Arg Ala Glu Leu Asp Thr Ala Cys Arg His Asn Tyr Glu Glu Thr

115 120 125

Glu Val Pro Thr Ser Leu Arg Arg Leu Glu Gln Pro Asn Val Ala Ile

130 135 140

Ser Leu Ser Arg Thr Glu Ala Leu Asn His His Asn Thr Leu Val Cys

145 150 155 160

Ser Val Thr Asp Phe Tyr Pro Ala Lys Ile Lys Val Arg Trp Phe Arg

165 170 175

Asn Gly Gln Glu Glu Thr Val Gly Val Ser Ser Thr Gln Leu Ile Arg

180 185 190

Asn Gly Asp Trp Thr Phe Gln Val Leu Val Met Leu Glu Met Thr Pro

195 200 205

His Gln Gly Glu Val Tyr Thr Cys His Val Glu His Pro Ser Leu Lys

210 215 220

Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser Glu Ser Ala Arg Ser

225 230 235 240

Lys Ser Gly Gly Gly Gly Gly Arg Ile Ala Arg Leu Glu Glu Lys Val

245 250 255

Lys Thr Leu Lys Ala Gln Asn Ser Glu Leu Ala Ser Thr Ala Asn Met

260 265 270

Leu Arg Glu Gln Val Ala Gln Leu Lys Gln Lys Val Met Asn His Asp

275 280 285

Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly

290 295 300

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

305 310 315 320

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

325 330 335

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

340 345 350

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

355 360 365

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

370 375 380

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

385 390 395 400

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Cys

405 410 415

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

420 425 430

Ser Cys Ala Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

435 440 445

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

450 455 460

Leu Asp Ser Asp Gly Ser Phe Phe Leu Val Ser Lys Leu Thr Val Asp

465 470 475 480

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

485 490 495

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

500 505 510

Gly Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp

515 520 525

Val Glu Glu Asn Pro Gly Pro Met Ala Ile Ile Tyr Leu Ile Leu Leu

530 535 540

Phe Thr Ala Val Arg Gly Glu Asp Asp Ile Glu Ala Asp His Val Gly

545 550 555 560

Phe Tyr Gly Thr Thr Val Tyr Gln Ser Pro Gly Asp Ile Gly Gln Tyr

565 570 575

Thr His Glu Phe Asp Gly Asp Glu Leu Phe Tyr Val Asp Leu Asp Lys

580 585 590

Lys Lys Thr Val Trp Arg Leu Pro Glu Phe Gly Gln Leu Ile Leu Phe

595 600 605

Glu Pro Gln Gly Gly Leu Gln Asn Ile Ala Ala Glu Lys His Asn Leu

610 615 620

Gly Ile Leu Thr Lys Arg Ser Asn Phe Thr Pro Ala Thr Asn Glu Ala

625 630 635 640

Pro Gln Ala Thr Val Phe Pro Lys Ser Pro Val Leu Leu Gly Gln Pro

645 650 655

Asn Thr Leu Ile Cys Phe Val Asp Asn Ile Phe Pro Pro Val Ile Asn

660 665 670

Ile Thr Trp Leu Arg Asn Ser Lys Ser Val Thr Asp Gly Val Tyr Glu

675 680 685

Thr Ser Phe Leu Val Asn Arg Asp His Ser Phe His Lys Leu Ser Tyr

690 695 700

Leu Thr Phe Ile Pro Ser Asp Asp Asp Ile Tyr Asp Cys Lys Val Glu

705 710 715 720

His Trp Gly Leu Glu Glu Pro Val Leu Lys His Trp Glu Pro Glu Ile

725 730 735

Pro Ala Pro Met Ser Glu Leu Thr Glu Ser Gly Gly Gly Gly Gly Leu

740 745 750

Thr Asp Thr Leu Gln Ala Glu Thr Asp Gln Leu Glu Asp Glu Lys Ser

755 760 765

Ala Leu Gln Thr Glu Ile Ala Asn Leu Leu Lys Glu Lys Glu Lys Leu

770 775 780

Glu Phe Ile Leu Ala Ala His Asp Lys Thr His Thr Cys Pro Pro Cys

785 790 795 800

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

805 810 815

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

820 825 830

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

835 840 845

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

850 855 860

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

865 870 875 880

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

885 890 895

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

900 905 910

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp Glu

915 920 925

Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe Tyr

930 935 940

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

945 950 955 960

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

965 970 975

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

980 985 990

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

995 1000 1005

Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Gly Ser

1010 1015 1020

Gly Ser Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu Leu Arg

1025 1030 1035

Asp His His His His His His Asn Trp Ser His Pro Gln Phe Glu

1040 1045 1050

Lys Cys

1055

<210> 30

<211> 975

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 30

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Arg

1 5 10 15

Ser Ala His His Pro Ile Trp Ala Arg Met Asp Ala Gly Gly Gly Gly

20 25 30

Ser Leu Val Pro Arg Gly Ser Gly Gly Gly Gly Ser Gly Asp Ser Glu

35 40 45

Arg His Phe Val His Gln Phe Lys Gly Glu Cys Tyr Phe Thr Asn Gly

50 55 60

Thr Gln Arg Ile Arg Leu Val Thr Arg Tyr Ile Tyr Asn Arg Glu Glu

65 70 75 80

Tyr Leu Arg Phe Asp Ser Asp Val Gly Glu Tyr Arg Ala Val Thr Glu

85 90 95

Leu Gly Arg His Ser Ala Glu Tyr Tyr Asn Lys Gln Tyr Leu Glu Arg

100 105 110

Thr Arg Ala Glu Leu Asp Thr Ala Cys Arg His Asn Tyr Glu Glu Thr

115 120 125

Glu Val Pro Thr Ser Leu Arg Arg Leu Glu Gln Pro Asn Val Ala Ile

130 135 140

Ser Leu Ser Arg Thr Glu Ala Leu Asn His His Asn Thr Leu Val Cys

145 150 155 160

Ser Val Thr Asp Phe Tyr Pro Ala Lys Ile Lys Val Arg Trp Phe Arg

165 170 175

Asn Gly Gln Glu Glu Thr Val Gly Val Ser Ser Thr Gln Leu Ile Arg

180 185 190

Asn Gly Asp Trp Thr Phe Gln Val Leu Val Met Leu Glu Met Thr Pro

195 200 205

His Gln Gly Glu Val Tyr Thr Cys His Val Glu His Pro Ser Leu Lys

210 215 220

Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser Glu Ser Ala Arg Ser

225 230 235 240

Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys

245 250 255

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

260 265 270

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

275 280 285

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

290 295 300

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

305 310 315 320

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

325 330 335

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

340 345 350

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

355 360 365

Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp Glu

370 375 380

Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe Tyr

385 390 395 400

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

405 410 415

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

420 425 430

Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

435 440 445

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

450 455 460

Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ala Thr Asn Phe

465 470 475 480

Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met

485 490 495

Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Glu Asp

500 505 510

Asp Ile Glu Ala Asp His Val Gly Phe Tyr Gly Thr Thr Val Tyr Gln

515 520 525

Ser Pro Gly Asp Ile Gly Gln Tyr Thr His Glu Phe Asp Gly Asp Glu

530 535 540

Leu Phe Tyr Val Asp Leu Asp Lys Lys Lys Thr Val Trp Arg Leu Pro

545 550 555 560

Glu Phe Gly Gln Leu Ile Leu Phe Glu Pro Gln Gly Gly Leu Gln Asn

565 570 575

Ile Ala Ala Glu Lys His Asn Leu Gly Ile Leu Thr Lys Arg Ser Asn

580 585 590

Phe Thr Pro Ala Thr Asn Glu Ala Pro Gln Ala Thr Val Phe Pro Lys

595 600 605

Ser Pro Val Leu Leu Gly Gln Pro Asn Thr Leu Ile Cys Phe Val Asp

610 615 620

Asn Ile Phe Pro Pro Val Ile Asn Ile Thr Trp Leu Arg Asn Ser Lys

625 630 635 640

Ser Val Thr Asp Gly Val Tyr Glu Thr Ser Phe Leu Val Asn Arg Asp

645 650 655

His Ser Phe His Lys Leu Ser Tyr Leu Thr Phe Ile Pro Ser Asp Asp

660 665 670

Asp Ile Tyr Asp Cys Lys Val Glu His Trp Gly Leu Glu Glu Pro Val

675 680 685

Leu Lys His Trp Glu Pro Glu Ile Pro Ala Pro Met Ser Glu Leu Thr

690 695 700

Glu Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys

705 710 715 720

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

725 730 735

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

740 745 750

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

755 760 765

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

770 775 780

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

785 790 795 800

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

805 810 815

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

820 825 830

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp Glu

835 840 845

Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe Tyr

850 855 860

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

865 870 875 880

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

885 890 895

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

900 905 910

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

915 920 925

Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Gly Ser Gly

930 935 940

Ser Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu Leu Arg Asp His

945 950 955 960

His His His His His Asn Trp Ser His Pro Gln Phe Glu Lys Cys

965 970 975

<210> 31

<211> 1056

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 31

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Phe Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Arg Ile Ala Arg

245 250 255

Leu Glu Glu Lys Val Lys Thr Leu Lys Ala Gln Asn Ser Glu Leu Ala

260 265 270

Ser Thr Ala Asn Met Leu Arg Glu Gln Val Ala Gln Leu Lys Gln Lys

275 280 285

Val Met Asn His Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

290 295 300

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

305 310 315 320

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

325 330 335

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

340 345 350

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

355 360 365

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

370 375 380

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

385 390 395 400

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

405 410 415

Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp Glu Leu Thr Lys

420 425 430

Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

435 440 445

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

450 455 460

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

465 470 475 480

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

485 490 495

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

500 505 510

Leu Ser Leu Ser Pro Gly Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu

515 520 525

Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Ile Ile

530 535 540

Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Ile Lys Glu Glu His

545 550 555 560

Val Ile Ile Gln Ala Glu Phe Tyr Leu Asn Pro Asp Gln Ser Gly Glu

565 570 575

Phe Met Phe Asp Phe Asp Gly Asp Glu Ile Phe His Val Asp Met Ala

580 585 590

Lys Lys Glu Thr Val Trp Arg Leu Glu Glu Phe Gly Arg Phe Ala Ser

595 600 605

Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile Ala Val Asp Lys Ala Asn

610 615 620

Leu Glu Ile Met Thr Lys Arg Ser Asn Tyr Thr Pro Ile Thr Asn Val

625 630 635 640

Pro Pro Glu Val Thr Val Leu Thr Asn Ser Pro Val Glu Leu Arg Glu

645 650 655

Pro Asn Val Leu Ile Cys Phe Ile Asp Lys Phe Thr Pro Pro Val Val

660 665 670

Asn Val Thr Trp Leu Arg Asn Gly Lys Pro Val Thr Thr Gly Val Ser

675 680 685

Glu Thr Val Phe Leu Pro Arg Glu Asp His Leu Phe Arg Lys Phe His

690 695 700

Tyr Leu Pro Phe Leu Pro Ser Thr Glu Asp Val Tyr Asp Cys Arg Val

705 710 715 720

Glu His Trp Gly Leu Asp Glu Pro Leu Leu Lys His Trp Glu Phe Asp

725 730 735

Ala Pro Ser Pro Leu Pro Glu Thr Thr Glu Ser Gly Gly Gly Gly Gly

740 745 750

Leu Thr Asp Thr Leu Gln Ala Glu Thr Asp Gln Leu Glu Asp Glu Lys

755 760 765

Ser Ala Leu Gln Thr Glu Ile Ala Asn Leu Leu Lys Glu Lys Glu Lys

770 775 780

Leu Glu Phe Ile Leu Ala Ala His Asp Lys Thr His Thr Cys Pro Pro

785 790 795 800

Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro

805 810 815

Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr

820 825 830

Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn

835 840 845

Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg

850 855 860

Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val

865 870 875 880

Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser

885 890 895

Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys

900 905 910

Gly Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp

915 920 925

Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe

930 935 940

Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu

945 950 955 960

Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe

965 970 975

Phe Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly

980 985 990

Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr

995 1000 1005

Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Gly

1010 1015 1020

Ser Gly Ser Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu Leu

1025 1030 1035

Arg Asp His His His His His His Asn Trp Ser His Pro Gln Phe

1040 1045 1050

Glu Lys Cys

1055

<210> 32

<211> 976

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 32

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Phe Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His

245 250 255

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

260 265 270

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

275 280 285

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

290 295 300

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

305 310 315 320

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

325 330 335

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

340 345 350

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

355 360 365

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro

370 375 380

Pro Cys Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu

385 390 395 400

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

405 410 415

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

420 425 430

Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg

435 440 445

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

450 455 460

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser

465 470 475 480

Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu

485 490 495

Asn Pro Gly Pro Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala

500 505 510

Val Arg Gly Ile Lys Glu Glu His Val Ile Ile Gln Ala Glu Phe Tyr

515 520 525

Leu Asn Pro Asp Gln Ser Gly Glu Phe Met Phe Asp Phe Asp Gly Asp

530 535 540

Glu Ile Phe His Val Asp Met Ala Lys Lys Glu Thr Val Trp Arg Leu

545 550 555 560

Glu Glu Phe Gly Arg Phe Ala Ser Phe Glu Ala Gln Gly Ala Leu Ala

565 570 575

Asn Ile Ala Val Asp Lys Ala Asn Leu Glu Ile Met Thr Lys Arg Ser

580 585 590

Asn Tyr Thr Pro Ile Thr Asn Val Pro Pro Glu Val Thr Val Leu Thr

595 600 605

Asn Ser Pro Val Glu Leu Arg Glu Pro Asn Val Leu Ile Cys Phe Ile

610 615 620

Asp Lys Phe Thr Pro Pro Val Val Asn Val Thr Trp Leu Arg Asn Gly

625 630 635 640

Lys Pro Val Thr Thr Gly Val Ser Glu Thr Val Phe Leu Pro Arg Glu

645 650 655

Asp His Leu Phe Arg Lys Phe His Tyr Leu Pro Phe Leu Pro Ser Thr

660 665 670

Glu Asp Val Tyr Asp Cys Arg Val Glu His Trp Gly Leu Asp Glu Pro

675 680 685

Leu Leu Lys His Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro Glu Thr

690 695 700

Thr Glu Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro

705 710 715 720

Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro

725 730 735

Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr

740 745 750

Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn

755 760 765

Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg

770 775 780

Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val

785 790 795 800

Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser

805 810 815

Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys

820 825 830

Gly Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp

835 840 845

Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe

850 855 860

Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu

865 870 875 880

Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe

885 890 895

Phe Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly

900 905 910

Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr

915 920 925

Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Gly Ser

930 935 940

Gly Ser Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu Leu Arg Asp

945 950 955 960

His His His His His His Asn Trp Ser His Pro Gln Phe Glu Lys Cys

965 970 975

<210> 33

<211> 1055

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 33

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Arg

1 5 10 15

Ser Ala His His Pro Ile Trp Ala Arg Met Asp Ala Gly Gly Gly Gly

20 25 30

Ser Leu Val Pro Arg Gly Ser Gly Gly Gly Gly Ser Gly Asp Ser Glu

35 40 45

Arg His Phe Val His Gln Phe Lys Gly Glu Cys Tyr Phe Thr Asn Gly

50 55 60

Thr Gln Arg Ile Arg Leu Val Thr Arg Tyr Ile Tyr Asn Arg Glu Glu

65 70 75 80

Tyr Leu Arg Phe Asp Ser Asp Val Gly Glu Tyr Arg Ala Val Thr Glu

85 90 95

Leu Gly Arg His Ser Ala Glu Tyr Tyr Asn Lys Gln Tyr Leu Glu Arg

100 105 110

Thr Arg Ala Glu Leu Asp Thr Ala Cys Arg His Asn Tyr Glu Glu Thr

115 120 125

Glu Val Pro Thr Ser Leu Arg Arg Leu Glu Gln Pro Asn Val Ala Ile

130 135 140

Ser Leu Ser Arg Thr Glu Ala Leu Asn His His Asn Thr Leu Val Cys

145 150 155 160

Ser Val Thr Asp Phe Tyr Pro Ala Lys Ile Lys Val Arg Trp Phe Arg

165 170 175

Asn Gly Gln Glu Glu Thr Val Gly Val Ser Ser Thr Gln Leu Ile Arg

180 185 190

Asn Gly Asp Trp Thr Phe Gln Val Leu Val Met Leu Glu Met Thr Pro

195 200 205

His Gln Gly Glu Val Tyr Thr Cys His Val Glu His Pro Ser Leu Lys

210 215 220

Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser Glu Ser Ala Arg Ser

225 230 235 240

Lys Ser Gly Gly Gly Gly Gly Arg Ile Ala Arg Leu Glu Glu Lys Val

245 250 255

Lys Thr Leu Lys Ala Gln Asn Ser Glu Leu Ala Ser Thr Ala Asn Met

260 265 270

Leu Arg Glu Gln Val Ala Gln Leu Lys Gln Lys Val Met Asn His Asp

275 280 285

Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly

290 295 300

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

305 310 315 320

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

325 330 335

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

340 345 350

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

355 360 365

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

370 375 380

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

385 390 395 400

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

405 410 415

Thr Leu Pro Pro Cys Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

420 425 430

Trp Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

435 440 445

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

450 455 460

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

465 470 475 480

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

485 490 495

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

500 505 510

Gly Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp

515 520 525

Val Glu Glu Asn Pro Gly Pro Met Ala Ile Ile Tyr Leu Ile Leu Leu

530 535 540

Phe Thr Ala Val Arg Gly Glu Asp Asp Ile Glu Ala Asp His Val Gly

545 550 555 560

Phe Tyr Gly Thr Thr Val Tyr Gln Ser Pro Gly Asp Ile Gly Gln Tyr

565 570 575

Thr His Glu Phe Asp Gly Asp Glu Leu Phe Tyr Val Asp Leu Asp Lys

580 585 590

Lys Lys Thr Val Trp Arg Leu Pro Glu Phe Gly Gln Leu Ile Leu Phe

595 600 605

Glu Pro Gln Gly Gly Leu Gln Asn Ile Ala Ala Glu Lys His Asn Leu

610 615 620

Gly Ile Leu Thr Lys Arg Ser Asn Phe Thr Pro Ala Thr Asn Glu Ala

625 630 635 640

Pro Gln Ala Thr Val Phe Pro Lys Ser Pro Val Leu Leu Gly Gln Pro

645 650 655

Asn Thr Leu Ile Cys Phe Val Asp Asn Ile Phe Pro Pro Val Ile Asn

660 665 670

Ile Thr Trp Leu Arg Asn Ser Lys Ser Val Thr Asp Gly Val Tyr Glu

675 680 685

Thr Ser Phe Leu Val Asn Arg Asp His Ser Phe His Lys Leu Ser Tyr

690 695 700

Leu Thr Phe Ile Pro Ser Asp Asp Asp Ile Tyr Asp Cys Lys Val Glu

705 710 715 720

His Trp Gly Leu Glu Glu Pro Val Leu Lys His Trp Glu Pro Glu Ile

725 730 735

Pro Ala Pro Met Ser Glu Leu Thr Glu Ser Gly Gly Gly Gly Gly Leu

740 745 750

Thr Asp Thr Leu Gln Ala Glu Thr Asp Gln Leu Glu Asp Glu Lys Ser

755 760 765

Ala Leu Gln Thr Glu Ile Ala Asn Leu Leu Lys Glu Lys Glu Lys Leu

770 775 780

Glu Phe Ile Leu Ala Ala His Asp Lys Thr His Thr Cys Pro Pro Cys

785 790 795 800

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

805 810 815

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

820 825 830

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

835 840 845

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

850 855 860

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

865 870 875 880

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

885 890 895

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

900 905 910

Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp Glu

915 920 925

Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe Tyr

930 935 940

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

945 950 955 960

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

965 970 975

Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

980 985 990

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

995 1000 1005

Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Gly Ser

1010 1015 1020

Gly Ser Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu Leu Arg

1025 1030 1035

Asp His His His His His His Asn Trp Ser His Pro Gln Phe Glu

1040 1045 1050

Lys Cys

1055

<210> 34

<211> 975

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 34

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Arg

1 5 10 15

Ser Ala His His Pro Ile Trp Ala Arg Met Asp Ala Gly Gly Gly Gly

20 25 30

Ser Leu Val Pro Arg Gly Ser Gly Gly Gly Gly Ser Gly Asp Ser Glu

35 40 45

Arg His Phe Val His Gln Phe Lys Gly Glu Cys Tyr Phe Thr Asn Gly

50 55 60

Thr Gln Arg Ile Arg Leu Val Thr Arg Tyr Ile Tyr Asn Arg Glu Glu

65 70 75 80

Tyr Leu Arg Phe Asp Ser Asp Val Gly Glu Tyr Arg Ala Val Thr Glu

85 90 95

Leu Gly Arg His Ser Ala Glu Tyr Tyr Asn Lys Gln Tyr Leu Glu Arg

100 105 110

Thr Arg Ala Glu Leu Asp Thr Ala Cys Arg His Asn Tyr Glu Glu Thr

115 120 125

Glu Val Pro Thr Ser Leu Arg Arg Leu Glu Gln Pro Asn Val Ala Ile

130 135 140

Ser Leu Ser Arg Thr Glu Ala Leu Asn His His Asn Thr Leu Val Cys

145 150 155 160

Ser Val Thr Asp Phe Tyr Pro Ala Lys Ile Lys Val Arg Trp Phe Arg

165 170 175

Asn Gly Gln Glu Glu Thr Val Gly Val Ser Ser Thr Gln Leu Ile Arg

180 185 190

Asn Gly Asp Trp Thr Phe Gln Val Leu Val Met Leu Glu Met Thr Pro

195 200 205

His Gln Gly Glu Val Tyr Thr Cys His Val Glu His Pro Ser Leu Lys

210 215 220

Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser Glu Ser Ala Arg Ser

225 230 235 240

Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys

245 250 255

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

260 265 270

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

275 280 285

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

290 295 300

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

305 310 315 320

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

325 330 335

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

340 345 350

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

355 360 365

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp Glu

370 375 380

Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe Tyr

385 390 395 400

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

405 410 415

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

420 425 430

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

435 440 445

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

450 455 460

Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ala Thr Asn Phe

465 470 475 480

Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met

485 490 495

Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Glu Asp

500 505 510

Asp Ile Glu Ala Asp His Val Gly Phe Tyr Gly Thr Thr Val Tyr Gln

515 520 525

Ser Pro Gly Asp Ile Gly Gln Tyr Thr His Glu Phe Asp Gly Asp Glu

530 535 540

Leu Phe Tyr Val Asp Leu Asp Lys Lys Lys Thr Val Trp Arg Leu Pro

545 550 555 560

Glu Phe Gly Gln Leu Ile Leu Phe Glu Pro Gln Gly Gly Leu Gln Asn

565 570 575

Ile Ala Ala Glu Lys His Asn Leu Gly Ile Leu Thr Lys Arg Ser Asn

580 585 590

Phe Thr Pro Ala Thr Asn Glu Ala Pro Gln Ala Thr Val Phe Pro Lys

595 600 605

Ser Pro Val Leu Leu Gly Gln Pro Asn Thr Leu Ile Cys Phe Val Asp

610 615 620

Asn Ile Phe Pro Pro Val Ile Asn Ile Thr Trp Leu Arg Asn Ser Lys

625 630 635 640

Ser Val Thr Asp Gly Val Tyr Glu Thr Ser Phe Leu Val Asn Arg Asp

645 650 655

His Ser Phe His Lys Leu Ser Tyr Leu Thr Phe Ile Pro Ser Asp Asp

660 665 670

Asp Ile Tyr Asp Cys Lys Val Glu His Trp Gly Leu Glu Glu Pro Val

675 680 685

Leu Lys His Trp Glu Pro Glu Ile Pro Ala Pro Met Ser Glu Leu Thr

690 695 700

Glu Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys

705 710 715 720

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

725 730 735

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

740 745 750

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

755 760 765

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

770 775 780

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

785 790 795 800

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

805 810 815

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

820 825 830

Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp Glu

835 840 845

Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe Tyr

850 855 860

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

865 870 875 880

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

885 890 895

Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

900 905 910

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

915 920 925

Gln Lys Ser Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Gly Ser Gly

930 935 940

Ser Leu Gly Gly Ile Phe Glu Ala Met Lys Met Glu Leu Arg Asp His

945 950 955 960

His His His His His Asn Trp Ser His Pro Gln Phe Glu Lys Cys

965 970 975

<210> 35

<211> 518

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 35

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Phe Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Arg Ile Ala Arg

245 250 255

Leu Glu Glu Lys Val Lys Thr Leu Lys Ala Gln Asn Ser Glu Leu Ala

260 265 270

Ser Thr Ala Asn Met Leu Arg Glu Gln Val Ala Gln Leu Lys Gln Lys

275 280 285

Val Met Asn His Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

290 295 300

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

305 310 315 320

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

325 330 335

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

340 345 350

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

355 360 365

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

370 375 380

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

385 390 395 400

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

405 410 415

Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys

420 425 430

Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe Tyr Pro Ser Asp

435 440 445

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

450 455 460

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Val Ser

465 470 475 480

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

485 490 495

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

500 505 510

Leu Ser Leu Ser Pro Gly

515

<210> 36

<211> 518

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 36

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Phe Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Arg Ile Ala Arg

245 250 255

Leu Glu Glu Lys Val Lys Thr Leu Lys Ala Gln Asn Ser Glu Leu Ala

260 265 270

Ser Thr Ala Asn Met Leu Arg Glu Gln Val Ala Gln Leu Lys Gln Lys

275 280 285

Val Met Asn His Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

290 295 300

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

305 310 315 320

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

325 330 335

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

340 345 350

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

355 360 365

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

370 375 380

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

385 390 395 400

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

405 410 415

Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp Glu Leu Thr Lys

420 425 430

Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

435 440 445

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

450 455 460

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

465 470 475 480

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

485 490 495

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

500 505 510

Leu Ser Leu Ser Pro Gly

515

<210> 37

<211> 478

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 37

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Ile

1 5 10 15

Lys Glu Glu His Val Ile Ile Gln Ala Glu Phe Tyr Leu Asn Pro Asp

20 25 30

Gln Ser Gly Glu Phe Met Phe Asp Phe Asp Gly Asp Glu Ile Phe His

35 40 45

Val Asp Met Ala Lys Lys Glu Thr Val Trp Arg Leu Glu Glu Phe Gly

50 55 60

Arg Phe Ala Ser Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile Ala Val

65 70 75 80

Asp Lys Ala Asn Leu Glu Ile Met Thr Lys Arg Ser Asn Tyr Thr Pro

85 90 95

Ile Thr Asn Val Pro Pro Glu Val Thr Val Leu Thr Asn Ser Pro Val

100 105 110

Glu Leu Arg Glu Pro Asn Val Leu Ile Cys Phe Ile Asp Lys Phe Thr

115 120 125

Pro Pro Val Val Asn Val Thr Trp Leu Arg Asn Gly Lys Pro Val Thr

130 135 140

Thr Gly Val Ser Glu Thr Val Phe Leu Pro Arg Glu Asp His Leu Phe

145 150 155 160

Arg Lys Phe His Tyr Leu Pro Phe Leu Pro Ser Thr Glu Asp Val Tyr

165 170 175

Asp Cys Arg Val Glu His Trp Gly Leu Asp Glu Pro Leu Leu Lys His

180 185 190

Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro Glu Thr Thr Glu Ser Gly

195 200 205

Gly Gly Gly Gly Leu Thr Asp Thr Leu Gln Ala Glu Thr Asp Gln Leu

210 215 220

Glu Asp Glu Lys Ser Ala Leu Gln Thr Glu Ile Ala Asn Leu Leu Lys

225 230 235 240

Glu Lys Glu Lys Leu Glu Phe Ile Leu Ala Ala His Asp Lys Thr His

245 250 255

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

260 265 270

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

275 280 285

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

290 295 300

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

305 310 315 320

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

325 330 335

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

340 345 350

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

355 360 365

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro

370 375 380

Pro Cys Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu

385 390 395 400

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

405 410 415

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

420 425 430

Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg

435 440 445

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

450 455 460

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

465 470 475

<210> 38

<211> 478

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 38

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Ile

1 5 10 15

Lys Glu Glu His Val Ile Ile Gln Ala Glu Phe Tyr Leu Asn Pro Asp

20 25 30

Gln Ser Gly Glu Phe Met Phe Asp Phe Asp Gly Asp Glu Ile Phe His

35 40 45

Val Asp Met Ala Lys Lys Glu Thr Val Trp Arg Leu Glu Glu Phe Gly

50 55 60

Arg Phe Ala Ser Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile Ala Val

65 70 75 80

Asp Lys Ala Asn Leu Glu Ile Met Thr Lys Arg Ser Asn Tyr Thr Pro

85 90 95

Ile Thr Asn Val Pro Pro Glu Val Thr Val Leu Thr Asn Ser Pro Val

100 105 110

Glu Leu Arg Glu Pro Asn Val Leu Ile Cys Phe Ile Asp Lys Phe Thr

115 120 125

Pro Pro Val Val Asn Val Thr Trp Leu Arg Asn Gly Lys Pro Val Thr

130 135 140

Thr Gly Val Ser Glu Thr Val Phe Leu Pro Arg Glu Asp His Leu Phe

145 150 155 160

Arg Lys Phe His Tyr Leu Pro Phe Leu Pro Ser Thr Glu Asp Val Tyr

165 170 175

Asp Cys Arg Val Glu His Trp Gly Leu Asp Glu Pro Leu Leu Lys His

180 185 190

Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro Glu Thr Thr Glu Ser Gly

195 200 205

Gly Gly Gly Gly Leu Thr Asp Thr Leu Gln Ala Glu Thr Asp Gln Leu

210 215 220

Glu Asp Glu Lys Ser Ala Leu Gln Thr Glu Ile Ala Asn Leu Leu Lys

225 230 235 240

Glu Lys Glu Lys Leu Glu Phe Ile Leu Ala Ala His Asp Lys Thr His

245 250 255

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

260 265 270

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

275 280 285

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

290 295 300

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

305 310 315 320

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

325 330 335

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

340 345 350

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

355 360 365

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro

370 375 380

Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala

385 390 395 400

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

405 410 415

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

420 425 430

Asp Gly Ser Phe Phe Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg

435 440 445

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

450 455 460

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

465 470 475

<210> 39

<211> 478

<212> PRT

<<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 39

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Phe Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His

245 250 255

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

260 265 270

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

275 280 285

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

290 295 300

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

305 310 315 320

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

325 330 335

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

340 345 350

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

355 360 365

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro

370 375 380

Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala

385 390 395 400

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

405 410 415

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

420 425 430

Asp Gly Ser Phe Phe Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg

435 440 445

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

450 455 460

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

465 470 475

<210> 40

<211> 478

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 40

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Phe Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His

245 250 255

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

260 265 270

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

275 280 285

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

290 295 300

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

305 310 315 320

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

325 330 335

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

340 345 350

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

355 360 365

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro

370 375 380

Pro Cys Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu

385 390 395 400

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

405 410 415

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

420 425 430

Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg

435 440 445

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

450 455 460

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

465 470 475

<210> 41

<211> 438

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 41

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Ile

1 5 10 15

Lys Glu Glu His Val Ile Ile Gln Ala Glu Phe Tyr Leu Asn Pro Asp

20 25 30

Gln Ser Gly Glu Phe Met Phe Asp Phe Asp Gly Asp Glu Ile Phe His

35 40 45

Val Asp Met Ala Lys Lys Glu Thr Val Trp Arg Leu Glu Glu Phe Gly

50 55 60

Arg Phe Ala Ser Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile Ala Val

65 70 75 80

Asp Lys Ala Asn Leu Glu Ile Met Thr Lys Arg Ser Asn Tyr Thr Pro

85 90 95

Ile Thr Asn Val Pro Pro Glu Val Thr Val Leu Thr Asn Ser Pro Val

100 105 110

Glu Leu Arg Glu Pro Asn Val Leu Ile Cys Phe Ile Asp Lys Phe Thr

115 120 125

Pro Pro Val Val Asn Val Thr Trp Leu Arg Asn Gly Lys Pro Val Thr

130 135 140

Thr Gly Val Ser Glu Thr Val Phe Leu Pro Arg Glu Asp His Leu Phe

145 150 155 160

Arg Lys Phe His Tyr Leu Pro Phe Leu Pro Ser Thr Glu Asp Val Tyr

165 170 175

Asp Cys Arg Val Glu His Trp Gly Leu Asp Glu Pro Leu Leu Lys His

180 185 190

Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro Glu Thr Thr Glu Ser Gly

195 200 205

Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

210 215 220

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

225 230 235 240

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

245 250 255

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

260 265 270

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

275 280 285

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

290 295 300

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

305 310 315 320

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

325 330 335

Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp Glu Leu Thr Lys

340 345 350

Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

355 360 365

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

370 375 380

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

385 390 395 400

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

405 410 415

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

420 425 430

Leu Ser Leu Ser Pro Gly

435

<210> 42

<211> 438

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 42

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Ile

1 5 10 15

Lys Glu Glu His Val Ile Ile Gln Ala Glu Phe Tyr Leu Asn Pro Asp

20 25 30

Gln Ser Gly Glu Phe Met Phe Asp Phe Asp Gly Asp Glu Ile Phe His

35 40 45

Val Asp Met Ala Lys Lys Glu Thr Val Trp Arg Leu Glu Glu Phe Gly

50 55 60

Arg Phe Ala Ser Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile Ala Val

65 70 75 80

Asp Lys Ala Asn Leu Glu Ile Met Thr Lys Arg Ser Asn Tyr Thr Pro

85 90 95

Ile Thr Asn Val Pro Pro Glu Val Thr Val Leu Thr Asn Ser Pro Val

100 105 110

Glu Leu Arg Glu Pro Asn Val Leu Ile Cys Phe Ile Asp Lys Phe Thr

115 120 125

Pro Pro Val Val Asn Val Thr Trp Leu Arg Asn Gly Lys Pro Val Thr

130 135 140

Thr Gly Val Ser Glu Thr Val Phe Leu Pro Arg Glu Asp His Leu Phe

145 150 155 160

Arg Lys Phe His Tyr Leu Pro Phe Leu Pro Ser Thr Glu Asp Val Tyr

165 170 175

Asp Cys Arg Val Glu His Trp Gly Leu Asp Glu Pro Leu Leu Lys His

180 185 190

Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro Glu Thr Thr Glu Ser Gly

195 200 205

Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

210 215 220

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

225 230 235 240

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

245 250 255

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

260 265 270

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

275 280 285

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

290 295 300

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

305 310 315 320

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

325 330 335

Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys

340 345 350

Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe Tyr Pro Ser Asp

355 360 365

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

370 375 380

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Val Ser

385 390 395 400

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

405 410 415

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

420 425 430

Leu Ser Leu Ser Pro Gly

435

<210> 43

<211> 513

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 43

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Arg

1 5 10 15

Ser Ala His His Pro Ile Trp Ala Arg Met Asp Ala Gly Gly Gly Gly

20 25 30

Ser Leu Val Pro Arg Gly Ser Gly Gly Gly Gly Ser Gly Asp Ser Glu

35 40 45

Arg His Phe Val His Gln Phe Lys Gly Glu Cys Tyr Phe Thr Asn Gly

50 55 60

Thr Gln Arg Ile Arg Leu Val Thr Arg Tyr Ile Tyr Asn Arg Glu Glu

65 70 75 80

Tyr Leu Arg Phe Asp Ser Asp Val Gly Glu Tyr Arg Ala Val Thr Glu

85 90 95

Leu Gly Arg His Ser Ala Glu Tyr Tyr Asn Lys Gln Tyr Leu Glu Arg

100 105 110

Thr Arg Ala Glu Leu Asp Thr Ala Cys Arg His Asn Tyr Glu Glu Thr

115 120 125

Glu Val Pro Thr Ser Leu Arg Arg Leu Glu Gln Pro Asn Val Ala Ile

130 135 140

Ser Leu Ser Arg Thr Glu Ala Leu Asn His His Asn Thr Leu Val Cys

145 150 155 160

Ser Val Thr Asp Phe Tyr Pro Ala Lys Ile Lys Val Arg Trp Phe Arg

165 170 175

Asn Gly Gln Glu Glu Thr Val Gly Val Ser Ser Thr Gln Leu Ile Arg

180 185 190

Asn Gly Asp Trp Thr Phe Gln Val Leu Val Met Leu Glu Met Thr Pro

195 200 205

His Gln Gly Glu Val Tyr Thr Cys His Val Glu His Pro Ser Leu Lys

210 215 220

Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser Glu Ser Ala Arg Ser

225 230 235 240

Lys Ser Gly Gly Gly Gly Gly Arg Ile Ala Arg Leu Glu Glu Lys Val

245 250 255

Lys Thr Leu Lys Ala Gln Asn Ser Glu Leu Ala Ser Thr Ala Asn Met

260 265 270

Leu Arg Glu Gln Val Ala Gln Leu Lys Gln Lys Val Met Asn His Asp

275 280 285

Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly

290 295 300

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

305 310 315 320

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

325 330 335

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

340 345 350

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

355 360 365

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

370 375 380

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

385 390 395 400

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Cys

405 410 415

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

420 425 430

Ser Cys Ala Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

435 440 445

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

450 455 460

Leu Asp Ser Asp Gly Ser Phe Phe Leu Val Ser Lys Leu Thr Val Asp

465 470 475 480

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

485 490 495

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

500 505 510

gly

<210> 44

<211> 513

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 44

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Arg

1 5 10 15

Ser Ala His His Pro Ile Trp Ala Arg Met Asp Ala Gly Gly Gly Gly

20 25 30

Ser Leu Val Pro Arg Gly Ser Gly Gly Gly Gly Ser Gly Asp Ser Glu

35 40 45

Arg His Phe Val His Gln Phe Lys Gly Glu Cys Tyr Phe Thr Asn Gly

50 55 60

Thr Gln Arg Ile Arg Leu Val Thr Arg Tyr Ile Tyr Asn Arg Glu Glu

65 70 75 80

Tyr Leu Arg Phe Asp Ser Asp Val Gly Glu Tyr Arg Ala Val Thr Glu

85 90 95

Leu Gly Arg His Ser Ala Glu Tyr Tyr Asn Lys Gln Tyr Leu Glu Arg

100 105 110

Thr Arg Ala Glu Leu Asp Thr Ala Cys Arg His Asn Tyr Glu Glu Thr

115 120 125

Glu Val Pro Thr Ser Leu Arg Arg Leu Glu Gln Pro Asn Val Ala Ile

130 135 140

Ser Leu Ser Arg Thr Glu Ala Leu Asn His His Asn Thr Leu Val Cys

145 150 155 160

Ser Val Thr Asp Phe Tyr Pro Ala Lys Ile Lys Val Arg Trp Phe Arg

165 170 175

Asn Gly Gln Glu Glu Thr Val Gly Val Ser Ser Thr Gln Leu Ile Arg

180 185 190

Asn Gly Asp Trp Thr Phe Gln Val Leu Val Met Leu Glu Met Thr Pro

195 200 205

His Gln Gly Glu Val Tyr Thr Cys His Val Glu His Pro Ser Leu Lys

210 215 220

Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser Glu Ser Ala Arg Ser

225 230 235 240

Lys Ser Gly Gly Gly Gly Gly Arg Ile Ala Arg Leu Glu Glu Lys Val

245 250 255

Lys Thr Leu Lys Ala Gln Asn Ser Glu Leu Ala Ser Thr Ala Asn Met

260 265 270

Leu Arg Glu Gln Val Ala Gln Leu Lys Gln Lys Val Met Asn His Asp

275 280 285

Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly

290 295 300

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

305 310 315 320

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

325 330 335

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

340 345 350

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

355 360 365

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

370 375 380

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

385 390 395 400

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

405 410 415

Thr Leu Pro Pro Cys Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

420 425 430

Trp Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

435 440 445

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val

450 455 460

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

465 470 475 480

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

485 490 495

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

500 505 510

gly

<210> 45

<211> 482

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 45

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Glu

1 5 10 15

Asp Asp Ile Glu Ala Asp His Val Gly Phe Tyr Gly Thr Thr Val Tyr

20 25 30

Gln Ser Pro Gly Asp Ile Gly Gln Tyr Thr His Glu Phe Asp Gly Asp

35 40 45

Glu Leu Phe Tyr Val Asp Leu Asp Lys Lys Lys Thr Val Trp Arg Leu

50 55 60

Pro Glu Phe Gly Gln Leu Ile Leu Phe Glu Pro Gln Gly Gly Leu Gln

65 70 75 80

Asn Ile Ala Ala Glu Lys His Asn Leu Gly Ile Leu Thr Lys Arg Ser

85 90 95

Asn Phe Thr Pro Ala Thr Asn Glu Ala Pro Gln Ala Thr Val Phe Pro

100 105 110

Lys Ser Pro Val Leu Leu Gly Gln Pro Asn Thr Leu Ile Cys Phe Val

115 120 125

Asp Asn Ile Phe Pro Pro Val Ile Asn Ile Thr Trp Leu Arg Asn Ser

130 135 140

Lys Ser Val Thr Asp Gly Val Tyr Glu Thr Ser Phe Leu Val Asn Arg

145 150 155 160

Asp His Ser Phe His Lys Leu Ser Tyr Leu Thr Phe Ile Pro Ser Asp

165 170 175

Asp Asp Ile Tyr Asp Cys Lys Val Glu His Trp Gly Leu Glu Glu Pro

180 185 190

Val Leu Lys His Trp Glu Pro Glu Ile Pro Ala Pro Met Ser Glu Leu

195 200 205

Thr Glu Ser Gly Gly Gly Gly Gly Leu Thr Asp Thr Leu Gln Ala Glu

210 215 220

Thr Asp Gln Leu Glu Asp Glu Lys Ser Ala Leu Gln Thr Glu Ile Ala

225 230 235 240

Asn Leu Leu Lys Glu Lys Glu Lys Leu Glu Phe Ile Leu Ala Ala His

245 250 255

Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly

260 265 270

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met

275 280 285

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His

290 295 300

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val

305 310 315 320

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr

325 330 335

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly

340 345 350

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile

355 360 365

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

370 375 380

Tyr Thr Leu Pro Pro Cys Arg Asp Glu Leu Thr Lys Asn Gln Val Ser

385 390 395 400

Leu Trp Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu

405 410 415

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro

420 425 430

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val

435 440 445

Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met

450 455 460

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser

465 470 475 480

Pro Gly

<210> 46

<211> 482

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 46

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Glu

1 5 10 15

Asp Asp Ile Glu Ala Asp His Val Gly Phe Tyr Gly Thr Thr Val Tyr

20 25 30

Gln Ser Pro Gly Asp Ile Gly Gln Tyr Thr His Glu Phe Asp Gly Asp

35 40 45

Glu Leu Phe Tyr Val Asp Leu Asp Lys Lys Lys Thr Val Trp Arg Leu

50 55 60

Pro Glu Phe Gly Gln Leu Ile Leu Phe Glu Pro Gln Gly Gly Leu Gln

65 70 75 80

Asn Ile Ala Ala Glu Lys His Asn Leu Gly Ile Leu Thr Lys Arg Ser

85 90 95

Asn Phe Thr Pro Ala Thr Asn Glu Ala Pro Gln Ala Thr Val Phe Pro

100 105 110

Lys Ser Pro Val Leu Leu Gly Gln Pro Asn Thr Leu Ile Cys Phe Val

115 120 125

Asp Asn Ile Phe Pro Pro Val Ile Asn Ile Thr Trp Leu Arg Asn Ser

130 135 140

Lys Ser Val Thr Asp Gly Val Tyr Glu Thr Ser Phe Leu Val Asn Arg

145 150 155 160

Asp His Ser Phe His Lys Leu Ser Tyr Leu Thr Phe Ile Pro Ser Asp

165 170 175

Asp Asp Ile Tyr Asp Cys Lys Val Glu His Trp Gly Leu Glu Glu Pro

180 185 190

Val Leu Lys His Trp Glu Pro Glu Ile Pro Ala Pro Met Ser Glu Leu

195 200 205

Thr Glu Ser Gly Gly Gly Gly Gly Leu Thr Asp Thr Leu Gln Ala Glu

210 215 220

Thr Asp Gln Leu Glu Asp Glu Lys Ser Ala Leu Gln Thr Glu Ile Ala

225 230 235 240

Asn Leu Leu Lys Glu Lys Glu Lys Leu Glu Phe Ile Leu Ala Ala His

245 250 255

Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly

260 265 270

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met

275 280 285

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His

290 295 300

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val

305 310 315 320

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr

325 330 335

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly

340 345 350

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile

355 360 365

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

370 375 380

Cys Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser

385 390 395 400

Leu Ser Cys Ala Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu

405 410 415

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro

420 425 430

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Val Ser Lys Leu Thr Val

435 440 445

Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met

450 455 460

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser

465 470 475 480

ProGly

<210> 47

<211> 473

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 47

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Arg

1 5 10 15

Ser Ala His His Pro Ile Trp Ala Arg Met Asp Ala Gly Gly Gly Gly

20 25 30

Ser Leu Val Pro Arg Gly Ser Gly Gly Gly Gly Ser Gly Asp Ser Glu

35 40 45

Arg His Phe Val His Gln Phe Lys Gly Glu Cys Tyr Phe Thr Asn Gly

50 55 60

Thr Gln Arg Ile Arg Leu Val Thr Arg Tyr Ile Tyr Asn Arg Glu Glu

65 70 75 80

Tyr Leu Arg Phe Asp Ser Asp Val Gly Glu Tyr Arg Ala Val Thr Glu

85 90 95

Leu Gly Arg His Ser Ala Glu Tyr Tyr Asn Lys Gln Tyr Leu Glu Arg

100 105 110

Thr Arg Ala Glu Leu Asp Thr Ala Cys Arg His Asn Tyr Glu Glu Thr

115 120 125

Glu Val Pro Thr Ser Leu Arg Arg Leu Glu Gln Pro Asn Val Ala Ile

130 135 140

Ser Leu Ser Arg Thr Glu Ala Leu Asn His His Asn Thr Leu Val Cys

145 150 155 160

Ser Val Thr Asp Phe Tyr Pro Ala Lys Ile Lys Val Arg Trp Phe Arg

165 170 175

Asn Gly Gln Glu Glu Thr Val Gly Val Ser Ser Thr Gln Leu Ile Arg

180 185 190

Asn Gly Asp Trp Thr Phe Gln Val Leu Val Met Leu Glu Met Thr Pro

195 200 205

His Gln Gly Glu Val Tyr Thr Cys His Val Glu His Pro Ser Leu Lys

210 215 220

Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser Glu Ser Ala Arg Ser

225 230 235 240

Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys

245 250 255

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

260 265 270

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

275 280 285

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

290 295 300

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

305 310 315 320

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

325 330 335

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

340 345 350

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

355 360 365

Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp Glu

370 375 380

Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe Tyr

385 390 395 400

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

405 410 415

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

420 425 430

Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

435 440 445

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

450 455 460

Gln Lys Ser Leu Ser Leu Ser Pro Gly

465 470

<210> 48

<211> 473

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 48

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Arg

1 5 10 15

Ser Ala His His Pro Ile Trp Ala Arg Met Asp Ala Gly Gly Gly Gly

20 25 30

Ser Leu Val Pro Arg Gly Ser Gly Gly Gly Gly Ser Gly Asp Ser Glu

35 40 45

Arg His Phe Val His Gln Phe Lys Gly Glu Cys Tyr Phe Thr Asn Gly

50 55 60

Thr Gln Arg Ile Arg Leu Val Thr Arg Tyr Ile Tyr Asn Arg Glu Glu

65 70 75 80

Tyr Leu Arg Phe Asp Ser Asp Val Gly Glu Tyr Arg Ala Val Thr Glu

85 90 95

Leu Gly Arg His Ser Ala Glu Tyr Tyr Asn Lys Gln Tyr Leu Glu Arg

100 105 110

Thr Arg Ala Glu Leu Asp Thr Ala Cys Arg His Asn Tyr Glu Glu Thr

115 120 125

Glu Val Pro Thr Ser Leu Arg Arg Leu Glu Gln Pro Asn Val Ala Ile

130 135 140

Ser Leu Ser Arg Thr Glu Ala Leu Asn His His Asn Thr Leu Val Cys

145 150 155 160

Ser Val Thr Asp Phe Tyr Pro Ala Lys Ile Lys Val Arg Trp Phe Arg

165 170 175

Asn Gly Gln Glu Glu Thr Val Gly Val Ser Ser Thr Gln Leu Ile Arg

180 185 190

Asn Gly Asp Trp Thr Phe Gln Val Leu Val Met Leu Glu Met Thr Pro

195 200 205

His Gln Gly Glu Val Tyr Thr Cys His Val Glu His Pro Ser Leu Lys

210 215 220

Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser Glu Ser Ala Arg Ser

225 230 235 240

Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys

245 250 255

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

260 265 270

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

275 280 285

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

290 295 300

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

305 310 315 320

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

325 330 335

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

340 345 350

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

355 360 365

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp Glu

370 375 380

Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe Tyr

385 390 395 400

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

405 410 415

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

420 425 430

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

435 440 445

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

450 455 460

Gln Lys Ser Leu Ser Leu Ser Pro Gly

465 470

<210> 49

<211> 442

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 49

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Glu

1 5 10 15

Asp Asp Ile Glu Ala Asp His Val Gly Phe Tyr Gly Thr Thr Val Tyr

20 25 30

Gln Ser Pro Gly Asp Ile Gly Gln Tyr Thr His Glu Phe Asp Gly Asp

35 40 45

Glu Leu Phe Tyr Val Asp Leu Asp Lys Lys Lys Thr Val Trp Arg Leu

50 55 60

Pro Glu Phe Gly Gln Leu Ile Leu Phe Glu Pro Gln Gly Gly Leu Gln

65 70 75 80

Asn Ile Ala Ala Glu Lys His Asn Leu Gly Ile Leu Thr Lys Arg Ser

85 90 95

Asn Phe Thr Pro Ala Thr Asn Glu Ala Pro Gln Ala Thr Val Phe Pro

100 105 110

Lys Ser Pro Val Leu Leu Gly Gln Pro Asn Thr Leu Ile Cys Phe Val

115 120 125

Asp Asn Ile Phe Pro Pro Val Ile Asn Ile Thr Trp Leu Arg Asn Ser

130 135 140

Lys Ser Val Thr Asp Gly Val Tyr Glu Thr Ser Phe Leu Val Asn Arg

145 150 155 160

Asp His Ser Phe His Lys Leu Ser Tyr Leu Thr Phe Ile Pro Ser Asp

165 170 175

Asp Asp Ile Tyr Asp Cys Lys Val Glu His Trp Gly Leu Glu Glu Pro

180 185 190

Val Leu Lys His Trp Glu Pro Glu Ile Pro Ala Pro Met Ser Glu Leu

195 200 205

Thr Glu Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro

210 215 220

Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro

225 230 235 240

Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr

245 250 255

Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn

260 265 270

Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg

275 280 285

Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val

290 295 300

Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser

305 310 315 320

Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys

325 330 335

Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp

340 345 350

Glu Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe

355 360 365

Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu

370 375 380

Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe

385 390 395 400

Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly

405 410 415

Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr

420 425 430

Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

435 440

<210> 50

<211> 442

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 50

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Glu

1 5 10 15

Asp Asp Ile Glu Ala Asp His Val Gly Phe Tyr Gly Thr Thr Val Tyr

20 25 30

Gln Ser Pro Gly Asp Ile Gly Gln Tyr Thr His Glu Phe Asp Gly Asp

35 40 45

Glu Leu Phe Tyr Val Asp Leu Asp Lys Lys Lys Thr Val Trp Arg Leu

50 55 60

Pro Glu Phe Gly Gln Leu Ile Leu Phe Glu Pro Gln Gly Gly Leu Gln

65 70 75 80

Asn Ile Ala Ala Glu Lys His Asn Leu Gly Ile Leu Thr Lys Arg Ser

85 90 95

Asn Phe Thr Pro Ala Thr Asn Glu Ala Pro Gln Ala Thr Val Phe Pro

100 105 110

Lys Ser Pro Val Leu Leu Gly Gln Pro Asn Thr Leu Ile Cys Phe Val

115 120 125

Asp Asn Ile Phe Pro Pro Val Ile Asn Ile Thr Trp Leu Arg Asn Ser

130 135 140

Lys Ser Val Thr Asp Gly Val Tyr Glu Thr Ser Phe Leu Val Asn Arg

145 150 155 160

Asp His Ser Phe His Lys Leu Ser Tyr Leu Thr Phe Ile Pro Ser Asp

165 170 175

Asp Asp Ile Tyr Asp Cys Lys Val Glu His Trp Gly Leu Glu Glu Pro

180 185 190

Val Leu Lys His Trp Glu Pro Glu Ile Pro Ala Pro Met Ser Glu Leu

195 200 205

Thr Glu Ser Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro

210 215 220

Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro

225 230 235 240

Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr

245 250 255

Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn

260 265 270

Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg

275 280 285

Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val

290 295 300

Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser

305 310 315 320

Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys

325 330 335

Gly Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp

340 345 350

Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe

355 360 365

Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu

370 375 380

Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe

385 390 395 400

Phe Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly

405 410 415

Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr

420 425 430

Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

435 440

<210> 51

<211> 226

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 51

Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly

1 5 10 15

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met

20 25 30

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His

35 40 45

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val

50 55 60

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr

65 70 75 80

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly

85 90 95

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile

100 105 110

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

115 120 125

Cys Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser

130 135 140

Leu Ser Cys Ala Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu

145 150 155 160

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro

165 170 175

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Val Ser Lys Leu Thr Val

180 185 190

Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met

195 200 205

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser

210 215 220

Pro Gly

225

<210> 52

<211> 106

<212> PRT

<213> Homo sapiens

<400> 52

Gly Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro Pro Ser Arg Asp

1 5 10 15

Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala Val Lys Gly Phe

20 25 30

Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu

35 40 45

Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe

50 55 60

Phe Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly

65 70 75 80

Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr

85 90 95

Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

100 105

<210> 53

<211> 226

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 53

Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly

1 5 10 15

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met

20 25 30

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His

35 40 45

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val

50 55 60

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr

65 70 75 80

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly

85 90 95

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile

100 105 110

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

115 120 125

Tyr Thr Leu Pro Pro Cys Arg Asp Glu Leu Thr Lys Asn Gln Val Ser

130 135 140

Leu Trp Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu

145 150 155 160

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro

165 170 175

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val

180 185 190

Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met

195 200 205

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser

210 215 220

Pro Gly

225

<210> 54

<211> 106

<212> PRT

<213> Homo sapiens

<400> 54

Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp

1 5 10 15

Glu Leu Thr Lys Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe

20 25 30

Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu

35 40 45

Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe

50 55 60

Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly

65 70 75 80

Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr

85 90 95

Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

100 105

<210> 55

<211> 113

<212> PRT

<213> Homo sapiens

<400> 55

Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe

1 5 10 15

Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val

20 25 30

Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe

35 40 45

Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro

50 55 60

Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr

65 70 75 80

Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val

85 90 95

Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala

100 105 110

Lys

<210> 56

<211> 224

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 56

Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr Tyr Thr Phe Gly Gly Gly

1 5 10 15

Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser Gly Asp Thr Arg Pro Arg

20 25 30

Phe Leu Glu Tyr Ser Thr Ser Glu Cys His Phe Phe Asn Gly Thr Glu

35 40 45

Arg Val Arg Tyr Leu Asp Arg Tyr Phe His Asn Gln Glu Glu Asn Val

50 55 60

Arg Phe Asp Ser Asp Val Gly Glu Phe Arg Ala Val Thr Glu Leu Gly

65 70 75 80

Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln Lys Asp Leu Leu Glu Gln

85 90 95

Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg His Asn Tyr Gly Val Val

100 105 110

Glu Ser Phe Thr Val Gln Arg Arg Val His Pro Lys Val Thr Val Tyr

115 120 125

Pro Ser Lys Thr Gln Pro Leu Gln His His Asn Leu Leu Val Cys Ser

130 135 140

Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu Val Arg Trp Phe Arg Asn

145 150 155 160

Gly Gln Glu Glu Lys Thr Gly Val Val Ser Thr Gly Leu Ile His Asn

165 170 175

Gly Asp Trp Thr Phe Gln Thr Leu Val Met Leu Glu Thr Val Pro Arg

180 185 190

Ser Gly Glu Val Tyr Thr Cys Gln Val Glu His Pro Ser Val Thr Ser

195 200 205

Pro Leu Thr Val Glu Trp Arg Ala Arg Ser Glu Ser Ala Gln Ser Lys

210 215 220

<210> 57

<211> 191

<212> PRT

<213> Homo sapiens

<400> 57

Ile Lys Glu Glu His Val Ile Ile Gln Ala Glu Phe Tyr Leu Asn Pro

1 5 10 15

Asp Gln Ser Gly Glu Phe Met Phe Asp Phe Asp Gly Asp Glu Ile Phe

20 25 30

His Val Asp Met Ala Lys Lys Glu Thr Val Trp Arg Leu Glu Glu Phe

35 40 45

Gly Arg Phe Ala Ser Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile Ala

50 55 60

Val Asp Lys Ala Asn Leu Glu Ile Met Thr Lys Arg Ser Asn Tyr Thr

65 70 75 80

Pro Ile Thr Asn Val Pro Glu Val Thr Val Leu Thr Asn Ser Pro

85 90 95

Val Glu Leu Arg Glu Pro Asn Val Leu Ile Cys Phe Ile Asp Lys Phe

100 105 110

Thr Pro Pro Val Val Asn Val Thr Trp Leu Arg Asn Gly Lys Pro Val

115 120 125

Thr Thr Gly Val Ser Glu Thr Val Phe Leu Pro Arg Glu Asp His Leu

130 135 140

Phe Arg Lys Phe His Tyr Leu Pro Phe Leu Pro Ser Thr Glu Asp Val

145 150 155 160

Tyr Asp Cys Arg Val Glu His Trp Gly Leu Asp Glu Pro Leu Leu Lys

165 170 175

His Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro Glu Thr Thr Glu

180 185 190

<210> 58

<211> 198

<212> PRT

<213> Mus musculus

<400> 58

Gly Asp Ser Glu Arg His Phe Val His Gln Phe Lys Gly Glu Cys Tyr

1 5 10 15

Phe Thr Asn Gly Thr Gln Arg Ile Arg Leu Val Thr Arg Tyr Ile Tyr

20 25 30

Asn Arg Glu Glu Tyr Leu Arg Phe Asp Ser Asp Val Gly Glu Tyr Arg

35 40 45

Ala Val Thr Glu Leu Gly Arg His Ser Ala Glu Tyr Tyr Asn Lys Gln

50 55 60

Tyr Leu Glu Arg Thr Arg Ala Glu Leu Asp Thr Ala Cys Arg His Asn

65 70 75 80

Tyr Glu Glu Thr Glu Val Pro Thr Ser Leu Arg Arg Leu Glu Gln Pro

85 90 95

Asn Val Ala Ile Ser Leu Ser Arg Thr Glu Ala Leu Asn His His Asn

100 105 110

Thr Leu Val Cys Ser Val Thr Asp Phe Tyr Pro Ala Lys Ile Lys Val

115 120 125

Arg Trp Phe Arg Asn Gly Gln Glu Glu Thr Val Gly Val Ser Ser Thr

130 135 140

Gln Leu Ile Arg Asn Gly Asp Trp Thr Phe Gln Val Leu Val Met Leu

145 150 155 160

Glu Met Thr Pro His Gln Gly Glu Val Tyr Thr Cys His Val Glu His

165 170 175

Pro Ser Leu Lys Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser Glu

180 185 190

Ser Ala Arg Ser Lys Ser

195

<210> 59

<211> 196

<212> PRT

<213> Mus musculus

<400> 59

Glu Asp Asp Ile Glu Ala Asp His Val Gly Phe Tyr Gly Thr Thr Val

1 5 10 15

Tyr Gln Ser Pro Gly Asp Ile Gly Gln Tyr Thr His Glu Phe Asp Gly

20 25 30

Asp Glu Leu Phe Tyr Val Asp Leu Asp Lys Lys Lys Thr Val Trp Arg

35 40 45

Leu Pro Glu Phe Gly Gln Leu Ile Leu Phe Glu Pro Gln Gly Gly Leu

50 55 60

Gln Asn Ile Ala Ala Glu Lys His Asn Leu Gly Ile Leu Thr Lys Arg

65 70 75 80

Ser Asn Phe Thr Pro Ala Thr Asn Glu Ala Pro Gln Ala Thr Val Phe

85 90 95

Pro Lys Ser Pro Val Leu Leu Gly Gln Pro Asn Thr Leu Ile Cys Phe

100 105 110

Val Asp Asn Ile Phe Pro Pro Val Ile Asn Ile Thr Trp Leu Arg Asn

115 120 125

Ser Lys Ser Val Thr Asp Gly Val Tyr Glu Thr Ser Phe Leu Val Asn

130 135 140

Arg Asp His Ser Phe His Lys Leu Ser Tyr Leu Thr Phe Ile Pro Ser

145 150 155 160

Asp Asp Asp Ile Tyr Asp Cys Lys Val Glu His Trp Gly Leu Glu Glu

165 170 175

Pro Val Leu Lys His Trp Glu Pro Glu Ile Pro Ala Pro Met Ser Glu

180 185 190

Leu Thr Glu Ser

195

<210> 60

<211> 476

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 60

Met Ala Ile Ile Tyr Leu Ile Leu Leu Phe Thr Ala Val Arg Gly Ile

1 5 10 15

Lys Glu Glu His Val Ile Ile Gln Ala Glu Phe Tyr Leu Asn Pro Asp

20 25 30

Gln Ser Gly Glu Phe Met Phe Asp Phe Asp Gly Asp Glu Ile Phe His

35 40 45

Val Asp Met Ala Lys Lys Glu Thr Val Trp Arg Leu Glu Glu Phe Gly

50 55 60

Arg Phe Ala Ser Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile Ala Val

65 70 75 80

Asp Lys Ala Asn Leu Glu Cys Met Thr Lys Arg Ser Asn Tyr Thr Pro

85 90 95

Ile Thr Asn Val Pro Pro Glu Val Thr Val Leu Thr Asn Ser Pro Val

100 105 110

Glu Leu Arg Glu Pro Asn Val Leu Ile Cys Phe Ile Asp Lys Phe Thr

115 120 125

Pro Pro Val Val Asn Val Thr Trp Leu Arg Asn Gly Lys Pro Val Thr

130 135 140

Thr Gly Val Ser Glu Thr Val Phe Leu Pro Arg Glu Asp His Leu Phe

145 150 155 160

Arg Lys Phe His Tyr Leu Pro Phe Leu Pro Ser Thr Glu Asp Val Tyr

165 170 175

Asp Cys Arg Val Glu His Trp Gly Leu Asp Glu Pro Leu Leu Lys His

180 185 190

Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro Glu Thr Thr Glu Ser Gly

195 200 205

Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

210 215 220

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

225 230 235 240

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

245 250 255

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

260 265 270

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

275 280 285

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

290 295 300

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

305 310 315 320

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

325 330 335

Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp Glu Leu Thr Lys

340 345 350

Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

355 360 365

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

370 375 380

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

385 390 395 400

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

405 410 415

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

420 425 430

Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Gly Ser Gly Ser Leu Gly

435 440 445

Gly Ile Phe Glu Ala Met Lys Met Glu Leu Arg Asp His His His His

450 455 460

His His Asn Trp Ser His Pro Gln Phe Glu Lys Cys

465 470 475

<210> 61

<211> 478

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 61

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Cys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His

245 250 255

Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val

260 265 270

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

275 280 285

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

290 295 300

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

305 310 315 320

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

325 330 335

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

340 345 350

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

355 360 365

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro

370 375 380

Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala

385 390 395 400

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

405 410 415

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

420 425 430

Asp Gly Ser Phe Phe Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg

435 440 445

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

450 455 460

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

465 470 475

<210> 62

<211> 443

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 62

Met Met Ser Phe Val Ser Leu Leu Leu Val Gly Ile Leu Phe His Ala

1 5 10 15

Thr Gln Ala Ile Lys Glu Glu His Val Ile Ile Gln Ala Glu Phe Tyr

20 25 30

Leu Asn Pro Asp Gln Ser Gly Glu Phe Met Phe Asp Phe Asp Gly Asp

35 40 45

Glu Ile Phe His Val Asp Met Ala Lys Lys Glu Thr Val Trp Arg Leu

50 55 60

Glu Glu Phe Gly Arg Phe Ala Ser Phe Glu Ala Gln Gly Ala Leu Ala

65 70 75 80

Asn Ile Ala Val Asp Lys Ala Asn Leu Glu Met Thr Lys Arg Ser Asn

85 90 95

Tyr Thr Pro Ile Thr Asn Val Pro Pro Glu Val Thr Val Leu Thr Asn

100 105 110

Ser Val Glu Leu Arg Glu Pro Asn Val Leu Ile Cys Phe Ile Asp Lys

115 120 125

Phe Thr Pro Val Val Asn Val Thr Trp Leu Arg Asn Gly Lys Pro Val

130 135 140

Thr Thr Gly Val Ser Glu Thr Val Phe Leu Pro Arg Glu Asp His Leu

145 150 155 160

Phe Arg Lys Phe His Tyr Leu Pro Phe Leu Pro Ser Thr Glu Asp Val

165 170 175

Tyr Asp Cys Arg Val Glu His Trp Gly Leu Asp Glu Pro Leu Leu Lys

180 185 190

His Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro Glu Thr Thr Glu Ser

195 200 205

Gly Gly Gly Gly Gly Asp Lys Thr His Thr Cys Pro Cys Pro Ala Pro

210 215 220

Glu Ala Ala Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

225 230 235 240

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

245 250 255

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

260 265 270

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

275 280 285

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

290 295 300

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

305 310 315 320

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

325 330 335

Glu Pro Gln Val Tyr Thr Leu Pro Pro Cys Arg Asp Glu Leu Thr Lys

340 345 350

Asn Gln Val Ser Leu Trp Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

355 360 365

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

370 375 380

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

385 390 395 400

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

405 410 415

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

420 425 430

Leu Ser Leu Ser Pro Gly Gly Ser Gly Ser Cys

435 440

<210> 63

<211> 478

<212> PRT

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 63

Met Gly Ser Leu Gln Pro Leu Ala Thr Leu Tyr Leu Leu Gly Met Leu

1 5 10 15

Val Ala Ser Ser Leu Gly Gln His Leu Gln Lys Asp Tyr Arg Ala Tyr

20 25 30

Tyr Thr Cys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Ser

35 40 45

Gly Asp Thr Arg Pro Arg Phe Leu Glu Tyr Ser Thr Ser Glu Cys His

50 55 60

Phe Phe Asn Gly Thr Glu Arg Val Arg Tyr Leu Asp Arg Tyr Phe His

65 70 75 80

Asn Gln Glu Glu Asn Val Arg Phe Asp Ser Asp Val Gly Glu Phe Arg

85 90 95

Ala Val Thr Glu Leu Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln

100 105 110

Lys Asp Leu Leu Glu Gln Lys Arg Gly Arg Val Asp Asn Tyr Cys Arg

115 120 125

His Asn Tyr Gly Val Val Glu Ser Phe Thr Val Gln Arg Arg Val His

130 135 140

Pro Lys Val Thr Val Tyr Pro Ser Lys Thr Gln Pro Leu Gln His His

145 150 155 160

Asn Leu Leu Val Cys Ser Val Ser Gly Phe Tyr Pro Gly Ser Ile Glu

165 170 175

Val Arg Trp Phe Arg Asn Gly Gln Glu Glu Lys Thr Gly Val Val Ser

180 185 190

Thr Gly Leu Ile His Asn Gly Asp Trp Thr Phe Gln Thr Leu Val Met

195 200 205

Leu Glu Thr Val Pro Arg Ser Gly Glu Val Tyr Thr Cys Gln Val Glu

210 215 220

His Pro Ser Val Thr Ser Pro Leu Thr Val Glu Trp Arg Ala Arg Ser

225 230 235 240

Glu Ser Ala Gln Ser Lys Ser Gly Gly Gly Gly Gly Asp Lys Thr His

245 250 255

Thr Cys Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly Gly Pro Ser Val

260 265 270

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

275 280 285

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

290 295 300

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

305 310 315 320

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser

325 330 335

Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys

340 345 350

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

355 360 365

Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Cys Thr Leu Pro

370 375 380

Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Ser Cys Ala

385 390 395 400

Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn

405 410 415

Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

420 425 430

Asp Gly Ser Phe Phe Leu Val Ser Lys Leu Thr Val Asp Lys Ser Arg

435 440 445

Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu

450 455 460

His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

465 470 475

<210> 64

<211> 1344

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 64

atgatgagct tcgtgagcct gctgctggtg ggcatcctgt tccacgccac ccaggccatc 60

aaagaagaac atgtgatcat ccaggccgag ttctatctga atcctgacca atcaggcgag 120

tttatgtttg actttgatgg tgatgagatt ttccatgtgg atatggcaaa gaaggagacg 180

gtctggcggc ttgaagaatt tggacgattt gccagctttg aggctcaagg tgcattggcc 240

aacatagctg tggacaaagc caacctggaa tgcatgacaa agcgctccaa ctatactccg 300

atcaccaatg tacctccaga ggtaactgtg ctcacaaaca gccctgtgga actgagagag 360

cccaacgtcc tcatctgttt catagacaag ttcaccccac cagtggtcaa tgtcacgtgg 420

cttcgaaatg gaaaacctgt caccacagga gtgtcagaga cagtcttcct gcccagggaa 480

gaccaccttt tccgcaagtt ccactatctc cccttcctgc ccctcaactga ggacgtttac 540

gactgcaggg tggagcactg gggcttggat gagcctcttc tcaagcactg ggagtttgat 600

gctccaagcc ctctcccaga gactacagag tccgggaggcg gaggcggaga caaaactcac 660

acatgcccac cgtgcccagc acctgaagcc gcggggggac cgtcagtctt cctcttcccc 720

ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacatg cgtggtggtg 780

gacgtgagcc acgaagaccc tgaggtcaag ttcaactggt acgtggacgg cgtggaggtg 840

cataatgcca agacaaagcc gcgggaggag cagtacaaca gcacgtaccg tgtggtcagc 900

gtcctcaccg tcctgcacca ggactggctg aatggcaagg agtacaagtg caaggtctcc 960

aacaaagccc tcccagcccc catcgagaaa accatctcca aagccaaagg gcagccccga 1020

gaaccacagg tgtacaccct gcccccatgc cgggatgagc tgaccaagaa ccaggtcagc 1080

ctgtggtgcc tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat 1140

gggcagccgg agaacaacta caagaccacg cctcccgtgc tggactccga cggctccttc 1200

ttcctctaca gcaagctcac cgtggacaag agtaggtggc agcaggggaa cgtcttctca 1260

tgctccgtga tgcatgaggc tctgcacaac cactacacac agaagagcct ctccctgtct 1320

ccgggcggta gtggtagttg ttga 1344

<210> 65

<211> 1437

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial sequence description: synthetic

polypeptide"

<400> 65

atgggttctc tgcaaccgct ggccaccttg tacctgctgg gtatgctggt cgctagcagc 60

ctcggacagc acctgcagaa ggactacaga gcctactaca cctgtggagg tggaggcggc 120

tcaggaggtg gaagcggcgg ctctggggac acccgaccac gtttcttgga gtactctacg 180

tctgagtgtc atttcttcaa tgggacggag cgggtgcggt acctggacag atacttccat 240

aaccagggagg agaacgtgcg cttcgacagc gacgtggggg agttccgggc ggtgacggag 300

ctggggcggc ctgatgccga gtactggaac agccagaagg acctcctgga gcagaagcgg 360

ggccgggtgg acaactactg cagacacaac tacggggttg tggagagctt cacagtgcag 420

cggcgagtcc atcctaaggt gactgtgtat ccttcaaaga cccagcccct gcagcaccat 480

aacctcctgg tctgttctgt gagtggtttc tatccaggca gcattgaagt caggtggttc 540

cggaatggcc aggaagagaa gactggggtg gtgtccacag gcctgatcca caatggagac 600

tggaccttcc agaccctggt gatgctggaa acagttcctc ggagtggaga ggtttacacc 660

tgccaagtgg agcacccaag cgtgacaagc cctctcacag tggaatggag agcacggtct 720

gaatctgcac agagcaagtc cggaggcggga ggcggagaca aaactcacac atgcccaccg 780

tgcccagcac ctgaagccgc ggggggaccg tcagtcttcc tcttcccccc aaaacccaag 840

gacaccctca tgatctcccg gacccctgag gtcacatgcg tggtggtgga cgtgagccac 900

gaagaccctg aggtcaagtt caactggtac gtggacggcg tggaggtgca taatgccaag 960

acaaagccgc gggaggagca gtacaacagc acgtaccgtg tggtcagcgt cctcaccgtc 1020

ctgcaccagg actggctgaa tggcaaggag tacaagtgca aagtctccaa caaagccctc 1080

ccagccccca tcgagaaaac catctccaaa gccaaagggc agccccgaga accacaggtg 1140

tgcaccctgc ccccatcccg ggatgagctg accaagaacc aggtcagcct gagctgcgcg 1200

gtcaaaggct tctatcccag cgacatcgcc gtggagtggg agagcaatgg gcagccggag 1260

aacaactaca agaccacgcc tcccgtgctg gactccgacg gctccttctt cctcgtcagc 1320

aagctcaccg tggacaagag caggtggcag caggggaacg tcttctcatg ctccgtgatg 1380

catgaggctc tgcacaacca ctacacacag aagagcctct ccctgtctcc cggctga 1437

<---

Claims (67)

1. An isolated heterodimer for regulating the immune response, containing: at least one first polypeptide containing an amino acid sequence that is at least 90% identical to an amino acid sequence selected from SEQ ID NO: 53 and SEQ ID NO: 54, and at least one second polypeptide containing an amino acid sequence that is at least 90% identical to an amino acid sequence selected from SEQ ID NO: 51 and SEQ ID NO: 52, moreover, the first polypeptide and the second polypeptide meet on the contact surface, and the contact surface of the first polypeptide contains a designed protrusion, which is located in the designed cavity on the contact surface of the second polypeptide; and wherein one of the first and second polypeptides of the heterodimer contains an MHC class II α-domain and the other of the first and second polypeptides contains an MHC class II β-domain, such that either (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof. 2. The isolated heterodimer of claim 1, wherein the overhang contains one or more unnatural amino acid residues. 3. An isolated heterodimer according to claim 1 or 2, wherein the protrusion contains one or more amino acids selected from phenylalanine, arginine, tyrosine, tryptophan, and cysteine. 4. Selected heterodimer according to any one of paragraphs. 1, 2, wherein the first or second polypeptide of the isolated heterodimer contains an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 53. 5. The isolated heterodimer according to claim 4, wherein the first or second polypeptide of the isolated heterodimer contains an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 54. 6. The isolated heterodimer according to claim 1, wherein the first polypeptide of the isolated heterodimer comprises an engineered protrusion comprising an MHC class II β1 domain, a class II MHC β2 domain, an IgG C _H 2 domain, and an IgG C _H 3 domain, wherein the protrusion is formed by mutations in the C domain _H 3 corresponding to S354C and T366W (EU numbering), and the second polypeptide contains the α1 MHC class II domain, the α2 MHC class II domain, the C _H 2 domain of IgG and the C _H 3 domain of IgG, and the cavity is formed by mutations in the C _H 3 domain of IgG corresponding to Y349C, T366S, L368A and Y407V (EU numbering). 7. The isolated heterodimer of claim 1, wherein the cavity contains a non-naturally occurring amino acid residue. 8. An isolated heterodimer according to claim 1 or 7, wherein the cavity contains one or more amino acids selected from alanine, serine, threonine, valine, and cysteine. 9. The isolated heterodimer of claim 1, wherein the first or second polypeptide of the isolated heterodimer contains an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 51. 10. The isolated heterodimer of claim 9, wherein the first or second polypeptide of the isolated heterodimer contains an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 52. 11. Selected heterodimer according to any one of paragraphs. 1-10, wherein one or both of the first polypeptide or the second polypeptide does not contain a heterologous dimerization domain. 12. Selected heterodimer according to any one of paragraphs. 1-11, in which one or both of the first polypeptide or the second polypeptide does not contain a leucine zipper. 13. Selected heterodimer according to any one of paragraphs. 1-12, wherein one or both of the first polypeptide or the second polypeptide does not contain a site-specific biotinylation site. 14. Selected heterodimer according to any one of paragraphs. 1-13, additionally containing an antigen related to an autoimmune disease. 15. The isolated heterodimer of claim 14, wherein the disease antigen comprises a polypeptide at least 11 amino acids in length. 16. The isolated heterodimer of claim 15, wherein the autoimmune disease antigen is linked to an MHC class II α1 domain or an MHC class II β1 domain by a flexible linker. 17. The isolated heterodimer of claim 14 wherein the antigen is covalently linked to the MHC class II α1 domain or class II MHC β1 domain via a disulfide bond formed between the cysteine amino acid associated with the antigenic peptide and the cysteine amino acid of the MHC class II α1 domain or domain β1 MHC class II. 18. The isolated heterodimer of claim 17, wherein the cysteine amino acid of the MHC class II α1 domain or MHC class II β1 domain is within 10 amino acids of a residue that forms part of the MHC class II binding groove. 19. The isolated heterodimer of claim 18, wherein the cysteine residue of the MHC class II α1 domain or MHC class II β1 domain is within 3 amino acids of the residue that forms part of the MHC class II binding groove. 20. Selected heterodimer according to any one of paragraphs. 17-19 wherein the amino acid cysteine of an MHC class II α1 domain or an MHC class II β1 domain is introduced into a naturally occurring sequence of an MHC class II α1 domain or an MHC class II β1 domain. 21. The use of a selected heterodimer according to any one of paragraphs. 1-20 for treating an individual diagnosed with an autoimmune disease. 22. Polynucleotide encoding the first polypeptide according to any one of paragraphs. 1-20. 23. The host cell, which is a Chinese hamster ovary cell (CHO), to obtain the polypeptide according to one of paragraphs. 1-20 containing an expression vector containing a polynucleotide according to claim 22 or 41. 24. The host cell of claim 23, wherein the expression vector is stably integrated into the genome. 25. A heterodimer-nanoparticle conjugate for the treatment of an autoimmune disease, containing an isolated heterodimer according to any one of paragraphs. 1-20, wherein at least one heterodimer is conjugated to the nanoparticle to form a heterodimer-nanoparticle conjugate, wherein the nanoparticle contains a solid core of gold, iron, or iron oxide. 26. The heterodimer-nanoparticle conjugate of claim 25, wherein the solid core is less than 100 nanometers in diameter. 27. Conjugate heterodimer-nanoparticle according to any one of paragraphs. 25, 26, in which at least one heterodimer is covalently bonded to the nanoparticle. 28. The heterodimer-nanoparticle conjugate of claim 27, wherein at least one heterodimer is covalently linked to the nanoparticle via a polyethylene glycol (PEG) containing linker. 29. The heterodimer-nanoparticle conjugate of claim 28, wherein the polyethylene glycol is functionalized with maleimide. 30. The heterodimer-nanoparticle conjugate of claim 29, wherein the polyethylene glycol is less than 5 kDa. 31. A pharmaceutical composition for the treatment of an autoimmune disease, containing an effective amount of a heterodimer-nanoparticle conjugate according to any one of paragraphs. 25-30 and pharmaceutical excipient, stabilizer or diluent. 32. The use of a heterodimer-nanoparticle conjugate according to any one of paragraphs. 25-30 or a pharmaceutical composition according to claim 31 for the treatment of an autoimmune disease. 33. A method of treating an autoimmune disease, comprising administering to an individual a heterodimer-nanoparticle conjugate according to any one of paragraphs. 25-30 or a pharmaceutical composition according to claim 31. 34. Method for obtaining a heterodimer containing the first polypeptide and the second polypeptide: at least one first polypeptide containing an amino acid sequence that is at least 90% identical to an amino acid sequence selected from SEQ ID NO: 51 and SEQ ID NO: 52, and at least one second polypeptide containing an amino acid sequence that is at least 90% identical to the amino acid sequence selected from SEQ ID NO: 53 and SEQ ID NO: 54, and the first polypeptide and the second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that is located in an engineered cavity on the contact surface of the second polypeptide; and wherein one of the first and second polypeptides of the heterodimer contains an MHC class II α-domain, and the other of the first and second polypeptides contains a class II MHC β-domain, such that either (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof; including stages: (i) culturing a host cell containing a nucleic acid encoding a first polypeptide and a second polypeptide, including their interfaces, wherein the nucleic acid encoding the interface of the first polypeptide has been changed from the nucleic acid encoding the original interface of the first polypeptide, to coding for a protrusion, the nucleic acid encoding the second polypeptide interface has been changed from the nucleic acid encoding the original interface of the second polypeptide to encoding the cavity, or both, and wherein the culture is such that both the first polypeptide and the second polypeptide are expressed; and (ii) recovering and purifying the heterodimer from the host cell culture. 35. A method for producing a heterodimer containing a first polypeptide and a second polypeptide, wherein the first polypeptide and the second polypeptide meet at a contact surface, wherein the contact surface of the first polypeptide comprises an engineered protrusion that is located in an engineered cavity on the contact surface of the second polypeptide; and (i) the first polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, or (ii) the first polypeptide comprises an MHC class II β1 domain, an MHC class II β2 domain, or a combination thereof, and the second polypeptide comprises an MHC class II α1 domain, an MHC class II α2 domain, or a combination thereof; including stages: (i) culturing a first host cell containing a nucleic acid encoding a first polypeptide; (ii) culturing a second host cell containing a nucleic acid encoding a second polypeptide; (iii) isolating the first and second polypeptides from host cell cultures; as well as (iv) forming a heterodimer by incubating the first and second polypeptides together; wherein the nucleic acid encoding the contact surface of the first polypeptide was changed from the nucleic acid encoding the original contact surface of the first polypeptide to encode the protrusion, and the nucleic acid encoding the contact surface of the second polypeptide was changed from the nucleic acid encoding the original contact surface of the second polypeptide, to encode the cavity, or both. 36. The method of claim 34 or 35, wherein the nucleic acid encoding the first polypeptide and the second polypeptide is stably integrated into the genome of the host cell. 37. The method of claim 34 wherein the host cell comprises a Chinese Hamster Ovary (CHO) cell. 38. The method of claim 35 wherein the first and second host cells comprise a Chinese Hamster Ovary (CHO) cell. 39. The method according to any one of paragraphs. 34-38 wherein recovering the polypeptides from the host cell culture or host cell cultures comprises applying a liquid containing the heterodimer to a liquid chromatography column. 40. The method of claim 39, wherein the liquid chromatography column contains protein A, protein G, protein L, or any combination thereof. 41. A polynucleotide encoding a second polypeptide according to any one of claims 1-20. 42. The use of a heterodimer-nanoparticle conjugate according to any one of paragraphs. 25-30 or the pharmaceutical composition of claim 31 for the treatment of an inflammatory condition. 43. A method of treating an inflammatory condition, comprising administering to an individual a heterodimer-nanoparticle conjugate according to any one of paragraphs. 25-30 or a pharmaceutical composition according to claim 31.

Images