RU2775914C2 - Method for amplification of nucleic acids of heavy and light chains of human immunoglobulins for the creation of recombinant antibodies, primer compositions (variants) - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, in particular to the method for amplification of nucleic acids of the heavy and light chain of human immunoglobulins.

EFFECT: invention makes it possible to reduce the probability of false-negative amplification, increasing the probability of successful amplification of cDNA antibodies with rarely occurring alleles of V gene segments.

1 cl, 16 dwg, 6 ex

Description

The invention relates to the field of biotechnology, bioengineering, biopharmacology, and can be used for the design and preparative (non-industrial) production of recombinant fully human antibodies specific for the antigen of interest.

Antibodies are able to specifically bind to foreign molecules and infectious agents and neutralize them. Therefore, medicinal products with proven clinical efficacy, including target-specific monoclonal antibodies as an active substance or as a component of a therapeutic composition, are already being actively produced, and this direction has been successfully developed over the past two decades. The most promising for therapeutic use are fully human monoclonal antibodies. They are less immunogenic than humanized and chimeric monoclonal antibodies. By the first half of 2020, the US Food and Drug Administration (FDA), in conjunction with the European Medicines Agency (EMA), has approved approximately 40 fully human therapeutic antibodies as therapeutic agents. Most of them have been certified in the last 5 years.

In terms of immunogenicity, natively paired antibodies formed in a living organism (in vivo) are considered the safest. Their fragments are encoded in the genome of human germline cells, so they will be minimally perceived by the body as foreign molecules. There are several main ways to obtain human antibodies with natively paired heavy and light chain variable domains (V _H and V _L ). One method involves working with single immunoglobulin-producing cells. As a rule, these are peripheral blood cells: plasmablasts or memory B-lymphocytes with a switched class of immunoglobulin. However, plasma cells (lymphocytic plasmocytes) from the secondary lymphoid organs of the pharyngeal lymphatic ring can also be used. From single cells isolated using a micromanipulator or fluorescence sorting (FACS) cells, cDNA encoding the variable domains of immunoglobulin chains is amplified, and then, if necessary, adding the missing (not amplified) constant regions using genetic engineering, genes of a full-size recombinant antibody are obtained in plasmid vectors for eukaryotic expression.

Single primary peripheral blood cells contain an extremely small amount of RNA: 10–30 pg of the total RNA fraction, among which the proportion of mRNA does not exceed 5%. Various immunoglobulin light and heavy chain transcripts do not have a constant nucleotide composition in the 5′ region, since the variable domain is encoded by a set of V, D (heavy chain only), J gene segments, which undergo V(D)J recombination during domain formation. Each V segment contains three functional parts: a promoter and two exons that encode the signal sequence and the N-terminal part of the variable domain. Currently, according to the IMGT (International ImMunoGeneTics information system) database, 55 functional IGHV gene segments for the formation of the V _H domain polynucleotide, 41 functional segments of IGKV and 33 functional segments of IGLV for the formation of the V _L domain polynucleotide are known (not counting allelic variants of the segments). Among the V-segments of one group, nucleotide homology of varying degrees occurs. Due to this, as well as the use of several degenerate nucleotides during the design of 5' primers, it is possible to significantly reduce the number of primers for hybridization with the beginning of the coding sequences of the variable domain or signal sequence. The nucleotide diversity of the terminal regions of the J-segments, which correspond to the end of the variable domains V _H and V _L , is represented to a lesser extent, therefore, a total of 9-13 3' primers can be covered for all possible variants of the heavy chain and light chain cDNA of both types: κ and λ. Since the variable domain is followed by a constant domain, which is encoded by a relatively conserved nucleotide sequence within each type of heavy chain (α, γ, ε, μ) and each type of light chain (κ and λ), the number of 3' primers can be reduced to the number of these types , for example, will be limited to four for routine studies: to the heavy chain γ and μ, the light chain κ and λ. Currently, for the amplification of cDNA (complementary DNA) of the variable part of immunoglobulin from single cells, two-stage (nested) PCR is considered an integral operation in protocols for the creation of recombinant natively paired human antibodies. However, methods for performing nested PCR described in the literature differ from each other to one degree or another, in particular, the features of the selection of single cells, the reverse transcription protocol, primers, modes and reagents, as well as vectors for embedding the resulting PCR products for further expression. antibodies. Almost all known methods eliminate the special stage of RNA isolation, replacing it with direct cell lysis in buffer, which is then fully involved in the reverse transcription reaction and cDNA amplification. Due to this, time and labor costs are reduced, reproducibility of results is increased, RNA is less exposed to the risk of degradation and contamination. Existing methods for amplifying natively paired human immunoglobulin cDNA are discussed below. They either directly target the production of recombinant antibodies, or antibodies can be created post factum by genetic engineering after the results of sequencing of the V _H and V _L nucleotide sequences. None of the methods is a full-fledged prototype of the proposed method. The main amplification methods are presented below.

The first rational protocol for the amplification of the Fab fragment of immunoglobulin G with κ and λ light chain isotype from single immunoglobulin-producing B-lymphocytes and plasma cells is presented in (Coronella JA et al. Amplification of IgG V _H and V _L (Fab) from single human plasma cells and B cells //Nucleic acids research. - 2000. - V. 28. - No. 20. - P. e85-e85.). Described is cell sorting directly into the reaction buffer, reverse transcription primed for the synthesis of the first strand using oligo(dT) ₁₆ , then semi-nested PCR, where the same 5' primers are involved in the first and second stages according to (Sblattero D., Bradbury A. A definitive set of oligonucleotide primers for amplifying human V regions // Immunotechnology. - 1998. - V. 3. - No. 4. - P. 271-278.), corresponding to the beginning of FR1 in the V-segments. Primers 3' for the first and second PCR are complementary to the sequences in the constant regions and borrowed from (Burton DR, Barbas III CF Human antibodies from combinatorial libraries //Advances in immunology. - Academic Press, 1994. - T. 57. - P. 191- 280.). A total of 29 oligonucleotides are used to amplify the V _H and V _L domains of IgG. The aim of this work is not to obtain full-length recombinant polynucleotides for the purpose of further expression of antibodies. Despite the minimal number of oligonucleotides and the relatively high reported success rates for simultaneous amplification of V _H and V _L from a single cell (68% and 50% for plasma and B lymphocytes, respectively), there are few publications reproducing this protocol.

Currently, to obtain human recombinant antibodies from single cells, the protocol described in (Smith K. et al. Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen //Nature protocols. - 2009. - T. 4. - No. 3. - S. 372.). Briefly, in this work, human plasmablasts are sorted in salt-free 10 mM Tris buffer (pH 8.0) free of nucleases and containing the RNase inhibitor RNasin. Cell lysis and release of mRNA into the reaction mixture occurs due to the hypotonic properties of the buffer for cell sorting, followed by a single freeze-thaw of cells in this buffer. Next, with a single cell lysate as a source of mRNA, a reverse transcription reaction is carried out, followed by the first multiplex PCR in the same tube using the OneStep RT-PCR Kit (Qiagen). A mixture of gene-specific primers to the constant regions of the heavy chain of the γ and μ types and the light chain of the κ and λ isotypes is added to the reaction to prime the synthesis of the first strand of cDNA, as well as a mixture of outer 5' and 3' primers for the first PCR. Primers 5' are designed to mate with a region of the signal sequence (valid for the 5'L Vκ group), or with the junction of the signal sequence and FR1 (valid for the primer group 5'L-VH and 5'L Vλ). Group 3' primers are complementary to the cDNA of the corresponding constant domains. Upon completion of the first PCR, a second PCR is performed, which in turn is carried out in separate tubes for each type of heavy chain and light chain. It uses primers that anneal inside the obtained PCR products and contain non-complementary overhangs (overhangs) with restriction sites. The resulting amplification products are cloned into vectors with an open reading frame and the missing polynucleotide fragments of the light and heavy chains for the expression of antibodies of the IgG1 class in the eukaryotic system. In total, from 50 to 52 oligonucleotides (up to 1660 nucleotides) can be involved in the process of converting the mRNA of a single cell into recombinant DNA encoding the light and heavy chains of human immunoglobulin.

Later publication (Rudkin FM et al. Single human B cell-derived monoclonal anti-Candida antibodies enhance phagocytosis and protect against disseminated candidiasis //Nature communications. - 2018. - T. 9. - No. 1. - P. 1- 16.) describes a different protocol for obtaining recombinant antibodies from single cells. In particular, oligo(dT) ₂₀ is used for first strand cDNA synthesis. This is followed by the first stage of nested PCR, where 5' primers are used, similar to (Smith K. et al. Rapid generation ... P. 372.), And 3' primers are replaced with author's ones: two oligonucleotides to the coding region C _H1 of the γ heavy chain domain and three primers to the terminal regions of cDNA light chains of each type: a section of the last few codons of the constant domain and two sections synthesized on the template of the 3'-untranslated region of mRNA. The use of multiple 3' primers is likely used to enhance amplification. The list of primers for the second stage of PCR has been significantly expanded and improved compared to (Smith K. et al. Rapid generation ... P. 372.) to cover more V-segment alleles. As a result, the light chains are amplified full-length, while only the V _H domain is amplified within the heavy chain. An additional feature of this protocol is the rejection of the use of restriction enzymes in favor of In-Fusion cloning, which entails the addition of each primer with a large overhang of 14 nucleotides. In total, 104 primers (4119 nucleotides) are used in the method.

An alternative way can be considered the work (Ozawa T., Kishi H., Muraguchi A. Amplification and analysis of cDNA generated from a single cell by 5′-RACE: application to isolation of antibody heavy and light chain variable gene sequences from single B cells / /Biotechniques. - 2006. - T. 40. - No. 4. - P. 469-478.). The authors developed a strategy for amplifying cDNA of immunoglobulins with heavy chain γ and μ and light chain κ and λ from single B cells using the 5'-RACE method. It involves seeding the synthesis of the first cDNA strands with four gene-specific primers in a reverse transcription reaction, and the subsequent addition of an adapter sequence to the 5'-ends of the synthesized cDNA through the extension of a homopolymeric nucleotide sequence at the 3'-OH end of the first cDNA strand by the enzyme terminal deoxynucleotilytransferase. This homopolymeric nucleotide sequence, in turn, hybridizes a primer with a complementary homopolymer sequence and an adapter nucleotide sequence. This adapter sequence further serves as a site for sequential annealing of two 5' primers: internal and external, involved in the first and second stages of nested PCR. Two 3′ primers are also used (similarly, one external, the second internal) to each constant region of the light chain κ and λ and the heavy chain γ and μ. Thus, with the complete rejection of primers complementary to the V and J gene segments, it is possible to amplify the V _H /V _L pair from more than 50% of B cells.

In (Rajan S. et al. Recombinant human B cell repertoires enable screening for rare, specific, and natively paired antibodies // Communications biology. - 2018. - Vol. 1. - No. 1. - P. 1-8. ) presents a method for generating natively paired scFv phage libraries from human B lymphocytes. The authors designed 92 primers for hybridization with all known human V and J gene segments: a total of 542 alleles at the time of publication, obtained on the basis of consensus sequences from the IMGT database. For the method proposed in this application, a list of primers for V-segments has been developed, reduced and rationalized to reduce the cost of synthesis based on complementary parts of the internal 5' primers of the VH_in_5, VK_in_5, VL_in_5 groups from this work.

The disadvantages of existing methods for amplifying polynucleotides of a pair of natively paired V _H and V _L can be considered:

A. a large number of synthetic primers and the total length of nucleotides;

B. the fact that some methods are not designed for the subsequent rapid assembly of recombinant DNA encoding full-length human immunoglobulin chains;

B. the fact that for some methods the efficiency of successful simultaneous amplification of cDNA and V _H and V _L domains is not more than 70%.

The technical result of the proposed invention lies in the fact that a method is proposed for amplifying the nucleic acids of the V _H and V _L domains of single immunoglobulin-producing human cells obtained from the biological material of donors, which makes it possible to reduce the likelihood of false negative amplification, increasing the likelihood of successful amplification of cDNA antibodies with rare V alleles. gene segments. In the future, a recombinant antibody created by chimerization of the coding sequences of human immunoglobulin constant domains with amplified polynucleotides can be tested and approved as a therapeutic agent.

The technical result is achieved by using a modified SMART technology (switching mechanism at the 5' end of the RNA transcript) for cDNA synthesis and selective enrichment of target low-copy templates for the next PCR stage. The modification consists in replacing the anchored oligo(dT) ₃₀ primer with an adapter nucleotide sequence with a composition of five gene-specific primers to conserved regions of immunoglobulin chains of all possible types. The adapter sequence remains identical to that of oligo(dT). The result of RT-PCR (reverse transcription PCR) is a mixture of many copies of two cDNA along with non-specific reaction products. One cDNA encodes a variable domain and a portion of an α, γ, ε or μ type heavy chain constant domain; the second encodes the variable domain and part of the heavy chain constant domain of the κ or λ type. In this case, the type of chains after the first PCR is unknown and is not established, since it does not matter.

Also, the technical result is achieved by the fact that a set of primers is proposed for compiling three compositions participating in three parallel PCR of the second stage. An aliquot of the first PCR performed by SMART cDNA synthesis serves as template in three subsequent separate PCRs with primers to amplify the V _H , Vκ or Vλ regions. For each PCR of the second stage, compositions of 5' and 3' primers were developed. These primers do not have non-complementary overhangs (overhangs) at the 5'-ends to introduce a restriction site, however, each group 3' primer that hybridizes to a conservative site contains a restriction site with the formation of a sticky end "inside itself", without violating the primary amino acid sequence of the immunoglobulin chain . In turn, 5' primers are designed for hybridization with all possible allelic variants of the V gene segments of IGHV, IGKV, IGLV human immunoglobulin. After the second PCR, the V _H domain amplicon and the resulting V _L domain amplicon are purified and cloned into vectors that, when co-expressed in eukaryotic cells, form a complete IgG1 molecule.

Also, the technical result is achieved by the proposed isolation of single immunoglobulin-producing cells from human biological material in the process of cytofluorometric sorting (FACS) on the basis of specific interaction with the antigen. Thus, the described method is aimed at obtaining specific antibodies to the antigen of interest. Cells are sorted directly into solutions that promote rapid in situ lysis and do not inhibit the reverse transcription and amplification reaction.

The difference of the proposed method is that it is proposed to use 32 or 34 synthetic primers for amplification. The total length of synthesized primers is 762 or 815 nucleotides, depending on whether commercial kits are used, which already contain 2 universal oligonucleotides. Also provided are primers for amplifying V _H from cells producing heavy chain antibodies such as α and ε.

The claimed method provides for a two-stage amplification of cDNA of the variable domains of V _H and V _L immunoglobulin according to the principle of nested PCR, that is, in two stages. The first PCR is performed to multiplex amplify two of the six potential PCR products in one tube: an immunoglobulin-producing cell (plasma and class-switched memory B cells) can transcribe one of four types of heavy chain and one of two types of light chain. This PCR can be carried out thanks to reverse transcription using SMART technology. was developed and developed and developed (YYD libraries YYD libraries protocol technologi cals and militaries of n a t n a t m o n a t i o n s t r e c o n t i o n s. clyazed by M-MLV reverseRNA transcriptase //Gen Library and screenetic constructioning. – Springer, technol ogy berlincatal et cal et ical construction, Heidel, 2002. - P. 69-93. Zhu YY et al. Reverse transcriptase template switching: A SMART™ approach for full-length cDNA library construction // Biotechniques. - 2001. - V. 30. - No. 4. - P. 892-897.). The technology is designed to create full-length cDNA libraries from eukaryotic cells for further NGS sequencing. In SMART technology, the first strand of cDNA is synthesized using MMLV family revertases, which, upon completion of synthesis, exhibit terminal transferase activity by adding several deoxyribonucleotides, usually 3-4 dC nucleotides, to the 3'-end of a single-stranded cDNA. The standard primer for first strand synthesis is an anchored oligo(dT) ₃₀ VN with an oligonucleotide overhang of 20–30 nucleotides at the 3′ end, an adapter sequence. The second oligonucleotide required for SMART is the same adapter sequence with 3-4 rG ribonucleotide residues at the 3' end and is commonly referred to as Template Switching Oligo (TSO). The non-templated oligo(dC) serves as the hybridization site for the oligo(rG) region of the TSO oligonucleotide. Then, in the presence of Mn ^{2+ ions,} reversetase perceives TSO as a continuation of the RNA template, synthesizing a complementary strand in continuation of the 3′-OH end of the cDNA. Thus, the first strand of cDNA is obtained flanked at both ends by a universal nucleotide sequence complementary to the PCR primer at the 3'-end, and at the 5'-end corresponding to the PCR primer in the 3'-5' orientation. The PCR primer is the third necessary oligonucleotide for second strand synthesis and cDNA amplification. It acts as the only forward and reverse primer for double-stranded cDNA.

Graphic materials illustrating the invention:

Fig. 1. List of synthesized primers for making changes to plasmids from the Human IgG Vector Set.

Fig. 2. List of synthesized primers for cDNA amplification containing nucleotide sequences of human immunoglobulin variable regions.

Fig. 3. Graphical representation of the result of amplification of plasmids in order to introduce modifications in the form of electrophoretic separation of PCR products in 1% agarose gel.

Lane 1 - pSF-CMV-HuIgG1_HCmod. Lane 2 - pSF-CMV-HuKappa_LCmod. Lane 3 - pSF-CMV-HuLambda_LCmod. Lane 4 - DNA molecular weight marker GeneRuler DNA Ladder Mix (Thermo Fisher).

Fig. 4. Horizontal genetic maps of modified plasmid vectors pSF-CMV-HuIgG1_HCmod, pSF-CMV-HuKappa_LCmod and pSF-CMV-HuLambda_LCmod.

Fig. 5. Hybridization of the gene-specific primer 3' HuIgSMART-G&E with IgE heavy chain mRNA (Homo sapiens immunoglobulin heavy chain V-D-J-Ce region mRNA, partial sequence, GenBank: DQ680069.1). Graphical representation made using the BLAST nucleotide sequence alignment algorithm.

Fig. 6. Alignment of primers 3′ Cλ_XhoI and 3′ XhoI Cλ according to (Smith K. et al., 2009).

Fig. 7. Strategy for multi-stage gating of a subpopulation of memory B cells using a panel of CD19 APC/CD38 PE-Cy7/CD27 BB515/IgG BB700/antigen "A" PE.

Fig. 8. Graphical representation of the result of cDNA amplification of immunoglobulin chains from single memory B cells after electrophoretic separation of PCR products in 1.5% agarose gel.

Lane 1 is a negative heavy chain amplification from an empty A1 slot. Lane 2 is a negative light chain amplification result of the κ isotype of the cell from the empty slot A1. Lane 3 is a negative amplification of the isotype λ light chain from the empty slot A1. Lane 4 is immunoglobulin heavy chain cDNA from a cell in slot A2. Lane 5, immunoglobulin light chain cDNA of the κ isotype from a cell in slot A2. Lane 6 is a negative λ isotype light chain amplification result from a cell in slot A2. Lane 7 is immunoglobulin heavy chain cDNA from a cell in slot A3. Lane 8 is a negative κ isotype light chain amplification result from a cell in slot A3. Lane 9 is the λ isotype immunoglobulin light chain cDNA from a cell in slot A3. Lane 13 - DNA molecular weight marker GeneRuler DNA Ladder Mix (Thermo Fisher).

Fig. 9. Treatment of plasmids and inserts (cDNA) with various restriction endonucleases prior to ligation: visual representation in tabular form.

Fig. 10. Graphical representation of the result of screening E. coli colonies for the presence of a plasmid insert after electrophoretic separation of PCR products in 1.5% agarose gel.

Lane 1 is the product from the plasmid pSF-CMV-HuIgG1_HCmod without insert (control, 519 bp). Lane 2 is a product from an E. coli colony transformed with the pSF-CMV-HuIgG1_HCmod plasmid with cloned VH-A2agA cDNA (883 bp). Lane 3 is the product from the E. coli colony transformed with the pSF-CMV-HuIgG1_HCmod plasmid with cloned VH-A3agA cDNA (853 bp). Lane 4, product from plasmid CMV-HuKappa_LCmod without insert (control, 309 bp). Lane 5 is a product from an E. coli colony transformed with the plasmid pSF-CMV-HuKappa_LCmod with cloned Vκ-A2agA cDNA (746 bp). Lane 6 is the product from the plasmid pSF-CMV-HuLambda_LCmod without insert (control, 281 bp). Lane 7 is a product from an E. coli colony transformed with the pSF-CMV-HuLambda_LCmod plasmid with cloned Vλ-A3agA cDNA (639 bp). Lane 8 - DNA molecular weight marker GeneRuler DNA Ladder Mix (Thermo Fisher).

Fig. 11. Analysis of the sequenced region of pSF-HC-A2agA with the IMGT/V-QUEST instrument.

Fig. 12. Analysis of the sequenced region of pSF-HC-A3agA with the IMGT/V-QUEST instrument.

Fig. 13. Analysis of the sequenced region pSF-LC-A2agA with the IMGT/V-QUEST instrument.

Fig. 14. Analysis of the sequenced region pSF-LC-A2agA with the IMGT/V-QUEST instrument.

Fig. 15. Graphical representation of the result of purification of recombinant human antibodies A2agA and A3agA from culture liquid after electrophoretic separation in PAAG. Part A - separation in 7.5% PAAG under non-reducing conditions. Part B - separation in 12% PAAG under reducing conditions. Staining of Coomassie gels with R-250 Brilliant Blue.

Lane 1A, 1B—Spectra Multicolor Broad Range Protein Ladder (Thermo Fisher) protein molecular weight marker. Lane 2A is a sample of purified A2agA antibody. Lane 3A is a sample of purified A3agA antibody. Lane 2B is a sample of purified A2agA antibody supplemented with 2-mercaptoethanol. Lane 3B is a sample of purified A3agA antibody supplemented with 2-mercaptoethanol.

Fig. 16. Electrophoretic separation of antigen "A" in 12% PAAG. Part A - Coomassie gel staining with R-250 Brilliant Blue. Part B is the result of immunoblot binding of human recombinant human antibodies A2agA and A3agA to antigen "A".

Lanes 1A, 1B—Spectra Multicolor Broad Range Protein Ladder (Thermo Fisher) protein molecular weight marker. Lane 2A - antigen "A". Lane 2B, binding of the A2agA antibody to the A antigen. Lane 3B, binding of the A3agA antibody to the A antigen.

The essence of the invention.

For the practical implementation of the proposed method, it is proposed to use the SMART-Seq HT Kit (TaKaRa Bio), which allows you to perform a reverse transcription reaction and PCR in one tube (RT-PCR) from a minimum starting amount of 10 pg of RNA obtained by direct cell lysis without an isolation step. This kit contains the 3' SMART-Seq CDS Primer II A primer as an oligo(dT) with adapter sequence, and the SMART-Seq HT Oligonucleotide as TSO; The PCR primer is included in the One-Step Buffer reaction buffer. The present method eliminates the use of 3' SMART-Seq CDS Primer II A in the protocol, replacing it with the 3' HuIgSMART primer composition (group SEQ ID NO: 6, 7, 8, 9, 10). The composition is an equimolar mixture of gene-specific primers to prime the synthesis of the first strand of cDNA on the mRNA matrix of heavy chains γ, ε, α, μ and light chains κ and λ. In the 5' region of each primer of this composition is an adapter sequence (AAGCAGTGGTATCAACGCAGAGT), which then serves as the annealing site for the PCR primer. As a result, after reverse transcription and the first stage of PCR, the test tube contains enriched cDNA of the variable part of immunoglobulin, regardless of its class and isotype of the light chain. It is possible to use kits or individual components of kits for cDNA synthesis and amplification thanks to the use of SMART technology with the composition of gene-specific primers 3′ HuIgSMART instead of oligo(dT) _n : other TaKaRa Bio kits of the SMART-Seq and SMARTer lines, Template Switching RT Enzyme Mix (NEB #M0466), SmartRT Reverse Transcriptase Kit (MCLAB, USA), Mint (Evrogen, Russia), etc. The kits differ in declared sensitivity to the minimum starting amount of RNA in the reaction, different names of the components, the presence of a step for extracting RNA from the cell and / or separation of steps reverse transcription and cDNA amplification, if provided. In the absence of a specific lysis buffer for sorting human Ig ⁺ cells, a 0.3% solution of NP-40 detergent in nuclease and nucleic acid free deionized water supplemented with 160 U/mL of an RNase inhibitor can be used. It is also possible to perform the method without the use of ready-made commercial kits, using a suitable MMLV-revertase, thermostable DNA polymerase, synthesized by TSO and PCR primer.

Based on plasmid vectors pSF-CMV-HuIgG1_HC (OG527), pSF-CMV-HuKappa_LC (OG528), and pSF-CMV-HuLambda LC (OG529) from the commercially available Human IgG Vector Set for engineering chimeric or human immunoglobulins (PP2409, Oxford Genetics) ) create a working vector for cloning the immunoglobulin cDNA, which is obtained by the proposed method, into the existing reading frame. The changes are reduced to the addition of the ATG start code in the context environment of the Kozak sequence and the signal sequence polynucleotide with a restriction site at the end, as well as cutting off a part of the DNA encoding the constant domains C _H1 , Cκ, Cλ with the introduction of a "silent" mutation in order to open the site restrictions. A prerequisite is the selection of such a restriction site at the end of the coding sequence of the signal peptide, so that after enzymatic cutting, a blunt end is formed immediately after the last codon of this signal peptide. As an example, the signal sequence of the IGHV1-69*31 allele for the heavy chain expression vector and the IGKV1D-8*01 allele for the κ and λ light chain expression vectors are used (international patent application WO2014058389A1. Haryadi R. et al. Optimization of heavy chain and light chain signal peptides for high level expression of therapeutic antibodies in CHO cells // PloS one. - 2015. - V. 10. - No. 2. - P. e0116878). To modify plasmids, the WP-PCR (whole-plasmid PCR) method is used, in which linearized plasmid DNA is used as a template. The restriction enzymes RfuI (NruI isoschiisomer) and NsbI, respectively, are used to form blunt ends after the heavy and light chain signal sequence polynucleotides. In the nucleotide sequences of the constant domains, sites are selected where it is possible to introduce a restriction site with the formation of a sticky end without disturbing the amino acid sequence of this immunoglobulin chain. Consider that the desired restriction site in the plasmid vector after modification should occur only once, and at the same time the same restriction site should not occur in the cDNA sequence of the immunoglobulin chain intended for cloning into the appropriate vector. As a result, the SalI site is introduced into the pSF-CMV-HuIgG1_HC and pSF-CMV-HuKappa_LC vectors, and the XhoI site is introduced into the pSF-CMV-HuLambda_LC vector. All new genetic constructs are introduced using forward and reverse primers. An ApaI restriction site is added to the 5' end of each primer to easily close the modified plasmids. These primers were synthesized according to the nucleotide sequences as indicated in the sequence group SEQ ID NO: 1, 2, 3, 4, 5 and in the table shown in FIG. 1. Get new plasmid vectors pSF-CMV-HuIgG1_HCmod, pSF-CMV-HuKappa_LCmod and pSF-CMV-HuLambda_LCmod. Plasmid genetic maps are shown in Fig. 4. Partial nucleotide sequences of the plasmids are shown in the sequence listing as SEQ ID NO:38, SEQ ID NO:39, and SEQ ID NO:40, for the plasmids listed above, respectively.

Gene-specific primers of the 3'HuIgSMART group are designed: 3'HuIgSMART-G&E (SEQ ID NO: 6), 3'HuIgSMART-A (SEQ ID NO: 7), 3'HuIgSMART-M (SEQ ID NO: 8), 3' HuIgSMART-κ (SEQ ID NO: 9) and 3' HuIgSMART-λ (SEQ ID NO: 10), which are required to prime first-strand cDNA synthesis in a reverse transcription reaction. They are gene-specific because they are only complementary to the target mRNA. The principle of annealing gene-specific primers to mRNA is shown in FIG. 5, which shows as an example a graphical result of aligning the ε strand mRNA sequence (GenBank: DQ680069.1) and the 3′ HuIgSMART-G&E primer using the BLAST algorithm. Each primer is designed with the addition of a non-complementary sequence (overhang) in the 5′ region: (5′ AAGCAGTGGTATCAACGCAGAGT), which subsequently serves as the site for PCR primer annealing at the first stage of PCR with cDNA synthesized using SMART technology. These primers are synthesized according to the nucleotide sequences from the table shown in FIG. 2, lines No. 1 - 5.

The design of 5' and 3' primers for PCR of the second stage is carried out, where separate amplification of cDNA regions of the immunoglobulin heavy and light chains containing codons of the variable domain takes place. The group of 5' primers includes primers for hybridization with cDNA in the region of IGHV, IGKV, IGLV gene segments, starting from the first codon of the FR1 regions. These primers were synthesized according to the nucleotide sequences shown in SEQ ID NOs: 11-31 and the table shown in FIG. 2, lines 6–26. Since the 5'-ends of the amplicons are not subjected to restriction enzyme hydrolysis after PCR, the resulting blunt end must have a phosphate group at the 5'-carbon atom. For this, the 5' primers are designed to be phosphorylated at the 5' end. Group 3' primers are designed to hybridize at the conserved portion of the polynucleotides encoding the γ, ε, α, μ, κ, and λ immunoglobulin chains. Within these conserved sequences, a site is found where the restriction site can be introduced with a primer as a "silent" mutation without changing the amino acid sequence. The approximate primer annealing site and the desired restriction site are known in advance as this is taken into account when engineering the modified plasmid vectors. These primers were synthesized according to the nucleotide sequences shown in the group SEQ ID NO: 32-37 and the table shown in FIG. 2, lines nos. 27-32. The cDNA downstream of the restriction site is considered as a region to be deleted and then recreated or replaced (in the case of amplification of the variable domain of the heavy chain of an immunoglobulin other than IgG1) using the appropriate plasmid vector.

The proposed method, as an example, describes the selection of IgG ⁺ B-memory cells from human peripheral blood. The method is also applicable to memory B cells that produce IgA and IgE immunoglobulins, if isolated. Memory cells secrete membrane (surface) immunoglobulins as part of the B-cell receptor (BCR). Therefore, a population of these cells can be stained with the fluorescent antigen of interest in addition to immunophenotyping dyes prior to the fluorescent sorting procedure. It is proposed to take blood from donors who have immunity to an antigen, to which antibodies can most likely be produced as a result of vaccination, infection, food poisoning, infestation, etc. The method does not exclude the production of monoclonal antibodies from single plasmablasts that produce specific immunoglobulins IgG, IgM, IgA and IgE, and even seems to be more productive when taking blood on days 5-14 after the disease or donor immunization, but is not considered in the example of the present invention. Plasmablasts produce a secreted form of immunoglobulin, so direct staining of viable cells with antigen is not possible. It is necessary to apply special staining techniques, for example, involving the creation of a "trap" of antibody molecules around the secreting cell. One of these methods, referred to by the authors as “ICA” (immunoglobulin capture assay), is described in the original source (Pinder CL et al. Isolation and characterization of antigen-specific plasmablasts using a novel flow cytometry–based Ig capture assay // The Journal of Immunology. - 2017. - T. 199. - No. 12. - P. 4180-4188.). To obtain specific antibodies, the antigen of interest is conjugated with a fluorophore, the spectral characteristics of which allow it to be used in a multicolor panel with monoclonal antibodies for the phenotyping of a population of memory B cells. Enriched B-lymphocytes from donor blood are stained with fluorophore-labeled antibodies and antigen. Based on the phenotype, single memory B cells are sorted by flow cytofluorometry combined with fluorescent sorting. Cells are sorted one by one directly into a container intended for the reverse transcription reaction and the first PCR, where a lysing solution that does not inhibit these reactions, a mixture of HuIgSMART group 3' gene-specific primers, and an RNase inhibitor are added in advance. Then, after shock freezing and thawing, the following components are added to the entire volume of the lysate in the same container:

- water free from nucleases and nucleic acids;

- reaction buffer;

- TSO oligonucleotide with the nucleotide sequence 5′ AAGCAGTGGTATCAACGCAGAGTACGC(rG) ₃ 3′ or similar, since when using TSO from commercially available kits, the oligo(rG) site may differ and is a trade secret of the manufacturer;

- PCR primer with the nucleotide sequence 5′ AAGCAGTGGTATCAACGCAGAGT 3′;

- RNase inhibitor;

- thermostable DNA polymerase;

- reverse transcriptase (revertase) of the MMLV family.

The reverse transcription reaction is carried out using SMART technology, followed by the first PCR, obtaining nucleic acids in one tube - cDNA of both a heavy chain fragment and a light chain fragment, flanked at both ends with an adapter sequence. The second PCR step is carried out in parallel in three tubes using the product of the first PCR as a DNA template, which corresponds to the nested PCR concept. This PCR is designed to amplify polynucleotides that include the V _H and Vκ or Vλ domains of immunoglobulin chains, and the polynucleotides are designed to be cloned into appropriate plasmid vectors to assemble the full length human IgG heavy and light chain gene. For each reaction, use its own mixture of 5' and 3' primers and 0.1 - 1 µl of the reaction product of the first PCR without purification. To amplify the V _H domain nucleic acid, a mixture of primers with sequences as indicated in FIG. 2 in lines under Nos. 6 - 14 and 27 - 30, as well as in SEQ ID NOs 11 - 19 and 32 - 35, for which an annealing temperature of 50 °C is determined. To amplify the nucleic acid of the Vκ domain, a mixture of primers with sequences as indicated in FIG. 2 in lines under Nos. 15 - 18, 31, as well as in SEQ ID NO 20 - 23, 36, for which an annealing temperature of 55 °C is determined. To amplify the Vλ domain nucleic acid, a mixture of primers with sequences as indicated in FIG. 2 in lines under No. 19 - 26, 32, as well as in SEQ ID NO 24 - 31, 37, for which the annealing temperature is determined to be 55 °C. Amplification is carried out using a thermostable DNA polymerase with 3'-5' exonuclease activity. 30 cycles are performed: denaturation, primer annealing for 15 s, and DNA elongation for 30 s. The time and temperature of denaturation, as well as the temperature of DNA elongation, are chosen according to the optimal values for the DNA polymerase used. The results of the reactions are evaluated on the basis of agarose gel electrophoresis data. Successful reactions are recorded that meet the requirement: one clearly distinguishable DNA fragment of the following size (in base pairs): V _H 360-390 bp, Vκ 470-490 bp, Vλ 360-380 bp. From one single cell, only one variant of the light chain fragment can be successfully amplified, determined by its type: κ or λ. Products of positive reactions are purified and subjected to restriction hydrolysis. The nucleic acid of the V _H domain is cut with SalI and XhoI restriction enzymes, the Vκ domain with SalI restriction enzyme, and the Vλ domain with XhoI restriction enzyme. Concurrently, engineered plasmid vectors providing the Kozak sequence, the signal sequence polynucleotide, and the missing portion of the corresponding immunoglobulin chain are treated with restriction enzymes. For example, plasmid pSF-CMV-HuIgG1_HCmod is cut with NruI (RfuI) and SalI, pSF-CMV-HuKappa_LCmod with NsbI and SalI, pSF-CMV-HuLambda_LCmod with NsbI and XhoI. The prepared plasmids and PCR products are crosslinked in a T4 DNA ligase ligation reaction. As a result, two plasmid vectors with recombinant human specific immunoglobulin heavy and light chain expression cassettes are obtained from this cell.

The resulting plasmids are delivered into linear mammalian cells, eg CHO, HEK293, COS-7, or others, by liposomal co-transfection. To do this, use a mixture of plasmid vectors carrying the genes of natively paired light chain and heavy chain, in a ratio of 2:1 by molar concentration of DNA. The cells are cultivated for 7–14 days in a serum-free nutrient medium, after which the clarified culture liquid is passed through a Protein A chromatographic sorbent to bind immunoglobulins. The purified antibodies are then eluted from the column with pH 2.4 buffer. Purified antibodies are tested for specificity for the antigen of interest in ELISA and/or immunoblot.

For a better understanding of the essence of the invention, examples of its specific implementation follow.

Example 1. Preparation of vectors.

Plasmid vectors pSF-CMV-HuIgG1_HC, pSF-CMV-HuKappa_LC and pSF-CMV-HuLambda_LC in the amount of 1 µg are linearized (relaxed) at the NcoI restriction site. To do this, prepare the appropriate individual mixtures of plasmids in 20 µl of 1X Tango buffer and incubate with 10 u. restrictase NcoI (Thermo Fisher) 1 hour at 37°C. The enzyme is then inactivated by heating at 65°C for 20 min. Next, the linearized plasmids are amplified with the following primer pairs: pSF-CMV-HuIgG1 HC with a pair of H_Apa/Sal_For-WP and HSS_Rfu/Apa_Rev-WP; pSF-CMV-HuKappa LC with a pair of K_Apa/Sal_For-WP and K&LSS_Nsb/Apa_Rev-WP; pSF-CMV-HuLambda LC with a pair of K&LSS_Nsb/Apa_Rev-WP and L_Apa/Xho_For-WP. The nucleotide sequences of the primers are shown in the table shown in FIG. 1. To prepare a PCR mixture for one reaction with a volume of 25 µl, use water free from nucleic acids and nucleases, 5 pM each of the forward (For) and reverse (Rev) primer, 0.1 µl of linear plasmid DNA and 12.5 µl of the 2X mixture Phusion Hot Start II High-Fidelity PCR Master Mix (Thermo Fisher). Amplification is carried out using the following parameters: pre-denaturation 98°C for 1 min, then 20 cycles: 98°C 15 s, 60°C 15 s, 72°C 3 min, then final elongation at 72°C for 5 minutes . The qualitative result of the reactions is evaluated electrophoretically (Fig. 3). Register three DNA fragments larger than 4000 base pairs. After PCR, DNA is subjected to phenol-chloroform extraction and alcohol precipitation. Then, 50-100 ng of purified PCR products are hydrolyzed with ApaI FastDigest restriction endonuclease in FD buffer (Thermo Fisher). After an hour of incubation at 37 °C, the enzyme in reactions is inactivated at 65 °C for 5 minutes, then ATP is added to 0.5 mM, dithiothreitol to 10 mM, and 5 U. Weiss T4 DNA ligases (all Thermo Fisher reagents). Incubated for 2-3 hours at room temperature, and then subjected to phenol-chloroform extraction and alcohol precipitation. DNA pellets are dissolved in 1 µl of deionized water and used for electrotransformation of competent E. coli DH12S cells. From positive transformants grown on LB agar medium with kanamycin, plasmid DNA is isolated, which is subsequently sequenced by Sanger from the primer CMV Forward (5' CGCAAATGGGCGGTAGGCGTG 3'). The new vectors are named pSF-CMV-HuIgG1_HCmod, pSF-CMV-HuKappa_LCmod and pSF-CMV-HuLambda_LCmod.

Example 2 Design of primers for amplification of target cDNA.

Design of primers to prime the synthesis of the first cDNA strand. The complementary portions of the 3' HuIgSMART-κ and 3' HuIgSMART-λ primers are left identical to the 3' Cκ 494-516 and 3' Cλ primers by (Smith K. et al. Rapid generation ... C. 372.), respectively. The annealing regions of primers 3'HuIgSMART-G&E,3' HuIgSMART-A, and 3' HuIgSMART-M are designed to hybridize to heavy chain mRNA regions in the C _H1 constant domain regions of human immunoglobulin G, A, and M. Primer 3'HuIgSMART-G&E is also capable of to annealing on mRNA of the C _H1 domain of immunoglobulin E with three minor nucleotide mismatches. Group 3' primers are synthesized according to the nucleotide sequences in the table shown in FIG. 2, lines No. 1 - 5.

Design of 5' and 3' PCR primers to clone the obtained reaction products. Group 5' primers were synthesized according to the nucleotide sequences in the table shown in FIG. 2, lines Nos. 6-26. Primers within one subgroup (5'VH, 5'Vκ, 5'Vλ) are assigned through numbering, not tied to a subgroup of the V segment or a specific segment. These primers are phosphorylated by introducing a 5'-Pi modification during synthesis.

Group 3' primers are synthesized according to the nucleotide sequences in the table shown in FIG. 2, lines nos. 27-32. Primers 3' JCHG_XhoI, 3'JCHG&E_XhoI,3' JCHA_SalI and 3' JCHM_SalI are designed to hybridize at the junction of the J gene segments and the C _H1 domain, namely with the last 9 nucleotides of the FR4 region and several nucleotides of the constant area so that the melting point is at least 55 ° C, taking into account partial non-complementarity. Primers 3' Cκ_SalI and 3' Cλ_XhoI are designed to hybridize to the coding sequences for the Cκ and Cλ constant domains. The 3′ Cλ_XhoI primer was designed in analogy to the 3′ XhoI Cλ primer (Smith K. et al. Rapid generation ... p. 372.), with an internal XhoI restriction enzyme recognition site (FIG. 6).

Example 3. Fluorescent cell sorting and sample preparation for it

Antigen "A", a 33 kDa polypeptide with seven lysine amino acid residues in the molecule, is labeled with R-Phycoerythrin (PE) from the R-Phycoerythrin Conjugation Kit (Abcam).

All work is carried out in a "clean zone" under strict aseptic conditions. Use only disposable consumables with PCR clean grade (Eppendorf) and tips with an aerosol barrier. The preparation of the CDS Sorting Solution buffer for cell sorting and lysis is carried out using the components of the SMART-Seq HT Kit (TaKaRa), but replacing the 3′ SMART-Seq CDS Primer II A primer with a mixture of gene-specific primers for the synthesis of the first cDNA strand. To prepare this mixture, primers 3'HuIgSMART-G&E, 3'HuIgSMART-A, 3'HuIgSMART-M, 3'HuIgSMART-κ and 3'HuIgSMART-λ are combined into a common stock solution, where the concentration of each primer is 10 μM. Next, a buffer for 12 reactions is prepared for sorting 12 single B cells: 126 µl of water (free from nucleases), 12 µl of a primer mixture solution, 11.4 µl of tenfold lysis buffer, 0.6 µl of RNase inhibitor are mixed. The buffer is placed in 12.5 µl PCR tubes (can be combined into a strip) or in the first horizontal row of the PCR plate and is immediately used for sorting.

An enriched B-lymphocyte fraction is obtained from 40-50 ml of donated blood using the RosetteSep Human B Cell Enrichment Cocktail (STEMCELL). To identify a subpopulation of memory B cells, a multicolor panel is used: CD19 APC / CD27 BB515 / CD38 PE-Cy7 / IgG BB700 / PE antigen A. B lymphocytes are stained with a combination of fluorochrome-conjugated monoclonal antibodies: anti-CD19 APC (clone HIB19), anti-CD38 PE-cy7 (clone HIT2), anti-CD27 BB515 (clone M-T271), anti-IgG BB700, and antigen "A"-PE in phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.76 mM KH2PO4, pH 7.4, hereinafter: PBS) with the addition of 2% fetal calf serum. Unbound molecules are removed by washing the cells three times in PBS. Immunophenotyping and sorting of target cell populations is carried out on the day of blood sampling using a FACS Aria III flow cytometer (BD Biosciences) equipped with three lasers with wavelengths of 405, 488 and 633 nm. First, forward scatter (FSC) and side scatter (SSC) gates are performed to determine size and granularity, respectively (FIG. 7A). After deletion of doublets (Fig. 7B) and gated CD19⁺B-lymphocytes (Fig. 7C), based on the co-expression of CD27/CD38 molecules, memory B-cells with the CD19 phenotype are isolated⁺CD27⁺CD38^−/+ (Fig. 7D). Thus, both “activated” and “resting” memory B cells are selected for analysis. Further, in this subpopulation, only IgG is additionally isolated.⁺cells (Fig. 7E). Thus, this panel allows you to isolate IgG⁺ Memory B cells with the CD19 phenotype⁺CD27⁺CD38^−/+IgG⁺. At the last stage, the subpopulation of IgG-positive memory B cells is additionally gated through the PE channel, isolating specific memory cells for the target antigen with the CD19 phenotype.⁺CD27⁺CD38^−/+IgG⁺antigen "A" PE⁺ (Fig. 7F). Cells of a given phenotype are sorted one at a time into slots from A2 onwards. Slot A1 is skipped for a control demo reaction.

After sorting is complete, the tubes or cell plates are blast-frozen in liquid nitrogen or on dry ice. The samples are then stored at -80°C.

Example 4 Synthesis and amplification of target cDNA.

All work is carried out in a "clean zone" under strict aseptic conditions. Use only disposable consumables with PCR clean grade (Eppendorf) and tips with an aerosol barrier. The cycler is located in the immediate vicinity of the workplace, and all modes of incubation and amplification are combined into one continuous program according to further instructions.

PCR tubes, a strip or a plate with sorted cells according to example 3 are removed from the low-temperature refrigerator and immediately placed in a preheated to 72°C amplifier with a lid heated to 105°C for 3 minutes. Then the temperature in the cycler is lowered to 4°C and incubated for another 2 minutes. During incubation, prepare the reaction mixture for RT-PCR, not exceeding the total incubation time of 5 minutes for this operation, so the frozen components of the mixture are thawed in advance. To carry out 12 reactions, the following components from the SMART-Seq HT Kit are sequentially added to the microtube:

Water - 8.4 µl;

One-Step Buffer - 96 µl;

SMART-Seq HT Oligonucleotide - 12 µl;

RNase Inhibitor - 6 µl;

SeqAmp DNA Polymerase - 3.6 µl (strictly controlling the amount of enzyme during collection and application);

SMARTScribe Reverse Transcriptase (100 U/µl) - 24 µl.

The contents are mixed gently by pipetting several times, avoiding the formation of bubbles. Preparation of the mixture for the number of reactions less than 12 is not desirable. With a larger number of single sorted cells, the amount of each component is calculated by proportion.

The tubes or plate are removed from the cycler after completion of the incubation at 4°C. Set the temperature of the thermoblock to 42°C and the time to 90 minutes. When the desired temperature is reached, the program is paused. Add 12.5 µl of the reaction mixture to each PCR tube/well and mix gently by pipetting 2-3 times to avoid bubbles. After that, the samples are returned to the cycler and the following program is started: incubation 42°C 90 min, then heating to 95°C for 1 min, then 20 cycles: 98°C 10 s, 65°C 30 s, 68°C 1 min , - then final elongation 72°C 5 min and storage of samples until extraction 4°C ∞.

The product of the RT-PCR reaction is used as a DNA template in the PCR of the second stage. First, primers are mixed to make three compositions - stock 50-fold solutions with a concentration of each primer 10 mm.

1) Composition "VH-JCH": primers 5'VH-1, 5'VH-2, 5'VH-3, 5'VH-4, 5'VH-5, 5'VH-6, 5'VH- 7, 5' VH-8, 5' VH-9, 3' JCHG_XhoI, 3' JCHG&E_XhoI, 3' JCHA_SalI, 3' JCHM_SalI with nucleotide sequences as indicated in rows 6–14 and 27–30 of Fig. 2.

2) Composition "Vκ-Cκ": 5'Vκ-1, 5'Vκ-2, 5'Vκ-3, 5'Vκ-4, 3'Cκ_SalI with nucleotide sequences as indicated in the lines under No. 15 - 18, 31 Fig. 2.

3) Composition "Vλ-Cλ": 5'Vλ-1, 5'Vλ-2, 5'Vλ-3, 5'Vλ-4, 5'Vλ-5, 5'Vλ-6, 5'Vλ-7 , 5' Vλ-8, 3' Cλ_XhoI with nucleotide sequences as indicated in rows 19–26, 32 Fig. 2.

Three versions of the PCR mixture are prepared for each product of the RT-PCR reaction using SMART technology. For one 50 µl reaction, use 1 µl of VH-JCH or Vκ-Cκ or Vλ-Cλ primer composition, 0.5 µl of RT-PCR product without purification, 25 µl of 2X Phusion Hot Start II High-Fidelity PCR Master Mix (Thermo Fisher), and the remaining volume of 23.5 μl is flooded with water free of nucleic acids and nucleases. Amplification is carried out using the following parameters: pre-denaturation 98°C for 1 min, then 30 cycles: 98°C 15 s, 50°C for V _H amplification or 55°C for V _L amplification (κ and λ) 15 s, 72°C for 30 s, then final elongation at 72°C for 5 minutes. The qualitative result of the reaction is evaluated electrophoretically, which is reflected in Fig. 8. True amplicons are identified if they are expressed as a clear mono-product and have the following length compared to the molecular weight marker: V _H 360-390 bp (Fig. 8, lanes 4 and 7) bases, Vκ 470-490 bp. (Fig. 8, track 5), Vλ 360-380 p. (Fig. 8, lane 9). A clear lane or the presence of 1–3 faint bands formed as a result of nonspecific annealing of primers with contaminating DNA in the absence of the target template indicates a failed reaction (Fig. 8, lanes 1, 2, 3, 6, 8). This phenomenon should occur when amplifying one of the light chain isotypes (FIG. 8, lanes 6 and 8). In case of unsuccessful amplification of a pair of V _H and V _L from a single cell, cDNA cloning is not started, as is the case with simultaneous amplification of both Vκ and Vλ. With the simultaneous absence of the amplification product of the fragment of the heavy and light chains, similar to the electrophoretic separation of the PCR products of a series of reactions with the contents of the well (tube) A1 according to example 3 (Fig. 8, lanes 1, 2, 3), the absence of a cell in the lysis buffer is indirectly judged .

Based on the results of amplification, the presence of the following PCR products is established:

1. VH-A2agA is a polynucleotide of the variable domain and a part of the constant domain of the heavy chain of the antibody A2agA to antigen "A", obtained by amplifying the cDNA of a single human memory B-cell sorted into cell A2 according to example 3 (Fig. 8, lane 4)

2. VH-A3agA is a polynucleotide of the variable domain and part of the constant domain of the heavy chain of the A3agA antibody to antigen "A", obtained by amplifying the cDNA of a single human memory B cell sorted into cell A3 according to example 3 (Fig. 8, lane 7)

3. Vκ-A2agA is a polynucleotide of the variable domain and a part of the constant domain of the light chain of the κ isotype of the A2agA antibody to antigen “A”, obtained by amplifying the cDNA of a single human memory B cell sorted into cell A2 according to example 3 (Fig. 8, lane 5)

4. Vλ-A3agA is a polynucleotide of the variable domain and part of the constant domain of the light chain of the λ isotype of the A3agA antibody to antigen “A”, obtained by amplifying the cDNA of a single human memory B cell sorted into cell A3 according to example 3 (Fig. 8, lane 9)

Example 5 Cloning of PCR products into vectors.

Plasmid vectors obtained according to example 1, in the amount of 100 ng hydrolyzed restriction endonuclease line FastDigest (Thermo Fisher) in buffer FD with the addition of alkaline phosphatase FastAP (Thermo Fisher). The pSF-CMV-HuIgG1_HCmod vector is cut at the RfuI and SalI sites. The pSF-CMV-HuKappa_LCmod vector was cut at the NsbI and SalI sites. The pSF-CMV-HuLambda_LCmod vector is cut at the NsbI and XhoI sites. After an hour of incubation at 37°C, plasmid DNA is subjected to phenol-chloroform extraction and alcohol precipitation. The precipitates are dissolved in 10 µl of water.

The PCR products of Example 4, interpreted as passing, are purified on disposable silica membrane columns, eg using the QIAquick PCR Purification Kit or MinElute PCR Purification Kit (Qiagen). Water (pH 7.0) is used to elute the DNA. Next, reaction mixtures are prepared for restriction hydrolysis with a total volume of 20 μl each, 16 μl of which is occupied by the DNA eluate. 10x FD buffer and FastDigest restriction enzymes are added to the samples according to the table shown in FIG. 9. After an hour of incubation at 37 °C, DNA is subjected to phenol-chloroform extraction and alcohol precipitation. The precipitates are dissolved in 10 µl of water.

Cross-linking of the prepared plasmids with the appropriate inserts is performed with the T4 DNA ligase enzyme (Thermo Fisher). 10-20 ng of plasmid and 5 µl of insert are taken into the reaction. The reactions are kept at room temperature for 12 to 16 hours. The products of the ligation reactions are subjected to phenol-chloroform extraction and alcohol precipitation, after which the DNA-containing precipitates are dissolved in 1 μl of water and used for electrotransformation of E. coli DH12S cells. The cells are then plated on LB agar medium with ampicillin and grown overnight. Then, a preliminary screening for the insertion of amplicons into plasmids is carried out by PCR with the universal forward primer CMV Forward and reverse primers.

HuIgG-const-anti (5′ TCTTGTCCACCTTGGTGTTGCT 3′),

3′ Ck 494-516 (5′ GTCGCTGTCCTTGCTGTCCTGCT 3′) and

3′Cλ (5′CACCAGTGTGGCCTTGTTGGCTTG 3′)

for single colonies of E. coli with plasmids pSF-CMV-HuIgG1_HCmod, pSF-CMV-HuKappa_LCmod and pSF-CMV-HuLambda_LCmod, where the PCR products were cloned, respectively. As a control, amplification of these plasmids without inserts from the same primer pairs is carried out in parallel. Screening results are evaluated by agarose gel electrophoresis, as shown in FIG. 10. Plasmid DNA was isolated from positive transformants using the PureLink HiPure Plasmid Midiprep Kit (Thermo Fisher). Get the following plasmid vectors:

1. pSF-HC-A2agA as a result of cloning the VH-A2agA polynucleotide into the plasmid vector pSF-CMV-HuIgG1_HCmod;

2. pSF-HC-A3agA as a result of cloning the VH-A3agA polynucleotide into the plasmid vector pSF-CMV-HuIgG1_HCmod;

3. pSF-LC-A2agA as a result of cloning the Vκ-A2agA polynucleotide into the plasmid vector pSF-CMV-HuKappa_LCmod;

4. pSF-LC-A3agA as a result of cloning the Vλ-A3agA polynucleotide into the plasmid vector pSF-CMV-HuLambda_LCmod.

The correctness of cloning of PCR products is confirmed by Sanger sequencing of plasmids from primer CMV Forward and SV40pA-R (5' GAAATTTGTGATGCTATTGC 3'). The sequencing results are shown in the sequences SEQ ID NO: 41, 43, 45, 47 for the plasmid vectors above, respectively. The read nucleotide sequences are also analyzed by checking for the presence of an open reading frame of the immunoglobulin chain (SEQ ID NOS: 42, 44, 46, 48) and confirming belonging to polynucleotides encoding the heavy/light chain variable domain using the automated computer algorithm IMGT/V- QUEST, publicly available at: http://www.imgt.org/IMGT_vquest/input . The results are presented in Fig. 11, 12, 13 and 14. In each nucleotide sequence, the algorithm determined the region of V(D)J recombination and the names of the alleles of the gene segments involved in the recombination.

Example 6 Preparative Expression, Purification and Validation of Antibodies.

The ExpiCHO-S cell line, which is part of the ExpiCHO Expression System Kit (Gibco, Thermo Fisher), is grown in ExpiCHO Expression Medium in disposable 500 ml Erlenmeyer flasks with a vent cap (Corning) on a Minitron shaker (Infors HT), mode 125 min ^-1 in an atmosphere of 8% CO ₂ at 37°C. Upon reaching a density of 6×10 ⁶ cells/ml and the number of viable cells of at least 95%, which is estimated by trypan blue staining, the cells are co-transfected with plasmids encoding the light and heavy chain of immunoglobulin of a single cell, which were obtained according to example 5. On the day transfections partially or completely replace the medium with a similar new one. Transfection was performed using the reagents and methodology of the ExpiCHO Expression System Kit, and then the cells were grown according to the "Max Titer Protocol". Briefly: To each 500 ml flask containing 100 ml of ExpiCHO culture, add a mixture of 80 μl of plasmid DNA mixture containing plasmids pSF-LC and pSF-HC in a 2:1 molar ratio with a total nucleic acid concentration of 1 mg / ml, 7.7 ml of OptiPRO SFM medium and 320 µl of ExpiFectamine CHO Reagent. The culture is grown on a shaker at 32°C in an atmosphere of 5% CO ₂ . 24 hours after transfection, 600 µl of ExpiCHO Enhancer and 16 ml of ExpiCHO Feed are added to the flask. On day 5 after transfection, another 16 ml of ExpiCHO Feed was added. On day 14, the culture is centrifuged at 10,000 xg for 10 minutes. The antibody containing supernatant is further filtered through a 0.2 μm membrane, then concentrated tenfold in an Amicon Stirred Cell (Merck Millipore). If necessary, freeze -20 °C or immediately proceed to cleaning.

Isolation of recombinant antibodies from filtered and concentrated culture fluid was performed by affinity chromatography on a 1 ml HiTrap rProtein A FF column (GE Healthcare) using an ÄKTA Pure 25 chromatographic system (GE Healthcare). The column is equilibrated with loading buffer (50mM Tris, 100mM NaCl, 0.02% NaN3, pH 8.0). Produce the application of the culture fluid at a rate of 2 ml/min on ice. Next, the column is washed from unbound components with a loading buffer, and the immunoglobulins are eluted with a buffer of the composition: 100 mM glycine, 100 mM NaCl, pH 2.4. The pH of the eluate was adjusted to 7.5-8.0 by adding 1 M Tris base solution. Subsequently, the eluate of the immunoglobulin fraction was applied to a commercially available 5 ml HiTrap Desalting column (GE Healthcare) equilibrated with PBS at a flow rate of 5 ml/min. The immunoglobulin fraction is collected after some time, identifying it by the change in A ₂₈₀ (the amount of absorption of light with a wavelength of 280 nm by the protein). To calculate the concentration of antibodies [mg / ml], the A ₂₈₀ indicator of the protein solution is measured on a spectrophotometer, after which the resulting value is divided by the mass extinction coefficient, which for immunoglobulin is 1.37. As a rule, the yield is 15 - 20 mg of protein from 1 liter of culture. The purity of the obtained immunoglobulin fractions is evaluated by Laemmli SDS electrophoresis (Laemmli UK Cleavage of structural proteins during the assembly of the head of bacteriophage T4 //nature. - 1970. - T. 227. - No. 5259. - P. 680-685 .) in 7.5% polyacrylamide gel (PAAG) under non-reducing conditions (electropherogram is shown in Fig. 15, part A) and 12% PAAG under reducing conditions with the addition of mercaptoethanol (electropherogram is shown in Fig. 15, part B). Based on the results of this assay, purified human antibodies A2agA and A3agA have a standard molecular weight for human IgG1 of approximately 150 kDa, and also have a characteristic separation pattern under reducing conditions, degrading into 2 identical 25 kDa light chains and two identical heavy chains 50 kDa.

The evaluation of the immunological specificity of purified recombinant antibodies is carried out by immunoblot with antigen "A". The antigen is subjected to SDS-electrophoresis in 12% PAAG in the amount of 0.5 μg per lane in duplicate (according to the number of antibodies obtained) and in the amount of 3 μg per lane. Then the part of the gel with lane 3 μg of antigen "A" stained with Coomassie brilliant blue R-250 (Fig. 16, part A). From the rest of the gel, horizontal protein transfer is carried out onto a Hybond-C Extra nitrocellulose membrane (GE Healthcare). After the transfer is complete, the membrane is blocked by immersion in skimmed milk with a mass fraction of fat not exceeding 0.5% and incubated for 1 hour on an orbital thermostatically controlled shaker at 300 rpm and a temperature of 37 °C. Further, after washing three times with PBS buffer with the addition of 0.5% detergent Tween® 20 (FSB-TV), the membrane is cut into two parts to isolate lanes and each part is incubated with different recombinant antibodies diluted to a concentration of 0.5 μg/ml in FSB for 1 hour on a thermostatically controlled shaker. After washing three times with PBS-Tv buffer, the membranes are incubated with goat antibodies to the Fc fragment of human IgG (Sigma-Aldrich A0170) at a dilution of 1:10,000 in PSB-Tv buffer for 30 minutes. Then the membranes are washed 5 times in PBS-TV. Visualization of the reaction is carried out with a solution of a substrate mixture based on diaminobenzidine (0.05% diaminobenzidine, 0.015% H ₂ O ₂ in PBS pH 7.4). The reaction is stopped after a distinct staining of the samples by immersing the membranes in distilled water. As shown by the analysis, the results of which are shown in Fig. 16 in lanes 2B and 3B, the obtained human antibodies A2agA and A3agA interact specifically with the 33 kDa antigen "A" of a protein nature.

Claims (4)

A method for amplifying human immunoglobulin heavy and light chain nucleic acids, which comprises (a) isolation of human single immunoglobulin-producing cells (B-lymphocytes) obtained from the biological material of donors using flow cytometry combined with fluorescent sorting based on interaction with a fluorophore-labeled antigen, moreover, the cells are sorted directly into a container with a lysis buffer for release mRNA from the cell into the solution; (b) reverse transcription reaction on the mRNA template of a single cell according to SMART technology using a TSO oligonucleotide and MMLV reversease in the reaction, and then amplification of the obtained cDNA, which, using this technology, is synthesized by a universal adapter sequence flanked on both sides, and the reverse transcription reaction is different the fact that the seed of cDNA synthesis is carried out in the presence of a composition of five gene-specific primers as shown in the group of sequences SEQ ID NO: 6, 7, 8, 9, 10, which in the 3'-region are complementary to mRNA chains of immunoglobulin type γ, ε, α, μ, κ, λ, respectively, but in the 5'-region have the same adapter sequence for hybridization with a PCR primer, which allows selective amplification of two polynucleotides of the light and heavy chain of the immunoglobulin of a given cell in one reaction mixture using this PCR primer; (c) three subsequent polymerase chain reactions with an amplified cDNA sample as a template, which differ in the use for each reaction of three different compositions of oligonucleotide primers with nucleotide sequences as presented in groups (SEQ ID NO: 11 - 19, 32 - 35), (SEQ ID NO: 20 - 23, 36) and (SEQ ID NO: 24 - 31, 37), designed to carry out the amplification of nucleic acids encoding the variable domains VH, Vκ and Vλ, starting from the first amino acid of the FR1 region, at annealing temperatures of 50 ° C, 55 °C and 55 °C, respectively, for each group, with three reactions resulting in two products: one VH domain polynucleotide 360-390 bp long with an XhoI or SalI restriction site at the 3'-end and one polynucleotide or Vκ domain length 470-490 bp with a SalI restriction site at the 3' end, or a 360-380 bp Vλ domain with an XhoI restriction site at the 3' end, which can then be cloned into suitable plasmid vectors according to "the "same" and "sticky" end between the coding sequence of the signal peptide and the missing (non-amplified) part of the constant domain of the immunoglobulin chain of the appropriate type for the expression of recombinant human immunoglobulin in mammalian cells.

Images