RU2773611C1 - PYRAZOLO[3,4-b]PYRIDINE COMPOUNDS AS TAM AND MET KINASE INHIBITORS - Google Patents

Abstract

FIELD: pharmaceuticals.

SUBSTANCE: group of inventions relates to pharmaceutical chemistry and includes a compound by the formula I or stereoisomers, tautomers and pharmaceutically acceptable salts thereof, (R)-N-(3-fluoro-4-((3-((1-hydroxypropane-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide, a pharmaceutical composition and a method for treating cancer based thereon. In the formula I, X¹ constitutes CH or N; R¹ constitutes hydrogen or a C1-C6 alkyl; R² and G are selected from the groups listed in the claim; R⁹ constitutes hydrogen or halogen.

EFFECT: compound by the formula I, exhibiting an inhibitory effect against TAM and MET kinases, used for treating TAM-associated c-Met-associated cancer in a patient.

17 cl, 9 tbl, 201 ex

Description

Cross-reference to related applications

The present application claims priority under U.S. Provisional Application No. 62/724829, filed August 30, 2018, and 62/858686, filed June 7, 2019, the contents of which are incorporated herein by reference in their entirety.

State of the art

This document provides novel TAM and MET kinase inhibitors, pharmaceutical compositions comprising the compounds, methods for preparing the compounds, and the use of the compounds in therapy. More specifically, provided herein are pyrazolo[3,4-b]pyridine compounds useful in the treatment and prevention of diseases that can be treated with a TAM kinase inhibitor or a MET kinase inhibitor.

Receptor tyrosine kinases (RTKs) are cell surface proteins that transmit signals from the extracellular environment to the cytoplasm and nucleus of the cell to regulate cellular events such as survival, growth, proliferation, differentiation, adhesion, and migration.

The TAM subfamily consists of three RTKs including TYRO3, AXL and Mer (Graham et al., 2014, Nature Reviews Cancer 14, 769-785; Linger et al., 2008, Advances in Cancer Research 100, 35-83). TAM kinases are characterized by an extracellular ligand-binding domain consisting of two immunoglobulin-like domains and two type III fibronectin domains. Two ligands, growth arrest-specific 6 (GAS6) and protein S (PROS1), have been identified for TAM kinases. GAS6 can bind to and activate all three TAM kinases, while PROS1 is a ligand for Mer and TYRO3 (Graham et al., 2014, Nature Reviews Cancer 14, 769-785).

AXL (also known as UFO, ARK, JTK11 and TYRO7) was originally identified as a transforming gene from the DNA of patients with chronic myelogenous leukemia (O'Bryan et al., 1991, Mol Cell Biol 11, 5016-5031; Graham et al., 2014, Nature Reviews Cancer 14, 769-785; Linger et al., 2008, Advances in Cancer Research 100, 35-83). GAS6 binds to AXL and causes subsequent autophosphorylation and activation of the AXL tyrosine kinase. AXL activates several downstream signaling pathways including PI3K-Akt, Raf-MAPK, PLC-PKC (Feneyrolles et al., 2014, Molecular Cancer Therapeutics 13, 2141-2148; Linger et al., 2008, Advances in Cancer Research 100, 35 -83).

MER (also known as MERTK, EYK, RYK, RP38, NYK, and TYRO 12) was originally identified as a phosphoprotein from the lymphoblastoid expression library (Graham et al., 1995, Oncogene 10, 2349-2359; Graham et al., 2014, Nature Reviews Cancer 14, 769-785; Linger et al., 2008, Advances in Cancer Research 100, 35-83). Both GAS6 and PROS1 can bind Mer and induce Mer kinase phosphorylation and activation (Lew et al., 2014). Like AXL, MER activation also transmits downstream signaling pathways, including PI3K-Akt and Raf-MAPK (Linger et al., 2008, Advances in Cancer Research 100, 35-83).

TYRO3 (also known as DTK, SKY, RSE, BRT, TIF, ETK2) was originally identified by a PCR-based cloning study (Lai et al., Neuron 6, 691-70, 1991; Graham et al., 2014, Nature Reviews Cancer 14, 769-785; Linger et al., 2008, Advances in Cancer Research 100, 35-83). Both ligands, GAS6 and PROS1, can bind to and activate TYRO3. Although signaling pathways downstream of TYRO3 activation are the least studied among TAM RTKs, both PI3K-Akt and Raf-MAPK pathways appear to be involved (Linger et al., 2008, Advances in Cancer Research 100, 35-83). AXL, MER and TYRO3 have been found to be overexpressed in cancer cells.

The MET family includes mesenchymal-epithelial transition factor (c-Met), a single pass tyrosine kinase receptor that is expressed on the surface of various epithelial cells; its ligand is hepatocyte growth factor/scatter factor (HGF/SF) (Nakamura et al., Nature 342:440-443, 1989). Binding of HFG to c-Met initiates a series of intracellular signals that mediate embryogenesis and will heal in normal cells (Organ, Ther. Adv. Med. Oncol. 3(1 Supply):S7-S19, 2011). However, in cancer cells, aberrant activation of the HGF/c-Met axis, which is closely associated with mutations in the c-Met gene, overexpression and amplification contributes to tumor development and progression - for example, by stimulating PI3K/AKT, Ras/MAPK, JAK/STAT, SRC and Wnt/β-catenin signaling pathways (Zhang et al., Mol. Cancer 17:45, 2018; Mizuno et al., Int. J. Mol. Sci. 14:888-919, 2013). Constitutively activating the aforementioned c-Met-dependent signaling pathways endows cancer cells with a competitive growth advantage over normal cells and increases the likelihood of metastasis—for example, by providing access to a blood supply and the ability to dissociate from tissues (Comoglio et al., Nat. Rev. Drug Discov 7 : 504-516, 2008; Birchmeier et al., Nat. Rev. Mol. Cell Biol. 4:915-925, 2003).

Accordingly, there is a need in the art for compounds and methods for using them to modulate TAM and MET kinases in the treatment of cancer.

The essence of the invention

Provided herein is a compound of formula I:

and its stereoisomers, tautomers and pharmaceutically acceptable salts, wherein R ¹ , R ² , R ⁹ , X ¹ and G are as defined herein.

Also provided herein is a pharmaceutical composition comprising a compound of formula I, or a pharmaceutically acceptable salt thereof, in admixture with a pharmaceutically acceptable diluent or carrier.

Also provided herein is a method for inhibiting cell proliferation in vitro or in vivo, comprising contacting a cell with an effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein.

Also provided herein is a method of treating cancer and/or inhibiting metastasis associated with a particular cancer in a patient in need of such treatment, the method comprising administering to the patient a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined in this document.

Also provided herein is a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein, for use in therapy.

Also provided herein is a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein, for use in the treatment of cancer and/or the inhibition of metastasis associated with a particular cancer.

Also provided herein is a compound of Formula I, or a pharmaceutically acceptable salt thereof, for use in inhibiting TAM kinase activity.

Also provided herein is a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein, for use in the treatment of a TAM-associated disease or disorder, such as cancer. In some embodiments, a TAM-associated cancer is a cancer having a chromosomal translocation that results in the expression of a TMEM87B-MERTK fusion protein (e.g., TMEM87B amino acids 1-55 and MERTK amino acids 433-1000) or an AXL-MBIP fusion protein.

Also provided herein is the use of a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined herein, in the manufacture of a medicament for the treatment of cancer and/or the inhibition of metastases associated with a particular cancer.

Also provided herein is the use of a compound of formula I, or a pharmaceutically acceptable salt thereof, as defined herein, in the preparation of a medicament for inhibiting TAM kinase activity.

Also provided herein is the use of a compound of Formula I, or a pharmaceutically acceptable salt thereof, as defined herein, in the manufacture of a medicament for the treatment of a TAM-associated disease or disorder, such as cancer.

Also provided herein is a pharmaceutical combination that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt thereof, and (b) an additional therapeutic agent. Also provided herein is a pharmaceutical combination that includes (a) a compound of formula I, or a pharmaceutically acceptable salt thereof, and (b) an additional therapeutic agent, for use in therapy. In one embodiment, a compound of formula I, or a pharmaceutically acceptable salt thereof, and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate, or sequential use in therapy, wherein the amounts of a compound of formula I, or a pharmaceutically acceptable salt thereof, and an additional therapeutic agent together are therapeutically efficient. Also provided herein is a pharmaceutical composition comprising such a combination. Also provided herein is a commercial package or product that includes a combination such as a combined preparation for simultaneous, separate or sequential use.

In one embodiment, the additional therapeutic agent is an anticancer agent (eg, any of the additional anticancer agents described herein). Accordingly, provided herein is a pharmaceutical combination for the treatment of cancer (e.g., TAM-associated cancer) in a patient in need thereof, which comprises (a) a compound of Formula I or a pharmaceutically acceptable salt thereof, and (b) an additional anti-cancer agent (e.g., any of the additional anticancer agents described herein), wherein the compound of formula I, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate, or sequential use in the treatment of cancer, wherein the amounts of the compound of formula I, or its the pharmaceutically acceptable salt and the additional anti-cancer agent together are effective in treating cancer.

Also provided herein is a pharmaceutical combination for the treatment of cancer (e.g., TAM-associated cancer) in a patient in need thereof, which comprises (a) a compound of formula I, or a pharmaceutically acceptable salt thereof, and (b) an additional anti-cancer agent (e.g., any of the additional anticancer agents described herein), wherein the compound of formula I, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate, or sequential use in the treatment of cancer, wherein the amounts of the compound of formula I, or its pharmaceutically acceptable an acceptable salt and an additional anti-cancer agent together are effective in treating cancer. Also provided herein is a pharmaceutical composition comprising such a combination. The present document also proposes the use of such a combination for the preparation of a medicament for the treatment of cancer. Also provided herein is a commercial package or product that includes a combination such as a combined preparation for simultaneous, separate or sequential use; and a method for treating cancer in a patient in need thereof.

Also provided are methods of treating a subject suffering from cancer which comprises administering a compound of Formula I or a pharmaceutically acceptable salt thereof before, during or after administration of another anticancer agent (e.g., another anticancer agent to which the subject has previously developed resistance, e.g., any of the additional anticancer agents described herein).

Also provided herein are methods of treating a patient identified or diagnosed with TAM associated cancer which comprises administering to a patient identified or diagnosed with TAM associated cancer a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof.

Also provided herein are methods of treating a patient suffering from cancer which comprise (a) identifying the patient as having TAM associated cancer, and (b) administering to the patient identified as having TAM associated cancer a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable thereof. salt, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof.

Also provided herein are methods for reducing the risk of developing metastases or additional metastases in a patient identified or diagnosed with TAM associated cancer, which comprises administering to the patient identified or diagnosed with TAM associated cancer a therapeutically effective amount of a compound of Formula I or a pharmaceutically effective amount thereof. an acceptable salt, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof.

Also provided herein are methods for reducing the risk of developing metastases or additional metastases in a patient with cancer, which includes: (a) identifying the patient for TAM associated cancer, and (b) administering to the patient diagnosed with TAM associated cancer a therapeutically effective an amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof.

Also provided herein are methods of reducing cancer cell migration and/or invasion in a patient identified or diagnosed with TAM associated cancer, which comprises administering to the patient identified or diagnosed with TAM associated cancer a therapeutically effective amount of a compound of formula I or its a pharmaceutically acceptable salt, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof.

Also provided herein are methods for reducing migration and/or invasion of a cancer cell in a patient with cancer, which includes (a) determining the patient has a TAM-associated cancer; and (b) administering to a patient diagnosed with TAM associated cancer a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof.

Also provided herein are methods for selecting treatment for a patient who has been identified or diagnosed with TAM-associated cancer, which includes selecting a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, for a patient who is identified or diagnosed with TAM-associated cancer.

Methods for selecting treatment for a patient are also provided herein, which include (a) determining the patient has a TAM-associated cancer, and (b) selecting a compound of Formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, for a patient diagnosed with TAM-associated cancer.

Also provided herein are methods for selecting treatment for a patient who has been identified or diagnosed with cancer, which includes (a) administering an additional anti-cancer agent to the patient, (b) after (a), detecting increased expression and/or activity of TAM kinase in the cancer cell. the patient and (c) after (b), selecting a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, for the patient.

Methods for treating a patient identified or diagnosed with cancer are also provided herein, which include: (a) administering to the patient identified or diagnosed with cancer one or more doses of at least one additional anticancer agent; (b) after (a), determining an increase in the expression and/or activity of TAM kinase in a cancer cell or immune cell of the subject; and (c) after (b), administering to the patient a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. In some embodiments of these methods, step (c) further comprises administering at least one additional anticancer agent to the patient.

Methods for treating a patient identified or diagnosed with cancer are also provided, which include: (a) determining an increase in the expression and/or activity of TAM kinase in a cancer cell or immune cell of a patient identified or diagnosed with cancer and previously administered one or more doses of at least one additional anticancer agent; and (b) after (a), administering to the patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. In some embodiments of these methods, step (b) further comprises administering at least one additional anticancer agent to the patient.

Also provided herein are methods of treating a patient who has been identified or diagnosed with cancer, who has previously received one or more doses of at least one additional anticancer agent, and who has been identified as having a cancer cell or immune cell that has increased expression and/or activity of the kinase. TAMs which comprise administering a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof, to a patient. In some embodiments of these methods, step (b) further comprises administering at least one additional anticancer agent to the patient.

Also provided herein are methods of treating a patient diagnosed or identified with cancer, which include: (a) selecting a patient who is identified or diagnosed with increased expression and/or activity of TAM kinase in a cancer cell or immune cell; and (b) after (a) administering to the selected patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. In some embodiments of these methods, step (b) further comprises administering at least one additional anticancer agent to the patient.

Methods for treating a patient identified or diagnosed with cancer are also provided herein, which include: (a) selecting a patient identified or diagnosed with cancer who has previously received one or more doses of an additional anti-cancer agent and who has a cancer cell or immune response. a cell having increased expression and/or activity of TAM kinase; and (b) after (a), administering to the selected patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. In some embodiments of these methods, step (b) further comprises administering at least one additional anticancer agent to the patient.

Also provided herein are methods of treating a patient identified or diagnosed with TAM-associated cancer, which comprises: (a) administering to a patient identified or diagnosed with TAM-associated cancer one or more doses of a TAM kinase inhibitor; (b) after (a), determining the resistance of the patient's TAM-associated cancer to a TAM kinase inhibitor; and (c) after (b), administering to the patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. In some embodiments of these methods, step (c) further comprises administering at least one additional anticancer agent to the patient.

Also provided herein are methods for treating a patient who has been identified or diagnosed with TAM-associated cancer, which includes: (a) determining the resistance of the TAM-associated cancer in the patient to a TAM kinase inhibitor that has previously been administered to the patient; and (b) after (a), administering to the patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. In some embodiments of these methods, step (b) further comprises administering at least one additional anticancer agent to the patient.

Also provided herein are methods of treating a patient identified or diagnosed with TAM-associated cancer and determined to have already developed resistance to a TAM kinase inhibitor, which comprises administering to the patient a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition. , comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent.

Also provided herein are methods for reducing immune tolerance in a subject in need thereof, which comprises administering to the subject a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein.

Also provided herein are methods for inhibiting angiogenesis in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein.

Also provided herein are methods for suppressing resistance to a therapeutic agent in a subject in need thereof, which comprises administering to the subject a therapeutically effective amount of (i) a compound of Formula I, or a pharmaceutically acceptable salt thereof, or any of the pharmaceutical compositions described herein, and (ii) a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of a chemotherapeutic agent, a PI-3 kinase inhibitor, an EGFR inhibitor, a HER2/neu inhibitor, an FGFR inhibitor, an ALK inhibitor, an IGF1R inhibitor, a VEGFR inhibitor, a PDGFR inhibitor, a glucocorticoid, a BRAF inhibitor, a MEK inhibitor, a HER4 inhibitor, a MET inhibitor (eg, c-Met type 1 inhibitor), a RAF inhibitor, an Akt inhibitor, an FTL-3 inhibitor, and an inhibitor of the MAP kinase pathway.

Also provided herein are methods of treating a patient identified or diagnosed with TAM-associated cancer, which comprises administering radiation therapy before or after administering to the patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of the compound formula I or a pharmaceutically acceptable salt thereof.

Also provided herein are methods of treating a patient identified or diagnosed with TAM-associated cancer, which comprises performing surgery before or after administering to the patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of the compound formula I or a pharmaceutically acceptable salt thereof.

Also provided herein are methods for inhibiting TAM kinase activity in a mammalian cell in need thereof, which comprises contacting the mammalian cell with a compound of Formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof. salt.

This document also provides a process for preparing a compound of formula I or a pharmaceutically acceptable salt thereof.

Also provided herein is a compound of formula I, or a pharmaceutically acceptable salt thereof, prepared by a process for preparing a compound as defined herein.

Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as generally understood by a person skilled in the art to which the present invention pertains. This document describes methods and materials for use in the present invention; other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries and other references mentioned in this document are incorporated by reference in their entirety. In case of conflict, the present description, including definitions, takes precedence.

Other features and advantages of the invention will be apparent from the following detailed description as well as from the claims.

DETAILED DESCRIPTION OF THE INVENTION

Provided herein is a compound of formula I :

and its stereoisomers, tautomers and pharmaceutically acceptable salts, where:

X ¹ represents CH or N;

R ¹ is hydrogen or C1-C6 alkyl;

R ² is

(a) hydrogen,

(b) C1-C6 alkyl,

(c) hydroxyC1-C6 alkyl,

(d) dihydroxyC2-C6 alkyl,

(e) C1-C6 fluoroalkyl, optionally substituted with OH,

(f) (di-C1-C6 alkoxy)C2-C6 alkyl-,

(g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH,

(h) Cyc ¹ ,

(i) Cyc ² ,

(j) (hetCyc ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH,

(k) (Ar ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH,

(l) (hetAr ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, or

(m) (HOSO ₃ )C1-C6 alkyl-;

Cyc ¹ is a 3-4 membered cycloalkyl ring optionally substituted with 1-2 substituents independently selected from halo, hydroxy, C1-C3 alkyl, hydroxyC1-C3 alkyl, C1-C3 alkoxy, (C1-C3 alkoxy)C1-C3 alkyl- and R'R''NC(=O)-;

R' and R'' are independently hydrogen or C1-C6 alkyl;

Cyc ² is a 5-membered cycloalkyl ring substituted with 1-2 substituents independently selected from C1-C3 alkyl, (C1-C3 alkoxy)C1-C3 alkyl- and hydroxyC1-C3 alkyl-;

hetCyc ¹ is a 5-6 membered saturated heterocyclic ring having 1-2 ring heteroatoms independently selected from O, N and SO ₂ wherein said ring is optionally substituted with oxo;

Ar ¹ is phenyl;

hetAr ¹ is pyridyl;

G represents

или

;

or

;

X ² is C or N;

Ring A, including atoms at the points of attachment, is a 5-6 membered heterocyclic ring, optionally having an additional 1-2 ring nitrogen atoms when X ² is N and having one ring nitrogen atom when X ² is C;

R ³ is hydrogen, methyl or absent;

Ring B, including the atoms at the attachment points, is a 6-membered saturated carbocyclic group optionally substituted with oxo, or a 6-membered aromatic carbocyclic ring optionally substituted with OH;

R ⁶ is hydrogen, halogen, C1-C6 alkyl, C1-C6 alkoxy, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² , provided that when R ⁶ is on a ring carbon adjacent to the carbon associated with the -NHC(=O)- moiety of formula I, then R ⁶ is not halogen, and

R ⁷ is hydrogen, C1-C6 alkyl, oxo or thioxo,

or optionally, when R ⁶ and R ⁷ are on the same carbon atom, R ⁶ and R ⁷ together with the carbon atom to which they are attached form a cyclopropyl ring;

hetCyc ² is a 4-6 membered saturated heterocyclic ring having a ring nitrogen atom and optionally substituted with C1-C6 alkyl;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

For complex chemical names used herein, the substituent group is mentioned before the group to which it is attached. For example, methoxyethyl includes an ethyl backbone with a methoxy substituent.

The term "heterocyclic ring", when specifically referring to ring A, means that ring A is a saturated, partially unsaturated or aromatic 5-6 membered heterocyclic ring.

The term "halogen" means -F (sometimes referred to here as "fluorine"), -Cl, -Br and -I.

The terms "C1-C2 alkyl", "C1-C3 alkyl", "C1-C6 alkyl" and "C2-C6 alkyl" as used herein refer to saturated linear or branched monovalent hydrocarbon radicals from one to two, from one to three, one to six, or two to six carbon atoms, respectively. Examples include, but are not limited to, methyl, ethyl, 1-propyl, isopropyl, 1-butyl, isobutyl, sec-butyl, t-butyl, 2-methyl-2-propyl, pentyl, neopentyl, and hexyl.

The terms "C1-C2 alkoxy", "C1-C3 alkoxy", and "C1-C6 alkoxy", as used herein, refer to a saturated monovalent straight or branched alkoxy radical containing one to two, one to three, or from one to six carbon atoms, respectively, where the radical is on the oxygen atom. Examples include methoxy, ethoxy, propoxy, isopropoxy, butoxy and t-butoxy.

The term "C1-C6 fluoroalkyl" as used herein includes C1-C6 alkyl and C1-C6 alkoxy groups, respectively, which are substituted with one or more fluorines such as, but not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl and the like.

The term "(C1-C6 alkoxy)C1-C6 alkyl-" as used herein refers to saturated monovalent straight or branched chain radicals containing from one to six carbon atoms, where one of the carbon atoms is substituted with a C1-C6 alkoxy group. as defined in this document. Examples include methoxymethyl (CH ₃ OCH ₂ -) and methoxyethyl (CH ₃ OCH ₂ CH ₂ -).

The term "(C1-C3 alkoxy)C1-C3 alkyl-", as used herein, refers to saturated monovalent straight or branched chain radicals containing from one to three carbon atoms, where one of the carbon atoms is substituted with a C1-C3 alkoxy group. as defined in this document.

The term "(di-C1-C6 alkoxy)C2-C6 alkyl-", as used herein, refers to saturated monovalent straight or branched chain radicals containing from one to six carbon atoms, where two carbon atoms are substituted by C1-C6 an alkoxy group as defined herein.

The terms "hydroxyC1-C3 alkyl-" and "hydroxyC1-C6 alkyl-" as used herein refer to straight or branched saturated monovalent alkyl radicals containing from one to six carbon atoms, respectively, where one of the carbon atoms substituted with a hydroxyl group.

The term "dihydroxyC2-C6 alkyl-" as used herein refers to a saturated monovalent straight or branched chain alkyl radical of two to six carbon atoms, where two carbon atoms are replaced by a hydroxyl group, provided that the two hydroxyl groups are not on the same carbon atom.

The term "(hetCyc ¹ )C1-C6 alkyl-", as used herein, refers to saturated monovalent straight or branched chain alkyl radicals containing from one to six carbon atoms, respectively, wherein one of the carbon atoms is substituted by the group hetCyc ¹ as defined in this document.

The term "(Ar ¹ )C1-C6 alkyl-" as used herein refers to saturated monovalent linear or branched chain alkyl radicals containing from one to six carbon atoms, respectively, wherein one of the carbon atoms is substituted with an Ar ¹ group. as defined in this document.

The term "(hetAr ¹ )C1-C6 alkyl-" as used herein refers to saturated monovalent linear or branched chain alkyl radicals containing from one to six carbon atoms, respectively, wherein one of the carbon atoms is substituted by the group hetAr ¹ as defined in this document.

The term "(HOSO ₃ )C1-C6 alkyl-" as used herein refers to straight or branched saturated monovalent alkyl radicals containing from one to six carbon atoms, respectively, wherein one of the carbon atoms is substituted with a HOSO ₃ group. -.

The term "(C3-C6 cycloalkyl)C1-C6 alkyl-", as used herein, refers to saturated monovalent straight or branched chain alkyl radicals containing from one to six carbon atoms, respectively, where one of the carbon atoms is substituted with C3 -C6 cycloalkyl group.

The term "C3-C6 cycloalkyl" as used herein refers to a saturated carbocyclic ring having three to six ring carbon atoms, ie cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl.

The term "oxo" or "oxo" as used herein means an oxygen atom that is double bonded to a carbon atom, i.e. =O.

The term "thioxo" as used herein means a sulfur atom that is double bonded to a carbon atom, i.e. =S.

The term "compound" as used herein includes all stereoisomers, geometric isomers, tautomers, and isotopes of the depicted structures. Compounds herein identified by name or structure as one particular tautomeric form are intended to include other tautomeric forms unless otherwise indicated.

The term "tautomer" as used herein refers to compounds whose structures differ markedly in the arrangement of atoms, but which exist in easy and rapid equilibrium, and it should be understood that the compounds presented herein may be depicted as different tautomers, and when the compounds have tautomeric forms, all tautomeric forms are intended to be included within the scope of the invention and the naming of the compounds does not exclude the presence of any tautomer. Examples of tautomerizations include, but are not limited to, amide-imide; enamine-imine; enamine-(different)enamine tautomerization; and keto-enol.

It should be understood that certain compounds provided herein may contain one or more centers of asymmetry and therefore may be prepared and isolated in a mixture of isomers, such as a racemic mixture, or in enantiomerically pure form. For compounds of the invention in which the stereochemistry is indicated by straight thick lines or straight dashed lines, straight thick lines or straight dashed lines indicate relative stereochemistry. For compounds of the invention in which stereochemistry is indicated by solid wedges or dashed wedges, solid wedges or dotted wedges indicate absolute stereochemistry.

In one embodiment of Formula I, X ¹ is CH.

In one embodiment of Formula I, X ¹ is N.

In one embodiment of Formula I, R ⁹ is hydrogen.

In one embodiment of formula I, R ⁹ is halogen.

In one embodiment of Formula I, X ¹ is CH and R ⁹ is halogen. In one embodiment of Formula I, X ¹ is CH and R ⁹ is fluorine.

In one embodiment of Formula I, X ¹ is N and R ⁹ is hydrogen.

In one embodiment of Formula I, R ¹ is hydrogen.

In one embodiment of Formula I, R ¹ is C1-C6 alkyl. In one embodiment of Formula I, R ¹ is methyl.

In one embodiment of Formula I, R ² is hydrogen. In one embodiment of Formula I, R ² is hydrogen and R ¹ is hydrogen.

In one embodiment of Formula I, R ² is C1-C6 alkyl. In one embodiment of Formula I, R ² is C1-C6 alkyl and R ¹ is hydrogen. In one embodiment of Formula I, R ² is methyl or ethyl. In one embodiment of Formula I, R ² is methyl or ethyl and R ¹ is hydrogen.

In one embodiment of Formula I, R ² is hydroxyC1-C6 alkyl. In one embodiment of Formula I, R ² is hydroxyC1-C6 alkyl and R ¹ is hydrogen. In one embodiment of Formula I, R ² is hydroxyC1-C6 alkyl and R ¹ is C1-C6 alkyl. In one embodiment of formula I, R ² is hydroxyC1-C6 alkyl and R ¹ is methyl. In one embodiment of formula I, R ² is selected from the structures:

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen. In one of these embodiments, R ¹ is C1-C6 alkyl. In one of these embodiments, R ¹ is methyl.

In one embodiment of Formula I, is dihydroxyC2-C6 alkyl. In one embodiment of formula I, R ² is dihydroxyC2-C6 alkyl and R ¹ is hydrogen. In one embodiment of formula I, R ² is selected from the structures:

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen.

In one embodiment of Formula I, R ² is C1-C6 fluoroalkyl optionally substituted with OH. In one embodiment of formula I, R ² is C1-C6 fluoroalkyl optionally substituted with OH, and R ¹ is hydrogen. In one embodiment of Formula I, R ² is C1-C6 fluoroalkyl optionally substituted with OH, and R ¹ is C1-C6 alkyl. In one embodiment of formula I, R ² is selected from the structures:

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen.

In one embodiment of formula IR ² is (di-C1-C6 alkoxy)C2-C6 alkyl-. In one embodiment of the formula, IR ² is (di-C1-C6 alkoxy)C2-C6 alkyl- and R ¹ is hydrogen. In one embodiment of the formula, IR ² is (di-C1-C6 alkoxy)C2-C6 alkyl- and R ¹ is C1-C6 alkyl. In one embodiment, R ² is

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen.

In one embodiment of Formula I, R ² is (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH. In one embodiment of Formula I, R ² is (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH and R ¹ is hydrogen. In one embodiment of Formula I, R ² is (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH and R ² is C1-C6 alkyl. In one embodiment, R ² is selected from the structures:

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen. In one of these embodiments, R ¹ is C1-C6 alkyl. In one of these embodiments, R ¹ is methyl.

In one embodiment of Formula I, R ² is Cyc ¹ . In one embodiment of Formula I, R ² is Cyc ¹ and R ¹ is hydrogen. In one embodiment of Formula I, R ² is Cyc ¹ and R ¹ is C1-C6 alkyl. In one embodiment of the formula, IR ² is selected from the structures:

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen.

In one embodiment of Formula I, R ² is Cyc ² . In one embodiment of Formula I, R ² is Cyc ² and R ¹ is hydrogen. In one embodiment of Formula I, R ² is Cyc ² and R ¹ is C1-C6 alkyl. In one embodiment of the formula, IR ² is selected from the structures:

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen.

In one embodiment of Formula I, R ² is (hetCyc ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH. In one embodiment of Formula I, R ² is (hetCyc ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH and R ¹ is hydrogen. In one embodiment of Formula I, R ² is (hetCyc ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, and R ¹ is C1-C6 alkyl. In one embodiment, R ² is selected from the structures

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen.

In one embodiment of Formula I, R ² is (Ar ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH. In one embodiment of Formula I, R ² is (Ar ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH and R ¹ is hydrogen. In one embodiment of Formula I, R ² is (Ar ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, and R ² is C1-C6 alkyl. In one of these embodiments, R ² is (Ar ¹ )C1-C6 alkyl-, wherein said alkyl moiety is substituted with OH. In one embodiment, R ² is

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen.

In one embodiment of Formula I, R ² is (hetAr ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH. In one embodiment of Formula I, R ² is (hetAr ¹ )C1-C6 alkyl- wherein said alkyl moiety is optionally substituted with OH and R ¹ is hydrogen. In one embodiment of formula I, R ² is (hetAr ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, and R ¹ is C1-C6 alkyl. In one of these embodiments, R ² is (hetAr ¹ )C1-C6 alkyl-, wherein said alkyl moiety is substituted with OH. In one embodiment, R ² is selected from the structures:

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen.

In one embodiment of Formula I, R ² is (HOSO ₃ )C1-C6 alkyl-. In one embodiment of formula IR ² is (HOSO ₃ )C1-C6 alkyl- and R ¹ is hydrogen. In one embodiment of Formula I, R ² is (HOSO ₃ )C1-C6 alkyl- and R ¹ is C1-C6 alkyl. In one embodiment, R ² is

and R ¹ is hydrogen or C1-C6 alkyl. In one of these embodiments, R ¹ is hydrogen.

In one embodiment of Formula I, G is

where X ² is C or N and ring A is a 5-6 membered heterocyclic ring optionally having an additional 1-2 ring nitrogen atoms when X ² is N and having one ring nitrogen atom when X ² is is C, and R ³ , R ⁶ , R ⁷ and R ⁸ are as defined for Formula I.

In one embodiment of Formula I, G is

where X ² is C or N, ring A is a 5-6 membered heterocyclic ring having one ring nitrogen atom, and R ³ , R ⁶ , R ⁷ and R ⁸ are as defined for formula I.

In one embodiment of Formula I, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having one additional ring nitrogen atom, and R ⁷ is oxo, where G has the formula A-1

where R ⁶ is C1-C6 alkyl, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² , and hetCyc ² and R ⁸ are as defined for Formula I. In one embodiment of Formula A-1, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl, and C1-C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment, G is formula A-1, where formula A-1 is selected from the structures:

In one embodiment of Formula I, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having an additional ring nitrogen atom, and R ⁷ is hydrogen, where G has the formula A-2

where R ⁶ is hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, R ⁷ is hydrogen, and R ⁸ is as defined for formula I. In one embodiment of formula A-2, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment, ring A is formula A-2 and is selected from the structures:

In one embodiment of Formula I, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring, where G has the formula A-3

where R ⁶ is halogen, C1-C6 alkyl, C1-C6 alkoxy or C3-C6 cycloalkyl, R ⁷ is hydrogen, provided that when R ⁶ is on a ring carbon adjacent to the carbon associated with the -NHC moiety (=O)- formula I , then R ⁶ is not halogen, and R ⁸ has the meaning as defined for formula I. As used in the present description, the term "ring carbon atom located next to the carbon associated with the moiety -NHC(=O )- of formula I" refers to the carbon atom indicated by an asterisk in the following structure:

In one embodiment of Formula A-3, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl, and C1-C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment, G is formula A-3 and is selected from the structures:

In one embodiment of Formula I, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having two additional ring nitrogen atoms, and R ⁷ is oxo or thiooxo, where G has the formula A-4

where Y is O or S, R ⁶ is C1-C6 alkyl, and R ⁸ is as defined for Formula I. In one embodiment of Formula A-4, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment, G is formula A-4 and is selected from the structures:

In one embodiment of Formula I, G is

where X ² is C, R ³ is absent, ring A is a 6-membered heterocyclic ring having a ring nitrogen atom, where G has the formula A-5

where R ⁶ is C1-C6 alkyl, R ⁷ is hydrogen, and R ⁸ is as defined for formula I. In one embodiment of formula A-5, R ⁸ is Ar ² where Ar ² is phenyl , optionally substituted with substituents independently selected from halo, C1-C2 alkyl, and C1-C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment, G is formula A-5 and is selected from the structures:

In one embodiment of Formula I, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having two additional ring nitrogen atoms, where G has the formula A-6

where R ⁶ and R ⁷ are hydrogen and R ⁸ is as defined for formula I. In one embodiment of formula A-6, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment, G is formula A-6 and has the structure:

In one embodiment of Formula I, G is

where X ² is N, R ³ is hydrogen or methyl, and ring A is a 6-membered heterocyclic ring having a ring nitrogen atom, where G has the formula A-7

where R ⁶ and R ⁷ are hydrogen, or R ⁶ and R ⁷ are on the same carbon atom and R ⁶ and R ⁷ together with the carbon atom to which they are attached form a cyclopropyl ring, and R ⁸ is, as defined for formula I. In one embodiment of formula A-7, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with substituents independently selected from halo, C1-C2 alkyl, and C1-C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment, G is formula A-7 and is selected from the structures:

In one embodiment of Formula I, G is

where X ² is N, R ³ is absent, ring A is a 5-membered heterocyclic ring having an additional ring nitrogen atom, where G has the formula A-8

where R ⁶ is C1-C6 alkyl, R ⁷ is hydrogen or C1-C6 alkyl, and R ⁸ is as defined for formula I. In one embodiment of formula A-8, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment, G is Formula A-8 and is selected from the structures:

In one embodiment of Formula I, G is

where ring B and R ⁸ have the meanings as defined for formula I.

In one embodiment of Formula I, G is

where ring B is a 6-membered saturated carbocyclic group optionally substituted with oxo. In one embodiment, G has the formula B-1

where R ⁸ is as defined for formula I. In one embodiment of formula B-1, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with substituents independently selected from halo, C1-C2 alkyl, and C1 -C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment, G is formula B-1 and has the structure:

.

.

In one embodiment of Formula I, G is

where Ring B is a 6-membered aromatic carbocyclic ring optionally substituted with OH. In one embodiment, G has the formula B-2

where R ⁸ is as defined for formula I. In one embodiment of formula B-2, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with substituents independently selected from halo, C1-C2 alkyl, and C1 -C2 alkoxy. In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens. In one embodiment of formula B-2, R ⁸ is Ar ² where Ar ² is phenyl which is unsubstituted. In one embodiment, G is formula B-2 and has the structure:

In one embodiment, compounds of formula I include formula I-A, where:

X ¹ represents CH or N;

R ¹ is hydrogen or C1-C6 alkyl;

R ² is

(a) hydrogen,

(b) C1-C6 alkyl,

(c) hydroxyC1-C6 alkyl,

(g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, or

(h) Cyc ¹ ;

Cyc ¹ is a 3-4 membered cycloalkyl ring optionally substituted with 1-2 substituents independently selected from halo, hydroxy, C1-C3 alkyl, hydroxyC1-C3 alkyl, C1-C3 alkoxy, (C1-C3 alkoxy)C1-C3 alkyl- and R'R''NC(=O)-;

X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having one additional ring nitrogen atom, and R ⁷ is oxo, where G has the formula A-1

R ⁶ is C1-C6 alkyl, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² ;

hetCyc ² is a 4-6 membered saturated heterocyclic ring having a ring nitrogen atom and optionally substituted with C1-C6 alkyl;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of formula IA, R ¹ is hydrogen,

In one embodiment of Formula IA, R ⁹ is hydrogen.

In one embodiment of formula IA, R ⁹ is halogen. In one embodiment of Formula IA, R ⁹ is fluoro.

In one embodiment of Formula IA, X ¹ is CH.

In one embodiment of Formula IA, X ¹ is CH and R ⁹ is halogen. In one embodiment of Formula IA, X ¹ is CH and R ⁹ is fluorine.

In one embodiment of formula IA, R ¹ is H, X ¹ is CH, and R ⁹ is fluoro.

In one embodiment of formula IA, R ¹ is H, X ¹ is CH, R ⁸ is Ar ² and R ⁹ is fluorine.

In one embodiment of Formula IA, X ¹ is N.

In one embodiment of formula IA, X ¹ is N and R ⁹ is hydrogen.

In one embodiment of formula IA, R ¹ is hydrogen, X ¹ is N, and R ⁹ is hydrogen.

In one embodiment of formula IA, R ¹ is hydrogen, X ¹ is N, R ⁸ is Ar ² and R ⁹ is hydrogen.

In one embodiment of formula IA, R ² is H.

In one embodiment of formula IA, R ² is C1-C6 alkyl.

In one embodiment of formula IA, R ² is hydroxyC1-C6 alkyl.

In one embodiment of Formula IA, R ² is (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH.

In one embodiment of formula IA, R ² is Cyc ¹ .

In one embodiment of Formula IA, R ⁸ is Ar ² . In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of Formula IA, R ⁸ is hetAr ² . In one embodiment of Formula IA, R ⁸ is pyrazolyl optionally substituted with C1-C6 alkyl.

In one embodiment of formula IA, R ⁸ is C3-C6 cycloalkyl.

In one embodiment of Formula IA, R ⁸ is hetCyc ³ .

In one embodiment of formula IA, R ⁸ is C1-C6 alkyl.

In one embodiment, compounds of formula I include formula I-B, where:

X ¹ represents CH or N;

R ¹ is hydrogen or C1-C6 alkyl;

R ² is

(c) hydroxyC1-C6 alkyl,

(d) dihydroxyC2-C6 alkyl,

(e) C1-C6 fluoroalkyl optionally substituted with OH,

(f) (di-C1-C6 alkoxy)C2-C6 alkyl-,

(g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH,

(h) Cyc ¹ ,

(i) Cyc ² ,

(j) (hetCyc ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH,

(k) (Ar ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH,

(l) (hetAr ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, or

(m) (HOSO ₃ )C1-C6 alkyl-;

Cyc ¹ is a 3-4 membered cycloalkyl ring optionally substituted with 1-2 substituents independently selected from halo, hydroxy, C1-C3 alkyl, hydroxyC1-C3 alkyl, C1-C3 alkoxy, (C1-C3 alkoxy)C1-C3 alkyl- and R'R''NC(=O)-;

R' and R'' are independently hydrogen or C1-C6 alkyl;

Cyc ² is a 5-membered cycloalkyl ring substituted with 1-2 substituents independently selected from C1-C3 alkyl, (C1-C3 alkoxy)C1-C3 alkyl- and hydroxyC1-C3 alkyl-;

hetCyc ¹ is a 5-6 membered saturated heterocyclic ring having 1-2 ring heteroatoms independently selected from O, N and SO ₂ wherein said ring is optionally substituted with oxo;

Ar ¹ is phenyl;

hetAr ¹ is pyridyl;

X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having an additional ring nitrogen atom, and R ⁷ is hydrogen, where G has the formula A-2

R ⁶ is hydrogen, C1-C6 alkyl or C3-C6 cycloalkyl;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of Formula IB, X ¹ is CH.

In one embodiment of Formula IB, X ¹ is N.

In one embodiment of Formula IB, R ⁸ is Ar ² . In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of Formula IB, R ¹ is hydrogen.

In one embodiment of Formula IB, R ⁹ is hydrogen.

In one embodiment of Formula IB, R ⁹ is halo. In one embodiment of Formula IB, R ⁹ is fluoro.

In one embodiment of formula IB, R ¹ is hydrogen, X ¹ is CH, R ⁸ is Ar ² , where Ar ² is as defined for formula IB and R ⁹ is fluoro.

In one embodiment of formula IB, R ¹ is hydrogen, X ¹ is CH, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with one or more halogens and R ⁹ is fluoro.

In one embodiment of formula IB, R ¹ is hydrogen, X ¹ is N, R ⁸ is Ar ² , where Ar ² is as defined for formula IB and R ⁹ is hydrogen.

In one embodiment of formula IB, R ¹ is hydrogen, X ¹ is N, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with one or more halogens and R ⁹ is hydrogen.

In one embodiment, compounds of formula I include formula I-C, where:

X ¹ represents CH or N;

R ¹ is hydrogen;

R ² is

(c) hydroxyC1-C6 alkyl,

(e) C1-C6 fluoroalkyl optionally substituted with OH, or

(g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH;

X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring, where G has the formula A-3

R ⁶ is halo, C1-C6 alkyl, C1-C6 alkoxy, or C3-C6 cycloalkyl;

R ⁷ is hydrogen;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of formula IC, R ⁹ is hydrogen.

In one embodiment of formula IC, R ⁹ is halogen. In one embodiment of Formula IC, R ⁹ is fluoro.

In one embodiment of Formula IC, X ¹ is CH.

In one embodiment of formula IC, X ¹ is CH and R ⁹ is halogen. In one embodiment of Formula IC, X ¹ is CH and R ⁹ is fluorine.

In one embodiment of Formula IC, X ¹ is N.

In one embodiment of Formula IC, X ¹ is N and R ⁹ is hydrogen.

In one embodiment of Formula IC, R ⁸ is Ar ² . In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of Formula IC, X ¹ is CH, R ⁹ is fluorine, and R ⁸ is Ar ² , where Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of formula IC, X ¹ is N, R ⁹ is hydrogen, and R ⁸ is Ar ² , where Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment, compounds of formula I include formula I-D, where:

X ¹ is CH;

R ¹ is hydrogen;

R ² is

(c) hydroxyC1-C6 alkyl,

(e) C1-C6 fluoroalkyl optionally substituted with OH, or

(g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH;

R ³ absent;

X ² is N;

X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having two additional ring nitrogen atoms, and R ⁷ is oxo or thiooxo, where G has the formula

R ⁶ is C1-C6 alkyl;

Y is O or S;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of Formula ID, R ⁸ is Ar ² . In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of formula ID, R ⁹ is halogen. In one embodiment of formula ID, R ⁹ is fluoro.

In one embodiment of Formula ID, Ar ² is phenyl optionally substituted with one or more halogens, and R ⁹ is fluorine.

In one embodiment, compounds of formula I include formula I-E, where:

X ¹ represents CH or N;

R ² is

(c) hydroxyC1-C6 alkyl,

(e) C1-C6 fluoroalkyl optionally substituted with OH, or

(g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH;

X ² is C, R ³ is absent, ring A is a 6-membered heterocyclic ring having a ring nitrogen atom, where G has the formula A-5

R ⁶ is C1-C6 alkyl;

R ⁷ is hydrogen;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of Formula IE, R ¹ is hydrogen.

In one embodiment of Formula IE, X ¹ is CH.

In one embodiment of Formula IE, X ¹ is N.

In one embodiment of formula IE, R ⁸ is Ar ² . In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of Formula IE, R ⁹ is hydrogen.

In one embodiment of Formula IE, R ⁹ is fluoro.

In one embodiment of formula IE, R ¹ is hydrogen, X ¹ is CH, Ar ² is phenyl optionally substituted with one or more halogens, and R ⁹ is fluorine.

In one embodiment of Formula IE, R ¹ is hydrogen, X ¹ is N, Ar ² is phenyl optionally substituted with one or more halogens, and R ⁹ is hydrogen.

In one embodiment, compounds of formula I include formula I-F, where:

X ¹ is CH;

R ¹ is hydrogen;

R ² is (c) hydroxyC1-C6 alkyl;

X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having two additional ring nitrogen atoms, where G has the formula A-6

R ⁶ is hydrogen;

R ⁷ is hydrogen;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of Formula IF, R ⁸ is Ar ² . In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of Formula IF, R ⁹ is halo. In one embodiment of Formula IF, R ⁹ is fluoro.

In one embodiment of Formula IF, Ar ² is phenyl optionally substituted with one or more halogens, and R ⁹ is fluoro.

In one embodiment, compounds of formula I include formula I-G, where:

X ¹ is CH;

R ¹ is hydrogen;

R ² is (c) hydroxyC1-C6 alkyl;

X ² is N, R ³ is hydrogen or methyl, and ring A is a 6-membered heterocyclic ring having a ring nitrogen atom, where G has the formula A-7

R ⁶ is hydrogen and R ⁷ is hydrogen,

or R ⁶ and R ⁷ are on the same carbon atom and R ⁶ and R ⁷ together with the carbon atom to which they are attached form a cyclopropyl ring;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of formula IG, R ⁸ is Ar ² . In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of formula IG, R ⁹ is halogen. In one embodiment of Formula IG, R ⁹ is fluoro.

In one embodiment of formula IG, Ar ² is phenyl optionally substituted with one or more halogens, and R ⁹ is fluorine.

In one embodiment, compounds of formula I include formula I-H, where:

X ¹ is CH;

R ¹ is hydrogen;

R ² is (c) hydroxyC1-C6 alkyl;

X ² is N, R ³ is absent, ring A is a 5-membered heterocyclic ring having an additional ring nitrogen atom, where G has the formula A-8

R ⁶ is C1-C6 alkyl;

R ⁷ is hydrogen or C1-C6 alkyl;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of Formula IH, R ⁸ is Ar ² . In one embodiment of Formula IH, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of formula IH, R ⁹ is halogen. In one embodiment of Formula IH, R ⁹ is fluoro.

In one embodiment of Formula IH, R ⁸ is Ar ² where Ar ² is phenyl optionally substituted with one or more halogens and R ⁹ is fluoro.

In one embodiment, compounds of formula I include formula I-I, where:

X ¹ is CH;

R ¹ is hydrogen;

R ² is (c) hydroxyC1-C6 alkyl;

G is formula B-1

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of formula II, R ⁸ is Ar ² . In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of formula II, R ⁹ is halogen. In one embodiment of Formula II, R ⁹ is fluoro.

In one embodiment of Formula II, Ar ² is phenyl optionally substituted with one or more halogens, and R ⁹ is fluoro.

In one embodiment, compounds of formula I include formula I-J, where:

X ¹ is CH;

R ¹ is hydrogen;

R ² is (c) hydroxyC1-C6 alkyl;

G is formula B-2

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo, C1-C2 alkyl and C1-C2 alkoxy;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from halogen, C1-C2 alkyl and C1-C2 alkoxy;

hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and

R ⁹ is hydrogen or halogen.

In one embodiment of Formula IJ, R ⁸ is Ar ² . In one embodiment, Ar ² is phenyl optionally substituted with one or more halogens.

In one embodiment of formula IJ, R ⁹ is halogen. In one embodiment of Formula IJ, R ⁹ is fluoro.

In one embodiment of formula IJ, Ar ² is phenyl optionally substituted with one or more halogens, and R ⁹ is fluorine.

The compounds of formula I include their pharmaceutically acceptable salts. In addition, compounds of formula I also include other salts of such compounds, which are not necessarily pharmaceutically acceptable salts and which may be useful as intermediates for the preparation and/or purification of compounds of formula I and/or for separating enantiomers of compounds of formula I. Non-limiting examples pharmaceutically acceptable salts of the compounds of formula I include the hydrochloride salts.

In addition, it should be understood that the compounds of formula I or their salts can be isolated in the form of solvates, and, accordingly, any such solvate is included in the scope of the present invention. For example, the compounds of formula I and their salts may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like.

In one embodiment, the compounds of formula I include the compounds of examples 1-201 and their stereoisomers and pharmaceutically acceptable salts and solvates. In one embodiment, the compounds of examples 1-201 are in free base form. In one embodiment, one or more of the compounds of Examples 1-201 are hydrochloric acid salts.

In one embodiment, the compound of Formula I is the compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 or 201, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 25, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 37, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 46, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 48, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 55, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 58, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 72, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 76, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 77, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 78, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 83, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 84, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 85, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 91, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 97, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 100, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 103, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 105, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 107, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 108, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 114, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 115, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 119, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 121, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 124, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 125, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 126, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 127, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 129, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 151, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 152, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 163, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 169, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 188, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 190, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 199, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 200, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of Formula I is the compound of Example No. 201, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compounds of formula I include compounds of formula II and their stereoisomers, tautomers and pharmaceutically acceptable salts, where:

X ¹ represents CH or N;

R ¹ is hydrogen or C1-C6 alkyl;

R ² is

(a) hydrogen,

(b) C1-C6 alkyl,

(c) hydroxyC1-C6 alkyl,

(d) dihydroxyC2-C6 alkyl,

(e) C1-C6 fluoroalkyl optionally substituted with OH,

(g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH,

(h) Cyc ¹ ,

(i) Cyc ² ,

(j) (hetCyc ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH,

(k) (Ar ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH,

(l) (hetAr ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, or

(m) (HOSO ₃ )C1-C6 alkyl-;

Cyc ¹ is a 3-4 membered cycloalkyl ring optionally substituted with 1-2 substituents independently selected from halo, hydroxy, hydroxyC1-C3 alkyl, C1-C3 alkoxy, (C1-C3 alkoxy)C1-C3 alkyl- and R'R''NC(=O)-;

R' and R'' are independently selected from C1-C6 alkyl;

Cyc ² is a 5-membered cycloalkyl ring substituted with 1-2 substituents independently selected from C1-C3 alkyl, (C1-C3 alkoxy)C1-C3 alkyl- and hydroxyC1-C3 alkyl-;

hetCyc ¹ is a 5-6 membered saturated heterocyclic ring having 1-2 ring heteroatoms independently selected from O, N and SO ₂ wherein said ring is optionally substituted with oxo;

Ar ¹ is phenyl;

hetAr ¹ is pyridyl;

G represents

или

;

or

;

X ² is C or N;

Ring A, including atoms at the points of attachment, is a 5-6 membered heterocyclic ring, optionally having an additional 1-2 ring nitrogen atoms when X ² is N and having one ring nitrogen atom when X ² is C;

R ³ is hydrogen or absent;

R ⁶ is hydrogen, halogen, C1-C6 alkyl, C1-C6 alkoxy, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² , provided that when R ⁶ is halogen and is on the ring carbon adjacent to the carbon associated with the -NHC(=O)- moiety of formula I , then R ⁶ is not halogen;

R ⁷ is hydrogen, C1-C6 alkyl, oxo or thioxo;

hetCyc ² is a 4-membered saturated heterocyclic ring having a ring nitrogen atom substituted with C1-C6 alkyl;

ring B, including the atoms at the attachment points, is a 6-membered saturated carbocyclic group optionally substituted with oxo, or a 6-membered aromatic carbocyclic ring optionally substituted with OH;

R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl;

Ar ² is phenyl optionally substituted with one or more substituents independently selected from halo;

hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with one or more substituents independently selected from C1-C2 alkyl; and

R ⁹ is hydrogen or halogen.

In one embodiment of Formula II, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having one additional ring nitrogen atom, and R ⁷ is oxo, so that G has the formula A-1

where R ⁶ is C1-C6 alkyl, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² , and hetCyc ² and R ⁸ are as defined for Formula II.

In one embodiment of Formula II, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having an additional ring nitrogen atom, and R ⁷ is hydrogen, so that G has the formula A-2

where R ⁶ is hydrogen, C1-C6 alkyl or C3-C6 cycloalkyl, R ⁷ is hydrogen, and R ⁸ is as defined for formula II.

In one embodiment of Formula II, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring, so that G has the formula A-3

where R ⁶ is halogen, C1-C6 alkyl, C1-C6 alkoxy, or C3-C6 cycloalkyl, R ⁷ is hydrogen, provided that when R ⁶ is on a ring carbon atom adjacent to the carbon associated with the moiety - NHC(=O)- of formula II, then R ⁶ is not halo and R ⁸ is as defined for formula II. As used herein, the term "ring carbon adjacent to the carbon associated with the -NHC(=O)- moiety of formula II" refers to the carbon atom indicated by an asterisk in the following structure:

.

.

In one embodiment of Formula II, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having two additional ring nitrogen atoms, and R ⁷ is oxo or thiooxo, so that G has the formula A-4

where Y is O or S, R ⁶ is C1-C6 alkyl, and R ⁸ is as defined for formula II.

In one embodiment of Formula II, G is

where X ² is C, R ³ is absent, ring A is a 6-membered heterocyclic ring having a ring nitrogen atom, so that G has the formula A-5

where R ⁶ is C1-C6 alkyl, R ⁷ is hydrogen, and R ⁸ is as defined for formula II.

In one embodiment of Formula II, G is

where X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having two additional ring nitrogen atoms, so that G has the formula A-6

where R ⁶ and R ⁷ are hydrogen and R ⁸ is as defined for formula II.

In one embodiment of Formula II, G is

where X ² is N, R ³ is hydrogen or methyl, and ring A is a 6-membered heterocyclic ring having a ring nitrogen atom, so that G has the formula A-7

where R ⁶ and R ⁷ represent hydrogen, and R ⁸ is as defined for formula II.

In one embodiment of Formula II, G is

where X ² is N, R ³ is absent, ring A is a 5-membered heterocyclic ring having an additional ring nitrogen atom, so that G has the formula A-8

where R ⁶ is C1-C6 alkyl, R ⁷ is hydrogen or C1-C6 alkyl, and R ⁸ is as defined for formula II.

In one embodiment of Formula II, G is

where ring B and R ⁸ have the meanings as defined for formula II.

In one embodiment of Formula II, G is

where ring B is a 6-membered saturated carbocyclic group optionally substituted with oxo.

In one embodiment of formula II, G is of formula B-1

where R ⁸ has the meaning as defined for formula II.

In one embodiment, the compound of formula II is the compound of Example No. 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 75, 76, 77, 79, 80, 81, 84, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 128, 142, 144, 145, 146, 147, 148, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 166, 167, 168, 169, 170, 171, 172, 173, 179, 181, 182, 183, 184, 185, 186, 187, 189, 191, 192, 193, 194, 195, 196, or 197, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 2, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 3, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 4, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 5, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 6, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 7, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 8, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 12, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 13, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 14, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 16, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 17, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 18, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 19, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 20, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 21, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 22, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 23, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 24, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 25, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 26, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 27, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 28, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 29, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 30, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 31, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 32, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 33, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 34, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 35, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 36, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 37, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 38, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 39, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 40, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 41, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 42, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 43, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 44, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 45, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 46, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 47, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 50, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 51, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 52, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 53, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 54, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 55, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 56, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 57, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 58, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 59, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 60, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 61, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 62, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 63 , or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 64, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 65, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 66, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 67, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 68, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 69, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 70, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 71, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 72 or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 73, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 74, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 75, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 76, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 77, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 79, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 80, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 81, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 84, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 86, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 87 , or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 88, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 89, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 90, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 91, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 92, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 93, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 94, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 95, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 96, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 97, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 98, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 99, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 100, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 101, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 102, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 103, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 104, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 105, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 106, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 107, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 108, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 109, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 110, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 113, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 114 or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 115, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 116, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 117, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 118, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 119, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 120, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 121, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 122, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 128, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 142, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 144, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 145, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 146, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 147, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 148, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 150, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 151, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 152, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 153, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 154, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 155, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 156, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 157, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 158, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 159, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 160, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 161, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 162, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 163, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 164, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 166, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 167, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 168, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 169, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 170, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 171, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 172, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 173, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 179, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 181, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 182, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 183, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 184, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 185, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 186, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 187, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 189, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 191, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 192, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 193, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 194, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 195, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 196, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, the compound of formula II is the compound of Example No. 197, or a pharmaceutically acceptable salt or solvate thereof.

The term "pharmaceutically acceptable" indicates that the compound, or a salt or composition thereof, is chemically and/or toxicologically compatible with the other ingredients that make up the formulation and/or with the patient being treated with it.

The compounds provided herein may also contain unnatural proportions of atomic isotopes on one or more of the atoms that make up such compounds. That is, an atom, particularly when referred to in relation to a compound of formula I, includes all isotopes and mixtures of isotopes of that atom, whether naturally occurring or synthetically produced, either in natural composition or in isotopically enriched form. For example, when hydrogen is mentioned, it is meant to refer to ¹ H, ² H, ³ H, or mixtures thereof; when carbon is mentioned, it is understood that it refers to ¹¹ C, ¹² C, ¹³ C, ¹⁴ C or mixtures thereof; when nitrogen is mentioned, it is meant to refer to ¹³ N, ¹⁴ N, ¹⁵ N, or mixtures thereof; when oxygen is mentioned, it is meant to refer to ¹⁴ O, ¹⁵ O, ¹⁶ O, ¹⁷ O, ¹⁸ O, or mixtures thereof; and when fluorine is mentioned, it is meant to refer to ¹⁸ F, ¹⁹ F, or mixtures thereof. The compounds provided herein therefore also include compounds with one or more isotopes of one or more atoms and mixtures thereof, including radioactive compounds in which one or more non-radioactive atoms are replaced by one of its enriched radioactive isotopes. Radiolabeled compounds are useful as additional anti-cancer agents, eg, cancer therapeutics, research reagents, eg, assay reagents, and diagnostic agents, eg, in vivo imaging agents. All isotopic variants of the compounds provided herein, whether radioactive or not, are intended to be included within the scope of the present invention.

For illustrative purposes, Schemes 1-24 show general preparations for the compounds provided herein as well as key intermediates. For a more detailed description of the individual reaction steps, see the "Examples" section below. Those skilled in the art will recognize that other synthetic routes may be used to synthesize the compounds of the invention. Although specific starting materials and reagents are shown in the schemes and described below, other starting materials and reagents can be easily substituted to provide a variety of derivatives and/or reaction conditions. In addition, many of the compounds obtained by the methods described below can be further modified in light of this disclosure using conventional chemistry well known to those skilled in the art.

Scheme 1

Scheme 1 shows the general method for preparing compound 5, where R ⁶ and R ⁸ are as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A- 1, R ⁷ is hydrogen and R ³ is absent.

Diethyl 2-(aminomethylene)malonate can be reacted with a reagent having the formula OCN-R ⁸ where R ⁸ is as defined for formula I to give compound 2. Compound 2 can be treated with a strong base (eg sodium methoxide) with compound 3. Compound 3 can be reacted with a reagent having the formula R ⁶ -I and a base such as K ₂ CO ₃ where R ⁶ is as defined for formula I to give compound 4. Treatment of compound 4 with aqueous acid gives connection 5.

Scheme 2

Scheme 2 shows the general method for preparing compound 7, where R ⁶ is cyclopropyl and R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-1, R ⁶ is cyclopropyl, R ⁷ is hydrogen, and R ³ is absent.

Compound 3, where R ⁸ is as defined for formula I (prepared as in Scheme 1), can be treated with a reagent having the formula R ⁶ -B(OH) ₂ where R ⁶ is cyclopropyl, in the presence of Cu( OAc) ₂ and 2,2'-bipyridine to give compound 6. Treatment of compound 6 with aqueous acid gives compound 7.

Scheme 3

Scheme 3 shows the general method for preparing compound 12, where R ⁶ is hetCyc ² and R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-1, R ⁷ is hydrogen and R ³ is absent.

Compound 3, where R ⁸ is as defined for formula I (prepared as in scheme 1), can be treated with reagent (8), where P ¹ is an amino protecting group (for example, Boc), in the presence of a base (for example, K ₂ CO ₃ ) to give compound 9. The protecting group P ^{1 of} compound 9 can be removed to give compound 10. Compound 10 can be reacted with a reagent having the formula RC(=O)H, where R is C1-C6 alkyl, in the presence of a reducing agent (eg NaBH(OAc) ₃ ) to give compound 11. Compound 11 can be treated with aqueous acid to give compound 12.

Scheme 4

Scheme 4 shows the general method for preparing compound 16, where R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-2, R ⁶ and R ⁷ are hydrogen and R ³ is absent.

Compound 13, where R ⁸ is as defined for formula I, can be treated with oxalaldehyde in the presence of an acid to give compound 14. Compound 14 can be treated with 2,2-dimethyl-1,3-dioxane-4,6-dione in the presence of a carboxylic acid (eg, acetic acid) and an amine base (eg, piperidine) to give compound 15. Compound 15 can be treated with a base (eg, sodium methoxide) to give compound 16.

Scheme 5

Scheme 5 shows the general method for preparing compound 19, where R ⁶ is hydrogen, C1-C6 alkyl, C1-C6 alkoxy, HOC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² and R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-2, R ⁷ is hydrogen and R ³ is absent .

Compound 17 wherein R ⁶ is hydrogen, C1-C6 alkyl, C1-C6 alkoxy, P ² OC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² , and where P ² is a hydroxy protecting group, can be reacted with a reagent having the formula H ₂ N-NHR ⁸ where R ⁸ is as defined for formula I to give compound 18 as a minor product. Compound 18 can be reacted with 2,2-dimethyl-1,3-dioxane-4,6-dione in the presence of an acid (eg HOAc) and piperidine to give compound 19, after which, if R ⁶ is P ² OC1-C6 alkyl, the protecting group for the hydroxyl group is removed.

Scheme 6

Scheme 6 shows the general method for preparing compound 22, where R ⁸ is as defined for formula I, and R ¹ and R ² are independently H or C 1 -C 3 alkyl, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-3, R ⁶ is C1-C6 alkyl, R ⁷ is hydrogen and R ³ is absent.

Compound 20, where R ⁸ is as defined for formula I, may be reacted with compound 21a, where R ¹ and R ² are independently H or C1-C3 alkyl, in the presence of a palladium catalyst to give compound 21. Compound 21 may be treated with lithium hydroxide to give compound 22.

Scheme 7

Scheme 7 shows the general method for preparing compound 25 wherein R ⁶ is C1-C6 alkoxy and R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-3, R ⁷ is hydrogen, and R ³ is absent.

Compound 23, where R ⁶ is C1-C6 alkoxy, can react with a reagent having the formula R ⁸ -I, where R ⁸ is as defined for formula I, in the presence of a copper catalyst, a base and quinolinol, to obtain compound 24 Treatment of compound 24 with aqueous acid gives compound 25.

Scheme 8

Scheme 8 shows the general method for preparing compound 28, where R ⁶ is C1-C6 alkyl and R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-3, R ⁷ is hydrogen, and R ³ is absent.

Ethyl 3-chloro-3-oxopropanoate can be reacted with reagent R ⁸ -NH ₂ where R ⁸ is as defined for formula I to give compound 26. Compound 26 can be reacted with reagent 27 where R ⁶ is C1- C6 alkyl, in the presence of a base (eg sodium ethoxide) to give compound 28.

Scheme 9

Scheme 9 shows the general method for preparing compound 32, where R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-3, R ⁶ is methyl, R ⁷ is hydrogen and R ³ is absent.

Diethyl 2-(propan-2-ylidene)malonate can be reacted with a reagent having the formula R ⁸ -NH ₂ where R ⁸ has the meaning as defined for formula I, in the presence of imidazole at elevated temperatures (for example, at about 200°C ) to give compound 30. Compound 30 can be reacted with 1,1-dimethoxy-N,N-dimethylmethanamine to give compound 31. Treatment of compound 32 with lithium hydroxide gives compound 32.

Scheme 10

Scheme 10 shows a general method for the preparation of compound 34, where R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-3, R ⁶ is C1-C6 alkyl, R ⁷ is hydrogen and R ³ is absent.

Compound 34 can be prepared by treating compound 26 (prepared as in Scheme 8), where R ⁸ is as defined for formula I, with reagent 27a, where R ⁶ is C1-C6 alkyl, in the presence of sodium ethoxide.

Scheme 11

Scheme 11 shows the general method for preparing compound 38 where R ⁸ is Ar ² , hetAr ² or C3-C6 cycloalkyl and R ⁶ is C3-C6 cycloalkyl and compound 39 where R ⁸ is as defined for formula I, and X is Cl or Br, which are intermediates used to prepare compounds of formula I, where G is ring A and ring A is A-3, R ⁷ is hydrogen and R ³ is absent.

Compound 35, where X is Cl or Br, can be reacted with boronic acid having the formula (HO) ₂ BR ⁸ where R ⁸ is Ar ² , hetAr ² , or C3-C6 cycloalkyl, in the presence of a copper catalyst (for example, copper(II) acetate) and a base (eg, pyridine) to give compound 36. Compound 36 can be treated with a compound having the formula R ⁶ -BF ₃ K, where R ⁶ is C3-C6 cycloalkyl to give compound 37. Workup compound 37 with lithium hydroxide gives compound 38. Compound 39 can be obtained by treating compound 36 with lithium hydroxide.

Scheme 12

Scheme 12 shows the general preparation of compound 43, where R ⁶ is C1-C6 alkyl, C1-C6 alkoxy, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² . and R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-4, R ⁷ is thioxo and R ³ is absent.

Diethyl 2-oxomalonate can be reacted with a compound having the formula 40, where R ⁸ is as defined for formula I, to give compound 41. Compound 41 can be treated with a reagent having the formula R ⁶ -I, where R ⁶ is C1 -C6 alkyl, C1-C6 alkoxy, P ² O-C1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² and P ² is a protecting group for a hydroxyl group, in the presence of base (eg, K ₂ CO ₃ ) to give compound 42. Treatment of compound 42 with aqueous acid gives compound 43, after which, if R ⁶ is P ² OC1-C6 alkyl, the hydroxyl protecting group is removed.

Scheme 13

Scheme 13 shows the general preparation of compound 46, where R ⁶ is C1-C6 alkyl, C1-C6 alkoxy, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² and R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-4, R ⁷ is oxo and R ³ is absent.

Compound 42, obtained according to scheme 12, can be treated with hydrogen peroxide in the presence of an acid to obtain compound 44. Compound 44 can be treated with a compound having the formula R ⁶ -I, where R ⁶ represents C 1 -C 6 alkyl, C 1 -C 6 alkoxy, P ² O-C1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² and P ² is a hydroxy protecting group, in the presence of a base (eg K ₂ CO ₃ ) to give a compound 45. Treatment of compound 45 with aqueous acid gives compound 46, after which, if R ⁶ is P ² OC1-C6 alkyl, the hydroxy protecting group is removed.

Scheme 14

Scheme 14 shows the general method for preparing compound 50, where R ⁶ is C1-C6 alkyl, C1-C6 alkoxy, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² and R ⁸ is Ar ² , hetAr ² or cyclopropyl which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-5, R ⁷ is hydrogen and R ³ is absent.

Methyl 5-bromo-4-hydroxynicotinate can be treated with a compound having the formula R ⁶ -I, where R ⁶ is C1-C6 alkyl, C1-C6 alkoxy, P ² O-C1-C6 alkyl, C3-C6 cycloalkyl, ( C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² and P ² is a hydroxy protecting group, in the presence of a base (eg Cs ₂ CO ₃ ) to give compound 47. Compound 47 can be treated with boronic acid 48 where R ⁸ is is Ar ² , hetAr ² , or cyclopropyl to give compound 49. Treatment of compound 49 with aqueous acid gives compound 50, after which, if R ⁶ is P ² OC1-C6 alkyl, the hydroxyl protecting group is removed.

Scheme 15

Scheme 15 shows the general method for preparing compound 58, where R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-6, R ⁶ and R ⁷ are hydrogen and R ³ is absent.

Compound 51, where R ⁸ is as defined for formula I, can be treated with formaldehyde and potassium cyanide to give compound 52. Compound 52 can be treated with oxalyl dichloride to give compound 53. Compound 53 can be treated with sodium methoxide to give compound 54. Compound 54 can be reduced under standard hydrogenation conditions (eg, under hydrogen atmosphere in the presence of a palladium catalyst such as palladium on charcoal) to give compound 55. Compound 55 can be converted to compound 56 by treatment with phosphoryl chloride. Compound 56 can be treated with zinc cyanide in the presence of a palladium catalyst and a ligand (e.g., Pd ₂ dba ₃ and dppf) to give compound 57. The nitrile group of compound 57 can be hydrolyzed by treatment with aqueous acid to give compound 58.

Scheme 16

Scheme 16 shows the general method for preparing compound 59 where R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl or hetCyc ³ and compound 61 where R ³ is C1-C6 alkyl and R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl or hetCyc ³ which are intermediates used to prepare compounds of formula I, where G is ring A and ring A is A-7, R ⁷ is hydrogen, and R ³ is methyl.

Ethyl 2-oxo-piperidine-3-carboxylate can be treated with R ⁸ -I where R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl or hetCyc ³ in the presence of copper(I) iodide, quinolin-8-ol and bases (eg CsCO ₃ ) to give compound 58. Compound 58 can be hydrolyzed under basic conditions (eg LiOH) to give compound 59.

Alternatively, compound 58 can be treated with a compound having the formula R ³ -I, where R ³ is C 1 -C 6 alkyl, to give compound 60. Compound 60 can be hydrolyzed under basic conditions (e.g., LiOH) to give compound 61.

Scheme 17

Scheme 17 shows the general method for preparing compound 65 where R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl or hetCyc ³ which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-7, R ⁶ and R ⁷ together form a cyclopropyl ring, and R ³ is hydrogen.

(1-Cyanocyclopropyl)methyl methanesulfonate can be treated with diethylmalonate in the presence of sodium hydride to give compound 62. Compound 62 can be subjected to intramolecular cyclization in the presence of hydrogen and a catalytic amount of platinum(IV) oxide to give compound 63. Compound 63 can be treated with a compound having the formula R ⁸ -I, where R ⁸ represents Ar ² , hetAr ² , C3-C6 cycloalkyl or hetCyc ³ , in the presence of copper (I) iodide, quinolin-8-ol and a base (for example, Cs ₂ CO ₃ ) to obtain compound 64. Compound 64 can be hydrolyzed under basic conditions (eg LiOH) to give compound 65.

Scheme 18

Scheme 18 shows the general method for preparing compound 70, where R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring A and ring A is A-8, R ⁷ is hydrogen and R ³ is absent.

Diethyl 2-(ethoxymethylene)malonate can be reacted with compound 66 where R ⁸ is as defined for formula I to give compound 67. Compound 67 can be reacted with compound 68 where R ⁶ is C1-C6 alkyl to give compound 69. Treatment of compound 69 with sodium hydroxide gives compound 70.

Scheme 19

Scheme 19 shows the general method for preparing compound 72, where R ⁸ is as defined for formula I, which is an intermediate used to prepare compounds of formula I, where G is ring B and ring B is B-1.

Ethyl (E)-2-cyano-3-ethoxyacrylate can be reacted with cyclohexane-1,3-dione in the presence of potassium tert-butoxide to give compound 71. Compound 71 can be reacted with R ⁸ -I, where R ⁸ is as defined for formula I to give compound 72.

Scheme 20

Scheme 20 shows a general method for the preparation of compound 79, where R ⁹ is as defined for formula I, and compound 80, where R ⁹ and R ² are as defined for formula I, which are intermediates used to obtain compounds formula I, where X ¹ represents CH.

Compound 73, where P ³ is an amino protecting group (e.g., p-methoxybenzyl; PMB), can be reacted with compound 74, where R ⁹ is as defined for formula I, in the presence of a base to give compound 75. Amino protecting group of compound 75 can be removed under standard conditions (eg TFA) to give compound 76. Compound 76 can be treated can be treated with I ₂ in the presence of a base (eg KOH) to give compound 77. The amino group of compound 77 can be protected under standard conditions to give compounds 78, where P ³ represents an amino protecting group (for example, para-methoxybenzyl; PMB). The nitro group of compound 78 can be reduced under standard conditions (eg, tin(II) chloride) to give compound 79. Compound 79 can be treated with a compound having the formula H ₂ NR ² , where R ² is as defined for formula I, in the presence of CuI, a ligand (for example, 1H-pyrrole-2-carboxylic acid), and a base (for example, potassium carbonate) to give compound 80.

Scheme 21

Scheme 21 shows the general method for preparing compound 86, where R ² is hydrogen, C1-C6 alkyl, C1-C6 fluoroalkyl, (di-C1-C6 alkoxy)C2-C6 alkyl-, (C1-C6 alkoxy)C1-C6 alkyl-, Cyc ¹ , Cyc ² , (hetCyc ¹ )C1-C6 alkyl-, (Ar ¹ )C1-C6 alkyl-, (hetAr ¹ )C1-C6 alkyl- or (HOSO ₃ )C1-C6 alkyl-, which is an intermediate used to prepare compounds of formula I where X ¹ is N, R ⁹ is hydrogen, and R ² is hydrogen, C1-C6 alkyl, C1-C6 fluoroalkyl, (di-C1-C6 alkoxy)C2- C6 alkyl-, (C1-C6 alkoxy)C1-C6 alkyl-, Cyc ¹ , Cyc ² , (hetCyc ¹ )C1-C6 alkyl-, (Ar ¹ )C1-C6 alkyl-, (hetAr ¹ )C1-C6 alkyl - or (HOSO ₃ )C1-C6 alkyl-.

Compound 81 can be treated with I ₂ in the presence of a base (eg KOH) to give compound 82. The amino group of compound 82 can be protected under standard conditions (eg by treatment with 1-(chloromethyl)-4-methoxybenzene in the presence of a base, eg K ₂ CO ₃ ) to give compound 83, where P ³ is an amino protecting group (eg PMB). Compound 83 can be treated with 2-chloro-5-hydroxypyridine in the presence of a base (eg Cs ₂ CO ₃ ) to give compound 84. Compound 84 can be treated with H ₂ NR ² where R ² is hydrogen, C1-C6 alkyl , C1-C6 fluoroalkyl, (di-C1-C6 alkoxy)C2-C6 alkyl-, (C1-C6 alkoxy)C1-C6 alkyl-, Cyc ¹ , Cyc ² , (hetCyc ¹ )C1-C6 alkyl-, (Ar ¹ )C1-C6 alkyl-, (hetAr ¹ )C1-C6 alkyl- or (HOSO ₃ )C1-C6 alkyl-, in the presence of CuI, a ligand (e.g. 1H-pyrrole-2-carboxylic acid), and a base (e.g. , potassium carbonate) to give compound 85. Compound 85 can be treated with lithium bis(trimethylsilyl)amide in the presence of a palladium catalyst (eg Pd ₂ dba ₃ ) and a ligand (eg X-Phos) to give compound 86.

Scheme 22

Scheme 22 shows the general method for preparing compound 91, where R ² is hydroxyC1-C6 alkyl and P ³ is an amino protecting group, which is an intermediate used to prepare compounds of formula I, where X ¹ is N and R ⁹ is hydrogen.

Compound 87 (prepared as in Scheme 21), where P ³ is an amino protecting group, can be treated with a compound having the formula H ₂ NR ² , where R ² is hydroxyC1-C6 alkyl, in the presence of CuI, a ligand (e.g., 1H -pyrrole-2-carboxylic acid), and a base (e.g., potassium carbonate) to give compound 88. The hydroxyl moiety of the R ² group of compound 88 can be protected under standard conditions (e.g., treatment with tert-butyldimethylsilyl chloride) to give compound 89, where R ^2a is hydroxyC1-C6 alkyl where the hydroxyl group is protected. Compound 89 can be treated with t-butyl carbamate in the presence of a palladium catalyst (e.g. Pd ₂ dba ₃ ) and a ligand (e.g. X-Phos) to give compound 90. Deprotection of the hydroxyl group under standard conditions gives compound 91.

Scheme 23

Scheme 23 shows a general method for the preparation of compound 96, which is a compound of formula I, where R ¹ , R ² , X ¹ , R ⁹ and G are as defined for formula I.

Compound 92 wherein R ⁹ and X ¹ are as defined for formula I and P ³ is an amino protecting group can be treated with compound 93 where G is as defined for formula I in the presence of coupling reagents ( e.g., in the presence of HATU or EDCI/HOBt and diisopropylethylamine) to give compound 94. Compound 94 can be treated with R ¹ R ² NH where R ¹ and R ² are as defined for formula I, and where if the moiety R ² contains a hydroxyl group, the hydroxyl group is optionally protected by a protecting group for the hydroxyl group in the presence of copper(I) iodide and either in the presence of a base (eg K ₂ CO ₃ ) and 1H-pyrrole-2-carboxylic acid, or in the presence of a ligand ( eg N1,N2-dimethylethane-1,2-diamine) and a base (eg K ₃ PO ₄ ) to give compound 95. Removal of the amino protecting group and hydroxyl group, if present, under standard conditions (eg trifluoroacetic acid) gives connect 96. In embodiments where G is B-1 (e.g., as in Scheme 19), compound 95, in which G is B-2, is formed as an oxidation by-product during the reaction step of converting compound 94 to compound 95.

Scheme 24

Scheme 24 shows an alternative general method for the preparation of compound 96, which is a compound of formula I, where R ¹ , R ² , X ¹ , R ⁹ and G are as defined for formula I.

Compound 92 wherein R ⁹ and X ¹ are as defined for Formula I and P ³ is an amino protecting group can be treated with a reagent having the formula R ¹ R ² NH where R ¹ and R ² are as defined for formula I, and where, if the fragment R ² contains a hydroxyl group, then the hydroxyl group is optionally protected by a protective group for the hydroxyl group, in the presence of copper (I) iodide and either in the presence of a base (for example, K ₂ CO ₃ ) and 1H-pyrrole -2-carboxylic acid, or in the presence of a ligand (for example, N1,N2-dimethylethane-1,2-diamine) and a base (for example, K ₃ PO ₄ ), to obtain compound 97. Compound 97 can be treated with compound 93, where G is as defined for Formula I in the presence of coupling reagents (e.g., in the presence of HATU or EDCI/HOBt and diisopropylethylamine) to give compound 95. Removal of the amino protecting group and hydroxyl group, if present, under standard conditions (e.g., trifluoroace hydrochloric acid) gives compound 96.

The term "amino protecting group" as used herein refers to a derivative of groups commonly used to block or protect an amino group while reactions are carried out on other functional groups of the compound. Examples of suitable protecting groups for use in any of the methods described herein include carbamates, amides, alkyl and aryl groups, imines, as well as many N-heteroatom derivatives that can be removed to regenerate the desired amino group. Non-limiting examples of amino protecting groups are para-methoxybenzyl (PMB), tert-butyloxycarbonyl (“Boc”), benzyloxycarbonyl (“CBz”), and 9-fluorenylmethyleneoxycarbonyl (“Fmoc”). Additional examples of such groups are found in T.W. Greene, et al., Greene's Protective Groups in Organic Synthesis. New York: Wiley Interscience, 2006.

The hydroxyl groups may be protected by any suitable hydroxyl protecting group, for example as described in T.W. Greene, et al., Greene's Protective Groups in Organic Synthesis. New York: Wiley Interscience, 2006. Examples include benzyl, trityl, silyl ethers, and the like.

In one embodiment, provided herein is a process for preparing a compound of Formula I, comprising:

(a) reacting a compound having the formula

where X ¹ , N, and R ⁹ have the meanings as defined for formula I, and P ³ represents an amino protecting group, with a reagent having the formula R ¹ R ² NH, where R ¹ and R ² have the meanings as defined for the formula I, and where, if the fragment R ² contains a hydroxyl group, then the hydroxyl group is optionally protected by a protecting group for the hydroxyl group, in the presence of copper (I) iodide and either in the presence of a base and 1H-pyrrole-2-carboxylic acid, or in the presence of a ligand and bases, followed by removal of the amino protecting group and removal of the hydroxyl group, if present; or

(b) reacting a compound having the formula:

where R ⁹ and X ¹ have the meanings as defined for formula I, P ³ represents an amino protecting group, and R ¹ and R ² have the meanings as defined for formula I, where, if the fragment R ² contains a hydroxyl group, then the hydroxyl group optionally protected by a protecting group for the hydroxyl group, with a reagent having the formula

where G is as defined for formula I, in the presence of coupling reagents, followed by removal of the amino protecting group and removal of the hydroxyl group, if present; and

optionally forming a pharmaceutically acceptable salt thereof.

The compounds of formula I, or pharmaceutically acceptable salts thereof, may modulate or inhibit the activity of one or more TAM kinases. The ability of compounds of formula I to act as inhibitors of one or more TAM kinases can be demonstrated using the assays described in examples A, B and C. IC ₅₀ values are shown in the tables in the examples.

The compounds of formula I or their pharmaceutically acceptable salts can modulate or inhibit the activity of c-Met kinase. The ability of compounds of formula I to act as inhibitors of wild-type and certain mutant c-Met kinases can be demonstrated using the assay described in Example D. IC ₅₀ values are shown in Table 9.

As used herein, the term "TAM kinase" refers to one, two, or all three TAM receptor tyrosine kinases, ie, TYRO3, AXL, and MER.

As used herein, the term "TAM kinase inhibitor" refers to any compound that exhibits inhibitory activity against one, two, or all three TAM receptor kinases, i. the compounds exhibit inhibitory activity against AXL and/or MER and/or TYRO3.

As used herein, the term "c-Met kinase inhibitor" refers to any compound that exhibits inhibitory activity against wild-type c-Met kinases or certain mutant c-Met kinases. In one embodiment, the term "c-met kinase inhibitor" refers to any compound exhibiting inhibitory activity against a wild-type c-Met kinase or a mutant c-Met kinase selected from Del14, D1228H, D1228N, F1200I, L1195V, Y1230C , Y1230H and Y1230S.

In some embodiments, the compounds of formula I, or pharmaceutically acceptable salts thereof, have inhibitory activity against AXL. In some embodiments, the compounds of formula I, or pharmaceutically acceptable salts thereof, have inhibitory activity against MER. In some embodiments, a compound of formula I has inhibitory activity against AXL and MER. In some embodiments, the compounds of formula I, or pharmaceutically acceptable salts thereof, have inhibitory activity against AXL, MER, and TYRO3. In some embodiments, a compound of formula I, or pharmaceutically acceptable salts thereof, has c-Met kinase inhibitory activity. In some embodiments, a compound of Formula I, or pharmaceutically acceptable salts thereof, has inhibitory activity on one or more receptor tyrosine kinases selected from AXL, MER, TYRO3, and c-Met. In some embodiments, a compound of formula I or pharmaceutically acceptable salts thereof has c-Met kinase inhibitory activity that does not include the amino acids encoded by exon 14. In some embodiments, a compound of formula I or pharmaceutically acceptable salts thereof has inhibitory activity against mutated c -Met (eg, any of the examples of mutated c-Met proteins described herein or known in the art) (eg, a mutation in c-Met that causes resistance to a type I c-Met inhibitor).

In one embodiment, the compounds of Formula I, or pharmaceutically acceptable salts thereof, exhibit an inhibitory activity (IC ₅₀ ) against TAM kinase and/or c-Met of less than about 1000 nM, less than about 500 nM, less than about 200 nM, less than about 100 nM, less than about 50 nM, less than about 25 nM, less than about 10 nM, or less than about 1 nM, as measured in an assay as described herein. In some embodiments, the compounds of Formula I, or pharmaceutically acceptable salts thereof, exhibit an inhibitory activity (IC ₅₀ ) against TAM kinase and/or c-Met of less than about 25 nM, less than about 10 nM, less than about 5 nM, or less than about 1 nM, as measured in the assay as presented herein.

In one embodiment, exemplary compounds of formula I, or pharmaceutically acceptable salts thereof, exhibit an inhibitory activity (IC ₅₀ ) against AXL of less than about 50 nM, less than about 25 nM, less than about 10 nM, or less than about 1 nM, as measured in the assay as described. in this document.

In one embodiment, the compounds of Formula I, or pharmaceutically acceptable salts thereof, exhibit an inhibitory activity (IC ₅₀ ) against MER of less than about less than about 200 nM, less than about 100 nM, less than about 50 nM, less than about 25 nM, less than about 10 nM or less than about 1 nM as measured in the assay as described herein. In some embodiments, the compounds of Formula I, or pharmaceutically acceptable salts thereof, exhibit an inhibitory activity (IC ₅₀ ) against MER of less than about 25 nM, less than about 10 nM, less than about 5 nM, or less than about 1 nM, as measured in the assay as provided herein. document.

In one embodiment, the compounds of Formula I, or pharmaceutically acceptable salts thereof, exhibit an inhibitory activity (IC ₅₀ ) against TYRO3 of less than about 1000 nM, less than about 750 nM, less than about 500 nM, less than about 250 nM, less than about 200 nM, less than about 100 nM, less than about 50 nM, less than about 25 nM, less than about 10 nM, or less than about 1 nM as measured in the assay as described herein.

In one embodiment, the compounds of Formula I, or pharmaceutically acceptable salts thereof, exhibit an inhibitory activity (IC ₅₀ ) against c-Met of less than about 1000 nM, less than about 750 nM, less than about 500 nM, less than about 250 nM, less than about 200 nM, less than about 100 nM, less than about 50 nM, less than about 25 nM, less than about 10 nM, or less than about 1 nM, as measured in an assay as described herein.

In some embodiments, compounds of Formula I, or pharmaceutically acceptable salts thereof, inhibit all three TAM kinases (ie, AXL, MER, and TYRO3) by about a 5-fold difference.

In some embodiments, the compounds of formula I, or pharmaceutically acceptable salts thereof, are selective for AXL over MER. In some embodiments, a compound of formula I, or a pharmaceutically acceptable salt thereof, exhibits at least 2-fold selectivity; at least 3-fold selectivity; at least 4-fold selectivity; at least 5-fold selectivity; at least 6-fold selectivity; at least 7-fold selectivity; at least 8-fold selectivity; at least 9-fold selectivity; at least 10-fold selectivity; at least 11-fold selectivity; at least 12-fold selectivity; at least 13-fold selectivity; at least 14-fold selectivity; at least 15-fold selectivity; at least 20-fold selectivity; at least 25-fold selectivity; at least 30-fold selectivity; at least 35-fold selectivity; at least 40-fold selectivity; at least 45-fold selectivity; at least 50-fold selectivity; or at least 55-fold selectivity to AXL compared to MER. In some embodiments, selectivity for AXL and MER is measured using an enzyme assay (e.g., an enzyme assay as provided herein.

In some embodiments, a compound of formula I, or a pharmaceutically acceptable salt thereof, exhibits at least 5-fold selectivity; at least 10-fold selectivity; at least 15-fold selectivity; at least 20-fold selectivity; at least 25-fold selectivity; at least 30-fold selectivity; at least 35-fold selectivity, at least 40-fold selectivity; at least 50-fold selectivity; at least 60-fold selectivity; at least 70-fold selectivity; at least 80-fold selectivity; at least 90-fold selectivity; at least 100-fold selectivity; at least 125-fold selectivity; at least 150-fold selectivity; or at least 200-fold selectivity for AXL over TYRO3. In some embodiments, selectivity for AXL and TYRO3 is measured using an enzyme assay (eg, an enzyme assay as provided herein).

In some embodiments, the compounds of formula I, or pharmaceutically acceptable salts thereof, exhibit at least 5-fold selectivity; at least 10-fold selectivity; at least 15-fold selectivity; at least 20-fold selectivity; at least 25-fold selectivity; at least 30-fold selectivity; at least 35-fold selectivity; or at least 40-fold selectivity; to MER compared to TYRO3. In some embodiments, selectivity for MER and TYRO3 is measured using an enzyme assay (e.g., an enzyme assay as provided herein.

In some embodiments, provided herein is a method for inhibiting an AXL kinase, which comprises contacting an AXL kinase with a compound of Formula I, or a pharmaceutically acceptable salt thereof.

In some embodiments, provided herein is a method for inhibiting MER kinase, which comprises contacting the MER kinase with a compound of formula I, or a pharmaceutically acceptable salt thereof.

In some embodiments, provided herein is a method for inhibiting TYRO3 kinase, which comprises contacting the TYRO3 kinase with a compound of formula I, or a pharmaceutically acceptable salt thereof.

In some embodiments, provided herein is a method for inhibiting a c-Met kinase (e.g., any of the exemplary c-Met kinases described herein) which comprises contacting the c-Met kinase with a compound of Formula I or a pharmaceutically acceptable salt thereof.

The compounds of formula I, or pharmaceutically acceptable salts thereof, are useful in the treatment of various diseases associated with increased (e.g., at least 1%, at least 2%, at least 4%, at least 6%, at least 8% at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130% , at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260%, at least 270%, at least 280%, at least 290% or at least 300%) by the expression, level and/or activity of one or multiple TAM kinases and/or c-Met kinase (e.g., in a cancer cell or immune cell) (e.g., compared to a control, such as a non-cancerous tissue or cell, or a corresponding tissue or cell from a non-cancer control subject ). In one embodiment, the compounds of formula I, or pharmaceutically acceptable salts thereof, are useful in the treatment or prevention of proliferative disorders such as cancer. In one embodiment, tumors with an activating mutation (e.g., point mutation or chromosomal translocation) in a gene encoding a receptor tyrosine kinase and/or upregulation of a receptor tyrosine kinase (e.g., any of the TAM kinases or c-Met kinase described herein ) may be particularly susceptible to compounds of formula I. In one embodiment, tumors with a mutation in the MET gene that results in exon 14 skipping during mRNA splicing are susceptible to compounds of formula I. In one embodiment, tumors having a mutation in the gene MET that results in the expression of c-Met protein having resistance to c-Met inhibitor type I are sensitive to the compounds of formula I.

As used herein, the terms "treat" or "treatment" refer to therapeutic or palliative measures. Beneficial or desirable clinical results include, but are not limited to, alleviation, in whole or in part, of the symptoms associated with the disease or disorder or condition, reduction in the degree of the disease, stabilization (i.e., not worsening) of the disease, delay or slowing of the progression disease, improvement or temporary alleviation of a disease state (eg, one or more symptoms of a disease); and remission (partial or complete), detectable or undetectable. "Treatment" can also mean an increase in survival compared to expected survival without treatment.

As used herein, the terms "subject", "individual", or "patient" are used interchangeably and refer to any animal, including mammals such as mice, rats, other rodents, rabbits, dogs, cats, pigs, cattle, sheep, horses, primates and humans. In some embodiments, the patient is a human. In some embodiments, the subject has experienced and/or has at least one symptom of a disease or disorder being treated and/or prevented. In some embodiments, the subject has been identified or diagnosed with a TAM-associated disease or disorder (e.g., TAM-associated cancer) and/or has been identified or diagnosed with a c-Met-associated disease or disorder (e.g., c-Met-associated cancer) ( eg, as determined using a regulatory approved, eg, FDA approved, assay or kit). In some embodiments, the subject has been identified or diagnosed with cancer associated with one or more TAM kinases and/or c-Met kinase (e.g., TAK-associated cancer) (e.g., as determined using regulatory approval, e.g., FDA-approved, analysis or set). In some embodiments, the subject has a tumor associated with one or more TAM kinases and/or c-Met kinase (e.g., increased expression, level, and/or activity of one or more TAM kinases and/or c-Met kinase in a cell (e.g., cancer cell or immune cell) compared to a control, e.g., non-cancerous tissue or corresponding tissue from a control subject that does not have cancer (e.g., as determined using a regulatory approved assay or kit).In some embodiments, the subject is suspected of having TAM-associated cancer and/or c-Met-associated cancer In some embodiments, the subject has a medical history indicating that the subject has a tumor associated with one or more TAM kinases (e.g., TAM-associated cancer) and/or c-Met kinase (and possibly the history indicates that the subject should be treated with any of the compositions provided herein). In some embodiments, the patient is a pediatric patient.

The term "pediatric patient" as used herein refers to a patient under the age of 21 at the time of diagnosis or treatment. The term "pediatric" can be further divided into various subpopulations, including: neonates (from birth to the first month of life); infants (from 1 month to two years); child (from two years to 12 years); and teenagers (from 12 to 21 years old (up to but not including the twenty-second birthday)). Berhman RE, Kliegman R, Arvin AM, Nelson WE. Nelson Textbook of Pediatrics , 15th Ed. Philadelphia: WB Saunders Company, 1996; Rudolph AM, et al. Rudolph's Pediatrics , 21st Ed. New York: McGraw-Hill, 2002; and Avery MD, First LR. Pediatric Medicine , 2nd Ed. Baltimore: Williams &Wilkins; 1994. In some embodiments, a pediatric patient is a patient from birth to the first 28 days of life, from 29 days to less than two years of age, from two to less than 12 years of age, or from 12 years to 21 years of age (until the twenty-second birthday, but not including). In some embodiments, the pediatric patient is a patient from birth to the first 28 days of life, 29 days to less than 1 year of age, one month to less than four months of age, three months to less than seven months of age, six months to less than 1 1 to less than 2 years 2 to less than 3 years 2 to less than seven years 3 to less than 5 years 5 to less than 10 years 6 to less than 13 years 10 years to less than 15 years or from 15 years to less than 22 years.

The phrase "therapeutically effective amount" means an amount of a compound which, when administered to a patient in need of such treatment, is sufficient to (i) treat a TAM kinase-associated disease or disorder (e.g., TAM-associated cancer) and/or the disease or disorder associated with c-Met kinase (e.g., MET-associated cancer), (ii) alleviate, improve, or eliminate one or more symptoms of a particular disease, condition, or disorder, or (iii) delay the onset of one or more symptoms of a particular disease, condition, or disorder described in this document. The amount of a compound of formula I that will correspond to such an amount will vary depending on such factors as the particular compound, the state of the disease and its severity, the identification characteristics (for example, weight) of the patient in need of treatment, but nevertheless can be determined by the usual as a specialist in this field.

The term "regulatory body" refers to a country's agency for authorizing the medical use of pharmaceuticals in a country. For example, a non-limiting example of a regulatory body is the US Food and Drug Administration (FDA).

The term "TAM-associated disease or disorder" as used herein refers to diseases or disorders associated with or having increased expression and/or activity of one or more TAM kinases in a cell (e.g., cancer cell or immune cell) (e.g., compared to a control, e.g., a non-cancerous tissue or cell, or a corresponding tissue or cell from a control subject who does not have cancer) and/or where activation of a TAM kinase expressed on non-cancerous cells contributes to the disease. Non-limiting examples of a TAM-associated disease or disorder include, for example, cancer (TAM-associated cancer), for example, any of the cancers described herein. In one embodiment, the disease is a cancer that overexpresses one or more TAM kinases after treatment with at least one additional anticancer agent (e.g., one or more additional anticancer agents described herein), e.g., a kinase targeting therapeutic agent , and/or a chemotherapeutic agent as described herein). In one embodiment, the disease is associated with signaling through one or more TAM kinases expressed in cells of the immune system (e.g., immune cells selected from the group of tumor-associated macrophages, natural killer (NK) cells, and subsets of tumor-associated dendritic cells), where expression of one or more TAM kinases in immune cells can limit the ability of the patient's immune system to elicit an effective antitumor response.

The term "TAM-associated cancer" as used herein refers to cancers associated with or having increased expression and/or activity of one or more TAM kinases in a cancer cell or immune cell (e.g., compared to a control, e.g., non-cancerous tissue). or a cell, or a corresponding tissue or cell from a non-cancer control subject). Non-limiting examples of TAM-associated cancers are described herein. In some embodiments, a TAM-associated cancer is a cancer having a chromosomal translocation that results in the expression of a TMEM87B-MERTK fusion protein (e.g., TMEM87B amino acids 1-55 and MERTK amino acids 433-1000) or an AXL-MBIP fusion protein. A description of an exemplary chromosomal translocation that results in expression of the TMEM87B-MERTK fusion protein is provided by Shaver et al. ( Cancer Res. 76(16):4850-4860, 2016). A description of an exemplary chromosomal translocation that results in the expression of an AXL-MBIP fusion protein is provided by Seo et al. ( Genome Res. 22:2109-2119, 2012). Chromosomal translocations or resulting expression of TMEM87B-MERTK or AXL-MBIP fusion proteins can be detected using in situ hybridization (eg, fluorescence in situ hybridization (FISH)). Chromosomal translocations that result in the expression of TMEM87B-MERTK or AXL-MBIP can be detected by DNA sequencing from a sample obtained from the subject (eg, blood, plasma, urine, cerebrospinal fluid, saliva, sputum, bronchoalveolar lavage, bile, lymphatic fluid , cyst fluid, fecal ascites, or tumor biopsy obtained from the subject). Examples of methods that can be used for DNA sequencing are known in the art and include, for example, next generation sequencing (NGS), conventional PCR, digital PCR, and microarray analysis. Additional methods that can be used to detect chromosomal translocations that result in the expression of TMEM87B-MERTK or AXL-MBIP fusion proteins or in the expression of TMEM87B-MERTK or AXL-MBIP fusion proteins are known in the art.

The term "disease or disorder associated with c-Met", as used herein, refers to diseases or disorders associated with or having increased expression, level and/or activity of c-Met kinase in a cell (for example, a cancer cell or immune cell) (e.g., compared to a control, e.g., a non-cancerous tissue or cell, or a corresponding tissue or cell from a non-cancerous control subject) and/or in which activation of c-Met kinase expressed in non-cancerous cells promotes the development of the disease. Non-limiting examples of a disease or disorder associated with c-MET include, for example, cancer (c-Met-associated cancer), for example, any of the cancers described herein. In one embodiment, the disease is a cancer that overexpresses c-Met kinase after treatment with at least one additional anticancer agent (e.g., one or more additional anticancer agents described herein), for example, a kinase-targeting therapeutic agent, and/or a chemotherapeutic agent as described herein). In some embodiments, the disease is a cancer that has a higher level of c-Met kinase protein (eg, due to a mutation in the MET gene that results in reduced proteasomal degradation of c-MET kinase in a mammalian cell). In some embodiments, the disease is a cancer that has a higher level of c-Met kinase activity due to an activating mutation in the c-Met gene (e.g., any of the activating mutations in the c-Met gene described herein) or increased expression c-Met kinase in a mammalian cell. In some embodiments, the disease is a cancer that expresses a c-Met kinase that is resistant (e.g., at least to some extent compared to wild-type c-Met kinase) to a type I c-Met inhibitor.

Receptor tyrosine kinases (RTKs) are cell surface proteins that transmit signals from the extracellular environment to the cytoplasm and nucleus of the cell to regulate cellular events such as survival, growth, proliferation, differentiation, adhesion, and migration. All RTKs contain an extracellular ligand-binding domain and a cytoplasmic protein tyrosine kinase domain. Ligand binding results in RTK dimerization, which triggers cytoplasmic kinase activation and initiates downstream signaling pathways. RTKs can be classified into distinct subfamilies based on their sequence similarity.

Receptor tyrosine kinases TAM (TYRO3, AXL (also known as UFO) and MER) are a new class of innate immune checkpoints that are involved in key steps in antitumor immunity (Akalu, T, et al., Immunological Reviews 2017; 276:165-177 ). TAM kinases are characterized by an extracellular ligand-binding domain consisting of two immunoglobulin-like domains and two type III fibronectin domains. Two ligands, growth arrest-specific 6 (GAS6) and protein S (ProS), have been identified for TAM kinases. GAS6 can bind to and activate all three TAM kinases, while ProS is a ligand for MER and TYRO3 (Graham et al., 2014, Nature reviews Cancer 14, 769-785).

TAM kinases are ectopically expressed or overexpressed in a wide variety of cancers, including breast, colon, kidney, skin, lung, liver, brain, ovarian, prostate, and thyroid cancers (Graham et al., 2014, Nature Reviews Cancer 14, 769-785; and Linger et al., 2008, Oncogene 32, 3420-3431) and play an important role in tumor initiation and maintenance. When activated, AXL and MER can regulate tumor cell survival, proliferation, migration and invasion, angiogenesis, and tumor-host interactions (Schoumacher, M. et al., Curr. Oncol. Rep. 2017; 19(3);19). Accordingly, blocking TAM signaling may promote the recruitment of adaptive immunity and blockade of complement T cell checkpoints (Akalu, T, et al., Immunological Reviews 2017; 276:165-177). Thus, TAM inhibition represents an attractive approach to target another class of oncogenic RTKs (Graham et al., 2014, Nature Reviews Cancer 14, 769-785; and Linger et al., 2008, Oncogene 32, 3420-3431).

AXL was originally identified as a transforming gene from the DNA of patients with chronic myelogenous leukemia (O'Bryan et al., 1991, Molecular and Cellular Biology 11, 5016-5031). GAS6 binds to AXL and causes subsequent autophosphorylation and activation of the AXL tyrosine kinase. AXL activates several downstream signaling pathways including PI3K-Akt, Raf-MAPK, PLC-PKC (Feneyrolles et al., 2014, Molecular Cancer Therapeutics 13, 2141-2148; Linger et al., 2008, Oncogene 32, 3420-3431) . Overexpression or overactivation of the AXL protein correlated with the stimulation of multiple oncogenic processes. High levels of AXL expression are associated with poor prognosis in various forms of cancer such as glioblastoma multiforme (Hutterer, M., et al., Clin. Caner Res. 2008, 14, 130-138), breast cancer (Wang, X., Cancer Res. 2013, 73, 6516-6525), lung cancer (Niederst, M. et al, Sci. Signaling, 2013, 6, re6), osteosarcoma (Han, J., Biochem. Biophys. Res. Commun. 2013, 435, 493-500), and acute myeloid leukemia (Ben-Batalla, L., et al., Blood 2013, 122, 2443-2452). AXL is overexpressed or amplified in various cancers including lung cancer, prostate cancer, colon cancer, breast cancer, melanoma, and renal cell carcinoma (Linger et al., 2008, Oncogene 32, 3420-3431), and AXL overexpression correlates with poor prognosis (Linger et al., 2008, Oncogene 32, 3420-3431). Activation of AXL promotes survival, proliferation, angiogenesis, cancer cell metastasis, and resistance to chemotherapy and targeted therapy. AXL knockdown or anti-AXL antibody can inhibit breast and NSCLC cancer migration in vitro and block tumor growth in tumor xenograft models (Li et al., 2009, Oncogene 28, 3442-3455). In pancreatic cancer cells, inhibition of AXL reduces cell proliferation and survival (Koorstra et al., 2009, Cancer Biology & Therapy 8, 618-626). In prostate cancer, inhibition of AXL reduces cell migration, invasion, and proliferation (Tai et al., 2008, Oncogene 27, 4044-4055). In triple-negative breast cancer, patients typically present a significant clinical challenge as they fail to respond to various targeted cancer therapies due to an apparent lack of RTK activation. However, patients with triple-negative breast cancer do show some response to taxane-based chemotherapy, and studies have shown that the combination of an antimitotic drug (eg, docetaxel) with an AXL inhibitor sensitizes cancer cells to an antimitotic drug, and AXL in combination with an antimitotic drug drug may be an appropriate combination therapy for this disease (Wilson, et al., Cancer Res. 2014, 74(20), 5878-5890).

TAM kinases may contribute to therapeutic resistance through at least three mechanisms: intrinsic survival signaling in tumor cells, induction of TAM kinases as an escape mechanism for tumors treated with oncogene-targeted agents, and immunosuppression in the tumor microenvironment (Graham, et al, Nature Reviews Cancer, 2014, 14, 769-785).

TAM kinases have been found to promote resistance to cytotoxic chemotherapy (chemoresistance) in leukemia cells and solid tumor cells (Graham, et al, Nature Reviews Cancer, 2014, 14, 769-785). Transgenic lymphocytes ectopically expressing MER were found to be more resistant to dexamethasone than wild-type lymphocytes (Keating, A.K., et al., Oncogene, 2006, 25, 6092-6100), and stimulation of B-ALL cells with GAS6 increased resistance to cytarabine (Shiozawa, Y., et al., Neoplasia, 2010, 12, 116-127). AXL is induced in acute myeloid leukemia (AML) cells that have been treated with cytotoxic chemotherapies and mediates increased chemoresistance (Hong, C.C., et al., Cancer Lett., 2008, 268, 314-324). Chemotherapy-resistant chronic myeloid leukemia (CML) cell lines have elevated AXL levels, and shRNA-mediated AXL knockdown increases chemotherapy sensitivity in CML cell and xenograft models (Zhao, Y., et al., Cancer Invest. 2012, 30, 287 -294). Similarly, shRNA-mediated MER knockdown sensitizes B-cell acute lymphoblastic leukemia (B-ALL) and T-cell acute lymphoblastic leukemia (T-ALL) cells to a range of chemotherapy treatments (Linger, R.M., et al., Blood, 2013, 122 , 1599-1609; Brandao, L.N., et al., Blood Cancer J., 2013, 3, e101). In solid tumors such as non-small cell lung cancer, pancreatic ductal adenocarcinoma, astrocytoma, lung adenocarcinoma, ovarian cancer, melanoma, and glioblastoma multiforme, overexpression of AXL or MER promotes chemoresistance, and shRNA-mediated inhibition sensitizes cells to treatment with cytotoxic chemotherapies (Linger , R.N., et al., Oncogene, 2013, 32, 3420-3431; Song, X., et al., Cancer, 2011, 117, 734-743; Keating, A.K., et al., Mol. Cancer Ther. 2010 , 9, 1298-1307; Lay, J.D., et al., Cancer Res. 2007, 67, 3878-3887; Zhao, Y., et al., Cancer Invest, 2012, 30, 287-294; Macleod, K. , Cancer Res. 2005, 65, 6789-6800; Zhu, S., et al., Proc. Natl Acad. Sci. USA, 2009, 106, 17025-17030; Wang, Y., et al., Oncogene 2013, 32, 872-882).

In contrast to chemoresistance, examples of acquired resistance to TAM kinases are currently limited to AXL. AXL is upregulated in imatinib-resistant CML and gastrointestinal stromal tumor (GIST) cell lines and tumor specimens (Mahadevan, D., et al., Oncogene, 2007, 26, 3909-3919; Dufies, M., et al., Oncotarget 2011, 2, 874-885; Gioia, R., et al., Blood, 2011, 118, 2211-2221), and siRNA-mediated AXL knockdown restores the sensitivity of imatinib to resistant cell lines (Dufies, M., et al. ). Similarly, AXL is induced in lapatinib-resistant HER2 (also known as ERBB2)-positive breast cancer cell lines, and inhibition of AXL restores sensitivity to lapatinib (Liu, L., et al., Cancer Res. 2009, 69, 6871- 6878). AXL has been associated with acquired resistance to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (eg, lapatinib and erlotinib) and therapeutic antibodies (eg, cetuximab) in triple-negative breast cancer (Meyer, A.S. et al., Sci. Signal 2013, 6, ra66), colorectal cancer (Brand, et al., Cancer Res. 2014, 74:5152-5164), head and neck cancer cell lines (Kiles, K.M, et al., Mol. Cancer Ther. 2013, 12, 2541-2558) and non-small cell lung cancer (Zhang, Nat. Genet. 2013, 44(8), 852-860). AXL has also been associated with acquired resistance to inhibitors targeting other kinases, including PI3Kα inhibitors such as apelisib (BYL719) in head and neck and esophageal squamous cell carcinoma (Elkabets, et al., Cancer Cell 2015, 27:533-546) , MEK inhibitors (e.g. U0126 (1,4-diamino-2,3-dicyano-1,4-bis(o-aminophenylmercapto)butadiene) and PD 325901 (1,4-diamino-2,3-dicyano-1, 4-bis(o-aminophenylmercapto)butadiene) in triple negative breast cancer and melanoma cell lines (Miller, et al., Cancer Discovery 2016, 6:382-39), fibroblast growth factor (FGFR) (Ware, K.E. , Oncogenesis 2013, 2, e39), anaplastic lymphoma kinase (ALK) (Kim, H.R., et al., Mol. Oncol. 2013, 7, 1093-1102) and insulin-like growth factor receptor 1 (IGF1R) (Huang, R. , Cancer Res. 2010, 70, 7221-7231), and inhibition of AXL has been shown to overcome or delay resistance to these inhibitors. AXL is upregulated in NSCLC cell lines and xenografts, in resistant to EGFR tyrosine kinase inhibitors (erlotinib) and antibody drugs (cetuximab) (Brad, T.M., et al., Cancer Res. 2014, 74, 5152-5164; Zhang, Z., et al., Nature Genet. 2012, 44, 852-860) and is induced in 20% of matched tumor samples from NSCLC patients after development of resistance to the EGFR inhibitor erlotinib.

With respect to dual inhibitors of MER and AXL, the normal role of MER and AXL in preventing or terminating innate immune-mediated inflammation and natural killer (NK) cell responses is disrupted in the tumor microenvironment. MER and AXL reduce the antitumor activity of NK cells, which contributes to the increase in metastases.

MER was originally identified as a phosphoprotein from the lymphoblastoid expression library (Graham et al., 1995, Oncogene 10, 2349-2359). Both GAS6 and ProS can bind to MER and induce MER kinase phosphorylation and activation (Lew et al., 2014. eLife, 3:e03385). Like AXL, MER activation also transmits downstream signaling pathways including PI3K-Akt and Raf-MAPK (Linger et al., 2008, Oncogene 32, 3420-3431). MER is overexpressed in many cancers including multiple myeloma, stomach, prostate, breast, melanoma and rhabdomyosarcoma (Linger et al., 2008, Oncogene 32, 3420-3431). MER knockdown inhibits the growth of multiple myeloma cells in vitro and in xenograft models (Waizenegger et al., 2014, Leukemia, 1-9). In acute myeloid leukemia, MER knockdown induced apoptosis, decreased colony formation, and increased survival in a mouse model (Lee-Sherick et al., 2013, Oncogene 32, 5359-5368). MER inhibition increased apoptosis, decreased colony formation, increased chemosensitivity, and reduced tumor growth in NSCLC (Linger et al., 2013, Oncogene 32, 3420-3431). Similar effects are seen with MER knockdown in melanoma (Schlegel et al., 2013) and glioblastoma (Wang et al., 2013, Oncogene 32, 872-882).

TYRO3 was originally identified using a PCR-based cloning study (Lai and Lemke, 1991, Neuron 6, 691-704). Both ligands, GAS6 and ProS, can bind to Tyro3 and activate it. TYPO3 also plays a role in cancer growth and proliferation. TYRO3 is overexpressed in melanoma cells, and TYRO3 knockdown induces apoptosis in these cells (Demarest et al., 2013, Biochemistry 52, 3102-3118).

TAM kinases have become potential targets for immuno-oncology. The sustained clinical response to immune checkpoint blockade observed in cancer patients clearly indicates that the immune system plays an important role in tumor initiation and maintenance. Genetic mutations in cancer cells can provide a diverse set of antigens that immune cells can use to distinguish tumor cells from their normal counterparts. However, cancer cells have evolved several mechanisms to evade the host's immune surveillance. In fact, one of the hallmarks of human cancer is its ability to evade destruction by the immune system. Cancer cells can induce an immunosuppressive microenvironment by promoting the formation of tumor-associated M2 macrophages, myeloid-derived suppressor cells (MDSCs), and regulatory T cells. Cancer cells can also produce high levels of immune checkpoint proteins such as PD-L1 to cause T cell anergy or depletion. It is now clear that tumors co-opt certain immune checkpoint pathways as a major mechanism of immunoresistance (Pardoll, 2012, Cancer 12, 252-264). Counteracting these negative regulators of T-cell function with antibodies has shown remarkable efficacy in clinical trials for a number of cancers, including advanced melanoma, non-small cell lung and bladder cancer. Although these therapies have shown promising results, not all patients experience an antitumor response, suggesting that other immunosuppressive pathways may also be important.

TAM kinases have been shown to function as checkpoints for the activation of the immune system in the tumor environment. All TAM kinases are expressed in NK cells, and TAM kinase kinases inhibit the antitumor activity of NK cells. LDC1267, a small molecule TAM kinase inhibitor, activates NK cells and blocks metastases in tumor models with various histologies (Paolino et al., 2014, Nature 507, 508-512). In addition, MER kinase reduces the activity of tumor-associated macrophages by increasing the secretion of immunosuppressive cytokines such as ILIO and IL4 and decreasing the production of immune activating cytokines such as IL12 (Cook et al., 2013, The Journal of Clinical Investigation 123, 3231 -3242). MER inhibition has been shown to reverse this effect. As a result, MER knockout mice become resistant to PyVmT tumor formation (Cook et al., 2013, Journal of Clinical Investigation 123, 3231-3242). The role of TAM kinases in the immune response is also supported by studies in gene knockout mice. TAM triple knockout (TKO) mice are viable. However, these mice showed signs of autoimmune disease, including enlargement of the spleen and lymph nodes, production of autoantibodies, swollen footpads and joints, skin lesions, and systemic lupus erythematosus (Lu and Lemke, 2001, Science 293, 306-311). This is consistent with the knockout phenotype for approved immuno-oncology targets such as CTLA4 and PD-1. CTLA-4 and PD-1 knockout mice showed signs of autoimmune disease and died within weeks of birth (Chambers et al., 1997, Immunity 7, 885-895; and Nishimura et al., 2001, Science 291, 319-322). Therefore, inhibition of TAM kinases alone or in combination with other immunotherapies may increase the ability of the immune system to elicit a therapeutically beneficial immune response against cancer.

MET receptor tyrosine kinases (eg, c-Met) control growth, invasion, and metastasis in cancer cells. c-Met is activated in human cancer through many different molecular mechanisms (see, for example, Zhang et al., Carcinogenesis 4:345-355, 2016). For example, a disease or condition associated with c-Met (eg, c-Met-associated cancer) includes: (i) mutations that change the sequence and increase the activity of c-Met kinase; (ii) mutations in regulatory sequences that control c-Met expression or regulators of c-Met expression that provide increased expression of c-Met; (iii) mutations that alter the sequence of the c-Met polypeptide to increase the half-life of the c-Met kinase (e.g., a mutation in the MET gene that results in exon 14 skipping during mRNA splicing, resulting in an increase in c-Met levels in a mammalian cell ); (iv) methylation of the MET gene (see, for example, Nones et al., Int. J. Cancer 135:1110-8, 2014); (v) methylation of the long dispersed nuclear element (L1) present in the MET intron between exon 2 and exon 3 (Weber et al., Oncogene 29:5775-5784, 2010); (vi) amplifying the MET gene; or (vii) simultaneous expression of the receptor and ligand, resulting in autocrine stimulation of cancer cells (Birchmeier et al., Nat. Rev. Mol. Cell Biol. 4:915-925, 2003).

Examples of mutations in the MET gene that alter the c-Met kinase sequence and increase c-Met kinase activity (e.g., compared to wild-type c-Met kinase) include, but are not limited to, the mutations listed in Table 1.

Table 1. Exemplary list of mutations in the MET gene that alter the c-Met kinase sequence and increase c-Met kinase activity

MET isoform 1 mutation 2 MET isoform mutation Link V1092I V1110I Schmidt et al., Oncogene 18:2343-2350, 1999 H1094L H1112L Schmidt et al., Oncogene 18:2343-2350, 1999 H1094R H1112R Schmidt et al., Cancer Research 58:1719-1722, 1998 H1094Y H1112Y Schmidt et al., Oncogene 18:2343-2350, 1999 H1106D H1124D Schmidt et al., Oncogene 18:2343-2350, 1999 D1228H D1246H Bardelli et al., Proc. Natl. Acad. sci. 95: 14379-14383, 2002 D1228N D1246N Bardelli et al., Proc. Natl. Acad. sci. 95: 14379-14383, 2002 Y1230C Y1248C Bardelli et al., Proc. Natl. Acad. sci. 95: 14379-14383, 2002 Y1230D Y1248D Schmidt et al., Oncogene 18:2343-2350, 1999 Y1230H Y1248H Bardelli et al., Proc. Natl. Acad. sci. 95: 14379-14383, 2002 M1250T M1268T Bardelli et al., Proc. Natl. Acad. sci. 95: 14379-14383, 2002

Examples of mutations that alter the c-Met polypeptide sequence to increase the half-life of c-Met kinase (compared to wild-type c-Met kinase) include, but are not limited to, the mutations listed in Table 2 that promote MET exon 14 skipping. during mRNA splicing. Other exemplary mutations that are expected to promote MET exon 14 skipping during mRNA splicing include, but are not limited to, those disclosed in Frampton et al., Cancer Discovery 5(8):850-9, 2015; and Heist et al., Oncologist 21(4):481-6, 2016. The portion of the c-Met protein encoded by exon 14, most prominently Y1003 in the DpYR motif, is required for efficient recruitment of CBL E3 ubiquitin protein ligase, which targets MET for ubiquitin mediated degradation (Lee et al., J. Biol. Chem. 269:19457-61, 1994; Lee et al., Exp. Mol. Med. 38:565-73, 2006; Lee et al., Oncogene 33:34-43, 2014). 14 MET exon skipping upon mRNA splicing results in c-Met kinase, which maintains the reading frame and exhibits increased c-Met protein stability and prolonged signaling upon HGF stimulation, resulting in increased oncogenic potential (Peschard et al., Mol. Cell 8 :995-1004, 2001; Abella et al., Mol. Cell Biol. 25:9632-45, 2005). Other exemplary mutations that alter the sequence of the c-Met polypeptide to increase the half-life of the c-Met kinase include, but are not limited to, an amino acid substitution at Y1003 (e.g., amino acid substitution Y1003F) (Peschard et al., Mol. Cell 8:995 -1004, 2001).

Table 2. Exemplary list of mutations that result in exon 14 MET skipping

chromosomal localization reference sequence Changed sequence ("-" means delete) Link chr7:116411875-116411897 AAGCTCTTTCTTTCTCTCTGTT - Kong-Beltran et al., Cancer Res. 66(1):283-289, 2006 chr7:116412022-116412050 ACCGAGCTACTTTTCCAGAAGGTATATT - Kong-Beltran et al., Cancer Res. 66(1):283-289, 2006 chr7:116412043-116412044 G T Kong-Beltran et al., Cancer Res. 66(1):283-289, 2006 chr7:116411854-116411874 CCCATGATAGCCGTCTTTAA - Onozato et al., J. Thorac. oncol. 4:5-11, 2009. chr7:116411884-116411895 CTTTCTCTCTG - Onozato et al., J. Thorac. oncol. 4:5-11, 2009. chr7:116411886-116411905 TTTCTCTCTGTTTTAAGATC - Onozato et al., J. Thorac. oncol. 4:5-11, 2009. chr7:116412043-116412044 G A Onozato et al., J. Thorac. oncol. 4:5-11, 2009. chr7:116412043-116412044 G T Asaoka et al., Biochem. Biophys. Res. Comm. 394:1042-6, 2010. chr7:116411884-116411896 CTTTCTCTCTGT - Jenkins et al., Clin. Lung Cancer 16:e101-e104, 2015. chr7:116412042-116412043 G C Waqar et al., J. Thorac. oncol. 10:e29-31, 2015. chr7:116412042-116412043 G C Mendenhall et al., J. Thorac. oncol. 10:e23-34, 2015.

Examples of c-Met associated cancers include, but are not limited to, those listed in Table 3.

Table 3 Exemplary c-Met-associated cancers demonstrating increased expression and/or activity of c-Met

type of cancer Type of genetic change Link Cancer of the gastrointestinal tract (GI); stomach cancer Amplification of the MET gene;
Amino acid substitution in the kinase domain (eg amino acid substitution at position 1108, eg amino acid substitution A1108S);
point mutation resulting in skipping of exon 14 MET during mRNA splicing (e.g., chr7:116412043-116412044, G to T mutation) Mo et al., Chronic Dis. Transl. Med. 3(3):148-153, 2017; Tovar et al., Ann. Transl. Med. 5(10):205, 2017; Asaoka et al., Biochem. Biophys. Res. Comm. 394:1042-6, 2010. Colorectal adenocarcinoma amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 1010 (eg amino acid substitution T1010I); amino acid substitution at position 988 (eg, amino acid substitution R988C); amino acid substitution at position 1253 (eg, amino acid substitution Y1253D); and amino acid substitution at position 1248 (e.g. amino acid substitution Y1248H) Zenali et al., Oncoscience 2(5):533-541, 2015. Colorectal Cancer (CRC) Amplification of the MET gene;
overexpression of MET ;
amino acid substitutions in the JM domain of c-Met kinase (eg, amino acid substitution at position 970 (eg, amino acid substitution R970C) and amino acid substitution at position 992 (eg, amino acid substitution T992I) Zeng et al., Cancer Lett. 265:258-269, 2008; Kong-Beltran et al., Cancer Res. 66:283-9, 2006; Tovar et al., Ann. Transl. Med. 5(10):205, 2017. Non-small cell lung cancer (NSCLC) a point mutation resulting in exon 14 MET skipping during mRNA splicing;
Amplification of the MET gene;
amino acid substitutions in the c-Met kinase domain (eg amino acid substitution at position 970 (eg amino acid substitution R970C), amino acid substitution at position 988 (eg amino acid substitution R988C); amino acid substitution at position 1010 (eg amino acid substitution T1010I); amino acid substitution at position 1058 (eg amino acid substitution S1058P));
amino acid substitution at c-Met kinase JM domain (e.g., amino acid substitution at position 988 (e.g., amino acid substitution R988C), amino acid substitution at position 1010 (e.g., amino acid substitution T1010I), amino acid substitution at position 1058 (e.g., amino acid substitution S1058P), amino acid substitution at position 970 (eg amino acid substitution R970C), and amino acid substitution at position 992 (eg amino acid substitution T992I)). Ichimura et al., Jpn J. Cancer Res. 87:1063-1069, 1996; Ma et al., Cancer Res. 63:6272-81, 2003; Kong-Beltran et al., Cancer Res. 66:283-9, 2006; Tovar et al., 2017, Ann. Transl. Med. 5(10):205, 2017 Hepatocellular carcinoma (HCC) Overexpression of MET;
Amino acid substitutions in the c-Met kinase domain (eg, amino acid substitution at position 1191 (eg, amino acid substitution T1191I), amino acid substitution at position 1262 (eg, amino acid substitution J1262R), or amino acid substitution at position 1268 (eg, amino acid substitution M1268T or M1268I)); amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 988 (e.g. amino acid substitution R988C) Goyal et al., Clin. Cancer Res. 19:2310-2318, 2013; Tovar et al., Ann. Transl. Med. 5(10):205, 2017; Zenali et al., Oncoscience 2(5):533-541, 2015 Hereditary papillary kidney cancer (HPRC) Amino acid substitutions in the c-Met kinase domain (eg, amino acid substitution at position 112 (eg, amino acid substitution H112R, H112L, or H112I), amino acid position as position 1230 (eg, amino acid substitution Y1230C, Y1230H, or Y1230D), amino acid substitution at position 1246 (eg amino acid substitution D1246N), amino acid substitution at position 1248 (eg amino acid substitution Y1248C), amino acid substitution at position 1268 (eg amino acid substitution M1268T or amino acid substitution M1268I). Tovar et al., Ann. Transl. Med. 5(10):205, 2017 papillary kidney cancer Amino acid substitutions in the c-Met kinase domain (for example, those listed in Table 1) Jeffers et al., Proc. Natl. Acad. sci. USA 94(21):11445-11450, 1997; Schmidt et al., Nat. Genet. 16:68-73, 1997; Schmidt et al., Oncogene 18:2343-50, 1991. Melanoma amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 988 (eg, amino acid substitution R988C); amino acid substitution at position 1010 (eg amino acid substitution T1010I). Zenali et al., Oncoscience 2(5):533-541, 2015. Adenocarcinoma of the stomach amino acid substitution at position 375 (eg amino acid substitution N375S). Zenali et al., Oncoscience 2(5):533-541, 2015. appendix adenocarcinoma amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 988 (e.g. amino acid substitution R988C) Zenali et al., Oncoscience 2(5):533-541, 2015. Adenocarcinoma of the duodenum amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. Adenocarcinoma of the pancreas amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. lung adenocarcinoma amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 988 (eg, amino acid substitution R988C); amino acid substitution at position 1010 (e.g. amino acid substitution T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. papillary thyroid cancer amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. Medullary thyroid cancer amino acid substitution at position 1010 (e.g. amino acid substitution T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. Ewing's sarcoma amino acid substitution at position 1010 (e.g. amino acid substitution T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. adenocarcinoma of the prostate amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. Squamous cell carcinoma of the head and neck and cervix amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 988 (eg, amino acid substitution R988C); amino acid substitution at position 1010 (e.g. amino acid substitution T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. renal cell carcinoma amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 1092 (eg, amino acid substitution V1092I); amino acid substitution at position 1094 (eg, amino acid substitution H1094L, H1094R, or H1094Y); amino acid substitution at position 1106 (eg, amino acid substitution H1106D); amino acid substitution at position 1228 (eg, amino acid substitution D1228H or D1228N); amino acid substitution at position 1230 (eg, amino acid substitution Y1230C, Y1230D or Y1230H); amino acid substitution at position 1250 (e.g. amino acid substitution M1250T) Zenali et al., Oncoscience 2(5):533-541, 2015; Schmidt et al., Oncogene 18:2343-2350, 1999; Schmidt et al., Cancer Research 58:1719-1722, 1998; Bardelli et al., Proc. Natl. Acad. sci. 95: 14379-14383, 2002. Pheochromocytoma and mixed pheochromocytoma amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 988 (e.g. amino acid substitution R988C) Zenali et al., Oncoscience 2(5):533-541, 2015. Serous ovarian cancer amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 1010 (e.g. amino acid substitution 1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. Clear cell ovarian cancer amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. Mixed ovarian cancer amino acid substitution at position 1010 (e.g. amino acid substitution T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. Serous peritoneal carcinoma amino acid substitution at position 1010 (e.g. amino acid substitution T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. Ductal adenocarcinoma of the breast amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 1010 (eg amino acid substitution T1010I). Zenali et al., Oncoscience 2(5):533-541, 2015. Leiomyosarcoma of the uterus amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 1010 (e.g. amino acid substitution T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. Endometrioid adenocarcinoma of the uterus amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 1010 (eg amino acid substitution T1010I). Zenali et al., Oncoscience 2(5):533-541, 2015. Mixed mesodermal tumor of the uterus amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. Glioblastoma amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. Anaplastic glioma amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. Oligodendroglioma amino acid substitution at position 1010 (e.g. amino acid substitution T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. Desmoplastic small round cell tumor amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. Squamous cell carcinoma of the rectum amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. salivary gland carcinoma amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. Angiosarcoma of the heart amino acid substitution at position 375 (eg amino acid substitution N375S); amino acid substitution at position 1010 (e.g. amino acid substitution T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015. Gastrointestinal stromal tumor (GIST) amino acid substitution at position 1010 (eg amino acid substitution T1010I); amino acid substitution at position 988 (e.g. amino acid substitution R988C) Zenali et al., Oncoscience 2(5):533-541, 2015. Invasive thymoma amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015. spindle sarcoma amino acid substitution at position 375 (e.g. N375S amino acid substitution) Zenali et al., Oncoscience 2(5):533-541, 2015.

In some embodiments, the compounds of formula I can be used to treat c-Met-associated cancer expressing c-Met kinase that is resistant (e.g., at least to some extent compared to wild-type c-Met kinase) to a c-Met inhibitor (eg c-Met type I inhibitor). Non-limiting examples of amino acid substitutions that result in resistance of c-Met to a c-Met inhibitor (e.g., c-Met type I inhibitor) include: amino acid substitution at position 1092 (e.g., amino acid substitution V1092I in c-Met isoform 1 or amino acid substitution V1110I in c-Met isoform 2); amino acid substitution at position 1094 (eg, amino acid substitution H1094L in c-Met isoform 1 or amino acid substitution H1112L in isoform 2 c-Met; amino acid substitution H1094Y in isoform 1 c-Met or amino acid substitution H1112Y in isoform 2 c-Met); amino acid substitution at position 1155 (eg, amino acid substitution V1155L in isoform 1 or amino acid substitution V1173L in isoform 2 of c-Met); amino acid substitution at position 1163 (eg, G1163R amino acid substitution in c-Met isoform 1 or G1181R amino acid substitution in c-Met isoform 2); amino acid substitution at position 1195 (eg, amino acid substitution L1195F in c-Met isoform 1 or amino acid substitution L1213F in c-Met isoform 2; amino acid substitution L1195V in c-Met isoform 1 or amino acid substitution L1213V in c-Met isoform 2); amino acid substitution at position 1200 (eg, amino acid substitution F1200I in isoform 1 of c-Met or amino acid substitution F1218I in isoform 2 of c-Met); amino acid substitution at position 1211 (eg, amino acid substitution M1211L in isoform 1 of c-Met or amino acid substitution M1229L in isoform 2 of c-Met); amino acid substitution at position 1228 (e.g. amino acid substitution D1228A in c-Met isoform 1 or amino acid substitution D1246A in c-Met isoform 2; amino acid substitution D1228G in c-Met isoform 1 or amino acid substitution D1246G in c-Met isoform 2; amino acid substitution D1228H in c-Met isoform 1 or D1246H amino acid substitution in c-Met isoform 2; D1228N amino acid substitution in c-Met isoform 1 or D1246N amino acid substitution in c-Met isoform 2; D1228V amino acid substitution in c-Met isoform 1 or amino acid substitution D1246V in c-Met isoform 2 or amino acid substitution D1228Y in c-Met isoform 1 or amino acid substitution D1246Y in c-Met isoform 2); amino acid substitution at position 1230 (e.g., Y1230C amino acid substitution in c-Met isoform 1 or Y1248C amino acid substitution in c-Met isoform 2; Y1230H amino acid substitution, c-Met isoform 1 amino acid substitution or Y1248H amino acid substitution in c-Met isoform 2; or the Y1230S amino acid substitution in c-Met isoform 1 or the Y1248S amino acid substitution in c-Met isoform 2); or amino acid substitution at position 1250 (eg, amino acid substitution M1250T in isoform 1 of c-Met or amino acid substitution M1268T in isoform 2 of c-Met). Non-limiting examples of type I inhibitors include crizotinib (PF-02341066), capmatinib, NVP-BVU972, AMG 337, bositinib, glumetinib, savolitinib, and tepotinib. In some embodiments, amino acid substitutions that result in c-Met resistance to c-Met type 1 inhibitor include L1195V, F1200I, D1228H, D1228N, Y1230C, Y1230H, and Y1230S.

In some embodiments, compounds of formula I can be used to treat c-Met associated cancer having a chromosomal translocation that results in a fusion protein comprising the c-Met kinase domain, wherein the fusion protein has increased c-Met activity relative to c-Met wild-type kinase (e.g., Met-TPR fusion protein (Rodrigues et al., Mol. Cell. Biol. 13:6711-6722, 1993) and fusion protein/chromosome translocation described in Cooper et al., Nature 311(5981 ):29-33, 1984.

Accordingly, in one embodiment, provided herein is a method of treating a TAM-associated disease or disorder (e.g., TAM-associated cancer), a c-Met-associated disease or disorder (e.g., c-Met-associated cancer), or both, in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof.

Also provided herein are methods of treating a patient identified or diagnosed with TAM associated cancer, c-Met associated cancer, or both, which comprises administering to a patient identified or diagnosed with TAM associated cancer, c-Met associated cancer. , or both, a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof.

Methods for treating a patient with cancer are also provided herein, which include: (a) determining the patient has TAM-associated cancer, c-Met-associated cancer, or both, and (b) administering to a patient who has TAM-associated cancer , c-Met-associated cancer, or both, a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof.

Also provided herein are methods for reducing the risk of developing metastases or additional metastases in a patient identified or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both, which comprises administering to a patient identified or diagnosed with TAM-associated cancer , c-Met-associated cancer, or both, a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, the methods result in a reduction of at least 1% (e.g., a reduction of at least 2%, a reduction of at least 3%, a reduction of at least 4%, a reduction of at least 5%, a reduction at least 6% reduction, at least 8% reduction, at least 10% reduction, at least 12% reduction, at least 14% reduction, at least 16% reduction, at least at least 18% reduction, at least 20% reduction, at least 25% reduction, at least 30% reduction, at least 35% reduction, at least 40% reduction, at least 45%, at least 50% reduction, at least 55% reduction, at least 60% reduction, at least 65% reduction, at least 70% reduction, at least 75% reduction , a reduction of at least 80%, a reduction of at least 85%, a reduction of at least 90%, a reduction of at least 95%, or a reduction at least 99%) of the risk of developing metastases or additional metastases in patients, for example, compared with a population of subjects who have similar TAM-associated cancer and/or c-Met-associated cancer, but receiving other treatment or no treatment.

Also provided are methods for reducing the risk of developing metastases or additional metastases in a cancer patient, which include: (a) determining that the patient has TAM-associated cancer, c-Met-associated cancer, or both; and (b) administering to a patient diagnosed with TAM-associated cancer, c-Met-associated cancer, or both, a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, the methods result in a reduction of at least 1% (e.g., a reduction of at least 2%, a reduction of at least 3%, a reduction of at least 4%, a reduction of at least 5%, a reduction at least 6% reduction, at least 8% reduction, at least 10% reduction, at least 12% reduction, at least 14% reduction, at least 16% reduction, at least at least 18% reduction, at least 20% reduction, at least 25% reduction, at least 30% reduction, at least 35% reduction, at least 40% reduction, at least 45%, at least 50% reduction, at least 55% reduction, at least 60% reduction, at least 65% reduction, at least 70% reduction, at least 75% reduction , a reduction of at least 80%, a reduction of at least 85%, a reduction of at least 90%, a reduction of at least 95%, or a reduction at least 99%) of the risk of developing metastases or additional metastases in patients, for example, compared with a population of subjects who have similar TAM-associated cancer and/or c-Met-associated cancer, but receiving other treatment or no treatment.

Also provided are methods of reducing migration and/or invasion of cancer cells in a patient diagnosed with TAM-associated cancer, c-Met-associated cancer, or both, which comprises administering to a patient diagnosed or diagnosed with TAM-associated cancer, c-Met -associated cancer, or both, a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, the methods result in a reduction of at least 1% (e.g., a reduction of at least 2%, a reduction of at least 3%, a reduction of at least 4%, a reduction of at least 5%, a reduction at least 6% reduction, at least 8% reduction, at least 10% reduction, at least 12% reduction, at least 14% reduction, at least 16% reduction, at least at least 18% reduction, at least 20% reduction, at least 25% reduction, at least 30% reduction, at least 35% reduction, at least 40% reduction, at least 45%, at least 50% reduction, at least 55% reduction, at least 60% reduction, at least 65% reduction, at least 70% reduction, at least 75% reduction , a reduction of at least 80%, a reduction of at least 85%, a reduction of at least 90%, a reduction of at least 95%, or a reduction in at least 99%) of the migration and/or invasion of a cancer cell in a patient, for example, compared with the migration and/or invasion of a cancer cell or population of cancer cells in a subject having a similar TAM-associated cancer and/or c-Met-associated cancer but receiving other treatment or no treatment.

Also provided herein are methods for reducing cancer cell migration and/or invasion in a cancer patient, which include: (a) determining the patient has TAM-associated cancer, c-Met-associated cancer, or both; and (b) administering to a patient diagnosed with TAM-associated cancer, c-Met-associated cancer, or both, a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, the methods result in a reduction of at least 1% (e.g., a reduction of at least 2%, a reduction of at least 3%, a reduction of at least 4%, a reduction of at least 5%, a reduction at least 6% reduction, at least 8% reduction, at least 10% reduction, at least 12% reduction, at least 14% reduction, at least 16% reduction, at least at least 18% reduction, at least 20% reduction, at least 25% reduction, at least 30% reduction, at least 35% reduction, at least 40% reduction, at least 45%, at least 50% reduction, at least 55% reduction, at least 60% reduction, at least 65% reduction, at least 70% reduction, at least 75% reduction , a reduction of at least 80%, a reduction of at least 85%, a reduction of at least 90%, a reduction of at least 95%, or a reduction at least 99%) of the migration and/or invasion of a cancer cell in a patient, for example, compared with the migration and/or invasion of a cancer cell or population of cancer cells in a subject having a similar TAM-associated cancer and/or c-Met-associated cancer but receiving other treatment or no treatment.

Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, any of the examples of additional anticancer agents described herein or known in the art). For example, in some examples, at least one anticancer agent or therapy can be selected from the group: immune checkpoint inhibitor, kinase inhibitor, chemotherapy, radiation therapy, and surgery.

In some embodiments of any of the methods described herein, the patient has previously received treatment with at least one additional anticancer agent (e.g., any of the additional anticancer agents described herein) and prior treatment with at least one additional anticancer agent was unsuccessful. (eg, the patient has previously developed resistance to one or more of the at least one additional anticancer agent).

In some embodiments of any of the methods described herein, at least one additional anticancer agent is selected from the group consisting of: a chemotherapeutic agent, a PI-3 kinase inhibitor, an EGFR inhibitor, a HER2/neu inhibitor, an FGFR inhibitor, an ALK inhibitor , IGF1R inhibitor, VEGFR inhibitor, PDGFR inhibitor, glucocorticoid, BRAF inhibitor, MEK inhibitor, HER4 inhibitor, MET inhibitor (e.g., c-Met kinase type I inhibitor), RAF inhibitor, Akt inhibitor, FTL-3 inhibitor, MAP- kinases.

In some embodiments of any of the methods described herein, at least one additional anticancer agent may include a kinase inhibitor, and the patient has previously developed resistance to the kinase inhibitor. In some embodiments of any of the methods described herein, at least one anticancer agent comprises a kinase inhibitor selected from the group: bositinib, 1-(6,7-dihydro-5H-benzo[6,7]cyclohepta[1, 2-c]pyridazin-3-yl)-N3-[7(S)-(1-pyrrolidinyl)-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl]-1H-1,2, 4-triazol-3,5-diamine (BGB324), crizotinib, foretinib, (N-[4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl]-4-ethoxy-1-(4 -fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (BMS-777607), , amuvatinib, BMS-796302, cabozantinib, glesatinib (MGCD265), 2-(4-fluorophenyl)-N-[3- fluoro-4-(3-phenyl-1H-pyrrolo[2,3-b]pyridin-4-yloxy)phenyl]-1,5-dimethyl-3-oxo-2,3-dihydro-1H-pyrazole-4- carboxamide (NPS-1034), N-[4-[(6,7-dimethoxyquinolin-4-yl)oxy]-3-fluorophenyl]-4-ethoxy-1-(4-fluoro-2-methylphenyl)-1H- pyrazole-3-carboxamide hydrochloride (LDC1267), gilteritinib, [3-(2-[[3-fluoro-4-(4-methylpiperazin-1-yl)phenyl]amino]-5-methyl-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)phenyl]acetonitrile (SGI-7079), duber matinib (TP-0903), trans-4-[2-(butylamino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]-7H-pyrrolo[2,3-d]pyrimidine- 7-yl]cyclohexanol (UNC2025), 3-[3-[4-(Morpholin-4-ylmethyl)-1H-pyrrol-2-ylmethylene]-2-oxo-2,3-dihydro-1H-indol-5- ylmethyl]thiazolidin-2,4-dione hydrochloride (S49076), sunitinib, 12A11, Mab173, YW327.6S2, D9, E8, merestinib, , [3-(2-[[3-fluoro-4-(4-methylpiperazin- 1-yl)phenyl]amino]-5-methyl-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl]acetonitrile (SGI-7079), , N-[4-[(6,7- dimethoxyquinolin-4-yl)oxy]-3-fluorophenyl]-4-ethoxy-1-(4-fluoro-2-methylphenyl)-1H-pyrazole-3-carboxamide hydrochloride, capmatinib, NVP-BVU972, AMG 337, bositinib, glumetinib, savolitinib and tepotinib.

In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises dexamethasone and the patient has previously developed resistance to dexamethasone. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises cytarabine and the patient has previously developed resistance to cytarabine. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises imatinib and the patient has previously developed resistance to imatinib. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises lapatinib and the patient has previously developed resistance to lapatinib. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises cetuximab and the patient has previously developed resistance to cetuximab. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises erlotinib and the patient has previously developed resistance to erlotinib. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises alpelisib and the patient has previously developed resistance to alpelisib. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises cisplatin and the patient has previously developed resistance to cisplatin. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises sunitinib and the patient has previously developed resistance to sunitinib. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises metformin and the patient has previously developed resistance to metformin.

In some embodiments of any of the methods described herein, at least one additional anti-cancer agent comprises an anti-PD1 antibody and the patient has previously developed resistance to the anti-PD1 antibody. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises docetaxel and the patient has previously developed resistance to docetaxel. In some embodiments of any of the methods described herein, at least one additional anticancer agent comprises an EGFR inhibitor and the patient has already developed resistance to the EGFR inhibitor.

In some embodiments of any of the methods described herein, at least one additional anticancer agent is a type 1 c-Met inhibitor and the patient has already developed resistance to the c-Met inhibitor. In some embodiments of any of the methods described herein, the at least one additional c-Met type 1 inhibitor comprises crizotinib and the patient has previously developed resistance to crizotinib. In some embodiments of any of the methods described herein, the at least one additional c-Met type 1 inhibitor comprises capmatinib and the patient has previously developed resistance to capmatinib. In some embodiments of any of the methods described herein, at least one additional type 1 c-Met inhibitor comprises NVP-BVU972 and the patient has previously developed resistance to NVP-BVU972. In some embodiments of any of the methods described herein, at least one additional c-Met type 1 inhibitor comprises AMG 337 and the patient has previously developed resistance to AMG 337. In some embodiments of any of the methods described herein , at least one additional c-Met type 1 inhibitor includes bositinib, and the patient has previously developed resistance to bositinib. In some embodiments of any of the methods described herein, the at least one additional c-Met type 1 inhibitor comprises glumetinib and the patient has previously developed resistance to glumetinib. In some embodiments of any of the methods described herein, the at least one additional c-Met type 1 inhibitor comprises savolitinib and the patient has previously developed resistance to savolitinib. In some embodiments of any of the methods described herein, the at least one additional c-Met type 1 inhibitor comprises tepotinib and the patient has previously developed resistance to tepotinib.

In some embodiments, the tumor has developed a resistance mutation after treatment with a c-Met type 1 inhibitor. In some embodiments, the resistance mutation in c-Met results in the expression of a c-Met protein comprising one or more of the following amino acid substitutions: L1195V, F1200I, D1228H, D1228N, D1230C, Y1230H and Y1230S.

Also provided herein are methods for selecting treatment for a patient who has been identified or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both, which comprises selecting a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof for the patient. , which is defined or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both. Some embodiments further include administering to a patient a selected compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof.

Also provided herein are methods for selecting treatment for a patient, which include: (a) determining the patient has TAM-associated cancer, c-Met-associated cancer, or both; and (b) selecting a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, for a patient diagnosed with TAM-associated cancer, c-Met-associated cancer, or both. Some embodiments further include administering the selected compound of Formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, to a patient diagnosed with TAM-associated cancer, c-Met-associated cancer, or both.

In some embodiments of any of the methods described herein, the subject is identified or diagnosed with a TAM-associated cancer (e.g., any of the TAM-associated cancers described herein, for example, having any of the exemplary TAM mutations described herein). document). In some embodiments of any of the methods described herein, the subject is identified or diagnosed as having a TAM-associated cancer (e.g., any of the TAM-associated cancers described herein, e.g., having any of the typical TAM mutations described herein) and c-Met-associated cancer (eg, any of the typical c-Met-associated cancers described herein, eg, having any of the typical c-Met mutations described herein). In some embodiments of any of the methods described herein, the subject is identified or diagnosed with c-Met-associated cancer (e.g., any of the typical c-Met-associated cancers described herein, for example, having any of the typical mutations c-Met described in this document).

In some embodiments of any of the methods described herein, c-Met-associated cancer is a cancer having a mutation that increases c-Met kinase activity. In some embodiments of any of the methods described herein, a mutation that increases the activity of c-Met kinase results in one or more amino acid substitutions in the c-Met kinase. In some embodiments of any of the methods described herein, c-Met-associated cancer is a cancer having a mutation that increases c-Met expression in a mammalian cell. In some embodiments of any of the methods described herein, c-Met-associated cancer is a cancer having a mutation that provides an increased half-life of c-Met kinase in a mammalian cell. In some embodiments of any of the methods described herein, the mutation that results in an increased half-life of c-Met kinase in a mammalian cell is a mutation that results in c-Met exon 14 skipping during mRNA splicing. In some embodiments of any of the methods described herein, the c-Met-associated cancer is a cancer having an amplification of the MET gene. In some embodiments of any of the methods described herein, the c-Met-associated cancer is a c-Met-associated cancer that is resistant to a c-Met type I inhibitor.

In some embodiments of any of the methods described herein, the c-Met-associated cancer is selected from the group: gastrointestinal (GI) cancer, gastric cancer, colorectal adenocarcinoma, colorectal cancer (CRC), non-small cell lung cancer (NSCLC) , hepatocellular carcinoma (HCC), hereditary papillary renal cell carcinoma (HPRC), papillary renal carcinoma, melanoma, gastric adenocarcinoma, appendix adenocarcinoma, duodenal adenocarcinoma, pancreatic adenocarcinoma, lung adenocarcinoma, papillary thyroid carcinoma, medullary thyroid carcinoma , Ewing's sarcoma, adenocarcinoma of the prostate, squamous cell carcinoma of the head and neck and cervix, renal cell carcinoma, pheochromocytoma and mixed pheochromocytoma, serous ovarian cancer, clear cell ovarian cancer, mixed ovarian cancer, serous peritoneal carcinoma, ductal breast adenocarcinoma, uterine leiomyosarcoma , endometrioid adenoid uterine carcinoma, mixed mesodermal uterine tumor, glioblastoma, anaplastic glioma, oligodendroglioma, desmoplastic small round cell tumor, rectal squamous cell carcinoma, salivary gland carcinoma, cardiac angiosarcoma, gastrointestinal stromal tumor, invasive thymoma, and spindle sarcoma.

Also provided herein are methods for selecting treatment for a patient who has been identified or diagnosed with cancer, which includes: (a) administering to the patient at least one additional anticancer agent (eg, any of the additional anticancer agents described herein); (b) after (a), detection of increased expression, level and/or activity of TAM kinase and/or c-Met kinase in the patient's cancer cell or immune cell; and (c) after (b), selecting a compound of formula I or a pharmaceutically acceptable salt or pharmaceutical composition thereof for the patient.

Methods for treating a patient identified or diagnosed with cancer are also provided herein, which include: (a) administering to the patient identified or diagnosed with cancer one or more doses of at least one additional anticancer agent (e.g., at least one from any additional anticancer agents described herein); (b) after (a), determining an increase in the expression, level and/or activity of TAM kinase and/or c-Met kinase in the patient's cancer cell or immune cell; and (c) after (b), administering to the patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, step (c) further comprises administering to the patient at least one additional anticancer agent.

Also provided herein are methods for treating a patient in whom cancer has been identified or diagnosed, which includes: (a) determining an increase in the expression, level, and/or activity of TAM kinase and/or c-Met kinase in a cancer cell or immune cell from a patient, in who has been identified or diagnosed with cancer and who has previously received one or more doses of at least one additional anticancer agent (eg, any of the additional anticancer agents described herein); and (b) after (a), administering to the patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, step (b) further comprises administering to the patient at least one additional anticancer agent.

Also provided herein are methods of treating a patient who has been identified or diagnosed with cancer, who has previously received one or more doses of at least one additional anticancer agent, and who has been identified as having a cancer cell or immune cell that is overexpressed, leveled and/or TAM kinase and/or c-Met kinase activity, which comprises administering a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, to a patient. In some embodiments, the method further comprises administering to the patient at least one additional anticancer agent.

Also provided herein are methods of treating a patient who has been identified or diagnosed with cancer, which includes: (a) selecting a patient who is identified or diagnosed with increased expression, level, and/or activity of TAM kinase and/or c-Met kinase in the cancer cell, or immune cell; and (b) after (a) administering to the selected patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, step (b) further comprises administering to the patient at least one additional anticancer agent (eg, any of the additional anticancer agents described herein).

Methods of treating a patient identified or diagnosed with cancer are also provided, which include: (a) selecting a patient identified or diagnosed with cancer who has previously received one or more doses of an additional anticancer agent (e.g., any of the additional anticancer agents described herein) and which has been identified as a cancer cell or immune cell having increased expression, level and/or activity of TAM kinase and/or c-Met kinase; and (b) after (a), administering to the selected patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, step (b) further comprises administering to the patient at least one additional anticancer agent.

In some embodiments of any of the methods described herein, increased expression, level and/or activity of TAM kinase is determined in a cancer cell or immune cell. In some embodiments of any of the methods described herein, the patient is identified or diagnosed with a cancer cell or immune cell having increased expression, level and/or activity of TAM kinase.

In some embodiments of any of the methods described herein, increased expression, level and/or activity of TAM kinase and c-Met kinase is determined in a cancer cell or immune cell. In some embodiments of any of the methods described herein, the patient is identified or diagnosed with a cancer cell or immune cell having increased expression, level and/or activity of TAM kinase and c-Met kinase.

In some embodiments of any of the methods described herein, the increased expression, level and/or activity of TAM kinase in a cancer cell or immune cell is the result of a chromosomal translocation that results in the expression of a TREM87B-MERTK fusion protein or an AXL-MBIP fusion protein.

In some embodiments of any of the methods described herein, increased expression, level and/or activity of c-Met kinase is determined in a cancer cell or immune cell. In some embodiments of any of the methods described herein, the patient is identified or diagnosed with a cancer cell or immune cell having increased expression, level and/or activity of c-Met kinase.

Also provided are methods of treating a patient identified or diagnosed with TAM-associated cancer, which include: (a) administering to a patient identified or diagnosed with TAM-associated cancer, one or more doses of a TAM kinase inhibitor; (b) after (a), determining the resistance of the patient's TAM-associated cancer to a TAM kinase inhibitor; and (c) after (b), administering to the patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, step (c) further comprises administering to the patient at least one additional anticancer agent (eg, any of the additional anticancer agents described herein).

Also provided are methods of treating a patient who has been identified or diagnosed with TAM-associated cancer, which includes: (a) determining the resistance of the TAM-associated cancer in the patient to a TAM kinase inhibitor that has previously been administered to the patient; and (b) after (a), administering to the patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, step (b) further comprises administering to the patient at least one additional anticancer agent.

Also provided herein are methods of treating a patient who has been identified or diagnosed with TAM-associated cancer and who has already developed resistance to a TAM kinase inhibitor, which comprises administering to the patient a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. . Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, any of the additional anticancer agents described herein or known in the art).

Also provided herein are methods of treating a patient identified or diagnosed with c-Met associated cancer which comprises: (a) administering to a patient identified or diagnosed with c-Met associated cancer one or more doses of a c- met; (b) after (a), determining the resistance of c-Met-associated cancer in a patient to a c-Met kinase inhibitor; and (c), after (b), administering to the patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, any of the additional anticancer agents described herein or known in the art). In one embodiment, the c-Met inhibitor administered in step (a) is a type I c-Met inhibitor. In one embodiment, the c-Met type 1 c-Met inhibitor is crizotinib, capmatinib, NVP-BVU972, AMG 337, bositinib, glumetinib, savolitinib, or tepotinib.

Also provided herein are methods of treating a patient who has been identified or diagnosed with c-Met associated cancer, which includes: (a) determining the resistance of the c-Met associated cancer in the patient to a c-Met kinase inhibitor that has previously been administered to the patient ; and (b) after (a), administering to the patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments of these methods, step (b) further comprises administering at least one additional anticancer agent to the patient. In one embodiment, the c-Met inhibitor administered in step (a) is a c-Met type I inhibitor. In one embodiment, the c-Met type 1 inhibitor is crizotinib, capmatinib, NVP-BVU972, AMG 337, bositinib , glumetinib, savolitinib, or tepotinib.

Also provided herein are methods of treating a patient who has been identified or diagnosed with c-Met associated cancer and has already developed resistance to a c-Met kinase inhibitor, which comprises administering to the patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or its pharmaceutical composition. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent. In one embodiment, the patient has developed resistance to a type I c-Met inhibitor. In one embodiment, the type 1 c-Met inhibitor is crizotinib, capmatinib, NVP-BVU972, AMG 337, bositinib, glumetinib, savolitinib, or tepotinib.

In some embodiments of any of the methods described herein, the step of determining a patient as having TAM-associated cancer and/or c-Met-associated cancer comprises performing analysis of a biopsy sample obtained from the patient. In some embodiments, the assay is selected from the group of sequencing, immunohistochemistry, enzyme-linked immunosorbent assay, and fluorescence in situ hybridization (FISH). In some embodiments, the assay is selected from the group: denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), temperature gradient capillary electrophoresis, single strand conformational polymorphism assay, molecular beacon assay, dynamic hybridization assay, PCR based assay and denaturing high performance liquid chromatography. Some embodiments of these methods may further include obtaining a biopsy sample from a patient.

In some embodiments of any of the methods described herein, the compound of Formula I is selected from the compounds described in Example Nos. 1-201, or their pharmaceutically acceptable salts. In some embodiments, a compound of Formula I is selected from i) Example No. 1-20; ii) Example No. 21-40; iii) Example No. 41-60; iv) Example No. 61-80; v) Example No. 81-100; vi) Example No. 101-120; vii) Example No. 121-140; viii) example no. 141-160; ix) Example No. 161-180; x) Example No. 181-201 or its pharmaceutically acceptable salts.

The compounds and methods described herein are useful in the treatment of tumors and cancers (eg, TAM-associated cancers and/or c-Met-associated cancers). The TAM-associated cancer and/or c-Met-associated cancer being treated may be a primary tumor or a metastatic tumor. In one aspect, the methods described herein are used to treat a solid TAM-associated tumor, e.g., melanoma, lung cancer (including lung adenocarcinoma, basal cell carcinoma, squamous cell carcinoma, large cell carcinoma, bronchioloalveolar carcinoma, bronchiogenic carcinoma, non-small cell carcinoma, small cell carcinoma , mesothelioma); breast cancer (including ductal carcinoma, lobular carcinoma, infiltrative breast cancer, clear cell carcinoma, mucinous carcinoma, carcinoma of the serous cavities of the breast); colorectal cancer (colon cancer, rectal cancer, colorectal adenocarcinoma); anal cancer; pancreatic cancer (including pancreatic adenocarcinoma, islet cell cancer, neuroendocrine tumors); prostate cancer; adenocarcinoma of the prostate; urinary tract cancer; ovarian cancer or carcinoma (ovarian epithelial carcinoma or superficial epithelial stromal tumor including serous tumor, endometrioid tumor and mucinous cystadenocarcinoma); cancer of the liver and bile ducts (including hepatocellular carcinoma, cholangiocarcinoma, hemangioma); esophageal carcinoma or cancer (including esophageal adenocarcinoma and squamous cell carcinoma); squamous cell carcinoma of the oral cavity and oropharynx; adenoid-cystic cancer of the salivary glands: bladder cancer; bladder carcinomas; uterine cancer (including endometrial cancer or endometrial adenocarcinoma, ocular, papillary serous uterine carcinoma, uterine clear cell carcinoma, uterine sarcomas and leiomyosarcomas, mixed Mullerian tumors); glioma, glioblastoma, medulloblastoma and other brain tumors; kidney cancer (including kidney cancer, renal cell carcinoma, renal cell carcinoma, Wilm's tumor); pituitary adenomas; head and neck cancer (including squamous cell carcinomas); gastric cancer (gastric cancer, gastric adenocarcinoma, gastrointestinal stromal tumor (GIST)); testicular cancer; embryonic cell tumor; neuroendocrine tumor; cervical cancer; carcinoids of the gastrointestinal tract, breast and other organs; mucus-forming cancer; mesenchymal tumors, including sarcomas (eg, Kaposi's sarcoma), fibrosarcomas, hemangioma, angiomatosis, hemangiopericytoma, pseudoangiomatous stromal hyperplasia, myofibroblastoma, fibromatosis, inflammatory myofibroblastic tumor, lipoma, angiolipoma, granular cell tumor, neurofibroma, schwannoma, liposarcoma, angiosarcoma , osteosarcoma, leiomyoma, leiomyosarcoma, skin (eg, squamous cell skin cancer), including melanoma, cervix, retinoblastoma, head and neck, pancreas, brain, thyroid, testicle, kidney, bladder, soft tissue, adrenal, urethra , penile cancer, myxosarcoma, chondrosarcoma, osteosarcoma, chordoma, malignant fibrous histiocytoma, lymphangiosarcoma, mesothelioma, squamous cell carcinoma; epidermoid cancer, malignant tumors of the skin appendages, adenocarcinoma, hepatoma, hepatocellular carcinoma, renal cell carcinoma, hypernephroma, cholangiocarcinoma, transitional cell carcinoma, choriocarcinoma, seminoma, embryonic cell carcinoma, anaplastic glioma; glioblastoma multiforme, neuroblastoma, medulloblastoma, malignant meningioma, malignant schwannoma, neurofibrosarcoma, parathyroid carcinoma, medullary thyroid carcinoma, bronchial carcinoid, pheochromocytoma, islet cell carcinoma, malignant carcinoid, malignant paraganglioma, melanoma, Merkel cell neoplasm, cystosarcoma foliaceus, carcinoma salivary glands, thymus cancer, and vaginal cancer among others.

The compounds of formula I, or pharmaceutically acceptable salts thereof, may also be used to treat lymphoma or a disorder or disorder of lymphocytic or myelocytic proliferation (eg TAM-associated lymphoma or a disorder or disorder of lymphocytic or myelocytic proliferation). For example, TAM-associated cancer may be Hodgkin's lymphoma or non-Hodgkin's lymphoma. For example, the subject may be suffering from TAM-associated non-Hodgkin's lymphoma, such as, but not limited to: AIDS-associated lymphoma; anaplastic large cell lymphoma; angioimmunoblastic lymphoma; blast N-cell lymphoma; Burkitt's lymphoma: Burkitt-like lymphoma (small cell lymphoma with undissected nuclei); chronic lymphocytic leukemia/small lymphocytic lymphoma: cutaneous T-cell lymphoma; diffuse B-large cell lymphoma; T-cell lymphoma of entropatic type; follicular lymphoma; hepatosplenic gamma-delta T-cell lymphoma; lymphoblastic lymphoma: mantle cell lymphoma; marginal zone lymphoma; nasal T-cell lymphoma; pediatric lymphoma; peripheral T-cell lymphomas; primary lymphoma of the central nervous system; T-cell leukemias; transformed lymphomas; treatment-related T-cell lymphomas; or Waldenström's macroglobulinemia.

Alternatively, the subject may suffer from TAM-associated Hodgkin's lymphoma, such as, but not limited to: nodular sclerosis of classical Hodgkin's lymphoma (CHL); mixed cellularity CHL; lymphopenia CHL; CHL high in lymphocytes; Hodgkin's lymphoma with lymphoid predominance; or HL with a predominance of nodular lymphocytes.

In one embodiment, the methods described herein may be useful for treating a patient suffering from a particular TAM-associated T-cell, B-cell, or NK-cell lymphoma, proliferative disorder, or disorder. For example, a patient may be suffering from a particular TAM-associated T-cell or NK-cell lymphoma, such as, but not limited to, peripheral T-cell lymphoma, such as peripheral T-cell lymphoma and peripheral T-cell lymphoma, unspecified (PTCL- NOS); anaplastic large cell lymphoma, for example, positive anaplastic lymphoma kinase (ALK). ALK-negative anaplastic large cell lymphoma, mantle cell lymphoma, or primary anaplastic large cell lymphoma of the skin; angioimmunoblastic lymphoma; cutaneous T-cell lymphoma, eg, mycosis fungoides, Cesari's syndrome, primary anaplastic large cell lymphoma of the skin, primary CD30+ T-cell lymphoproliferative skin disease; primary cutaneous aggressive epidermotropic CD8+ cytotoxic T-cell lymphoma; primary cutaneous gamma delta T cell lymphoma; primary cutaneous CD4+ small/large cell T-cell lymphoma and lymphomatoid papulosis; adult T-cell leukemia/lymphoma (ATLL); blast NK-cell lymphoma: T-cell lymphoma of the enteropathic type; hepatosplenic gamma-delta T-cell lymphoma: lymphoblastic lymphoma; nasal NK/T-cell lymphomas; treatment-related T-cell lymphomas; for example, lymphomas that appear after transplantation of a solid organ or bone marrow; T-cell prolymphocytic leukemia; T-cell large granular lymphocytic leukemia; chronic lymphoproliferative disease of NK cells; aggressive NK cell leukemia; systemic EBV+ T-cell lymphoproliferative disease of childhood (associated with chronic active EBV infection); lightpox-like lymphoma; adult T-cell leukemia/lymphoma; T-cell lymphoma associated with enteropathy; hepatosplenic T-cell lymphoma; or subcutaneous panniculitis-like T-cell lymphoma.

In one embodiment, the methods described herein may be useful for treating a patient suffering from a specific TAM-associated B-cell lymphoma or proliferative disorder such as, but not limited to: multiple myeloma; diffuse B-large cell lymphoma; follicular lymphoma; mucosal associated lymphoid tissue (MALT) lymphoma; small cell lymphocytic lymphoma; mantle cell lymphoma (MCL); Burkitt's lymphoma; mediastinal B-large cell lymphoma; macroglobulinemia Waldenström; nodular B-cell marginal zone lymphoma (NMZL); splenic marginal zone lymphoma (SMZL); intravascular large B-cell lymphoma; primary effusion lymphoma; or lymphogranulomatosis; chronic lymphocytic leukemia/small cell lymphocytic lymphoma; B-cell prolymphocytic leukemia; hairy cell leukemia; lymphoma/leukemia of the spleen, not classifiable; diffuse small cell B-cell lymphoma of the red pulp of the spleen; hairy cell leukemia variant; lymphoplasmacytic lymphoma; heavy chain diseases, eg, alpha heavy chain disease, gamma heavy chain disease, Mu heavy chain disease; plasma cell myeloma; solitary plasmacytoma of the bone; extraosseous plasmacytoma; primary skin lymphoma of the follicular center; B-large cell lymphoma, rich in cells / histiocytes; DLBCL associated with chronic inflammation; Epstein-Barr virus (EBV) + DLBCL in the elderly; primary B-large cell lymphoma of the mediastinum (thymus); primary dermal DLBCL, foot type; ALK+ B-large cell lymphoma; plasmablastic lymphoma; B-large cell lymphoma arising from HHV8-associated multifocal; Castleman's disease; Unclassifiable B-cell lymphoma with characteristics intermediate between diffuse large B-cell lymphoma and Burkitt's lymphoma; Unclassifiable B-cell lymphoma with characteristics intermediate between diffuse large B-cell lymphoma and classical Hodgkin's lymphoma; nodular sclerosis of classic Hodgkin's lymphoma; Classical Hodgkin's lymphoma with a high content of lymphocytes; classic Hodgkin's lymphoma with mixed cell variant; or classic Hodgkin's lymphoma with lymphoid depletion.

In one embodiment, the methods described herein may be useful for treating a patient suffering from TAM-associated leukemia. For example, the subject may suffer from acute or chronic TAM-associated leukemia of lymphocytic or myelogenous origin, such as, but not limited to: acute lymphoblastic leukemia (ALL); acute myelogenous leukemia (AML); chronic lymphocytic leukemia (CLL); chronic myeloid leukemia (CML); Juvenile myelomonocytic leukemia (JMML); hairy cell leukemia (HCL); acute promyelocytic leukemia (AML subtype); T-cell prolymphocytic leukemia (TPLL); leukemia from large granular lymphocytes; or chronic T-cell leukemia in adults; leukemia from large granular lymphocytes (LGL). In one embodiment, the patient is suffering from acute myelogenous leukemia, such as undifferentiated AML (MO); myeloid leukemia (Ml; with/without minimal cell maturation); myeloid leukemia (M2; with cell maturation); promyelocytic leukemia (M3 or M3 variant [M3V]); myelomonocytic leukemia (M4 or M4 variant with eosinophilia [M4E]); monocytic leukemia (M5); erythroleukemia (M6); or megakaryoblastic leukemia (M7).

In one embodiment, the compounds and methods described herein are useful for treating TAM-associated cancer in a patient in which the cancer overexpresses AXL, MER, or TYRO3, or a combination thereof, e.g., when compared to a control non-cancerous tissue or control cell ( e.g. from the same or another subject). In one embodiment, the cancer overexpresses AXL. In one embodiment, the cancer overexpresses MER. In an alternative embodiment, the cancer ectopically expresses MER. In one embodiment, the TAM-associated cancer is breast, colon, kidney, skin, lung (including non-small cell lung cancer), liver, stomach, brain (including glioblastoma), ovary, pancreas, prostate, glioblastoma multiforme, osteosarcoma, malignant neoplasms of the thyroid gland, rhabdomyosarcoma, melanoma. acute myeloid leukemia, acute T-cell lymphoid leukemia, B-cell acute lymphoid leukemia, schwannoma and mantle cell lymphoma.

In one embodiment, the TAM-associated cancer is selected from breast, colon, kidney, skin, lung (including non-small cell lung cancer), liver, stomach, brain (including glioblastoma), ovary, pancreas, prostate, glioblastoma multiforme, osteosarcomas, thyroid malignancies, rhabdomyosarcomas, and melanomas.

In one embodiment, the TAM-associated cancer is selected from leukemias (including acute myeloid leukemia and chronic myeloid leukemia, B-cell myeloid leukemia (B-CLL), B-cell acute lymphoblastic leukemia, erythroid leukemia, and T-cell acute lymphoblastic leukemia), non-small cell lung cancer, pancreatic ductal adenocarcinoma, astrocytoma, lung adenocarcinoma, ovarian cancer, melanoma and glioblastoma multiforme.

In one embodiment, the TAM-associated cancer is selected from chronic myeloid leukemia, gastrointestinal stromal tumors (GIST), breast cancer (e.g., HER2 positive breast cancer and triple negative breast cancer), head and neck cancer, and non-small cell lung cancer. .

In some embodiments of any of the methods described herein, a TAM-associated cancer is a cancer having TAM kinase overexpression, for example, compared to a non-cancerous tissue or cell in the same patient or another subject. In some embodiments of any of the methods described herein, the TAM-associated cancer is cancer having ectopic expression of TAM kinase.

In some embodiments of any of the methods described herein, the TAM-associated cancer is a cancer having overexpression or ectopic expression of the TYRO3 protein. In some embodiments of any of the methods described herein, the TAM-associated cancer has one or more point mutations in the gene encoding TYRO3 that results in TYRO3 expression that includes one or more amino acid substitutions. In some embodiments of any of the methods described herein, the TAM-associated cancer has a chromosomal translocation that results in the expression of a fusion protein, including the TYRO3 kinase domain and a fusion partner. Non-limiting examples of TAM-associated cancers having overexpression or ectopic expression of TYRO3, or a mutation in the TYRO3 gene that results in the expression of TYRO3 having one or more point mutations, or a TYRO3 fusion protein, include: AML, multiple myeloma, lung cancer, melanoma, prostate cancer, endometrial cancer, thyroid cancer, schwannomas, pancreatic cancer, and brain cancer. Non-limiting aspects of TAM-associated cancers with increased TYRO3 expression and/or activity are listed in Table 4.

Table 4 Types of TAM-associated cancers with increased expression and/or activity of TYRO3

Melanoma Amino acid substitutions in: Q67 and/or R462Q and/or W708fs*5 Lungs' cancer Amino acid substitution in E340 or N615K in TYRO3 pancreas cancer Amino acid substitution R514Q in TYRO3 colon cancer Amino acid substitution of G809D and/or M592I in TYRO3 brain cancer Amino acid substitution A709T in TYRO3 AML, multiple myeloma, lung cancer, melanoma, prostate cancer, endometrial cancer, thyroid cancer and schwannoma Overexpression or ectopic expression of TYRO3

Additional anti-cancer agents that are TYRO3 inhibitors include, for example, 6g, merestinib (LY2801653), ASLAN002 (BMS-777607; (N-[4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl ]-4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide), LDC1267 (N-[4-[(6,7-dimethoxyquinolin-4-yl)oxy] -3-fluorophenyl]-4-ethoxy-1-(4-fluoro-2-methylphenyl)-1H-pyrazole-3-carboxamide hydrochloride, and UNC2025 (trans-4-[2-(butylamino)-5-[4- [(4-methylpiperazin-1-yl)methyl]phenyl]-7H-pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexanol).

In some embodiments of any of the methods described herein, the TAM-associated cancer is a cancer having overexpression or ectopic expression of the AXL protein. In some embodiments of any of the methods described herein, the TAM-associated cancer has one or more point mutations in the gene encoding AXL that results in AXL expression that includes one or more amino acid substitutions. In some embodiments of any of the methods described herein, the TAM-associated cancer has a chromosomal translocation that results in the expression of a fusion protein, including the AXL kinase domain and a fusion partner. Non-limiting examples of TAM-associated cancers having overexpression or ectopic expression of AXL, or a mutation in the AXL gene that results in the expression of AXL having one or more point mutations, or an AXL fusion protein, include: AML, CML, B-CLL, lung cancer , glioblastoma, breast cancer, colorectal cancer, gastric cancer, pancreatic cancer, esophageal cancer, melanoma, squamous cell skin cancer, prostate cancer, endometrial cancer, ovarian cancer, oral squamous cell carcinoma, thyroid cancer, bladder cancer, cancer kidney, schwannomas, mesothelioma, Kaposi's sarcoma, osteosarcoma, erythroid leukemia, colon cancer, liver cancer, renal cell carcinoma, osteosarcoma, kidney cancer, PH+ CML, non-small cell lung cancer, triple-negative metastatic breast cancer, and HER2+ breast cancer . Non-limiting aspects of TAM-associated cancer types with increased AXL expression and/or activity are listed in Table 5.

Table 5. Types of TAM-associated cancers with increased expression and/or activity of AXL

ovarian cancer amino acid substitutions C24G and/or A358V in AXL melanoma One or more amino acid substitutions P36L, R236C, G413W, E431K, A451T, E535K, G829E, I610V, A666T, S685F, and R784Q in AXL colon cancer One or more amino acid substitutions N43T, M580K, and L684P in AXL Skin cancer Amino acid substitution for P238L in AXL stomach cancer One or more amino acid substitutions V289M, R492C, S842F, and P636H in AXL Lungs' cancer One or more amino acid substitutions R295W, L423Q, K526N, and S599F in AXL Mammary cancer One or more T343M, E745K, and S747R amino acid substitutions in AXL prostate cancer Amino acid substitution for R368Q in AXL pancreas cancer Amino acid substitution for E484D in AXL kidney cancer Amino acid substitution for P742T in AXL AML, CML, B-CLL, lung cancer, glioblastoma, breast cancer, colorectal cancer, gastric cancer, pancreatic cancer, esophageal cancer, melanoma, skin squamous cell carcinoma, prostate cancer, endometrial cancer, ovarian cancer, oral squamous cell carcinoma , thyroid cancer, bladder cancer, kidney cancer, schwannoma, mesothelioma, Kaposi's sarcoma and osteosarcoma Overexpression or ectopic expression of AXL

Additional anticancer agents that are AXL inhibitors include, for example, bositinib (SKI-606, PF-5208765, Bosulif), bemcentinib (BGB324; R428), crizotinib (PF-2341066, Xalkon), foretinib (GSK1363089, XL880), (N-[4-(2-Amino-3-chloropyridin-4-yloxy)-3-fluorophenyl]-4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (BMS-777607; ASLAN002), LY2801653 (merestinib), amuvatinib (MP-470), cabozantinib (XL184, BMS-907351, Cometriq), glesatinib (MGCD265), NPS-1034 (2-(4-fluorophenyl)-N- [3-fluoro-4-(3-phenyl-1H-pyrrolo[2,3-b]pyridin-4-yloxy)phenyl]-1,5-dimethyl-3-oxo-2,3-dihydro-1H-pyrazole -4-carboxamide), LDC1267 (N-[4-[(6,7-dimethoxyquinolin-4-yl)oxy]-3-fluorophenyl]-4-ethoxy-1-(4-fluoro-2-methylphenyl)-1H -pyrazole-3-carboxamide hydrochloride), gilteritinib (ASP2215), SGI-7079 ([3-(2-[[3-fluoro-4-(4-methylpiperazin-1-yl)phenyl]amino]-5-methyl- 7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl]acetonitrile), dubermatinib (TP-0903), trans-4-[2-(butylamino)-5-[4-[(4-methylpiperazin- 1-yl)methyl]fe nyl]-7H-pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexanol (UNC2025), 3-[3-[4-(Morpholin-4-ylmethyl)-1H-pyrrol-2-ylmethylene]-2 -oxo-2,3-dihydro-1H-indol-5-ylmethyl]thiazolidin-2,4-dione hydrochloride (S49076), sunitinib (SU11248, Sutent), and monoclonal antibodies 12A11, Mab173, YW327.6S2, D9, and E8.

In some embodiments of any of the methods described herein, the TAM-associated cancer is a cancer having overexpression or ectopic expression of the MER protein. In some embodiments of any of the methods described herein, the TAM-associated cancer has one or more point mutations in the gene encoding MER that results in MER expression that includes one or more amino acid substitutions. In some embodiments of any of the methods described herein, the TAM-associated cancer has a chromosomal translocation that results in the expression of a fusion protein, including the MER kinase domain and a fusion partner. Non-limiting examples of TAM-associated cancers having overexpression or ectopic expression of MER, or a mutation in the MER gene that results in the expression of MER having one or more point mutations, or a MER fusion protein, include: AML, ALL (B-ALL, T- ALL), lung cancer, glioma, melanoma, prostate cancer, schwannomas, mantle cell lymphoma, rhabdomyosarcoma, pancreatic cancer, breast cancer, gastric cancer, pituitary adenoma, urinary tract cancer, kidney cancer, liver cancer, colon cancer and cancer mammary gland. Non-limiting aspects of the types of MER-associated cancers with increased MER expression and/or activity are listed in Table 6.

Table 6 Types of TAM-associated cancers with increased MER expression and/or activity

melanoma One or more P40S, V861I, K923R, and P802S amino acid substitutions in MER Lungs' cancer One or more amino acid substitutions S159F, I431F, S905F, P672S, N718Y, and M790V in MER urinary tract cancer One or more amino acid substitutions E204K, L586F, and S626C in MER stomach cancer Amino acid substitutions for S428G in MER kidney cancer Amino acid substitutions for A446G and/or P958L in MER liver cancer One or more amino acid substitutions N454S, V873I, and D983N in MER Lymphoma W485S/C amino acid substitution in MER colon cancer One or more D990N, L688M, and R722 amino acid substitutions in MER Mammary cancer G594R amino acid substitution in MER head and neck cancer Amino acid substitution A708S in MER AML, ALL, lung cancer, glioma, melanoma, prostate cancer, schwannoma, mantle cell lymphoma, and rhabdomyosarcoma Overexpression or ectopic expression of MER

Additional anticancer agents that are MER inhibitors include, for example, foretinib, merestinib (LY2801653), (N-[4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl]-4-ethoxy- 1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide (ASLAN002; BMS-777607), [3-(2-[[3-fluoro-4-(4-methylpiperazine-1- yl)phenyl]amino]-5-methyl-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl]acetonitrile (SGI-7079), dubermatinib (TP-0903), trans-4-[2- (butylamino)-5-[4-[(4-methylpiperazin-1-yl)methyl]phenyl]-7H-pyrrolo[2,3-d]pyrimidin-7-yl]cyclohexanol (UNC2025), and 3-[3 -[4-(morpholin-4-ylmethyl)-1H-pyrrol-2-ylmethylene]-2-oxo-2,3-dihydro-1H-indol-5-ylmethyl]thiazolidin-2,4-dione hydrochloride (S49076) .

Also provided are methods of treating cancer (e.g., TAM-associated cancer and/or c-Met-associated cancer) in a patient in need thereof, comprising: (a) determining if the patient's cancer is TAM-associated cancer, c-Met -associated cancer or both; and (b) if the cancer is determined to be TAM-associated cancer, c-Met-associated cancer, or both, administering to the patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. Some embodiments of these methods further include administering at least one additional anticancer agent (eg, immunotherapy) to the subject. In some embodiments, the subject has previously received treatment with at least one additional anticancer agent or therapy, such as a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to at least one additional anticancer agent. In one embodiment, at least one additional anticancer agent does not include a compound of Formula I.

Also provided herein is a method of treating a patient diagnosed or diagnosed with TAM-associated cancer (e.g., any of the typical TAM-associated cancers described herein), c-Met-associated cancer (e.g., any of the typical c-Met cancer described herein), or both, comprising administering to a patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein. Some embodiments of these methods further include administering to the subject at least one additional anticancer agent (eg, immunotherapy). In some embodiments, the subject has previously received treatment with at least one additional anticancer agent or therapy, such as a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In one embodiment, the patient has cancer that is resistant to previously administered at least one additional anticancer agent. In some embodiments, at least one additional anticancer agent does not include a compound of Formula I.

In one embodiment, provided herein are methods of treating a patient diagnosed with (or identified) cancer (e.g., e.g., TAM-associated cancer, c-Met-associated cancer, or both), which comprises administering to the patient a therapeutically effective amount of a compound formula I or a pharmaceutically acceptable salt thereof. Also provided herein are methods of treating a patient diagnosed or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both, which comprises administering to the patient a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In some embodiments, a patient who has been identified or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both, using a regulatory approved, e.g., FDA-approved test or assay to detect abnormal (e.g., increased) expression, the level and/or activity of one or more TAM kinases and/or c-Met kinase in a patient or in a biopsy specimen from a patient, or by performing any of the non-limiting assays described herein. In some embodiments, the test or assay is provided as a kit. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, immunotherapy). In some embodiments, the patient has previously received treatment with at least one additional anti-cancer agent or therapy, such as a kinase inhibitor, immunotherapy (eg, immune checkpoint inhibitor), chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to at least one additional anticancer agent. In some embodiments, at least one additional anticancer agent does not include a compound of Formula I.

Also provided is a compound of Formula I, or a pharmaceutically acceptable salt thereof, for use in the treatment of cancer in a patient in need thereof, or in a patient who has been identified or diagnosed with TAM-associated cancer (e.g., any of the types of TAM-associated cancer described herein). ), c-Met-associated cancer (eg, any of the types of c-Met-associated cancer described herein), or both. Also provided is the use of a compound of formula I, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of cancer in a patient diagnosed or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both. In some embodiments, the cancer is a TAM-associated cancer. In some embodiments, the implementation of the cancer is a c-Met-associated cancer. In some embodiments, the cancer is both TAM-associated cancer and c-Met-associated cancer. In some embodiments, a patient is diagnosed or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both, by using a regulatory approved, e.g., FDA approved, kit to detect abnormal (e.g., increased) expression, level, and/or the activity of one or more TAM kinases and/or c-Met kinase, for example, compared to a non-cancerous tissue or cell from the same or another subject. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, immunotherapy). In some embodiments, the subject has previously received treatment with at least one additional anticancer agent or therapy, for example, an immune checkpoint inhibitor, a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to one or more of the at least one additional anticancer agent. In one embodiment, at least one additional anticancer agent does not include a compound of Formula I.

In some embodiments of any of the methods or uses described herein, a patient is diagnosed or diagnosed with cancer associated with or having abnormal (e.g., increased) expression, levels, and/or activity of one or more TAM kinases and/or c- Met, for example, compared to a non-cancerous tissue or cell in the same or a different subject. In some embodiments, provided herein are methods of treating TAM-associated cancer, c-Met-associated cancer, or both, in a patient in need of such treatment, the method comprising a) determining abnormal (e.g., increased) expression and/or activity one or more TAM kinases and/or c-Met kinase, for example, compared to a non-cancerous tissue or cell in the same or a different subject; and b) after a), administering a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, immunotherapy). In some embodiments, the patient has previously received treatment with at least one additional anticancer agent or therapy, such as a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to one or more of the at least one additional anticancer agent. In one embodiment, at least one additional anticancer agent does not include a compound of Formula I.

In some embodiments of any of the methods or uses described herein, the patient has a medical history indicating that the patient has a tumor associated with abnormal (e.g., increased) expression, level, and/or activity of one or more TAM kinases and/ or c-Met kinase, e.g. compared to a non-cancerous tissue or cell from the same patient or another subject). In some embodiments, the medical history indicates that the patient should be treated with one or more compounds of Formula I or their pharmaceutically acceptable salts or compositions provided herein. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, immunotherapy). In some embodiments, the subject has previously received treatment with at least one additional anticancer agent or therapy, such as a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to one or more of the at least one additional anticancer agent. In one embodiment, at least one additional anticancer agent does not include a compound of Formula I.

Also provided are methods of treating a patient which comprise administering a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, to a patient having a medical history that indicates that the patient has cancer associated with or having abnormal (e.g., increased) expression, level, and /or the activity of one or more TAM kinases and/or c-Met kinase, for example, in comparison with a non-cancerous tissue or cell of a patient or other subject. Also contemplated is the use of a compound of formula I, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of TAM-associated cancer, c-Met-associated cancer, or both, in a patient who has a medical history that indicates that the patient has cancer associated with or having abnormal (eg, increased) expression, level, and/or activity of one or more TAM kinases and/or c-Met kinase, for example, compared to non-cancerous tissue or cell of a patient or other subject. Some embodiments of these methods and uses may further include: the step of performing analysis of a sample (e.g., biopsy sample) obtained from a patient to determine if the patient has abnormal (e.g., increased) expression, level, and/or activity of one or more kinases TAMs and/or c-Met kinases (eg, compared to non-cancerous tissue or cell of the patient or another subject), and recording information in the patient's clinical document (eg, computer-readable medium) that the patient had abnormal (eg, increased) expression and/or the activity of one or more TAM kinases and/or c-Met kinase. In some embodiments, the assay is an in vitro assay. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, immunotherapy). In some embodiments, the subject has previously received treatment with at least one additional anticancer agent or therapy, such as a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to one or more of the at least one additional anticancer agent. In one embodiment, at least one additional anticancer agent does not include a compound of Formula I.

Also provided herein is a method for treating a patient in need thereof. The method includes performing analysis of a sample obtained from a patient to determine if the subject has abnormal (e.g., increased) expression, level, and/or activity of one or more TAM kinases and/or c-Met kinase, e.g., compared to a non-cancerous tissue or cell. the same patient or another subject). The method also includes administering to a patient who has an abnormal (e.g., increased) expression, level, and/or activity of one or more TAM kinases and/or c-Met kinase (e.g., compared to a non-cancerous tissue or cell of the same patient or another subject). ) a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, immunotherapy). In some embodiments, the patient has previously received treatment with at least one additional anticancer agent or therapy, such as a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to one or more of the at least one additional anticancer agent. In one embodiment, at least one additional anticancer agent does not include a compound of Formula I.

Also provided are methods (eg, in vitro methods) for selecting treatment for a patient who is identified or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both. Some embodiments may further include administering the selected treatment to a patient identified or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both. For example, the treatment of choice may include administering a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof. Some embodiments may further include the step of performing analysis of a sample (e.g., a biopsy sample) obtained from a patient to determine if the patient has abnormal (e.g., increased) expression, level, and/or activity of one or more TAM kinases and/or kinases. c-Met (e.g., compared to a non-cancerous tissue or cell from the same patient or another subject), and identifying and diagnosing a patient who has abnormal (e.g., increased) expression, level, and/or activity of one or more TAM kinases and/ or c-Met kinase as having TAM-associated cancer and/or c-Met-associated cancer, respectively. In some embodiments, the patient has been identified or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both, using a regulatory approved, e.g. activity of one or more TAM kinases and/or c-Met kinase in the patient or in the patient's biopsy sample. In some embodiments, the TAM-associated cancer is a cancer described herein or known in the art. In some embodiments, the c-Met-associated cancer is a cancer described herein or known in the art. In some embodiments, the assay is an in vitro assay. For example, an assay that uses next generation sequencing, immunohistochemistry, or FISH assay. In some embodiments, the assay is a regulatory approved, eg, FDA approved, kit. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, immunotherapy). Some embodiments of these methods further include administering to the subject at least one additional anticancer agent (eg, immunotherapy). In some embodiments, the patient has previously received treatment with at least one additional anticancer agent or therapy, for example, an immune checkpoint inhibitor, a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to one or more of the at least one additional anticancer agent. In one embodiment, at least one additional anticancer agent does not include a compound of Formula I.

Also provided herein are methods for selecting a treatment for a patient, the methods comprising the step of analyzing a sample obtained from the patient to determine if the patient has abnormal (e.g., increased) expression, level, and/or activity of one or more TAM kinases, and /or c-Met kinase, for example, compared with non-cancerous tissue or cell of a patient or other subject. Some embodiments further include administering the selected treatment to a patient identified or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both. For example, the treatment of choice may include administering a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof to a patient diagnosed or diagnosed with TAM-associated cancer, c-Met-associated cancer, or both. In some embodiments, the assay is an in vitro assay. Some embodiments of these methods further include administering to the patient at least one additional anticancer agent (eg, immunotherapy). In some embodiments, the patient has previously received treatment with at least one additional anticancer agent or therapy, for example, an immune checkpoint inhibitor, a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to one or more of the at least one additional anticancer agent. In one embodiment, at least one additional anticancer agent does not include a compound of Formula I.

Also provided are methods for selecting a patient for treatment, the methods including selecting, determining, or diagnosing a patient having TAM-associated cancer, c-Met-associated cancer, or both, and selecting a patient for treatment, including administering a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. In some embodiments, determining or diagnosing a patient for TAM-associated cancer, c-Met-associated cancer, or both, may include the step of performing an analysis of a sample obtained from the patient to determine if the patient has abnormal (e.g., increased) expression, the level and/or activity of one or more TAM kinases and/or c-Met kinase (eg, compared to non-cancerous tissue or cell of a patient or other subject) having TAM-associated cancer and/or c-Met-associated cancer, respectively. In some embodiments, the treatment selection method may be used as part of a clinical trial that includes the administration of various treatments for TAM-associated cancer, c-Met-associated cancer, or both. In some embodiments, the assay is an in vitro assay. Some embodiments of these methods further include administering to the subject at least one additional anti-cancer agent or therapy, such as an immune checkpoint inhibitor, a kinase inhibitor, immunotherapy, chemotherapy, radiation therapy, and/or surgery. In some embodiments, the patient has cancer that is resistant to one or more of the at least one additional anticancer agent. In one embodiment, at least one additional anticancer agent does not include a compound of Formula I.

In some embodiments of any of the methods or uses described herein, an assay can be used to determine if a patient has abnormal (e.g., increased) expression, level, and/or activity of one or more TAM kinases and/or c- Met. In some embodiments, the sample is a biological sample or a biopsy sample (eg, a biopsy sample embedded in paraffin) from a patient. In some embodiments, the patient is a patient suspected of having TAM-associated cancer, c-Met-associated cancer, or both, a patient having one or more symptoms of TAM-associated cancer, c-Met-associated cancer, or both, and/ or a patient who has an increased risk of developing TAM-associated cancer, c-Met-associated cancer, or both).

In some embodiments of any of the methods described herein, a compound of formula I, or a pharmaceutically acceptable salt thereof, is administered in combination with a therapeutically effective amount of at least one additional anticancer agent selected from one or more additional therapies or therapeutic agents, e.g. which acts by the same or a different mechanism of action. In one embodiment, the compound of formula I is selected from the compounds described in Examples No. 1-201, or their pharmaceutically acceptable salts. In some embodiments, a compound of Formula I is selected from i) Example No. 1-20; ii) Example No. 21-40; iii) Example No. 41-60; iv) Example No. 61-80; v) Example No. 81-100; vi) Example No. 101-120; vii) Example No. 121-140; viii) example no. 141-160; ix) Example No. 161-180; x) Example No. 181-201 or its pharmaceutically acceptable salts.

Non-limiting examples of additional anticancer agents include immunotargeting agents, including immunotherapeutic agents, antiviral agents, kinase-targeting therapeutic agents, antiviral vaccines, antihormonal agents, signaling pathway inhibitors, chemotherapeutic or other anticancer agents, angiogenesis inhibitors, and radiation therapy.

One or more additional anticancer agents described herein may be combined with the present compounds in a single dosage form, or the present compounds and at least one additional anticancer agent may be administered simultaneously or sequentially as separate dosage forms.

In one embodiment, a compound of Formula I, or a pharmaceutically acceptable salt thereof, is administered daily for 28 consecutive days in a 28 day cycle.

In one embodiment, the compounds of formula I, or pharmaceutically acceptable salts thereof, may be combined with immunotargeting agents, including immunotherapeutic agents.

The term "immunotherapeutic agents" refers to an agent that modulates the immune system. In some embodiments, immunotherapy can increase the expression and/or activity of an immune system regulator. In some embodiments, immunotherapy may reduce the expression and/or activity of an immune system regulator. In some embodiments, the implementation of immunotherapy may involve and/or enhance the activity of immune cells.

In some embodiments, the immunotherapeutic agent is an immune checkpoint inhibitor. As used herein, the term "immune checkpoint inhibitor" or "immune checkpoint inhibitor" refers to molecules that wholly or partially reduce, inhibit, interfere with, or modulate the expression and/or activity of one or more checkpoint proteins. In some embodiments, the immunotherapy includes one or more immune checkpoint inhibitors. In some embodiments, the immune checkpoint inhibitor is a CTLA-4 inhibitor (e.g., an anti-CTLA-4 antibody), a PD-1 inhibitor (e.g., an anti-PD-1 monoclonal antibody), or a PD-L1 inhibitor (e.g., an anti-CTLA-4 antibody). -PD-Ll monoclonal antibody). In some embodiments, the CTLA-4 inhibitor is ipilimumab (Yervoy®) or tremelimumab (CP-675,206). In some embodiments, the PD-1 inhibitor is pembrolizumab (Keytruda®), nivolumab (Opdivo®), or pidilizumab. In some embodiments, the anti-PD-1 monoclonal antibody is nivolumab or pembrolizumab. In some embodiments, the anti-PDl antibody is pembrolizumab. In some embodiments, the PD-L1 inhibitor is atezolizumab (Tecentriq®), avelumab (Bavencio®), durvalumab (Imfinzi™), MEDI4736, or MPDL3280A. In some embodiments, the PD-1 or PD-L1 inhibitor is small molecule (eg, as described in US 2018/305313 and WO 2018/195321). In some embodiments, the PD-L1 inhibitor is atezolizumab (Tecentriq®), avelumab (Bavencio®), or durvalumab (Imfinzi™). In some embodiments, the checkpoint inhibitor may target 4-1BB (e.g., urelumab (BMS-663513) and PF-05082566 (PF-2566)), CD27 (e.g., varlilumab (CDX-1127), CD40 (e.g., CP- 870,893), OX40, TIM-3, ICOS, BTLA, A2AR, B7-H3, B7-H4, BTLA, IDO, KIR, LAG3, TIM-3, and VISTA Additional non-limiting examples of immune checkpoint inhibitors include ulokuplumab, urelumab , PF 05082566, TRX518, варлилумаб, CP 870893, PDR001MEDI4736, авелумаб, , BMS 986016, MGA271, IPH2201, эмактузумаб, INCB024360, MEDI6469, галунисертиб, BKT140, бавитуксимаб, лирилумаб, бевацизумаб, MNRP1685A, ламброизумаб, CC 90002, BMS-936559 и MGA271.

In some embodiments, a compound of Formula I, or a pharmaceutically acceptable salt thereof, is combined with an immune checkpoint inhibitor, wherein the immune checkpoint inhibitor is administered on one or more days in a 28 day cycle. In one embodiment, a compound of Formula I, or a pharmaceutically acceptable salt thereof, is administered daily for 28 consecutive days in a 28 day cycle.

In some embodiments, a compound of Formula I, or a pharmaceutically acceptable salt thereof, is combined with an immune checkpoint inhibitor, wherein the immune checkpoint inhibitor is administered once a week. In one embodiment, the immune checkpoint inhibitor is administered every two weeks. In one embodiment, the immune checkpoint inhibitor is administered every three weeks. In one embodiment, the immune checkpoint inhibitor is administered every 4 weeks. In one embodiment, the immune checkpoint inhibitor is administered on day 1 of a 28 day cycle. In one embodiment, the immune checkpoint inhibitor is administered on days 1 and 7 of a 28 day cycle. In one embodiment, the immune checkpoint inhibitor is administered on days 1, 7 and 14 of a 28 day cycle. In one embodiment, the immune checkpoint inhibitor is administered on days 1, 7, 14 and 21 of a 28 day cycle. In one embodiment, the immune checkpoint inhibitor is administered on days 1, 7, 14 and 28 of a 28 day cycle. In one embodiment, a compound of Formula I, or a pharmaceutically acceptable salt thereof, is administered daily for 28 consecutive days in a 28 day cycle. In one embodiment, the immune checkpoint inhibitor is administered by intravenous infusion.

In some embodiments, a compound of formula I, or a pharmaceutically acceptable salt thereof, is combined with an immune checkpoint inhibitor, wherein the immune checkpoint inhibitor is administered on day 1 of cycles 1 to 13. In one embodiment, the compound of formula I, or a pharmaceutically acceptable salt thereof, is administered daily for 28 consecutive days in a 28 day cycle.

In some embodiments, the immunotherapeutic agent is a cellular immunotherapy (eg, adoptive T cell therapy, dendritic cell therapy, or natural killer cell therapy). In some embodiments, the cellular immunotherapy is sipuleucel-T (APC8015; Provenge™; Plosker (2011) Drugs 71(1): 101-108). In some embodiments, the cellular immunotherapy includes cells that express a chimeric antigen receptor (CAR). In some embodiments, the cellular immunotherapy is a CAR-T cell therapy. In some embodiments, the CAR-T cell therapy is tisagenlecleisel (Kymriah™).

In some embodiments, the immunotherapeutic agent is an antibody preparation (eg, monoclonal antibody, conjugated antibody). In some embodiments, the antibody preparation is bevacizumab (Mvasti™, Avastin®), trastuzumab (Herceptin®), avelumab (Bavencio®), rituximab (MabThera™, Rituxan®), edrecolomab (Panorex), daratumumab (Darzalex®), olaratumab (Lartruvo™), ofatumumab (Arzerra®), alemtuzumab (Campath®), cetuximab (Erbitux®), oregovomab, pembrolizumab (Keytruda®), dinutuximab (Unituxin®), obinutuzumab (Gazyva®), tremelimumab (CP-675,206), ramucirumab (Cyramza®), ublituximab (TG-1101), panitumumab (Vectibix®), elotuzumab (Empliciti™), avelumab (Bavencio®), necitumumab (Portrazza™), cirmtuzumab (UC-961), ibritutomab (Zevalin®), isatuximab (SAR650984), nimotuzumab, fresolimumab (GC1008), lirilumab (INN), mogamulizumab (Poteligeo®), ficlatuzumab (AV-299), denosumab (Xgeva®), ganitumab, urelumab, pidilizumab, or amatuximab.

In some embodiments, the immunotherapeutic agent is an antibody-drug conjugate. In some embodiments, the antibody-drug conjugate is gemtuzumab ozogamicin (Mylotarg™), inotuzumab ozogamicin (Besponsa®), brentuximab vedotin (Adcetris®), ado-trastuzumab emtansine (TDM-1; Kadcyla®), mirvetuximab soravtansine (IMGN853) , or anetumab ravtansin

In some embodiments, the immunotherapy comprises blinatumomab (AMG103; Blincyto®) or midostaurin (Rydapt).

In some embodiments, the implementation of the immunotherapeutic agent includes a toxin. In some embodiments, the immunotherapy is denileukin diftitox (Ontak®).

In some embodiments, the immunotherapeutic agent is a cytokine therapy. In some embodiments, the cytokine therapy is interleukin (IL-2) therapy, interferon alpha (IFNα) therapy, granulocyte colony stimulating factor (G-CSF) therapy, interleukin 12 (IL-12) therapy, interleukin 15 (IL-15) therapy , interleukin 7 (IL-7) therapy, or erythropoietin-alpha (EPO) therapy. In some embodiments, the IL-2 therapy is aldesleukin (Proleukin®). In some embodiments, the IFNα therapy is IntronA® (Roferon-A®). In some embodiments, the G-CSF therapy is filgrastim (Neupogen®).

In some embodiments, the immunotherapeutic agent is an inhibitory nucleic acid immunotherapy (e.g., antisense oligonucleotides, small interfering RNAs (siRNAs), and short hairpin RNAs (sRNAs). In some embodiments, the inhibitory nucleic acid immunotherapy is CV9104 (see ., for example, Rausch et al (2014) Human Vaccine Immunother 10(11): 3146-52 and Kubler et al (2015) J Immunother Cancer 3:26).

In some embodiments, the immunotherapeutic agent is a Bacillus Calmette-Guerin (BCG) therapy. In some embodiments, the immunotherapeutic agent is an oncolytic virus therapy. In some embodiments, the oncolytic virus therapy is talimogen lagerparepvec (T-VEC; Imlygic®).

In some embodiments, the immunotherapeutic agent is a cancer vaccine. In some embodiments, the cancer vaccine is a human papillomavirus (HPV) vaccine. In some embodiments, the HPV vaccine is Gardasil®, Gardasil9®, or Cervarix®. In some embodiments, the cancer vaccine is a hepatitis B virus (HBV) vaccine. In some embodiments, the HBV vaccine is Engerix-B®, Recombivax HB®, or GI-13020 (Tarmogen®). In some embodiments, the cancer vaccine is Twinrix® or Pediarix®. In some embodiments, the cancer vaccine is BiovaxID®, Oncophage®, GVAX, ADXS11-001, ALVAC-CEA, PROSTVAC®, Rindopepimut®, CimaVax-EGF, lapuleucel-T (APC8024; Neuvenge™), GRNVAC1, GRNVAC2, GRN- 1201, hepcortespenlisimut-L (Hepko-V5), DCVAX®, SCIB1, BMT CTN 1401, PrCa VBIR, PANVAC, ProstAtak®, DPX-Survivac, or viagenpumatucel-L (HS-110).

In some embodiments, the immunotherapeutic agent is a peptide vaccine. In some embodiments, the peptide vaccine is Nelipepimut-S (E75) (NeuVax™), IMA901, or SurVaxM (SVN53-67). In some embodiments, the cancer vaccine is an immunogenic personal neoantigen vaccine (see, for example, Ott et al. (2017) Nature 547: 217-221; Sahin et al. (2017) Nature 547: 222-226). In some embodiments, the cancer vaccine is RGSH4K or NEO-PV-01. In some embodiments, the cancer vaccine is a DNA-based vaccine. In some embodiments, the DNA-based vaccine is a mammaglobin-A DNA vaccine (see, for example, Kim et al. (2016) OncoImmunology 5(2): e1069940).

In some embodiments, the immunotargeting agents are selected from aldesleukin, interferon alfa-2b, ipilimumab, lambrolizumab, nivolumab, prednisone, and sipuleucel-T.

Suitable antiviral agents for use in combination with a compound of formula I or a pharmaceutically acceptable salt thereof may include nucleoside and nucleotide reverse transcriptase inhibitors (RTIs), non-nucleoside reverse transcriptase inhibitors (NRTIs), protease inhibitors, and other antivirals.

Examples of suitable NRTIs include zidovudine (AZT); didanosine (ddl); zalcitabine (ddC); stavudine (d4T); lamivudine (3TC); abacavir (1592U89); adefovir dipivoxil [bis(POM)-PMEA]; lobukavir (BMS-180194); BCH-10652; emicitabine [(-)-FTC]; beta-L-FD4 (also called beta-L-D4C and called beta-L-2',3'-dicleoxy-5-fluoro-cytidene); DAPD, ((-)-beta-D-2,6,-diamino-purine dioxolane); and lodenosin (FddA). Typical suitable NNRTIs include nevirapine (BI-RG-587); delaviradin (BHAP, U-90152); efavirenz (DMP-266); PNU-142721; AG-1549; MKC-442 (1-(ethoxy-methyl)-5-(1-methylethyl)-6-(phenylmethyl)-(2,4(1H,3H)-pyrimidinedione) and (+)-calanolide A (NSC-675451 ) and B. Typical suitable protease inhibitors include saquinavir (Ro 31-8959), ritonavir (ABT-538), indinavir (MK-639), nelfnavir (AG-1343), amprenavir (141W94), lasinavir (BMS-234475); DMP-450, BMS-2322623, ABT-378, and AG-1 549. Other antivirals include hydroxyurea, ribavirin, IL-2, IL-12, pentafuzid, and Yissum Project No. 11607.

The compounds of formula I and their pharmaceutically acceptable salts can be used in combination with one or more other kinase inhibitors for the treatment of diseases, such as cancer, which are affected by one or more signaling pathways.

In some embodiments, the patient to be treated with the combination therapy described herein was not treated with an additional anti-cancer agent prior to the administration of the combination therapy. In some embodiments, the patient to be treated with the combination therapy described herein has previously received treatment with at least one additional anticancer agent prior to administration of a compound of formula I for use alone or in the combination therapy described herein. In some embodiments, the patient being treated with a compound of Formula I as monotherapy or in combination therapy as described herein has developed drug resistance to, or the patient has, a cancer that is resistant to at least one additional anticancer agent.

In one embodiment, the compounds of formula I and their pharmaceutically acceptable salts can be combined with one or more inhibitors of the following kinases for the treatment of cancer: PIM (PIM l, PIM 2, PIM 3), IDO, AKT l, AKT2 and AKT3, TGFR, PKA, PKG, PKC, CaM kinase, phosphorylase kinase, MEKK, ERK, MAPK, mTOR, EGFR, HER2, HER3, HER4, INS-R, IGF-1R, IR-R, PDGFaR, PDGF R, CSFIR, KIT, FLK-II, KDR/FLK-1, FLK-4, flt-1, FGFR, FGFR1, FGFR2, FGFR3, FGFR4, c-MET, Ron, Sea, TRKA, TRKB, TRKC, FLT3, VEGFR/Flt2, Flt4, EphAl, EphA2, EphA3, EphB2, EphB4, Tie2, Src, Fyn, Lck, Fgr, Btk, FAK, SYK, FRK, JAK, ABL, ALK, and B-Raf.

The compounds of formula I and their pharmaceutically acceptable salts can also be used in combination with one or more additional anticancer agents, such as chemotherapeutic agents. Examples of chemotherapeutic agents include any of: abarelix, aldesleukin, alemtuzumab, alitretinoin, allopurinol, altretamine, anastrozole, arsenic trioxide, asparaginase, azacitidine, bevacizumab, bexarotene, bleomycin, bortezomib, intravenous busulfan, oral busulfan, calusterone, capecitabine, carmustine, cetuximab, chlorambucil, cisplatin, cladribine, clofarabine, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, dalteparin sodium, dasatinib, daunorubicin, decitabin, denileukin, denileukin diftitox, dexrazoxane, docetaxel, doxorubicin, dromostanolone propionate, eculinubicinum, eculubicinum , etoposide phosphate, etoposide, exemestane, fentanyl citrate, filgrastim, floxuridine, fludarabine, fluorouracil, fulvestrant, gefitinib, gemcitabine, gemtuzumab ozogamicin, goserelin acetate, histrelin acetate, ibritutomab tiuxetan, idarubicin, ifosfamide, imatinib mesylate, ilafaferinibinib 2a, ilafaferinote 2a ditosylate, lenalidomide, letro sol, leucovorin, leuprolide acetate, levamisole, lomustine, meclorethamine, megestrol acetate, melphalan, mercaptopurine, methotrexate, methoxsalen, mitomycin C, mitotane, mitoxantrone, nandrolone phenpropionate, nelarabine, nofetumomab, oxaliplatin, paclitaxel, pamidronate, pegsparafilumumab, pemetrexed disodium, pentostatin, pipobroman, plicamycin, procarbazine, quinacrine, rasburicase, rituximab, ruxolitinib, sorafenib, streptozotocin, sunitinib, sunitinib maleate, tamoxifen, temozolomide, tenipozid, testolactone, thalidomide, thioguanine, thiotepa, topotecan, toremifene, tositumumab, trastuzumab, tretinoin, uramustine, valrubicin, vinblastine, vincristine, vinorelbine, vorinostat, and zoledronate.

In some embodiments, signal transduction pathway inhibitors include Ras-Raf-MEK-ERK pathway kinase inhibitors (e.g., binimetinib, selumetinib, encorafenib, sorafenib, trametinib, cobimetinib, dabrafenib, and vemurafenib), PI3K-AKT-mTOR-S6K pathway kinase inhibitors ( e.g. everolimus, rapamycin, perifosin, temsirolimus), and other kinase inhibitors such as baricitinib, brigatinib, capmatinib, danusertib, ibrutinib, milciclib, quercetin, regorafenib, ruxolitinib, semaxanib, ((R)-amino-N-[5, 6-dihydro-2-(1-methyl-1H-pyrazol-4-yl)-6-oxo-1H-pyrrolo[4,3,2-ef][2,3]benzodiazepin-8-yl]-cyclohexaneacetamide) , and TG101209 (N-tert-butyl-3-(5-methyl-2-(4-(4-methylpiperazin-1-yl)phenylamino)pyrimidin-4-ylamino)benzenesulfonamide).

The combination of a compound of formula I in combination with binimetinib, selumetinib, encorafenib, sorafenib, trametinib or vemurafenib results in sensitization of tumors resistant to binimetinib, selumetinib, encorafenib, sorafenib, trametinib or vemurafenib, respectively.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, ( iii) encorafenib, (iv) sorafenib, (v) trametinib, and (vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof; and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i ) binimetinib; and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) binimetinib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) binimetinib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) encorafenib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) encorafenib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) selumetinib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) selumetinib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) sorafenib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) sorafenib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) trametinib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) trametinib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) vemurafenib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) vemurafenib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 37, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 37, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 46, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 46, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 48, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 48, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 55, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 55, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 58, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 58, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 72, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 72, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 76, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 76, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 77, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 77, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 78, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 78, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 83, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 83, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 84, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 84, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 85, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 85, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 91, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 91, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 97, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 97, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 100, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 100, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 103, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 103, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 105, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 105, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 107, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 107, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 108, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 108, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 114, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 114, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 115, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 115, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 119, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 119, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 121, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 121, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 124, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 124, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 125, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 125, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 126, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 126, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 127, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 127, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 129, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 129, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 151, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 151, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 152, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 152, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 163, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 163, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 169, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 169, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 188, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 188, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 190, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 190, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 199, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 199, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 200, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 200, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib, (ii) selumetinib, (iii) encorafenib, (iv) sorafenib, (v) trametinib, ( vi) vemurafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) binimetinib and (ii) encorafenib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations thereof.

In each of the above combinations, the compound of formula I, or a pharmaceutically acceptable salt thereof, and the additional anticancer agent may be prepared as separate compositions or dosages for simultaneous, separate, or sequential use in the treatment of cancer, wherein the amounts of the compound of formula I, or a pharmaceutically acceptable salt thereof, and the additional anticancer agent the agents together are effective in the treatment of cancer. Also provided herein is a pharmaceutical composition comprising such a combination. Also provided herein is the use of such a combination for the preparation of a medicament for the treatment of cancer (eg, TAM-associated cancer or c-Met-associated cancer). Also provided herein is a commercial package or product that includes a combination such as a combined preparation for simultaneous, separate or sequential use; and a method for treating cancer in a patient in need thereof.

Also provided are methods of treating a subject suffering from cancer which comprises administering to a patient diagnosed or identified with cancer (eg, TAM-associated cancer or c-Met-associated cancer) a therapeutically effective amount of any of the combinations.

Also provided herein are methods of treating a patient diagnosed or diagnosed with TAM-associated cancer or c-Met-associated cancer, which comprises administering to a patient diagnosed or diagnosed with TAM-associated cancer or c-Met-associated cancer, a therapeutically effective amount a therapeutically effective amount of any of the combinations.

The combination of a compound of formula I in combination with an EGFR inhibitor (eg, any of the EGFR inhibitors described herein) results in an effective reduction in the proliferation of EGFR inhibitor resistant cancer cells or c-Met inhibitor resistant cancer cells).

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii ) panitumumab (or a biosimilar thereof), (iii) erlotinib, (iv) lapatinib, and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) cetuximab (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) panitumumab (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) erlotinib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) lapatinib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) gefitinib, or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i ) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, (iv) lapatinib, and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) cetuximab (or a biosimilar thereof), each optionally in the form of its a pharmaceutically acceptable salt or solvate; and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) panitumumab (or a biosimilar thereof), each optionally in the form its pharmaceutically acceptable salt or solvate; and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) erlotinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof , and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) lapatinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof , and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 37, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 46, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 48, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 55, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 58, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 72, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 76, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 77, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 78, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 83, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 84, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 85, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 91, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 97, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 100, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 103, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 105, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 107, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 108, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 114, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 115, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 119, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 121, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 124, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 125, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 126, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, (iv) ) lapatinib, and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 127, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 129, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 151, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 152, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 163, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 169, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 188, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 190, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 199, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 200, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) cetuximab (or a biosimilar thereof), (ii) panitumumab (or a biosimilar thereof), (iii) erlotinib, ( iv) lapatinib; and (v) gefitinib, each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

The combination of a compound of Formula I in combination with an immune checkpoint inhibitor (eg, any of the checkpoint inhibitors described herein, eg, a PD-1 or PD-L1 inhibitor) results in sensitization of tumors to immune checkpoint inhibitor therapy. For example, a compound of formula I in combination with an immune checkpoint inhibitor may result in one or more (e.g., two, three, four, or five) of increased dendritic cell antigen presentation, increased NK cell response, increased directed T cell migration, an increase in the number of type 1 macrophages, which leads to the production of immunostimulatory cytokines, and an increase in both innate and adaptive immune responses.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) ) pembrolizumab (or its biosimilar), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), and (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar) , (vii) avelumab (or a biosimilar thereof), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) nivolumab (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) pembrolizumab (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) cemiplimab (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) pidilizumab (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) 1141PDCA-170 (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) atezolizumab (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) avelumab (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Formula I, or a pharmaceutically acceptable salt or solvate thereof, and (b) durvalumab (or a biosimilar thereof), or a pharmaceutically acceptable salt or solvate thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i ) nivolumab (or its biosimilar), (ii) pembrolizumab (or its biosimilar), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or a biosimilar thereof), (vii) avelumab (or a biosimilar thereof), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) nivolumab (or a biosimilar thereof), each optionally in the form of its a pharmaceutically acceptable salt or solvate; and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) pembrolizumab (or a biosimilar thereof), each optionally in the form of its a pharmaceutically acceptable salt or solvate; and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) cemiplimab (or a biosimilar thereof), each optionally in the form of its a pharmaceutically acceptable salt or solvate; and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) pidilizumab (or a biosimilar thereof), each optionally in the form of its a pharmaceutically acceptable salt or solvate; and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) 1141PDCA-170 (or a biosimilar thereof), each optionally in the form of its pharmaceutically acceptable salt or solvate; and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) atezolizumab (or a biosimilar thereof), each optionally in the form of its a pharmaceutically acceptable salt or solvate; and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) avelumab (or a biosimilar thereof), each optionally in the form of its a pharmaceutically acceptable salt or solvate; and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) durvalumab (or its biosimilar), each optionally in the form of its a pharmaceutically acceptable salt or solvate; and combinations thereof.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 25, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 37, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 46, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 48, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 55, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 58, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 72, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 76, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 77, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 78, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 83, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 84, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 85, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 91, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 97, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 100, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 103, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 105, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 107, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 108, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 114, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 115, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 119, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 121, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 124, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 125, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 126, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 127, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 129, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 151, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 152, or a pharmaceutically acceptable salt or solvate thereof, and ((b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab ( or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii ) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 163, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 169, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 188, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 190, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 199, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 200, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of these.

In one embodiment, a pharmaceutical combination is provided that includes (a) a compound of Example No. 201, or a pharmaceutically acceptable salt or solvate thereof, and (b) an additional anticancer agent selected from the group consisting of (i) nivolumab (or a biosimilar thereof), (ii) pembrolizumab (or a biosimilar thereof), (iii) cemiplimab (or its biosimilar), (iv) pidilizumab (or its biosimilar), (v) 1141PDCA-170 (or its biosimilar), (vi) atezolizumab (or its biosimilar), (vii) avelumab (or its biosimilar), and (viii) durvalumab (or a biosimilar thereof), each optionally in the form of a pharmaceutically acceptable salt or solvate thereof, and combinations of any of them.

Angiogenesis inhibitors may be effective in some tumors when combined with the compounds of formula I or their pharmaceutically acceptable salts. These include anti-VEGF or VEGFR antibodies or VEGFR kinase inhibitors. Anti-VEGF antibodies or other therapeutic proteins include bevacizumab and aflibercept. VEGFR kinase inhibitors and other anti-angiogenesis inhibitors include, but are not limited to, sunitinib, sorafenib, axitinib, cediranib, pazopanib, regorafenib, brivanib, and vandetanib.

Non-limiting examples of radiation therapy include radioiodide therapy, external beam radiation therapy, and radium-223 therapy.

Non-limiting examples of surgery include, for example, open surgery or minimally invasive surgery. Surgery may include, for example, removal of the entire tumor, debulking of the tumor, or removal of the tumor that causes pain or pressure in the subject. Methods for performing open surgery and minimally invasive surgery on a subject suffering from cancer are known in the art.

Accordingly, the present document also provides a method for treating cancer comprising administering to a patient in need thereof a pharmaceutical combination for treating cancer which comprises (a) a compound of formula I or a pharmaceutically acceptable salt thereof, and (b) an additional anti-cancer agent for simultaneous, separate or sequential use for the treatment of cancer, wherein the amounts of a compound of formula I, or a pharmaceutically acceptable salt thereof, and an additional anti-cancer agent are together effective in the treatment of cancer.

Also provided herein is a method of treating cancer comprising administering to a patient in need thereof a pharmaceutical combination for treating cancer which comprises (a) a compound of formula I or a pharmaceutically acceptable salt thereof, and (b) an adjunctive anti-cancer therapy, wherein the therapy is selected from radiation therapy and surgery. In one embodiment, the additional cancer therapy is radiation therapy. In one embodiment, the additional anti-cancer therapy is surgery.

In some embodiments, the additional anti-cancer agent(s) includes any of the therapies listed above or therapeutic agents that are standard of care for cancers, where the cancer is TAM-associated cancer. In one embodiment, the compound of Formula I, the additional anti-cancer agent is an immunotherapeutic agent. In one embodiment, the immunotherapeutic agent is a CTLA-4 inhibitor (e.g., an anti-CTLA-4 antibody), a PD-1 inhibitor (e.g., an anti-PD-1 monoclonal antibody), or a PD-L1 inhibitor (e.g., an anti-PD -Ll monoclonal antibody).

In one embodiment, provided herein is a method of treating cancer comprising administering a compound of Formula I in combination with an immune checkpoint inhibitor. In some embodiments, the immunotherapy comprises one or more immune checkpoint inhibitors (eg, PDR001 or any of the other exemplary immune checkpoint inhibitors described herein). In some embodiments, the immune checkpoint inhibitor is a CTLA-4 inhibitor (e.g., an anti-CTLA-4 antibody), a PD-1 inhibitor (e.g., an anti-PD-1 monoclonal antibody), a PD-L1 inhibitor (e.g., an anti -PD-Ll monoclonal antibody), NOX2 inhibitor, A2A4 inhibitor, B7-H3 inhibitor (e.g. MGA271), B7-H4 inhibitor (e.g. anti-B7-H4 antibody, e.g. described in Dangaj et al., Cancer Res. 73(15):4820-4829, 2013), an IDO inhibitor (e.g. coptisine, 1-methyl-D-tryptophan, NLG-919, indoxymod, 1-DL-methyl tryptophan, or the inhibitors described in Brastianos et al., JACS 128(50:16046-16047, 2006), TIM3 inhibitor, LAG3 inhibitor (e.g. BMS-986016), TIGIT inhibitor, BTLA inhibitor, VISTA inhibitor (e.g. 1141PDCA-170), ICOS inhibitor, KIR inhibitor (e.g. lirilumab ), CD39 inhibitor, SIGLEC7 inhibitor, or SIGLEC9 inhibitor In some embodiments, the CTLA-4 inhibitor is ipilimumab (Yervoy®), tremelimumab (CP-675, 206), or the aptamers described in Santulli-Marotto et al., Cancer Res. 63(21):7483-7489, 2003. In some embodiments, the PD-1 inhibitor is pembrolizumab (Keytruda®), nivolumab (Opdivo®), cemiplimab (Libtayo®), pidilizumab, or 1141PDCA-170. In some embodiments, the anti-PD-1 monoclonal antibody is nivolumab or pembrolizumab. In some embodiments, the anti-PD-l antibody is pembrolizumab. In some embodiments, the PD-L1 inhibitor is atezolizumab (Tecentriq®), avelumab (Bavencio®), durvalumab (Imfinzi™). In some embodiments, the PD-L1 inhibitor is atezolizumab (Tecentriq®), avelumab (Bavencio®), or durvalumab (Imfinzi™). In one embodiment, the compound of formula I is selected from the compounds described in Example No. 1-201, or their pharmaceutically acceptable salts. In some embodiments, a compound of Formula I is selected from i) Example No. 1-20; ii) Example No. 21-40; iii) Example No. 41-60; iv) Example No. 61-80; v) Example No. 81-100; vi) Example No. 101-120; vii) Example No. 121-140; viii) Example No. 141-160; ix) Example No. 161-180; x) Example No. 181-201 or its pharmaceutically acceptable salts. In some embodiments, provided herein is a method of treating cancer comprising administering to a patient in need thereof a compound of formula I in combination with an immune checkpoint inhibitor, wherein the patient is additionally receiving ionizing radiation treatment. In one embodiment, the cancer overexpresses AXL. In one embodiment, the cancer does not have a B-RAF mutation. In one embodiment, the cancer has a B-RAF mutation. In one embodiment, the cancer has a RAS mutation. In one embodiment, the cancer has an EGFR mutation. In one embodiment, the cancer overexpresses MER. In one embodiment, the cancer is lung cancer. In one embodiment, the cancer is non-small cell lung cancer (NSCLC). In one embodiment, the cancer is colon cancer. In one embodiment, the cancer is prostate cancer. In one embodiment, the cancer is melanoma. In one embodiment, the cancer is acute lymphoblastic leukemia (ALL). In one embodiment, the cancer is acute myeloid leukemia (AML).

Combination therapies as described herein may be administered without limitation in the order in which the treatments are administered to a patient with the disease or disorder described herein. Thus, in one embodiment, a compound of Formula I, or a pharmaceutically acceptable salt thereof, may be administered before (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours , 36 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), at the same time, or after (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 36 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) administration of the second therapeutic agent (eg, any of the additional anti-cancer agents described herein) to the subject. In another embodiment, a compound of Formula I, or a pharmaceutically acceptable salt thereof, may be administered before (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 36 hours , 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), at the same time, or after (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 36 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) administration of the second therapeutic agent (eg, any of the anti-cancer agents described herein).

In one embodiment, provided herein is a method of treating cancer comprising sensitizing said cancer to an antimitotic drug by administering a compound of Formula I. In one embodiment, the antimitotic drug is a taxane-based chemotherapeutic agent such as docetaxel.

In one embodiment, the compounds of formula I can be used in combination with other agents to treat patients who have primary or acquired resistance to at least one additional anticancer agent.

In one embodiment of the methods disclosed herein for the treatment of cancer, the compounds of formula I can be used as monotherapy for the treatment of patients who have developed primary or acquired resistance to at least one additional anticancer agent.

In one embodiment, the compounds of formula I can be used to overcome resistance to at least one additional anticancer agent in cancer. In one embodiment, the compound of formula I is used in combination with at least one additional anticancer agent to which the cancer has developed resistance.

In one embodiment, the compounds of formula I can be used to delay resistance to at least one additional anticancer agent. In one embodiment, the compound of formula I is used in combination with at least one additional anticancer agent.

Used in the present description, the term "resistance" refers to the history of the disease, when the cancer does not respond to targeted therapy or immunotherapy. For example, cancer resistance can be observed, for example, by a decrease in the rate of increase in tumor mass in a subject, no decrease in tumor mass in a subject, an increase in the dose of a therapeutic agent over the time necessary to achieve the same therapeutic effect in a patient, and the need for co-administration of an additional anticancer agent. to achieve the same therapeutic effect as the previous administration of the therapeutic agent as monotherapy.

As used herein, the term "primary resistance", also known as true resistance, refers to a clinical scenario in which the cancer does not respond to targeted therapy or immunotherapy, i.e., the cancer is resistant to therapy without having previously been exposed to that therapy.

As used herein, the term "acquired resistance" refers to a clinical scenario in which the cancer initially responds to targeted therapy or immunotherapy, but after a period of time the cancer stops responding to treatment (eg, the cancer recurs and progresses).

In one embodiment of the cancer treatment methods disclosed herein, compounds of Formula I may be used as monotherapy to treat patients who have developed primary or acquired resistance to at least one additional anticancer agent.

In one embodiment of the cancer treatment methods disclosed herein, compounds of formula I may be used in combination with at least one additional anticancer agent to treat patients who have developed primary or acquired resistance to one or more of at least one additional anticancer agent ( e.g. targeted therapeutic agent).

Targeted therapeutics include inhibitors or antibodies against EGFR, HER2, VEGFR, c-Met, Ret, IGFR1, PDGFR, FGFR1, FGFR2, FGFR3, FGFR4, TrkA, TrkB, TrkC, ROS, c-Kit, or Flt-3 and against cancer-associated fusion protein kinases such as Bcr-Abl and EML4-Alk. Anti-EGFR inhibitors include gefitinib, erlotinib, and nazartinib (see, for example, U.S. Patent No. 10195208 and J. Med. Chem. 59(14):6671-6689, 2016), and anti-EGFR/Her2 inhibitors include but are not limited to dacomitinib, afatinib, lapatinib, and neratinib. Anti-EGFR antibodies include, but are not limited to, cetuximab, panitumumab, and necitumumab. c-Met inhibitors may be used in combination with the compounds of formula I or their pharmaceutically acceptable salts. c-MET inhibitors include onartumzumab, tivantinib, and INC-280. Anti-FGFR inhibitors include, but are not limited to, AZD4547, BAY1187982, ARQ087, BGJ398, BIBF1120, TKI258, lucitanib, dovitinib, TAS-120, JNJ-42756493, and Debiol347. Anti-Trk inhibitors include, but are not limited to, larotrectinib (LOXO-101), and entrectinib (RXDX-101). Anti-Abl (or Bcr-Abl) inhibitors include imatinib, dasatinib, nilotinib, and ponatinib, and also anti-Alk (or EML4-ALK) inhibitors include crizotinib.

In one embodiment, provided herein are methods of treating a patient with cancer who has previously received treatment with a first kinase inhibitor, wherein the first kinase inhibitor is not a Formula I compound, comprising administering to said patient a therapeutically effective amount of a Formula I compound or a pharmaceutically acceptable salt thereof. In one embodiment, the patient is treated with a compound of formula I as a single agent. In one embodiment, the patient is treated with a combination of a compound of formula I and a pre-administered first kinase inhibitor. In one embodiment, the patient is treated with a combination of a compound of formula I and a pre-administered first kinase inhibitor. In one embodiment, the compound of formula I and the pre-administered first kinase inhibitor are administered in separate doses sequentially in any order. In one embodiment, the kinase inhibitor is an EGFR inhibitor. In one embodiment, the EGFR inhibitor is erlotinib or lapatinib. In one embodiment, the kinase inhibitor is a PI3Kα inhibitor. In one embodiment, the PI3Kα inhibitor is alpelisib. In one embodiment, the kinase inhibitor is a MEK inhibitor. In one embodiment, the MEK inhibitor is binimetinib, U0126, or PD 325901. In one embodiment, the kinase inhibitor is an FGFR inhibitor. In one embodiment, the kinase inhibitor is an ALK inhibitor. In one embodiment, the kinase inhibitor is an IGFR1 inhibitor. In one embodiment, the cancer is breast cancer (eg, triple negative breast cancer), head and neck cancer (eg, head and neck squamous cell carcinoma), non-small cell lung cancer, colorectal cancer, esophageal squamous cell carcinoma, or melanoma.

In one embodiment, provided herein are methods of treating a patient with cancer who has previously received treatment with an anti-EGFR antibody, comprising administering to said patient a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof. In one embodiment, the patient is treated with a compound of formula I as a single agent. In one embodiment, the patient is treated with a combination of a compound of Formula I and a pre-administered anti-EGFR antibody. In one embodiment, the compound of Formula I and the pre-administered anti-EGFR antibody are administered in separate doses sequentially in any order. In one embodiment, the anti-EGFR antibody is cetuximab. In one embodiment, the cancer is breast cancer, head and neck cancer, or non-small cell lung cancer.

In one embodiment, provided herein are methods of treating a patient with cancer who has previously received treatment with a first kinase inhibitor, wherein the first kinase inhibitor is not a compound of formula I, comprising (a) determining that said cancer overexpresses TAM kinase and/or kinase c-Met (eg, compared to a non-cancerous tissue or cell in a patient or other subject) and (b) after (a) administering to said patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof. In one embodiment, the step of determining if the cancer overexpresses TAM kinase and/or c-Met kinase comprises the step of performing an analysis of a sample obtained from the patient to determine if the patient has abnormal (e.g., increased) expression, level, and/ or the activity of one or more TAM kinases and/or c-Met kinase (eg, compared to non-cancerous tissue or cell from a patient or other subject), for example, AXL and/or MER and/or TYRO3 and/or c-Met. In one embodiment, a cancer previously treated with a first kinase inhibitor overexpresses AXL. In one embodiment, a cancer previously treated with a first kinase inhibitor overexpresses MER. In one embodiment, a cancer previously treated with a first kinase inhibitor overexpresses TYRO3. In one embodiment, a cancer previously treated with a first kinase inhibitor overexpresses c-Met kinase. In one embodiment, the method further includes obtaining a sample from the patient. In one embodiment, the sample is a biopsy sample. In one embodiment, the assay is selected from the group consisting of sequencing, immunohistochemistry, enzyme-linked immunosorbent assay, and fluorescence in situ hybridization (FISH). In one embodiment, the first kinase inhibitor is an EGFR inhibitor. In one embodiment, the EGFR inhibitor is erlotinib or lapatinib. In one embodiment, the first kinase inhibitor is a PI3Kα inhibitor. In one embodiment, the PI3Kα inhibitor is alpelisib. In one embodiment, the first kinase inhibitor is a MEK inhibitor. In one embodiment, the MEK inhibitor is binimetinib, U0126, or PD 325901. In one embodiment, the first kinase inhibitor is an FGFR inhibitor. In one embodiment, the first kinase inhibitor is an ALK inhibitor. In one embodiment, the first kinase inhibitor is an IGFR1 inhibitor. In one embodiment, the cancer is breast cancer (eg, triple negative breast cancer), head and neck cancer (eg, head and neck squamous cell carcinoma), non-small cell lung cancer, colorectal cancer, esophageal squamous cell carcinoma, or melanoma. In one embodiment, the patient is treated with a compound of formula I as a single agent. In one embodiment, the patient is treated with a combination of a compound of Formula I and a first kinase inhibitor. In one embodiment, the compound of formula I and the previously prescribed kinase inhibitor are administered in separate doses sequentially in any order.

In one embodiment, provided herein is a method of treating a subject with cancer, wherein the method comprises (a) determining that a cancer cell in a sample obtained from a subject with cancer who has previously received one or more doses of a first kinase inhibitor, where the first kinase inhibitor is not a compound of formula I, overexpresses one or more TAM kinases and/or c-Met kinase (eg, compared to non-cancerous tissue or cell from a subject or another subject); and (b) administering to the subject a compound of formula I, or a pharmaceutically acceptable salt or solvate thereof, as monotherapy or in combination with a previously administered first kinase inhibitor. In one embodiment, a cancer previously treated with a first kinase inhibitor overexpresses AXL. In one embodiment, a cancer previously treated with a first kinase inhibitor overexpresses MER. In one embodiment, a cancer previously treated with a first kinase inhibitor overexpresses TYRO3. In one embodiment, a cancer previously treated with a first kinase inhibitor overexpresses c-Met kinase. In one embodiment, the first kinase inhibitor is an EGFR inhibitor. In one embodiment, the EGFR inhibitor is erlotinib or lapatinib. In one embodiment, the first kinase inhibitor is a PI3Kα inhibitor. In one embodiment, the PI3Kα inhibitor is alpelisib. In one embodiment, the first kinase inhibitor is a MEK inhibitor. In one embodiment, the MEK inhibitor is binimetinib, U0126, or PD 325901. In one embodiment, the first kinase inhibitor is an FGFR inhibitor. In one embodiment, the first kinase inhibitor is an ALK inhibitor. In one embodiment, the first kinase inhibitor is an IGFR1 inhibitor. In one embodiment, the cancer is breast cancer (eg, triple negative breast cancer), head and neck cancer (eg, head and neck squamous cell carcinoma), non-small cell lung cancer, colorectal cancer, esophageal squamous cell carcinoma, or melanoma. In one embodiment, the patient is treated with a compound of formula I as a single agent. In one embodiment, the patient is treated with a combination of a compound of Formula I and a first kinase inhibitor. In one embodiment, the compound of formula I and the previously prescribed kinase inhibitor are administered in separate doses sequentially in any order.

In one embodiment of the cancer treatment methods disclosed herein, the compounds of formula I can be used as monotherapy for the treatment of patients who have developed primary or acquired resistance to chemotherapy.

In one embodiment of the cancer treatment methods disclosed herein, compounds of Formula I may be used in combination with a chemotherapeutic agent to treat patients who have developed primary or acquired resistance to the chemotherapeutic agent.

In one embodiment, provided herein are methods of treating a patient with cancer who has previously received treatment with a chemotherapeutic agent, comprising administering to said patient a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof. In one embodiment, the patient is treated with a compound of Formula I as a single agent. In one embodiment, the patient is receiving treatment with a combination of a compound of Formula I and a previously administered chemotherapeutic agent. In one embodiment, the chemotherapy drug is selected from taxane-based chemotherapy (eg, docetaxel), dexamethasone, and cytarabine. In one embodiment, the patient is treated with a compound of formula I as a single agent. In one embodiment, the patient is treated with a compound of Formula I in combination with a previously administered chemotherapy drug. In one embodiment, the compound of formula I and the previously administered chemotherapeutic agent are administered as separate doses sequentially in any order. In one embodiment, the cancer is selected from leukemias (including acute myeloid leukemia and chronic myeloid leukemia, B-cell acute lymphoblastic leukemia and T-cell acute lymphoblastic leukemia), non-small cell lung cancer, pancreatic ductal adenocarcinoma, astrocytoma, lung adenocarcinoma, ovarian cancer , melanoma and glioblastoma multiforme.

In one embodiment, provided herein are methods of treating a patient with cancer who has previously received treatment with a chemotherapeutic agent, comprising (a) determining that said cancer overexpresses TAM kinase and/or c-Met kinase (e.g., compared to non-cancerous tissue or a cell in a patient or other subject) and (b) after (a) administering to said patient a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt thereof. In one embodiment, the step of determining if the cancer overexpresses TAM kinase and/or c-Met kinase comprises the step of performing an analysis of a sample obtained from the patient to determine if the patient has abnormal expression, level, and/or activity of one or more TAM kinases and/or c-Met kinases, eg AXL and/or MER and/or TYRO3 and/or c-Met kinases. In one embodiment, the method further includes obtaining a sample from the patient. In one embodiment, the sample is a biopsy sample. In one embodiment, the assay is selected from the group consisting of sequencing, immunohistochemistry, enzyme-linked immunosorbent assay, and fluorescence in situ hybridization (FISH). In one embodiment, the patient is treated with a compound of formula I as a single agent. In one embodiment, the patient is receiving treatment with a combination of a compound of Formula I and a previously administered chemotherapeutic agent. In one embodiment, the chemotherapy drug is selected from taxane-based chemotherapy (eg, docetaxel), dexamethasone, and cytarabine. In one embodiment, the patient is treated with a compound of formula I as a single agent. In one embodiment, the patient is treated with a compound of Formula I in combination with a previously administered chemotherapy drug. In one embodiment, the compound of formula I and the previously administered chemotherapeutic agent are administered as separate doses sequentially in any order. In one embodiment, the cancer is selected from leukemias (including acute myeloid leukemia and chronic myeloid leukemia, B-cell acute lymphoblastic leukemia and T-cell acute lymphoblastic leukemia), non-small cell lung cancer, pancreatic ductal adenocarcinoma, astrocytoma, lung adenocarcinoma, ovarian cancer , melanoma and glioblastoma multiforme.

In one embodiment, provided herein is a method of treating a subject with cancer, wherein the method comprises (a) determining that a cancer cell in a sample obtained from a subject with cancer who has previously received one or more doses of a chemotherapeutic agent overexpresses one or more TAM kinases and/or c-Met kinase (eg, compared to a non-cancerous tissue or cell from a subject or another subject); and (b) administering a compound of formula I, or a pharmaceutically acceptable salt or solvate thereof, as monotherapy or in combination with a previously administered chemotherapeutic agent or other chemotherapeutic agent. In one embodiment, a cancer previously treated with a chemotherapeutic agent overexpresses AXL. In one embodiment, a cancer previously treated with a chemotherapeutic agent overexpresses MER. In one embodiment, a cancer previously treated with a chemotherapeutic agent overexpresses TYRO3. In one embodiment, a cancer previously treated with a chemotherapeutic agent overexpresses c-Met kinase. In one embodiment, the patient is treated with a compound of formula I as a single agent. In one embodiment, the patient is receiving treatment with a combination of a compound of Formula I and a previously administered chemotherapeutic agent. In one embodiment, the chemotherapy drug is selected from taxane-based chemotherapy (eg, docetaxel), dexamethasone, and cytarabine. In one embodiment, the patient is treated with a compound of formula I as a single agent. In one embodiment, the patient is treated with a compound of Formula I in combination with a previously administered chemotherapy drug. In one embodiment, the compound of formula I and the previously administered chemotherapeutic agent are administered as separate doses sequentially in any order. In one embodiment, the cancer is selected from leukemias (including acute myeloid leukemia and chronic myeloid leukemia, B-cell acute lymphoblastic leukemia and T-cell acute lymphoblastic leukemia), non-small cell lung cancer, pancreatic ductal adenocarcinoma, astrocytoma, lung adenocarcinoma, ovarian cancer , melanoma and glioblastoma multiforme.

Also provided herein are (i) a pharmaceutical combination for the treatment of cancer in a patient in need thereof, which comprises (a) a compound of Formula I, or a pharmaceutically acceptable salt thereof, and (b) at least one additional anticancer agent (e.g., any of examples of additional anticancer agents described herein or known in the art), for simultaneous, separate or sequential use in the treatment of cancer, wherein the amounts of a compound of Formula I or a pharmaceutically acceptable salt thereof and the additional anticancer agent together are effective in treating cancer; (ii) a pharmaceutical composition comprising such a combination; (iii) using such a combination to produce a medicament for the treatment of cancer; and (iv) a commercial package or product comprising a combination such as a combined preparation for simultaneous, separate or sequential use; and to a method of treating cancer in a patient in need thereof. In one embodiment, the patient is a human. In some embodiments, the cancer is a TAM-associated cancer.

The term "pharmaceutical combination" as used herein refers to a pharmaceutical dosage form obtained by mixing or combining more than one active ingredient, and includes both fixed and non-fixed combinations of active ingredients. The term "fixed combination" means that a compound of formula I, or a pharmaceutically acceptable salt thereof, and at least one additional anticancer agent (eg, a chemotherapeutic agent) are administered to a patient simultaneously in the form of a single composition or dose. The term "non-fixed combination" means that a compound of formula I, or a pharmaceutically acceptable salt thereof, and at least one additional anticancer agent (e.g., a chemotherapeutic agent) are formulated as separate compositions or doses so that they can be administered to a patient in need thereof at the same time. , separately or sequentially, without any particular time limitation, where such administration provides effective levels of two or more compounds in the patient's body. This also applies to a mixture of preparations, for example the administration of three or more active ingredients.

Accordingly, the present document also provides a method for treating cancer comprising administering to a patient in need thereof a pharmaceutical combination for treating cancer which comprises (a) a compound of formula I or a pharmaceutically acceptable salt thereof, and (b) an additional anti-cancer agent, for simultaneously, separate or sequential use for the treatment of cancer, wherein the amounts of a compound of Formula I, or a pharmaceutically acceptable salt thereof, and an additional anticancer agent together are effective in treating cancer. In one embodiment, the compound of formula I, or a pharmaceutically acceptable salt thereof, and an additional anticancer agent are administered simultaneously in separate doses. In one embodiment, the compound of Formula I, or a pharmaceutically acceptable salt thereof, and the additional anticancer agent are administered in separate doses sequentially in any order, in jointly therapeutically effective amounts, eg, in daily or discrete doses. In one embodiment, the compound of formula I, or a pharmaceutically acceptable salt thereof, and an additional anticancer agent are administered simultaneously as a combined dose.

Accordingly, the present document also provides methods of inhibiting, preventing, assisting in the prevention, or reducing the symptoms of cancer metastasis in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. Such techniques may be used in the treatment of one or more of the cancers described herein. In some embodiments, the cancer is TAM-associated cancer, c-Met-associated cancer, or both. In some embodiments, a compound of formula I, or a pharmaceutically acceptable salt thereof, is used in combination with an additional anticancer agent, including immunotherapy.

The term "metastasis" is a term known in the art and means the formation of an additional tumor (eg, a solid tumor) at a site remote from the primary tumor in a subject or patient, where the additional tumor includes the same or similar cancer cells as the primary tumor.

Also provided are methods for reducing the risk of developing metastases or additional metastases in a patient suffering from TAM-associated cancer, c-Met-associated cancer, or both, which include: selecting, identifying or diagnosing a patient with TAM-associated cancer, c-Met-associated cancer or both, and administering a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, to a patient selected, identified, or diagnosed as having TAM-associated cancer, c-Met-associated cancer, or both. Also provided are methods for reducing the risk of developing metastases or additional metastases in a patient suffering from TAM-associated cancer, c-Met-associated cancer, or both, which comprises administering a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt or diluent thereof, to a patient suffering from TAM- associated cancer, c-Met-associated cancer, or both. The reduction in the risk of metastasis or additional metastasis in a patient with TAM-associated cancer, c-Met-associated cancer, or both can be compared with the risk of metastasis or additional metastasis in a patient before treatment, or compared with a patient or group of patients suffering from a similar or the same TAM-associated cancer, c-Met-associated cancer, or both that received no treatment or other treatment.

The phrase "risk of metastasis" means the risk that a subject or patient with a primary tumor will develop an additional tumor (e.g., a solid tumor) at a site remote from the subject's or patient's primary tumor within a specified period of time, where the additional tumor includes the same or similar cancer cells as the primary tumor. Methods for reducing the risk of developing metastases in a subject or patient suffering from cancer are described herein.

The phrase "risk of developing additional metastases" means the risk that a subject or patient having a primary tumor and one or more additional tumors at sites distant from the primary tumor (where one or more additional tumors include the same or similar cancer cells as primary tumor), one or more additional tumors will develop at a distance from the primary tumor, where the additional tumors include the same or similar cancer cells as the primary tumor. Ways to reduce the risk of developing additional metastases are described in this document.

Also provided is a method for inhibiting TAM kinase activity and/or inhibiting c-Met kinase activity in a cell (eg, mammalian cell), comprising contacting the cell with a compound of formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In one embodiment, bringing into contact is carried out in vitro . In one embodiment, bringing into contact is carried out in vivo . In one embodiment, the contact is carried out in vivo, wherein the method comprises administering an effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, to a subject having a cell having TAM kinase activity and/or c-Met kinase activity. In some embodiments, the cell is a cancer cell (eg, a human cancer cell). In one embodiment, the cancer cell is any cancer as described herein. In some embodiments, the cancer cell is a TAM-associated cancer cell. In some embodiments, the cancer cell is a c-Met associated cancer cell. In some embodiments, the cancer cell is both a TAM-associated cancer cell and a c-Met-associated cancer cell.

In some embodiments, the mammalian cell is in vitro . In some embodiments, the mammalian cell is in vivo . In some embodiments, the mammalian cell is located ex vivo.

Also provided herein is a method for inhibiting cell proliferation in vitro or in vivo, comprising contacting a cell with an effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein.

Also provided herein are methods for reducing immune tolerance in a subject in need thereof, which comprises administering to the subject a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein. As used herein, the term “immune tolerance” refers to a reduction (e.g., from 1% to about 99% reduction, or any subrange of that range described herein) of one or more of: the processing of tumor-associated antigens by antigen-presenting cells (e.g., , dendritic cells), presentation of antigens to tumor antigen-specific T cells, activation and proliferation of tumor antigen-specific T cells, and maintenance of a T cell response in a subject (e.g., in a solid tumor in a subject), e.g., compared to control (for example, the corresponding level in a similar subject who does not have cancer)). In some embodiments of these methods, a cancer has been identified or diagnosed in a subject (e.g., TAM-associated cancer (e.g., any of the typical TAM-associated cancers described herein), c-Met-associated cancer (e.g., any of the typical c-Met-associated cancers described herein), or both). In some examples, a decrease in immune tolerance in a subject can be detected by observing from about 1% to about 99% (e.g., from about 1% to about 95%, from about 1% to about 90%, from about 1% to about 85% , from about 1% to about 80%, from about 1% to about 75%, from about 1% to about 70%, from about 1% to about 65%, from about 1% to about 60%, from about 1% up to about 55%, from about 1% to about 50%, from about 1% to about 45%, from about 1% to about 40%, from about 1% to about 35%, from about 1% to about 30%, from about 1% to about 25%, from about 1% to about 20%, from about 1% to about 15%, from about 1% to about 10%, from about 1% to about 5%, from about 5% to about 99%, from about 5% to about 90%, from about 5% to about 85%, from about 5% to about 80%, from about 5% to about 75%, from about 5% to about 70%, from about 5% to about 65%, from about 5% to about but 60%, from about 5% to about 55%, from about 5% to about 50%, from about 5% to about 45%, from about 5% to about 40%, from about 5% to about 35%, from about 5% to about 30%, about 5% to about 25%, about 5% to about 20%, about 5% to about 10%, about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 85%, about 10% to about 80%, about 10% to about 75%, about 10% to about 70%, from about 10% to about 65%, about 10% to about 60%, about 10% to about 55%, about 10% to about 50%, about 10% to about 45%, about 10% to about 40 %, from about 10% to about 35%, from about 10% to about 30%, from about 10% to about 25%, from about 10% to about 20%, from about 10% to about 15%, from about 15 % to about 99%, from about 15% to about 95%, from about 15% to about 90%, from about 15% to about 85%, about 15% to about 80%, about 15% to about 75%, about 15% to about 70%, about 15% to about 65%, about 15% to about 60 %, from about 15% to about 55%, from about 15% to about 50%, from about 15% to about 45%, from about 15% to about 40%, from about 15% to about 35%, from about 15 % to about 30%, from about 15% to about 25%, from about 15% to about 20%, from about 20% to about 99%, from about 20% to about 95%, from about 20% to about 90% , from about 20% to about 85%, from about 20% to about 80%, from about 20% to about 75%, from about 20% to about 70%, from about 20% to about 65%, from about 20% up to about 60%, from about 20% to about 55%, from about 20% to about 50%, from about 20% to about 45%, from about 20% to about 40%, from about 20% to about 35%, about 20% to about 30%, about 20% to about 25%, about 25% to approx. about 99%, from about 25% to about 95%, from about 25% to about 90%, from about 25% to about 85%, from about 25% to about 80%, from about 25% to about 75%, from about 25% to about 70%, about 25% to about 65%, about 25% to about 60%, about 25% to about 55%, about 25% to about 50%, about 25% to about 45%, about 25% to about 40%, about 25% to about 35%, about 25% to about 30%, about 30% to about 99%, about 30% to about 95%, from about 30% to about 90%, about 30% to about 85%, about 30% to about 80%, about 30% to about 75%, about 30% to about 70%, about 30% to about 65 %, from about 30% to about 60%, from about 30% to about 55%, from about 30% to about 50%, from about 30% to about 45%, from about 30% to about 40%, from about 30 % to about 35%, from about 35% to about 99%, from about 35% to about 95% , from about 35% to about 90%, from about 35% to about 85%, from about 35% to about 80%, from about 35% to about 75%, from about 35% to about 70%, from about 35% up to about 65%, from about 35% to about 60%, from about 35% to about 55%, from about 35% to about 50%, from about 35% to about 45%, from about 35% to about 40%, from about 40% to about 99%, from about 40% to about 95%, from about 40% to about 90%, from about 40% to about 85%, from about 40% to about 80%, from about 40% to about 75%, from about 40% to about 70%, from about 40% to about 65%, from about 40% to about 60%, from about 40% to about 55%, from about 40% to about 50%, from about 40% to about 45%, about 45% to about 99%, about 45% to about 95%, about 45% to about 90%, about 45% to about 85%, about 45% to about 80%, about 45% to about 75%, about 45% to about 70%, from about 45% to about 65%, about 45% to about 60%, about 45% to about 55%, about 45% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 85%, about 50% to about 80%, about 50% to about 75%, about 50% to about 70%, from about 50% to about 65%, about 50% to about 60%, about 50% to about 55%, about 55% to about 99%, about 55% to about 95%, about 55% to about 90 %, from about 55% to about 85%, from about 55% to about 80%, from about 55% to about 75%, from about 55% to about 70%, from about 55% to about 65%, from about 55 % to about 60%, from about 60% to about 99%, from about 60% to about 95%, from about 60% to about 90%, from about 60% to about 85%, from about 60% to about 80% , from about 60% to about 75%, from about 60% to about 70%, from about 60% to about 65%, from about 65% to about 99%, from about 65% to about 95%, from about 65% to about 90%, from about 65% to about 85%, from about 65% to about 80%, from about 65% to about 75%, about 65% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 85%, from about 70% to about 80%, from about 70% to about 75%, from about 75% to about 99%, from about 75% to about 95%, from about 75% to about 90%, from about 75% to about 85%, about 75% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 80% to about 85 %, from about 85% to about 99%, from about 85% to about 95%, from about 85% to about 90%, from about 90% to about 99%, from about 90% to about 95%, or from about 95% to about 99%) reduction in myeloid-derived suppressor cells MDSC (e.g., cells characterized by CD33, CD14 expression, and low levels of HLA DR) in a subject (e.g., in a blood sample or a biopsy sample obtained from a subject) (e.g., compared to a subject's MDSC level before initiation of treatment (eg, prior to the administration of any of the compounds of formula I or any of the pharmaceutical compositions described herein).

In some examples, a decrease in immune tolerance in a subject can be determined by observing from about 1% to about 99% (or any of the subranges of this range described herein) of a decrease in the level of Treg cells (for example, cells characterized by the expression of CD4, FOXP3 and CD25) in a subject (e.g., in a blood sample or a biopsy sample obtained from a subject) (e.g., compared to the subject's Treg level prior to treatment (e.g., prior to administration of any of the compounds of formula I or any of those described herein). pharmaceutical composition document).

In some examples, a decrease in immune tolerance in a subject can be determined by observing from about 1% to about 99% (or any of the subranges of this range described herein) of a decrease in the level of dendritic cells with reduced expression of CD80/CD86 in a subject (for example, in sample containing blood or a biopsy sample obtained from the subject) (for example, compared with the level of dendritic cells with reduced expression of CD80/CD86 in the subject prior to treatment (for example, before administration of any of the compounds of formula I or any of those described herein pharmaceutical compositions) Examples of methods for determining levels of MDSC, Treg and CD80/CD86 down-expressing dendritic cells include cell sorting by fluorescence and immunofluorescence microscopy.

Also provided herein are methods for inhibiting angiogenesis in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, as defined herein. In some embodiments, the angiogenesis is tumor angiogenesis and the subject has been identified or diagnosed with cancer (eg, TAM-associated cancer, c-Met-associated cancer, or both). In some embodiments, these methods result in a reduction (e.g., from 1% to about 99% reduction, or any of the subranges of this range described herein) in the rate of new blood vessel development (e.g., compared to the rate of new blood vessel development in similar subject receiving placebo or other treatment for a similar period of time). Examples of methods for detecting new blood vessel formation include Doppler ultrasound (eg, color Doppler mapping), ultrasound-guided optical diffusion tomography, MRI, perfusion CT (also called functional multidetector helical CT (f-MDCT)), positron emission tomography (PET) , dynamic MRI, dynamic susceptibility contrast-enhanced MRI (DSC-MRI), and T1-weighted dynamic MRI (DCE-MRI). Non-limiting methods that can be used to detect new blood vessel formation (angiogenesis) are described in Jeswani et al. , Cancer Imaging 5(1):131-138, 2005.

Also provided herein are methods of suppressing (e.g., reducing, e.g., 1% to about 99% reduction, or any of the subranges of this range described herein) resistance to a therapeutic agent in a subject in need thereof, which comprises administering to the subject a therapeutically effective amount of (i) a compound of formula I or a pharmaceutically acceptable salt thereof, or any of its pharmaceutical compositions described herein, and (ii) a therapeutic agent, where the therapeutic agent is selected from the group consisting of a chemotherapeutic agent, a PI-3 inhibitor -kinase, EGFR inhibitor, HER2/neu inhibitor, FGFR inhibitor, ALK inhibitor, IGF1R inhibitor, VEGFR inhibitor, PDGFR inhibitor, glucocorticoid, BRAF inhibitor, MEK inhibitor, HER4 inhibitor, MET inhibitor, RAF inhibitor, Akt inhibitor, FTL-3 inhibitor and an inhibitor of the MAP kinase pathway. In some examples of these methods, the c-Met inhibitor is a type 1 c-Met inhibitor such as crizotinib, capmatinib, NVP-BVU972, AMG 337, bositinib, glumetinib, savolitinib, or tepotinib. In some examples of these methods, a compound of Formula I, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition and a therapeutic agent thereof, is administered to the subject at substantially the same time. In some embodiments of these methods, the compound of Formula I, or a pharmaceutically acceptable salt or pharmaceutical composition thereof, and the therapeutic agent are formulated into a single dosage form. In some embodiments of these methods, (i) a compound of formula I or a pharmaceutical salt thereof, or any of their pharmaceutical compositions described herein, is administered to a subject prior to (ii) the therapeutic agent is administered to the subject. In some embodiments of these methods, (ii) the therapeutic agent is administered to the subject prior to the administration of (i) a compound of formula I, or a pharmaceutical salt thereof, or any of their pharmaceutical compositions described herein.

In some embodiments of these methods, a compound of Formula I, or a pharmaceutically acceptable salt or pharmaceutical composition thereof, is administered to a subject prior to administration of a therapeutic agent to the subject. In some embodiments of these methods, the therapeutic agent is administered to the subject prior to the administration of the compound of Formula I or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, to the subject.

As used herein, the term "therapeutic agent resistance" refers to a reduced or decreased level of responsiveness to treatment with a therapeutic agent (e.g., chemotherapeutic agent, PI-3 kinase inhibitor, EGFR inhibitor, HER2/neu inhibitor, FGFR inhibitor, ALK inhibitor, IGF1R, VEGFR inhibitor, PDGFR inhibitor, glucocorticoid, BRAF inhibitor, MEK inhibitor, HER4 inhibitor, MET inhibitor (e.g. c-Met kinase type 1 inhibitor, e.g. crizotinib, capmatinib and NVP-BVU972), RAF inhibitor, Akt inhibitor, an FTL-3 inhibitor and an inhibitor of the MAP kinase pathway) in a subject (eg, compared with a similar subject or compared with the level of sensitivity to a therapeutic agent at an earlier time point). For example, resistance to a therapeutic agent in a subject can be observed by a clinician, for example, by observing the need to increase the magnitude of doses of the therapeutic agent over time to achieve the same therapeutic effect in the subject, observing the need to increase the number of doses, and/or increasing the frequency of dosing of the therapeutic agent. over time to achieve the same therapeutic effect in a subject, decrease in observed therapeutic response to treatment with the same dosage of therapeutic agent over time, or observed disease progression or disease recurrence in a subject administered a therapeutic agent

When used as pharmaceuticals, the compounds of formula I may be administered in the form of pharmaceutical compositions. These compositions may be prepared in a manner well known in the pharmaceutical art and may be administered in a variety of ways depending on whether topical or systemic treatment is required and the area to be treated. Administration may be topical (including transdermal, epidermal, ophthalmic, and mucosal, including intranasal, vaginal, and rectal administration), pulmonary (eg, by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal or intranasal), oral or parenteral. Oral administration may include a once-daily or twice-daily (BID) dosage form. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, intramuscular administration or injection or infusion; or intracranial, eg intrathecal or intraventricular administration. Parenteral administration may be in the form of a single bolus dose or may be carried out, for example, using a continuous infusion pump. Pharmaceutical compositions and topical dosage forms may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oil bases, thickeners, and the like may be necessary or desirable. In one embodiment, the compound of formula I is in the form of a tablet. In one embodiment, the compound of formula I is obtained as a carsula. In one embodiment, the compound of formula I is administered orally. In one embodiment, the compound of formula I is administered orally once a day. In one embodiment, the compound of formula I is administered orally twice a day.

Also provided herein are pharmaceutical compositions which comprise, as an active ingredient, a compound of Formula I, or a pharmaceutically acceptable salt thereof, in combination with one or more pharmaceutically acceptable carriers (excipients). In some embodiments, the implementation of the composition is suitable for topical application. In preparing the compositions described herein, the active ingredient is usually mixed with an excipient, diluted with the excipient, or enclosed in such a carrier in the form of, for example, a capsule, sachet, paper, or other container. When an excipient serves as a diluent, it may be a solid, semi-solid, or liquid material that acts as a vehicle, carrier, or medium for the active ingredient. Thus, the compositions may be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (in solid or liquid medium), ointments containing, for example, up to 10% by weight active compound, soft and hard gelatin capsules, suppositories, sterile injections and powders in sterile packaging. In one embodiment, the composition is formulated for oral administration. In one embodiment, the composition is formulated as a tablet or capsule.

Compositions comprising a compound of Formula I, or a pharmaceutically acceptable salt thereof, may be formulated into unit dosage form, each dose containing from about 5 to about 1000 mg (1 g), more typically from about 100 mg to about 500 mg, of the active ingredient. The term "unit dosage form" refers to physically discrete units suitable as unit doses for humans and other patients, each unit containing a predetermined amount of the active substance (i.e., the compounds of formula I, as presented in the present description), calculated to obtain desired therapeutic effect, in combination with a suitable pharmaceutical excipient.

In some embodiments, the compositions provided herein include from about 5 mg to about 50 mg of the active ingredient. Those skilled in the art will appreciate that the present invention includes compounds or compositions containing from about 5 mg to about 10 mg, from about 10 mg to about 15 mg, from about 15 mg to about 20 mg, from about 20 mg to about 25 mg, about 25 mg to about 30 mg, about 30 mg to about 35 mg, about 35 mg to about 40 mg, about 40 mg to about 45 mg, or about 45 mg to about 50 mg of the active ingredient .

In some embodiments, the compositions provided herein include from about 50 mg to about 500 mg of the active ingredient. Those skilled in the art will appreciate that the present invention includes compounds or compositions containing from about 50 mg to about 100 mg, from about 100 mg to about 150 mg, from about 150 mg to about 200 mg, from about 200 mg to about 250 mg, about 250 mg to about 300 mg, about 350 mg to about 400 mg, or about 450 mg to about 500 mg of the active ingredient.

In some embodiments, the compositions provided herein include from about 500 mg to about 1000 mg of the active ingredient. Those skilled in the art will appreciate that the present invention includes compounds or compositions containing from about 500 mg to about 550 mg, from about 550 mg to about 600 mg, from about 600 mg to about 650 mg, from about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, or from about 950 mg to about 1000 mg of the active ingredient.

The active compound may be effective over a wide dosage range and is usually administered in a pharmaceutically effective amount. However, it should be understood that the amount of a compound actually administered will generally be determined by the physician in accordance with the relevant circumstances, including the condition to be treated, the chosen route of administration, the particular compound administered, the age, body weight and response of the individual patient, the severity of the patient's symptoms, and the like.

In some embodiments, the compounds provided herein can be administered in an amount of from about 1 mg/kg to about 100 mg/kg. In some embodiments, a compound provided herein may be administered in an amount of about 1 mg/kg to about 20 mg/kg, about 5 mg/kg to about 50 mg/kg, about 10 mg/kg to about 40 mg/kg, from about 15 mg/kg to about 45 mg/kg, from about 20 mg/kg to about 60 mg/kg, or from about 40 mg/kg to about 70 mg/kg. For example, about 5 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, about 30 mg/kg, about 35 mg/kg, about 40 mg/kg, about 45 mg/kg, about 50 mg/kg, about 55 mg/kg, about 60 mg/kg, about 65 mg/kg, about 70 mg/kg, about 75 mg/kg, about 80 mg/kg, about 85 mg/kg, about 90 mg/kg, about 95 mg/kg, or about 100 mg/kg. In some embodiments, such administration may be a once daily or twice daily (BID) administration.

One of skill in the art will appreciate that both in vivo and in vitro testing using suitable, known, and conventional cell and/or animal models predicts the ability of a test compound to treat or prevent a given disorder.

It should also be appreciated by one of skill in the art that human clinical trials, including first use studies in humans, with a range of doses and efficacy, in healthy patients and/or those suffering from the disorder, may be completed in accordance with in ways well known in the clinical and medical fields.

Examples

The following examples illustrate the invention.

Biological examples

Example A

AXL Enzyme Assay

Compounds of Formula I were screened for their ability to inhibit AXL kinase using LanthaScreen™ Eu Kinase Binding technology from Invitrogen. His-tagged recombinant human AXL cytoplasmic domain was incubated with 20 nM Alexa-Fluor® Tracer 236 (PR9078A), 2 nM biotinylated anti-His (Cat. No. M4408), and 2 nM europium labeled streptavidin (Cat. No. PV5899) together with the test compound in a buffer consisting of 25 mm HEPES, pH 7.4, 10 mm MgCl ₂ , 0.01% Triton X-100, and 2% DMSO. Compounds were typically prepared in 3-fold serial dilution in DMSO and added to the assay to obtain the appropriate final concentration. After 60 minutes of incubation at 22° C., the reaction mixture was measured using a PerkinElmer EnVision multimodal plate reader using two wave TR-FRET detection and percent control (POC) was calculated using the ratiometric emission factor. 100 POC was determined using no test compounds, and 0 POC was determined using the control compound concentration that completely inhibits the enzyme. The POC values correspond to a 4-parameter logistic curve and the IC ₅₀ value is the point where the curve intersects the 50 POC.

Example B

MER Enzyme Assay

Compounds of Formula I were screened for their ability to inhibit AXL kinase using LanthaScreen™ Eu Kinase Binding technology from Invitrogen. His-tagged recombinant human cytoplasmic domain MER (5 nM) was incubated with 20 nM Alexa-Fluor® Tracer 236 (PR9078A), 2 nM biotinylated anti-His (Cat. No. M4408), and 2 nM Europium labeled streptavidin (Cat. No. PV5899) along with test compound in a buffer consisting of 25 mM HEPES, pH 7.4, 10 mM MgCl ₂ , 0.01% Triton X-100 and 2% DMSO. Compounds were typically prepared in 3-fold serial dilution in DMSO and added to the assay to obtain the appropriate final concentration. After 60 minutes of incubation at 22° C., the reaction mixture was measured using a PerkinElmer EnVision multimodal plate reader using two wave TR-FRET detection and percent control (POC) was calculated using the ratiometric emission factor. 100 POC was determined using no test compounds, and 0 POC was determined using the control compound concentration that completely inhibits the enzyme. The POC values correspond to a 4-parameter logistic curve and the IC ₅₀ value is the point where the curve intersects the 50 POC.

Example C

TYRO3 Enzyme Assay

Compounds of Formula I were screened for their ability to inhibit TYRO3 kinase using LanthaScreen™ Eu Kinase Binding technology from Invitrogen. GST-tagged recombinant human TYRO3 kinase domain from Carna (5 nM; Cat. No. PR7480A) was incubated with 20 nM Alexa-Fluor® Tracer 236 (PR9078A) and 2 nM europium anti-GST (Cat. No. A15116) along with test compound in a buffer consisting of 25 mM HEPES, pH 7.4, 10 mM MgCl ₂ , 0.01% Triton X-100, and 2% DMSO. Compounds were typically prepared in 3-fold serial dilution in DMSO and added to the assay to obtain the appropriate final concentration. After 60 minutes of incubation at 22° C., the reaction mixture was measured using a PerkinElmer EnVision multimodal plate reader using two wave TR-FRET detection and percent control (POC) was calculated using the ratiometric emission factor. 100 POC was determined using no test compounds, and 0 POC was determined using the control compound concentration that completely inhibits the enzyme. The POC values correspond to a 4-parameter logistic curve and the IC50 value is the point where the curve intersects 50 POC.

The average IC ₅₀ values of the compounds tested in the analyzes of examples A, B and C are shown in table 7.

Table 7

Etc. Enzyme AXL IC ₅₀ Enzyme MER IC ₅₀ Enzyme TYRO3 IC ₅₀ one 6.1 13.2 21.6 2 2.7 3.9 10.7 3 1.8 4.7 46.7 four 1.8 3.6 18.2 5 4.6 8.3 30.2 6 5.6 5.1 15.4 7 3.6 5.1 16.5 eight 3.4 5.1 13.8 9 4.4 8.3 57.9 ten 7.1 11.4 45.7 eleven 9.4 18.3 86 12 18.3 36.8 295.4 13 four 7.2 16.9 fourteen 5.4 11.6 65.7 fifteen 4.4 10.4 48.1 16 2 4.1 34.1 17 2.8 8.4 56.8 eighteen 3.8 7.3 131.1 19 16.1 24.6 85.6 twenty 18.9 51.9 535.8 21 12.7 18.1 187.7 22 18.3 29.5 317.9 23 four 6.5 29.6 24 7.1 13.1 119.6 25 1.4 2.3 7.7 26 3.9 4.9 41.1 27 3.3 11.3 64.6 28 19.1 37.9 374.9 29 5.4 11.9 51.9 thirty 6.1 12.1 79.3 31 4.1 7.5 76.8 32 2.2 5.7 37.3 33 0.8 2.1 14.9 34 1.2 2.8 19.6 35 3.8 8.8 26.7 36 2.8 4.1 13.1 37 2.4 3.5 8.4 38 1.1 3.1 29.1 39 3.8 11.6 96.3 40 2.5 7.6 98.3 41 0.9 3.9 13.5 42 1.1 7.4 53.1 43 2.8 2.6 18.5 44 7.3 19.4 109.1 45 1.3 2.8 12.1 46 2 2.7 9 47 1.1 2.4 16.9 48 2 2.7 9.8 49 2.2 5.8 23.9 fifty 4.4 9.7 40.3 51 1.3 4.1 eighteen 52 1.8 3.9 28.4 53 1.8 4.6 31.7 54 3.5 four 41.2 55 1.1 2 7.4 56 1.5 3.5 20.7 57 1.9 4.1 20.8 58 2.2 4.3 9.7 59 1.8 3.7 25.4 60 5.9 6.1 28.1 61 2.6 4.1 22.5 62 3.3 7 41.6 63 5.6 8.2 37.7 64 3.8 5.1 19.2 65 one 5.4 65.6 66 1.3 1.9 10.9 67 1.1 3.4 10.8 68 1.3 5.5 32.3 69 1.4 5.7 26.5 70 one 5.1 25.7 71 5.2 8.5 192.1 72 0.9 2.3 6 73 1.1 10.8 23.8 74 1.6 32.5 97.5 75 0.6 3.8 22.2 76 0.5 2.5 4.2 77 0.7 2.8 7.2 78 one 3.1 8.2 79 1.2 2.9 19.7 80 1.6 4.1 38 81 1.8 four 21.8 82 1.6 5.3 19.3 83 0.5 1.6 7.2 84 0.6 1.9 4.3 85 one 1.7 4.4 86 4.8 eleven 104.1 87 12.6 33.4 432.5 88 6.5 30.2 363.5 89 0.7 19.1 74.3 90 0.8 13.1 76.6 91 1.1 4.7 four 92 1.5 4.4 16.3 93 4.7 259.6 766.6 94 2.9 8.7 19 95 15.4 176.5 874.8 96 2.9 9.6 19.7 97 1.2 3.1 4.8 98 1.3 5.6 12.4 99 5.7 92.8 545.8 100 1.6 1.6 3.9 101 49.7 60.4 198.2 102 2 3.3 44.1 103 0.6 0.9 3.2 104 1.8 2.6 14.1 105 1.1 four 9.8 106 1.6 6.8 16.1 107 2.3 3.3 9.2 108 0.9 2 6.1 109 0.9 5.2 18.7 110 1.3 6.6 38.5 111 4.4 12.5 136.9 112 1.6 6.4 70 113 1.8 5.6 60.4 114 1.5 5.2 7.1 115 1.2 4.3 6.4 116 1.4 4.5 11.4 117 0.8 3.1 13.6 118 1.8 6.1 26.2 119 1.8 3.1 4.7 120 5 6.2 27.3 121 1.6 2.1 4.6 122 3.4 9 44.7 123 1.3 3.8 15.3 124 1.8 3.5 8.3 125 1.3 2.7 7.1 126 1.5 2.4 6.7 127 1.1 2.3 3.7 128 1.2 5.3 23 129 0.8 1.8 3.2 130 1.3 5.8 27.1 131 2.1 9.1 47.4 132 8.6 70 347.9 133 5.3 37.8 129.9 134 4.6 32.8 169.2 135 3.5 17.2 64.4 136 3.3 26.7 88.8 137 5.8 27.4 74.3 138 6.2 36.7 159 139 1.7 10.8 86.2 140 354.6 161.2 1000 141 484.6 178.1 1000 142 3.2 5.7 15.6 143 3.1 5.7 41.2 144 2.4 9.6 88.8 145 0.8 3.3 20.9 146 1.8 7 46.5 147 5.6 45.9 91.2 148 1.3 3.1 12.2 149 2 4.1 twenty 150 1.6 4.4 13.6 151 2 2.2 2.3 152 1.3 4.9 8.7 153 2 7.9 28.2 154 1.6 5.9 14.4 155 1.6 5.6 59.5 156 1.2 5.2 59.5 157 1.4 6.2 118.3 158 2 13.4 104 159 2.2 18.7 420.2 160 1.3 2.7 15.4 161 1.9 four 28 162 1.3 5.4 37.9 163 1.1 2.6 5.5 164 1.7 11.8 68.9 165 3.3 13.7 90 166 22.7 72.5 475.9 167 3.4 19.8 224.5 168 4.9 11.9 248 169 0.7 1.5 4.4 170 1.9 3.9 36.2 171 3 27.1 333.3 172 4.2 8.3 132.7 173 7.1 15.7 114.1 174 1.4 4.6 98.6 175 5.6 23.2 292.2 176 4.2 22 728 177 1.6 3.5 106.1 178 3.6 11.5 439.2 179 1.3 6 80.6 180 2 11.9 140 181 2.5 4.1 30.8 182 8.6 16.7 706.8 183 5.4 eighteen 108.7 184 1.8 2.7 35.2 185 1.3 2.3 18.4 186 6.6 18.9 217.4 187 1.9 3.5 11.9 188 1.9 1.7 7.8 189 5.8 7.5 69.6 190 1.2 1.8 5 191 4.8 8.9 73.2 192 3.5 10.8 61.4 193 2.2 6.5 12.1 194 4.8 11.2 97.4 195 1.5 3.8 13.4 196 one 10.5 22 197 1.1 12.7 52.3 198 1.3 5.5 23.3 199 1.6 2.7 4.5 200 1.3 1.9 3.4 201 1.3 2.2 3.8

Example D.

c-Met Enzyme Assay

experimental part

The binding affinity of the compound for wild-type and mutant human MET kinases was measured using the LanthaScreen™ Eu Kinase Binding technology from Invitrogen. Briefly, GST-labeled recombinant human MET kinase domain from Signal Chem (see Table 8 below for assay concentration) was incubated with 50 nM Alexa-Fluor® Tracer 236 (Invitrogen Cat No. PR9078A) and 2 nM europium anti- GST (Invitrogen Cat. No. A15116) along with test compound in a buffer consisting of 25 mM HEPES, pH 7.4, 10 mM MgCl2, 0.01% Triton X-100, 1 mM DTT, and 2% DMSO. Compounds were typically prepared in 3-fold serial dilutions in DMSO and added to the assay to obtain the appropriate final concentration. After 60 minutes of incubation at 22° C., the reaction mixture was measured using a PerkinElmer EnVision multimodal plate reader using two wave TR-FRET detection and percent control (POC) was calculated using the ratiometric emission factor. 100 POC was determined using no test compounds, and 0 POC was determined using the control compound concentration that completely inhibits the enzyme. The POC values correspond to a 4-parameter logistic curve and the IC ₅₀ value is the point where the curve intersects the 50 POC.

Table 8. Concentration of wild-type and mutant MET kinases in the binding assay

mutant Met enzyme Source Catalog number Amino acids MET Enzyme Concentration in Binding Assay (nM) del Ex14 SignalChem M52-12PG 956-1390 (end) 5 L1195V SignalChem NP-18-156G 956-1390 (end) ten F1200I SignalChem M52-12GG 956-1390 (end) 2 D1228H SignalChem M52-12HG 956-1390 (end) 2 D1228N SignalChem M52-12IG 956-1390 (end) 2 Y1230C SignalChem M52-12KG 956-1390 (end) 2 Y1230H SignalChem M52-12MG 956-1390 (end) 5 Y1230S SignalChem NP18-157G 956-1390 (end) eight MET (wild type (wt)) SignalChem M52-18G 956-1390 (end) ten

results

Table 9. IC50 values for wild-type and mutant kinase inhibition of MET kinases of exemplary compounds tested

Etc. # SigChem WT IC50 (nM) Del14
IC50 (nM) D1228H IC50 (nM) D1228N
IC50 (nM) F1200I IC50 (nM) L1195V IC50 (nM) Y1230C IC50 (nM) Y1230H
IC50 (nM) Y1230S
IC50 (nM) 2 3.9 13.0 11.2 7.6 6.8 125.9 3.9 15.8 8.2 3 3.7 9.6 16.6 5.2 3.6 133.4 3.9 3.9 3.9 four 3.0 9.3 19.7 3.8 4.9 116.7 10.1 9.4 6.3 5 3.3 7.6 21.2 4.3 5.1 116.1 3.1 7.7 5.0 6 9.2 31.4 61.5 13.5 11.3 244.1 11.2 22.1 13.8 7 12.4 28.2 51.6 15.4 18.8 452.8 15.4 26.5 16.0 eight 3.0 12.8 19.7 5.4 6.2 145.2 4.2 11.8 4.8 12 17.6 92.1 161.5 19.8 24.0 828.8 50.0 53.5 39.9 13 3.7 9.7 22.7 3.2 4.4 121.0 4.6 7.9 4.2 fourteen 17.5 104.4 181.7 24.1 15.8 961.5 31.5 48.4 41.3 16 3.2 8.9 22.6 5.3 4.4 101.6 3.5 10.9 4.5 17 26.5 107.7 183.6 38.5 34.2 1383.4 44.4 59.1 30.9 eighteen 49.8 116.4 435.0 87.4 75.2 3787.7 147.6 173.9 123.0 19 40.1 130.3 266.9 56.5 81.0 2060.5 121.4 125.2 100.4 twenty 19.8 85.4 169.7 48.6 41.3 919.2 30.8 81.8 52.2 21 21.7 80.0 143.4 31.0 36.8 2122.0 68.9 92.8 59.5 22 22.1 78.1 141.8 63.3 48.1 2861.3 41.3 94.8 30.8 23 7.7 23.3 36.9 12.2 13.1 514.7 13.7 18.3 15.7 24 13.9 101.7 132.1 19.2 25.0 1520.4 29.5 56.9 26.0 25 2.5 6.9 11.5 4.2 3.4 84.4 2.9 7.3 3.3 26 21.2 63.7 113.2 31.4 31.4 911.9 31.8 61.8 44.8 27 2.7 7.6 14.1 5.0 3.3 77.1 3.7 8.5 5.0 28 1.2 22.9 49.0 16.3 11.9 508.1 11.5 22.0 22.6 29 3.9 14.6 30.9 7.5 7.1 6.9 16.1 8.8 thirty 4.4 19.6 28.6 6.2 4.9 166.1 6.3 12.4 6.1 31 10.1 31.8 52.9 15.7 15.1 415.7 16.6 22.0 15.4 32 3.4 7.2 9.6 5.4 4.3 101.7 3.8 5.6 3.5 33 23.6 62.5 132.2 35.8 28.2 1107.5 29.6 64.3 26.4 34 1.5 3.9 6.8 2.3 2.6 60.7 2.9 5.0 2.4 35 10.6 31.0 51.7 16.5 17.2 347.7 19.3 26.6 15.6 36 3.4 10.2 14.2 4.4 4.1 83.3 2.4 9.2 4.8 37 1.1 4.6 6.1 1.9 1.3 44.6 1.3 3.9 2.2 38 9.4 21.5 42.7 13.0 13.2 280.4 12.8 25.0 10.7 39 9.5 25.4 48.7 13.8 13.2 451.2 19.5 26.5 10.5 40 4.9 39.5 59.1 8.7 15.6 487.8 17.2 19.8 9.4 41 2.6 9.3 14.3 3.3 3.6 89.5 3.6 7.6 2.7 42 8.5 31.6 38.5 11.1 9.5 297.8 6.6 19.4 6.0 43 6.3 12.0 23.8 9.1 7.4 292.6 10.5 13.9 5.4 44 9.7 42.1 57.3 12.0 15.0 641.0 16.3 24.0 12.0 45 1.9 3.8 4.9 3.1 1.4 75.3 1.4 2.6 1.8 46 12.2 13.9 21.5 12.5 9.7 102.2 9.5 15.9 10.2 47 4.7 9.0 16.3 5.8 8.0 236.8 6.3 12.0 15.0 fifty 8.0 23.3 26.7 11.9 13.5 446.4 8.2 22.2 15.6 51 3.8 7.0 7.8 6.7 4.9 68.8 5.4 5.2 5.4 52 5.9 10.7 11.7 12.0 8.1 141.3 7.2 7.8 6.3 53 18.1 76.0 109.6 32.0 23.6 772.6 21.3 48.8 28.1 54 7.3 33.5 42.8 9.5 12.9 516.5 15.4 21.6 11.3 55 2.6 6.0 7.7 5.4 3.2 34.4 2.6 4.3 2.8 56 2.9 8.4 14.8 3.4 3.6 75.8 3.0 4.9 3.2 57 18.2 33.0 120.0 15.9 15.4 575.7 10.7 43.9 18.3 58 7.2 12.7 34.8 7.6 7.5 256.8 9.1 19.9 9.7 59 5.7 31.0 38.1 9.6 7.8 347.0 9.3 7.9 8.4 60 8.2 21.3 39.2 15.3 11.5 363.1 21.2 17.4 7.9 61 3.0 4.6 11.7 3.4 3.8 75.9 2.9 5.8 4.7 62 29.4 81.0 129.4 30.9 31.9 1187.8 37.2 50.6 42.6 63 6.9 15.3 36.6 5.3 8.9 321.3 9.0 13.0 6.8 64 15.5 28.2 46.6 23.6 20.3 18.3 37.2 21.1 65 3.5 4.6 16.3 10.1 5.0 194.6 3.6 10.1 4.8 67 2.6 1.8 3.4 4.0 1.4 9.9 1.1 3.2 2.6 68 2.7 4.9 6.6 4.2 4.6 33.4 2.3 4.6 3.2 69 5.1 5.7 7.1 7.5 7.0 55.9 3.9 5.9 5.3 70 7.0 12.1 13.6 12.7 9.4 67.9 6.4 7.6 4.5 71 38.5 183.1 302.8 38.5 62.3 2169.7 79.3 88.8 89.8 72 2.0 1.7 2.0 2.3 2.3 8.4 1.2 2.5 1.0 73 4.3 4.6 4.3 5.6 4.1 27.1 2.6 4.6 2.8 75 3.5 7.2 7.6 4.8 12.8 40.7 3.1 4.9 2.7 76 2.2 6.0 4.9 3.8 3.1 29.7 1.7 4.6 1.8 77 2.5 4.8 4.1 4.3 2.2 36.0 1.5 5.8 79 3.9 4.0 3.6 3.6 2.2 18.1 1.5 4.6 2.7 80 4.3 4.9 6.2 4.9 3.0 19.5 3.0 4.0 3.6 81 3.2 1.7 2.7 3.4 2.2 5.9 2.7 2.5 1.4 84 1.5 1.0 1.5 2.2 2.0 6.0 1.7 1.2 1.2 86 19.0 81.8 96.4 36.5 36.9 1558.5 23.2 86.6 41.5 87 37.2 105.9 73.2 67.9 42.7 838.9 44.8 118.1 84.6 88 7.3 63.5 39.1 21.3 562.5 12.4 50.3 22.5 89 3.3 9.0 12.6 8.2 5.4 115.5 4.6 9.1 6.4 90 19.3 101.3 110.0 35.0 43.2 2453.5 58.2 93.3 49.8 91 1.2 0.9 1.8 2.3 1.6 3.6 1.1 1.1 1.8 92 1.3 3.4 4.0 3.0 3.0 45.8 1.9 2.3 1.7 93 23.4 66.3 107.4 35.5 19.6 2636.3 32.9 63.3 35.7 94 10.2 7.2 8.9 17.5 8.4 46.0 9.3 12.1 6.3 95 98.8 163.4 294.2 85.8 94.6 2206.4 89.1 267.9 78.4 96 10.0 16.2 26.1 13.0 202.2 13.8 23.4 13.8 97 4.1 10.1 19.2 5.9 4.7 85.8 3.8 12.4 4.0 98 4.0 4.8 6.8 5.0 2.9 29.6 2.3 5.7 4.1 99 51.0 202.3 370.1 109.0 105.9 3226.1 106.7 234.3 120.0 100 1.1 1.2 1.7 1.7 1.4 9.9 0.7 2.1 1.2 101 18.9 40.7 36.8 31.9 26.4 290.4 15.6 66.1 35.6 102 1.3 7.1 4.0 1.4 2.4 79.8 1.6 4.6 1.2 103 0.8 0.9 1.5 1.8 0.6 11.6 0.6 1.5 0.8 104 1.3 3.6 6.0 3.0 2.0 36.2 1.6 4.0 1.6 105 1.7 2.8 3.9 4.9 2.5 28.3 3.1 4.1 2.3 106 3.5 3.0 4.0 5.8 3.9 20.5 3.3 6.4 3.8 107 1.5 3.7 4.1 4.9 3.7 25.6 2.8 4.5 2.9 108 1.3 2.3 3.5 2.8 2.3 33.0 1.2 4.1 1.8 109 4.0 7.2 18.0 6.6 4.2 114.3 4.4 9.5 4.2 110 2.8 6.5 6.7 3.6 6.0 50.4 2.7 5.7 2.2 113 5.0 20.5 23.0 10.9 10.4 130.6 8.6 17.4 8.2 114 3.6 2.7 3.4 6.7 3.3 7.2 3.2 4.5 1.7 115 3.9 5.0 4.7 6.7 3.9 10.0 4.3 6.8 2.7 116 2.8 6.4 7.7 5.4 2.7 29.2 4.1 6.4 2.4 117 2.4 3.8 6.2 3.1 1.5 46.7 1.3 6.6 1.3 118 4.3 18.5 17.8 8.4 12.1 31.0 6.3 12.4 5.5 119 1.9 1.5 1.6 3.2 2.1 4.3 1.9 2.4 1.2 120 1.7 6.5 5.0 4.8 5.0 41.8 3.4 5.7 2.2 121 1.0 2.2 1.8 2.4 2.2 6.0 1.5 2.1 0.8 122 3.1 8.3 6.4 5.4 10.4 57.3 5.5 10.2 3.6 128 2.6 12.0 12.5 4.6 8.2 79.8 4.5 10.3 4.1 142 5.4 4.7 7.5 6.8 8.9 97.3 6.0 8.3 4.9 144 111.0 408.4 289.5 68.9 163.6 1819.2 117.2 483.0 289.8 145 4.2 9.6 14.7 8.4 6.8 184.3 4.9 12.1 9.1 146 2.4 5.6 7.9 5.1 5.3 31.5 2.7 6.3 3.6 147 73.3 277.4 256.5 154.4 133.8 2247.3 234.9 279.0 314.3 148 1.2 2.6 3.5 2.1 1.7 22.0 1.7 2.3 1.4 150 2.8 2.6 3.3 5.7 4.5 10.8 2.6 2.7 2.5 151 2.5 3.4 6.4 5.4 3.3 26.5 4.1 5.0 3.2 152 3.2 2.4 2.9 5.1 2.7 9.0 2.9 3.6 3.0 153 4.5 6.6 11.0 8.9 5.3 132.2 6.6 9.4 6.6 154 4.2 3.0 4.3 3.9 3.2 21.5 3.8 5.6 3.2 155 6.8 10.7 20.9 9.5 6.7 104.0 7.0 10.3 5.9 156 4.3 15.0 27.5 9.1 6.7 177.2 6.1 16.7 5.9 157 8.9 26.6 60.0 13.7 6.8 329.6 6.1 26.7 7.1 158 18.0 78.6 136.6 25.0 27.1 671.5 32.1 82.0 39.8 159 19.2 72.7 94.6 25.3 23.4 2007.9 20.1 54.6 20.8 160 1.5 3.3 8.3 3.2 1.8 38.7 2.3 4.4 1.6 161 3.2 3.4 4.1 5.2 2.9 22.4 3.1 4.7 3.2 162 3.1 4.6 6.3 5.4 2.1 43.3 3.4 4.3 3.5 163 2.5 5.9 8.0 3.0 4.0 50.5 4.5 6.2 3.5 164 4.2 6.2 7.3 6.7 4.5 35.2 6.1 6.6 4.3 166 29.8 50.7 78.8 38.8 28.5 329.2 33.6 44.4 18.1 167 33.6 156.4 134.7 55.7 74.1 598.9 86.3 128.4 71.0 168 9.4 52.0 39.8 12.5 20.6 285.2 10.3 32.8 10.4 169 2.8 3.8 3.9 4.0 1.6 27.4 2.1 4.5 1.9 170 8.7 37.9 14.9 10.9 4.8 143.0 5.1 16.6 5.5 171 9.0 40.9 16.5 9.7 17.3 114.9 10.4 18.9 8.9 172 3.6 16.5 16.1 5.7 4.7 42.9 3.8 7.1 2.8 173 27.3 106.2 153.9 44.6 51.2 913.9 70.8 63.8 41.6 179 2.4 3.1 4.5 5.3 4.1 17.8 3.0 4.2 3.4 181 6.7 12.2 14.9 8.1 8.7 110.3 6.5 12.0 10.0 182 65.1 393.2 624.9 60.1 97.9 4109.7 96.8 308.2 150.6 183 13.1 26.4 34.1 14.3 14.8 338.8 10.5 24.2 16.6 184 14.1 37.0 52.8 20.0 16.2 394.0 16.1 37.4 10.9 185 2.0 4.7 5.0 3.2 2.3 2.5 4.4 2.2 186 24.0 41.0 139.8 33.2 27.8 1182.7 46.8 74.1 35.1 187 8.5 14.8 46.9 18.4 8.9 259.5 8.6 22.3 13.6 189 14.0 33.4 61.3 11.9 15.5 22.6 27.9 16.4 191 10.3 29.1 63.9 12.5 14.2 505.9 14.4 32.1 17.3 192 5.0 19.2 39.5 10.2 5.0 263.3 9.2 17.4 9.2 193 1.5 2.6 4.9 3.7 2.4 45.0 1.9 3.9 1.7 194 3.8 23.8 44.5 6.0 6.0 191.4 9.4 21.2 9.3 195 1.5 2.7 3.5 3.2 2.5 31.0 1.7 4.1 1.8 196 2.6 10.9 7.0 4.2 5.7 44.4 4.8 7.9 4.8 197 2.7 10.1 7.8 6.1 5.6 54.2 3.1 10.6 4.5

Synthesis examples

Synthesis of synthetic intermediates

Getting 1

3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)aniline

Step A : A mixture of 1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-ol (23.5 g, 92.1 mmol), 1,2-difluoro-4-nitrobenzene (14 .6 g, 92.1 mmol) and cesium carbonate (30.0 g, 92.1 mmol) in DMF (300 ml) were heated to 100° C. for 1 hour. After cooling to room temperature, the reaction mixture was poured into water (750 ml) and diluted with EtOAc (750 ml). The organic layer was separated. The aqueous phase was re-extracted with EtOAc (1×300 ml, 1×100 ml). The combined organic phases were washed with water (2×300 ml) and brine (300 ml), dried over sodium sulfate, filtered and concentrated to give 4-(2-fluoro-4-nitrophenoxy)-1-(4-methoxybenzyl)- 1H-pyrazolo[3,4-b]pyridine (36.4 g, 100%).

Step B : Stirred mixture of 4-(2-fluoro-4-nitrophenoxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine (36 g, 91.3 mmol) in TFA (250 ml ) was heated to 60° C. for 18 hours under N ₂ with a reflux condenser attached. After cooling to room temperature, the reaction mixture was concentrated in vacuo. Toluene (3×75 ml) was used to remove residual TFA by azeotropic distillation. The dark mixture was carefully treated with aqueous NaHCO ₃ (total 150 ml) with stirring. The biphasic mixture was diluted with DCM (50 ml). A brown suspension was obtained which was stirred for 10 minutes. The suspension was then filtered. The solid (product) was washed with water (50 ml) then DCM (25 ml). Residual water in the solid was removed by azeotropic distillation of toluene on a rotary evaporator (3×100 ml) at 60°C to give 4-(2-fluoro-4-nitrophenoxy)-1H-pyrazolo[3,4-b]pyridine (23 d, 88%).

Step C : To a stirred mixture of 4-(2-fluoro-4-nitrophenoxy)-1H-pyrazolo[3,4-b]pyridine (22 g, 80 mmol) and KOH (14 g, 241 mmol) (ground with mortar and pestle ) in DMF (250 ml) was added I ₂ (41 g, 160 mmol). The resulting mixture was heated to 60°C for 1 h under N ₂ atmosphere. The reaction mixture was poured into saturated aqueous sodium thiosulfate (100 ml). The mixture was extracted with EtOAc (1×250 ml, 2×50 ml). The combined organic phases were washed with 10% LiCl (2×250 ml), dried over sodium sulfate, filtered and concentrated to give crude 4-(2-fluoro-4-nitrophenoxy)-3-iodo-1H-pyrazolo[3,4-b ]pyridine (29 g, 70%).

Step D : To a stirred mixture of 4-(2-fluoro-4-nitrophenoxy)-3-iodo-1H-pyrazolo[3,4-b]pyridine (29 g, 72.5 mmol) and 1-(chloromethyl)-4 -methoxybenzene (13.6 g, 87.0 mmol) in DMF (250 ml) was added K ₂ CO ₃ (12.0 g, 87.0 mmol). The reaction mixture was stirred for 18 h and then poured into EtOAc (500 ml) and diluted with water (500 ml). The phases were separated and the aqueous phase was extracted with EtOAc (2×250 ml). The combined organic phases were washed with water (250 ml) and brine (250 ml), dried over sodium sulfate, filtered and concentrated. The dark brown oil was purified with silica gel (30% EtOAc in hexanes) to give 4-(2-fluoro-4-nitrophenoxy)-3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b ]pyridine (24.2 g, 61%).

Step E : To a stirred mixture of 4-(2-fluoro-4-nitrophenoxy)-3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine (30 g, 57.7 mmol) in EtOH (500 ml) was added SnCl ₂ -2H ₂ O (59.9 g, 288 mmol). The mixture was heated to 65°C for 1 h under N ₂ atmosphere. After cooling to room temperature, the mixture was concentrated. The thick mixture was diluted with DCM (500 ml), stirred until the solids were dissolved, and then basified with 5N. aqueous NaOH (100 ml). The resulting suspension was filtered through Celite®, washed with DCM (3×50 ml). The filtrate was transferred to a separating funnel and the phases were separated. The aqueous phase was re-extracted with DCM (50 ml). The combined organic phases were dried over Na ₂ SO ₄ , filtered and concentrated to give 3-fluoro-4-(3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yloxy) aniline (26.9 g, 90%) as a yellow solid.

Getting 2

2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxylic acid

Step A : To a 2 L round bottom flask was added 40% oxalaldehyde aqueous solution (218 g, 1504 mmol) and a mixture of 1-(4-fluorophenyl)hydrazine hydrochloride (48.9 g, 301 mmol), acetic acid was added while stirring at room temperature (86.1 ml, 1504 mmol) and water (200 ml). The dark reddish brown mixture was stirred at room temperature for 1 hour. The solid was removed by filtration and washed with water. The solid was placed in a vacuum oven overnight to give (E)-2-(2-(4-fluorophenyl)hydrazono)acetaldehyde (48 g, 97.5%) as a brick red solid.

Step B : Added (E)-2-(2-(4-fluorophenyl)hydrazono)acetaldehyde (48 g, 289 mmol) and 2,2-dimethyl-1,3-dioxane-4,6-dione (43.7 g, 303 mmol) in a 1 L round bottom flask and suspended in toluene (400 ml). Acetic acid (1.65 ml, 28.9 mmol) and piperidine (2.85 ml, 28.9 mmol) were added and the mixture was stirred at room temperature overnight. The resulting precipitate was filtered, washed with hexanes and dried in a vacuum oven to give (E)-5-(2-(2-(4-fluorophenyl)hydrazono)ethylidene)-2,2-dimethyl-1,3-dioxane-4, 6-dione (84.8 g, 99%) as a bright red solid.

Step C : To a 3 L 4-necked round bottom flask equipped with temperature probe, mechanical stirrer and 2 reflux condensers was added (E)-5-(2-(2-(4-fluorophenyl)hydrazono)ethylidene)-2.2 -dimethyl-1,3-dioxane-4,6-dione (84.8 g, 290.2 mmol) and dissolved in MeOH (1 L). Sodium methoxide (79.62 mL, 348.2 mmol) in MeOH (25% by weight solution) was added and the dark brown solution was stirred and refluxed for 1 hour. HCl. The precipitate was removed by filtration, washed with water and ether, and dried in full vacuum (oven 60-70°C) overnight to give 2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxylic acid ( 56.4 g, 82%) as a yellow solid.

The following compounds were also prepared using the method of Preparation 2.

Receipt Structure Name 3

2-(4-fluorophenyl)-6-methyl-3-oxo-2,3-dihydropyridazine-4-carboxylic acid

Getting 4

2,5-dioxo-1-phenyl-1,2,5,6,7,8-hexahydroquinoline-3-carboxylic acid

Step A : To a stirred solution of cyclohexane-1,3-dione (5.0 g, 45 mmol) in DMF (100 ml) at room temperature under nitrogen atmosphere was added KOtBu (5.0 g, 45 mmol) followed by ethyl (E )-2-cyano-3-ethoxyacrylate (7.5 g, 45 mmol). The reaction mixture was stirred at room temperature overnight. The mixture was diluted with EtOAc (400 ml) and stirred while adding 2N aq. HCl (250 ml). The aqueous layer was extracted with EtOAc (2×200 ml) and the combined organic layers were washed with water (4×200 ml) and brine (200 ml), dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (0-60% EtOAc/hexanes) to give ethyl 2,5-dioxo-5,6,7,8-tetrahydro-2H-chromene-3-carboxylate (6.2g, 59%) as dark pink oil.

Step B : Aniline (210 μl) , 2.3 mmol). The mixture was stirred at room temperature overnight. The resulting solids were filtered, washed with EtOH and dried in vacuo to give 2,5-dioxo-1-phenyl-1,2,5,6,7,8-hexahydroquinoline-3-carboxylic acid (160 mg, 25%) as white solid.

The following compounds were also prepared using the method of Preparation 4.

Receipt Structure Name 5

1-(4-fluorophenyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxylic acid 6

1-(5-fluoropyridin-2-yl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxylic acid

Getting 7

3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid

Step A : To a solution of diethyl 2-(aminomethylene)malonate (2.5 g, 13.4 mmol) in dichloroethane (10 ml) was added 1-fluoro-4-isocyanatobenzene (1.59 ml, 14.0 mmol), then DIEA (2.57 ml, 14.7 mmol). The reaction mixture was stirred at 100°C for 6 h and then cooled to room temperature overnight. The resulting solids were filtered, washed with Et ₂ O and dried in vacuo to give diethyl 2-((3-(4-fluorophenyl)ureido)methylene)malonate (3.38 g, 78%) as a white solid.

Step B : Sodium ethoxide (6.23 ml, 21% , 16.7 mmol) drop by drop with a syringe. The mixture was stirred for 2 h, then concentrated and partitioned between EtOAc (150 ml) and 1M citric acid (100 ml). The aqueous layer was extracted with EtOAc (2×100 ml) and the combined organic phases were washed with brine (50 ml), dried over Na ₂ SO ₄ , filtered and concentrated to give ethyl 3-(4-fluorophenyl)-2,4-dioxo- 1,2,3,4-tetrahydropyrimidine-5-carboxylate (2.83 g, 98%) as a pale yellow solid.

Step C : To a suspension of ethyl 3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (1.0 g, 3.6 mmol) and K ₂ CO ₃ ( 993 mg, 7.2 mmol) in DMF (5 ml) was added 2-iodopropane (719 μl, 7.2 mmol). The mixture was heated in a sealed tube at 70° C. overnight. The cooled mixture was partitioned between water (50 ml) and EtOAc (50 ml) and the aqueous layer was extracted with EtOAc (2×30 ml). The combined organic phases were washed with water (5×20 ml) and brine (20 ml), then dried over Na ₂ SO ₄ , filtered and concentrated to give ethyl 3-(4-fluorophenyl)-1-isopropyl-2,4- dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (1.14 g, 99%) as a pale yellow foam.

Step D : To a solution of ethyl 3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (1.14 g, 3.56 mmol) in 4N HCl/dioxanes (10 ml) was added water (2 ml). The mixture was stirred at 70° C. overnight. The cooled mixture was treated with water (20 ml) and the resulting solids were filtered, washed with water and dried in vacuo to give 3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine- 5-carboxylic acid as a fluffy white solid.

The following compounds were also prepared using the method of Preparation 7.

Receipt Structure Name eight

3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid 9

1-ethyl-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid ten

1-(cyclopropylmethyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid eleven

3-(4-fluorophenyl)-1-(2-hydroxyethyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid 12

3-(4-fluorophenyl)-2,4-dioxo-1-(pentan-3-yl)-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid 13

1-cyclobutyl-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid fourteen

3-(3,4-difluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid fifteen

3-cyclohexyl-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid 16

3-cyclopentyl-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid 17

1-isopropyl-3-(1-methyl-1H-pyrazol-4-yl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid eighteen

1,3-diisopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid 19

1-isopropyl-2,4-dioxo-3-(tetrahydro-2H-pyran-4-yl)-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid twenty

3-(4-chlorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid 21

3-(3,4-difluorophenyl)-1-ethyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid

Getting 22

3-(4-fluorophenyl)-1-(1-methylazetidin-3-yl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid hydrochloride

Step A : To a suspension of ethyl 3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (1.0 g, 3.6 mmol) and K ₂ CO ₃ ( 993 mg, 7.2 mmol) in DMF (5 ml) was added tert-butyl 3-iodoazetidine-1-carboxylate (2.04 g, 7.2 mmol). The mixture was heated in a sealed tube at 70° C. overnight. The cooled mixture was partitioned between water (50 ml) and EtOAc (50 ml) and the aqueous layer was extracted with EtOAc (2×30 ml). The combined organic phases were washed with water (5×20 ml) and brine (20 ml), then dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (0-4% MeOH in DCM) to give ethyl 1-(1-(tert-butoxycarbonyl)azetidin-3-yl)-3-(4-fluorophenyl)-2,4-dioxo-1, 2,3,4-tetrahydropyrimidine-5-carboxylate (0.579 g, 37%).

Step B : To a solution of ethyl 1-(1-(tert-butoxycarbonyl)azetidin-3-yl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (400 mg, 0.92 mmol) in DCM (8 ml) was added TFA (2 ml). The mixture was stirred for 2 hours and concentrated to give crude ethyl 1-(azetidin-3-yl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate 2 ,2,2-trifluoroacetate (413 mg, 100%).

Step C : To a suspension of 2,2,2-trifluoroacetate ethyl 1-(azetidin-3-yl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (200 mg, 0.45 mmol) in dichloroethane (5 mL) formaldehyde (37% in water, 181 mg, 2.24 mmol) was added followed by NaBH(OAc) ₃ (237 mg, 1.12 mmol). The mixture was stirred vigorously for 4 hours. The mixture was treated with 2N Na ₂ CO ₃ (10 ml), stirred for 30 minutes, then extracted with DCM (3×10 ml). The combined organic phases were washed with brine (10 ml), dried over Na ₂ SO ₄ , filtered and concentrated to give crude ethyl 3-(4-fluorophenyl)-1-(1-methylazetidin-3-yl)-2,4- dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (127 mg, 82%) as a white solid.

Step D : To a solution of ethyl 3-(4-fluorophenyl)-1-(1-methylazetidin-3-yl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (174 mg, 0 .50 mmol) in 4N HCl/dioxanes (5 ml) was added water (1 ml). The mixture was stirred at 70° C. overnight. The cooled mixture was treated with water (10 ml) and extracted with EtOAc (10 ml). The aqueous layer was concentrated to give crude 3-(4-fluorophenyl)-1-(1-methylazetidin-3-yl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid hydrochloride salt (116 mg, 65%).

Getting 23

1-cyclopropyl-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid

Step A : To a suspension of ethyl 3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (900 mg, 3.23 mmol), cyclopropylboronic acid (834 mg, 9 .70 mmol) and Na ₂ CO ₃ (1028 mg, 9.70 mmol) in dichloroethane (6 ml) was added a suspension of diacetoxycopper (176 mg, 0.970 mmol) and 2,2'-bipyridine (505 mg, 3.23 mmol) in hot dichloroethane (6 ml). The mixture was heated to 70°C for 2 h. Additional Na ₂ CO ₃ (1028 mg, 9.70 mmol), cyclopropylboronic acid (834 mg, 9.70 mmol), diacetoxycopper (176 mg, 0.970 mmol) and 2, 2'-bipyridine (505 mg, 3.23 mmol) and the reaction mixture was stirred at 70° C. overnight. The reaction mixture was cooled to room temperature and diluted with a saturated solution of NH ₄ Cl (20 ml). The aqueous layer was extracted with DCM (2×20 ml), dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (0-100% EtOAc in hexanes) to give ethyl 1-cyclopropyl-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate (180 mg, 14%).

Step B : Hydrogen chloride (1414 µl, 5.65 mmol, 4M in dioxane) and water (0.3 ml). The mixture was heated to 70° C. for 3 hours. The reaction mixture was cooled to room temperature and diluted with EtOAc (20 ml) and water (10 ml). The aqueous layer was extracted with EtOAc (2×10 ml). The combined organics were dried over MgSO ₄ , filtered and concentrated to give 1-cyclopropyl-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid (180 mg, 110 %).

Receiving 24

4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic acid

Stage A : Ethyl 4-ethoxy-2-oxo-1,2-dihydropyridine-3-carboxylate (1.0 g, 4.73 mmol), quinolin-8-ol (275 mg, 1.89 mmol) and cesium carbonate (3.09 g, 9.47 mmol) was combined in DMF (10 mL) and Ar was flushed for 5 min. Cu(I)iodide (271 mg, 1.42 mmol) and 1-fluoro-4-iodobenzene (819 μl, 7.1 mmol) were added and the mixture was stirred in a closed vessel at 100° C. overnight. The mixture was partitioned between water (100 ml) and EtOAc (100 ml) and the aqueous layer was extracted with EtOAc (2×50 ml). The combined organic phases were washed with water (30 ml), 2N HCl (30 ml), water (2×30 ml) and brine (30 ml), dried over Na ₂ SO ₄ , filtered and concentrated to give ethyl 4-ethoxy- 1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate (1.38 g, 95%) as a yellow solid.

Step B : To a solution of ethyl 4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate (1.38 g, 4.52 mmol) in EtOH (40 mL) was added 2N HCl (9 ml, 18.1 mmol). The mixture was stirred at 65°C overnight. After cooling, the solids were filtered, washed with Et ₂ O and dried in vacuo to give 4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic acid (0.418 g, 33%) in form of a white solid.

The following compound was also prepared using the method of Preparation 24.

Receipt Structure Name 25

1-(4-fluorophenyl)-2-oxo-piperidine-3-carboxylic acid

Getting 26

2-(4-fluorophenyl)-1-methyl-3-oxo-2,3-dihydro-1H-pyrazole-4-carboxylic acid

Step A : (4-Fluorophenyl)hydrazine hydrochloride (3.13 g, 19.2 mmol) was suspended in EtOH (40 mL) and K ₂ CO ₃ (5.32 g, 38.5 mmol) was added, followed by diethyl 2-(ethoxymethylene)malonate (3.85 ml, 19.2 mmol) and the reaction mixture was heated to 80° C. overnight. The cooled reaction mixture was concentrated, diluted with water (100 ml) and acidified with 3N. aq. HCl (50 ml) to bring the pH to 3. The aqueous layer was extracted with EtOAc (2×100 ml). The combined organic layers were dried over Na ₂ SO ₄ and concentrated. The residue was triturated with MeOH (2×10 ml) and the solid was dried to give ethyl 2-(4-fluorophenyl)-3-oxo-2,3-dihydro-1H-pyrazole-4-carboxylate (2.88 g, 60% ).

Step B : To a 20 ml flask, ethyl 2-(4-fluorophenyl)-3-oxo-2,3-dihydro-1H-pyrazole-4-carboxylate (1.56 g, 6.23 mmol) and methyl trifluoromethanesulfonate ( 2.11 ml, 18.7 mmol) and heated to 80°C for 1 h. The reaction mixture was diluted with DCM (50 ml) and washed with saturated NaHCO ₃ (30 ml). The aqueous layer was extracted with DCM (2×20 ml). The combined organic layers were dried over Na ₂ SO ₄ and concentrated in vacuo. The residue was purified with silica gel (70-100% EtOAc in hexanes) to give (4-(ethoxycarbonyl)-2-(4-fluorophenyl)-1-methyl-1,2-dihydro-3H-pyrazol-3-ylidene)( methyl)oxonium trifluoromethanesulfonate (2.143 g, 100%).

Step C : To a 40 ml flask was added (4-(ethoxycarbonyl)-2-(4-fluorophenyl)-1-methyl-1,2-dihydro-3H-pyrazol-3-ylidene)(methyl)oxonium (1.74 g , 6.23 mmol) and diluted with THF (6 ml) and MeOH (5 ml). Added 4N aq. NaOH (9.35 ml, 37.4 mmol) and the reaction mixture was heated to 60°C. After 1 h the reaction mixture was cooled to room temperature. The reaction mixture was concentrated to remove volatile solvents. To the solution was added 3N aq. HCl to bring the pH to 1. The solution was extracted with EtOAc (3×10 ml). The combined organic layers were concentrated under reduced pressure to give 2-(4-fluorophenyl)-1-methyl-3-oxo-2,3-dihydro-1H-pyrazole-4-carboxylic acid (1.26 g, 85.8%) .

The following compound was also prepared using the method of Preparation 26.

Receipt Structure Name 27

1-methyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazole-4-carboxylic acid

Getting 28

1-(4-fluorophenyl)-6-methyl-2-oxo-1,2-dihydropyridine-3-carboxylic acid

Step A : A solution of 4-fluoroaniline (1.72 ml, 18.0 mmol) and triethylamine (3.01 ml, 21.6 mmol) in DCM (90 ml) was made and purged with argon from a balloon. The solution was cooled to 0° C. in an ice bath. Ethyl 3-chloro-3-oxopropanoate (2.719 ml, 21.60 mmol) was dissolved in DCM (8 ml) and this solution was added dropwise to the reaction mixture over five minutes. The reaction mixture was allowed to warm slowly to room temperature overnight. The reaction mixture was diluted with water (100 ml) and separated, washed with NaHCO ₃ (50 ml × 4) and brine (50 ml), dried over sodium sulfate, filtered and concentrated to give crude ethyl 3-((4-fluorophenyl)amino )-3-oxopropanoate (4.32 g, 106%).

Step B : Ethyl 3-((4-fluorophenyl)amino)-3-oxopropanoate (2 g, 8.88 mmol) was dissolved in ethanol (22 ml). This solution was stirred while adding (E)-4-methoxybut-3-en-2-one (1.36 ml, 13.3 mmol). After stirring for 10 minutes, sodium ethanolate (4.97 ml, 13.3 mmol) was added and heated under reflux for 2 hours. The reaction mixture was concentrated and diluted with DCM (200 ml) and washed with 1N HCl (50 ml × 2) and brine (50 ml), dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (5% MeOH in DCM) to give 1-(4-fluorophenyl)-6-methyl-2-oxo-1,2-dihydropyridine-3-carboxylic acid (2.2 g, 100%).

Getting 29

1-(4-fluorophenyl)-4-methyl-2-oxo-1,2-dihydropyridine-3-carboxylic acid

Step A : Solution of 4-fluoroaniline (1.73 ml, 18.0 mmol) and 1H-imidazole (0.249 g, 3.67 mmol) in diethyl 2-(propan-2-ylidene)malonate (9.80 ml, 50 mmol) were combined in a sealed tube and heated to 200°C under argon for 3 h. The reaction mixture was cooled to room temperature and purified with silica gel (25% EtOAc in hexanes) to give ethyl 2-((4-fluorophenyl)carbamoyl )-3-methylbut-2-enoate (2.13 g, 31%).

Step B : Ethyl 2-((4-fluorophenyl)carbamoyl)-3-methylbut-2-enoate (2.13 g, 8.03 mmol) was dissolved in 1,1-dimethoxy-N,N-dimethylmethanamine (0.957 g, 8.03 mmol) and heated to 90°C for 90 minutes in a sealed tube. The reaction mixture was cooled to room temperature and diluted with 30 ml of EtOAc and 30 ml of saturated NH ₄ Cl and stirred for 15 minutes. The phases were separated and the organic phase was washed with NH ₄ Cl (2×30 ml), dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (5% MeOH in DCM) to give ethyl 1-(4-fluorophenyl)-4-methyl-2-oxo-1,2-dihydropyridine-3-carboxylate (320 mg, 15%).

Step C : Ethyl 1-(4-fluorophenyl)-4-methyl-2-oxo-1,2-dihydropyridine-3-carboxylate (290 mg, 1.05 mmol) was dissolved in MeOH (3 ml) and water (2 ml ). Added LiOH (88 mg, 2.1 mmol) and the reaction mixture was heated to 37°C during the night. The reaction mixture was diluted with water (10 ml) and the methanol was removed under reduced pressure. The aqueous layer was extracted with Et ₂ O (2×50 ml) and the pH was lowered to 1 with 1M HCl. The resulting solids were filtered, washed with water and dried to give 1-(4-fluorophenyl)-4-methyl-2-oxo-1,2-dihydropyridine-3-carboxylic acid (121 mg, 46%).

Getting 30

1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxylic acid

Ethyl 3-((4-fluorophenyl)amino)-3-oxopropanoate (18 g, 79.9 mmol) was dissolved in ethanol (200 ml) and (E)-3-ethoxy-2-methylacrylaldehyde (13.7, 119 .8 mmol). After 5 minutes, sodium ethanolate (44.7 ml, 119.8 mmol, 21% wt. in EtOH) was added and the reaction mixture was refluxed for 3 hours. The reaction mixture was cooled to room temperature and added to a stirred aqueous solution of 2N. HCl (2 L) and the mixture was stirred overnight at room temperature. The solids were filtered and washed with 2N HCl (2×500 ml) and water (500 ml). The filter cake and filter paper were transferred to a large Buchi vacuum flask and dried overnight to give 1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxylic acid (15.9 g, 80%).

The following compounds were also prepared using the method of Preparation 30.

Receipt Structure Name 31

1-(3,4-difluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxylic acid 32

1-(3-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxylic acid

Getting 33

5-cyclopropyl-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic acid

Step A : A 250 ml round bottom flask was charged with methyl 5-bromo-2-oxo-1,2-dihydropyridine-3-carboxylate (2.84 g, 12.2 mmol), (4-fluorophenyl)boronic acid (4.62 g, 33.0 mmol), diacetoxycopper (4.34 g, 23.9 mmol) and DCM (50 ml). Activated molecular sieves (1 g) were added followed by pyridine (3.86 mL, 47.7 mmol). The reaction mixture was stirred for 3 days at room temperature under normal atmosphere. The reaction mixture was diluted to 200 ml DCM and filtered through Celite®. The filtrate was washed with water (3×250 ml) and brine, dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (25% EtOAc in DCM) to give methyl 5-bromo-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate (3.53 g, 10.8 mmol , 88.4% yield).

Step B : Methyl 5-bromo-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate (0.400 g, 1.23 mmol) was dissolved in 10:1 toluene:water (16 ml) and nitrogen was bubbled through this solution for 5 minutes. Potassium cyclopropyl trifluoroborate (0.726 g, 4.91 mmol), diacetoxypalladium (0.038 g, 0.169 mmol), and K ₃ PO ₄ (0.260 g, 1.23 mmol) were added while nitrogen was bubbled through the reaction mixture for 1 min. Dicyclohexyl(2',6'-diisopropoxy-[1,1'-biphenyl]-2-yl)phosphane (0.172 g, 0.368 mmol) was added and the reaction was sparged with nitrogen for 1 minute, then sealed and heated to 105°C during the night. The reaction mixture was partitioned between water and EtOAc, washed with water and brine, dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (80:20 DCM:EtOAc) to give methyl 5-cyclopropyl-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate (0.240 g, 0.835 mmol, 68, 1% yield).

Step C : Methyl 5-cyclopropyl-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate (240 mg, 0.835 mmol) was dissolved in THF (20 ml) and MeOH (5 ml). To this was added a solution of lithium hydroxide hydrate (550 mg, 13.1 mmol) in a minimum amount of water (1 ml). After 2.5 h, the reaction mixture was concentrated, diluted with water (5 ml) and the pH was adjusted to 1 with concentrated HCl. The resulting solid was filtered, washed with 2N HCl and dried to give 5-cyclopropyl-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic acid (160 mg, 0.586 mmol, 70.1% yield ).

Getting 34

5-bromo-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic acid

Step A : Methyl 5-bromo-2-oxo-1,2-dihydropyridine-3-carboxylate (1 g, 4.31 mmol), (4-fluorophenyl)boronic acid (1.63 g, 11, 6 mmol), diacetoxy copper (1.53 g, 8.40 mmol) and DCM (50 ml). Activated molecular sieves (1 g) were added followed by pyridine (1.36 ml, 16.8 mmol). The reaction mixture was stirred overnight at room temperature in air. The blue suspension was filtered through Celite® and washed with DCM and concentrated. The concentrate was partitioned between DCM and water, dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (25% EtOAc in DCM) to give methyl 5-bromo-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate (0.84 g, 60% yield) .

Step B : Methyl 5-bromo-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate (382.3 mg, 1.172 mmol) was dissolved in THF (20 ml) and MeOH (5 ml ). To this was added a solution of lithium hydroxide hydrate (491.9 mg, 11.72 mmol) in a minimum amount of ~1 ml of water. After 2.5 h, the reaction mixture was concentrated, diluted with water (5 ml) and the pH was adjusted to 1 with concentrated HCl. The resulting solid was filtered, washed with 2N HCl and dried to give 5-bromo-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic acid (287.6 mg, 0.9215 mmol, 78 .61% yield).

The following compound was also prepared using the method of Preparation 34.

Receipt Structure Name 35

5-chloro-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylic acid

Getting 36

4-(4-fluorophenyl)-3-oxo-3,4-dihydropyrazine-2-carboxylic acid

Step A : To a stirred mixture of 4-fluorobenzamine (41 g, 369.0 mmol) in acetic acid (211.2 ml, 3690 mmol) and KCN (31.23 g, 479.7 mmol) in water (50 ml) at 0°C was added formaldehyde (41.2 ml, 553.5 mmol, 37% in water) dropwise. The dark solution was stirred at 0° C. for 15 minutes and allowed to warm to room temperature overnight. The reaction mixture was diluted with water (500 ml), extracted with EtOAc, washed with 1N NaOH, water, and brine, dried over MgSO ₄ , filtered and concentrated to give crude 2-(4-fluorophenylamino)acetonitrile (52 g, 93%).

Step B : To a stirred mixture of 2-(4-fluorophenylamino)acetonitrile (52 g, 346 mmol) in 1,2-dichlorobenzene (139 mL, 346 mmol) was slowly added oxalyl dichloride (132 g, 1039 mmol). The reaction mixture was heated to 100° C. and stirred for 5.5 h. The dichlorobenzene was removed by vacuum distillation (10 mmHg at 75° C.) and the crude material was purified with silica gel (0-1% acetonitrile in DCM) to give 3,5-dichloro-1-(4-fluorophenyl)pyrazin-2(1H)-one (18 g, 20%).

Step C : 3,5-Dichloro-1-(4-fluorophenyl)pyrazin-2(1H)-one (18 g, 69.5 mmol) was suspended in MeOH (280 ml) and treated slowly with sodium methoxide (23.8 ml , 104 mmol) at 0°C. The reaction mixture was allowed to warm to room temperature and stirred for 5 h. The reaction mixture was neutralized with HCl (17.4 mL, 34.7 mmol, 2N Et ₂ O) and concentrated. The residue was taken up in EtOAc (800 ml), washed with aqueous 0.5 N HCl (600 ml), dried over MgSO ₄ , filtered and concentrated to give 5-chloro-1-(4-fluorophenyl)-3-methoxypyrazine-2(1H )-one (16.1 g, 91%).

Step D : 5-chloro-1-(4-fluorophenyl)-3-methoxypyrazin-2(1H)-one (43 g, 169 mmol) was suspended in MeOH (2 L) and heated to 50°C to dissolve all solids . The reaction mixture was cooled to room temperature and K ₂ CO ₃ (23.3 g, 169 mmol) and 10% (on a dry basis: about 50% water) Pd/C (18.0 g, 8.44 mmol) were added to the mixture at room temperature. The mixture was stirred under a hydrogen atmosphere. After 4 h, the mixture was filtered and concentrated. The residue was taken up in DCM (1500 ml) and washed with water (1000 ml) and brine, dried over MgSO ₄ , filtered and concentrated to give 1-(4-fluorophenyl)-3-methoxypyrazin-2(1H)-one (22 .7 g, 61%).

Step E : 1-(4-Fluorophenyl)-3-methoxypyrazin-2(1H)-one (22.0 g, 100 mmol) was suspended in DMF (200 ml). The mixture was cooled to 0°C and POCl ₃ (22.9 ml, 250 mmol) was added dropwise. After the addition, the mixture was heated to 90°C for 2 h and then cooled to 0°C. The reaction mixture was quenched by adding saturated sodium acetate solution (40 ml) and cooled to 0°C. After 20 minutes, a fine precipitate formed. The solid was removed by filtration and washed with a small portion (50 ml) of saturated sodium acetate solution and then with ice water (100 ml). The solid was dried overnight to give 3-chloro-1-(4-fluorophenyl)pyrazin-2(1H)-one (14.7 g).

Step F : 3-chloro-1-(4-fluorophenyl)pyrazin-2(1H)-one (17.9 g, 79.9 mmol), zinc cyanide (5.63 g, 47.9 mmol), dppf ( 4.43 g, 7.99 mmol), Pd ₂ dba ₃ (3.65 g, 3.99 mmol) was suspended in NMP (360 ml). The reaction mixture was stirred under nitrogen at 120° C. overnight. The reaction mixture was cooled, diluted with EtOAc (3000 ml), washed 4:1:4 with saturated NH ₄ Cl:conc. NH ₄ OH:water and brine, dried over MgSO ₄ , filtered and concentrated. The residue was purified with silica gel (0-1% MeOH in DCM) to give 4-(4-fluorophenyl)-3-oxo-3,4-dihydropyrazine-2-carbonitrile (10.76 g, 62%).

Step G : 4-(4-Fluorophenyl)-3-oxo-3,4-dihydropyrazine-2-carbonitrile (10.50 g, 48.80 mmol) was dissolved in concentrated H ₂ SO ₄ (104.0 ml, 1952 mmol ) and stirred for 2 hours. The reaction mixture was slowly poured into methanol (700 ml) at 0°C. After completion of the addition, the mixture was heated to 70° C. and stirred for 2.5 hours. The reaction mixture was cooled to room temperature and poured into 1500 ml of ice. The pH was adjusted to 12 with 5N NaOH. The pH was then adjusted to 2 with 2N. HCl, extracted with EtOAc, dried over MgSO ₄ , filtered and concentrated. The residue was triturated with ether and filtered to give 4-(4-fluorophenyl)-3-oxo-3,4-dihydropyrazine-2-carboxylic acid (9.2 g, 78%).

Getting 37

6-cyclopropyl-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxylic acid

Step A : To 2-cyclopropyl-2-oxoacetaldehyde (0.424 ml, 5.10 mmol) was added a mixture of 4-fluorophenylhydrazine hydrochloride (0.829 g, 5.10 mmol) in AcOH (4.25 ml, 5.10 mmol) and water (4.25 ml, 5.10 mmol) at room temperature with stirring for 20 minutes. The mixture was added to cold water (200 ml) and stirred for 10 minutes. The mixture was filtered and the isolated solids were washed with water (50 ml). The residue was purified with silica gel (1-10% EtOAc in DCM) to give (E)-2-cyclopropyl-2-(2-(4-fluorophenyl)hydrazono)acetaldehyde (0.080 g, 0.388 mmol, 7.61% yield) , minor isomer.

Step B : To a solution of (E)-2-cyclopropyl-2-(2-(4-fluorophenyl)hydrazono)acetaldehyde (0.080 g, 0.388 mmol) in toluene (3.88 ml) was added 2,2-dimethyl-1, 3-dioxane-4,6-dione (0.0671 g, 0.466 mmol), AcOH (0.00222 ml, 0.0388 mmol) and piperidine (0.00383 ml, 0.0388 mmol). After 1 hour the mixture was added to water (50 ml) and the organics were extracted with EtOAc (25 ml). The organic layer was washed with water (25 ml) and brine (25 ml), dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (1-10% EtOAc in DCM) to give 6-cyclopropyl-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxylic acid (0.025 g, 0.0912 mmol , 23.5% yield) as a tan solid.

The following compound was also prepared using the method of Preparation 37.

Receipt Structure Name 38

2-(4-fluorophenyl)-6-isopropyl-3-oxo-2,3-dihydropyridazine-4-carboxylic acid

Getting 39

4-(4-fluorophenyl)-2-isopropyl-5-oxo-3-thioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxylic acid

Step A : A mixture of diethyl 2-oxomalonate (4.12 mL, 26.99 mmol) and N-(4-fluorophenyl)hydrazinecarbothioamide (5.0 g, 26.99 mmol) in ethanol (100 mL) was refluxed at within 2 days. The mixture was cooled to room temperature and filtered. The solids were washed with cold EtOH and dried to give ethyl 4-(4-fluorophenyl)-5-oxo-3-thioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxylate (3, 85 g, 48%) as a yellow powder.

Step B : To a suspension of ethyl 4-(4-fluorophenyl)-5-oxo-3-thioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxylate (400 mg, 1.433 mmol) and K ₂ CO ₃ (396 mg, 2.865 mmol) in DMF (5 ml) was added 2-iodopropane (287 μl, 2.86 mmol). The mixture was heated in a sealed tube at 65° C. for 1 hour. The mixture was cooled to room temperature and partitioned between water (20 ml) and EtOAc (20 ml). The aqueous layer was extracted with EtOAc (2×15 ml). The combined organic phases were washed with water (5×15 ml) and brine (20 ml), dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (0-20% EtOAc in hexanes) to give ethyl 4-(4-fluorophenyl)-2-isopropyl-5-oxo-3-thioxo-2,3,4,5-tetrahydro-1,2 ,4-triazine-6-carboxylate (211 mg, 46% yield).

Step C : Sulfuric acid (5 ml) was carefully added to a mixture of ethyl 4-(4-fluorophenyl)-2-isopropyl-5-oxo-3-thioxo-2,3,4,5-tetrahydro-1,2,4- triazine-6-carboxylate (211.1 mg, 0.657 mmol) and water (1 ml). The mixture became homogeneous after a few minutes. The reaction mixture was stirred at 40° C. overnight, cooled to room temperature and then carefully added to ice. The mixture was saturated with solid NaCl and extracted with EtOAc (3×40 ml) The combined EtOAc layers were dried over sodium sulfate, filtered and concentrated to give 4-(4-fluorophenyl)-2-isopropyl-5-oxo-3-thioxo-2,3, 4,5-tetrahydro-1,2,4-triazine-6-carboxylic acid (195 mg, 100%).

Getting 40

4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxylic acid

Step A : To a solution of ethyl 4-(4-fluorophenyl)-5-oxo-3-thioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxylate (3.85 g, 13 .0 mmol) in DMF (35 ml) and acetic acid (14.2 ml, 248.0 mmol) was added 30% aq. H ₂ O ₂ (2 ml, 65.2 mmol). The mixture was stirred for 3 days. The reaction mixture was extracted between water (200 ml) and EtOAc (120 ml). The aqueous layer was washed with EtOAc (2×120 ml). The combined organic layers were washed with water (100 ml), sodium bicarbonate (3×100 ml), water (100 ml), and brine (200 ml). The organic layer was then dried with sodium sulfate, filtered and concentrated in vacuo to give a pale yellow solid. The resulting solid was triturated with ether and filtered. The filtrate was concentrated and purified with silica gel (0-40% EtOAc in hexanes) to give ethyl 4-(4-fluorophenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine -6-carboxylate (1.6 g, 45%).

Step B : To a suspension of ethyl 4-(4-fluorophenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxylate (800 mg, 2.87 mmol) and K ₂ CO ₃ (792 mg, 5.73 mmol) in DMF (10 ml) was added 2-iodopropane (573 μl, 5.73 mmol). The mixture was heated in a sealed tube at 65° C. for 1 hour. The cooled mixture was partitioned between water (50 ml) and EtOAc (25 ml) and the aqueous layer was extracted with EtOAc (2×25 ml). The combined organic phases were washed with water (5×30 ml) and brine (50 ml), then dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (0-20% EtOAc in hexanes) to give ethyl 4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4 -triazine-6-carboxylate (763 mg, 83%).

Step C : Sulfuric acid (10 ml) was carefully added to a mixture of ethyl 4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine- 6-carboxylate (763.7 mg, 2.377 mmol) and water (2 ml). The mixture became homogeneous after a few minutes. The reaction mixture was stirred at 40° C. overnight, cooled to room temperature, and added carefully to ice. The mixture was saturated with solid NaCl and extracted with EtOAc (3×40 ml) The combined organic layers were dried over sodium sulfate, filtered and concentrated to give 4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4, 5-tetrahydro-1,2,4-triazine-6-carboxylic acid (713 mg, 102%).

The following compounds were also prepared using the method of Preparation 40.

Receipt Structure Name 41

4-(3,4-difluorophenyl)-2-ethyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxylic acid 42

4-(3,4-difluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxylic acid 43

2-ethyl-4-(4-fluorophenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxylic acid

Getting 41

5-(4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxylic acid

Stage A : A mixture of methyl 5-bromo-4-hydroxynicotinate (100 mg, 0.431 mmol) and Cs ₂ CO ₃ (211 mg, 0.646 mmol) was diluted with DMF (2 ml), placed under nitrogen atmosphere and heated to 75°C for 10 min. The reaction mixture was allowed to cool to room temperature. MeI (40.4 μl, 0.646 mmol) was added and the reaction mixture was stirred for 3 h. The reaction mixture was diluted with water and extracted with DCM/IPA (3:1). The combined organic layers were dried over MgSO ₄ , filtered and concentrated. The residue was purified with silica gel (1-10% methanol in DCM with 1% NH ₄ OH) to give methyl 5-bromo-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxylate (92 mg, 0.374 mmol , 86.8% yield).

Step B : Mixture of methyl 5-bromo-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxylate (92 mg, 0.37 mmol), (4-fluorophenyl)boronic acid (105 mg, 0.75 mmol) and Pd(PPh ₃ ) ₄ (22 mg, 0.019 mmol) were diluted with dioxane (1 ml) followed by the addition of Na ₂ CO ₃ (561 μl, 1.1 mmol, 2.0 M). The reaction mixture was purged with argon, sealed and heated to 90° C. overnight. The reaction mixture was allowed to cool and the cooled mixture was diluted with water and adjusted to pH 2 with 1N HCl. HCl. The mixture was extracted three times with DCM/IPA (3/1). The combined organic layers were dried over MgSO ₄ , filtered and concentrated. The product was triturated with diethyl ether to give 5-(4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxylic acid.

The following compounds were also prepared using the method of Preparation 41.

Receipt Structure Name 42

5-(4-fluorophenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxylic acid 43

1-ethyl-5-(4-fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxylic acid 44

5-(3,4-difluorophenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxylic acid 45

5-(4-chlorophenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxylic acid 46

5-(2,4-difluorophenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxylic acid

Getting 47

1-(4-fluorophenyl)-2-oxo-5-vinyl-1,2-dihydropyridine-3-carboxylic acid

Step A : Dissolve methyl 5-bromo-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxylate (0.400 g, 1.227 mmol) in 10:1 in a 125 ml screw cap pressure vial toluene:water (16 ml) and nitrogen was bubbled through this solution for 5 minutes. Potassium trifluoro(vinyl)borate (0.6572 g, 4.906 mmol), diacetoxypalladium (0.04131 g, 0.1840 mmol), and K ₃ PO ₄ (0.7811 g, 3.680 mmol) were added while nitrogen was bubbled through the reaction mixture within 1 minute. Dicyclohexyl(2',6'-diisopropoxy-[1,1'-biphenyl]-2-yl)phosphane (0.1717 g, 0.3680 mmol) was added and the reaction mixture was sparged with nitrogen for 1 minute, then sealed and sealed. heated to 110° C. overnight. The reaction mixture was cooled and partitioned between water and ethyl acetate. The organic layer was washed with water and brine, dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (20% EtOAc in DCM) to give methyl 1-(4-fluorophenyl)-2-oxo-5-vinyl-1,2-dihydropyridine-3-carboxylate.

Step B : Methyl 1-(4-fluorophenyl)-2-oxo-5-vinyl-1,2-dihydropyridine-3-carboxylate was dissolved in MeOH (50 ml) and water (5 ml). LiOH (500 mg) was added and the reaction mixture was heated to 40° C. for 1.5 hours. MeOH was removed by rotary evaporation and diluted with water (50 ml). Concentrated HCl was added to pH 1. The resulting precipitate was filtered and dried to give 1-(4-fluorophenyl)-2-oxo-5-vinyl-1,2-dihydropyridine-3-carboxylic acid (209.6 mg, 66% yield) .

The following compounds were also prepared using the method of Preparation 47.

Receipt Structure Name 48

1-(4-fluorophenyl)-2-oxo-5-(prop-1-en-2-yl)-1,2-dihydropyridine-3-carboxylic acid 49

(E)-1-(4-fluorophenyl)-2-oxo-5-(prop-1-en-1-yl)-1,2-dihydropyridine-3-carboxylic acid

Getting 50

5-(4-fluorophenyl)-6-oxo-5-azaspiro[2.5]octane-7-carboxylic acid

Step A : A solution of 1-(hydroxymethyl)cyclopropane-1-carbonitrile (541 mg, 5.57 mmol) in DCM (10 mL) was cooled to 0°C in an ice bath and methanesulfonyl chloride (684 μL, 8.36 mmol) was added , then triethylamine (1708 μl, 12.3 mmol), and the reaction mixture was stirred at 0°C for 1 h and warmed to room temperature. The reaction mixture was diluted with DCM (10 ml), washed with brine, dried over sodium sulfate and concentrated to give crude (1-cyanocyclopropyl)methyl methanesulfonate (976 mg, 100% yield).

Step B : Diethylmalonate (765 μl, 5.01 mmol) was added to a solution of sodium hydride (243 mg, 6.08 mmol) in THF (25 ml) followed by the addition of (1-cyanocyclopropyl)methyl methanesulfonate (976 mg, 5.57 mmol) and the reaction mixture was refluxed for 4 days. The reaction mixture was cooled and partitioned between MTBE (50 ml) and 2N HCl (50 ml), washed with MTBE 2N. HCl (25 ml) and brine (25 ml), dried over sodium sulfate, filtered and concentrated. The crude material was purified with silica gel (5-95% EtOAc in hexanes) to give diethyl 2-((1-cyanocyclopropyl)methyl)malonate (430 mg, 1.80 mmol, 32.3% yield).

Step C : Diethyl 2-((1-cyanocyclopropyl)methyl)malonate (275 mg, 1.15 mmol) was dissolved in EtOH (50 ml) in a 250 ml Parr mixing flask. PtO ₂ (14 mg, 0.06 mmol) was added and the mixture was held at 50 psi. inch H ₂ within 48 hours. Additional PtO ₂ (14 mg, 0.06 mmol) was added to a Parr mixing flask and the reaction mixture was held at 50 psi. inch H ₂ during the night. The reaction mixture was filtered, the solids were washed with ethanol and the filtrate was concentrated. The residue was purified with silica gel (0-20% MeOH in EtOAc) to give ethyl 6-oxo-5-azaspiro[2.5]octane-7-carboxylate (98 mg, 43.2% yield).

Stage D : Ethyl 6-oxo-5-azaspiro[2.5]octane-7-carboxylate (0.098 g, 0.4969 mmol), cesium carbonate (0.4857 g, 1.491 mmol) and quinolin-8-ol (0.02885 g, 0.1987 mmol) was suspended in DMF (2 ml) and purged with argon for 5 minutes. Copper(I) iodide (0.03785 g, 0.1987 mmol) and 1-fluoro-4-iodobenzene (0.08595 ml, 0.7453 mmol) were added and the reaction mixture was heated to 100°C overnight in a sealed tube in an argon atmosphere. The reaction mixture was cooled and partitioned between water and EtOAc (3×25), dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (0-100% EtOAc in DCM) to give ethyl 5-(4-fluorophenyl)-6-oxo-5-azaspiro[2.5]octane-7-carboxylate (40 mg, 0.1373 mmol, 27 .63% yield).

Step E : Ethyl 5-(4-fluorophenyl)-6-oxo-5-azaspiro[2.5]octane-7-carboxylate (32.7 mg, 0.112 mmol) was dissolved in EtOH (25 ml) and lithium hydroxide hydrate (9, 42 mg, 0.224 mmol) was added as a solid. Was added water (2 ml) and the reaction mixture was heated to 35°C. After 1 hour, additional lithium hydroxide hydrate (9.42 mg, 0.224 mmol) was added. After an additional hour, the EtOH was removed under reduced pressure. Water (25 ml) was added to the residue and the pH was lowered to <2 by adding concentrated HCl. The cloudy suspension was extracted with EtOAc (3×15 ml), dried over sodium sulfate, filtered and concentrated to give 5-(4-fluorophenyl)-6-oxo-5-azaspiro[2.5]octane-7-carboxylic acid (23 mg, 0 .0874 mmol, 77.8% yield) as a white solid.

Getting 51

1-(4-fluorophenyl)-3-methyl-2-oxo-piperidine-3-carboxylic acid

Step A : Ethyl 2-oxo-piperidine-3-carboxylate (500 mg, 2.921 mmol), cesium carbonate (2855 mg, 8.762 mmol) and quinolin-8-ol (169.6 mg, 1.168 mmol) were suspended in DMF (6 ml) and purged with argon for 5 minutes. To this solution were added copper(I) iodide (222.5 mg, 1.168 mmol) and 1-fluoro-4-iodobenzene (505.2 µl, 4.381 mmol) and the reaction mixture was heated to 100° C. overnight in a sealed tube. The reaction mixture was cooled and partitioned between EtOAc and water, extracted with EtOAc, washed with brine, dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (0-100% EtOAc in DCM) to give ethyl 1-(4-fluorophenyl)-2-oxo-piperidine-3-carboxylate (468 mg, 1.76 mmol, 60.4% yield).

Step B : Ethyl 1-(4-fluorophenyl)-2-oxo-piperidine-3-carboxylate (468 mg, 1.76 mmol) was dissolved in DCM (10 ml). Cesium carbonate (2299 mg, 7.06 mmol) was added and the reaction mixture was stirred for 5 minutes. Iodomethane (659 μl, 10.6 mmol) was added and the reaction mixture was stirred overnight at room temperature. Added additional amount of iodomethane (659 μl, 10.6 mmol) and the reaction mixture was heated to 35°C for 5 h and then at room temperature over the weekend. The reaction mixture was diluted with DCM (50 ml), filtered through Celite® and concentrated. The residue was purified with silica gel (0-40% EtOAc in hexanes) to give ethyl 1-(4-fluorophenyl)-3-methyl-2-oxo-piperidine-3-carboxylate (420 mg, 1.50 mmol, 85.2% yield ) as a clear oil, which was used directly in the next step without purification.

Step C : Ethyl 1-(4-fluorophenyl)-3-methyl-2-oxo-piperidine-3-carboxylate (420 mg, 1.50 mmol) was dissolved in EtOH (3 ml) and lithium hydroxide hydrate (63.1 mg , 1.50 mmol), then water (3 ml) and the reaction mixture was heated to 35°C. After 2 hours, additional lithium hydroxide hydrate (63.1 mg, 1.50 mmol) was added and the reaction mixture was allowed to stir at room temperature overnight. The reaction mixture was concentrated, diluted with water (25 ml) and the pH was reduced to <2 by adding concentrated HCl. The cloudy mixture was extracted with EtOAc, washed with brine, dried over sodium sulfate, filtered and concentrated to give 1-(4-fluorophenyl)-3-methyl-2-oxo-piperidine-3-carboxylic acid (390 mg, 1.55 mmol, 103 % exit).

Getting 52

4-((6-Aminopyridin-3-yl)oxy)-N-(1-methoxy-2-methylpropan-2-yl)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine -3-amine

Step A : 4-Chloro-1H-pyrazolo[3,4-b]pyridine (11.6 g, 75.5 mmol) was dissolved in DMF (100 ml) and crushed potassium hydroxide (12.7 g, 227 mmol) was added , then I ₂ (34.5 g, 136 mmol). The resulting dark solution was stirred under nitrogen at 50° C. for 2 hours. The reaction mixture was quenched by adding an aqueous solution of 10% NaHSO ₃ (75 ml). The suspension was further diluted with water (100 ml) and filtered. The resulting precipitate was washed with water (3×30 ml), dried with a toluene azeotrope (3×50 ml) by rotary evaporation to give 4-chloro-3-iodo-1H-pyrazolo[3,4-b]pyridine (21.0 g , 88%).

Step B : 4-chloro-3-iodo-1H-pyrazolo[3,4-b]pyridine (21.0 g, 75.1 mmol) was dissolved in DMF (100 ml). K ₂ CO ₃ (20.8 g, 150 mmol) and 1-(chloromethyl)-4-methoxybenzene (12.3 ml, 90.2 mmol) were added and the reaction mixture was stirred under nitrogen overnight. The reaction mixture was diluted with water (100 ml) and filtered. The isolated solids were washed with water (3×30 mL) and purified with silica gel (25% EtOAc in hexanes) to give 4-chloro-3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b ]pyridine.

Step C : To a mixture of 2-chloro-5-hydroxypyridine (1.69 g, 13.1 mmol) and 4-chloro-3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b] pyridine (2.61 g, 6.53 mmol) in DMA (32 ml) was added Cs ₂ CO ₃ (6.38 g, 19.6 mmol) and the reaction mixture was heated to 120°C for 1 h. The reaction mixture was cooled to room temperature and poured into water (500 ml). The resulting solid was filtered and purified with silica gel (25-100% EtOAc in hexanes) to give 4-((6-chloropyridin-3-yl)oxy)-3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo [3,4-b]pyridine (1.87 g, 3.80 mmol, 58.1% yield) as a white solid.

Step D : (2-methoxy-1,1-dimethylethyl)amine (0.185 mL, 1.52 mmol), 4-((6-chloropyridin-3-yl)oxy)-3-iodo-1-(4-methoxybenzyl) )-1H-pyrazolo[3,4-b]pyridine (0.250 g, 0.507 mmol), K ₂ CO ₃ (0.561 g, 4.06 mmol) and pyrrole-2-carboxylic acid (0.0282 g, 0.254 mmol) suspended in DMSO (2.5 ml) and the reaction mixture was degassed for 5 min with Ar. Copper(I) iodide (0.0483 g, 0.254 mmol) was added and the reaction mixture was heated to 70° C. under argon for 66 h. The cooled reaction mixture was added to 50 ml of water and extracted with DCM, washed with saturated NaHCO ₃ (15 ml ) and brine (15 ml), dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (10-100% EtOAc in hexanes) to give 4-((6-chloropyridin-3-yl)oxy)-N-(1-methoxy-2-methylpropan-2-yl)-1-( 4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-3-amine (0.147 g, 0.276 mmol, 54.5% yield).

Step E : To a solution of 4-((6-chloropyridin-3-yl)oxy)-N-(1-methoxy-2-methylpropan-2-yl)-1-(4-methoxybenzyl)-1H-pyrazolo[3, 4-b]pyridine-3-amine (0.050 g, 0.11 mmol) in toluene (0.5 ml) was added 2-dicyclohexylphosphino-2',6'-dimethoxy-1,1'-biphenyl (0.0066 g , 0.016 mmol), then tris(dibenzylideneacetone)dipalladium (0) (0.0049 g, 0.0053 mmol) and lithium bis(trimethylsilyl)amide (0.040 ml, 0.21 mmol). The solution was degassed with Ar for 10 min and heated to 80°C over the weekend. The cooled reaction mixture was poured into water (25 ml) and extracted with DCM. The combined organic layers were washed with saturated NaHCO ₃ (15 ml) and brine (15 ml), dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (10-50% EtOAc in hexanes) to give 4-((6-aminopyridin-3-yl)oxy)-N-(1-methoxy-2-methylpropan-2-yl)-1-( 4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-3-amine (0.033 g, 0.037 mmol, 34% yield).

Getting 53

(R)-2-((4-(4-Amino-2-fluorophenoxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)amino)propan-1- ol

3-Fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)aniline (Preparation 1; 1.0 g, 2, 04 mmol), K ₂ CO ₃ (2.26 g, 16.3 mmol) and pyrrole-2-carboxylic acid (113 mg, 1.02 mmol) were suspended in DMSO (20 ml) and the mixture was degassed for 5 min Ar . Cu(I)iodide (194 mg, 1.02 mmol) and D-alaninol (476 μl, 6.12 mmol) were added and the mixture heated to 60° C. in a sealed tube overnight. The mixture was cooled and partitioned between water (100 ml) and EtOAc (100 ml) and the aqueous layer was extracted with EtOAc (2×50 ml). The combined organic phases were washed with water (5×30 ml) and brine (30 ml), dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (0-3% MeOH in DCM) to give (R)-2-((4-(4-amino-2-fluorophenoxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3, 4-b]pyridin-3-yl)amino)propan-1-ol (0.716 g, 80%) as light brown foam.

The following compounds were also prepared using the method of Preparation 53.

Receipt Structure Name 54

(S)-2-((4-(4-Amino-2-fluorophenoxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)amino)propan-1- ol 55

(S)-4-(4-Amino-2-fluorophenoxy)-1-(4-methoxybenzyl)-N-(1-methoxypropan-2-yl)-1H-pyrazolo[3,4-b]pyridine-3- amine 56

(R)-4-(4-Amino-2-fluorophenoxy)-1-(4-methoxybenzyl)-N-(1-methoxypropan-2-yl)-1H-pyrazolo[3,4-b]pyridine-3- amine 57

4-(4-Amino-2-fluorophenoxy)-N-(1-methoxy-2-methylpropan-2-yl)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-3- amine 58

4-(4-Amino-2-fluorophenoxy)-N-(4,4-difluorobutan-2-yl)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-3-amine 59

(S)-4-(4-Amino-2-fluorophenoxy)-N-(1-ethoxypropan-2-yl)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-3- amine

Getting 60

(R)-2-((4-((6-aminopyridin-3-yl)oxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)amino)propane -1-ol

Step A : D-Alaninol (0.142 ml, 1.83 mmol), 4-((6-chloropyridin-3-yl)oxy)-3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3.4 -b]pyridine (0.300 g, 0.609 mmol), K ₂ CO ₃ (0.673 g, 4.87 mmol) and pyrrole-2-carboxylic acid (0.0338 g, 0.304 mmol) were suspended in DMSO (6.09 ml, 0.609 mmol) and then this mixture was degassed for 5 min with Ar. Copper(I) iodide (0.0483 g, 0.254 mmol) was added and heated to 60° C. under argon overnight. The cooled reaction mixture was added to 25 ml of cold water with stirring, the resulting solids were filtered and washed with 10 ml of hexane. The solids were purified with silica gel (10-100% EtOAc in hexanes) to give (R)-2-((4-((6-chloropyridin-3-yl)oxy)-1-(4-methoxybenzyl)-1H- pyrazolo[3,4-b]pyridin-3-yl)amino)propan-1-ol (0.155 g, 0.352 mmol, 57.9% yield) as a clear oil.

Step B : (R)-2-((4-((6-chloropyridin-3-yl)oxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl) amino)propan-1-ol (0.155 g, 0.352 mmol) was dissolved in DMF (3.52 ml, 0.352 mmol), cooled to 0° C. and then treated with imidazole (0.0360 g, 0.529 mmol) followed by t-butyldimethylsilyl chloride (0.0797 g, 0.529 mmol). The mixture was allowed to warm to room temperature over 1 h. The reaction mixture was partitioned between water and EtOAc, washed with water and brine, dried over sodium sulfate, filtered and concentrated to give (R)-N-(1-((tert-butyldimethylsilyl )oxy)propan-2-yl)-4-((6-chloropyridin-3-yl)oxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-3-amine (0.218 g, 0.393 mmol, 112% yield) as a clear oil.

Step C : To a mixture of tert-butyl carbamate (0.277 g, 2.36 mmol), Cs ₂ CO ₃ (0.256 g, 0.787 mmol), tris(dibenzylideneacetone)dipalladium(0) (0.0360 g, 0.0393 mmol), and 2-(dicyclohexylphosphino)-2',4',6'-tri-iso-propyl-1,1'-biphenyl (0.0375 g, 0.0787 mmol) a solution of (R)-N-(1- ((tert-butyldimethylsilyl)oxy)propan-2-yl)-4-((6-chloropyridin-3-yl)oxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine- 3-amine (0.218 g, 0.393 mmol) in 1,4-dioxane (3.9 mL). This mixture was degassed for 2 min with Ar and heated to 100°C for 16 h in a sealed tube. The reaction mixture was cooled and partitioned between EtOAc (2×25 ml) and water (25 ml), washed with brine (25 ml), dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (10-50% EtOAc in hexanes) to give tert-butyl (R)-(5-((3-((1-((tert-butyldimethylsilyl)oxy)propan-2-yl)amino) -1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)pyridin-2-yl)carbamate (0.147 g, 0.232 mmol, 58.9% yield) as white solid.

Step D : K tert-butyl (R)-(5-((3-((1-((tert-butyldimethylsilyl)oxy)propan-2-yl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo [3,4-b]pyridin-4-yl)oxy)pyridin-2-yl)carbamate (0.147 g, 0.232 mmol) was added 4N HCl in 1,4-dioxane (9.26 ml, 0.232 mmol) and the reaction mixture stirred overnight. The reaction mixture was concentrated and partitioned between DCM and 1N NaOH, washed with water and brine, dried over sodium sulfate, filtered and concentrated to give (R)-2-((4-((6-aminopyridin-3-yl)oxy) -1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)amino)propan-1-ol (0.091 g, 0.216 mmol, 93.5% yield).

The following compound was also prepared using the method of Preparation 60.

Receipt Structure Name 61

4-((6-Aminopyridin-3-yl)oxy)-N-(4,4-difluorobutan-2-yl)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-3 -amine 62

(R)-4-((6-aminopyridin-3-yl)oxy)-1-(4-methoxybenzyl)-N-(1-methoxypropan-2-yl)-1H-pyrazolo[3,4-b]pyridine -3-amine

Getting 63

N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl )-3-oxo-2,3-dihydropyridazine-4-carboxamide

To a 200 ml flask was added 3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)aniline (5 g, 10, 2 mmol), 2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxylic acid (2.87 g, 12.2 mmol), 3-(((ethylimino)methylene)amino)- N,N-dimethylpropan-1-amine hydrochloride (2.93 g, 15.3 mmol), and 1H-benzo[d][1,2,3]triazol-1-ol (2.07 g, 15.3 mmol). DMF (50 ml) was stirred at room temperature for 1 hour. The reaction mixture was poured into ice water (200 ml) and allowed to stir for 30 minutes. The precipitate was filtered and washed with water (100 ml) and hexanes (100 ml). The product was triturated with MeOH and dried to give N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (6.68 g, 92%) as a tan solid.

The following compound was also prepared using the method of Preparation 63.

Receipt Structure Name 64

N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl )-6-methyl-3-oxo-2,3-dihydropyridazine-4-carboxamide

Getting 65

N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl )-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide

To a stirred solution of 3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid (500 mg, 1.71 mmol) and HATU (0.887 g, 2.33 mmol) in DMF (10 mL) at room temperature was added DIEA (813 μL, 4.67 mmol) followed by 3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo [3,4-b]pyridin-4-yl)oxy)aniline (762 mg, 1.56 mmol). The reaction mixture was stirred at room temperature overnight and partitioned between water (30 ml) and EtOAc (30 ml) and the aqueous layer was extracted with EtOAc (2×20 ml). The combined organic phases were washed with water (5×10 ml) and brine (10 ml), dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (30-100% EtOAc in hexanes) to give N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine -4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (1.13 g, 95%) .

The following compounds were also prepared using the method of Preparation 65.

Receipt Structure Name 66

N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2,5-dioxo- 1-phenyl-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide 67

N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-1-(4-fluorophenyl )-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide

Example 1

N-(3-fluoro-4-((3-((2-hydroxyethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl) -3-oxo-2,3-dihydropyridazine-4-carboxamide

Stage A : Ethanolamine (0.0213 ml, 0.354 mmol), N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-4 -yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (preparation 63; 0.050 g, 0.0708 mmol), K ₂ CO ₃ (0.0489 g, 0.354 mmol) and L-proline (0.00407 g, 0.0354 mmol) were suspended in DMSO (0.708 ml) and degassed for 5 min with Ar. Copper(I) iodide (0.00674 g, 0.0354 mmol) was added and the reaction mixture was heated to 80° C. under argon overnight. The reaction mixture was partitioned between water (15 ml) and EtOAc (15 ml) and the combined organic layers were washed with brine, dried over Na ₂ SO ₄ , filtered and concentrated to give crude N-(3-fluoro-4-((3- ((2-hydroxyethyl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo- 2,3-dihydropyridazine-4-carboxamide, which was used in the next step without further purification.

Step B : To a solution of crude N-(3-fluoro-4-((3-((2-hydroxyethyl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (0.0453 g, 0.0708 mmol) in 2 ml DCM was added 4 ml TFA and the reaction mixture stirred for 2 h at 50°C. The reaction mixture was concentrated in vacuo and resuspended in 2 ml of a 60:40 ACN:water solution with 2% TFA. The product was purified by C18 HPLC (5-95% ACN in water with 0.2% TFA). Fractions containing product were treated with saturated NaHCO ₃ (15 ml) to obtain the free base and the aqueous layer was extracted with DCM (2 x 15 ml). The combined organic layer was washed with brine (15 ml), dried over Na ₂ SO ₄ , filtered and concentrated in vacuo to give N-(3-fluoro-4-((3-((2-hydroxyethyl)amino)-1H- pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (0.0022 g, 0.00424 mmol , 5.98% yield) as an off-white solid. Mass spectrum: m/z=520.1 (M+H). ¹ H NMR (d ₆ -DMSO) δ 12.20 (s, 1H), 11.70 (s, 1H), 8.39 (d, 1H), 8.27 (d, 1H), 8.16 ( s, 1H), 8.04 (d, 1H), 7.69 (m, 1H), 7.61 (m, 1H), 7.51 (t, 1H), 7.42 (m, 2H), 6.04 (d, 1H), 3.64 (t, 2H), 3.36 (t, 2H).

The following compounds were also synthesized using the method according to Example 1.

Etc. no. Structure Name Mass spectrum (apci)
m/z 2

N-(3-fluoro-4-((3-((2-methoxyethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl) -3-oxo-2,3-dihydropyridazine-4-carboxamide 534.1
(M+H) 3

N-(3-fluoro-4-((3-((1-hydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 548.1
(M+H) four

N-(3-fluoro-4-((3-((2-hydroxy-2-methylpropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-( 4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 548.2
(M+H) 5

(R)-N-(3-fluoro-4-((3-((2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-( 4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 534.1
(M+H) 6

(S)-N-(3-fluoro-4-((3-((2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-( 4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 534.1
(M+H) 7

(S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 534.1
(M+H) eight

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 534.1
(M+H) 9

N-(3-fluoro-4-((3-((3-hydroxy-2,2-dimethylpropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2 -(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 562.2
(M+H) ten

(S)-N-(4-((3-((2,3-dihydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 550.1
(M+H) eleven

N-(4-((3-(cyclobutylamino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2-(4-fluorophenyl)-3-oxo-2 ,3-dihydropyridazine-4-carboxamide 530.2
(M+H) 12

N-(4-((3-((3,3-difluorocyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2-(4-fluorophenyl )-3-oxo-2,3-dihydropyridazine-4-carboxamide 566.2
(M+H) 13

(R)-N-(4-((3-((2,3-dihydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 550.2 (M+H) fourteen

N-(3-fluoro-4-((3-(((1r,3r)-3-methoxycyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2 -(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 560.2 (M+H) fifteen

N-(3-fluoro-4-((3-(((1s,3s)-3-methoxycyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2 -(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 560.2 (M+H) 16

N-(3-fluoro-4-((3-(((1s,3s)-3-hydroxy-1-methylcyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 560.2 (M+H) apci - Atmospheric Pressure Chemical Ionization

Example 17

N-(3-fluoro-4-((3-((1-(methoxymethyl)cyclopropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide

1-(Methoxymethyl)cyclopropan-1-amine hydrochloride (0.087 g, 0.637 mmol), N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4- b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (preparation 63; 0.150 g, 0.212 mmol), K ₂ CO ₃ ( 0.235 g, 1.70 mmol) and pyrrole-2-carboxylic acid (0.0118 g, 0.106 mmol) were suspended in DMSO (2.12 ml, 0.212 mmol) and the reaction mixture was degassed for 5 min with Ar. Copper(I) iodide (0.0202 g, 0.106 mmol) was added and the reaction mixture was heated to 60° C. under argon for 22 h. The mixture was partitioned between water and EtOAc, the aqueous phase was extracted with EtOAc and the combined organic layers were washed with brine (2 x 15 ml), dried over sodium sulfate, filtered and concentrated. The resulting oil was purified with silica gel (0-10% MeOH in DCM). The isolated product was suspended in 5 ml DCM and 10 ml TFA and stirred for 16 h at 50°C. The mixture was concentrated in vacuo and the residue suspended in 2 ml of a 60:40 ACN:water solution with 2% TFA. The product was purified by C18 HPLC (5-95% ACN in water with 0.2% TFA). Fractions containing product were treated with saturated NaHCO ₃ (15 ml) to obtain the free base and the aqueous phase was extracted with DCM (2 x 15 ml). The combined organic layers were washed with brine (15 ml), dried over sodium sulfate, filtered and concentrated to give N-(3-fluoro-4-((3-((1-(methoxymethyl)cyclopropyl)amino)-1H-pyrazolo) [3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (0.0221 g, 0.0395 mmol, 18.6% yield) as a yellow solid. Mass spectrum: m/z=560.2 (M+H). ¹ H NMR (d ₆ -DMSO) δ 12.23 (s, 1H), 11.69 (s, 1H), 8.38 (d, 1H), 8.26 (d, 1H), 8.14 ( d, 1H), 8.02 (dd, 1H), 7.68 (m, 2H), 7.59 (m, 1H), 7.48 (t, 1H), 7.41 (m, 2H), 6.03 (m, 1H), 5.72 (s, 1H), 3.55 (s, 2H), 3.25 (s, 3H), 0.82 (m, 2H), 0.72 (m , 2H).

The following compounds were also synthesized using the method according to Example 17.

Etc. no. Structure Name Mass spectrum (apci)
m/z eighteen

N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 562.2 (M+H) 19

N-(3-fluoro-4-((3-((2-methoxyethyl)(methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 548.1 (M+H) twenty

N-(3-fluoro-4-((3-((1-(methoxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 588.2 (M+H) 21

N-(3-fluoro-4-((3-((1-(methoxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 574.2 (M+H) 22

N-(3-fluoro-4-((3-((4-methoxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 576.2 (M+H) 23

N-(3-fluoro-4-((3-(((tetrahydrofuran-2-yl)methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 560.2 (M+H) 24

N-(4-((3-(((1,1-dioxidotetrahydrothiophen-3-yl)methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 608.1 (M+H) 25

(S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 548.2 (M+H) 26

N-(4-((3-((1,3-dimethoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 578.2 (M+H) 27

N-(4-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 568.2 (M+H) 28

N-(3-fluoro-4-((3-((cis-2-(methoxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 588.2 (M+H) 29

N-(3-fluoro-4-((3-(((tetrahydrofuran-3-yl)methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 560.2 (M+H) thirty

N-(3-fluoro-4-((3-(((2-oxopiperidin-4-yl)methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)- 2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 587.2 (M+H) 31

N-(4-((3-(((1s,3s)-3-(dimethylcarbamoyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 601.2 (M+H)

Example 32

N-(4-((3-((1,3-dihydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide

2-amino-2-methyl-1,3-propanediol (0.0670 g, 0.637 mmol), N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[ 3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (preparation 63; 0.150 g, 0.212 mmol), K ₂ CO ₃ (0.235 g, 1.70 mmol) and pyrrole-2-carboxylic acid (0.0118 g, 0.106 mmol) were suspended in DMSO (2.12 ml, 0.212 mmol) and degassed for 5 min with Ar. Copper(I) iodide (0.0202 g, 0.106 mmol) was added and the reaction mixture was heated to 60° C. under argon for 22 h. CuI 0.5 eq., pyrrole-2-carboxylic acid (0 .5 equiv.) and 1 equiv. 2-amino-2-methyl-1,3-propanediol and the reaction mixture was stirred at 70°C for 16 hours the Reaction mixture was cooled, then divided between water and EtOAc. The aqueous phase was extracted with EtOAc and the combined organic layers were washed with brine, dried over sodium sulfate, filtered and concentrated in vacuo. The resulting oil was purified using silica gel (30-100% EtOAc in hexanes). The isolated product was suspended in 2 ml DCM and 4 ml TFA and stirred for 16 h at 50°C. The mixture was concentrated in vacuo and the residue was suspended in 5 ml DCM and 5 ml 1M LiOH and stirred at room temperature for 30 minutes. The mixture was partitioned between saturated NaHCO ₃ (15 ml) and DCM (15 ml). The aqueous phase was extracted with EtOAc (2 x 15 ml). The combined organic layers were washed with brine, dried over sodium sulfate, filtered and concentrated. The residue was suspended in 3 ml of a 60:40 ACN:water solution with 2% TFA. The product was purified by C18 chromatography (5-95% ACN in water with 0.2% TFA). Fractions containing product were treated with saturated NaHCO ₃ (15 ml) to obtain the free base and the aqueous phase was extracted with DCM. The combined organic layers were washed with brine, dried over sodium sulfate, filtered and concentrated to give N-(4-((3-((1,3-dihydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[ 3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazin-4-carboxamide (0.0127 g, 0.0225 mmol, 10.6% yield) as a yellow solid. Mass spectrum: m/z=564.2 (M+H). ¹ H NMR (d ₆ -DMSO) δ 12.21 (s, 1H), 11.70 (s, 1H), 8.38 (d, 1H), 8.26 (d, 1H), 8.15 ( d, 1H), 8.03 (dd, 1H), 7.68 (m, 2H), 7.59 (m, 1H), 7.50 (t, 1H), 7.41 (m, 2H), 6.04 (dd, 1H), 5.24 (s, 1H), 4.87 (t, 2H), 3.65 (dd, 2H), 3.50 (dd, 2H), 1.32 (s , 3H).

The following compounds were also synthesized using the method of Example 32.

Etc. no. Structure Name Mass spectrum (apci)
m/z 33

N-(3-fluoro-4-((3-((4-hydroxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 562.2 (M+H) 34

N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 562.1 (M+H) 35

N-(3-fluoro-4-((3-((2-hydroxyethyl)(methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 534.1 (M+H) 36

N-(3-fluoro-4-((3-(((1r,3r)-3-(hydroxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 560.1 (M+H) 37

N-(3-fluoro-4-((3-(((1s,3s)-3-(hydroxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 560.1 (M+H) 38

N-(3-fluoro-4-((3-((3-hydroxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 562.2 (M+H) 39

N-(3-fluoro-4-((3-((3-hydroxy-2,3-dimethylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 576.2 (M+H) 40

N-(3-fluoro-4-((3-((4-hydroxy-2-methylpentan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 576.2 (M+H) 41

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-6-methyl-3-oxo-2,3-dihydropyridazine-4-carboxamide 548.2 (M+H) 42

N-(3-fluoro-4-((3-((1-hydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-6-methyl-3-oxo-2,3-dihydropyridazine-4-carboxamide 562.2 (M+H) 43

N-(3-fluoro-4-((3-((4-hydroxy-1-methoxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 592.2 (M+H) 44

(S)-N-(3-fluoro-4-((3-((3,3,3-trifluoro-2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 588.1 (M+H) 45

N-(4-((3-((1,3-dihydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 550.2 (M+H) 46

N-(3-fluoro-4-((3-((1-hydroxy-3-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 554.1 (M+H) 47

N-(3-fluoro-4-((3-((1-hydroxy-3-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 578.2 (M+H) 48

N-(3-fluoro-4-((3-((4-hydroxy-1-methoxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 578.2 (M+H) 49

N-(3-fluoro-4-((3-((1-hydroxy-4-methoxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 578.2 (M+H) fifty

N-(4-((3-((2,2-difluoro-3-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 570.2 (M+H) 51

N-(4-((3-((4,4-difluoro-1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 584.2 (M+H) 52

N-(3-fluoro-4-((3-((4,4,4-trifluoro-1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 602.2 (M+H) 53

N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 560.2 (M+H) 54

N-(3-fluoro-4-((3-(((1S,2R)-2-(hydroxymethyl)-1-methylcyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 588.2 (M+H) 55

(R)-N-(3-fluoro-4-((3-((1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 548.2 (M+H) 56

(S)-N-(3-fluoro-4-((3-((1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 548.1 (M+H)

Example 57

N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclopropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide

Step A : N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-( 4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (preparation 63; 150 mg, 0.212 mmol), (1-aminocyclopropyl) methanol hydrochloride (26.2 mg, 0.212 mmol), 1H-pyrrole- 2-carboxylic acid (11.8 mg, 0.106 mmol) and K ₂ CO ₃ (235 mg, 1.70 mmol) were suspended in DMSO (2 ml) and nitrogen was bubbled through the mixture for 5 minutes. Copper(I) iodide (20.2 mg, 0.106 mmol) was added and the reaction mixture was heated to 60° C. overnight. The reaction mixture was cooled to room temperature, diluted with water (10 ml), stirred for 10 min, and then filtered. The isolated solids were suspended in DCM/MeOH, dried over sodium sulfate, filtered through Celite® and the filtrate was concentrated. The residue was purified with silica gel (10-100% EtOAc in hexane) to give N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclopropyl)amino)-1-(4-methoxybenzyl)-1H -pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (75 mg, 0.113 mmol, 53, 1% yield) as a yellow solid.

Step B : N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclopropyl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (75 mg, 0.11 mmol) was dissolved in DCM (0.5 ml) and TFA (0 .5 ml). The reaction mixture was heated to 50°C overnight and then concentrated. The residue was dissolved in MeOH and the excess was added K ₂ CO ₃ . The mixture was stirred for 10 min, then partitioned between water and DCM. The organic layer was dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (0-10% MeOH in DCM) to give N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclopropyl)amino)-1H-pyrazolo[3,4-b ]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (33 mg, 0.060 mmol, 54% yield) as an orange solid. Mass spectrum: m/z=546.2 (M+H). ¹ H NMR (d ₆ -DMSO) δ 12.22 (s, 1H), 11.70 (s, 1H), 8.38 (d, 1H), 8.26 (d, 1H), 8.14 ( d, 1H), 8.03 (dd, 1H), 7.68 (m, 2H), 7.59 (m, 1H), 7.48 (t, 1H), 7.41 (m, 2H), 6.03 (m, 1H), 5.76 (s, 1H), 3.59 (s, 2H), 0.75 (m, 4H).

The following compounds were also synthesized using the method of Example 57.

Etc. no. Structure Name Mass spectrum (apci)
m/z 58

N-(3-fluoro-4-((3-((cis-2-(hydroxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 574.2 (M+H) 59

N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 574.2 (M+H) 60

(R)-N-(3-fluoro-4-((3-((2-hydroxy-1-phenylethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 596.2 (M+H) 61

N-(3-fluoro-4-((3-((1-hydroxy-2-(hydroxymethyl)butan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 578.2 (M+H) 62

N-(3-fluoro-4-((3-((2-hydroxy-1-(pyridin-3-yl)ethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 597.2 (M+H) 63

N-(3-fluoro-4-((3-((2-hydroxy-1-(pyridin-4-yl)ethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 597.2 (M+H) 64

N-(3-fluoro-4-((3-((2-hydroxy-1-(tetrahydro-2H-pyran-4-yl)ethyl)amino)-1H-pyrazolo[3,4-b]pyridine-4 -yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 604.2 (M+H) 65

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2,5-dioxo-1-phenyl-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide 583.2 (M+H) 66

N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-1-(4-fluorophenyl )-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide 601.2 (M+H) 67

(R)-N-(3-fluoro-4-((3-((1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H) 68

(S)-N-(3-fluoro-4-((3-((1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H) 69

N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4 -fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 618.2 (M+H) 70

N-(3-fluoro-4-((3-((1-hydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H)

Example 71

2-(4-fluorophenyl)-N-(5-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-3-oxo-2,3-dihydropyridazin-4-carboxamide

To a mixture of 4-((6-aminopyridin-3-yl)oxy)-N-(1-methoxy-2-methylpropan-2-yl)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b ]pyridine-3-amine (preparation 52; 0.033 g, 0.074 mmol), 2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxylic acid (0.034 g, 0.15 mmol), EDCI (0.085 g, 0.44 mmol) and HOBt (0.060 g, 0.44 mmol) were added DMF (0.7 ml) and the reaction mixture was stirred for 2 h. The reaction mixture was diluted with water, stirred for 30 min and then filtered. The isolated solids were washed with water and hexanes. The solids were dissolved in TFA (2 ml) and heated to 50° C. overnight. The reaction mixture was concentrated and purified by C18 chromatography (5-95% ACN in water with 0.2% TFA). Fractions containing product were treated with saturated NaHCO ₃ (30 ml) to obtain the free base and the aqueous phase was extracted with DCM (2 X 15 ml). The combined organic layers were washed with saturated NaHCO ₃ (15 ml) and brine (15 ml), dried over sodium sulfate, filtered and concentrated to give 2-(4-fluorophenyl)-N-(5-((3-((1 -methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)pyridin-2-yl)-3-oxo-2,3-dihydropyridazin-4 -carboxamide (0.0020 g, 0.0037 mmol, 5.0% yield). Mass spectrum: m/z=545.2 (M+H). ¹ H NMR (CDCl ₃ ) δ 12.20 (s, 1H), 8.47 (d, 1H), 8.40 (d, 1H), 8.33 (d, 1H), 8.22 (d, 1H), 8.17(m, 1H), 7.67-7.60(m, 3H), 7.22(m, 2H), 6.10(d, 1H), 5.02(br s , 1H), 3.52 (s, 2H), 3.36 (s, 3H), 1.47 (s, 6H).

Example 72

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide

Step A : N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-( 4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (preparation 65; 200 mg, 0.26 mmol), D-alaninol (61 µl, 0.785 mmol ), K ₂ CO ₃ (289 mg, 2.09 mmol) and pyrrole-2-carboxylic acid (0.0145 g, 0.131 mmol) were suspended in DMSO (5 ml) and the mixture was degassed for 5 min with Ar. Added Cu(I)iodide and the mixture was heated to 60°C in a sealed tube overnight and then cooled to room temperature. The cooled mixture was partitioned between water (10 ml) and EtOAc (10 ml) and the aqueous layer was extracted with EtOAc (2×10 ml). The combined organic phases were washed with water (5×10 ml) and brine (10 ml), then dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (0-5% MeOH in DCM) to give (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4 -methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4 -tetrahydropyrimidine-5-carboxamide (98 mg, 53%) as a white solid.

Step B : To a solution of (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4 -b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (98 mg, 0 .14 mmol) in DCM (2 ml) was added TFA (4 ml). The mixture was stirred at 35°C overnight. The mixture was concentrated and dried in vacuo. The residue was dissolved in MeOH/DCM, treated with K ₂ CO ₃ (57 mg, 0.41 mmol) and stirred at room temperature for 4 h. The mixture was filtered and concentrated. The residue was purified with silica gel (0-7.5% MeOH in DCM) to give (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H- pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (68 mg, 83%) as a yellow solid. Mass spectrum: m/z=592.2 (M+H). ¹ H NMR (CDCl ₃ ) δ 11.00 (s, 1H), 8.69 (s, 1H), 8.16 (d, 1H), 7.90 (dd, 1H), 7.30 (m, 1H), 7.27 (s, 2H), 7.25 (s, 2H), 7.22 (d, 1H), 6.12 (d, 1H), 4.98 (m, 1H), 4, 02 (m, 1H), 3.83 (dd, 1H), 3.71 (dd, 1H), 1.51 (d, 6H), 1.34 (d, 3H).

The following compounds were also synthesized using the method of Example 72.

Etc. no. Structure Name mass spectrum 73

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)(methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H) 74

(S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)(methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H) 75

(R)-N-(3-fluoro-4-((3-((2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-( 4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 592.2 (M+H) 76

(S)-N-(3-fluoro-4-((3-((2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-( 4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 592.2 (M+H) 77

N-(3-fluoro-4-((3-((2-hydroxy-2-methylpropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-( 4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H) 78

N-(3-fluoro-4-((3-(((2R,3S)-3-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H) 79

N-(3-fluoro-4-((3-(((2R,3R)-3-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H) 80

(R)-N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 620.2 (M+H) 81

(S)-N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 620.2 (M+H)

Example 82

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide hydrochloride

Step A : To a stirred solution of 3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid (66.4 mg, 0.251 mmol) and HATU ( 0.1304 g, 0.3429 mmol) in DMF (3 ml) at room temperature was added DIEA (119 μl, 0.686 mmol), then (R)-2-((4-(4-amino-2-fluorophenoxy)- 1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)amino)propan-1-ol (preparation 53; 100 mg, 0.229 mmol) and stirred overnight. The reaction mixture was partitioned between water (20 ml) and EtOAc (20 ml) and the aqueous layer was extracted with EtOAc (2×10 ml). The combined organic phases were washed with water (5×10 ml) and brine (10 ml), dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (0-5% MeOH in DCM) to give (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4 -methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4 -tetrahydropyrimidine-5-carboxamide (123 mg, 79%).

Step B : To a solution of (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4 -b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (123.0 mg , 0.180 mmol) in DCM (1 ml) was added TFA (2 ml). The mixture was stirred at 35°C for 7 h and then cooled to room temperature overnight. The mixture was concentrated and the residue was dissolved in MeOH/DCM, treated with K ₂ CO ₃ (74.6 mg, 0.540 mmol) and stirred for 5.5 h. The mixture was filtered and concentrated and the residue was purified using silica gel (0-5% MeOH in DCM). The purified compound was dissolved in DCM (5 ml), treated with 4N HCl/dioxanes (0.5 ml), concentrated and dried in vacuo to give (R)-N-(3-fluoro-4-((3-((1- hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1, 2,3,4-tetrahydropyrimidine-5-carboxamide hydrochloride (20.3 mg, 18%) as a yellow solid. Mass spectrum: m/z=564.2 (M+H-HCl). ¹ H NMR (CDCl ₃ ) δ 11.05 (s, 1H), 8.67 (s, 1H), 8.26 (d, 1H), 7.95 (dd, 1H), 7.36-7, 22 (m, 6H), 6.22 (d, 1H), 4.02 (m, 1H), 3.76 (m, 1H), 3.71 (s, 3H), 3.65 (m, 1H ), 1.35 (d, 3H).

The following compounds were also synthesized using the method according to Example 82 .

Etc. no. Structure Name mass spectrum 83

(R)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 578.2 (M+H) 84

(R)-1-(cyclopropylmethyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 604.2 (M+H) 85

(R)-4-ethoxy-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide 577.2 (M+H) 86

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1,5-dimethyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazole-4-carboxamide 532.2 (M+H) 87

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-methyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazole-4-carboxamide 518.2 (M+H) 88

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-1-methyl-3-oxo-2,3-dihydro-1H-pyrazole-4-carboxamide 536.2 (M+H) 89

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-(1-methylazetidin-3-yl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 619.2 (M+H) 90

(R)-3-cyclopentyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 566.2 (M+H) 91

(R)-1-cyclobutyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 604.2 (M+H) 92

(R)-3-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 610.2 (M+H) 93

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-isopropyl-3-(1-methyl-1H-pyrazol-4-yl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 578.2 (M+H) 94

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-2,4-dioxo-1-(pentan-3-yl)-1,2,3,4-tetrahydropyrimidine-5-carboxamide 620.2 (M+H) 95

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1,3-diisopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 540.2 (M+H) 96

(R)-3-cyclohexyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 580.3 (M+H) 97

(R)-3-(4-chlorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 608.2 (M+H) 98

(S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 592.2 (M+H) 99

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-isopropyl-2,4-dioxo-3-(tetrahydro-2H-pyran-4-yl)-1,2,3,4-tetrahydropyrimidine-5-carboxamide 582.2 (M+H) 100

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-6-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 547.2 (M+H) 101

N-(3-fluoro-4-((3-(((R)-1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-2-oxopiperidine-3-carboxamide 537.3 (M+H) 102

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-4-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 547.2 (M+H) 103

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 547.2 (M+H) 104

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-3-oxo-3,4-dihydropyrazine-2-carboxamide 534.2 (M+H) 105

(R)-6-cyclopropyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 574.2 (M+H) 106

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-6-isopropyl-3-oxo-2,3-dihydropyridazine-4-carboxamide 576.2 (M+H) 107

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-5-oxo-3-thioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 609.2 (M+H) 108

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 593.2 (M+H) 109

(S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 593.2 (M+H) 110

(R)-1-cyclopropyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 590.2 (M+H) 111

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(5-fluoropyridin-2-yl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide 602.2 (M+H) 112

(R)-5-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide 530.2 (M+H) 113

(R)-1-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 530.2 (M+H) 114

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide 575.2 (M+H) 115

(R)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-5-(4-fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide 561.2 (M+H) 116

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide 547.2 (M+H) 117

(S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 547.2 (M+H) 118

(S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide 547.2 (M+H) 119

(R)-5-cyclopropyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide 573.2 (M+H) 120

(R)-1-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 565.1 (M+H) 121

(R)-5-bromo-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide 611.1, 613.1 (M+H) 122

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(3-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 547.2 (M+H) 123

(R)-5-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide 593.2 (M+H) 124

(R)-5-(4-chlorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)phenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide 591.2 (M+H) 125

(S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide 575.2 (M+H) 126

(S)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-5-(4-fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide 561.2 (M+H) 127

(R)-5-(2,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide 593.2 (M+H) 128

(R)-3-(3,4-difluorophenyl)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3, 4-b]pyridin-4-yl)oxy)phenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 596.2 (M+H) 129

(R)-5-chloro-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide 567.2 (M+H) 130

(S)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 578.2 (M+H) 131

(S)-3-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 610.2 (M+H) 132

(S)-4-(3,4-difluorophenyl)-2-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3, 4-b]pyridin-4-yl)oxy)phenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 597.2 (M+H) 133

(R)-4-(3,4-difluorophenyl)-2-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3, 4-b]pyridin-4-yl)oxy)phenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 597.2 (M+H) 134

(S)-4-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 611.2 (M+H) 135

(R)-4-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 611.2 (M+H) 136

(S)-2-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-4-(4-fluorophenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 579.2 (M+H) 137

(R)-2-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-4-(4-fluorophenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 579.2 (M+H) 138

(S)-3-(3,4-difluorophenyl)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3, 4-b]pyridin-4-yl)oxy)phenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 596.2 (M+H) 139

(S)-1-cyclopropyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 590.2 (M+H) 140

N-(3-fluoro-4-((3-(((R)-1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-6-oxo-5-azaspiro[2.5]octane-7-carboxamide 563.2 (M+H) 141

N-(3-fluoro-4-((3-(((R)-1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-3-methyl-2-oxopiperidine-3-carboxamide 551.2 (M+H)

Example 142

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-hydroxy-2-oxo-1-phenyl-1,2-dihydroquinoline-3-carboxamide

Step A : N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2.5 -dioxo-1-phenyl-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide (preparation 66; 400 mg, 0.53 mmol), D-alaninol (124 μl, 1.59 mmol), K ₂ CO ₃ (585 mg, 4.24 mmol) and pyrrole-2-carboxylic acid (0.0294 g, 0.265 mmol) were suspended in DMSO (5 ml) and the mixture was degassed for 5 min with Ar. Added Cu(I)iodide and the mixture was heated to 60°C in a sealed tube overnight. The cooled mixture was partitioned between water (30 ml) and EtOAc (30 ml) and the aqueous layer was extracted with EtOAc (2×20 ml). The combined organic phases were washed with water (5×20 ml) and brine (20 ml), dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel to give 2 products. The lower Rf material was isolated to give (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[ 3,4-b]pyridin-4-yl)oxy)phenyl)-5-hydroxy-2-oxo-1-phenyl-1,2-dihydroquinoline-3-carboxamide (41 mg, 11%).

Step B : (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b ]pyridin-4-yl)oxy)phenyl)-5-hydroxy-2-oxo-1-phenyl-1,2-dihydroquinoline-3-carboxamide (41 mg, 0.06 mmol) was dissolved in DCM (0.5 ml ) and TFA (1 ml) was added and the reaction mixture was heated to 35°C for 4 hours. The cooled mixture was concentrated, diluted with DCM and concentrated again. The residue was dissolved in MeOH with a little DCM to improve solubility and K ₂ CO ₃ (20 mg) was added. After stirring for 2 hours, the reaction mixture was filtered and concentrated. The residue was purified with silica gel (0-12% MeOH in DCM) to give (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[ 3,4-b]pyridin-4-yl)oxy)phenyl)-5-hydroxy-2-oxo-1-phenyl-1,2-dihydroquinoline-3-carboxamide (11.2 mg, 33%). Mass spectrum: m/z=581.2 (M+H). ¹ H NMR (CD ₃ OD) δ 12.23 (s, 1H), 9.58 (d, 1H), 8.13 (d, 1H), 8.00 (dd, 1H), 7.71-7 .57 (m, 3H), 7.40 (ddd, 1H), 7.35-7.29 (m, 6H), 7.23 (t, 1H), 6.73 (d, 1H), 6, 14 (d, 1H), 6.09 (dd, 1H), 3.93 (m, 1H), 3.70 (d, 2H), 1.34 (d, 3H).

Example 143

(R)-2-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-3-oxo-2,3-dihydropyridazin-4-carboxamide hydrochloride

To a mixture of (R)-2-((4-((6-aminopyridin-3-yl)oxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)amino )propan-1-ol (preparation 60; 0.030 g, 0.071 mmol), 2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxylic acid (0.033 g, 0.14 mmol), EDCI (0.082 g, 0.43 mmol) and HOBt (0.058 g, 0.43 mmol) were added DMF (0.7 ml). The reaction mixture was allowed to stir for 4 hours and then added to 50 ml of water with stirring. The resulting solids were filtered and washed with water (15 ml) and hexanes (15 ml) and purified by C18 chromatography (5-95% ACN in water with 0.2% TFA). The purified material was dissolved in TFA (2 ml) and heated to 50° C. for 4 h. The reaction mixture was concentrated and partitioned between DCM and 1M LiOH. The combined organic layers were dried over sodium sulfate, filtered and concentrated. The residue was purified by C18 chromatography (5-95% ACN in water with 0.2% TFA). Fractions containing product were concentrated in vacuo and then treated with 4N. HCl in dioxanes. A small amount of methanol (5 ml) was added to make sure everything was in solution. The mixture was concentrated in vacuo. The isolated solids were dried overnight to give (R)-2-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4 -b]pyridin-4-yl)oxy)pyridin-2-yl)-3-oxo-2,3-dihydropyridazin-4-carboxamide hydrochloride (0.0054 g, 0.0092 mmol, 13% yield) as yellow solid. Mass spectrum: m/z=517.2 (M+H-HCl). ¹ H NMR (d ₆ -DMSO) δ 12.13 (s, 1H), 8.45 (d, 1H), 8.42 (d, 1H), 8.40 (d, 1H), 8.34 ( d, 1H), 8.22 (s, 1H), 7.96 (m, 1H), 7.69 (m, 2H), 7.41 (m, 2H), 6.13 (d, 1H), 3.80 (m, 1H), 3.73-3.65 (m, 2H), 3.55-3.45 (m, 3H), 1.22 (d, 3H).

The following compounds were also prepared using the method of Example 143.

Etc. no. Structure Name mass spectrum 144

(R)-2-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-6-methyl-3-oxo-2,3-dihydropyridazine-4-carboxamide 531.2 (M+H) 145

(R)-3-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 575.2 (M+H)

Example 146

(R)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide hydrochloride

Step A : 3-(4-Fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid (preparation 7; 11.3 g, 38.5 mmol) was dissolved in DMF (150 ml) and 2-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)-1,1,3,3-tetramethylisouronium hexafluorophosphate(V) (14 .7 g, 38.5 mmol). The reaction mixture was stirred for 10 minutes and then triethylamine (13.4 ml, 96.3 mmol) was added to the mixture. (R)-4-(4-Amino-2-fluorophenoxy)-1-(4-methoxybenzyl)-N-(1-methoxypropan-2-yl)-1H-pyrazolo[3,4-b]pyridine-3- amine (14.5 g, 32.1 mmol) dissolved in DMF (50 ml) was added to the reaction mixture and the reaction mixture was stirred overnight. The reaction mixture was partitioned between 80% saline and MTBE. The combined organic layers were dried over Na ₂ SO ₄ , filtered and concentrated, during which formed solid particles. The concentrated solution was filtered to give the crude product. The filtrate was purified with silica gel (40-80% EtOAc in hexanes) to give additional product. The pooled lots gave (R)-N-(3-fluoro-4-((1-(4-methoxybenzyl)-3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b ]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (22.3 g, 30 .7 mmol, 95.7% yield).

Step B : (R)-N-(3-fluoro-4-((1-(4-methoxybenzyl)-3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b ]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (22.3 g, 30 .7 mmol) was dissolved in TFA (40 ml) and heated to 50°C. After 4 hours, additional TFA (10 ml) was added. After 8 h, the reaction mixture was cooled and carefully poured into MTBE (150 ml) with vigorous stirring. The solids were dissolved in EtOAc and washed with saturated NaHCO ₃ , dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (70-100% EtOAc in hexanes) to give a solid. The solid was dissolved in DCM (100 ml) and 5M HCl in IPA (1.5 eq) was added. The solution was slowly added to 700 ml of Et ₂ O with stirring. The mixture was stirred for 10 min, then filtered and the solids washed with Et ₂ O. The isolated solids were dried in a vacuum oven to give (R)-N-(3-fluoro-4-((3-((1-methoxypropane-2 -yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3 ,4-tetrahydropyrimidine-5-carboxamide hydrochloride (13.9 g, 21.6 mmol, 70.5% yield) as a bright yellow solid. Mass spectrum: m/z=606.2 (M+H-HCl). ¹ H NMR (d ₆ -DMSO) δ 11.07 (s, 1H), 8.68 (s, 1H), 8.24 (d, 1H), 8.03 (dd, 1H), 7.57 ( dd, 1H), 7.50 (t, 1H), 7.43 (m, 2H), 7.36 (m, 2H), 6.11 (dd, 1H), 4.78 (m, 1H), 3.98 (m, 1H), 3.51 (dd, 1H), 3.39 (dd, 1H), 1.43 (d, 6H), 1.23 (d, 3H).

The following compounds were also prepared using the method of Example 146.

Etc. no. Structure Name mass spectrum 147

(S)-3-cyclopentyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 580.3 (M+H) 148

(S)-1-ethyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 592.2 (M+H) 149

(S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 578.2 (M+H) 150

(S)-1-(cyclopropylmethyl)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 618.2 (M+H) 151

(S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-6-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 561.2 (M+H) 152

(S)-1-cyclobutyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 618.2 (M+H) 153

(S)-3-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 624.2 (M+H) 154

(S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H) 155

N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 620.2 (M+H) 156

N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 621.2 (M+H) 157

1-ethyl-N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 606.2 (M+H) 158

N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 592.2 (M+H) 159

N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-(2-hydroxyethyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 622.2 (M+H) 160

(R)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-6-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 561.2 (M+H) 161

(R)-1-cyclobutyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 618.3 (M+H) 162

(R)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 607.2 (M+H) 163

(S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide 607.2 (M+H) 164

N-(4-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-3- (4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 626.2 (M+H) 165

N-(4-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-5- (4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide 581.2 (M+H) 166

N-(4-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-6-isopropyl-3-oxo-2,3-dihydropyridazine-4-carboxamide 610.2 (M+H) 167

N-(5-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)pyridin-2-yl)-5 -(4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide 564.2 (M+H) 168

N-(5-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)pyridin-2-yl)-1 -(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 564.2 (M+H) 169

(S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 561.2 (M+H) 170

N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 575.2 (M+H) 171

(S)-3-(3,4-difluorophenyl)-N-(4-((3-((1-ethoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)-3-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 638.3 (M+H) 172

(S)-N-(4-((3-((1-ethoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)- 1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 575.2 (M+H) 173

(S)-N-(4-((3-((1-ethoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)- 2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 562.2 (M+H) 174

(R)-5-(4-fluorophenyl)-1-isopropyl-N-(5-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)pyridin-2-yl)-4-oxo-1,4-dihydropyridine-3-carboxamide 572.2 (M+H) 175

(R)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-6-isopropyl-3-oxo-2,3-dihydropyridazine-4-carboxamide 590.2 (M+H) 176

(R)-2-(4-fluorophenyl)-6-isopropyl-N-(5-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)pyridin-2-yl)-3-oxo-2,3-dihydropyridazin-4-carboxamide 573.2 (M+H) 177

(R)-5-cyclopropyl-1-(4-fluorophenyl)-N-(5-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)pyridin-2-yl)-2-oxo-1,2-dihydropyridine-3-carboxamide 570.3 (M+H) 178

(R)-1-(4-fluorophenyl)-N-(5-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide 544.2 (M+H)

Example 179

(R)-1-(cyclopropylmethyl)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide

To a mixture of 1-(cyclopropylmethyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxylic acid (Preparation 10; 0.0438 g, 0.144 mmol), ( R)-4-(4-amino-2-fluorophenoxy)-1-(4-methoxybenzyl)-N-(1-methoxypropan-2-yl)-1H-pyrazolo[3,4-b]pyridine-3-amine (0.050 g, 0.111 mmol), EDCI (0.0637 g, 0.332 mmol) and HOBt (0.0449 g, 0.332 mmol) were added DMF (1.1 ml) and stirred overnight. The reaction mixture was added to 30 ml of cold water with stirring. The resulting solids were filtered and washed with water (15 ml) and hexanes (5 ml). The isolated solids were suspended in 5 ml DCM, treated with 5 ml TFA and left to stir for 2 h at 50°C. The reaction mixture was concentrated and partitioned between saturated NaHCO ₃ and DCM. The organic layer was washed with water and then with brine, dried over Na ₂ SO ₄ , filtered and concentrated. The residue was purified with silica gel (5-50% EtOAc in DCM) to give (R)-1-(cyclopropylmethyl)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino )-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (54 mg, 71%). Mass spectrum: m/z=618.2 (M+H). ¹ H NMR (d ₆ -DMSO) δ 12.19 (s, 1H), 11.03 (s, 1H), 8.92 (s, 1H), 8.13 (d, 1H), 8.00 ( dd, 1H), 7.53 (dd, 1H), 7.45 (m, 3H), 7.36 (m, 2H), 6.02 (dd, 1H), 5.09 (d, 1H), 3.96 (m, 1H), 3.86 (d, 2H), 3.50 (dd, 1H), 3.37 (dd, 1H), 3.27 (s, 3H), 1.22 (d , 3H), 0.57 (m, 2H), 0.44 (m, 2H).

The following compounds were also prepared using the method of Example 179.

Etc. no. Structure Name mass spectrum 180

(R)-1-ethyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 592.2 (M+H) 181

(R)-4-ethoxy-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide 591.2 (M+H)

Example 182

N-(3-fluoro-4-((3-((1-(2-hydroxypropan-2-yl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide

Step A : N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-( 4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (preparation 63; 75 mg, 0.11 mmol), methyl 1-aminocyclopentane-1-carboxylate hydrochloride (57 mg, 0.32 mmol), 1H-pyrrole-2-carboxylic acid (5.9 mg, 0.053 mmol) and K ₂ CO ₃ (117 mg, 0.85 mmol) were suspended in DMSO (1 ml) and sparged with nitrogen for 5 minutes. Copper(I) iodide (10 mg, 0.053 mmol) was added and the reaction mixture was heated to 70° C. overnight. The reaction mixture was cooled, diluted with EtOAc (10 ml), stirred for 10 min and filtered. The filtrate was washed with water and brine, dried over Na ₂ SO ₄ , filtered through Celite® and concentrated. The residue was purified with silica gel (0-10% MeOH in DCM) to give methyl 1-((4-(2-fluoro-4-(2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4 -carboxamido)phenoxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)amino)cyclopentan-1-carboxylate (25 mg, 0.035 mmol, 33% yield).

Step B : Methyl 1-((4-(2-fluoro-4-(2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamido)phenoxy)-1-(4-methoxybenzyl) -1H-pyrazolo[3,4-b]pyridin-3-yl)amino)cyclopentan-1-carboxylate (25mg, 0.035mmol) was dissolved in THF (1ml) and methylmagnesium bromide (99µl, 0.14mmol) was added . The reaction mixture was stirred for 10 minutes. The reaction mixture was partitioned between saturated NH ₄ Cl and EtOAc and the organic layer was washed with brine, dried over sodium sulfate, filtered and concentrated to give N-(3-fluoro-4-((3-((1-(2-hydroxypropane -2-yl)cyclopentyl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo -2,3-dihydropyridazine-4-carboxamide (17 mg, 0.024 mmol, 68% yield).

Step C : N-(3-fluoro-4-((3-((1-(2-hydroxypropan-2-yl)cyclopentyl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4- b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (17 mg, 0.024 mmol) was dissolved in DCM (1 ml) and added TFA (2 ml). The reaction mixture was stirred at 37°C overnight. The reaction mixture was concentrated and partitioned between DCM and 1N NaOH. The organic layer was dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (1-15% MeOH in DCM) to give N-(3-fluoro-4-((3-((1-(2-hydroxypropan-2-yl)cyclopentyl)amino)-1H-pyrazolo [3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (9.4 mg, 0.016 mmol, 66% yield) as a yellow solid. Mass spectrum: m/z=602.2 (M+H). ¹ H NMR (CDCl ₃ ) δ 11.85 (s, 1H), 9.26 (s, 1H), 8.42 (d, 1H), 8.18 (d, 1H), 7.97 (dd, 1H), 7.60 (m, 2H), 7.42 (ddd, 1H), 7.32-7.22 (m, 3H), 6.10 (dd, 1H), 5.02 (s, 1H ), 2.36 (m, 2H), 2.16 (m, 2H), 1.85 (m, 4H), 1.55 (s, 6H).

Example 183

2-((4-(2-fluoro-4-(2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamido)phenoxy)-1H-pyrazolo[3,4-b]pyridine -3-yl)amino)-2-methylpropyl hydrosulfate

N-(3-fluoro-4-((3-((1-hydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (Example 3; 50 mg, 0.0913 mmol) was suspended in DMF (1 ml) and heated to 50°C. Sulfuric acid (9 μl, 0.14 mmol) was added and the reaction mixture was stirred for 10 minutes. The reaction mixture was cooled to room temperature, MTBE (2 ml) was added and the reaction mixture was vigorously stirred for 10 minutes. The reaction mixture was decanted and the remaining oil was treated with water (2 ml) with vigorous stirring. The resulting solids were filtered off and dried to give 2-((4-(2-fluoro-4-(2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamido)phenoxy)-1H-pyrazolo [3,4-b]pyridin-3-yl)amino)-2-methylpropyl hydrogen sulfate (44 mg, 0.0701 mmol, 76.8% yield) as a yellow solid. Mass spectrum: m/z=548.2 (M+H-SO3). ¹ H NMR (CDCl ₃ ) δ 12.38 (br s, 1H), 11.70 (s, 1H), 8.37 (d, 1H), 8.27 (d, 1H), 8.18 ( m, 1H), 8.03 (dd, 1h), 7.69 (m, 2H), 7.61-7.49 (m, 2H), 7.41 (m, 2H), 6.08 (d , 1H), 3.86 (s, 2H), 1.40 (s, 6H).

Examples 184 and 185

(S)-N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide (Example 184) and (R)-N-(3-fluoro-4-((3-(( 3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2, 3-dihydropyridazine-4-carboxamide (Example 185)

N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide was purified by SFC on a Chiral Tech IA column (5-70% MeOH:IPA:DIEA 80:20:0.1) with obtaining each purified enantiomer. The absolute configuration is unknown. Peak 1: Mass spectrum: m/z=562.1 (M+H). Peak 2: Mass spectrum: m/z=562.1 (M+H).

In accordance with the method described in example 184, the following single enantiomers were isolated from their racemic mixtures, obtained as racemates, as described above.

Etc. no. Structure Name mass spectrum 186

N-(3-fluoro-4-((3-(((1S,2R)-2-(hydroxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 574.2 (M+H) 187

N-(3-fluoro-4-((3-(((1R,2S)-2-(hydroxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 574.2 (M+H) 188

(S)-N-(3-fluoro-4-((3-((4-hydroxy-1-methoxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 592.2 (M+H) 189

(R)-N-(3-fluoro-4-((3-((4-hydroxy-1-methoxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 592.2 (M+H) 190

(S)-N-(3-fluoro-4-((3-((1-hydroxy-3-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 564.2 (M+H) 191

(R)-N-(3-fluoro-4-((3-((1-hydroxy-3-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 564.1 (M+H) 192

(R)-N-(3-fluoro-4-((3-((1-hydroxy-4-methoxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 578.2 (M+H) 193

(S)-N-(3-fluoro-4-((3-((1-hydroxy-4-methoxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 578.2 (M+H) 194

(R)-N-(4-((3-((4,4-difluoro-1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) -3-fluorophenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 584.2 (M+H) 195

(S)-N-(4-((3-((4,4-difluoro-1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) -3-fluorophenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide 584.2 (M+H)

Example 196

N-(4-((3-amino-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4 -dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide

Step A : Suspension of N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3- (4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (preparation 65; 100 mg, 0.13 mmol), tert-butyl carbamate (0.153 g, 1.3 mmol), N1,N2-dimethylethane-1,2-diamine (0.032 ml, 0.26 mmol), K ₃ PO ₄ (0.16 g, 0.78 mmol) and copper (I) iodide (0.024 g, 0.13 mmol) in dioxane (2 ml) was stirred at 60°C for 12 h. The reaction mixture was diluted with water (30 ml) and extracted with DCM (3×20 ml). The organic layer was washed with brine (15 ml), dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel (20-60% EtOAc in hexanes) to give tert-butyl (4-(2-fluoro-4-(3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1, 2,3,4-tetrahydropyrimidin-5-carboxamido)phenoxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)carbamate (45.8 mg, 46%).

Step B : To a solution of tert-butyl (4-(2-fluoro-4-(3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamido )phenoxy)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)carbamate (45.8 mg, 0.061 mmol) in DCM (1 ml) TFA (2 ml) was added . The mixture was stirred at 35°C for 6 h, then at room temperature overnight. The mixture was concentrated and the residue was dissolved in MeOH/DCM, treated with K ₂ CO ₃ (25.2 mg, 0.182 mmol) and stirred for 3 h. The mixture was filtered and concentrated. The residue was purified with silica gel (0-5% MeOH in DCM) to give N-(4-((3-amino-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide (20.3 mg, 60%). Mass spectrum: m/z=534.2 (M+H). ¹ H NMR (CDCl ₃ ) δ 10.97 (s, 1H), 9.65 (s, 1H), 8.69 (s, 1H), 8.21 (d, 1H), 7.89 (dd, 1H), 7.29 (ddd, 1H), 7.27-7.20 (m, 4H), 6.11 (dd, 1H), 4.98 (m, 1H), 4.50 (s, 2H ), 1.51 (d, 6H).

The following compounds were also synthesized using the method of Example 196.

Etc. no. Structure Name mass spectrum 197

N-(3-fluoro-4-((3-(methylamino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl- 2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 548.2 (M+H) 198

N-(4-((3-(ethylamino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-3-(4-fluorophenyl)-1-isopropyl-2 ,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide 562.2 (M+H)

Example 199

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-isopropyl-2-oxo-1,2-dihydropyridine-3-carboxamide hydrochloride

Step A : 1-(4-Fluorophenyl)-2-oxo-5-(prop-1-en-2-yl)-1,2-dihydropyridine-3-carboxylic acid (preparation 48; 93.7 mg, 0.343 mmol ) was dissolved in DMF (3 ml). 2-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)-1,1,3,3-tetramethylisouronium hexafluorophosphate(V) (130 mg, 0.343 mmol) was added and a solution stirred for 5 minutes followed by the addition of N-ethyl-N-isopropylpropan-2-amine (119 μl, 0.686 mmol) and (R)-2-((4-(4-amino-2-fluorophenoxy)-1-( 4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-3-yl)amino)propan-1-ol (preparation 53; 100 mg, 0.229 mmol). After stirring overnight, the reaction mixture was partitioned between water and EtOAc, washed with water and brine, dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel to give (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3 ,4-b]pyridin-4-yl)oxy)phenyl)-1-(4-fluorophenyl)-2-oxo-5-(prop-1-en-2-yl)-1,2-dihydropyridine-3- carboxamide (194 mg, 0.280 mmol, 123% yield).

Step B : (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b ]pyridin-4-yl)oxy)phenyl)-1-(4-fluorophenyl)-2-oxo-5-(prop-1-en-2-yl)-1,2-dihydropyridine-3-carboxamide (190 mg , 0.274 mmol) was dissolved in 25 ml of methanol and 5 ml of EtOAc. 10% Pd/C (30 mg, 0.253 mmol) was added and the solution was purged with balloon hydrogen and stirred under balloon pressure for 1 hour. The reaction mixture was filtered and concentrated. The residue was purified with silica gel (20% DCM in EtOAc) to give (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4-methoxybenzyl )-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-1-(4-fluorophenyl)-5-isopropyl-2-oxo-1,2-dihydropyridine-3-carboxamide (138 mg, 0.199 mmol, 72.4% yield).

Step C : (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b ]pyridin-4-yl)oxy)phenyl)-1-(4-fluorophenyl)-5-isopropyl-2-oxo-1,2-dihydropyridine-3-carboxamide (138 mg, 0.199 mmol) was suspended in DCM (1 ml ) and TFA (20 ml) was added and heated to 50 C for 4 h. The reaction mixture was concentrated, partitioned between EtOAc and 1M NaOH, dried over sodium sulfate, filtered and concentrated. The residue was purified with silica gel and the isolated product was converted into the HCl salt to give (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3, 4-b]pyridin-4-yl)oxy)phenyl)-1-(4-fluorophenyl)-5-isopropyl-2-oxo-1,2-dihydropyridine-3-carboxamide hydrochloride as a yellow solid. Mass spectrum: m/z=575.2 (M+H-HCl). ¹ H NMR (CDCl ₃ ) δ 12.30 (s, 1H), 8.72 (d, 1H), 8.68 (d, 1H), 8.06 (dd, 1H), 7.46-7, 39 (m, 4H), 7.31-7.24 (m, 3H), 6.12 (d, 1H), 5.32 (br s, 1H), 4.17 (m, 1H), 3 .92 (dd, 1H), 3.72 (dd, 1H), 2.87 (m, 1H), 1.38 (d, 3H), 1.30 (d, 6H).

The following compounds were also synthesized using the method of Example 199.

Etc. no. Structure Name mass spectrum 200

(R)-5-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide 561.2 (M+H) 201

(R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-2-oxo-5-propyl-1,2-dihydropyridine-3-carboxamide 575.2 (M+H)

Abbreviations:

ACN acetonitrile AcOH acetic acid boc, boc tert-butyl carboxylate group DCM dichloromethane DIEA N,N-diisopropylethylamine DMA N,N-Dimethylacetamide DMF N,N-Dimethylformamide DMSO Dimethyl sulfoxide _Et2O diethyl ether EtOAc ethyl acetate EtOH ethanol Eq. equivalent h hour, hours HATU 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate or 2-(7-aza-1H-benzotriazol-1-yl)-1, 1,3,3-tetramethyluronium hexafluorophosphate HOAC acetic acid IPA Isopropyl alcohol min minute, minutes MTBE Methyl tert-butyl ether 10% Pd/C Palladium 10% wt. (dry weight), activated carbon, wet, Degussa Pd(PPh ₃ ) ₄ Tetrakis(triphenylphosphine)palladium(0) Pd ₂ (dba) ₃ tris(dibenzylideneacetone)dipalladium(0) TFA Trifluoroacetic acid THF tetrahydrofuran XPHOS dicyclohexyl(2',4',6'-triisopropyl-[1,1'-biphenyl]-2-yl)phosphine

Illustrative Embodiments

Embodiment 1 A compound of formula I, wherein the compound is Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 or 201, or a pharmaceutically acceptable salt or solvate thereof.

Embodiment 2. A pharmaceutical combination that includes (a) a compound of formula I or a pharmaceutically acceptable salt thereof, and (b) an additional therapeutic agent.

Embodiment 3. A pharmaceutical combination that includes (a) a compound of formula I, or a pharmaceutically acceptable salt thereof, and (b) an additional therapeutic agent, for use in therapy.

Embodiment 4. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, wherein the compound of formula I or a pharmaceutically acceptable salt thereof and the additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in for use in therapy, wherein the amounts of a compound of formula I, or a pharmaceutically acceptable salt thereof, and an additional therapeutic agent together are therapeutically effective.

Embodiment 5. A pharmaceutical composition comprising (a) a compound of formula I or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 6. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 7. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is binimetinib and encorafenib.

Embodiment 8. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is binimetinib.

Embodiment 9. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is encorafenib.

Embodiment 10. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is selumetinib.

Embodiment 11. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is sorafenib.

Embodiment 12. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is trametinib.

Embodiment 13. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is vemurafenib.

Embodiment 14. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is an EGFR inhibitor.

Embodiment 15. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is cetuximab or a biosimilar thereof.

Embodiment 16. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is panitumumab or a biosimilar thereof.

Embodiment 17. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is erlotinib.

Embodiment 18. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is lapatinib.

Embodiment 19. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is gefitinib.

Embodiment 20. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is an immune checkpoint inhibitor.

Embodiment 21. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is nivolumab or a biosimilar thereof.

Embodiment 22. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is pembrolizumab or a biosimilar thereof.

Embodiment 23. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is cemiplimab or a biosimilar thereof.

Embodiment 24. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is pidilizumab or a biosimilar thereof.

Embodiment 25. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is atezolizumab or a biosimilar thereof.

Embodiment 26. The pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or the pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is avelumab or a biosimilar thereof.

Embodiment 27. A pharmaceutical combination according to Embodiment 2, or for use according to Embodiment 3, or a pharmaceutical composition according to Embodiment 5, wherein the additional therapeutic agent is durvalumab or a biosimilar thereof.

Embodiment 28 A pharmaceutical combination that includes (a) the compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 29 A pharmaceutical combination that includes (a) the compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt thereof, and (b) an additional therapeutic agent, for use in therapy.

Embodiment 30. Pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, where the compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199 200, or 201, or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 or 201, or a pharmaceutically acceptable salt thereof, and the additional therapeutic agent together are therapeutically effective.

Embodiment 31 A pharmaceutical composition comprising (a) the compound of Example No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 32. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 33. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is binimetinib and encorafenib.

Embodiment 34. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is binimetinib.

Embodiment 35. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is encorafenib.

Embodiment 36. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is selumetinib.

Embodiment 37. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is sorafenib.

Embodiment 38. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is trametinib.

Embodiment 39. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is vemurafenib.

Embodiment 40. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is an EGFR inhibitor.

Embodiment 41. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is cetuximab or a biosimilar thereof.

Embodiment 42. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is panitumumab or a biosimilar thereof.

Embodiment 43. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is erlotinib.

Embodiment 44. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is lapatinib.

Embodiment 45. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is gefitinib.

Embodiment 46. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is an immune checkpoint inhibitor.

Embodiment 47. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is nivolumab or a biosimilar thereof.

Embodiment 48. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is pembrolizumab or a biosimilar thereof.

Embodiment 49. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is cemiplimab or a biosimilar thereof.

Embodiment 50. A pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or a pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is pidilizumab or a biosimilar thereof.

Embodiment 51. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is atezolizumab or a biosimilar thereof.

Embodiment 52. The pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or the pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is avelumab or a biosimilar thereof.

Embodiment 53. A pharmaceutical combination according to Embodiment 28, or for use according to Embodiment 29, or a pharmaceutical composition according to Embodiment 31, wherein the additional therapeutic agent is durvalumab or a biosimilar thereof.

Embodiment 54 A pharmaceutical combination that includes (a) the compound of Example No. 25 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 55 A pharmaceutical combination that includes (a) the compound of Example No. 25 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 56. Pharmaceutical combination according to Embodiment 54, or for use according to Embodiment 55, wherein the compound of Example No. 25 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 25 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 57 A pharmaceutical composition comprising (a) the compound of Example No. 25 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 58. A pharmaceutical combination according to Embodiment 54, or for use according to Embodiment 55, or a pharmaceutical composition according to Embodiment 57, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 59. The pharmaceutical combination according to Embodiment 54, or for use according to Embodiment 55, or the pharmaceutical composition according to Embodiment 57, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 60 A pharmaceutical combination that includes (a) the compound of Example No. 37 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 61 A pharmaceutical combination that includes (a) the compound of Example No. 37 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 62. Pharmaceutical combination according to Embodiment 60, or for use according to Embodiment 61, wherein Example Compound No. 37 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 37 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 63 A pharmaceutical composition comprising (a) the compound of Example No. 37 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 64. The pharmaceutical combination according to Embodiment 60, or for use according to Embodiment 61, or the pharmaceutical composition according to Embodiment 63, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 65. The pharmaceutical combination according to Embodiment 60, or for use according to Embodiment 61, or the pharmaceutical composition according to Embodiment 63, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 66 A pharmaceutical combination that includes (a) the compound of Example No. 46 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 67 A pharmaceutical combination that includes (a) the compound of Example No. 46 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 68. Pharmaceutical combination according to Embodiment 66, or for use according to Embodiment 67, wherein Example Compound No. 46 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 46 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 69 A pharmaceutical composition comprising (a) the compound of Example No. 46 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 70. A pharmaceutical combination according to Embodiment 66, or for use according to Embodiment 67, or a pharmaceutical composition according to Embodiment 69, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 71. The pharmaceutical combination according to Embodiment 66, or for use according to Embodiment 67, or the pharmaceutical composition according to Embodiment 70, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 72 A pharmaceutical combination that includes (a) the compound of Example No. 48 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 73 A pharmaceutical combination that includes (a) the compound of Example No. 48 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 74. Pharmaceutical combination according to Embodiment 72, or for use according to Embodiment 73, where the compound of Example No. 48 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 48 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 75 A pharmaceutical composition comprising (a) the compound of Example No. 48 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 76. A pharmaceutical combination according to Embodiment 72, or for use according to Embodiment 73, or a pharmaceutical composition according to Embodiment 75, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 77. The pharmaceutical combination according to Embodiment 72, or for use according to Embodiment 73, or the pharmaceutical composition according to Embodiment 75, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 78 A pharmaceutical combination that includes (a) the compound of Example No. 55 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 79 A pharmaceutical combination that includes (a) the compound of Example No. 55 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 80. Pharmaceutical combination according to Embodiment 78, or for use according to Embodiment 79, wherein Example Compound No. 55 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 55 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 81 A pharmaceutical composition comprising (a) the compound of Example No. 55 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 82. A pharmaceutical combination according to Embodiment 78, or for use according to Embodiment 79, or a pharmaceutical composition according to Embodiment 81, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 83. The pharmaceutical combination according to Embodiment 78, or for use according to Embodiment 79, or the pharmaceutical composition according to Embodiment 81, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 84 A pharmaceutical combination that includes (a) the compound of Example No. 58 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 85 A pharmaceutical combination that includes (a) the compound of Example No. 58 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 86. Pharmaceutical combination according to Embodiment 84, or for use according to Embodiment 85, wherein Example Compound No. 58 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 58 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 87 A pharmaceutical composition comprising (a) the compound of Example No. 58 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 88. A pharmaceutical combination according to Embodiment 84, or for use according to Embodiment 85, or a pharmaceutical composition according to Embodiment 87, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 89. The pharmaceutical combination of Embodiment 84, or for the use of Embodiment 85, or the pharmaceutical composition of Embodiment 87, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 90. A pharmaceutical combination that includes (a) the compound of Example No. 72 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 91 A pharmaceutical combination that includes (a) the compound of Example No. 72 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 92. Pharmaceutical combination according to Embodiment 90, or for use according to Embodiment 91, wherein Example Compound No. 72 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 72 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 93 A pharmaceutical composition comprising (a) the compound of Example No. 72 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 94. A pharmaceutical combination according to Embodiment 90, or for use according to Embodiment 91, or a pharmaceutical composition according to Embodiment 93, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 95. The pharmaceutical combination of Embodiment 90, or for the use of Embodiment 91, or the pharmaceutical composition of Embodiment 93, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 96 A pharmaceutical combination that includes (a) the compound of Example No. 76 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 97 A pharmaceutical combination that includes (a) the compound of Example No. 76 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 98. Pharmaceutical combination according to Embodiment 96, or for use according to Embodiment 97, wherein Example Compound No. 76 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 76 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 99 A pharmaceutical composition comprising (a) the compound of Example No. 76 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 100. A pharmaceutical combination according to Embodiment 96, or for use according to Embodiment 97, or a pharmaceutical composition according to Embodiment 99, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 101. The pharmaceutical combination according to Embodiment 96, or for use according to Embodiment 97, or the pharmaceutical composition according to Embodiment 99, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 102 A pharmaceutical combination that includes (a) the compound of Example No. 77 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 103 A pharmaceutical combination that includes (a) the compound of Example No. 77 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 104. Pharmaceutical combination according to Embodiment 102, or for use according to Embodiment 103, wherein Example Compound No. 77 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 77 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 105 A pharmaceutical composition comprising (a) the compound of Example No. 77 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 106. A pharmaceutical combination according to Embodiment 102, or for use according to Embodiment 103, or a pharmaceutical composition according to Embodiment 105, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 107. The pharmaceutical combination of Embodiment 102, or for the use of Embodiment 103, or the pharmaceutical composition of Embodiment 105, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 108 A pharmaceutical combination that includes (a) the compound of Example No. 78 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 109 A pharmaceutical combination that includes (a) the compound of Example No. 78 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 110. Pharmaceutical combination according to Embodiment 108, or for use according to Embodiment 109, wherein Example Compound No. 78 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 78 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 111 A pharmaceutical composition comprising (a) the compound of Example No. 78 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 112. A pharmaceutical combination according to Embodiment 108, or for use according to Embodiment 109, or a pharmaceutical composition according to Embodiment 111, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 113. The pharmaceutical combination of Embodiment 108, or for the use of Embodiment 109, or the pharmaceutical composition of Embodiment 111, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 114 A pharmaceutical combination that includes (a) the compound of Example No. 83 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 115 A pharmaceutical combination that includes (a) the compound of Example No. 83 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 116. Pharmaceutical combination according to Embodiment 114, or for use according to Embodiment 115, wherein Example Compound No. 83 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 83 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 117 A pharmaceutical composition comprising (a) the compound of Example No. 83 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 118. A pharmaceutical combination according to Embodiment 114, or for use according to Embodiment 115, or a pharmaceutical composition according to Embodiment 117, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 119. The pharmaceutical combination of Embodiment 114, or for the use of Embodiment 115, or the pharmaceutical composition of Embodiment 117, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 120. A pharmaceutical combination that includes (a) the compound of Example No. 84 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 121 A pharmaceutical combination that includes (a) the compound of Example No. 84 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 122. Pharmaceutical combination according to Embodiment 120, or for use according to Embodiment 121, wherein Example Compound No. 84 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 84 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 123 A pharmaceutical composition comprising (a) the compound of Example No. 84 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 124. A pharmaceutical combination according to Embodiment 120, or for use according to Embodiment 121, or a pharmaceutical composition according to Embodiment 123, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 125. The pharmaceutical combination of Embodiment 120, or for the use of Embodiment 121, or the pharmaceutical composition of Embodiment 123, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 126 A pharmaceutical combination that includes (a) the compound of Example No. 85 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 127 A pharmaceutical combination that includes (a) the compound of Example No. 85 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 128. Pharmaceutical combination according to Embodiment 126, or for use according to Embodiment 127, wherein Example Compound No. 85 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 85 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 129 A pharmaceutical composition comprising (a) the compound of Example No. 85 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 130. A pharmaceutical combination according to Embodiment 126, or for use according to Embodiment 127, or a pharmaceutical composition according to Embodiment 129, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 131. The pharmaceutical combination of Embodiment 126, or for the use of Embodiment 127, or the pharmaceutical composition of Embodiment 129, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 132 A pharmaceutical combination that includes (a) the compound of Example No. 91 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 133 A pharmaceutical combination that includes (a) the compound of Example No. 91 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 134. Pharmaceutical combination according to Embodiment 132, or for use according to Embodiment 133, wherein Example Compound No. 91 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 91 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 135 A pharmaceutical composition comprising (a) the compound of Example No. 91 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 136. A pharmaceutical combination according to Embodiment 132, or for use according to Embodiment 133, or a pharmaceutical composition according to Embodiment 135, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 137. The pharmaceutical combination of Embodiment 132, or for the use of Embodiment 133, or the pharmaceutical composition of Embodiment 135, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 138 A pharmaceutical combination that includes (a) the compound of Example No. 97 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 139 A pharmaceutical combination that includes (a) the compound of Example No. 97 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 140. Pharmaceutical combination according to Embodiment 138, or for use according to Embodiment 139, wherein Example Compound No. 97 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 97 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 141 A pharmaceutical composition comprising (a) the compound of Example No. 97 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 142. A pharmaceutical combination according to Embodiment 138, or for use according to Embodiment 139, or a pharmaceutical composition according to Embodiment 141, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 143. The pharmaceutical combination according to Embodiment 138, or for use according to Embodiment 139, or the pharmaceutical composition according to Embodiment 141, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 144 A pharmaceutical combination that includes (a) the compound of Example No. 100 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 145 A pharmaceutical combination that includes (a) the compound of Example No. 100 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 146. A pharmaceutical combination according to Embodiment 144, or for use according to Embodiment 145, wherein Example Compound No. 100 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 100 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 147 A pharmaceutical composition comprising (a) the compound of Example No. 100 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 148. A pharmaceutical combination according to Embodiment 144, or for use according to Embodiment 145, or a pharmaceutical composition according to Embodiment 147, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 149. The pharmaceutical combination of Embodiment 144, or for the use of Embodiment 145, or the pharmaceutical composition of Embodiment 147, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 150. A pharmaceutical combination that includes (a) the compound of Example No. 103 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 151 A pharmaceutical combination that includes (a) the compound of Example No. 103 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 152. Pharmaceutical combination according to Embodiment 150, or for use according to Embodiment 151, wherein Example Compound No. 103 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 103 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 153 A pharmaceutical composition comprising (a) the compound of Example No. 103 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 154. A pharmaceutical combination according to Embodiment 150, or for use according to Embodiment 151, or a pharmaceutical composition according to Embodiment 153, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 155. The pharmaceutical combination according to Embodiment 150, or for use according to Embodiment 151, or the pharmaceutical composition according to Embodiment 153, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 156 A pharmaceutical combination that includes (a) the compound of Example No. 105 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 157 A pharmaceutical combination that includes (a) the compound of Example No. 105 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 158. A pharmaceutical combination according to Embodiment 156, or for use according to Embodiment 157, wherein Example Compound No. 105 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 105 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 159 A pharmaceutical composition comprising (a) the compound of Example No. 105 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 160. A pharmaceutical combination according to Embodiment 156, or for use according to Embodiment 157, or a pharmaceutical composition according to Embodiment 159, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 161. The pharmaceutical combination according to Embodiment 156, or for use according to Embodiment 157, or the pharmaceutical composition according to Embodiment 159, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 162 A pharmaceutical combination that includes (a) the compound of Example No. 107 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 163 A pharmaceutical combination that includes (a) the compound of Example No. 107 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 164. A pharmaceutical combination according to Embodiment 162, or for use according to Embodiment 163, wherein Example Compound No. 107 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 107 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 165 A pharmaceutical composition comprising (a) the compound of Example No. 107 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 166. A pharmaceutical combination according to Embodiment 162, or for use according to Embodiment 163, or a pharmaceutical composition according to Embodiment 165, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 167. The pharmaceutical combination of Embodiment 162, or for the use of Embodiment 163, or the pharmaceutical composition of Embodiment 165, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 168 A pharmaceutical combination that includes (a) the compound of Example No. 108, or a pharmaceutically acceptable salt thereof, and (b) an additional therapeutic agent.

Embodiment 169 A pharmaceutical combination that includes (a) the compound of Example No. 108 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 170. Pharmaceutical combination according to Embodiment 168, or for use according to Embodiment 169, wherein Example Compound No. 108 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 108 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 171 A pharmaceutical composition comprising (a) the compound of Example No. 108 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 172. A pharmaceutical combination according to Embodiment 168, or for use according to Embodiment 169, or a pharmaceutical composition according to Embodiment 171, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 173. The pharmaceutical combination according to Embodiment 168, or for use according to Embodiment 169, or the pharmaceutical composition according to Embodiment 171, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 174 A pharmaceutical combination that includes (a) the compound of Example No. 114 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 175 A pharmaceutical combination that includes (a) the compound of Example No. 114 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 176. Pharmaceutical combination according to Embodiment 174, or for use according to Embodiment 175, wherein Example Compound No. 114 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 114 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 177 A pharmaceutical composition comprising (a) the compound of Example No. 114 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 178. A pharmaceutical combination according to Embodiment 174, or for use according to Embodiment 175, or a pharmaceutical composition according to Embodiment 177, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 179. The pharmaceutical combination of Embodiment 174, or for the use of Embodiment 175, or the pharmaceutical composition of Embodiment 177, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 180 A pharmaceutical combination that includes (a) the compound of Example No. 115 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 181 A pharmaceutical combination that includes (a) the compound of Example No. 115 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 182. Pharmaceutical combination according to Embodiment 180, or for use according to Embodiment 181, wherein Example Compound No. 115 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 115 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 183 A pharmaceutical composition comprising (a) the compound of Example No. 115 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 184. A pharmaceutical combination according to Embodiment 180, or for use according to Embodiment 181, or a pharmaceutical composition according to Embodiment 183, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 185. The pharmaceutical combination of Embodiment 180, or for the use of Embodiment 181, or the pharmaceutical composition of Embodiment 183, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 186 A pharmaceutical combination that includes (a) the compound of Example No. 119 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 187 A pharmaceutical combination that includes (a) the compound of Example No. 119 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 188. Pharmaceutical combination according to Embodiment 186, or for use according to Embodiment 187, wherein Example Compound No. 119 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 119 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 189 A pharmaceutical composition comprising (a) the compound of Example No. 119 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 190. A pharmaceutical combination according to Embodiment 186, or for use according to Embodiment 187, or a pharmaceutical composition according to Embodiment 189, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 191. The pharmaceutical combination according to Embodiment 186, or for use according to Embodiment 187, or the pharmaceutical composition according to Embodiment 189, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 192 A pharmaceutical combination that includes (a) the compound of Example No. 121 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 193 A pharmaceutical combination that includes (a) the compound of Example No. 121 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 194. Pharmaceutical combination according to Embodiment 192, or for use according to Embodiment 193, wherein Example Compound No. 121 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 121 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 195 A pharmaceutical composition comprising (a) the compound of Example No. 121 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 196. A pharmaceutical combination according to Embodiment 192, or for use according to Embodiment 193, or a pharmaceutical composition according to Embodiment 195, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 197. The pharmaceutical combination of Embodiment 192, or for the use of Embodiment 193, or the pharmaceutical composition of Embodiment 195, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 198 A pharmaceutical combination that includes (a) the compound of Example No. 124 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 199 A pharmaceutical combination that includes (a) the compound of Example No. 124 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 200. Pharmaceutical combination according to Embodiment 198, or for use according to Embodiment 199, wherein Example Compound No. 124 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 124 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 201 A pharmaceutical composition comprising (a) the compound of Example No. 124 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 202. A pharmaceutical combination according to Embodiment 198, or for use according to Embodiment 199, or a pharmaceutical composition according to Embodiment 201, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 203. The pharmaceutical combination of Embodiment 198, or for the use of Embodiment 199, or the pharmaceutical composition of Embodiment 201, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 204 A pharmaceutical combination that includes (a) the compound of Example No. 125 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 205 A pharmaceutical combination that includes (a) the compound of Example No. 125 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 206. Pharmaceutical combination according to Embodiment 204, or for use according to Embodiment 205, wherein Example Compound No. 125 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 125 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 207 A pharmaceutical composition comprising (a) the compound of Example No. 125 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 208. A pharmaceutical combination according to Embodiment 204, or for use according to Embodiment 205, or a pharmaceutical composition according to Embodiment 207, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 209. The pharmaceutical combination of Embodiment 204, or for the use of Embodiment 205, or the pharmaceutical composition of Embodiment 207, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 210. A pharmaceutical combination that includes (a) the compound of Example No. 126 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 211 A pharmaceutical combination that includes (a) the compound of Example No. 126 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 212. Pharmaceutical combination according to Embodiment 210, or for use according to Embodiment 211, where Example Compound No. 126 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 126 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 213 A pharmaceutical composition comprising (a) the compound of Example No. 126 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 214. A pharmaceutical combination according to Embodiment 210, or for use according to Embodiment 211, or a pharmaceutical composition according to Embodiment 213, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 215. The pharmaceutical combination of Embodiment 210, or for the use of Embodiment 211, or the pharmaceutical composition of Embodiment 213, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 216 A pharmaceutical combination that includes (a) the compound of Example No. 127 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 217 A pharmaceutical combination that includes (a) the compound of Example No. 127 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 218. Pharmaceutical combination according to Embodiment 216, or for use according to Embodiment 217, where Example Compound No. 127 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 127 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 219 A pharmaceutical composition comprising (a) the compound of Example No. 127 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 220. A pharmaceutical combination according to Embodiment 216, or for use according to Embodiment 217, or a pharmaceutical composition according to Embodiment 219, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 221. The pharmaceutical combination of Embodiment 216, or for the use of Embodiment 217, or the pharmaceutical composition of Embodiment 219, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 222 A pharmaceutical combination that includes (a) the compound of Example No. 129 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 223 A pharmaceutical combination that includes (a) the compound of Example No. 129 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 224. Pharmaceutical combination according to Embodiment 222, or for use according to Embodiment 223, wherein Example Compound No. 129 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amount of the compound of example No. 129 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 225 A pharmaceutical composition comprising (a) the compound of Example No. 129 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 226. A pharmaceutical combination according to Embodiment 222, or for use according to Embodiment 223, or a pharmaceutical composition according to Embodiment 225, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 227. The pharmaceutical combination of Embodiment 222, or for the use of Embodiment 223, or the pharmaceutical composition of Embodiment 225, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 228 A pharmaceutical combination that includes (a) the compound of Example No. 151 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 229 A pharmaceutical combination that includes (a) the compound of Example No. 151 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 230. Pharmaceutical combination according to Embodiment 228, or for use according to Embodiment 229, wherein Example Compound No. 151 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 151 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 231 A pharmaceutical composition comprising (a) the compound of Example No. 151 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 232. A pharmaceutical combination according to Embodiment 228, or for use according to Embodiment 229, or a pharmaceutical composition according to Embodiment 231, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 233. The pharmaceutical combination of Embodiment 228, or for the use of Embodiment 229, or the pharmaceutical composition of Embodiment 231, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 234 A pharmaceutical combination that includes (a) the compound of Example No. 152 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 235 A pharmaceutical combination that includes (a) the compound of Example No. 152 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 236. Pharmaceutical combination according to Embodiment 234 or for use according to Embodiment 235, wherein Example Compound No. 152 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 152 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 237 A pharmaceutical composition comprising (a) the compound of Example No. 152 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 238. A pharmaceutical combination according to Embodiment 234, or for use according to Embodiment 235, or a pharmaceutical composition according to Embodiment 237, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 239. A pharmaceutical combination according to Embodiment 234, or for use according to Embodiment 235, or a pharmaceutical composition according to Embodiment 237, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 240 A pharmaceutical combination that includes (a) the compound of Example No. 163 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 241 A pharmaceutical combination that includes (a) the compound of Example No. 163 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 242. A pharmaceutical combination according to Embodiment 240 or for use according to Embodiment 241, wherein Example Compound No. 163 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 163 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 243 A pharmaceutical composition comprising (a) the compound of Example No. 163 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 244. A pharmaceutical combination according to Embodiment 240, or for use according to Embodiment 241, or a pharmaceutical composition according to Embodiment 243, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 245. The pharmaceutical combination of Embodiment 240, or for the use of Embodiment 241, or the pharmaceutical composition of Embodiment 243, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 246 A pharmaceutical combination that includes (a) the compound of Example No. 169 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 247 A pharmaceutical combination that includes (a) the compound of Example No. 169 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 248. Pharmaceutical combination according to Embodiment 246, or for use according to Embodiment 247, wherein Example Compound No. 169 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 169 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 249 A pharmaceutical composition comprising (a) the compound of Example No. 169 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 250. A pharmaceutical combination according to Embodiment 246, or for use according to Embodiment 247, or a pharmaceutical composition according to Embodiment 249, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 251. The pharmaceutical combination of Embodiment 246, or for the use of Embodiment 247, or the pharmaceutical composition of Embodiment 249, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 252 A pharmaceutical combination that includes (a) the compound of Example No. 188 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 253 A pharmaceutical combination that includes (a) the compound of Example No. 188 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 254. A pharmaceutical combination according to Embodiment 252, or for use according to Embodiment 253, wherein Example Compound No. 188 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 188 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 255 A pharmaceutical composition comprising (a) the compound of Example No. 188 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 256. A pharmaceutical combination according to Embodiment 252, or for use according to Embodiment 253, or a pharmaceutical composition according to Embodiment 255, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 257. A pharmaceutical combination according to Embodiment 252, or for use according to Embodiment 253, or a pharmaceutical composition according to Embodiment 255, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 258 A pharmaceutical combination that includes (a) the compound of Example No. 190 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 259 A pharmaceutical combination that includes (a) the compound of Example No. 190 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 260. A pharmaceutical combination according to Embodiment 258, or for use according to Embodiment 259, wherein Example Compound No. 190 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 190 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 261 A pharmaceutical composition comprising (a) the compound of Example No. 190 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 262. A pharmaceutical combination according to Embodiment 258, or for use according to Embodiment 259, or a pharmaceutical composition according to Embodiment 261, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 263. The pharmaceutical combination of Embodiment 258, or for the use of Embodiment 259, or the pharmaceutical composition of Embodiment 261, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 264 A pharmaceutical combination that includes (a) the compound of Example No. 199 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 265 A pharmaceutical combination that includes (a) the compound of Example No. 199 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 266. Pharmaceutical combination according to Embodiment 264, or for use according to Embodiment 265, wherein Example Compound No. 199 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 199 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 267 A pharmaceutical composition comprising (a) the compound of Example No. 199 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 268. A pharmaceutical combination according to Embodiment 264, or for use according to Embodiment 265, or a pharmaceutical composition according to Embodiment 267, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 269. The pharmaceutical combination of Embodiment 264, or for the use of Embodiment 265, or the pharmaceutical composition of Embodiment 267, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 270 A pharmaceutical combination that includes (a) the compound of Example No. 200 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 271 A pharmaceutical combination that includes (a) the compound of Example No. 200 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 272. Pharmaceutical combination according to Embodiment 270, or for use according to Embodiment 271, wherein Example Compound No. 200 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amounts of the compound of example No. 200 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 273 A pharmaceutical composition comprising (a) the compound of Example No. 200 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 274. A pharmaceutical combination according to Embodiment 270, or for use according to Embodiment 271, or a pharmaceutical composition according to Embodiment 273, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 275. The pharmaceutical combination of Embodiment 270, or for the use of Embodiment 271, or the pharmaceutical composition of Embodiment 273, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

Embodiment 276 A pharmaceutical combination that includes (a) the compound of Example No. 201 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent.

Embodiment 277 A pharmaceutical combination that includes (a) the compound of Example No. 201 or a pharmaceutically acceptable salt thereof; and (b) an additional therapeutic agent for use in therapy.

Embodiment 278. A pharmaceutical combination according to Embodiment 276, or for use according to Embodiment 277, wherein Example Compound No. 201 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent are formulated as separate compositions or doses for simultaneous, separate or sequential use in therapy, where the amount of the compound of example No. 201 or a pharmaceutically acceptable salt thereof and an additional therapeutic agent together are therapeutically effective.

Embodiment 279 A pharmaceutical composition comprising (a) the compound of Example No. 201 or a pharmaceutically acceptable salt thereof, (b) an additional therapeutic agent, and (c) a pharmaceutically acceptable diluent or carrier.

Embodiment 280. A pharmaceutical combination according to Embodiment 276, or for use according to Embodiment 277, or a pharmaceutical composition according to Embodiment 279, wherein the additional therapeutic agent is an anti-cancer agent.

Embodiment 281. The pharmaceutical combination of Embodiment 276, or for the use of Embodiment 277, or the pharmaceutical composition of Embodiment 279, wherein the additional therapeutic agent is selected from the group consisting of binimetinib, encorafenib, selumetinib, sorafenib, trametinib, vemurafenib, cetuximab or its biosimilar, panitumumab or its biosimilar, erlotinib, lapatinib, gefitinib, nivolumab or its biosimilar, pembrolizumab or its biosimilar, cemiplimab or its biosimilar, pidilizumab or its biosimilar, atezolizumab or its biosimilar, avelumab or its biosimilar, and durvalumab or its biosimilar .

--->

SEQUENCE LIST

<110> Array BioPharma Inc.

<120> PYRAZOLO[3,4-b]PYRIDINE COMPOUNDS AS

KINASE INHIBITORS TAM AND MET

<130> 41357-0092WO1

<140> PCT/US2019/048701

<141> 2019-08-29

<150> 62/858.686

<151> 2019-06-07

<150> 62/724.829

<151> 2018-08-30

<160> 6

<170>PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213> Artificial

<220>

<223> synthetic oligonucleotide

<400> 1

aagctctttc ttctctctg tt 22

<210> 2

<211> 28

<212> DNA

<213> Artificial

<220>

<223> synthetic oligonucleotide

<400> 2

accgagctac ttttccagaa ggtatatt 28

<210> 3

<211> 20

<212> DNA

<213> Artificial

<220>

<223> synthetic oligonucleotide

<400> 3

cccatgatag ccgtctttaa 20

<210> 4

<211> 11

<212> DNA

<213> Artificial

<220>

<223> synthetic oligonucleotide

<400> 4

ctttctctct g 11

<210> 5

<211> 19

<212> DNA

<213> Artificial

<220>

<223> synthetic oligonucleotide

<400> 5

ttctctctgt tttaagatc 19

<210> 6

<211> 12

<212> DNA

<213> Artificial

<220>

<223> synthetic oligonucleotide

<400> 6

ctttctctct gt 12

<---

Claims (319)

1. Compound of formula I

and its stereoisomers, tautomers and pharmaceutically acceptable salts, where: X ¹ represents CH or N; R ¹ is hydrogen or C1-C6 alkyl; R ² is (a) hydrogen, (b) C1-C6 alkyl, (c) hydroxyC1-C6 alkyl, (d) dihydroxyC2-C6 alkyl, (e) C1-C6 fluoroalkyl, optionally substituted with OH, (f) (di-C1-C6 alkoxy)C2-C6 alkyl-, (g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, (h) Cyc ¹ , (i) Cyc ² , (j) (hetCyc ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, (k) (Ar ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, (l) (hetAr ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, or (m) (HOSO ₃ )C1-C6 alkyl-; Cyc ¹ is a 3-4 membered cycloalkyl ring optionally substituted with 1-2 substituents independently selected from halo, C1-C3 alkyl, hydroxyC1-C3 alkyl, C1-C3 alkoxy, (C1-C3 alkoxy)C1-C3 alkyl- and R'R''NC(=O)-; R' and R'' are independently hydrogen or C1-C6 alkyl; Cyc ² is a 5-membered cycloalkyl ring substituted with 1-2 substituents independently selected from C1-C3 alkyl, (C1-C3 alkoxy)C1-C63 alkyl- and hydroxyC1-C3 alkyl-; hetCyc ¹ is a 5-6 membered saturated heterocyclic ring having 1-2 ring heteroatoms independently selected from O, N, S and SO ₂ wherein said ring is optionally substituted with oxo; Ar ¹ is phenyl; hetAr ¹ is pyridyl; G represents

or

; X ² is C or N; ring A, including the atoms at the points of attachment, is a 5-6 membered heterocyclic ring, optionally having an additional 1-2 ring nitrogen atoms when X ² is N, and having one ring nitrogen atom when X ² is C; R ³ is hydrogen, methyl or absent; R ⁶ is hydrogen, halogen, C1-C6 alkyl, C1-C6 alkoxy, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² , provided that when R ⁶ is on a ring carbon adjacent to the carbon associated with the -NHC(=O)- moiety of formula I, then R ⁶ is not halogen, and R ⁷ is hydrogen, C1-C6 alkyl, oxo or thioxo, or optionally, when R ⁶ and R ⁷ are on the same carbon atom, R ⁶ and R ⁷ together with the carbon atom to which they are attached form a cyclopropyl ring; hetCyc ² is a 4-6 membered saturated heterocyclic ring having a ring nitrogen atom and optionally substituted with C1-C6 alkyl; ring B, including the atoms at the attachment points, is a 6-membered saturated carbocyclic group optionally substituted with oxo, or a 6-membered aromatic carbocyclic ring optionally substituted with OH; R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl; Ar ² is phenyl optionally substituted with one or two substituents independently selected from halo; hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with a substituent selected from halo and C1-C2 alkyl; hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and R ⁹ is hydrogen or halogen. 2. The compound according to p. 1 or its stereoisomer, tautomer or pharmaceutically acceptable salt, where G is

. 3. The compound of claim 2, or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof, wherein X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having one additional ring nitrogen atom, and R ⁷ is oxo where G has the formula A-1

, where R ⁶ is C1-C6 alkyl, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² . 4. The connection according to any one of paragraphs. 1-3 or its stereoisomer, tautomer or pharmaceutically acceptable salt, where R ² is hydroxyC1-C6 alkyl. 5. Connection according to any one of paragraphs. 1-4 or its stereoisomer, tautomer or pharmaceutically acceptable salt, where R ⁸ represents Ar ² . 6. The connection according to any one of paragraphs. 1-5 or its stereoisomer, tautomer or pharmaceutically acceptable salt, where X ¹ represents CH. 7. Connection according to any one of paragraphs. 1-5 or its stereoisomer, tautomer or pharmaceutically acceptable salt, where R ⁹ represents halogen. 8. The compound according to claim 7 or its stereoisomer, tautomer or pharmaceutically acceptable salt, where R ⁹ represents fluorine. 9. Connection according to any one of paragraphs. 1-8 or its stereoisomer, tautomer or pharmaceutically acceptable salt, where R ¹ represents hydrogen. 10. The compound according to claim 1, selected from N-(3-fluoro-4-((3-((2-hydroxyethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl) -3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((2-methoxyethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4-fluorophenyl) -3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-hydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((2-hydroxy-2-methylpropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-( 4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-( 4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(3-fluoro-4-((3-((2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-( 4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((3-hydroxy-2,2-dimethylpropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2 -(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(4-((3-((2,3-dihydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-(cyclobutylamino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2-(4-fluorophenyl)-3-oxo-2 ,3-dihydropyridazine-4-carboxamide; N-(4-((3-((3,3-difluorocyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2-(4-fluorophenyl )-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(4-((3-((2,3-dihydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((1r,3r)-3-methoxycyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2 -(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((1s,3s)-3-methoxycyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2 -(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((1s,3s)-3-hydroxy-1-methylcyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-(methoxymethyl)cyclopropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((2-methoxyethyl)(methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-(methoxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-(methoxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((4-methoxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((tetrahydrofuran-2-yl)methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-(((1,1-dioxidotetrahydrothiophen-3-yl)methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-((1,3-dimethoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((cis-2-(methoxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((tetrahydrofuran-3-yl)methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((2-oxopiperidin-4-yl)methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)- 2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-(((1s,3s)-3-(dimethylcarbamoyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-((1,3-dihydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((4-hydroxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((2-hydroxyethyl)(methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((1r,3r)-3-(hydroxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((1s,3s)-3-(hydroxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((3-hydroxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((3-hydroxy-2,3-dimethylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((4-hydroxy-2-methylpentan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-6-methyl-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-hydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-6-methyl-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((4-hydroxy-1-methoxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(3-fluoro-4-((3-((3,3,3-trifluoro-2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-((1,3-dihydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-hydroxy-3-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-hydroxy-3-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((4-hydroxy-1-methoxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-hydroxy-4-methoxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-((2,2-difluoro-3-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-((4,4-difluoro-1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((4,4,4-trifluoro-1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((1S,2R)-2-(hydroxymethyl)-1-methylcyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclopropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((cis-2-(hydroxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2- (4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-2-(4 -fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((2-hydroxy-1-phenylethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((1-hydroxy-2-(hydroxymethyl)butan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((2-hydroxy-1-(pyridin-3-yl)ethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((2-hydroxy-1-(pyridin-4-yl)ethyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-((2-hydroxy-1-(tetrahydro-2H-pyran-4-yl)ethyl)amino)-1H-pyrazolo[3,4-b]pyridine-4 -yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2,5-dioxo-1-phenyl-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide; N-(3-fluoro-4-((3-iodo-1-(4-methoxybenzyl)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-1-(4-fluorophenyl )-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-((1-(hydroxymethyl)cyclobutyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4 -fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-((1-hydroxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; 2-(4-fluorophenyl)-N-(5-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-3-oxo-2,3-dihydropyridazin-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)(methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)(methyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy )phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-( 4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-N-(3-fluoro-4-((3-((2-hydroxypropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-( 4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-((2-hydroxy-2-methylpropyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-( 4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-(((2R,3S)-3-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-(((2R,3R)-3-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-1-(cyclopropylmethyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-4-ethoxy-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1,5-dimethyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazole-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-methyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazole-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-1-methyl-3-oxo-2,3-dihydro-1H-pyrazole-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-(1-methylazetidin-3-yl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-3-cyclopentyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-1-cyclobutyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-3-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-isopropyl-3-(1-methyl-1H-pyrazol-4-yl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-2,4-dioxo-1-(pentan-3-yl)-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1,3-diisopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-3-cyclohexyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-3-(4-chlorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-isopropyl-2,4-dioxo-3-(tetrahydro-2H-pyran-4-yl)-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-6-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; N-(3-fluoro-4-((3-(((R)-1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-2-oxo-piperidine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-4-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-3-oxo-3,4-dihydropyrazine-2-carboxamide; (R)-6-cyclopropyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-6-isopropyl-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-5-oxo-3-thioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (R)-1-cyclopropyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(5-fluoropyridin-2-yl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide; (R)-5-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide; (R)-1-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide; (R)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-5-(4-fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide; (R)-5-cyclopropyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-1-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-5-bromo-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(3-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-5-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide; (R)-5-(4-chlorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)phenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide; (S)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-5-(4-fluorophenyl)-4-oxo-1,4-dihydropyridine-3-carboxamide; (R)-5-(2,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-4-oxo-1,4-dihydropyridine-3-carboxamide; (R)-3-(3,4-difluorophenyl)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3, 4-b]pyridin-4-yl)oxy)phenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-5-chloro-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide; (S)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-3-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-4-(3,4-difluorophenyl)-2-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3, 4-b]pyridin-4-yl)oxy)phenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (R)-4-(3,4-difluorophenyl)-2-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3, 4-b]pyridin-4-yl)oxy)phenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (S)-4-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (R)-4-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (S)-2-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-4-(4-fluorophenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (R)-2-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-4-(4-fluorophenyl)-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (S)-3-(3,4-difluorophenyl)-1-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3, 4-b]pyridin-4-yl)oxy)phenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-1-cyclopropyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-(((R)-1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-(4-fluorophenyl)-6-oxo-5-azaspiro[2.5]octane-7-carboxamide; N-(3-fluoro-4-((3-(((R)-1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-3-methyl-2-oxo-piperidine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -5-hydroxy-2-oxo-1-phenyl-1,2-dihydroquinoline-3-carboxamide; (R)-2-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-3-oxo-2,3-dihydropyridazin-4-carboxamide; (R)-2-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-6-methyl-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-3-(4-fluorophenyl)-N-(5-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-3-cyclopentyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-1-ethyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-1-(cyclopropylmethyl)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-6-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (S)-1-cyclobutyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-3-(3,4-difluorophenyl)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b] pyridin-4-yl)oxy)phenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; 1-ethyl-N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -3-(4-fluorophenyl)-1-(2-hydroxyethyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-6-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-1-cyclobutyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; (S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -4-(4-fluorophenyl)-2-isopropyl-3,5-dioxo-2,3,4,5-tetrahydro-1,2,4-triazine-6-carboxamide; N-(4-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-3- (4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(4-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-5- (4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide; N-(4-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-2- (4-fluorophenyl)-6-isopropyl-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(5-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)pyridin-2-yl)-5 -(4-fluorophenyl)-1-methyl-4-oxo-1,4-dihydropyridine-3-carboxamide; N-(5-((3-((4,4-difluorobutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)pyridin-2-yl)-1 -(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (S)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; N-(3-fluoro-4-((3-((1-methoxy-2-methylpropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (S)-3-(3,4-difluorophenyl)-N-(4-((3-((1-ethoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)-3-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (S)-N-(4-((3-((1-ethoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)- 1-(4-fluorophenyl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (S)-N-(4-((3-((1-ethoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)- 2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-5-(4-fluorophenyl)-1-isopropyl-N-(5-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)pyridin-2-yl)-4-oxo-1,4-dihydropyridine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -2-(4-fluorophenyl)-6-isopropyl-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-2-(4-fluorophenyl)-6-isopropyl-N-(5-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)pyridin-2-yl)-3-oxo-2,3-dihydropyridazin-4-carboxamide; (R)-5-cyclopropyl-1-(4-fluorophenyl)-N-(5-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)pyridin-2-yl)-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-1-(4-fluorophenyl)-N-(5-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)pyridin-2-yl)-5-methyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-1-(cyclopropylmethyl)-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine-4- yl)oxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-1-ethyl-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-3-(4-fluorophenyl)-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-4-ethoxy-N-(3-fluoro-4-((3-((1-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide; N-(3-fluoro-4-((3-((1-(2-hydroxypropan-2-yl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; 2-((4-(2-fluoro-4-(2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamido)phenoxy)-1H-pyrazolo[3,4-b]pyridine -3-yl)amino)-2-methylpropyl hydrogen sulfate; (S)-N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((3-hydroxy-3-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((1S,2R)-2-(hydroxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(3-fluoro-4-((3-(((1R,2S)-2-(hydroxymethyl)cyclopentyl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl )-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(3-fluoro-4-((3-((4-hydroxy-1-methoxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((4-hydroxy-1-methoxy-2-methylbutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridine- 4-yl)oxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxy-3-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxy-3-methoxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxy-4-methoxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(3-fluoro-4-((3-((1-hydroxy-4-methoxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (R)-N-(4-((3-((4,4-difluoro-1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) -3-fluorophenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; (S)-N-(4-((3-((4,4-difluoro-1-hydroxybutan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) -3-fluorophenyl)-2-(4-fluorophenyl)-3-oxo-2,3-dihydropyridazine-4-carboxamide; N-(4-((3-amino-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4 -dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(3-fluoro-4-((3-(methylamino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl)-3-(4-fluorophenyl)-1-isopropyl- 2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; N-(4-((3-(ethylamino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)-3-fluorophenyl)-3-(4-fluorophenyl)-1-isopropyl-2 ,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-5-isopropyl-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-5-ethyl-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl) hydroxy)phenyl)-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide; (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy)phenyl) -1-(4-fluorophenyl)-2-oxo-5-propyl-1,2-dihydropyridine-3-carboxamide; and their stereoisomers, tautomers and pharmaceutically acceptable salts. 11. The compound according to claim 1 or its stereoisomer, tautomer or pharmaceutically acceptable salt, where: X ¹ represents CH or N; R ¹ is hydrogen or C1-C6 alkyl; R ² is (a) hydrogen, (b) C1-C6 alkyl, (c) hydroxyC1-C6 alkyl, (d) dihydroxyC2-C6 alkyl, (e) C1-C6 fluoroalkyl optionally substituted with OH, (g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, (h) Cyc ¹ , (i) Cyc ² , (j) (hetCyc ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, (k) (Ar ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, (l) (hetAr ¹ )C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, or (m) (HOSO ₃ )C1-C6 alkyl-; Cyc ¹ is a 3-4 membered cycloalkyl ring optionally substituted with 1-2 substituents independently selected from halo, hydroxyC1-C3 alkyl, C1-C3 alkoxy, (C1-C3 alkoxy)C1-C3 alkyl- and R'R''NC(=O)-; R' and R'' are independently selected from C1-C6 alkyl; Cyc ² is a 5-membered cycloalkyl ring substituted with 1-2 substituents independently selected from C1-C3 alkyl, (C1-C3 alkoxy)C1-C3 alkyl- and hydroxyC1-C3 alkyl-; hetCyc ¹ is a 5-6 membered saturated heterocyclic ring having 1-2 ring heteroatoms independently selected from O, N and SO ₂ wherein said ring is optionally substituted with oxo; Ar ¹ is phenyl; hetAr ¹ is pyridyl; G represents

or

; X ² is C or N; ring A, including the atoms at the points of attachment, is a 5-6 membered heterocyclic ring, optionally having an additional 1-2 ring nitrogen atoms when X ² is N, and having one ring nitrogen atom when X ² is C; R ³ is hydrogen or absent; R ⁶ is hydrogen, halogen, C1-C6 alkyl, C1-C6 alkoxy, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² , provided that when R ⁶ is on a ring carbon adjacent to the carbon associated with the -NHC(=O)- moiety of formula I, then R ⁶ is not halogen; R ⁷ is hydrogen, C1-C6 alkyl, oxo or thioxo; hetCyc ² is a 4-membered saturated heterocyclic ring having a ring nitrogen atom substituted with C1-C6 alkyl; ring B, including the atoms at the attachment points, is a 6-membered saturated carbocyclic group optionally substituted with oxo, or a 6-membered aromatic carbocyclic ring optionally substituted with OH; R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl; Ar ² is phenyl optionally substituted with one or two substituents independently selected from halo; hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with a substituent selected from C1-C2 alkyl; and R ⁹ is hydrogen or halogen. 12. Compound of formula I-A

and its stereoisomers, tautomers and pharmaceutically acceptable salts, wherein X ¹ represents CH or N; R ¹ is hydrogen or C1-C6 alkyl; R ² is (a) hydrogen, (b) C1-C6 alkyl, (c) hydroxyC1-C6 alkyl, (g) (C1-C6 alkoxy)C1-C6 alkyl-, wherein said alkyl moiety is optionally substituted with OH, or (h) Cyc ¹ ; Cyc ¹ is a 3-4 membered cycloalkyl ring optionally substituted with 1-2 substituents independently selected from halo, C1-C3 alkyl, hydroxyC1-C3 alkyl, C1-C3 alkoxy, (C1-C3 alkoxy)C1-C3 alkyl- and R'R''NC(=O)-; X ² is N, R ³ is absent, ring A is a 6-membered heterocyclic ring having one additional ring nitrogen atom, and R ⁷ is oxo, where G has the formula A-1

R ⁶ is C1-C6 alkyl, hydroxyC1-C6 alkyl, C3-C6 cycloalkyl, (C3-C6 cycloalkyl)C1-C6 alkyl- or hetCyc ² ; hetCyc ² is a 4-6 membered saturated heterocyclic ring having a ring nitrogen atom and optionally substituted with C1-C6 alkyl; R ⁸ is Ar ² , hetAr ² , C3-C6 cycloalkyl, hetCyc ³ or C1-C6 alkyl; Ar ² is phenyl optionally substituted with one or two substituents independently selected from halo; hetAr ² is a 5-6 membered heteroaryl having 1-2 ring nitrogen atoms and optionally substituted with a substituent selected from halo and C1-C2 alkyl; hetCyc ³ is a 5-6 membered heterocyclic ring having a ring oxygen atom; and R ⁹ is hydrogen or halogen. 13. (R)-N-(3-fluoro-4-((3-((1-hydroxypropan-2-yl)amino)-1H-pyrazolo[3,4-b]pyridin-4-yl)oxy) phenyl)-3-(4-fluorophenyl)-1-isopropyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidine-5-carboxamide having the structure

, or a stereoisomer, tautomer or pharmaceutically acceptable salt thereof. 14. Pharmaceutical composition having inhibitory activity against TAM and MET kinases, comprising a compound of formula I, as defined in any of paragraphs. 1-14, or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable diluent or carrier. 15. A method of treating TAM-associated cancer or c-Met-associated cancer in a patient in need thereof, comprising administering to the patient an effective amount of a compound according to any one of paragraphs. 1-13 or its stereoisomer, tautomer or pharmaceutically acceptable salt or pharmaceutical composition according to claim 14. 16. The method of claim 15, wherein the cancer is selected from the group consisting of: acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), anaplastic glioma, appendix adenocarcinoma, astrocytoma, B-cell acute lymphoblastic leukemia, B-cell chronic myeloid leukemia, B-cell lymphoma, B-cell myeloid leukemia, urinary cancer bladder, brain cancer, breast cancer, cervical cancer, chronic myeloid leukemia, colorectal cancer, desmoplastic small round cell tumor, duodenal adenocarcinoma, endometrial cancer, erythroid leukemia, esophageal cancer, Ewing's sarcoma, gastrointestinal cancer, glioblastoma, glioma , head and neck cancer, angiosarcoma of the heart, Hodgkin's lymphoma, invasive thymoma, Kaposi's sarcoma, leukemia of lymphocytic or myelogenous origin, liver cancer, lung cancer, mantle cell lymphoma, melanoma, Merkel cell neoplasms, mesothelioma, NK-cell lymphoma, oligodendroglioma, squamous cell oral cavity carcinoma, osteosarco us, ovarian cancer, pancreatic cancer, serous peritoneal carcinoma, pheochromocytoma and mixed pheochromocytoma, pituitary adenoma, prostate cancer, renal cell carcinoma, rhabdomyosarcoma, salivary gland carcinoma, schwannoma, spindle sarcoma, rectal squamous cell carcinoma, head squamous cell carcinoma and neck and cervix, squamous cell skin cancer, T-cell acute lymphocytic leukemia, T-cell lymphoma, thyroid cancer, urinary tract cancer, uterine leiomyosarcoma, uterine endometrioid adenocarcinoma, and mixed mesodermal uterine tumor. 17. The method of claim 16, wherein the cancer is selected from cervical cancer, gastrointestinal cancer, esophageal cancer, endometrial cancer, liver cancer, melanoma, Merkel cell neoplasm, lung cancer, head and neck cancer, renal -cell carcinoma and bladder cancer.