RU2771484C1 - Brucella suis bi-1-deficient strain, method for engineering and application thereof - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: group of inventions relates to a BI-1-deficient strain of Brucella suis and a method for engineering said strain. Proposed is a BI-1-deficient strain of B. suis for inhibiting the growth and enhancing the aggregation of cells of B. suis, wherein said strain is produced by replacing the BI-1 gene of B. suis with the kanamycin resistance gene. Said strain is deposited in the Chinese General Microbiological Culture Collection Center (CGMCC) under the registration number CGMCC No. 18741. Also proposed is a method for producing the strain, including the following stages: using the genome of the B. suis S2 vaccine strain as a matrix, performing PCR amplification to produce left and right homologous regions of the BI-1 gene, and cloning said left and right homologous regions into the pUC18 plasmid jointly with a fragment of the kanamycin resistance gene produced by PCR amplification, to produce the recombinant pUC18-BI1-KanR plasmid. The resulting plasmid is injected by electroporation into competent B. suis cells, and a positive transformant is identified by PCR as a BI-1-deficient strain of B. suis.

EFFECT: compared with a wild strain, the proposed strain is characterised by slow growth, a reduced number of colonies, high membrane permeability, and enhanced cell aggregation.

4 cl, 9 dwg, 1 tbl, 1 ex

Description

The present application claims the priority of Chinese Patent Application No. CN201911190912.9 filed with the National Intellectual Property Office of China (CNIPA) on November 28, 2019 with the title "BI-1-deficient strain of Brucella suis , its construction method and its use", which is fully incorporated into the present invention by reference.

The technical field to which the invention belongs

The present invention relates to a method for constructing a BI-1-deficient strain of Brucella suis and relates to the field of biotechnology.

State of the art

Brucellosis is a zoonotic infectious disease caused by bacteria of the genus Brucella , which mainly causes abortion and infertility in affected animals and manifests itself mainly as undulating fever, osteoarthritis, and inflammation of the reproductive system in humans. This disease poses a serious threat to public health and the sustainable development of animal husbandry. Vaccination is the most effective way to prevent brucellosis. However, existing vaccines still have many disadvantages, such as insufficient immune protection and the inability to differentiate infected animals from immunized animals; moreover, there is no effective vaccine against human brucellosis. Therefore, the development of a vaccine against brucellosis and related research are urgently needed.

Brucella is a genus of gram-negative, facultative intracellular bacteria that are rod-shaped, lack capsules and flagella, do not form spores, and can infect professional and non-professional phagocytes. Brucella has developed many virulence factors and virulence systems. Once inside the host cell, Brucella , with the help of multiple virulence factors, disrupts the killing mechanism of the host's immune system and avoids recognition by it, and then multiplies intracellularly and causes a chronic infection. Numerous studies have reported that outer membrane proteins (OMPs), lipopolysaccharide (LPS), type IV secretion system encoding VirB, BvrR/BvrS two-component regulatory system, L7/L12 nucleoprotein, quorum sensing system are important virulence factors involved in Brucella virulence. , most of which have strong immunoprotective activity; in addition, most of the components are membrane molecules.

The Bax-1 inhibitor (BI-1) is a highly conserved transmembrane protein in eukaryotes and prokaryotes that mainly plays a role in the inhibition of BAX-induced apoptosis in eukaryotes, but acts vaguely in prokaryotes. However, the Escherichia coli BI-1-like YccA protein has been shown to be a substrate and regulator of the ATP-dependent metalloproteinase FtsH, which plays an important role in the biosynthesis of the bacterial outer membrane. A study by the present inventors has shown that BI-1 deficiency has a significant effect on the growth and outer membrane characteristics of Brucella.beta ., indicating that the BI-1-deficient strain has the potential to generate live attenuated vaccines and develop appropriate detection methods.

The essence of the invention

The aim of the present invention is to obtain a Bax-1 inhibitor (BI-1) deficient strain of B. suis , a method for its construction and its use. The technical problem to be solved is to remove the BI-1 gene from the B. suis S2 vaccine strain, further attenuate the virulence of this strain, and increase its availability and efficiency in vaccine development and development of suitable detection methods.

In order to achieve the above object, the present invention proposes the following technical solutions.

The present invention relates to a BI-1 deficient strain of Brucella suis , wherein the strain is obtained by replacing the BI-1 gene of Brucella suis with a kanamycin resistance gene; A BI-1-deficient strain of Brucella suis has been deposited with the China General Microbiological Culture Collection Center (CGMCC) under registration number CGMCC No.18741.

The present invention also relates to a method for constructing the aforementioned BI-1-deficient Brucella suis strain, comprising the following steps:

step 1, designing the required PCR primers based on the Brucella suis S2 vaccine strain genome sequence, the pEGFP-C1 gene sequence, and the restriction site information of the pUC18 plasmid;

step 2, using the Brucella suis vaccine strain S2 genome as a template, performing PCR amplification to obtain left and right BI1-UP and BI1-DW homologous regions, respectively, of the BI-1 gene; using the pEGFP-C1 plasmid as a template, performing PCR amplification to obtain the kanamycin resistance gene KanR;

step 3, separate ligation of the gene fragments obtained in step 2 into pMD19T-simple vectors to obtain the corresponding recombinant plasmids pMD19T-BI1-UP, pMD19T-BI1-DW and pMD19T-KanR;

step 4, separately transforming the competent DH5α cells with the recombinant plasmids obtained in step 3, selecting positive transformants for cultivation, isolating and sending the corresponding recombinant plasmids to a biotechnology company for sequencing;

step 5, performing double restriction of the recombinant plasmids sequenced correctly in step 4 with the respective restriction endonucleases, respectively, to isolate left and right homologous BI-1 gene fragments and KanR gene fragments;

step 6, mixing the gene fragments obtained in step 5 in equal volumes and ligating these gene fragments into the pUC18 vector to obtain the recombinant plasmid pUC18-BI1-KanR;

step 7, obtaining competent Brucella suis cells for use;

step 8, mixing recombinant plasmid pUC18-BI1-KanR obtained in step 6 with competent cells obtained in step 7, placed on ice for 10 min, transferred to a pre-chilled 1 mm electroporation cuvette and electroporated at 2.5 kV within 4.5 ms; immediate addition of 1 ml trypticase soy broth (TSB) medium without antibiotics, and incubation with shaking 180 rpm and 37°C for 12 hours; inoculation on trypticase soy agar (TSA) medium supplemented with 25 μg/ml kanamycin, incubation for 72 h at 37°C and selection of individual colonies for cultivation;

step 9, thermal lysis of the bacterial suspension obtained in step 8 in a water bath at 70°C for 2 hours, and use of primers BI1-F/R for PCR identification to screen for BI-1-deficient strain.

Preferably, obtaining competent Brucella suis cells involves the following steps: streaking the vaccine strain S2 Brucella suis stored at -80°C on TSA medium without antibiotics for recovery, inoculation of individual colonies in 10 ml of TSB medium without antibiotics, culturing for 48 hours with 180 rpm shaking at 37°C, and then inoculating in 50 ml antibiotic-free TSB medium at a 1:100 volume ratio to propagate the culture; when the OD600 value reaches 0.9, pre-cool the bacterial suspension on ice for 30 minutes, centrifuge for 20 minutes at 4500 g and remove the supernatant; resuspension of bacterial cells in 20 ml of pre-chilled ddH ₂ O, centrifugation for 15 minutes at 4500 g, removing the supernatant and repeating this step one more time; resuspension of cells in 20 ml of pre-chilled 10% aqueous glycerol solution, centrifugation for 15 minutes at 4500 g, removal of the supernatant and repetition of this step one more time; finally, resuspension of bacterial cells in 1 ml of pre-chilled 10% aqueous glycerol solution, distribution into 100 μl aliquots and storage at -80°C until use.

Preferably the PCR primers used in step 1 include:

Primer name Primer sequence Restriction site Fragment length no. primer BI1-UF GCATGC CAGGTGACGGAGAACATT
As shown in SEQ ID NO. one Sph I 1.176 b.p. P1 BI1-UR ACTAGT TGTGATTCATTATGGGGATTTC
As shown in SEQ ID NO. 2 Spe I P2 BI1-DF GTCGAC TGGGCAACCGTGAATAATC
As shown in SEQ ID NO. 3 Sal I 1.093 b.p. P3 BI1-DR GAATTC AAGCGCAGCGAATGAAGAT
As shown in SEQ ID NO. 4 EcoR I P4 KanR-F GTCGAC TCAGGTGGCACTTTTCGGGGA
As shown in SEQ ID NO. 5 Sal I 1.375 b.p. P5 KanR-R ACTAGT TTGGGCGTCGCTTGGTCGGT
As shown in SEQ ID NO. 6 Spe I P6 BI1-TF CAGCGTCGCCTTCATAGTA
As shown in SEQ ID NO. 7 Not 453 b.p. P7 BI1-TR CTTTCCAGCAGCTTCTTTTT
As shown in SEQ ID NO. eight Not P8

The present invention also relates to the use of the aforementioned BI-1-deficient strain of Brucella suis for the production of a live attenuated vaccine against Brucella .

The present invention also relates to the use of the aforementioned BI-1-deficient strain of Brucella suis for the preparation of a kit of reagents for the detection of animals infected with Brucella .

Preferably, the reagent kit further includes a reagent for detecting anti-BI-1 antibodies.

The present invention has the following beneficial effects:

By homologous recombination, the present invention constructs a BI-1-deficient strain of Brucella suis and proves that BI-1 deficiency will significantly affect the growth rate and characteristics of the outer membrane of the Brucella cell, so that Brucella will experience slow growth, increased aggregation of bacterial cells and increased permeability. The BI-1-deficient strain of B. suis obtained in accordance with the present invention provides the theoretical and material basis for the development of a new live attenuated vaccine against brucellosis and the creation of an appropriate method for its detection; in addition, this strain represents a theoretical basis for the study of the physiological functions of the BI-1 gene in Brucella .

Brief description of the drawings

Fig. 1 illustrates the PCR result of the left and right homologous regions of the BI-1 gene;

M is the DL5000 DNA marker, lane 1 is the PCR product of the left homologous region of the BI-1 BI1-UP gene, and lane 2 is the PCR product of the right homologous region of the BI-1 BI1-DW gene.

Fig. 2 illustrates the PCR result of the kanamycin resistance gene;

M is the DL5000 DNA marker and lane 1 is the PCR product of the KanR kanamycin resistance gene.

Fig. 3 illustrates the result of restriction identification pMD19T-BI1-UP;

M is the DL5000 DNA marker and lane 1 is the result of double restriction of pMD19T-BI1-UP with Sph I and Spe I.

Fig. 4 illustrates the result of restriction identification pMD19T-BI1-DW;

M is the DL5000 DNA marker and lane 1 is the result of double restriction of pMD19T-BI1-DW with Sal I and EcoR I.

Fig. 5 illustrates the result of restriction identification pMD19T-BI1-KanR;

M is the DL5000 DNA marker and lane 1 is the result of double restriction of pMD19T-BI1-KanR with Sal I and Spe I.

Fig. 6 illustrates the result of restriction identification of the recombinant plasmid pUC18-BI1-KanR;

M is the DL5000 DNA marker and lane 1 is the result of double restriction of pUC18-BI1-KanR with Sph I and EcoR I.

Fig. 7 illustrates the result of identification of a BI-1 deficient B. suis strain;

M is a DL5000 DNA marker, lane 1 is a PCR product for identifying B. suis vaccine strain S2, and lane 2 is a PCR product for identifying a BI-1-deficient B. suis strain.

Fig. 8 illustrates the result of detection of aggregation of B. suis strain bacterial cells with deletion of the BI-1 gene;

A: B. suis S2 live vaccine suspension and B. suis BI-1-deficient suspension before exposure, B: B. suis S2 live vaccine suspension and B. suis BI-1-deficient suspension 24 hours later , exposure at room temperature, C: aggregation of bacterial cells calculated by measuring the optical density at 600 nm (OD600) of suspensions of both strains before and after exposure.

Fig. 9 shows the result of detecting the growth rate of a BI-1 deficient strain of B. suis .

Deposition of biological material

The Brucella suis -ΔBI-1 strain was deposited with the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, Yard 3, NO. 1, West Beichen Road, Chaoyang District, Beijing, China, October 21, 2019 under registration number CGMCC No.18741.

Detailed description of the invention

For a clear understanding of the technical characteristics of the present invention, the present invention will be described below as a specific embodiment.

A method for constructing a Bax-1 inhibitor (BI-1) deficient B. suis strain is proposed, which includes the following specific steps:

Stage 1, primer design: based on the sequence of the B. suis S2 genome, PCR primers were designed for the left and right homologous regions of the BI-1 gene, BI1-UF/BI1-UR (containing Sph I and Spe I restriction sites, respectively) and BI1-DF/BI1-DR (containing restriction sites Sal I and EcoR I, respectively); based on the sequence of the pEGFP-C1 gene, PCR primers for the kanamycin resistance gene KanR-F/KanR-R (containing restriction sites Sal I and Spe I, respectively) were designed; in addition, based on the B. suis S2 genome sequence within the BI-1 gene sequence, primers were designed to identify the deficient BI1-TF/BI1-TR strain. The primer sequences were as follows:

Primer name Primer sequence Restriction site Fragment length no. primer BI1-UF GCATGC CAGGTGACGGAGAACATT
As shown in SEQ ID NO. one Sph I 1.176 b.p. P1 BI1-UR ACTAGT TGTGATTCATTATGGGGATTTC
As shown in SEQ ID NO. 2 Spe I P2 BI1-DF GTCGAC TGGGCAACCGTGAATAATC
As shown in SEQ ID NO. 3 Sal I 1.093 b.p. P3 BI1-DR GAATTC AAGCGCAGCGAATGAAGAT
As shown in SEQ ID NO. 4 EcoR I P4 KanR-F GTCGAC TCAGGTGGCACTTTTCGGGGA
As shown in SEQ ID NO. 5 Sal I 1.375 b.p. P5 KanR-R ACTAGT TTGGGCGTCGCTTGGTCGGT
As shown in SEQ ID NO. 6 Spe I P6 BI1-TF CAGCGTCGCCTTCATAGTA
As shown in SEQ ID NO. 7 Not 453 b.p. P7 BI1-TR CTTTCCAGCAGCTTCTTTTT
As shown in SEQ ID NO. eight Not P8

Step 2, obtaining target fragments: using the isolated B. suis vaccine strain S2 genome as a template, the left homologous region of the BI-1 gene, BI1-UP, was amplified using the PCR primers BI1-UF/BI1-UR, while as the right homologous region of the BI-1 gene, BI1-DW, was amplified using PCR primers BI1-DF/BI1-DR; Using the pEGFP-C1 plasmid as a template, the kanamycin resistance gene fragment was amplified using KanR-F/KanR-R PCR primers. The resulting PCR products BI1-UP, BI1-DW, and KanR, respectively, were ligated into the pMD19T-Simple cloning vector to obtain recombinant plasmids pMD19T-BI1-UP, pMD19T-BI1-DW, and pMD19T-KanR. The above recombinant plasmids were transformed into competent DH5α cells by heat shock, respectively, and incubated for 1 h at 37°C and shaking at 180 rpm, after which they were plated on solid LB medium supplemented with 60 μg/ml ampicillin. Positive transformants were selected the next day and incubated for 16 hours at 37°C and shaking at 180 rpm, after which the corresponding recombinant plasmids were isolated. The isolated recombinant plasmids pMD19T-BI1-UP, pMD19T-BI1-DW, and pMD19T-KanR were double-restricted with Sph I/ Spe I, Sal I/ EcoR I, and Sal I/ Spe I, respectively, and the correctly digested and identified plasmids were sent to biotechnology company for sequencing.

Step 3, construction of recombinant plasmid pUC18-BI1-KanR: The recombinant plasmids correctly sequenced in step 2, pMD19T-BI1-UP, pMD19T-BI1-DW, and pMD19T-KanR, were double-restricted with Sph I/Spe I, Sal I/EcoR I and Sal I/Spe I, respectively; the digested products were subjected to 1% agarose gel electrophoresis and the left and right homologous regions of the BI-1, BI1-UP and BI1-DW gene and the KanR fragment of the kanamycin resistance gene, respectively, were isolated. The above-mentioned purified gene fragments were mixed in equal volumes and ligated into the plasmid pUC18, which was subjected to double restriction with Sph I/EcoR I restriction enzymes overnight at 16°C to obtain the recombinant plasmid pUC18-BI1-KanR deficient in BI-1. The above ligation product was transformed into competent DH5α cells by heat shock and incubated for 1 h at 37°C and shaking at 180 rpm, after which they were plated on solid LB medium supplemented with 25 μg/ml kanamycin. The positive transformant was selected the next day and incubated for 16 hours at 37°C and shaking at 180 rpm, after which the corresponding recombinant plasmid was isolated. The isolated plasmid pUC18-BI1-KanR was identified by Sph I/EcoR I double digestion and the correctly identified plasmid was sent to a biotechnology company for sequencing.

Step 4, preparation of competent B. suis cells: B. suis vaccine strain S2 stored at -80°C was streaked onto antibiotic-free Trypticase Soy Agar (TSA) medium for reconstitution and individual colonies were selected and inoculated in 10 ml trypticase soy broth (TSB) medium without antibiotic, cultured for 48 hours with shaking at 180 rpm and 37°C, and then inoculated into 50 ml TSB liquid medium without antibiotics in a volume ratio of 1:100 for culture propagation ; when the OD600 value reached 0.9, the bacterial suspension was pre-cooled on ice for 30 minutes and centrifuged for 20 minutes at 4500 g and 4°C, and the supernatant was removed; bacterial cells were resuspended in 20 ml of pre-chilled ddH ₂ O, centrifuged for 20 minutes at 4500 g and 4°C, the supernatant was discarded and this operation was repeated one more time; bacterial cells were resuspended in 20 ml of a pre-chilled 10% aqueous glycerol solution, centrifuged for 15 minutes at 4500 g and 4°C, the supernatant was removed and this operation was repeated one more time; finally, the bacterial cells were resuspended in 1 ml of pre-chilled 10% aqueous glycerol solution, distributed into 100 μl aliquots, and stored at ---80°C until use.

Step 5, screening and identification of a BI-1-deficient B. suis strain: Competent cells from step 4 were thawed on ice, mixed with 20 µl of pUC18-BI1-KanR, placed on ice for 10 minutes, and transferred to pre-chilled 1 -mm electroporation cuvette and electroporated at 2.5 kV for 4.5 ms; immediately after completion of electroporation, 1 ml of TSB medium without antibiotics was added, incubated with shaking at 180 rpm and a temperature of 37°C for 12 hours, seeded on TSA medium with the addition of 25 μg/ml of kanamycin, and cultured for 72 hours at a temperature of 37°C C; single colonies were inoculated into TSB medium for 48 hours at 37°C and shaking at 180 rpm, and 1 ml of the bacterial suspension was aseptically pipetted, subjected to thermal lysis in a water bath at 70°C for 2 hours and identified by PCR using identifying primers BI1-F/R. Since the BI1-F/R identifying primers are designed to be in the BI-1 gene, the absence of a PCR product on electrophoresis indicates that the BI-1 gene has been completely replaced, indicating that a BI-1-deficient strain has been obtained.

An example of the construction of a recombinant plasmid

1. Primer design

Based on the B. suis S2 genome sequence (registration number: NC_017251.1) published in the NCBI database, primers were designed for PCR amplification of the left and right homologous regions of the BI-1 gene, BI1-UF/BI1-UR (containing sites restriction Sph I and Spe I, respectively) and BI1-DF/BI1-DR (containing restriction sites Sal I and EcoR I, respectively) and primers for identification of the mutant strain located within the BI-1 gene sequence, BI1-TF/BI1- TR; Based on the gene sequence of the plasmid pEGFP-C1 (registration number: U55763.1) published in the NCBI database, primers were designed for PCR amplification of the kanamycin resistance gene KanR-F/KanR-R (containing restriction sites Sal I and Spe I , respectively). The primer sequences were as follows:

Primer name Primer sequence Restriction site Fragment length no. primer BI1-UF GCATGC CAGGTGACGGAGAACATT
As shown in SEQ ID NO. one Sph I 1.176 b.p. P1 BI1-UR ACTAGT TGTGATTCATTATGGGGATTTC
As shown in SEQ ID NO. 2 Spe I P2 BI1-DF GTCGAC TGGGCAACCGTGAATAATC
As shown in SEQ ID NO. 3 Sal I 1.093 b.p. P3 BI1-DR GAATTC AAGCGCAGCGAATGAAGAT
As shown in SEQ ID NO. 4 EcoR I P4 KanR-F GTCGAC TCAGGTGGCACTTTTCGGGGA
As shown in SEQ ID NO. 5 Sal I 1.375 b.p. P5 KanR-R ACTAGT TTGGGCGTCGCTTGGTCGGT
As shown in SEQ ID NO. 6 Spe I P6 BI1-TF CAGCGTCGCCTTCATAGTA
As shown in SEQ ID NO. 7 Not 453 b.p. P7 BI1-TR CTTTCCAGCAGCTTCTTTTT
As shown in SEQ ID NO. eight Not P8

2. Getting target fragments.

(1) PCR for the left and right homologous regions of the BI-1 gene BI1-UP and BI1-DW

Using the genome of the live B. suis S2 vaccine strain as a template, PCR was performed with primers BI1-UF/UR and BI1-DF/DR. The reaction system was as follows: BI1-UF/DF 1 µl, BI1-UR/DR 1 µl, matrix 1 µl, 2x Taq Mix 10 µl and ddH ₂ O 7 µl.

The reaction conditions were as follows: 94°C for 5 min; 30 cycles of 94°C for 30 s, 54°C for 30 s and 72°C for 1.5 min; 72°C for 10 min.

After completion of the PCR, the PCR product was subjected to 1% agarose gel electrophoresis and the specific electrophoretic mobility target zone was excised. The TIANgel Midi Purification Kit (Tiangen Biotech (Beijing) Co., Ltd.) was used to purify the PCR product according to the manufacturer's instructions.

The result is shown in Figure 1. The single zone has a size of 1176 bp. and 1093 b.p. accordingly, the molecular weights are in line with expectations.

(2) PCR for kanamycin resistance gene KanR

Using the pEGFP-C1 plasmid as a template, PCR was performed with primers KanR-F and KanR-R. The reaction system was as follows: KanR-F 1 µl, KanR-R 1 µl, matrix 1 µl, 2x Taq Mix 10 µl and ddH ₂ O 7 µl.

The reaction conditions were as follows: 94°C for 5 min; 30 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 1.5 min; 72°C for 10 min.

After completion of the PCR, the PCR product was subjected to 1% agarose gel electrophoresis and the specific target zone was excised. The TIANgel Midi Purification Kit (Tiangen Biotech (Beijing) Co., Ltd.) was used to purify the PCR product according to the manufacturer's instructions.

The result is shown in Figure 2. The single zone has a size of 1375 bp and the molecular weight is as expected.

(3) Construction of recombinant plasmids pMD19T-BI1-UP, pMD19T-BI1-DW and pMD19T-KanR.

The TAKARA ligation mixture was used to ligate BI1-UP, BI1-DW and KanR isolated and purified in steps 1 and 2 into the pMD19T-Simple vector to generate recombinant plasmids pMD19T-BI1-UP, pMD19T-BI1-DW and pMD19T-KanR, respectively. . The reaction system was as follows:

BI1-UP/BI1-DW/KanR 1 µl, pMD19T-Simple 1 µl, ligation mix 5 µl and ddH ₂ O 3 µl.

The above reaction system was incubated overnight at 16°C, competent DH5α cells were transformed, plated on solid LB medium supplemented with 60 μg/ml ampicillin, and cultured overnight at 37°C. The next day, individual colonies were selected and cultured for 16 h with shaking at 180 rpm and a temperature of 37°C.

(4) Identification of recombinant plasmids pMD19T-BI1-UP, pMD19T-BI1-DW and pMD19T-KanR.

To isolate plasmids from the bacterial suspensions obtained in step 3, the TIANprep Mini Plasmid Kit (Tiangen Biotech (Beijing) Co., Ltd.) was used according to the manufacturer's instructions, respectively, the obtained recombinant plasmids pMD19T-BI1-UP, pMD19T- BI1-DW and pMD19T-KanR were identified by double restriction, respectively. The reaction system was as follows:

i. pMD19T-BI1-UP 1 µl, Sph I 0.3 µl, Spe I 0.3 µl, 10×H buffer 1 µl and ddH ₂ O 7.4 µl;

ii. pMD19T-BI1-DW 1 µl, Sal I 0.3 µl, EcoR I 0.3 µl, 10×H buffer 1 µl and ddH ₂ O 7.4 µl;

iii. pMD19T-KanR 1 µl, Sal I 0.3 µl, Spe I 0.3 µl, 10×H buffer 1 µl and ddH ₂ O 7.4 µl.

The above reaction system was incubated for 2 h at 37°C and subjected to electrophoresis in 1% agarose gel. Restriction results were monitored using a gel imaging system. Recombinant plasmids, correctly identified by enzymatic digestion, were sent to a biotech company for sequencing.

The results are shown in Figures 3, 4 and 5. The specific zones are 2694 bp in size. and 1176 b.p., 2694 b.p. and 1093 b.p., 2694 b.p. and 1375 b.p. respectively, indicating that the recombinant plasmids were correctly ligated.

(5) Obtaining BI1-UP, BI1-DW and KanR fragments

Recombinant plasmids pMD19T-BI1-UP, pMD19T-BI1-DW, and pMD19T-KanR correctly sequenced in step 3 were double-restricted, respectively. The reaction system was as follows:

i. pMD19T-BI1-UP 20 µl, Sph I 1.5 µl, Spe I 1.5 µl, 10×H buffer 5 µl and ddH ₂ O 22 µl;

ii. pMD19T-BI1-DW 20 µl, Sal I 1.5 µl, EcoR I 1.5 µl, 10×H buffer 5 µl and ddH ₂ O 22 µl;

iii. pMD19T-KanR 20 µl, Sal I 1.5 µl, Spe I 1.5 µl, 10×H buffer 5 µl and ddH ₂ O 22 µl.

The above reaction system was incubated overnight at 37°C and subjected to electrophoresis in 1% agarose gel to excise specific target zones of electrophoretic mobility. The TIANgel Midi Purification Kit (Tiangen Biotech (Beijing) Co., Ltd.) was used to purify the target areas according to the manufacturer's instructions, and thus the left and right homologous regions of the BI-1 gene, BI1-UP, and BI1 were obtained. -DW, and kanamycin resistance gene KanR.

3. Construction of recombinant plasmid pUC18-BI1-KanR.

Purified BI1-UP, BI1-DW and KanR were mixed in equal volumes and ligated into the pUC18 vector using TAKARA ligation mixture to obtain the recombinant plasmid pUC18-BI1-KanR. The reaction system was as follows: BI1-UP 2 µl, BI1-DW 2 µl, KanR 2 µl, pUC18 1 µl and ligation mix 7 µl.

The above reaction system was incubated overnight at 16°C, competent DH5α cells were transformed, plated on LB solid medium supplemented with 25 μg/ml kanamycin, and cultured overnight at 37°C. The next day, individual colonies were selected and cultured for 16 h with 180 rpm shaking and 37°C.

4. Identification of the recombinant plasmid pUC18-BI1-KanR

The TIANprep Mini Plasmid Kit (Tiangen Biotech (Beijing) Co., Ltd.) was used to isolate plasmids from the bacterial suspensions obtained in step 3 according to the manufacturer's instructions, and the recombinant pUC18-BI1-KanR plasmid was identified by double restriction. The reaction system was as follows:

pUC18-BI1-KanR 1 µl, Sph I 0.3 µl, EcoR I 0.3 µl, 10×H buffer 1 µl and ddH ₂ O 7.4 µl.

The above reaction system was incubated for 2 h at 37°C and subjected to electrophoresis in 1% agarose gel. Restriction results were monitored using a gel imaging system. Recombinant plasmids, correctly identified by enzymatic digestion, were sent to a biotechnology company for sequencing.

The result is shown in Figure 6. Specific zones have a size of 2645 bp, 1479 bp, 1308 bp, 763 bp. and 72 b.p. respectively, indicating that the recombinant plasmid was correctly ligated.

Obtaining Competent B. suis Cells

(1) B. suis vaccinal strain S2 stored at -80°C was streaked on antibiotic-free TSA medium for reconstitution and cultured for 72 hours at 37°C;

(2) Individual colonies were selected and inoculated into 10 ml TSB medium containing no antibiotics and cultured for 48 hours with 180 rpm shaking and 37°C;

(3) The above bacterial suspension was inoculated into 50 ml of antibiotic-free TSB medium at a volume ratio of 1:100 and cultured with shaking at 180 rpm and a temperature of 37°C until the OD600 value of the bacterial suspension reached 0.9;

(4) The above bacterial suspension was pre-chilled on ice for 30 minutes and centrifuged for 20 minutes at 4500 g and 4°C, the supernatant was removed;

(5) Bacterial cells were resuspended in 20 ml of pre-chilled ddH ₂ O and centrifuged for 15 minutes at 4500 g and 4°C, the supernatant was removed and this operation was repeated one more time;

(6) Bacterial cells were resuspended in 20 ml of pre-chilled 10% aqueous glycerol solution and centrifuged for 15 minutes at 4500 g and 4°C, the supernatant was removed and this operation was repeated one more time;

(7) bacterial cells were resuspended in 1 ml of pre-chilled 10% aqueous glycerol solution; distributed into aliquots of 100 μl and stored at -80°C until use.

Screening and identification of a mutant strain of B. suis with a deletion of the BI-1 gene

1. Electroporation of B. suis competent cells.

(1) B. suis competent cells were removed from -80°C and thawed on ice;

(2) 20 μl of recombinant plasmid pUC18-BI1-KanR was pipetted, mixed with competent cells and placed on ice for 10 min;

(3) The above mixture was transferred to a pre-cooled 1 mm electroporation cuvette and electroporated at 2.5 kV for 4.5 ms;

(4) immediately add 1 ml of TSB without antibiotics and incubate for 12 h at 1 shaking 80 rpm and a temperature of 37°C;

(5) The above transformation product was plated on TSA medium supplemented with 25 µg/ml kanamycin and cultured for 72 hours at 37°C;

(6) Individual colonies were selected and inoculated into 10 ml of TSB medium and cultured for 48 hours with shaking at 180 rpm and a temperature of 37°C;

(7) 1 ml of the above bacterial suspension was aseptically pipetted and subjected to thermal lysis in a water bath at 70°C for 2 hours. The remaining bacterial suspension was temporarily stored at 4°C.

2. Identification of a mutant strain of B. suis with a deletion of the BI-1 gene by PCR.

Using the suspension of the heat-killed bacteria in step 1 as a template, primers BI1-TF and BI1-TR were used to perform PCR identification of the bacterial suspension sample. The reaction system was as follows:

BI1-TF 1 µl, BI1-TR 1 µl, matrix 1 µl, 2× Taq Mix 10 µl and ddH ₂ O 7 µl;

The reaction conditions were as follows:

94°C for 5 min; 30 cycles of 94°C for 30 seconds, 48°C for 30 seconds and 72°C for 30 seconds; 72°C for 10 min.

After completion of the above PCR, the PCR products were subjected to 1% agarose gel electrophoresis, and the PCR results were observed using a gel imaging system. Glycerol at a final concentration of 25% was added to a correctly identified BI-1-deficient B. suis strain and stored at -80°C until use.

The result is shown in Figure 7. The B. suis live vaccine strain S2 has one specific 453 bp zone, and the selected transformant has no zones, indicating that the selected transformant is a BI-1-deficient B. suis strain .

Determination of the Growth Rate of the B. suis Mutant Strain with the BI-1 Gene Deletion

(1) B. suis vaccine strain S2 and BI-1 deletion mutant B. suis strain ΔBI-1 stored at -80°C were streaked on TSA medium containing no antibiotics and TSA medium supplemented with 25 μg /ml kanamycin for recovery and cultured for 72 h at 37°C, respectively;

(2) Individual colonies were selected and inoculated into 10 ml TSB medium without antibiotics and TSB medium supplemented with 25 μg/ml kanamycin and cultured for 48 hours with 180 rpm shaking and 37° C., respectively;

(3) The above bacterial suspensions were centrifuged for 10 minutes at 5000 g and 4°C, and the bacterial cells were resuspended in 10 ml of sterile PBS;

(4) The above bacterial suspensions were diluted 10, 10 ² , 10 ³ , 104, 10 ⁵ , 10 ⁶ , 10 ⁷ , and 10 ⁸ times with sterile PBS, plated on antibiotic-free TSA, and cultured for 72 hours at 37°C, respectively; colonies were counted to determine the concentrations of the two bacterial suspensions;

(5) The above two bacterial suspensions with the same number of bacteria were pipetted, inoculated into antibiotic-free TSB medium, cultured at 180 rpm and 37° C., respectively; the optical density of bacterial suspensions at was measured at a wavelength of 600 nm to determine the growth rate of two strains at 0, 8, 16, 24, 32, 40, and 48 hours after inoculation, respectively.

The results are shown in Figure 9. Compared to the live B. suis S2 vaccine strain, the growth rate of the BI-1 deficient B. suis strain is significantly slowed down.

Determination of aggregation of bacterial cells of a mutant strain of B. suis with a deletion of BI-1

(1) B. suis vaccine strain S2 and BI-1 deletion mutant B. suis strain ΔBI-1 stored at -80°C were streaked on TSA medium containing no antibiotics and TSA medium supplemented with 25 μg /ml kanamycin for recovery and cultured for 72 h at 37°C, respectively;

(2) Individual colonies were selected and inoculated into 10 ml TSB medium without antibiotics and TSB medium supplemented with 25 μg/ml kanamycin and cultured for 48 hours with 180 rpm shaking and 37° C., respectively;

(3) 1 ml of each of the above bacterial suspensions was aseptically pipetted and subjected to thermal lysis in a water bath at 70°C for 2 hours; To measure the optical density at a wavelength of 600 nm, 150 μl of each of the suspensions of heat-killed bacteria were taken;

(4) After aseptically adding 1 ml of each bacterial suspension, the remaining bacterial suspensions were left for 24 hours at room temperature; 1 ml of each supernatant was taken with a pipette and thermally inactivated in a water bath at a temperature of 70°C for 2 hours; similarly, 150 μl of each of the suspensions of heat-killed bacteria were taken to measure the optical density at a wavelength of 600 nm;

(5) Aggregation of bacterial cells of two strains was calculated by the following formula.

Cell Aggregation (%) = ([OD _{Intact Bacteria} - OD _Supernatant ] / OD _{Intact Bacteria} ) × 100

The results are shown in Figure 8. Compared to the live B. suis S2 vaccine strain, cell aggregation of the B. suis strain with the BI-1 gene deletion is significantly enhanced, indicating that the characteristics of the outer cell membrane of the deficient strain are significantly altered.

The BI-1-deficient strain of B. suis in the present application is Brucella suis -ΔBI-1, and this strain of Brucella suis -ΔBI-1 has been deposited. The deposit of biological material looks like this:

Deposit date: October 21, 2019;

Full name of the depository: China General Microbiological Culture Collection Center;

Depository abbreviation: CGMCC;

Depository Address: Institute of Microbiology, Chinese Academy of Sciences, Yard 3, NO. 1, West Beichen Road, Chaoyang District, Beijing, China;

Registration number: CGMCC No.18741;

Taxonomic name: Brucella suis .

The above description is only a preferred example of the present invention; It should be noted that a number of improvements and modifications can also be made by those skilled in the art without deviating from the principles of the present invention, and these improvements and modifications should also be considered to be included within the protection scope of the present invention.

--->

SEQUENCE LIST

<110> NORSWEST A&F UNIVERSITY

<120> BI-1-deficient Brucella suis strain, method of construction thereof

and its application

<160> 8

<170> SIPO sequence list 1.0

<210> 1

<211> 24

<212> DNA

<213> Artificial sequence

<400> 1

gcatgccagg tgacggagaa catt 24

<210> 2

<211> 28

<212> DNA

<213> Artificial sequence

<400> 2

actagttgtg attcattatg gggatttc 28

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence

<400> 3

gtcgactggg caaccgtgaa taatc 25

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence

<400> 4

gaattcaagc gcagcgaatg aagat 25

<210> 5

<211> 27

<212> DNA

<213> Artificial sequence

<400> 5

gtcgactcag gtggcacttt tcgggga 27

<210> 6

<211> 26

<212> DNA

<213> Artificial sequence

<400> 6

actagtttgg gcgtcgcttg gtcggt 26

<210> 7

<211> 19

<212> DNA

<213> Artificial sequence

<400> 7

cagcgtcgcc ttcatagta 19

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

ctttccagca gcttcttttt 20

<---

Claims (22)

1. BI-1-deficient strain of Brucella suis to slow down the growth rate and enhance cell aggregation of Brucella suis where the specified strain obtained by replacing the gene BI-1 Brucella suis gene resistance to kanamycin; A BI-1-deficient strain of Brucella suis has been deposited with the China General Microbiological Culture Collection Center (CGMCC) under registration number CGMCC No.18741. 2. A method for constructing a BI-1-deficient strain of Brucella suis according to claim 1, which includes the following steps: step 1 - design of the required PCR primers based on the genome sequence of the Brucella suis S2 vaccine strain, the pEGFP-C1 gene sequence and the restriction site information of the pUC18 plasmid; stage 2 - using the genome of the vaccine strain S2 Brucella suis as a template, carrying out PCR amplification to obtain the left and right homologous regions of BI1-UP and BI1-DW, respectively, of the BI-1 gene; using the plasmid pEGFP-C1 as a template, performing PCR amplification to obtain the kanamycin resistance gene KanR; step 3 - separate ligation of the gene fragments obtained in step 2 into pMD19T-simple vectors to obtain the corresponding recombinant plasmids pMD19T-BI1-UP, pMD19T-BI1-DW and pMD19T-KanR; step 4 - separate transformation of competent DH5α cells with the recombinant plasmids obtained in step 3, selection of positive transformants for cultivation, isolation and sending of the corresponding recombinant plasmids to a biotechnology company for sequencing; step 5 - performing double restriction of the recombinant plasmids sequenced in step 4 with the corresponding restriction endonucleases, respectively, to isolate left and right homologous fragments of the BI-1 gene and KanR gene fragments; step 6 - mixing the gene fragments obtained in step 5 in equal volumes and ligating these gene fragments into the pUC18 vector to obtain the recombinant plasmid pUC18-BI1-KanR; step 7 - obtaining competent Brucella suis cells for use; step 8 - mixing recombinant plasmid pUC18-BI1-KanR obtained in step 6 with competent cells obtained in step 7, placed on ice for 10 min, transferred to a pre-chilled 1 mm electroporation cuvette and electroporated at 2.5 kV within 4.5 ms; immediate addition of 1 ml trypticase soy broth (TSB) medium without antibiotics and incubation with shaking 180 rpm and 37°C for 12 hours; inoculation on trypticase soy agar (TSA) medium supplemented with 25 μg/ml kanamycin, incubation for 72 h at 37°C and selection of individual colonies for cultivation; step 9 - thermal lysis of the bacterial suspension obtained in step 8 in a water bath at a temperature of 70°C for 2 hours and the use of primers BI1-F/R for PCR identification for screening BI-1-deficient strain. 3. A method for constructing a BI-1-deficient Brucella suis strain according to claim 2, wherein obtaining competent Brucella suis cells includes the following steps: streaking a Brucella suis S2 vaccine strain stored at -80°C on TSA medium without antibiotics for recovery, inoculation of single colonies in 10 ml of TSB medium without antibiotics, culture for 48 hours with 180 rpm and 37°C, and then inoculation in 50 ml of antibiotic-free TSB medium in a 1:100 volume ratio for propagation culture; when the OD600 value reaches 0.9, pre-cool the bacterial suspension on ice for 30 minutes, centrifuge for 20 minutes at 4500 g and remove the supernatant; resuspension of bacterial cells in 20 ml of pre-chilled ddH ₂ O, centrifugation for 15 minutes at 4500g, removing the supernatant and repeating this step one more time; resuspending the cells in 20 ml of pre-chilled 10% aqueous glycerol solution, centrifuging for 15 minutes at 4500g, removing the supernatant and repeating this step one more time; finally, resuspension of bacterial cells in 1 ml of pre-chilled 10% aqueous glycerol solution, distribution into 100 μl aliquots and storage at -80°C until use. 4. A method for constructing a BI-1 deficient strain of Brucella suis according to claim 2 or 3, wherein the PCR primers used in step 1 include: BI1-UF with the GCATG primer sequence CCAGGTGACGGAGAACATT (shown in SEQ ID NO: 1) and Sph I restriction site; BI1-UR with primer sequence ACTAGT TGTGATTCATTATGGGGATTTC (shown in SEQ ID NO. 2) and Spe I restriction site; BI1-DF with primer sequence GTCGAC TGGGCAACCGTGAATAATC (shown in SEQ ID NO. 3) and restriction site Sal I; BI1-DR with primer sequence GAATTC AAGCGCAGCGAATGAAGAT (shown in SEQ ID NO: 4) and EcoR I restriction site; KanR-F with primer sequence GTCGAC TCAGGTGGCACTTTTCGGGGA (shown in SEQ ID NO. 5) and restriction site Sal I; KanR-R with primer sequence ACTAGT TTGGGCGTCGCTTGGTCGGT (shown in SEQ ID NO. 6) and Spe I restriction site; BI1-TF with primer sequence CAGCGTCGCCTTCATAGTA (given in SEQ ID NO. 7) and no restriction site; BI1-TR with primer sequence CTTTCCAGCAGCTTCTTTTT (shown in SEQ ID NO. 8) and no restriction site; BI1-UF and BI1-UR can produce 1176 bp DNA fragments, BI1-DF and BI1-DR can produce 1093 bp DNA fragments, KanR-F and KanR-R can produce 1375 bp DNA fragments bp, BI1-TF and BI1-TR can produce 453 bp DNA fragments.

Images