RU2770691C2 - DNA APTAMERS TO HUMAN PrimPol PRIMASE AND DNA POLYMERASE - Google Patents

Abstract

FIELD: molecular biology.

SUBSTANCE: options of a DNA aptamer intended for specific binding to human PrimPol and inhibiting its DNA polymerase and primase activities are proposed.

EFFECT: group of inventions provides for inhibiting DNA-synthesizing PrimPol activity, which is achieved by the interaction of DNA aptamers with PrimPol molecule.

2 cl, 1 dwg, 2 ex

Description

The present invention relates to molecular biology and medicine, and specifically to DNA aptamers to human Primase and DNA polymerase PrimPol and a method of using DNA aptamers to inhibit PrimPol activity. The DNA aptamers of the present invention may have biological and therapeutic applications. DNA aptamers can be used as an inhibitor of human PrimPol, a means of binding and detecting PrimPol in scientific research, as well as inhibition of activity in human cells in order to increase the effectiveness of chemotherapy drugs.

The action of most chemotherapy drugs is based on blocking the replication of rapidly dividing tumor cells using DNA damage. The mechanisms of DNA damage removal during repair and the mechanisms that ensure cell tolerance to DNA damage reduce the therapeutic effect of chemotherapy. The mechanisms of tolerance to DNA damage include translesional synthesis (or "synthesis through damaged areas") and the mechanism of reinitiation of replication after the damaged site using primase and PrimPol DNA polymerase.

In recent years, the development of inhibitors of human translesional DNA polymerases has begun. To date, inhibitors based on small molecular weight compounds for Rev1 [Sail V. et al, ACS Chem Biol 2017, 12:1903-1912] and this DNA polymerase [Zafar MK. et al. Biochemistry 2018, 57, 1262-1273], and based on ribozymes and RNA aptamers to Rev1 [Dumstorf C.A. et al, Mol. Cancer Res. 2009, 7, 247-254], beta DNA polymerase [Gening L.. et al, Nucleic Acids Res 2006, 34:2579-86] and iota DNA polymerase [Lakhin A.V. et al, Nucleic Acid Ther. 2012, 22: 49-57].

. et al, Mol. Cell 2013, 52:541; Makarova A.V. et. al., DNA Repair 2018, 70:18-24]. В отличие от большинства других известных праймаз, которые синтезируют только РНК-праймеры, уникальной особенностью PrimPol является способность использовать дезоксирибонуклеотидтрифосфаты в реакции синтеза ДНК de novo [

. et al, Mol. Cell 2013, 52:541].Primase and DNA polymerase PrimPol (“Prim” - primase, “Pol” - polymerase) belongs to the superfamily of archaeo-eukaryotic primases and was first described in 2013. PrimPol is involved in both genomic and mitochondrial DNA replication. In vitro human PrimPol replicate on DNA templates with some damage [

. et al, Mol. Cell 2013, 52:541; Makarova A. V. et. al., DNA Repair 2018, 70:18-24]. Unlike most other known primases, which synthesize only RNA primers, the unique feature of PrimPol is the ability to use deoxyribonucleotide triphosphates in the de novo DNA synthesis reaction [

. et al, Mol. Cell 2013, 52:541].

. et al, Struct Mol Biol 2013, 20: 1383-1389; Pilzecker B. et al, Nucleic Acids Res. 2016, 44: 4734-4744; Kobayashi K. et al, Cell Cycle 2016, 15: 1997-2008]. При репликации геномной и митохондриальной ДНК PrimPol необходима также для преодоления блоков репликации, вызванных включением нуклеотидных аналогов, терминирующих синтез ДНК, или резким падением концентрации нуклеотидов в клетке [

. et al, Struct Mol Biol 2013, 20: 1383-1389; Kobayashi K. et al, Cell Cycle 2016, 15: 1997-2008; Wan L. et al, EMBO Rep 2013, 14: 1104-1112]. Таким образом, PrimPol выполняет функцию универсального белка, возобновляющего репликацию, остановки которой вызваны широким спектром ДНК-повреждающих агентов (или другими причинами). Ожидается, что ингибирование активности PrimPol позволит сенсибилизировать опухолевые клетки к ДНК-повреждающим агентам и повысит эффективность препаратов химиотерапии.PrimPol can start a stalled replication fork by performing DNA synthesis opposite the damaged site, or initiate DNA synthesis after de novo damage. Studies using PrimPol variants lacking primase activity have shown that the main mechanism of replication involving PrimPol is repriming after damaged sites. PrimPol performs repriming during DNA replication containing AP sites, photoproducts, G-quadruplexes and cisplatin crosslinks [Schiavone D et al, Mol. Cell 2016, 61:161;

. et al, Struct Mol Biol 2013, 20: 1383-1389; Pilzecker B. et al, Nucleic Acids Res. 2016, 44: 4734-4744; Kobayashi K. et al, Cell Cycle 2016, 15: 1997-2008]. During the replication of genomic and mitochondrial DNA, PrimPol is also necessary to overcome replication blocks caused by the inclusion of nucleotide analogs that terminate DNA synthesis, or a sharp drop in the concentration of nucleotides in the cell [

. et al, Struct Mol Biol 2013, 20: 1383-1389; Kobayashi K. et al, Cell Cycle 2016, 15: 1997-2008; Wan L. et al, EMBO Rep 2013, 14: 1104-1112]. Thus, PrimPol performs the function of a universal protein that resumes replication, the stops of which are caused by a wide range of DNA-damaging agents (or other reasons). It is expected that inhibition of PrimPol activity will make it possible to sensitize tumor cells to DNA-damaging agents and increase the effectiveness of chemotherapy drugs.

PrimPol is a new target for the creation of drugs to combat chemotherapeutic resistance based on inhibitors of DNA synthetic activity. One of the new approaches to the development of DNA polymerase inhibitors is the creation of aptamers. In the present invention, the problem of PrimPol inhibition is solved by using DNA aptamers. The conducted patent search did not reveal sources of information on the use of aptamers as inhibitors of human PrimPol, as well as information on the preparation of other PrimPol inhibitors.

Specific interactions between proteins and nucleic acids underlie many cellular biochemical processes. The large combinatorial diversity of nucleic acids and their ability to form a variety of secondary and tertiary structures make it possible to target the search for nucleic acid sequences that have the ability to interact with certain proteins. Such small oligonucleotide nucleic acid molecules that form strong complexes with certain target molecules have been called aptamers. Aptamers to proteins often bind in functionally important regions of the molecule and act as inhibitors of the activity of target proteins. Aptamers may contain single-stranded, double-stranded or triple-stranded regions.

Aptamers are obtained by the method of systematic evolution of ligands by exponential enrichment (SELEX - "Systematic Evolution of Ligands by Exponential Enrichment") using selection from large libraries of random sequences (combinatorial DNA and RNA libraries), using their ability to specifically bind to the corresponding immobilized ligand proteins. As a result of several rounds of selection of aptamers to the target protein immobilized on the affinity resin, the library of random nucleic acid sequences is gradually enriched with sequences that have a high affinity. Once identified, the aptamer can be prepared or synthesized by any known method, including chemical synthesis methods and enzymatic synthesis methods.

In terms of their specificity and high affinity, aptamers, as a rule, are not inferior to antibodies, and in a number of indicators they have an advantage over antibodies. Aptamers have low immunogenicity and toxicity, better ability to penetrate biological membranes. Aptamers that specifically recognize certain types of receptors can cross the blood-brain barrier [Monaco I. et al, J. Med. Chem. 2017, 60: 4510-4516] and can serve as delivery vehicles for therapeutic drugs. An important advantage is the availability of chemical or enzymatic synthesis of aptamers in large quantities and the ease of chemical modification of nucleic acids.

Based on aptamers, new drugs are being developed for the treatment of various diseases. Some drugs based on RNA and DNA aptamers are at the stage of clinical trials or entered the pharmaceutical market. Inhibitor aptamers have been obtained for some RNA and DNA polymerases: influenza virus RNA polymerase [Yuan S. et. al., Antimicrob. Agents Chemother. 2015, 59:4082-4093], enterovirus vesicular stomatitis RNA polymerase [Forrest S. et. al., J. Gen. Virol. 2014, 95:2649-2657], human immunodeficiency virus reverse transcriptase [Shiang Nanoscale 2013, 5:2756-2764], DNA polymerase beta [Gening L.. et al, Nucleic Acids Res 2006, 34:2579-86], and iota [Lakhin A.V. et al, Nucleic Acid Ther. 2012, 22: 49-57] of a person. The main mechanism of inhibition of the biochemical activity of RNA polymerases and DNA polymerases by aptamers is presumably their binding to the active site of the enzyme and competition of aptamers for binding to deoxyribonucleotide triphosphates. The dissociation constants of complexes of aptamers with proteins, as a rule, lie in the range of nano- and picomolar values.

In the development of the present invention, a full-length recombinant human PrimPol with a GST affinity tag immobilized on a resin with glutathione sepharose was used as a target protein. Individual aptamers were selected from a combinatorial single-stranded DNA library 75 nucleotides long containing a central randomized region surrounded by primer binding sites (GGGAGCTCAGAATAAACGCTCAA and TTCGACATGAGGCCCGGATC), which are necessary for library amplification during selection. A single-stranded DNA library was incubated with PrimPol, and oligonucleotides that did not bind to the target protein were washed off the affinity resin (before binding to the immobilized enzyme, the aptamer mixture was preincubated with an empty sorbent to exclude the selection of molecules interacting with it). DNA molecules bound to the target protein were eluted and amplified during PCR. The amplified double stranded DNA was then used to generate an enriched library of single stranded oligonucleotides. The selection procedure was carried out 12 times.

The present invention provides aptamers that have the ability to specifically bind to PrimPol and inhibit the DNA-synthetic activity of the enzyme. "Binding specificity" of an aptamer to its target means that the aptamer binds to its target with a much higher degree of affinity than when it binds to other non-target components in the mixture or sample. Inhibitory activity against human PrimPol means inhibition of any DNA-synthetic activity, since the enzyme uses the same active site to turn on nucleotides during de novo dinucleotide synthesis (primase activity) and continuing synthesis from the 3'-OH group (DNA polymerase activity).

The DNA aptamers of the present invention contain a central region with a unique nucleotide sequence and 5'- and 3'-terminal sequences. The central unique part contains the G-quadruplex motif, which is a DNA sequence with four guanine repeats and is capable of forming a four-strand structure held by G-G pair interactions. Such structures are highly stable in solution. Between the guanine repeats, there is a single-stranded region that forms a loop and is probably involved in direct binding to PrimPol.

The length and composition of the aptamers of the present invention are not limited. The unique central part can be used as part of a larger DNA molecule. DNA aptamers may contain additional variable regions flanking the central region, where n is any number of nucleotides from about 1 to 10, selected from a, c, t, g, without adversely affecting the properties of the aptamer. The 5' and 3' end sequences can be modified. Modifications can be aimed at protecting the 5'- and 3'-ends from the action of exonucleases and include non-nucleoside linkers, inverted dT, a methylene group between the 4' and 2' positions of deoxyribose (closed DNA), include fluorescent substances, radioactive isotopes, biotin and peptides . The invention covers all modifications and equivalents that may be included in the present invention according to its claims.

The present invention and a variant of its implementation are illustrated by the following examples. The proof of the feasibility of the technical result in the example is the inhibition of DNA polymerization PrimPol in vitro using DNA aptamers.

Example 1 demonstrates the inhibition of the DNA polymerase activity of PrimPol (figure 1A). A single-stranded DNA aptamer or an initial library at a concentration of 3 μM was annealed in a buffer containing 100 mM NaCl, 50 mM KCl, 30 mM Hepes pH 7.4, 1 mM DTT, heated to 90°C and cooled to 24°C for 10 min. The aptamer and control library at 400 nM or 200 nM were incubated with 200 nM human PrimPol and oligonucleotide DNA substrate with a 55 bp template DNA and a 22 bp 5'- ³² P-labeled primer at 30 nM in buffer containing 30 mM Hepes pH 7.4, 8% glycerol, 10 mM MgCl ₂ , 1 mM DTT, 100 μg/ml BSA, at 22°C for 5 min. A mixture of deoxyribonucleotide triphosphates was added at a concentration of 200 μM and incubated at 37°C for 30 min. DNA synthesis was stopped on ice by adding an equal volume of a mixture of formamide with 40 mM EDTA and bromophenol blue dye. ³² P-labeled DNA synthesis products were separated in a denaturing 23% polyacrylamide gel and detected by radiography. The reduction in the length of synthesized DNA molecules upon incubation of PrimPol with DNA aptamers PP3 (described by formula 1) and PP13, PP16, PP18 (described by formula 2), but not by the library, indicates a decrease in PrimPol DNA polymerase activity.

Example 2 demonstrates the inhibition of primase activity of PrimPol (figure 1B). A single-stranded DNA aptamer or an initial library at a concentration of 3 μM was annealed in a buffer containing 100 mM NaCl, 50 mM KCl, 30 mM Hepes pH 7.4, 1 mM DTT, heated to 90°C and cooled to 24°C for 10 min. The 400 nM aptamer and control library were incubated with 200 nM human PrimPol and 30 nM oligonucleotide DNA substrate with 55 bp template DNA in buffer containing 30 mM Hepes pH 7.4, 8% glycerol, 10 mM MgCl _2.1 mM DTT, 100 µg/ml BSA, at 22°C for 5 min. A mixture of deoxyribonucleotide triphosphates at a concentration of 200 μM, unlabeled ATP at a concentration of 10 μM, and ^[γ-32] P-labeled ATP at a concentration of 20 nM were added. Reactions were incubated at 37°С for 30 min. DNA synthesis was stopped on ice by adding an equal volume of a mixture of formamide with 40 mM EDTA and bromophenol blue dye. ³² P-labeled products of DNA synthesis were separated in a denaturing 30% polyacrylamide gel and detected by radiography. A decrease in the amount of synthesized di-, tri-, and tetranucleotides and full-length DNA synthesis products upon incubation of PrimPol with DNA aptamers PP3 (described by formula 1) and PP13, PP16, PP18 (described by formula 2), but not by the library, indicates a decrease in PrimPol primase activity. Examples 1 and 2 lead to the conclusion about the inhibition of the DNA-synthetic ability of PrimPol.

The examples given do not limit other possible embodiments of the present invention. The aptamers of the present invention may also have inhibitory activities against PrimPol molecules derived from other mammalian species. DNA aptamers can serve as a means for binding and detecting human PrimPol. The DNA aptamer can be used to create an affinity chromatographic sorbent and purify PrimPol using this sorbent. The DNA aptamer can serve as a reagent for detecting and assessing the amount of PrimPol in biological samples. The ability of the aptamer to bind to the target protein with high specificity and high affinity can facilitate the detection of the target protein in the test sample, making it possible to determine the absence, presence and concentration of PrimPol molecules. Such a sample can be any material obtained from the body, including cell cultures, cell extracts of cell and tissue cultures, tissue sections. Labeling DNA atamers with fluorescent dyes or radioactive isotopes will increase the sensitivity of the detection method and/or reduce the analysis time.

Stabilized DNA aptamers with a similar nucleotide sequence and structural motifs of the central region can be used to inhibit the activity of PrimPol in human cells in order to increase the effectiveness of chemotherapy drugs. Delivery of the DNA aptamer into cells can be accomplished using known transfection and nucleic acid delivery techniques, or by fusion with the aptamer that serves as the delivery vehicle (a chimera of two aptamers).

Figure 1 shows the inhibition of DNA polymerase (1A) and primase (1B) activities of human PrimPol by DNA aptamers in vitro. (1A). To 0.2 μM PrimPol was added 0.2 or 0.4 μM of the PP3 aptamer (described by formula 1, lanes 2,3), or one of the PP13, PP16, PP18 aptamers (described by formula 2, lanes 10-15), or one from aptamers PP6, PP8, PP10 (described by formulas other than formulas 1 and 2 of the present invention, lanes 4-9). As controls, the original library was added (N, lanes 18,19) or neither DNA aptamers nor the library were added (lane 1). (1B). To 0.2 μM PrimPol was added 0.4 μM of the PP3 aptamer (described by formula 1, lane 22), or one of the PP13, PP16, PP18 aptamers (described by formula 2, lanes 23-25). As controls, the original library was added (N, lane 26), neither the DNA aptamers nor the library was added (lane 2), or PrimPol was added (lane 1).

--->

Nucleotide sequences

<110> Institute of Molecular Genetics of Russian Academy of Sciences

<120> DNA aptamers to human primase and DNA polymerase PrimPol

and method for inhibiting its activity

<160> 2

<210> 1

<211> 77

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> 24

<223> Designed DNA aptamer to human PrimPol

<400> 1

gggagctcag aataaacgct caanctggtt tggtgagaga ggttgggttg agagtanttc 60

gacatgaggc ccggatc 77

<210> 2

<211> 68

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> 24

<223> Designed DNA aptamer to human PrimPol

<400> 1

gggagctcag aataaacgct caanctggtt ggtgcacggga ggatgggntt cgacatgagg 60

ccggatc 68

<---

Claims (8)

1. DNA aptamer designed for specific binding to human PrimPol and inhibiting its DNA polymerase and primase activities and having the nucleotide sequence: gggagctcag aataaacgct caanctggtt tggtgagaga ggttgggttg agagtanttc 60 gacatgaggc ccggatc 77, where n represents any number of nucleotides from 1 to 10 selected from a, c, t, g, which can be additionally introduced into the aptamer. 2. DNA aptamer designed for specific binding to human PrimPol and inhibiting its DNA polymerase and primase activities and having a nucleotide sequence: gggagctcag aataaacgct caanctggtt ggtgcacggga ggatgggntt cgacatgagg 60 ccggatc 68, where n represents any number of nucleotides from 1 to 10 selected from a, c, t, g, which can be additionally introduced into the aptamer.

Images