RU2760439C1 - Immunobiological agent for induction of immune response to filoviruses: ebolavirus and/or marburgvirus, method of using immunobiological agent - Google Patents

Abstract

FIELD: immunology; virology.SUBSTANCE: immunobiological agent was created for inducing an immune response to human pathogenic filoviruses, including a base representing a recombinant human adenovirus of serotype 26 or serotype 5 containing an expression cassette SEQIDNO:1, or SEQIDNO:2, or SEQIDNO:3, or SEQIDNO:4, or SEQIDNO:5, or SEQIDNO:6, or SEQIDNO:7, or SEQIDNO:8. In addition, an immunobiological agent was created to induce an immune response to human pathogenic filoviruses, including a base representing a recombinant vesicular stomatitis virus containing nucleic acid corresponding to cDNA SEQIDNO:9, or SEQIDNO:10, or SEQIDNO:11, or SEQIDNO:12, or SEQIDNO:13, or SEQIDNO:14, or SEQIDNO:15, or SEQIDNO:16. A method for using an immunobiological agent was also developed, consisting in its introduction into the mammalian body in an effective amount to induce specific immunity against the Ebola virus and/ or the Marburg virus. In this case, sequential administration of any of the immunobiological agents into the mammalian body with an interval of more than 1 week or simultaneous administration of several immunobiological agents into the mammalian body is possible. The developed variants of the immunobiological agent can be administered intranasally and / or subcutaneously and / or intramuscularly.EFFECT: invention can be used as a specific preventive agent against diseases caused by Ebola virus (EBOV), Bundibugyo virus (BDBV), Sudan virus (SUDV), Marburg virus (MARV).10 cl, 14 tbl, 13 ex

Description

Technology area

The invention relates to immunology and virology and can be used to create a specific prophylactic agent against diseases caused by the Ebola virus (EBOV), Bundibugyo virus (BDBV), Sudan virus (SUDV), Marburg virus (MARV).

Prior art

Filoviridae is a family of RNA viruses, which, according to the modern classification, includes 6 genera: Cuevavirus, Dianlovirus, Ebolavirus, Marburgvirus, Striavirus, Thamnovirus (https://talk.ictvonline.org/ictv-reports/ictv_online_report/negative-sense-rna -viruses / mononegavirales / w / filoviridae). Of these, 2 genera are considered pathogenic for humans: Marburgvirus and Ebolavirus.

The genus Marburgvirus includes two species: Marburg virus (MARV) and Ravn virus (RAVV). Marburg virus was first isolated in 1967 during an outbreak of hemorrhagic fever in workers at a polio vaccine plant who came into contact with grivet tissue. Outbreaks were recorded in three cities: Marburg, Frankfurt and Belgrade. In total, 31 people were infected, 7 of whom died. Subsequently, outbreaks and isolated cases have been reported in Angola, the Democratic Republic of the Congo, Kenya, Uganda and South Africa. Ravn virus was first described in 1987 and named after the Danish patient from whom it was isolated. Both types of Marburgvirus cause Marburg haemorrhagic fever, which is a serious illness with a high mortality rate, which can be as high as 90% in some outbreaks. The initial symptoms of the disease include high fever, headache, chills, nausea, vomiting, diarrhea, pharyngitis, maculopapular rash, abdominal pain, conjunctivitis. In the future, shortness of breath, edema, injection of the conjunctiva, viral exanthema develop and neurological symptoms increase: confusion, delirium, apathy, aggression, encephalitis. Hemorrhagic symptoms appear in the final stage of the disease and include bloody stools, ecchymosis, leakage of blood from venipuncture sites, mucous membranes and visceral bleeding. The death of patients can occur from pulmonary or cerebral edema, hypovolemic shock, disseminated intravascular coagulation syndrome, acute renal failure. Since the beginning of the observation, 466 cases of the disease have been recorded, 373 people have died. (https://www.cdc.gov/vhf/marburg/outbreaks/chronology.html)

The genus Ebolavirus includes 6 species: Ebola virus (EBOV), Reston virus (RESTV), Bundibugyo virus (BDBV), Sudan virus (SUDV), Taï Forest virus (TAFV), Bombali virus (BOMV). Three of them are highly pathogenic for humans (Ebola virus, Bundibugyo virus, Sudan virus) and cause Ebola hemorrhagic fever. This is a serious disease, with an acute manifestation, without prodromal phenomena. The first symptoms include fever, headache, catarrhal symptoms, myalgia. Later, indomitable vomiting, diarrhea, abdominal pains appear, stabbing pains in the chest area can be observed, dehydration of the body develops, in 50% of patients a hemorrhagic rash appears, hemorrhages in the form of skin hemorrhages, external and internal bleeding. Since the beginning of the observation, more than 31 thousand cases of the disease have been recorded, more than 12 thousand people have died. The largest epidemic was associated with the EBOV virus and occurred in 2014-2016. It affected 5 countries in West and Central Africa and claimed the lives of more than eleven thousand people. SUDV has caused several outbreaks in Uganda and South Sudan (412 deaths). BDBV, discovered in 2007, has been linked to two outbreaks in the Democratic Republic of Congo and Uganda, and has killed 50 people (https://www.cdc.gov/vhf/ebola/history/distribution-map.html).

Marburg haemorrhagic fever and Ebola haemorrhagic fever are zoonotic infections. It is currently believed that bats (Rousettus aegyptiacus, Mops condylurus, Chaerephon pumilus, etc.), which are widespread in nature, are the natural reservoir of filoviruses. The development of agriculture leads to the fact that people are increasingly in contact with wildlife, and, therefore, in the future, new epidemics associated with filoviruses can be expected.

Currently, there are no approved prophylactic drugs against Marburg haemorrhagic fever and a limited number of vaccines against Ebola haemorrhagic fever.

Known solution according to patent WO 2011130627 A2, in which for the induction of an immune response to filoviruses (Ebola virus, Marburg virus), it is proposed to use chimpanzee adenoviruses, which contain genes of various proteins of these viruses, including the GP protein of the Ebola virus.

There is a solution according to patent CA 2821289 A1, according to which a recombinant adenoviral vector based on adenoviruses 26 and 35 of serotype, which express filovirus antigens, is used to induce an immune response against filoviruses.

Known solution according to patent US 20100047282 A1, where as a vaccine against Ebola hemorrhagic fever using a recombinant adenovirus containing the gene for the glycoprotein of the Ebola virus (GP).

Known solution according to the patent CA 2493142 C, in which to stimulate the immune response to the Ebola virus using a recombinant vesicular stomatitis virus (VSV) containing a glycoprotein gene selected from the group consisting of the Lassa fever virus glycoprotein, the Marburg virus glycoprotein and the inserted virus glycoprotein into the viral genome so that this sequence replaces the original VSV glycoprotein gene. The disadvantage of this solution is that when re-vaccinated, antibodies to the vector portion can reduce the effectiveness of vaccination.

Thus, in the prior art, there is a need to develop a new immunobiological agent for the induction of specific immunity against filoviruses based on various types of recombinant viruses.

Disclosure of invention

The technical objective of the claimed invention is to expand the arsenal of immunobiological agents that provide effective induction of an immune response against filoviruses: genus Ebolavirus: Ebola virus (EBOV), Bundibugyo virus (BDBV), Sudan virus (SUDV), and / or filoviruses of the genus Marburgvirus: Marburg virus (MARV ).

The technical result consists in creating an immunobiological agent for inducing specific immunity against Ebola and / or Marburg viruses based on a recombinant human adenovirus 26 serotype containing an expression cassette SEQ ID NO: 1, or SEQ ID NO: 2, or SEQ ID NO: 3, or SEQ ID NO: 4, or SEQ ID NO: 5, or SEQ ID NO: 6, or SEQ ID NO: 7, or SEQ ID NO: 8.

In addition, the technical result consists in creating an immunobiological agent for the induction of specific immunity against Ebola and / or Marburg viruses based on recombinant human adenovirus serotype 5, containing an expression cassette SEQ ID NO: 1, or SEQ ID NO: 2, or SEQ ID NO: 3, or SEQ ID NO: 4, or SEQ ID NO: 5, or SEQ ID NO: 6, or SEQ ID NO: 7, or SEQ ID NO: 8.

And also, the technical result is to create an immunobiological agent for the induction of specific immunity against Ebola and / or Marburg viruses based on a recombinant vesicular stomatitis virus containing a nucleic acid corresponding to cDNA SEQ ID NO: 9 or SEQ ID NO: 10, or SEQ ID NO : 11, or SEQ ID NO: 12, or SEQ ID NO: 13, or SEQ ID NO: 14, or SEQ ID NO: 15, or SEQ ID NO: 16.

In addition, a method was developed for using an immunobiological agent, which consists in introducing it into the mammalian body in an effective amount to induce specific immunity against the Ebola virus and / or Marburg virus.

Also, a method of use has been developed, which provides for the sequential introduction of any of the immunobiological agents into the mammalian body at an interval of more than 1 week.

Another use case involves the simultaneous introduction of several immunobiological agents into the mammalian organism.

In this case, the developed variants of the immunobiological agent can be administered intranasally and / or subcutaneously and / or intramuscularly.

A variant of the method of use was also developed, which consists in the introduction into the mammalian organism of a composition containing any number of immunobiological agents. In this case, the composition can be administered multiple times with an interval of more than 1 week.

Implementation of the invention

Glycoprotein (GP) is the only protein located on the surface of the filovirus virion. It is necessary for the attachment of the viral particle to the cell and subsequent internalization. GP has been shown to be a target for virus neutralizing antibodies, and anti-GP antibody titers correlate with disease protection. All this makes it one of the most promising vaccine antigens.

Filovirus glycoprotein (GP) is synthesized as a precursor GP0, which is cleaved by furin into GP1 and GP2. GP1 contains a receptor-binding domain, a glycan cap, and a highly glycosylated mucin-like domain. GP2 includes a transmembrane domain, a hybrid peptide, and heptad repeats required for the fusion of the virus with the cell membrane. GP1 and GP2 are linked by a disulfide bond and form a heterodimer. Then the GP1 / GP2 heterodimers are assembled into a trimer, which forms spikes on the surface of the virion.

In this case, the mucin-like domain is characterized by high variability. In order to obtain antibodies to more conserved epitopes as a result of vaccination, the sequence encoding the mucin-like domain (GPΔmuc) was removed from the filovirus glycoprotein gene.

Based on the genes of GP filoviruses (Ebola virus (EBOV), Bundibugyo virus (BDBV), Sudan virus (SUDV), Marburg virus (MARV)) and their modifications, several variants of expression cassettes for adenoviral vectors have been proposed:

1) Expression cassette SEQ ID NO: 1, which contains:

- CMV promoter,

- full-length gene GP Ebola virus (EBOV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST". The change in the sequence of the GP gene was carried out in accordance with the data available in the literature that a loop is formed at this site, which is a complex structure for the passage of the enzyme by polymerase,

- SV40 virus polyadenylation signal.

2) Expression cassette SEQ ID NO: 2, which contains:

- CMV promoter,

- modified gene GPΔmuc Ebola virus (EBOV), in which the sequence encoding the mucin-like domain was deleted and the sequence "ASTAAAAAAASST" was replaced by "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

3) Expression cassette SEQ ID NO: 3, which contains:

- CMV promoter,

- full-length gene GP Bundibugyo virus (BDBV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

4) Expression cassette SEQ ID NO: 4, which contains:

- CMV promoter,

- modified gene GPΔmuc Bundibugyo virus (BDBV), in which the sequence encoding the mucin-like domain has been deleted and the sequence "ASTAAAAAAASST" is replaced by "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

5) Expression cassette SEQ ID NO: 5, which contains:

- CMV promoter,

- full-length gene GP Sudan virus (SUDV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

6) Expression cassette SEQ ID NO: 6, which contains:

- CMV promoter,

- modified gene GPΔmuc Sudan virus (SUDV), in which the sequence encoding the mucin-like domain was deleted and the sequence "ASTAAAAAAASST" was replaced by "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

7) Expression cassette SEQ ID NO: 7, which contains:

- CMV promoter,

- full-length gene GP Marburg virus (MARV),

- SV40 virus polyadenylation signal.

8) Expression cassette SEQ ID NO: 8, which contains:

- CMV promoter,

- modified gene GPΔmuc Marburg virus (MARV), in which the sequence encoding the mucin-like domain has been deleted,

- SV40 virus polyadenylation signal.

In addition, several variants of discrete transcriptional units for the recombinant vesicular stomatitis virus have been proposed:

1) Transcriptional unit (corresponding to cDNA SEQ ID NO: 9), which contains:

- site of transcription initiation,

- full-length gene GP Ebola virus (EBOV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST". The change in the sequence of the GP gene was carried out in accordance with the data available in the literature that a loop is formed at this site, which is a complex structure for the passage of the enzyme by polymerase,

- signal for termination and polyadenylation.

2) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 10), which contains:

- site of transcription initiation,

- modified gene GPΔmuc Ebola virus (EBOV), in which the sequence encoding the mucin-like domain was deleted and the sequence "ASTAAAAAAASST" was replaced by "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

3) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 11), which contains:

- site of transcription initiation,

- full-length gene GP Bundibugyo virus (BDBV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

4) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 12), which contains:

- site of transcription initiation,

- modified gene GPΔmuc Bundibugyo virus (BDBV), in which the sequence encoding the mucin-like domain has been deleted and the sequence "ASTAAAAAAASST" is replaced by "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

5) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 13), which contains:

- site of transcription initiation,

- full-length gene GP Sudan virus (SUDV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

6) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 14), which contains:

- site of transcription initiation,

- modified gene GPΔmuc Sudan virus (SUDV), in which the sequence encoding the mucin-like domain was deleted and the sequence "ASTAAAAAAASST" was replaced by "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

7) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 15), which contains:

- site of transcription initiation,

- full-length gene GP Marburg virus (MARV),

- signal for termination and polyadenylation.

8) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 16), which contains:

- site of transcription initiation,

- modified gene GPΔmuc Marburg virus (MARV), in which the sequence encoding the mucin-like domain has been deleted,

- signal for termination and polyadenylation.

Recombinant human adenoviruses of serotypes 5 and 26 and a vector based on vesicular stomatitis virus, which are able to induce a stable T-cell and humoral response, and also show high safety profiles, were selected as expression vectors.

Thus, variants of an immunobiological agent were developed for the induction of an immune response to filoviruses, which provide the induction of an immune response to epidemiologically significant types of filoviruses.

The implementation of the invention is confirmed by the following examples.

Example 1.

Development of the design of expression cassettes.

At the first stage of the work, the GP gene sequence was selected for each filovirus (Ebola virus, Bundibugyo virus, Sudan virus, Marburg virus) separately. Sequences published in open databases were used for the analysis. Based on the nucleotide sequence, the amino acid sequence was obtained. Next, the variability of amino acids in each position was calculated and the consensus (conservative) amino acid sequence was determined, which was then compared with the complete GP sequences of this filovirus. According to the results of the study, it was determined that the amino acid sequence closest to the consensus for Ebola virus (EBOV) is ID AIG 95977, for Bundibugyo virus (BDBV) - ID AGL73460, for Sudan virus (SUDV) - ID AGB56678, for Marburg virus (MARV ) - ID AFV31307. Further, the nucleotide sequence GP-EBOV, GP-BDBV, GP-SUDV, GP-MARV was obtained from the amino acid sequence. Then, modifications of the GP gene were developed with a deleted sequence encoding a mucin-like domain: GPΔmuc-EBOV, GPΔmuc-BDBV, GPΔmuc-SUDV, GPΔmuc-MARV.

Thus, the design of expression cassettes for adenoviral recombinant vectors was developed:

1) Expression cassette SEQ ID NO: 1, which contains:

- CMV promoter,

- full-length gene GP Ebola virus (EBOV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST". The change in the sequence of the GP gene was performed in accordance with the data available in the literature that a loop is formed at this site, which is a complex structure for the passage of the enzyme by polymerase,

- SV40 virus polyadenylation signal.

2) Expression cassette SEQ ID NO: 2, which contains:

- CMV promoter,

- modified gene GPΔmuc Ebola virus (EBOV), in which the sequence encoding the mucin-like domain was deleted and the sequence "ASTAAAAAAASST" was replaced by "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

3) Expression cassette SEQ ID NO: 3, which contains:

- CMV promoter,

- full-length gene GP Bundibugyo virus (BDBV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

4) Expression cassette SEQ ID NO: 4, which contains:

- CMV promoter,

- modified gene GPΔmuc Bundibugyo virus (BDBV), in which the sequence encoding the mucin-like domain was deleted and the sequence "ASTAAAAAAASST" was replaced by "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

5) Expression cassette SEQ ID NO: 5, which contains:

- CMV promoter,

- full-length gene GP Sudan virus (SUDV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

6) Expression cassette SEQ ID NO: 6, which contains:

- CMV promoter,

- modified gene GPΔmuc Sudan virus (SUDV), in which the sequence encoding the mucin-like domain was deleted and the sequence "ASTAAAAAAASST" was replaced by "ASTAAAAAAAASST",

- SV40 virus polyadenylation signal.

7) Expression cassette SEQ ID NO: 7, which contains:

- CMV promoter,

- full-length gene GP Marburg virus (MARV),

- SV40 virus polyadenylation signal.

8) Expression cassette SEQ ID NO: 8, which contains:

- CMV promoter,

- modified gene GPΔmuc Marburg virus (MARV), in which the sequence encoding the mucin-like domain has been deleted,

- SV40 virus polyadenylation signal.

In addition, several variants of discrete transcriptional units for the recombinant vesicular stomatitis virus have been proposed:

1) Transcriptional unit (corresponding to cDNA SEQ ID NO: 9), which contains:

- site of transcription initiation,

- full-length gene GP Ebola virus (EBOV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST". The change in the sequence of the GP gene was performed in accordance with the data available in the literature that a loop is formed at this site, which is a complex structure for the passage of the enzyme by polymerase,

- signal for termination and polyadenylation.

2) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 10), which contains:

- site of transcription initiation,

- modified gene GPΔmuc Ebola virus (EBOV), in which the sequence encoding the mucin-like domain was deleted and the sequence "ASTAAAAAAASST" was replaced by "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

3) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 11), which contains:

- site of transcription initiation,

- full-length gene GP Bundibugyo virus (BDBV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

4) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 12), which contains:

- site of transcription initiation,

- modified gene GPΔmuc Bundibugyo virus (BDBV), in which the sequence encoding the mucin-like domain has been deleted and the sequence "ASTAAAAAAASST" is replaced by "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

5) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 13), which contains:

- site of transcription initiation,

- full-length gene GP Sudan virus (SUDV), which was modified by replacing the sequence "ASTAAAAAAASST" with "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

6) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 14), which contains:

- site of transcription initiation,

- modified gene GPΔmuc Sudan virus (SUDV), in which the sequence encoding the mucin-like domain was deleted and the sequence "ASTAAAAAAASST" was replaced by "ASTAAAAAAAASST",

- signal for termination and polyadenylation.

7) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 15), which contains:

- site of transcription initiation,

- full-length gene GP Marburg virus (MARV),

- signal for termination and polyadenylation.

8) Discrete transcriptional unit (corresponding to cDNA SEQ ID NO: 16), which contains:

- site of transcription initiation,

- modified gene GPΔmuc Marburg virus (MARV), in which the sequence encoding the mucin-like domain has been deleted,

- signal for termination and polyadenylation.

The genes were synthesized by ZAO Evrogen (Moscow).

Example 2.

A method of producing an immunobiological agent based on human adenovirus 26 serotype.

At the first stage, plasmids pAd26-Ends-GP-EBOV, pAd26-Ends-GPΔmuc-EBOV, pAd26-Ends-GP-BDBV, pAd26-Ends-GPΔmuc-BDBV, pAd26-Ends-GP-SUDV were obtained using genetic engineering methods. , pAd26-Ends-GPΔmuc-SUDV, pAd26-Ends-GP-MARV, pAd26-Ends-GPΔmuc-MARV containing expression cassettes SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, respectively, as well as bearing genome homology arms of the 26th serotype adenovirus. After that, the obtained constructs were linearized according to the unique hydrolysis site between the homology arms, each plasmid was mixed with the recombinant vector pAd26-too, which contains the genome of human adenovirus serotype 26 with an open reading frame ORF6 of human adenovirus serotype 5 (in place of ORF6 of human adenovirus 26 serotype) and with deletions of the E1 and E3 regions. As a result of homologous recombination, plasmids pAd26-too-GP-EBOV, pAd26-too-GPΔmuc-EBOV, pAd26-too-GP-BDBV, pAd26-too-GPΔmuc-BDBV, pAd26-too-GP-SUDV, pAd26-too -GPΔmuc-SUDV, pAd26-too-GP-MARV, pAd26-too-GPΔmuc-MARV carrying the genome of recombinant human adenovirus 26 serotype with an open reading frame ORF6 human adenovirus serotype 5 (in place of ORF6 human adenovirus 26 serotype) and c by deleting the E1 and E3 regions, with the expression cassette SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, respectively.

Further, the resulting plasmids were digested with specific restriction endonucleases to remove the vector portion. The obtained DNA preparations were used to transfect the HEK293 culture cells. As a result, a material was obtained, which was then used for the accumulation of preparative quantities of recombinant adenoviruses.

Thus, the immunobiological agent according to option 1 is a recombinant human adenovirus of serotype 26 containing an expression cassette SEQ ID NO: 1 (Ad26-GP-EBOV), or SEQ ID NO: 2 (Ad26-GPΔmuc-EBOV), or SEQ ID NO : 3 (Ad26-GP-BDBV), or SEQ ID NO: 4 (Ad26-GPΔmuc-BDBV), or SEQ ID NO: 5 (Ad26-GP-SUDV), or SEQ ID NO: 6 (Ad26-GPΔmuc-SUDV ), or SEQ ID NO: 7 (Ad26-GP-MARV), or SEQ ID NO: 8 (Ad26-GPΔmuc-MARV) in buffered solution. In this case, the buffer solution can have any composition that ensures the viability and stability of viral particles and is suitable for administration to mammals. For example, the composition of the buffer solution: tris (0.1831-0.3432 wt%), sodium chloride (0.3313-0.6212 wt%), sucrose (3.7821-7.0915 wt%), magnesium chloride hexahydrate (0.0154-0.0289 wt%), EDTA (0.0029-0.0054 wt%), polysorbate-80 (0.0378-0.0709 wt%), ethanol 95% (0, 0004-0.0007 wt.%), Water is the rest.

Example 3.

A method of obtaining an immunobiological agent based on human adenovirus serotype 5.

At the first stage, plasmids pAd5-Ends-GP-EBOV, pAd5-Ends-GPΔmuc-EBOV, pAd5-Ends-GP-BDBV, pAd5-Ends-GPΔmuc-BDBV, pAd5-Ends-GP- SUDV, pAd5-Ends-GPΔmuc-SUDV, pAd5-Ends-GP-MARV, pAd5-Ends-GPΔmuc-MARV containing expression cassettes SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO : 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, respectively, as well as bearing the homology arms of the 5th serotype adenovirus genome.

Then the resulting constructs were lianerized according to the unique hydrolysis site between the homologous arms, each plasmid was mixed with the pAd5-too recombinant vector, which contains the genome of human adenovirus serotype 5 with deletions of the E1 and E3 regions of the genome. As a result of homologous recombination, plasmids pAd5-too-GP-EBOV, pAd5-too-GPΔmuc-EBOV, pAd5-too-GP-BDBV, pAd5-too-GPΔmuc-BDBV, pAd5-too-GP-SUDV, pAd5-too -GPΔmuc-SUDV, pAd5-too-GP-MARV, pAd5-too-GPΔmuc-MARV carrying the genome of the recombinant human adenovirus 5th serotype with deletions of E1 and E3 regions and expression cassettes SEQ ID NO: 1, SEQ ID NO: 2 , SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, respectively.

In the fourth step, these plasmids were digested with a specific restriction endonuclease to remove the vector portion. The resulting DNA preparation was used to transfect the HEK293 culture cells. The resulting material was used to accumulate preparative amounts of recombinant adenoviruses.

Thus, the immunobiological agent according to option 2 is a recombinant human adenovirus serotype 5 containing an expression cassette SEQ ID NO: 1 (Ad5-GP-EBOV), or SEQ ID NO: 2 (Ad5-GPΔmuc-EBOV), or SEQ ID NO : 3 (Ad5-GP-BDBV), or SEQ ID NO: 4 (Ad5-GPΔmuc-BDBV), or SEQ ID NO: 5 (Ad5-GP-SUDV), or SEQ ID NO: 6 (Ad5-GPΔmuc-SUDV ), or SEQ ID NO: 7 (Ad5-GP-MARV), or SEQ ID NO: 8 (Ad5-GPΔmuc-MARV) in buffered solution. In this case, the buffer solution can have any composition that ensures the viability and stability of viral particles and is suitable for administration to mammals. For example, the composition of the buffer solution: tris (0.1831-0.3432 wt%), sodium chloride (0.3313-0.6212 wt%), sucrose (3.7821-7.0915 wt%), magnesium chloride hexahydrate (0.0154-0.0289 wt%), EDTA (0.0029-0.0054 wt%), polysorbate-80 (0.0378-0.0709 wt%), ethanol 95% (0, 0004-0.0007 wt.%), Water is the rest.

Example 4.

To obtain recombinant vesicular stomatitis viruses, we used the pVSV-deltaG plasmid, which is a cDNA complementary to the genomic RNA of the vesicular stomatitis virus with a deleted glycoprotein gene. 8 genetic constructs were obtained from this plasmid by genetic engineering: pVSV-deltaG-GP-EBOV, pVSV-deltaG-GPΔmuc-EBOV, pVSV-deltaG-GP-SUDV, pVSV-deltaG-GPΔmuc-SUDV, pVSV-deltaG-GP- BDBV, pVSV-deltaG-GPΔmuc-BDBV, pVSV-deltaG-GP-MARV, pVSV-deltaG-GPΔmuc-MARV containing SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 , SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, respectively.

To obtain preparations of recombinant vesicular stomatitis viruses, BHK21 cells were transfected with plasmids carrying: en DNA-dependent RNA polymerase of bacteriophage T7; genes - N (nucleocapsid), P (phosphoprotein), L (large polymerase subunit) of VSV proteins; and a vector plasmid selected from pVSV-deltaG-GP-EBOV, pVSV-deltaG-GPΔmuc-EBOV, pVSV-deltaG-GP-SUDV, pVSV-deltaG-GPΔmuc-SUDV, pVSV-deltaG-GP-BDBV, pV-SV-deltaG GPΔmuc-BDBV, pVSV-deltaG-GP-MARV, pVSV-deltaG-GPΔmuc-MARV. Transfection was performed using Lipofectamine-2000 reagent (Life Technologies) according to the manufacturer's instructions. Thus, 8 preparations of the recombinant vesicular stomatitis virus were obtained.

Thus, the immunobiological agent according to option 3 is a recombinant vesicular stomatitis virus containing the sequence corresponding to the cDNA of SEQ ID NO: 9 (VSV-GP-EBOV), or SEQ ID NO: 10 (VSV-GPΔmuc-EBOV), or SEQ ID NO: 11 (VSV-GP-BDBV), or SEQ ID NO: 12 (VSV-GPΔmuc-BDBV), or SEQ ID NO: 13 (VSV-GP-SUDV), or SEQ ID NO: 14 (VSV-GPΔmuc- SUDV) or SEQ ID NO: 15 (VSV-GP-MARV) or SEQ ID NO: 16 (VSV-GPΔmuc-MARV) in buffered solution. In this case, the buffer solution can have any composition that ensures the viability and stability of viral particles and is suitable for administration to mammals. For example, the composition of the buffer solution: tris (hydroxymethyl) aminomethane - 0.4-0.7 mg, EDTA disodium salt - 0.1-0.2 mg, sucrose - 30-70 mg, water for injection up to 0.5 ml.

Example 5.

Checking the safety of the developed variants of the immunobiological agent.

The purpose of this experiment was to test the toxicity of the developed agent with a single injection (acute toxicity) in mice with and intramuscular injection.

Outbred mice, both sexes, weighing 18-20 grams, 6-8 weeks old, were used in the study.

The minimum dose for toxicological experiments was selected for a mouse 10 ⁸ vp, as the closest to the therapeutic. The interspecies conversion factor was not used for dose conversion; doses were obtained by direct conversion to body weight, according to the WHO recommendation for vaccine preparations.

As a result, the following doses of the agent were chosen for administration to mice in this experiment:

10 ⁹ v.h. - increased effective dose (ED) for mice by 20 times;

10 ¹⁰ w.h. - increased ED for mice by 200 times;

10 ¹¹ w.h. - increased ED for mice by 2000 times;

Thus, the following experimental groups of animals were obtained:

1) Ad26-GP-EBOV, 10 ⁹ p.p. / mouse, 20 mice;

2) Ad26-GP-EBOV, 10 ¹⁰ p.p. / mouse, 20 mice;

3) Ad26-GP-EBOV, 10 ¹¹ p.p. / mouse, 20 mice;

4) Ad26-GPΔmuc-EBOV, 10 ⁹ p.p. / mouse, 20 mice;

5) Ad26-GPΔmuc-EBOV, 10 ¹⁰ p.p. / mouse, 20 mice;

6) Ad26-GPΔmuc-EBOV, 10 ¹¹ p.p. / mouse, 20 mice;

7) Ad26-GP-BDBV, 10 ⁹ p.p. / mouse, 20 mice;

8) Ad26-GP-BDBV, 10 ¹⁰ p.p. / mouse, 20 mice;

9) Ad26-GP-BDBV, 10 ¹¹ p.p. / mouse, 20 mice;

10) Ad26-GPΔmuc-BDBV, 10 ⁹ p.p. / mouse, 20 mice;

11) Ad26-GPΔmuc-BDBV, 10 ¹⁰ p.p. / mouse, 20 mice;

12) Ad26-GPΔmuc-BDBV, 10 ¹¹ p.p. / mouse, 20 mice;

13) Ad26-GP-SUDV, 10 ⁹ p.p. / mouse, 20 mice;

14) Ad26-GP-SUDV, 10 ¹⁰ p.p. / mouse, 20 mice;

15) Ad26-GP-SUDV, 10 ¹¹ p.p. / mouse, 20 mice;

16) Ad26-GPΔmuc-SUDV, 10 ⁹ p.p. / mouse, 20 mice;

17) Ad26-GPΔmuc-SUDV, 10 ¹⁰ p.p. / mouse, 20 mice;

18) Ad26-GPΔmuc-SUDV, 10 ¹¹ p.p. / mouse, 20 mice;

19) Ad26-GP-MARV, 10 ⁹ p.p. / mouse, 20 mice;

20) Ad26-GP-MARV, 10 ¹⁰ p.p. / mouse, 20 mice;

21) Ad26-GP-MARV, 10 ¹¹ p.p. / mouse, 20 mice;

22) Ad26-GPΔmuc-MARV, 10 ⁹ p.p. / mouse, 20 mice;

23) Ad26-GPΔmuc-MARV, 10 ¹⁰ p.p. / mouse, 20 mice;

24) Ad26-GPΔmuc-MARV, 10 ¹¹ p.p. / mouse, 20 mice;

25) Ad5-GP-EBOV, 10 ⁹ p.p. / mouse, 20 mice;

26) Ad5-GP-EBOV, 10 ¹⁰ vp / mouse, 20 mice;

27) Ad5-GP-EBOV, 10 ¹¹ p.p. / mouse, 20 mice;

28) Ad5-GPΔmuc-EBOV, 10 ⁹ p.p. / mouse, 20 mice;

29) Ad5-GPΔmuc-EBOV, 10 ¹⁰ p.p. / mouse, 20 mice;

30) Ad5-GPΔmuc-EBOV, 10 ¹¹ p.p. / mouse, 20 mice;

31) Ad5-GP-BDBV, 10 ⁹ p.p. / mouse, 20 mice;

32) Ad5-GP-BDBV, 10 ¹⁰ vp / mouse, 20 mice;

33) Ad5-GP-BDBV, 10 ¹¹ p.p. / mouse, 20 mice;

34) Ad5-GPΔmuc-BDBV, 10 ⁹ p.p. / mouse, 20 mice;

35) Ad5-GPΔmuc-BDBV, 10 ¹⁰ p.p. / mouse, 20 mice;

36) Ad5-GPΔmuc-BDBV, 10 ¹¹ p.p. / mouse, 20 mice;

37) Ad5-GP-SUDV, 10 ⁹ p.p. / mouse, 20 mice;

38) Ad5-GP-SUDV, 10 ¹⁰ p.p. / mouse, 20 mice;

39) Ad5-GP-SUDV, 10 ¹¹ p.p. / mouse, 20 mice;

40) Ad5-GPΔmuc-SUDV, 10 ⁹ p.p. / mouse, 20 mice;

41) Ad5-GPΔmuc-SUDV, 10 ¹⁰ p.p. / mouse, 20 mice;

42) Ad5-GPΔmuc-SUDV, 10 ¹¹ p.p. / mouse, 20 mice;

43) Ad5-GP-MARV, 10 ⁹ p.p. / mouse, 20 mice;

44) Ad5-GP-MARV, 10 ¹⁰ p.p. / mouse, 20 mice;

45) Ad5-GP-MARV, 10 ¹¹ p.p. / mouse, 20 mice;

46) Ad5-GPΔmuc-MARV, 10 ⁹ p.p. / mouse, 20 mice;

47) Ad5-GPΔmuc-MARV, 10 ¹⁰ p.p. / mouse, 20 mice;

48) Ad5-GPΔmuc-MARV, 10 ¹¹ p.p. / mouse, 20 mice;

49) VSV-GP-EBOV, 10 ⁹ p.p. / mouse, 20 mice;

50) VSV -GP-EBOV, 10 ¹⁰ p.p. / mouse, 20 mice;

51) VSV -GP-EBOV, 10 ¹¹ p.p. / mouse, 20 mice;

52) VSV -GPΔmuc-EBOV, 10 ⁹ p.p. / mouse, 20 mice;

53) VSV -GPΔmuc-EBOV, 10 ¹⁰ p.p. / mouse, 20 mice;

54) VSV -GPΔmuc-EBOV, 10 ¹¹ p.p. / mouse, 20 mice;

55) VSV -GP-BDBV, 10 ⁹ p.p. / mouse, 20 mice;

56) VSV -GP-BDBV, 10 ¹⁰ vp / mouse, 20 mice;

57) VSV -GP-BDBV, 10 ¹¹ p.p. / mouse, 20 mice;

58) VSV -GPΔmuc-BDBV, 10 ⁹ p.p. / mouse, 20 mice;

59) VSV -GPΔmuc-BDBV, 10 ¹⁰ p.p. / mouse, 20 mice;

60) VSV -GPΔmuc-BDBV, 10 ¹¹ p.p. / mouse, 20 mice;

61) VSV -GP-SUDV, 10 ⁹ p.p. / mouse, 20 mice;

62) VSV -GP-SUDV, 10 ¹⁰ p.p. / mouse, 20 mice;

63) VSV -GP-SUDV, 10 ¹¹ p.p. / mouse, 20 mice;

64) VSV -GPΔmuc-SUDV, 10 ⁹ p.p. / mouse, 20 mice;

65) VSV -GPΔmuc-SUDV, 10 ¹⁰ p.p. / mouse, 20 mice;

66) VSV -GPΔmuc-SUDV, 10 ¹¹ p.p. / mouse, 20 mice;

67) VSV -GP-MARV, 10 ⁹ p.p. / mouse, 20 mice;

68) VSV -GP-MARV, 10 ¹⁰ p.p. / mouse, 20 mice;

69) VSV -GP-MARV, 10 ¹¹ p.p. / mouse, 20 mice;

70) VSV -GPΔmuc-MARV, 10 ⁹ p.p. / mouse, 20 mice;

71) VSV -GPΔmuc-MARV, 10 ¹⁰ p.p. / mouse, 20 mice;

72) VSV -GPΔmuc-MARV, 10 ¹¹ p.p. / mouse, 20 mice;

73) placebo (buffered solution), 20 mice.

Clinical examination of each animal was carried out daily for 14 days, registering signs of intoxication and the number of dead animals.

The following parameters of the functional state of laboratory animals were recorded: activity, movement, appearance, condition of hair, eyes, ears, teeth, limbs. Physiological functions: respiration, salivation, saliva, urine, excretion. - Throughout the experiment, all the animals remained alive. In all groups, the animals looked healthy, actively ate food, adequately responded to stimuli, and showed research interest. The coat is dense, even and shiny, tightly adhered to the surface of the body, no hair loss or brittleness was found. Muscle tone was not characterized by increased excitability. Auricles without crusts, not inflamed, twitching is not noticed. The teeth are of normal color, no breakages. The mice were of average fatness and did not suffer from exhaustion. The abdominal area is not enlarged. Breathing is even, unobstructed. Salivation is normal. The frequency of urination, urine color, gastrointestinal parameters, muscle tone, reflexes corresponded to the physiological norm. The behavior of the experimental animals did not differ from the control ones.

On the 14th day from the beginning of the experiment, the planned euthanasia of mice was carried out by the method of dislocation of the cervical vertebrae. During the study, animals in serious condition with signs of imminent death were not observed, and there was no death of animals.

Complete necropsy of all animals was performed. During necropsy, the external state of the body, internal surfaces and passages, the cranial cavity, chest, abdominal and pelvic cavities with organs and tissues located in them, the neck with organs and tissues, and the musculoskeletal system were examined.

Macroscopic examination did not reveal the effect of the agent on the state of the internal organs of mice; no differences were found between the control and experimental groups. There were no statistically significant differences in the mass of organs between the experimental and control groups. The weight gain of animals in the experimental and control groups did not differ.

Thus, in the course of the work carried out, the safety of the developed agents was determined by assessing the acute toxicity. Based on the data obtained, it can be concluded that all the developed immunobiological agents are safe.

Example 6.

Testing the immunogenicity of variants of an immunobiological agent containing the Ebola virus glycoprotein gene or its derivatives.

The purpose of this experiment was to determine the effectiveness of immunization with variants of the developed immunobiological agent to assess the humoral immune response. The intensity of the humoral immune response in immunized animals was assessed by the production of glycoprotein-specific IgG antibodies in the blood serum.

The experiment used mammals - mice of the BALB / c line, females 18g. All animals were divided into groups of 7 animals, which were injected intramuscularly with the developed immunobiological agent at a dose of 10 ¹⁰ viral particles / mouse. Control animals were injected with recombinant viruses (Ad26-null, Ad5-null, VSV-null) that did not contain the GP Ebola virus gene or buffer solution.

Thus, the following groups of animals were obtained:

1) Ad26-GP-EBOV;

2) Ad26-GPΔmuc-EBOV;

3) Ad26-null;

4) Ad5-GP-EBOV;

5) Ad5-GPΔmuc-EBOV;

6) Ad5-null;

7) VSV-GP-EBOV;

8) VSV-GPΔmuc-EBOV;

9) VSV-null;

10) Buffer solution.

Evaluation of the titer of antibodies to GP Ebola virus in the peripheral blood serum of the test animals was carried out on the 21st day after immunization by ELISA.

For enzyme immunoassay, antigen (GP Ebola virus) diluted in carbonate-bicarbonate buffer (CBB) (pH 9.6) was applied to a 96-well plate at 100 ng per well. The plate was incubated at + 4 ^° C overnight.

The next day, the plate was washed with a TPSB solution (Tween 20 - phosphate-buffered saline: for 1 liter of distilled water 8.00 g NaCl, 0.20 g KCl, 1.44 g Na ₂ HPO ₄ , 0.24 g KH ₂ PO ₄ , Tween 20 0.1%) in a volume of 230 μl per well 5 times. Then, to get rid of nonspecific binding, the plate was treated with ELISA buffer (XEMA, Russia), in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour. The plate was washed with a TPSB solution in a volume of 230 μl per well 4 times.

Then added serum of peripheral blood of mice in various dilutions in a solution of ELISA buffer and again incubated for an hour under the same conditions.

Then the plate was washed with a TPSB solution in a volume of 200 μl per well 5 times to remove unbound antibodies. Then added secondary antibodies specific to mouse immunoglobulins conjugated with horseradish peroxidase, diluted in ELISA buffer in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour.

Then the plate was washed again with TFSB solution 5 times. After that, TMB was added to the wells in a volume of 100 μl per well and kept in the dark until the solution acquired a blue color for 15 minutes. Next, the reaction was stopped by adding 50 μl of 4M sulfuric acid, and the optical density was measured on a plate spectrophotometer at a light wavelength of 450 nm.

The results of the experiment are presented in table 1.

Table 1. The titer of antibodies to GP Ebola virus in the peripheral blood sera of test animals on the 21st day after immunization (geometric mean of the antibody titer).

Table 1

No. Animal group name Antibody titer 1 Ad26-GP-EBOV 220.8 2 Ad26-GPΔmuc-EBOV 243.8 3 Ad26-null 0 4 Ad5-GP-EBOV 7801.7 5 Ad5-GPΔmuc-EBOV 8613.8 6 Ad5-null 0 7 VSV-GP-EBOV 7066.2 eight VSV-GPΔmuc-EBOV 8613.8 nine VSV-null 0 ten Buffer solution 0

As can be seen from the presented results, all tested variants of the developed immunobiological agent ensure the development of a humoral immune response to the Ebola virus glycoprotein.

Example 7.

Testing the immunogenicity of variants of an immunobiological agent containing the Bundibugyo virus glycoprotein gene or its derivatives.

The purpose of this experiment was to determine the effectiveness of immunization with variants of the developed immunobiological agent to assess the humoral immune response. The intensity of the humoral immune response in immunized animals was assessed by the production of glycoprotein-specific IgG antibodies in the blood serum.

The experiment used mammals - mice of the BALB / c line, females 18g. All animals were divided into groups of 7 animals, which were injected intramuscularly with the developed immunobiological agent at a dose of 10 ¹⁰ viral particles / mouse. Control animals were injected with recombinant viruses (Ad26-null, Ad5-null, VSV-null) that did not contain the GP Bundibugyo virus gene or buffer solution.

Thus, the following groups of animals were obtained:

1) Ad26-GP-BDBV;

2) Ad26-GPΔmuc-BDBV;

3) Ad26-null;

4) Ad5-GP- BDBV;

5) Ad5-GPΔmuc-BDBV;

6) Ad5-null;

7) Buffer solution.

Evaluation of the titer of antibodies to GP Bundibugyo virus in the serum of the peripheral blood of the test animals was carried out on the 21st day after immunization by ELISA.

For enzyme immunoassay, antigen (GP Bundibugyo virus) diluted in carbonate-bicarbonate buffer (CBB) (pH 9.6) was plated onto a 96-well plate at 100 ng per well. The plate was incubated at + 4 ^° C overnight.

The next day, the plate was washed with a TPSB solution (Tween 20 - phosphate-buffered saline: for 1 liter of distilled water 8.00 g NaCl, 0.20 g KCl, 1.44 g Na ₂ HPO ₄ , 0.24 g KH ₂ PO ₄ , Tween 20 0.1%) in a volume of 230 μl per well 5 times. Then, to get rid of nonspecific binding, the plate was treated with ELISA buffer (XEMA, Russia), in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour. The plate was washed with a TPSB solution in a volume of 230 μl per well 4 times.

Then added serum of peripheral blood of mice in various dilutions in a solution of ELISA buffer and again incubated for an hour under the same conditions.

Then the plate was washed with a TPSB solution in a volume of 200 μl per well 5 times to remove unbound antibodies. Then added secondary antibodies specific to mouse immunoglobulins conjugated with horseradish peroxidase, diluted in ELISA buffer in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour.

Then the plate was washed again with TFSB solution 5 times. After that, TMB was added to the wells in a volume of 100 μl per well and kept in the dark until the solution acquired a blue color for 15 minutes. Next, the reaction was stopped by adding 50 μl of 4M sulfuric acid, and the optical density was measured on a plate spectrophotometer at a light wavelength of 450 nm.

The results of the experiment are presented in table 2.

Table 2. The titer of antibodies to GP Bundibugyo virus in the peripheral blood sera of the test animals on the 21st day after immunization (geometric mean of the antibody titer).

table 2

No. Animal group name Antibody titer 1 Ad26-GP-BDBV 220.8 2 Ad26-GPΔmuc- BDBV 441.6 3 Ad26-null 0 4 Ad5-GP- BDBV 2898.3 5 Ad5-GPΔmuc- BDBV 1076.7 6 Ad5-null 0 7 Buffer solution 0

As can be seen from the presented results, all tested variants of the developed immunobiological agent ensure the development of a humoral immune response to the Bundibugyo virus glycoprotein.

Example 8.

Testing the immunogenicity of variants of an immunobiological agent containing the Sudan virus glycoprotein gene or its derivatives.

The purpose of this experiment was to determine the effectiveness of immunization with variants of the developed immunobiological agent to assess the humoral immune response. The intensity of the humoral immune response in immunized animals was assessed by the production of glycoprotein-specific IgG antibodies in the blood serum.

The experiment used mammals - mice of the BALB / c line, females 18g. All animals were divided into groups of 7 animals, which were injected intramuscularly with the developed immunobiological agent at a dose of 10 ¹⁰ viral particles / mouse. Control animals were injected with recombinant viruses (Ad26-null, Ad5-null, VSV-null) that did not contain the GP Sudan virus gene or buffer solution.

Thus, the following groups of animals were obtained:

1) Ad26-GP-SUDV;

2) Ad26-GPΔmuc-SUDV;

3) Ad26-null;

4) Ad5-GP- SUDV;

5) Ad5-GPΔmuc-SUDV;

6) Ad5-null;

7) VSV-GP- SUDV;

8) VSV-GPΔmuc-SUDV;

9) VSV-null;

10) Buffer solution.

Evaluation of the titer of antibodies to GP Sudan virus in the serum of the peripheral blood of the test animals was carried out on the 21st day after immunization by the ELISA method.

For enzyme immunoassay, antigen (GP Sudan virus) diluted in carbonate-bicarbonate buffer (CBB) (pH 9.6) was applied to a 96-well plate at 100 ng per well. The plate was incubated at + 4 ^° C overnight.

The next day, the plate was washed with a TPSB solution (Tween 20 - phosphate-buffered saline: for 1 liter of distilled water 8.00 g NaCl, 0.20 g KCl, 1.44 g Na ₂ HPO ₄ , 0.24 g KH ₂ PO ₄ , Tween 20 0.1%) in a volume of 230 μl per well 5 times. Then, to get rid of nonspecific binding, the plate was treated with ELISA buffer (XEMA, Russia), in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour. The plate was washed with a TPSB solution in a volume of 230 μl per well 4 times.

Then added serum of peripheral blood of mice in various dilutions in a solution of ELISA buffer and again incubated for an hour under the same conditions.

Then the plate was washed with a TPSB solution in a volume of 200 μl per well 5 times to remove unbound antibodies. Then added secondary antibodies specific to mouse immunoglobulins conjugated with horseradish peroxidase, diluted in ELISA buffer in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour.

Then the plate was washed again with TFSB solution 5 times. After that, TMB was added to the wells in a volume of 100 μl per well and kept in the dark until the solution acquired a blue color for 15 minutes. Next, the reaction was stopped by adding 50 μl of 4M sulfuric acid, and the optical density was measured on a plate spectrophotometer at a light wavelength of 450 nm.

The results of the experiment are presented in table 3.

Table 3.

Antibody titer to GP Sudan virus in peripheral blood sera of test animals on day 21 after immunization (geometric mean of antibody titer).

Table 3

No. Animal group name Antibody titer 1 Ad26-GP- SUDV 220.8 2 Ad26-GPΔmuc- SUDV 181.1 3 Ad26-null 0 4 Ad5-GP- SUDV 34455.0 5 Ad5-GPΔmuc- SUDV 4306.9 6 Ad5-null 0 7 VSV-GP- SUDV 883.3 eight VSV-GPΔmuc- SUDV 800.0 nine VSV-null 0 ten Buffer solution 0

As can be seen from the presented results, all tested variants of the developed immunobiological agent ensure the development of a humoral immune response to the Sudan virus glycoprotein.

Example 9.

Testing the immunogenicity of variants of an immunobiological agent containing the gene of the Marburg virus glycoprotein or its derivatives.

The purpose of this experiment was to determine the effectiveness of immunization with variants of the developed immunobiological agent to assess the humoral immune response. The intensity of the humoral immune response in immunized animals was assessed by the production of glycoprotein-specific IgG antibodies in the blood serum.

The experiment used mammals - mice of the BALB / c line, females 18g. All animals were divided into groups of 7 animals, which were injected intramuscularly with the developed immunobiological agent at a dose of 10 ¹⁰ viral particles / mouse. Control animals were injected with recombinant viruses (Ad26-null, Ad5-null, VSV-null) that did not contain the GP Marburg virus gene or buffer solution.

Thus, the following groups of animals were obtained:

1) Ad26-GP-MARV;

2) Ad26-GPΔmuc-MARV;

3) Ad26-null;

4) Ad5-GP- MARV;

5) Ad5-GPΔmuc-MARV;

6) Ad5-null;

7) VSV-GP- MARV;

8) VSV-GPΔmuc-MARV;

9) VSV-null;

10) Buffer solution.

Evaluation of the titer of antibodies to GP Marburg virus in the peripheral blood serum of the test animals was carried out on the 21st day after immunization by the ELISA method.

For enzyme immunoassay, antigen (GP Marburg virus) diluted in carbonate-bicarbonate buffer (CBB) (pH 9.6) was applied to a 96-well plate at 100 ng per well. The plate was incubated at + 4 ^° C overnight.

The next day, the plate was washed with a TPSB solution (Tween 20 - phosphate-buffered saline: for 1 liter of distilled water 8.00 g NaCl, 0.20 g KCl, 1.44 g Na ₂ HPO ₄ , 0.24 g KH ₂ PO ₄ , Tween 20 0.1%) in a volume of 230 μl per well 5 times. Then, to get rid of nonspecific binding, the plate was treated with ELISA buffer (XEMA, Russia), in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour. The plate was washed with a TPSB solution in a volume of 230 μl per well 4 times.

Then added serum of peripheral blood of mice in various dilutions in a solution of ELISA buffer and again incubated for an hour under the same conditions.

Then the plate was washed with a TPSB solution in a volume of 200 μl per well 5 times to remove unbound antibodies. Then added secondary antibodies specific to mouse immunoglobulins conjugated with horseradish peroxidase, diluted in ELISA buffer in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour.

Then the plate was washed again with TFSB solution 5 times. After that, TMB was added to the wells in a volume of 100 μl per well and kept in the dark until the solution acquired a blue color for 15 minutes. Next, the reaction was stopped by adding 50 μl of 4M sulfuric acid, and the optical density was measured on a plate spectrophotometer at a light wavelength of 450 nm.

The results of the experiment are presented in table 4.

Table 4. The titer of antibodies to GP Marburg virus in the peripheral blood sera of the test animals on the 21st day after immunization (geometric mean value of the antibody titer).

Table 4

No. Animal group name Antibody titer 1 Ad26-GP- MARV 243.8 2 Ad26-GPΔmuc- MARV 243.8 3 Ad26-null 0 4 Ad5-GP- MARV 975.2 5 Ad5-GPΔmuc- MARV 2377.6 6 Ad5-null 0 7 VSV-GP- MARV 656.3 eight VSV-GPΔmuc- MARV 883.3 nine VSV-null 0 ten Buffer solution 0

As can be seen from the presented results, all tested variants of the developed immunobiological agent ensure the development of a humoral immune response to the Marburg virus glycoprotein.

Example 10.

Testing the effectiveness of the developed immunobiological agents by assessing their ability to induce virus-neutralizing antibodies to filoviruses in mammals.

The experiment used mammals - mice of the BALB / c line, females 18g. All animals were divided into groups of 5 animals, which were injected intramuscularly twice with an interval of 21 days with a mixture of various variants of immunobiological agents.

The following groups of animals were formed:

1) Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV /

Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV;

2) Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV /

Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV;

3) VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV /

VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV;

4) Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV /

Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV;

5) Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV /

Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV;

6) Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV /

VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV;

7) VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV /

Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV;

8) VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV /

Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV;

9) Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV /

VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV;

10) Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV /

VSV-GPΔmuc-EBOV, VSV-GPΔmuc-BDBV, VSV-GPΔmuc-SUDV; VSV-GPΔmuc-MARV;

11) VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV /

Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV;

12) VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc-SUDV; VSV - GPΔmuc -MARV /

Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV;

13) Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV /

VSV-GPΔmuc -EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV, VSV-GPΔmuc -MARV;

14) Buffer solution / Buffer solution.

Twenty-one days after the last immunization, the animals were bled and then serum was isolated.

To carry out the virus-neutralization reaction, the VeroE6 cell line (African green monkey kidney cells) was used. The cells were seeded in 12-well plates at a concentration of 5 * 10 ⁵ cells per well 24 hours before the reaction. The cells were incubated in a CO ₂ incubator at t = 37ºC and 100% humidity.

The dose of pseudotyped vesicular stomatitis virus was taken at the rate of 100 pfu / well. The titer of the pseudotyped vesicular stomatitis virus preparation was previously measured in plaque-forming units (PFU) per 1 ml of suspension. Using 10-fold dilutions, a solution of pseudotyped vesicular stomatitis virus with a concentration of 100 pfu / 100 μl was prepared. The virus was diluted in a buffer containing 10 mM Tris-HCl, 1 mM EDTA, 10% sucrose. The prepared virus solution was diluted and stored at -70 ° C. The studied inactivated sera were diluted in phosphate buffered saline before adding viral particles. The first dilution was 1:20, the total volume in each dilution was 100 μL. Then, the same number of viral particles of pseudotyped vesicular stomatitis virus was added to each dilution in a volume of 100 μl. To form the AG + AT complex, a mixture of viral particles and serum was incubated at t = 37ºC for 60 min and then added in a volume of 200 μl per well to VeroE6 cells in a 12-well plate. Each dilution was repeated three times. As a control virus, dilutions of a pseudotyped virus with a concentration of 100 PFU / 100 μl were used without the addition of serum. The cells were incubated at t = 37ºC for 2-3 hours. After incubation, the medium with the AG + AT complex was removed from the wells, then 3 ml of a coating containing 0.4% agarose diluted in growth medium DMEM with 5% fetal calf serum was added and left for 48-96 hours in an incubator with 5% CO ₂ at t = 37ºC and 100% humidity.

The results were taken into account after 48-96 hours. Viral plaques were counted at each dilution. The titer of virus-neutralizing antibodies was taken as the maximum dilution of serum, giving a decrease in viral plaques by more than 50% compared to the control virus.

The experimental results are presented in tables 5,6,7,8.

Table 5. The titer of neutralizing antibodies to VSV-GP-EBOV in the peripheral blood sera of test animals on the 21st day after immunization (geometric mean of the antibody titer).

Table 5

No. Animal group name Antibody titer 1 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 139.3 2 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV 367.6 3 VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV 367.6 4 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 422.2 5 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 367.6 6 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV; 367.6 7 VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV 422.2 eight VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 640.0 nine Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV-GP-SUDV; VSV -GP-MARV; 640.0 ten Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GPΔmuc-EBOV, VSV-GPΔmuc-BDBV, VSV-GPΔmuc-SUDV; VSV-GPΔmuc-MARV; 320.0 eleven VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 367.6 12 VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc-SUDV; VSV - GPΔmuc -MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 485.0 13 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV; VSV-GPΔmuc -MARV; 557.2 fourteen Buffer solution / Buffer solution 0

Table 6. The titer of neutralizing antibodies to VSV-GP-BDBV in the peripheral blood sera of test animals on the 21st day after immunization (geometric mean of the antibody titer).

Table 6

No. Animal group name Antibody titer 1 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 139.3 2 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV 367.6 3 VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV 367.6 4 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 422.2 5 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 367.6 6 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV; 367.6 7 VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV 422.2 eight VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 640.0 nine Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV-GP-SUDV; VSV -GP-MARV; 640.0 ten Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GPΔmuc-EBOV, VSV-GPΔmuc-BDBV, VSV-GPΔmuc-SUDV; VSV-GPΔmuc-MARV; 320.0 eleven VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 422.2 12 VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc-SUDV; VSV - GPΔmuc -MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 557.2 13 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV; VSV-GPΔmuc -MARV; 557.2 fourteen Buffer solution / Buffer solution 0

Table 7. The titer of neutralizing antibodies to VSV-GP-SUDV in the peripheral blood sera of the test animals on the 21st day after immunization (geometric mean of the antibody titer).

Table 7

No. Animal group name Antibody titer 1 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 160.0 2 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV 320.0 3 VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV 367.6 4 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 367.6 5 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 320.0 6 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV; 320.0 7 VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV 422.2 eight VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 557.2 nine Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV-GP-SUDV; VSV -GP-MARV; 640.0 ten Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GPΔmuc-EBOV, VSV-GPΔmuc-BDBV, VSV-GPΔmuc-SUDV; VSV-GPΔmuc-MARV; 278.6 eleven VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 320.0 12 VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc-SUDV; VSV - GPΔmuc -MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 557.2 13 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV; VSV-GPΔmuc -MARV; 557.2 fourteen Buffer solution / Buffer solution 0

Table 8. The titer of neutralizing antibodies to VSV-GP-MARV in the peripheral blood sera of the test animals on the 21st day after immunization (geometric mean of the antibody titer).

Table 8

No. Animal group name Antibody titer 1 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 139.3 2 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV 422.2 3 VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV 367.6 4 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 557.2 5 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 367.6 6 Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV -GP-SUDV; VSV -GP-MARV; 422.2 7 VSV-GP-EBOV, VSV-GP-BDBV, VSV-GP-SUDV; VSV-GP-MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV 422.2 eight VSV-GP-EBOV, VSV-GP-BDBV, VSV-GP-SUDV; VSV -GP-MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 735.2 nine Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GP-EBOV, VSV-GP-BDBV, VSV-GP-SUDV; VSV -GP-MARV; 640.0 ten Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GPΔmuc-EBOV, VSV-GPΔmuc-BDBV, VSV-GPΔmuc-SUDV; VSV-GPΔmuc-MARV; 485.0 eleven VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad26-GP-EBOV, Ad26-GP-BDBV, Ad26-GP-SUDV; Ad26-GP-MARV; 422.2 12 VSV-GPΔmuc-EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc-SUDV; VSV - GPΔmuc -MARV / Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV; 640.0 13 Ad5-GP-EBOV, Ad5-GP-BDBV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -BDBV, VSV-GPΔmuc -SUDV; VSV-GPΔmuc -MARV; 640.0 fourteen Buffer solution / Buffer solution 0

Based on the data obtained, it can be concluded that immunization of mammals with the developed immunobiological means leads to the formation of virus neutralizing antibodies to filoviruses.

Example 11.

A method of using immunobiological agents by introducing into the mammalian body a composition consisting of the developed agents for inducing an immune response to filoviruses.

The experiment used mammals - mice of the BALB / c line, females 18g. All animals were divided into groups of 5 animals, which were injected intramuscularly twice with an interval of 21 days with a mixture of various variants of immunobiological agents.

The following groups of animals were formed:

1) Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV /

Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV;

2) Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV /

Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV;

3) VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV /

VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV;

4) Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV /

Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV;

5) Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV /

Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV;

6) Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV /

VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV;

7) VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV /

Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV;

8) VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV /

Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV;

9) Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV /

VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV;

10) Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV /

Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV;

11) Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV /

Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV;

12) Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV /

VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV;

13) VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV /

Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV;

14) VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV /

Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV;

15) Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV /

VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV;

16) Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV /

Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV;

17) Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV /

Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV;

18) Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV /

VSV- GP -EBOV, VSV - GP -SUDV; VSV - GP -MARV;

19) VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV /

Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV;

20) VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV /

Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV;

21) Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV /

VSV- GP -EBOV, VSV - GP -SUDV; VSV - GP -MARV;

22) Buffer solution / Buffer solution.

Twenty-one days after the last immunization, the animals were bled and then serum was isolated.

To carry out the virus-neutralization reaction, the VeroE6 cell line (African green monkey kidney cells) was used. The cells were seeded in 12-well plates at a concentration of 5 * 10 ⁵ cells per well 24 hours before the reaction. The cells were incubated in a CO ₂ incubator at t = 37ºC and 100% humidity.

The dose of pseudotyped vesicular stomatitis virus was taken at the rate of 100 pfu / well. The titer of the pseudotyped vesicular stomatitis virus preparation was previously measured in plaque-forming units (PFU) per 1 ml of suspension. Using 10-fold dilutions, a solution of pseudotyped vesicular stomatitis virus with a concentration of 100 pfu / 100 μl was prepared. The virus was diluted in a buffer containing 10 mM Tris-HCl, 1 mM EDTA, 10% sucrose. The prepared virus solution was diluted and stored at -70 ° C. The studied inactivated sera were diluted in phosphate buffered saline before adding viral particles. The first dilution was 1:20, the total volume in each dilution was 100 μL. Then, the same number of viral particles of pseudotyped vesicular stomatitis virus was added to each dilution in a volume of 100 μl. For the formation of the AG + AT complex, a mixture of viral particles and serum was incubated at t = 37ºC for 60 min and then added in a volume of 200 μl per well to VeroE6 cells in a 12-well plate. Each dilution was repeated three times. Dilutions of a pseudotyped virus with a concentration of 100 pfu / 100 μl without adding serum were used as a control virus. The cells were incubated at t = 37ºC for 2-3 hours. After incubation, the medium with the AG + AT complex was removed from the wells, then 3 ml of a coating containing 0.4% agarose diluted in growth medium DMEM with 5% fetal calf serum was added and left for 48-96 hours in an incubator with 5% CO ₂ at t = 37ºC and 100% humidity.

The results were taken into account after 48-96 hours. Viral plaques were counted at each dilution. The titer of virus-neutralizing antibodies was taken as the maximum dilution of serum, giving a decrease in viral plaques by more than 50% compared to the control virus.

The experimental results are presented in tables 9, 10, 11, 12.

Table 9. The titer of neutralizing antibodies to VSV-GP-EBOV in the peripheral blood sera of the test animals on the 21st day after immunization (geometric mean of the antibody titer).

Table 9

No. Animal group name Antibody titer 1 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV; 121.3 2 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV 320.0 3 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV 367.6 4 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV; 367.6 5 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV; 320.0 6 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV; 320.0 7 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV 367.6 eight VSV-GP-EBOV, VSV-GP-SUDV; VSV -GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV; 640.0 nine Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV; 557.2 ten Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GPΔmuc -EBOV, Ad5-GPΔmuc -SUDV; Ad5-GPΔmuc -MARV; 278.6 eleven Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV; 278.6 12 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV; 320.0 13 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GPΔmuc -EBOV, Ad26-GPΔmuc -SUDV; Ad26-GPΔmuc -MARV; 320.0 fourteen VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad5-GPΔmuc -EBOV, Ad5-GPΔmuc -SUDV; Ad5-GPΔmuc -MARV; 557.2 15 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV; 557.2 16 Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV / Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV; 367.6 17 Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV / Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV; 278.6 eighteen Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV / VSV-GP -EBOV, VSV-GP -SUDV; VSV - GP -MARV; 320.0 19 VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV; 320.0 twenty VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV; 557.2 21 Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV / VSV-GP -EBOV, VSV-GP -SUDV; VSV - GP -MARV; 485.0 22 Buffer solution / Buffer solution 0

Table 10. The titer of neutralizing antibodies to VSV-GP-BDBV in the peripheral blood sera of test animals on the 21st day after immunization (geometric mean of the antibody titer).

Table 10

No. Animal group name Antibody titer 1 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV; 52.8 2 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV 121.3 3 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV 139.3 4 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV; 139.3 5 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV; 105.6 6 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV; 160.0 7 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV 121.3 eight VSV-GP-EBOV, VSV-GP-SUDV; VSV -GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV; 160.0 nine Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV; 139.3 ten Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GPΔmuc -EBOV, Ad5-GPΔmuc -SUDV; Ad5-GPΔmuc -MARV; 121.3 eleven Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV; 91.9 12 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV; 121.3 13 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GPΔmuc -EBOV, Ad26-GPΔmuc -SUDV; Ad26-GPΔmuc -MARV; 91.9 fourteen VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad5-GPΔmuc -EBOV, Ad5-GPΔmuc -SUDV; Ad5-GPΔmuc -MARV; 139.3 15 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV; 121.3 16 Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV / Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV; 105.6 17 Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV / Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV; 91.9 eighteen Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV / VSV-GP -EBOV, VSV-GP -SUDV; VSV - GP -MARV; 139.3 19 VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV; 91.9 twenty VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV; 121.3 21 Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV / VSV-GP -EBOV, VSV-GP -SUDV; VSV - GP -MARV; 121.3 22 Buffer solution / Buffer solution 0

Table 11. Titer of neutralizing antibodies to VSV-GP-SUDV in the peripheral blood sera of test animals on day 21 after immunization (geometric mean of antibody titer).

Table 11

No. Animal group name Antibody titer 1 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV; 139.3 2 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV 367.6 3 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV 320.0 4 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV; 367.6 5 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV; 367.6 6 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV; 367.6 7 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV 422.2 eight VSV-GP-EBOV, VSV-GP-SUDV; VSV -GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV; 485.0 nine Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV; 557.2 ten Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GPΔmuc -EBOV, Ad5-GPΔmuc -SUDV; Ad5-GPΔmuc -MARV; 320.0 eleven Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV; 320.0 12 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV; 367.6 13 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GPΔmuc -EBOV, Ad26-GPΔmuc -SUDV; Ad26-GPΔmuc -MARV; 422.2 fourteen VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad5-GPΔmuc -EBOV, Ad5-GPΔmuc -SUDV; Ad5-GPΔmuc -MARV; 422.2 15 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV; 422.2 16 Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV / Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV; 320.0 17 Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV / Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV; 367.6 eighteen Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV / VSV-GP -EBOV, VSV-GP -SUDV; VSV - GP -MARV; 320.0 19 VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV; 367.6 twenty VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV; 422.2 21 Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV / VSV-GP -EBOV, VSV-GP -SUDV; VSV - GP -MARV; 485.0 22 Buffer solution / Buffer solution 0

Table 12. The titer of neutralizing antibodies to VSV-GP-MARV in the peripheral blood sera of test animals on the 21st day after immunization (geometric mean of the antibody titer).

Table 12

No. Animal group name Antibody titer 1 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV; 160.0 2 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV 367.6 3 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV 422.2 4 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV; 557.2 5 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV; 367.6 6 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV; 422.2 7 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV 422.2 eight VSV-GP-EBOV, VSV-GP-SUDV; VSV -GP-MARV / Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV; 735.2 nine Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV; 557.2 ten Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / Ad5-GPΔmuc -EBOV, Ad5-GPΔmuc -SUDV; Ad5-GPΔmuc -MARV; 485.0 eleven Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV; 278.6 12 Ad26-GP-EBOV, Ad26-GP-SUDV; Ad26-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV; 367.6 13 VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad26-GPΔmuc -EBOV, Ad26-GPΔmuc -SUDV; Ad26-GPΔmuc -MARV; 367.6 fourteen VSV-GP-EBOV, VSV -GP-SUDV; VSV -GP-MARV / Ad5-GPΔmuc -EBOV, Ad5-GPΔmuc -SUDV; Ad5-GPΔmuc -MARV; 640.0 15 Ad5-GP-EBOV, Ad5-GP-SUDV; Ad5-GP-MARV / VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV; 485.0 16 Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV / Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV; 557.2 17 Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV / Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV; 320.0 eighteen Ad26-GPAmuc -EBOV, Ad26-GPAmuc -SUDV; Ad26-GPΔmuc -MARV / VSV-GP -EBOV, VSV-GP -SUDV; VSV - GP -MARV; 367.6 19 VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad26-GP -EBOV, Ad26-GP -SUDV; Ad26-GP-MARV; 367.6 twenty VSV-GPΔmuc -EBOV, VSV-GPΔmuc -SUDV; VSV - GPΔmuc -MARV / Ad5-GP -EBOV, Ad5-GP -SUDV; Ad5-GP-MARV; 640.0 21 Ad5-GPAmuc -EBOV, Ad5-GPAmuc -SUDV; Ad5-GPΔmuc -MARV / VSV-GP -EBOV, VSV-GP -SUDV; VSV - GP -MARV; 367.6 22 Buffer solution / Buffer solution 0

Based on the data obtained, it can be concluded that immunization of mammals with a composition of three developed immunobiological agents containing the glycoprotein gene Ebola virus, Sudan virus, Marburg virus leads to the formation of neutralizing antibodies against 4 types of filoviruses: Ebola virus, Bundibugyo virus, Sudan virus, Marburg virus ...

It is obvious to the average specialist that the antibodies formed after the administration of the developed immunobiological agents can also bind to the glycoprotein of closely related filovirus species.

Example 12.

Evaluation of the immunogenicity of the developed immunobiological agents depending on the route of their introduction into the mammalian organism.

The purpose of this experiment was to evaluate the effectiveness of immunization of mammals with variants of the developed immunobiological agent by intranasal, intramuscular, or subcutaneous administration. The intensity of the humoral immune response in immunized animals was assessed by the production of IgG antibodies specific to GP Ebola virus in the blood serum.

The experiment used mammals - mice of the BALB / c line, females 18g. All animals were divided into groups of 5 animals, which were injected intramuscularly, subcutaneously or intranasally with the developed immunobiological agent at a dose of 10 ¹⁰ viral particles / mouse.

Thus, the following groups of animals were obtained:

1) Ad26-GP-EBOV intranasally;

2) Ad26-GP-EBOV intramuscularly;

3) Ad26-GP-EBOV subcutaneously;

4) Ad5-GP-EBOV intranasally;

5) Ad5-GP-EBOV intramuscularly;

6) Ad5-GP-EBOV subcutaneously;

7) VSV-GP-EBOV intranasally;

8) VSV-GP-EBOV intramuscularly;

9) VSV-GP-EBOV subcutaneously;

10) Buffer solution.

Evaluation of the titer of antibodies to GP Ebola virus in the peripheral blood serum of the test animals was carried out on the 21st day after immunization by ELISA.

For enzyme immunoassay, antigen (GP Ebola virus) diluted in carbonate-bicarbonate buffer (CBB) (pH 9.6) was applied to a 96-well plate at 100 ng per well. The plate was incubated at + 4 ^° C overnight.

The next day, the plate was washed with a TPSB solution (Tween 20 - phosphate-buffered saline: for 1 liter of distilled water 8.00 g NaCl, 0.20 g KCl, 1.44 g Na ₂ HPO ₄ , 0.24 g KH ₂ PO ₄ , Tween 20 0.1%) in a volume of 230 μl per well 5 times. Then, to get rid of nonspecific binding, the plate was treated with ELISA buffer (XEMA, Russia), in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour. The plate was washed with a TPSB solution in a volume of 230 μl per well 4 times.

Then added serum of peripheral blood of mice in various dilutions in a solution of ELISA buffer and again incubated for an hour under the same conditions.

Then the plate was washed with a TPSB solution in a volume of 200 μl per well 5 times to remove unbound antibodies. Then added secondary antibodies specific to mouse immunoglobulins conjugated with horseradish peroxidase, diluted in ELISA buffer in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour.

Then the plate was washed again with TFSB solution 5 times. After that, TMB was added to the wells in a volume of 100 μl per well and kept in the dark until the solution acquired a blue color for 15 minutes. Next, the reaction was stopped by adding 50 μl of 4M sulfuric acid, and the optical density was measured on a plate spectrophotometer at a light wavelength of 450 nm.

The results of the experiment are presented in table 13.

Table 13. The titer of antibodies to GP Ebola virus in the peripheral blood sera of the test animals on the 21st day after immunization (geometric mean of the antibody titer).

Table 13

No. Animal group name Antibody titer 1 Ad26-GP-EBOV intranasally; 67.3 2 Ad26-GP-EBOV intramuscularly; 220.8 3 Ad26-GP-EBOV subcutaneously; 181.1 4 Ad5-GP-EBOV intranasally; 5250.1 5 Ad5-GP-EBOV intramuscularly; 8613.8 6 Ad5-GP-EBOV subcutaneously; 7066.2 7 VSV-GP-EBOV intranasally; 3533.1 eight VSV-GP-EBOV intramuscularly; 7801.7 nine VSV-GP-EBOV subcutaneously; 6400.0 ten Buffer solution. 0

As can be seen from the presented results, all routes of administration of the developed immunobiological agents into the mammalian organism lead to the development of a humoral immune response. In this case, the highest titers of antibodies are observed with intramuscular and subcutaneous administration.

Example 13.

Evaluation of the immunogenicity of the developed immunobiological agents during sequential and simultaneous immunization.

The purpose of this experiment was to evaluate the effectiveness of immunization of mammals with variants of the developed immunobiological agent for various schemes of administration of the agent. The intensity of the humoral immune response in immunized animals was assessed by the production of IgG antibodies specific to GP Ebola virus in the blood serum.

The experiment used mammals - mice of the BALB / c line, females 18g. All animals were divided into groups of 5 animals, which were injected intramuscularly with the developed immunobiological agent at a dose of 10 ¹⁰ viral particles / mouse.

Thus, the following groups of animals were obtained:

1) Ad26-GP-EBOV, Ad5-GP-EBOV simultaneously,

2) Ad26-GP-EBOV, Ad5-GP-EBOV sequentially with an interval of 21 days,

3) Ad5-GP-EBOV, Ad26-GP-EBOV sequentially with an interval of 21 days,

4) Ad26-GP-EBOV, VSV-GP-EBOV simultaneously,

5) Ad26-GP-EBOV, VSV -GP-EBOV sequentially with an interval of 21 days,

6) VSV -GP-EBOV, Ad26-GP-EBOV sequentially with an interval of 21 days,

7) VSV -GP-EBOV, Ad5-GP-EBOV simultaneously,

8) VSV-GP-EBOV, Ad5-GP-EBOV sequentially with an interval of 21 days,

9) Ad5-GP-EBOV, VSV -GP-EBOV sequentially with an interval of 21 days,

10) Buffer solution.

Evaluation of the titer of antibodies to GP Ebola virus in the peripheral blood serum of the test animals was carried out on the 21st day after immunization by ELISA.

For enzyme immunoassay, antigen (GP Ebola virus) diluted in carbonate-bicarbonate buffer (CBB) (pH 9.6) was applied to a 96-well plate at 100 ng per well. The plate was incubated at + 4 ^° C overnight.

The next day, the plate was washed with a TPSB solution (Tween 20 - phosphate-buffered saline: for 1 liter of distilled water 8.00 g NaCl, 0.20 g KCl, 1.44 g Na ₂ HPO ₄ , 0.24 g KH ₂ PO ₄ , Tween 20 0.1%) in a volume of 230 μl per well 5 times. Then, to get rid of nonspecific binding, the plate was treated with ELISA buffer (XEMA, Russia), in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour. The plate was washed with a TPSB solution in a volume of 230 μl per well 4 times.

Then added serum of peripheral blood of mice in various dilutions in a solution of ELISA buffer and again incubated for an hour under the same conditions.

Then the plate was washed with a TPSB solution in a volume of 200 μl per well 5 times to remove unbound antibodies. Then added secondary antibodies specific to mouse immunoglobulins conjugated with horseradish peroxidase, diluted in ELISA buffer in a volume of 100 μl per well. Incubated on a shaker at 37 ^o C for an hour.

Then the plate was washed again with TFSB solution 5 times. After that, TMB was added to the wells in a volume of 100 μl per well and kept in the dark until the solution acquired a blue color for 15 minutes. Next, the reaction was stopped by adding 50 μl of 4M sulfuric acid, and the optical density was measured on a plate spectrophotometer at a light wavelength of 450 nm.

The results of the experiment are presented in table 14.

Table 14.

Antibody titer to GP Ebola virus in the peripheral blood sera of test animals on day 21 after immunization (geometric mean of the antibody titer).

Table 14

No. Animal group name Antibody titer 1 Ad26-GP-EBOV, Ad5-GP-EBOV simultaneously, 8613.8 2 Ad26-GP-EBOV, Ad5-GP-EBOV sequentially at 21 day intervals, 46373.1 3 Ad5-GP-EBOV, Ad26-GP-EBOV sequentially with an interval of 21 days, 34455.0 4 Ad26-GP-EBOV, VSV-GP-EBOV simultaneously, 10500.3 5 Ad26-GP-EBOV, VSV -GP-EBOV sequentially with an interval of 21 days, 42001.2 6 VSV -GP-EBOV, Ad26-GP-EBOV sequentially with an interval of 21 days, 38041.5 7 VSV -GP-EBOV, Ad5-GP-EBOV simultaneously, 11593.3 eight VSV -GP-EBOV, Ad5-GP-EBOV sequentially with an interval of 21 days, 51200.0 nine Ad5-GP-EBOV, VSV -GP-EBOV sequentially with an interval of 21 days, 42001.2 ten Buffer solution. 0

As can be seen from the presented results, both simultaneous and sequential administration of immunobiological agents into the mammalian organism lead to the development of a humoral immune response. In this case, the highest titers of antibodies are observed with the sequential administration of immunobiological agents.

The above examples confirm the fulfillment of the technical task, namely: “expanding the arsenal of immunobiological agents that ensure effective induction of an immune response against filoviruses: genus Ebolavirus: Ebola virus (EBOV), Bundibugyo virus (BDBV), Sudan virus (SUDV), and / or filoviruses of the genus Marburgvirus: Marburg virus (MARV).

Industrial applicability

All these examples confirm the industrial applicability of the invention.

--->

LIST OF SEQUENCES

<110> federal state budgetary institution "National

Research Center for Epidemiology and Microbiology named after

Academician N.F. Gamaleya "of the Ministry of Health of the Russian Federation

<120> Immunobiological agent for the induction of an immune response to pathogenic

for humans filoviruses, a method of using an immunobiological agent

<160> 16

<170> BISSAP1.3.6

<210> 1

<211> 2914

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed expression cassette containing the CMV promoter,

Ebola virus GP sequence and polyadenylation signal

<400> 1

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 60

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 120

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 180

gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 240

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 300

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 360

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 420

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 480

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 540

ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagagat ctgaattcac 600

catgggtgtt acaggaatat tgcagttacc tcgtgatcga ttcaagagga catcattctt 660

tctttgggta attatccttt tccaaagaac attttccatc ccgcttggag ttatccacaa 720

tagtacatta caggttagtg atgtcgacaa actagtttgt cgtgacaaac tgtcatccac 780

aaatcaattg agatcagttg gactgaatct cgaggggaat ggagtggcaa ctgacgtgcc 840

atctgtgact aaaagatggg gcttcaggtc cggtgtccca ccaaaggtgg tcaattatga 900

agctggtgaa tgggctgaaa actgctacaa tcttgaaatc aaaaaacctg acgggagtga 960

gtgtctacca gcagcgccag acgggattcg gggcttcccc cggtgccggt atgtgcacaa 1020

agtatcagga acgggaccat gtgccggaga ctttgccttc cacaaagagg gtgctttctt 1080

cctgtatgat cgacttgctt ccacagttat ctaccgagga acgactttcg ctgaaggtgt 1140

cgttgcattt ctgatactgc cccaagctaa gaaggacttc ttcagctcac accccttgag 1200

agagccggtc aatgcaacgg aggacccgtc gagtggctat tattctacca caattagata 1260

tcaggctacc ggttttggaa ctaatgagac agagtacttg ttcgaggttg acaatttgac 1320

ctacgtccaa cttgaatcaa gattcacacc acagtttctg ctccagctga atgagacaat 1380

atatgcaagt gggaagagga gcaacaccac gggaaaacta atttggaagg tcaaccccga 1440

aattgataca acaatcgggg agtgggcctt ctgggaaact aaaaaaaacc tcactagaaa 1500

aattcgcagt gaagagttgt ctttcacagc tgtatcaaac ggacccaaaa acatcagtgg 1560

tcagagtccg gcgcgaactt cttccgaccc agagaccaac acaacaaatg aagaccacaa 1620

aatcatggct tcagaaaatt cctctgcaat ggttcaagtg cacagtcaag gaaggaaagc 1680

tgcagtgtcg catctgacaa cccttgccac aatctccacg agtcctcaac ctcccacaac 1740

caaaacaggt ccggacaaca gcacccataa tacacccgtg tataaacttg acatctctga 1800

ggcaactcaa gttggacaac atcaccgtag agcagacaac gacagcacag cctccgacac 1860

tccccccgcc acgaccgcag ccggaccctt aaaagcagag aacaccaaca cgagtaagag 1920

cgctgactcc ctggacctcg ccaccacgac aagcccccaa aactacagcg agactgctgg 1980

caacaacaac actcatcacc aagataccgg agaagagagt gccagcagcg ggaagctagg 2040

cttaattacc aatactattg ctggagtagc aggactgatc acaggcggga gaaggactcg 2100

aagagaagta attgtcaatg ctcaacccaa atgcaacccc aatttacatt actggactac 2160

tcaggatgaa ggtgctgcaa tcggattggc ctggatacca tatttcgggc cagcagccga 2220

aggaatttac acagaggggc taatgcacaa ccaagatggt ttaatctgtg ggttgaggca 2280

gctggccaac gaaacgactc aagctctcca actgttcctg agagccacaa ctgagctgcg 2340

aaccttttca atcctcaacc gtaaggcaat tgacttcctg ctgcagcgat ggggtggcac 2400

atgccacatt ttgggaccgg actgctgtat cgaaccacat gattggacca agaacataac 2460

agacaaaatt gatcagatta ttcatgattt tgttgataaa acccttccgg accaggggga 2520

caatgacaat tggtggacag gatggagaca atggataccg gcaggtattg gagttacagg 2580

tgttataatt gcagttatcg ctttattctg tatatgcaaa tttgtctttt gataaggaat 2640

tcaagcttct agataagata tccgatccac cggatctaga taactgatca taatcagcca 2700

taccacattt gtagaggttt tacttgcttt aaaaaacctc ccacacctcc ccctgaacct 2760

gaaacataaa atgaatgcaa ttgttgttgt taacttgttt attgcagctt ataatggtta 2820

caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag 2880

ttgtggtttg tccaaactca tcaatgtatc ttaa 2914

<210> 2

<211> 2320

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed expression cassette containing the CMV promoter,

GPEbolavirus sequence modified by region deletion,

encoding a mucin-like domain, and a polyadenylation signal

<400> 2

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 60

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 120

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 180

gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 240

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 300

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 360

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 420

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 480

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 540

ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagagat ctacgcgtat 600

gggtgttaca ggaatattgc agttacctcg tgatcgattc aagaggacat cattctttct 660

ttgggtaatt atccttttcc aaagaacatt ttccatcccg cttggagtta tccacaatag 720

tacattacag gttagtgatg tcgacaaact agtttgtcgt gacaaactct catccacaaa 780

tcaattgaga tcagttggac tgaatctcga ggggaatgga gtggcaactg acgtgccatc 840

tgtgactaaa agatggggct tcaggtccgg tgtcccacca aaggtggtca attatgaagc 900

tggtgaatgg gctgaaaact gctacaatct tgaaatcaaa aaacctgacg ggagtgagtg 960

tctaccagca gcgccagacg ggattcgggg cttcccccgg tgccggtatg tgcacaaagt 1020

atcaggaacg ggaccatgtg ccggagactt tgccttccac aaagagggtg ctttcttcct 1080

gtatgatcga cttgcttcca cagttatcta ccgaggaacg actttcgctg aaggtgtcgt 1140

tgcatttctg atactgcccc aagctaagaa ggacttcttc agctcacacc ccttgagaga 1200

gccggtcaat gcaacggagg acccgtcgag tggctattat tctaccacaa ttagatatca 1260

ggctaccggt tttggaacta atgagacaga gtacttgttc gaggttgaca atttgaccta 1320

cgtccaactt gaatcaagat tcacaccaca gtttctgctc cagctgaatg agacaatata 1380

tgcaagtggg aagaggagca acaccacggg aaaactaatt tggaaggtca accccgaaat 1440

tgatacaaca atcggggagt gggccttctg ggaaactaaa aaaaacctca ctagaaaaat 1500

tcgcagtgaa gagttgtctt tcacagctgt atcaaacaga aggactcgaa gagaagtaat 1560

tgtcaatgct caacccaaat gcaaccccaa tttacattac tggactactc aggatgaagg 1620

tgctgcaatc ggattggcct ggataccata tttcgggcca gcagccgaag gaatttacat 1680

agaggggcta atgcacaacc aagatggttt aatctgtggg ttgaggcagc tggccaacga 1740

aacgactcaa gctctccaac tgttcctgag agccacaact gagctgcgaa ccttttcaat 1800

cctcaaccgt aaggcaattg acttcctgct gcagcgatgg ggtggcacat gccacatttt 1860

gggaccggac tgctgtatcg aaccacatga ttggaccaag aacataacag acaaaattga 1920

tcagattatt catgattttg ttgataaaac ccttccggac cagggggaca atgacaattg 1980

gtggacagga tggagacaat ggataccggc aggtattgga gttacaggtg ttataattgc 2040

agttatcgct ttattctgta tatgcaaatt tgtcttttga gctagataac tgatcataat 2100

cagccatacc acatttgtag aggttttact tgctttaaaa aacctcccac acctccccct 2160

gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa 2220

tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca 2280

ttctagttgt ggtttgtcca aactcatcaa tgtatcttaa 2320

<210> 3

<211> 2903

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed expression cassette containing the CMV promoter,

GPBundibugyovirus sequence and polyadenylation signal

<400> 3

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 60

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 120

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 180

gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 240

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 300

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 360

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 420

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 480

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 540

ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagagat ctggtaccgt 600

cgacgcggcc gctcgagcct aagcttacgc gtatggaggg tcttagccta ctccaattgc 660

ccagagataa atttcgaaaa agctctttct ttgtttgggt catcatctta tttcaaaagg 720

ccttttccat gcctttgggt gttgtgacca acagcacttt agaagtaaca gagattgacc 780

agctagtctg caaggatcat cttgcatcca ctgaccagct gaaatcagtt ggtctcaacc 840

tcgaggggag cggagtatct actgacatcc catctgcgac aaagcgttgg ggcttcaggt 900

ctggtgtgcc tcccaaagtg gtcagctatg aagcaggaga atgggctgaa aattgctaca 960

atcttgaaat aaagaagccg gacgggagcg aatgcttacc cccaccgccg gatggtgtca 1020

gaggctttcc aaggtgccgc tatgttcaca aagcccaagg aaccgggccc tgcccgggtg 1080

actatgcctt tcacaaggat ggagctttct tcctctatga caggctggct tcaactgtaa 1140

tttacagagg agtcaatttt gctgaggggg taattgcctt cttgatattg gctaaaccaa 1200

aggaaacgtt ccttcaatca ccccccattc gagaggcagt aaactacact gagaatacat 1260

caagttacta tgccacatcc tacttggagt acgaaatcga aaattttggt gctcaacact 1320

ccacgaccct tttcaaaatt aacaacaata cttttgttct tctggacagg ccccacacgc 1380

ctcagttcct tttccagctg aatgatacca ttcaccttca ccaacagttg agcaacacaa 1440

ctgggaaact aatttggaca ctagatgcta atatcaatgc tgatattggt gaatgggctt 1500

tttgggaaaa taaaaaaaat ctctccgaac aactacgtgg agaagagctg tctttcgaaa 1560

ctttatcgct caacgagaca gaagacgatg atgcgacatc gtcgagaact acaaagggaa 1620

gaatctccga ccgagccacc aggaagtatt cggacctggt tccaaaggat tcccctggga 1680

tggtttcatt gcacgtacca gaaggggaaa caacattgcc gtctcagaat tcgacagaag 1740

gacgaagagt agatgtgaat actcaggaaa ctatcacaga gacaactgca acaatcatag 1800

gcactaacgg taacaacatg cagatcagca ccatcgggac aggactgagc tccagccaaa 1860

tcctgagttc ctcaccgacc atggcaccaa gccctgagac tcagacctcc acaacctaca 1920

caccaaaact accagtgatg accaccgagg aaccaacaac accaccgaga aactctcctg 1980

gctcaacaac agaagcaccc actctcacca ccccagagaa tataacaaca gcggtgaaaa 2040

ctgttttgcc acaagagtcc acaagcaacg gtctaataac ttcaacagta acaggtattc 2100

ttgggagcct tggacttcga aaacgcagca gaagacaagt taacaccagg gccacgggta 2160

aatgcaatcc caacttacac tactggactg cacaagaaca acataatgct gctgggattg 2220

cctggatccc gtactttgga ccgggtgcag aaggcatata cactgaaggc cttatgcaca 2280

accaaaatgc cttagtctgt ggactcagac aacttgcaaa tgaaaccact caagctctgc 2340

agcttttctt aagggccacg acggagctgc ggacatatac catactcaat aggaaggcca 2400

tagatttcct tctgcgacga tggggcggga catgtaggat cctgggacca gattgttgca 2460

ttgagccaca tgattggacc aaaaacatca ctgataaaat caaccaaatc atccatgatt 2520

tcatcgacaa ccctttaccc aatcaggata atgatgataa ttggtggacg ggctggagac 2580

agtggatccc tgcaggaata ggcattactg gaattattat tgcaatcatt gctcttcttt 2640

gcgtctgcaa gctgctttgt tgagctagat aactgatcat aatcagccat accacatttg 2700

tagaggtttt acttgcttta aaaaacctcc cacacctccc cctgaacctg aaacataaaa 2760

tgaatgcaat tgttgttgtt aacttgttta ttgcagctta taatggttac aaataaagca 2820

atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt 2880

ccaaactcat caatgtatct taa 2903

<210> 4

<211> 2357

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed expression cassette containing the CMV promoter,

GPBundibugyovirus sequence modified by deletion

region encoding a mucin-like domain and a polyadenylation signal

<400> 4

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 60

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 120

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 180

gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 240

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 300

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 360

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 420

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 480

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 540

ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagagat ctggtaccgt 600

cgacgcggcc gctcgagcct aagcttacgc gtatggaggg tcttagccta ctccaattgc 660

ccagagataa atttcgaaaa agctctttct ttgtttgggt catcatctta tttcaaaagg 720

ccttttccat gcctttgggt gttgtgacca acagcacttt agaagtaaca gagattgacc 780

agctagtctg caaggatcat cttgcatcca ctgaccagct gaaatcagtt ggtctcaacc 840

tcgaggggag cggagtatct actgacatcc catctgcgac aaagcgttgg ggcttcaggt 900

ctggtgtgcc tcccaaagtg gtcagctatg aagcaggaga atgggctgaa aattgctaca 960

atcttgaaat aaagaagccg gacgggagcg aatgcttacc cccaccgccg gatggtgtca 1020

gaggctttcc aaggtgccgc tatgttcaca aagcccaagg aaccgggccc tgcccgggtg 1080

actatgcctt tcacaaggat ggagctttct tcctctatga caggctggct tcaactgtaa 1140

tttacagagg agtcaatttt gctgaggggg taattgcctt cttgatattg gctaaaccaa 1200

aggaaacgtt ccttcaatca ccccccattc gagaggcagt aaactacact gagaatacat 1260

caagttacta tgccacatcc tacttggagt acgaaatcga aaattttggt gctcaacact 1320

ccacgaccct tttcaaaatt aacaacaata cttttgttct tctggacagg ccccacacgc 1380

ctcagttcct tttccagctg aatgatacca ttcaccttca ccaacagttg agcaacacaa 1440

ctgggaaact aatttggaca ctagatgcta atatcaatgc tgatattggt gaatgggctt 1500

tttgggaaaa taaaaaaaat ctctccgaac aactacgtgg agaagagctg tctttcgaaa 1560

ctttatcgct caacaaacgc agcagaagac aagttaacac cagggccacg ggtaaatgca 1620

atcccaactt acactactgg actgcacaag aacaacataa tgctgctggg attgcctgga 1680

tcccgtactt tggaccgggt gcagaaggca tatacactga aggccttatg cacaaccaaa 1740

atgccttagt ctgtggactc agacaacttg caaatgaaac cactcaagct ctgcagcttt 1800

tcttaagggc cacgacggag ctgcggacat ataccatact caataggaag gccatagatt 1860

tccttctgcg acgatggggc gggacatgta ggatcctggg accagattgt tgcattgagc 1920

cacatgattg gaccaaaaac atcactgata aaatcaacca aatcatccat gatttcatcg 1980

acaacccttt acccaatcag gataatgatg ataattggtg gacgggctgg agacagtgga 2040

tccctgcagg aataggcatt actggaatta ttattgcaat cattgctctt ctttgcgtct 2100

gcaagctgct ttgttgagct agataactga tcataatcag ccataccaca tttgtagagg 2160

ttttacttgc tttaaaaaac ctcccacacc tccccctgaa cctgaaacat aaaatgaatg 2220

caattgttgt tgttaacttg tttattgcag cttataatgg ttacaaataa agcaatagca 2280

tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt ttgtccaaac 2340

tcatcaatgt atcttaa 2357

<210> 5

<211> 2909

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed expression cassette containing the CMV promoter,

GPSudanvirus sequence and polyadenylation signal

<400> 5

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 60

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 120

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 180

gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 240

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 300

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 360

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 420

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 480

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 540

ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagagat ctggtaccgt 600

cgacgcggcc gctcgagcct aagcttacgc gtatggttac atcaggaatt ctacaattgc 660

cccgtgaacg cttcaggaaa acatcatttt ttgtttgggt aataatccta ttccataagg 720

ttttccctat cccattgggc gtagttcaca acaacactct ccaggtaagt gatatagata 780

aattggtgtg ccgggataaa ctttcctcca caagtcaact gaaatcggtc gggcttaacc 840

tagaaggtaa tggagttgcc acagatgtac caacagcaac gaagagatgg ggattccgag 900

ccggtgttcc acccaaagtg gtgaactacg aggctgggga gtgggctgaa aactgctaca 960

acctggacat caagaaagca gatggtagcg aatgcctacc tgaagcccct gagggtgtaa 1020

gaggcttccc tcgctgccgt tatgtgcaca aggtttctgg aacagggccg tgtcctgaag 1080

gtttcgcttt ccacaaagaa ggcgctttct tcctgtatga tcgactggca tcaacaatca 1140

tctatcgaag caccacgttt tcagaaggtg ttgtggcttt cttgatcctc cccaagacta 1200

aaaaggactt tttccaatca ccaccactac atgaaccggc caatatgaca acagacccat 1260

ccagctacta ccacacagtc acacttaatt atgtggctga caattttggg accaatatga 1320

ctaactttct gtttcaagtg gatcatctaa cttatgtgca acttgaacca agattcacac 1380

cacaatttct tgtccaactc aatgagacca tttatactaa tgggcgtcgc agcaacacca 1440

caggaacact aatttggaaa gtaaatccta ctgttgacac cggcgtaggt gaatgggcct 1500

tctgggaaaa taaaaaaaac ttcacaaaaa ccctttcaag tgaagagctg tctgtcatac 1560

ttgtaccaag agcccaggat ccaggcagca accagaagac gaaggtcact cccaccagct 1620

tcgccaacaa ccaaacctcc aagaaccacg aagacttggt tccaaaggat cccgcttcag 1680

tcgttcaagt gcgagacctc cagagggaaa acacagtgcc gacctcaccc ttgaacacag 1740

tccccacaac tctgatcccc gacacaatgg aagagcaaac caccagccac tacgaactac 1800

caaacatttc cggaaaccat caagagagga acaacaccgc acaccccgaa actctcgcca 1860

acaatcctcc agacaacaca accccttcga caccacctca agacggtgag cggacaagtt 1920

cccacacaac accctccccc cgcccagtcc caaccagcac aatccatccc accacacgag 1980

agactcaaat tcccaccaca atgataacaa gccatgatac tgacagtaat cgacccaacc 2040

caattgacat cagcgagtct acagagccag gactactcac caacaccata agaggggttg 2100

caaatttgct gacaggttca agaagaaccc ggagggaaat caccttgaga acacaagcca 2160

aatgtaatcc gaacctacac tattggacaa cccaagatga aggggctgcc attggtctag 2220

cctggatacc ttacttcggg cccgcagcag agggaattta tacggaagga ataatgcaca 2280

atcaaaatgg gctaatttgc gggttgaggc aactagcaaa tgagacgact caagccctac 2340

agttattctt gcgtgctacc acggaattgc gcactttctc catattgaat cgaaaagcca 2400

tcgacttctt acttcaaaga tggggaggaa cgtgccacat cttaggccca gattgctgta 2460

ttgagcccca tgattggact aagaacatta ctgacaagat agatcaaatc attcatgatt 2520

tcattgataa acctctacca gatcagacag ataatgacaa ttggtggaca gggtggaggc 2580

aatgggttcc tgctgggatt gggatcacgg gggtaataat cgcagttata gcactgctgt 2640

gtatttgcaa atttctactc taagctagct ctagataact gatcataatc agccatacca 2700

catttgtaga ggttttactt gctttaaaaa acctcccaca cctccccctg aacctgaaac 2760

ataaaatgaa tgcaattgtt gttgttaact tgtttattgc agcttataat ggttacaaat 2820

aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg 2880

gtttgtccaa actcatcaat gtatcttaa 2909

<210> 6

<211> 2360

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed expression cassette containing the CMV promoter,

GPSudanvirus sequence modified by region deletion,

encoding a mucin-like domain, and a polyadenylation signal

<400> 6

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 60

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 120

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 180

gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 240

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 300

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 360

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 420

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 480

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 540

ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagagat ctggtaccgt 600

cgacgcggcc gctcgagcct aagcttacgc gtatggttac atcaggaatt ctacaattgc 660

cccgtgaacg cttcaggaaa acatcatttt ttgtttgggt aataatccta ttccataagg 720

ttttccctat cccattgggc gtagttcaca acaacactct ccaggtaagt gatatagata 780

aattggtgtg ccgggataaa ctttcctcca caagtcaact gaaatcggtc gggcttaacc 840

tagaaggtaa tggagttgcc acagatgtac caacagcaac gaagagatgg ggattccgag 900

ccggtgttcc acccaaagtg gtgaactacg aggctgggga gtgggctgaa aactgctaca 960

acctggacat caagaaagca gatggtagcg aatgcctacc tgaagcccct gagggtgtaa 1020

gaggcttccc tcgctgccgt tatgtgcaca aggtttctgg aacagggccg tgtcctgaag 1080

gtttcgcttt ccacaaagaa ggcgctttct tcctgtatga tcgactggca tcaacaatca 1140

tctatcgaag caccacgttt tcagaaggtg ttgtggcttt cttgatcctc cccaagacta 1200

aaaaggactt tttccaatca ccaccactac atgaaccggc caatatgaca acagacccat 1260

ccagctacta ccacacagtc acacttaatt atgtggctga caattttggg accaatatga 1320

ctaactttct gtttcaagtg gatcatctaa cttatgtgca acttgaacca agattcacac 1380

cacaatttct tgtccaactc aatgagacca tttatactaa tgggcgtcgc agcaacacca 1440

caggaacact aatttggaaa gtaaatccta ctgttgacac cggcgtaggt gaatgggcct 1500

tctgggaaaa taaaaaaaac ttcacaaaaa ccctttcaag tgaagagctg tctgtcatac 1560

ttgtaccaag aagaagaacc cggagggaaa tcaccttgag aacacaagcc aaatgtaatc 1620

cgaacctaca ctattggaca acccaagatg aaggggctgc cattggtcta gcctggatac 1680

cttacttcgg gcccgcagca gagggaattt atacggaagg aataatgcac aatcaaaatg 1740

ggctaatttg cgggttgagg caactagcaa atgagacgac tcaagcccta cagttattct 1800

tgcgtgctac cacggaattg cgcactttct ccatattgaa tcgaaaagcc atcgacttct 1860

tacttcaaag atggggagga acgtgccaca tcttaggccc agattgctgt attgagcccc 1920

atgattggac taagaacatt actgacaaga tagatcaaat cattcatgat ttcattgata 1980

aacctctacc agatcagaca gataatgaca attggtggac agggtggagg caatgggttc 2040

ctgctgggat tgggatcacg ggggtaataa tcgcagttat agcactgctg tgtatttgca 2100

aatttctact ctaagctagc tctagataac tgatcataat cagccatacc acatttgtag 2160

aggttttact tgctttaaaa aacctcccac acctccccct gaacctgaaa cataaaatga 2220

atgcaattgt tgttgttaac ttgtttattg cagcttataa tggttacaaa taaagcaata 2280

gcatcacaaa tttcacaaat aaagcatttt tttcactgca ttctagttgt ggtttgtcca 2340

aactcatcaa tgtatcttaa 2360

<210> 7

<211> 2924

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed expression cassette containing the CMV promoter,

GP Marburgvirus sequence and polyadenylation signal

<400> 7

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 60

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 120

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 180

gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 240

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 300

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 360

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 420

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 480

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 540

ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagagat ctggtaccgt 600

cgacgcggcc gctcgagcct aagcttacgc gtatgtggac tacatgcttc tttatcagtc 660

tcatcttaat ccaagggata aaaactctcc ctattttgga gatagccagt aacgatcaac 720

cccaaaatgt ggattcggta tgctccggaa ctctccagaa aactgaagac gtccatctga 780

tgggatttac actgagcggt cagaaagttg ctgattcccc tttggaggca tccaagcgat 840

gggctttcag gacaggtgta cctcctaaga atgttgagta tacggaaggg gaggaagcca 900

aaacatgcta caatataagt gtaacggatc cctctggaaa atccttgctg ttagatcctc 960

ccaccaacgt ccgagactat cctaaatgca agactatcca tcacattcaa ggtcaaaacc 1020

ctcatgcgca ggggattgcc ctccatttgt ggggagcatt tttcctatat gatcgcattg 1080

cctccacaac aatgtaccga ggcaaagtct tcactgaagg gaacatagca gccatgattg 1140

tcaataagac agtgcacaaa atgattttct cgcgtcaagg acaagggtat cgtcacatga 1200

atctgacttc tactaacaag tattggacaa gtagcaacgg aacgcaaaca aatgacactg 1260

gatgtttcgg tactcttcaa gaatacaatt ctacgaagaa ccaaacatgt gctccgtcta 1320

aaacaccccc accaccgccc acagcccatc cggagatcaa acccacaagc accccaaccg 1380

atgccactag actcaacacc acaaacccaa acagtgatga tgaggatctc acaacatccg 1440

gctcggggtc tggggaacag gaaccctata cgacttctga tgcggtcact aagcaagggc 1500

tttcatcaac aatgccaccc actccctcac cgcaaccagg cacgccacag cagggaggaa 1560

acaacacaaa ccactcccag gacgctgcaa ctgaacttga caacaccaat acaactgcac 1620

aacctcccat gccttcccac aacacgacca caatctcgac caacaacacg tccaaacaca 1680

acctcagcac cctctccgaa ccaccacaaa acaccaccaa tcccaacaca caaagcatgg 1740

ccactgaaaa tgagaaaacc agtgcccctc cgaaaacaac cctgcctcca acagaaagtc 1800

ctaccacaga aaagagcacc aacaatacaa aaagccccac cacaatggaa ccaaatacaa 1860

caaatggaca tttcactagt ccctcctcca cctccaactc gactactcaa catcttatct 1920

acttcaggag gaaacgaagt atcctctgga gggaaggcga tatgttccct ttcctagatg 1980

ggttaataaa tgctccaatt gattttgatc cagttccaaa tacaaagaca atctttgatg 2040

aatcttctag ttctggtgct tcagccgagg aagatcaaca tgcatcctcc aatatcagct 2100

tgactttatc ttatcttcct catacaagtg aaaacactgc ctactctgga gagaatgaaa 2160

atgattgtga tgcagagcta agaatttgga gcgttcagga ggacgacctg gcagcagggc 2220

tcagttggat accattcttc ggccctggaa tcgaaggact ttataccgct ggtttaatca 2280

agaaccaaaa caatttggtc tgcaggttga ggcgtctagc caatcaaact gcaaaatctt 2340

tggaactctt actaagggtc acaaccgagg aaagaacatt ttccttgatc aatagacatg 2400

ctattgactt tctactcaca aggtggggag gaacatgcaa agtgcttgga cctgattgtt 2460

gcataggaat agaggacttg tccagaaata tttcagaaca gattgaccaa atcaagaagg 2520

acgaacaaaa agaggggact ggttggggtc tgggtggtaa gtggtggaca tccgactggg 2580

gtgttcttac taacttgggc atcttgctac tattgtccat agctgtcttg attgctctat 2640

cctgtatttg tcgtatcttc actaaatata ttggataggc tagctctaga taactgatca 2700

taatcagcca taccacattt gtagaggttt tacttgcttt aaaaaacctc ccacacctcc 2760

ccctgaacct gaaacataaa atgaatgcaa ttgttgttgt taacttgttt attgcagctt 2820

ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac 2880

tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttaa 2924

<210> 8

<211> 2351

<212> DNA

<213> ArtificialSequence

<220>

<223> Designed expression cassette containing the CMV promoter,

GPMarburgvirus sequence modified by region deletion,

encoding a mucin-like domain, and a polyadenylation signal

<400> 8

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 60

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 120

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 180

gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 240

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 300

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 360

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 420

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 480

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 540

ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagagat ctggtaccgt 600

cgacgcggcc gctcgagcct aagcttacgc gtatgtggac tacatgcttc tttatcagtc 660

tcatcttaat ccaagggata aaaactctcc ctattttgga gatagccagt aacgatcaac 720

cccaaaatgt ggattcggta tgctccggaa ctctccagaa aactgaagac gtccatctga 780

tgggatttac actgagcggt cagaaagttg ctgattcccc tttggaggca tccaagcgat 840

gggctttcag gacaggtgta cctcctaaga atgttgagta tacggaaggg gaggaagcca 900

aaacatgcta caatataagt gtaacggatc cctctggaaa atccttgctg ttagatcctc 960

ccaccaacgt ccgagactat cctaaatgca agactatcca tcacattcaa ggtcaaaacc 1020

ctcatgcgca ggggattgcc ctccatttgt ggggagcatt tttcctatat gatcgcattg 1080

cctccacaac aatgtaccga ggcaaagtct tcactgaagg gaacatagca gccatgattg 1140

tcaataagac agtgcacaaa atgattttct cgcgtcaagg acaagggtat cgtcacatga 1200

atctgacttc tactaacaag tattggacaa gtagcaacgg aacgcaaaca aatgacactg 1260

gatgtttcgg tactcttcaa gaatacaatt ctacgaagaa ccaaacatgt gctccgtcta 1320

aaacaccccc accaccgccc acagctcatc cgaggaggaa acgaagtatc ctctggaggg 1380

aaggcgatat gttccctttc ctagatgggt taataaatgc tccaattgat tttgatccag 1440

ttccaaatac aaagacaatc tttgatgaat cttctagttc tggtgcttca gccgaggaag 1500

atcaacatgc atcctccaat atcagcttga ctttatctta tcttcctcat acaagtgaaa 1560

acactgccta ctctggagag aatgaaaatg attgtgatgc agagctaaga atttggagcg 1620

ttcaggagga cgacctggca gcagggctca gttggatacc attcttcggc cctggaatcg 1680

aaggacttta taccgctggt ttaatcaaga accaaaacaa tttggtctgc aggttgaggc 1740

gtctagccaa tcaaactgca aaatctttgg aactcttact aagggtcaca accgaggaaa 1800

gaacattttc cttgatcaat agacatgcta ttgactttct actcacaagg tggggaggaa 1860

catgcaaagt gcttggacct gattgttgca taggaataga ggacttgtcc agaaatattt 1920

cagaacagat tgaccaaatc aagaaggacg aacaaaaaga ggggactggt tggggtctgg 1980

gtggtaagtg gtggacatcc gactggggtg ttcttactaa cttgggcatc ttgctactat 2040

tgtccatagc tgtcttgatt gctctatcct gtatttgtcg tatcttcact aaatatattg 2100

gataggctag ctctagataa ctgatcataa tcagccatac cacatttgta gaggttttac 2160

ttgctttaaa aaacctccca cacctccccc tgaacctgaa acataaaatg aatgcaattg 2220

ttgttgttaa cttgtttatt gcagcttata atggttacaa ataaagcaat agcatcacaa 2280

atttcacaaa taaagcattt ttttcactgc attctagttg tggtttgtcc aaactcatca 2340

atgtatcttaa 2351

<210> 9

<211> 2147

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed transcriptional unit containing an initiation site

transcription, GPEbolavirus sequence and signal for termination and

polyadenylation

<400> 9

aacagagatcgatctgtttacgcgaattcaccatgggtgttacaggaatattgcagttac 60

ctcgtgatcgattcaagaggacatcattctttctttgggtaattatccttttccaaagaa 120

cattttccat cccgcttgga gttatccaca atagtacatt acaggttagt gatgtcgaca 180

aactagtttg tcgtgacaaa ctgtcatcca caaatcaatt gagatcagtt ggactgaatc 240

tcgaggggaa tggagtggca actgacgtgc catctgtgac taaaagatgg ggcttcaggt 300

ccggtgtccc accaaaggtg gtcaattatg aagctggtga atgggctgaa aactgctaca 360

atcttgaaat caaaaaacct gacgggagtg agtgtctacc agcagcgcca gacgggattc 420

ggggcttccc ccggtgccgg tatgtgcaca aagtatcagg aacgggacca tgtgccggag 480

actttgcctt ccacaaagag ggtgctttct tcctgtatga tcgacttgct tccacagtta 540

tctaccgagg aacgactttc gctgaaggtg tcgttgcatt tctgatactg ccccaagcta 600

agaaggactt cttcagctca caccccttga gagagccggt caatgcaacg gaggacccgt 660

cgagtggcta ttattctacc acaattagat atcaggctac cggttttgga actaatgaga 720

cagagtactt gttcgaggtt gacaatttga cctacgtcca acttgaatca agattcacac 780

cacagtttct gctccagctg aatgagacaa tatatgcaag tgggaagagg agcaacacca 840

cgggaaaact aatttggaag gtcaaccccg aaattgatac aacaatcggg gagtgggcct 900

tctgggaaac taaaaaaaac ctcactagaa aaattcgcag tgaagagttg tctttcacag 960

ctgtatcaaa cggacccaaa aacatcagtg gtcagagtcc ggcgcgaact tcttccgacc 1020

cagagaccaa cacaacaaat gaagaccaca aaatcatggc ttcagaaaat tcctctgcaa 1080

tggttcaagt gcacagtcaa ggaaggaaag ctgcagtgtc gcatctgaca acccttgcca 1140

caatctccac gagtcctcaa cctcccacaa ccaaaacagg tccggacaac agcacccata 1200

atacacccgt gtataaactt gacatctctg aggcaactca agttggacaa catcaccgta 1260

gagcagacaa cgacagcaca gcctccgaca ctccccccgc cacgaccgca gccggaccct 1320

taaaagcaga gaacaccaac acgagtaaga gcgctgactc cctggacctc gccaccacga 1380

caagccccca aaactacagc gagactgctg gcaacaacaa cactcatcac caagataccg 1440

gagaagagag tgccagcagc gggaagctag gcttaattac caatactatt gctggagtag 1500

caggactgat cacaggcggg agaaggactc gaagagaagt aattgtcaat gctcaaccca 1560

aatgcaaccc caatttacat tactggacta ctcaggatga aggtgctgca atcggattgg 1620

cctggatacc atatttcggg ccagcagccg aaggaattta cacagagggg ctaatgcaca 1680

accaagatgg tttaatctgt gggttgaggc agctggccaa cgaaacgact caagctctcc 1740

aactgttcct gagagccaca actgagctgc gaaccttttc aatcctcaac cgtaaggcaa 1800

ttgacttcct gctgcagcga tggggtggca catgccacat tttgggaccg gactgctgta 1860

tcgaaccaca tgattggacc aagaacataa cagacaaaat tgatcagatt attcatgatt 1920

ttgttgataa aacccttccg gaccaggggg acaatgacaa ttggtggaca ggatggagac 1980

aatggatacc ggcaggtatt ggagttacag gtgttataat tgcagttatc gctttattct 2040

gtatatgcaa atttgtcttt tgataaggaa ttctagctgt ttaggcgata tccatgctca 2100

aagaggcctc aattatattt gagtttttaa tttttatgaa aaaaact 2147

<210> 10

<211> 1583

<212> DNA

<213> ArtificialSequence

<220>

<223> Designed transcriptional unit containing an initiation site

transcription, GPEbolavirus sequence modified by

removal of the region encoding the mucin-like domain and the signal for termination and

polyadenylation

<400> 10

aacagagatcgatctgtttacgcgtatgggtgttacaggaatattgcagttacctcgtga 60

tcgattcaagaggacatcattctttctttgggtaattatccttttccaaagaacattttc 120

catcccgcttggagttatccacaatagtacattacaggttagtgatgtcgacaaactagt 180

ttgtcgtgacaaactctcatccacaaatcaattgagatcagttggactgaatctcgaggg 240

gaatggagtggcaactgacgtgccatctgtgactaaaagatggggcttcaggtccggtgt 300

cccaccaaaggtggtcaattatgaagctggtgaatgggctgaaaactgctacaatcttga 360

aatcaaaaaacctgacgggagtgagtgtctaccagcagcgccagacgggattcggggctt 420

cccccggtgccggtatgtgcacaaagtatcaggaacgggaccatgtgccggagactttgc 480

cttccacaaagagggtgctttcttcctgtatgatcgacttgcttccacagttatctaccg 540

aggaacgactttcgctgaaggtgtcgttgcatttctgatactgccccaagctaagaagga 600

cttcttcagctcacaccccttgagagagccggtcaatgcaacggaggacccgtcgagtgg 660

ctattattct accacaatta gatatcaggc taccggtttt ggaactaatg agacagagta 720

cttgttcgag gttgacaatt tgacctacgt ccaacttgaa tcaagattca caccacagtt 780

tctgctccag ctgaatgaga caatatatgc aagtgggaag aggagcaaca ccacgggaaa 840

actaatttgg aaggtcaacc ccgaaattga tacaacaatc ggggagtggg ccttctggga 900

aactaaaaaa aacctcacta gaaaaattcg cagtgaagag ttgtctttca cagctgtatc 960

aaacagaagg actcgaagag aagtaattgt caatgctcaa cccaaatgca accccaattt 1020

acattactgg actactcagg atgaaggtgc tgcaatcgga ttggcctgga taccatattt 1080

cgggccagca gccgaaggaa tttacataga ggggctaatg cacaaccaag atggtttaat 1140

ctgtgggttg aggcagctgg ccaacgaaac gactcaagct ctccaactgt tcctgagagc 1200

cacaactgag ctgcgaacct tttcaatcct caaccgtaag gcaattgact tcctgctgca 1260

gcgatggggt ggcacatgcc acattttggg accggactgc tgtatcgaac cacatgattg 1320

gaccaagaac ataacagaca aaattgatca gattattcat gattttgttg ataaaaccct 1380

tccggaccag ggggacaatg acaattggtg gacaggatgg agacaatgga taccggcagg 1440

tattggagtt acaggtgtta taattgcagt tatcgcttta ttctgtatat gcaaatttgt 1500

cttttgagct agctgtttag gcgatatcca tgctcaaaga ggcctcaatt atatttgagt 1560

ttttaatttt tatgaaaaaa act 1583

<210> 11

<211> 2132

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed transcriptional unit containing an initiation site

transcription, GPBundibugyovirus sequence and signal for termination and

polyadenylation

<400> 11

aacagagatcgatctgtttacgcgtatggagggtcttagcctactccaattgcccagaga 60

taaatttcgaaaaagctctttctttgtttgggtcatcatcttatttcaaaaggccttttc 120

catgcctttgggtgttgtgaccaacagcactttagaagtaacagagattgaccagctagt 180

ctgcaaggatcatcttgcatccactgaccagctgaaatcagttggtctcaacctcgaggg 240

gagcggagtatctactgacatcccatctgcgacaaagcgttggggcttcaggtctggtgt 300

gcctcccaaagtggtcagctatgaagcaggagaatgggctgaaaattgctacaatcttga 360

aataaagaagccggacgggagcgaatgcttacccccaccgccggatggtgtcagaggctt 420

tccaaggtgccgctatgttcacaaagcccaaggaaccgggccctgcccgggtgactatgc 480

ctttcacaaggatggagctttcttcctctatgacaggctggcttcaactgtaatttacag 540

aggagtcaattttgctgagggggtaattgccttcttgatattggctaaaccaaaggaaac 600

gttccttcaatcaccccccattcgagaggcagtaaactacactgagaatacatcaagtta 660

ctatgccacatcctacttggagtacgaaatcgaaaattttggtgctcaacactccacgac 720

ccttttcaaaattaacaacaatacttttgttcttctggacaggccccacacgcctcagtt 780

ccttttccagctgaatgataccattcaccttcaccaacagttgagcaacacaactgggaa 840

actaatttggacactagatgctaatatcaatgctgatattggtgaatgggctttttggga 900

aaataaaaaaaatctctccgaacaactacgtggagaagagctgtctttcgaaactttatc 960

gctcaacgagacagaagacgatgatgcgacatcgtcgagaactacaaagggaagaatctc 1020

cgaccgagccaccaggaagtattcggacctggttccaaaggattcccctgggatggtttc 1080

attgcacgtaccagaaggggaaacaacattgccgtctcagaattcgacagaaggacgaag 1140

agtagatgtgaatactcaggaaactatcacagagacaactgcaacaatcataggcactaa 1200

cggtaacaacatgcagatcagcaccatcgggacaggactgagctccagccaaatcctgag 1260

ttcctcaccgaccatggcaccaagccctgagactcagacctccacaacctacacaccaaa 1320

actaccagtgatgaccaccgaggaaccaacaacaccaccgagaaactctcctggctcaac 1380

aacagaagcacccactctcaccaccccagagaatataacaacagcggtgaaaactgtttt 1440

gccacaagagtccacaagcaacggtctaataacttcaacagtaacaggtattcttgggag 1500

ccttggacttcgaaaacgcagcagaagacaagttaacaccagggccacgggtaaatgcaa 1560

tcccaacttacactactggactgcacaagaacaacataatgctgctgggattgcctggat 1620

cccgtactttggaccgggtgcagaaggcatatacactgaaggccttatgcacaaccaaaa 1680

tgccttagtctgtggactcagacaacttgcaaatgaaaccactcaagctctgcagctttt 1740

cttaagggccacgacggagctgcggacatataccatactcaataggaaggccatagattt 1800

ccttctgcgacgatggggcgggacatgtaggatcctgggaccagattgttgcattgagcc 1860

acatgattggaccaaaaacatcactgataaaatcaaccaaatcatccatgatttcatcga 1920

caaccctttacccaatcaggataatgatgataattggtggacgggctggagacagtggat 1980

ccctgcaggaataggcattactggaattattattgcaatcattgctcttctttgcgtctg 2040

caagctgctttgttgagctagctgtttaggcgatatccatgctcaaagaggcctcaatta 2100

tatttgagtt tttaattttt atgaaaaaaa ct 2132

<210> 12

<211> 1586

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed transcriptional unit containing an initiation site

transcription, GPBundibugyovirus sequence modified by

removal of the region encoding the mucin-like domain and the signal for termination and

polyadenylation

<400> 12

aacagagatcgatctgtttacgcgtatggagggtcttagcctactccaattgcccagaga 60

taaatttcgaaaaagctctttctttgtttgggtcatcatcttatttcaaaaggccttttc 120

catgcctttgggtgttgtgaccaacagcactttagaagtaacagagattgaccagctagt 180

ctgcaaggatcatcttgcatccactgaccagctgaaatcagttggtctcaacctcgaggg 240

gagcggagtatctactgacatcccatctgcgacaaagcgttggggcttcaggtctggtgt 300

gcctcccaaagtggtcagctatgaagcaggagaatgggctgaaaattgctacaatcttga 360

aataaagaagccggacgggagcgaatgcttacccccaccgccggatggtgtcagaggctt 420

tccaaggtgccgctatgttcacaaagcccaaggaaccgggccctgcccgggtgactatgc 480

ctttcacaaggatggagctttcttcctctatgacaggctggcttcaactgtaatttacag 540

aggagtcaattttgctgagggggtaattgccttcttgatattggctaaaccaaaggaaac 600

gttccttcaatcaccccccattcgagaggcagtaaactacactgagaatacatcaagtta 660

ctatgccacatcctacttggagtacgaaatcgaaaattttggtgctcaacactccacgac 720

ccttttcaaaattaacaacaatacttttgttcttctggacaggccccacacgcctcagtt 780

ccttttccagctgaatgataccattcaccttcaccaacagttgagcaacacaactgggaa 840

actaatttggacactagatgctaatatcaatgctgatattggtgaatgggctttttggga 900

aaataaaaaaaatctctccgaacaactacgtggagaagagctgtctttcgaaactttatc 960

gctcaacaaacgcagcagaagacaagttaacaccagggccacgggtaaatgcaatcccaa 1020

cttacactactggactgcacaagaacaacataatgctgctgggattgcctggatcccgta 1080

ctttggaccgggtgcagaaggcatatacactgaaggccttatgcacaaccaaaatgcctt 1140

agtctgtggactcagacaacttgcaaatgaaaccactcaagctctgcagcttttcttaag 1200

ggccacgacggagctgcggacatataccatactcaataggaaggccatagatttccttct 1260

gcgacgatggggcgggacatgtaggatcctgggaccagattgttgcattgagccacatga 1320

ttggaccaaaaacatcactgataaaatcaaccaaatcatccatgatttcatcgacaaccc 1380

tttacccaatcaggataatgatgataattggtggacgggctggagacagtggatccctgc 1440

aggaataggcattactggaattattattgcaatcattgctcttctttgcgtctgcaagct 1500

gctttgttgagctagctgtttaggcgatatccatgctcaaagaggcctcaattatatttg 1560

agtttttaat ttttatgaaa aaaact 1586

<210> 13

<211> 2131

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed transcriptional unit containing an initiation site

transcription, GPSudanvirus sequence and signal for termination and

polyadenylation

<400> 13

aacagagatcgatctgtttacgcgtatggttacatcaggaattctacaattgccccgtga 60

acgcttcaggaaaacatcattttttgtttgggtaataatcctattccataaggttttccc 120

tatcccattgggcgtagttcacaacaacactctccaggtaagtgatatagataaattggt 180

gtgccgggataaactttcctccacaagtcaactgaaatcggtcgggcttaacctagaagg 240

taatggagttgccacagatgtaccaacagcaacgaagagatggggattccgagccggtgt 300

tccacccaaagtggtgaactacgaggctggggagtgggctgaaaactgctacaacctgga 360

catcaagaaagcagatggtagcgaatgcctacctgaagcccctgagggtgtaagaggctt 420

ccctcgctgccgttatgtgcacaaggtttctggaacagggccgtgtcctgaaggtttcgc 480

tttccacaaagaaggcgctttcttcctgtatgatcgactggcatcaacaatcatctatcg 540

aagcaccacgttttcagaaggtgttgtggctttcttgatcctccccaagactaaaaagga 600

ctttttccaatcaccaccactacatgaaccggccaatatgacaacagacccatccagcta 660

ctaccacacagtcacacttaattatgtggctgacaattttgggaccaatatgactaactt 720

tctgtttcaagtggatcatctaacttatgtgcaacttgaaccaagattcacaccacaatt 780

tcttgtccaactcaatgagaccatttatactaatgggcgtcgcagcaacaccacaggaac 840

actaatttggaaagtaaatcctactgttgacaccggcgtaggtgaatgggccttctggga 900

aaataaaaaaaacttcacaaaaaccctttcaagtgaagagctgtctgtcatacttgtacc 960

aagagcccaggatccaggcagcaaccagaagacgaaggtcactcccaccagcttcgccaa 1020

caaccaaacctccaagaaccacgaagacttggttccaaaggatcccgcttcagtcgttca 1080

agtgcgagacctccagagggaaaacacagtgccgacctcacccttgaacacagtccccac 1140

aactctgatccccgacacaatggaagagcaaaccaccagccactacgaactaccaaacat 1200

ttccggaaaccatcaagagaggaacaacaccgcacaccccgaaactctcgccaacaatcc 1260

tccagacaacacaaccccttcgacaccacctcaagacggtgagcggacaagttcccacac 1320

aacaccctccccccgcccagtcccaaccagcacaatccatcccaccacacgagagactca 1380

aattcccaccacaatgataacaagccatgatactgacagtaatcgacccaacccaattga 1440

catcagcgagtctacagagccaggactactcaccaacaccataagaggggttgcaaattt 1500

gctgacaggttcaagaagaacccggagggaaatcaccttgagaacacaagccaaatgtaa 1560

tccgaacctacactattggacaacccaagatgaaggggctgccattggtctagcctggat 1620

accttacttcgggcccgcagcagagggaatttatacggaaggaataatgcacaatcaaaa 1680

tgggctaatttgcgggttgaggcaactagcaaatgagacgactcaagccctacagttatt 1740

cttgcgtgctaccacggaattgcgcactttctccatattgaatcgaaaagccatcgactt 1800

cttacttcaaagatggggaggaacgtgccacatcttaggcccagattgctgtattgagcc 1860

ccatgattggactaagaacattactgacaagatagatcaaatcattcatgatttcattga 1920

taaacctctaccagatcagacagataatgacaattggtggacagggtggaggcaatgggt 1980

tcctgctgggattgggatcacgggggtaataatcgcagttatagcactgctgtgtatttg 2040

caaatttctactctagctagctgtttaggcgatatccatgctcaaagaggcctcaattat 2100

atttgagttt ttaattttta tgaaaaaaac t 2131

<210> 14

<211> 1582

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed transcriptional unit containing an initiation site

transcription, GPSudanvirus sequence modified by

removal of the region encoding the mucin-like domain and the signal for termination and

polyadenylation

<400> 14

aacagagatcgatctgtttacgcgtatggttacatcaggaattctacaattgccccgtga 60

acgcttcaggaaaacatcattttttgtttgggtaataatcctattccataaggttttccc 120

tatcccattgggcgtagttcacaacaacactctccaggtaagtgatatagataaattggt 180

gtgccgggataaactttcctccacaagtcaactgaaatcggtcgggcttaacctagaagg 240

taatggagttgccacagatgtaccaacagcaacgaagagatggggattccgagccggtgt 300

tccacccaaagtggtgaactacgaggctggggagtgggctgaaaactgctacaacctgga 360

catcaagaaagcagatggtagcgaatgcctacctgaagcccctgagggtgtaagaggctt 420

ccctcgctgccgttatgtgcacaaggtttctggaacagggccgtgtcctgaaggtttcgc 480

tttccacaaagaaggcgctttcttcctgtatgatcgactggcatcaacaatcatctatcg 540

aagcaccacgttttcagaaggtgttgtggctttcttgatcctccccaagactaaaaagga 600

ctttttccaatcaccaccactacatgaaccggccaatatgacaacagacccatccagcta 660

ctaccacacagtcacacttaattatgtggctgacaattttgggaccaatatgactaactt 720

tctgtttcaagtggatcatctaacttatgtgcaacttgaaccaagattcacaccacaatt 780

tcttgtccaactcaatgagaccatttatactaatgggcgtcgcagcaacaccacaggaac 840

actaatttggaaagtaaatcctactgttgacaccggcgtaggtgaatgggccttctggga 900

aaataaaaaaaacttcacaaaaaccctttcaagtgaagagctgtctgtcatacttgtacc 960

aagaagaagaacccggagggaaatcaccttgagaacacaagccaaatgtaatccgaacct 1020

acactattggacaacccaagatgaaggggctgccattggtctagcctggataccttactt 1080

cgggcccgcagcagagggaatttatacggaaggaataatgcacaatcaaaatgggctaat 1140

ttgcgggttgaggcaactagcaaatgagacgactcaagccctacagttattcttgcgtgc 1200

taccacggaattgcgcactttctccatattgaatcgaaaagccatcgacttcttacttca 1260

aagatggggaggaacgtgccacatcttaggcccagattgctgtattgagccccatgattg 1320

gactaagaac attactgaca agatagatca aatcattcat gatttcattg ataaacctct 1380

accagatcag acagataatg acaattggtg gacagggtgg aggcaatggg ttcctgctgg 1440

gattgggatc acgggggtaa taatcgcagt tatagcactg ctgtgtattt gcaaatttct 1500

actctagcta gctgtttagg cgatatccat gctcaaagag gcctcaatta tatttgagtt 1560

tttaattttt atgaaaaaaa ct 1582

<210> 15

<211> 2147

<212> DNA

<213> Artificial Sequence

<220>

<223> Designed transcriptional unit containing an initiation site

transcription, GPMarburgvirus sequence and signal for termination and

polyadenylation

<400> 15

aacagagatcgatctgtttacgcgtatgtggactacatgcttctttatcagtctcatctt 60

aatccaagggataaaaactctccctattttggagatagccagtaacgatcaaccccaaaa 120

tgtggattcggtatgctccggaactctccagaaaactgaagacgtccatctgatgggatt 180

tacactgagcggtcagaaagttgctgattcccctttggaggcatccaagcgatgggcttt 240

caggacaggtgtacctcctaagaatgttgagtatacggaaggggaggaagccaaaacatg 300

ctacaatataagtgtaacggatccctctggaaaatccttgctgttagatcctcccaccaa 360

cgtccgagactatcctaaatgcaagactatccatcacattcaaggtcaaaaccctcatgc 420

gcaggggattgccctccatttgtggggagcatttttcctatatgatcgcattgcctccac 480

aacaatgtaccgaggcaaagtcttcactgaagggaacatagcagccatgattgtcaataa 540

gacagtgcacaaaatgattttctcgcgtcaaggacaagggtatcgtcacatgaatctgac 600

ttctactaacaagtattggacaagtagcaacggaacgcaaacaaatgacactggatgttt 660

cggtactcttcaagaatacaattctacgaagaaccaaacatgtgctccgtctaaaacacc 720

cccaccaccgcccacagcccatccggagatcaaacccacaagcaccccaaccgatgccac 780

tagactcaacaccacaaacccaaacagtgatgatgaggatctcacaacatccggctcggg 840

gtctggggaacaggaaccctatacgacttctgatgcggtcactaagcaagggctttcatc 900

aacaatgccacccactccctcaccgcaaccaggcacgccacagcagggaggaaacaacac 960

aaaccactcccaggacgctgcaactgaacttgacaacaccaatacaactgcacaacctcc 1020

catgccttcccacaacacgaccacaatctcgaccaacaacacgtccaaacacaacctcag 1080

caccctctccgaaccaccacaaaacaccaccaatcccaacacacacaaagcatggccactga 1140

aaatgagaaaaccagtgcccctccgaaaacaaccctgcctccaacagaaagtcctaccac 1200

agaaaagagcaccaacaatacaaaaagccccaccacaatggaaccaaatacaacaaatgg 1260

acatttcact agtccctcct ccacctccaa ctcgactact caacatctta tctacttcag 1320

gaggaaacga agtatcctct ggagggaagg cgatatgttc cctttcctag atgggttaat 1380

aaatgctcca attgattttg atccagttcc aaatacaaag acaatctttg atgaatcttc 1440

tagttctggt gcttcagccg aggaagatca acatgcatcc tccaatatca gcttgacttt 1500

atcttatctt cctcatacaa gtgaaaacac tgcctactct ggagagaatg aaaatgattg 1560

tgatgcagag ctaagaattt ggagcgttca ggaggacgac ctggcagcag ggctcagttg 1620

gataccattc ttcggccctg gaatcgaagg actttatacc gctggtttaa tcaagaacca 1680

aaacaatttg gtctgcaggt tgaggcgtct agccaatcaa actgcaaaat ctttggaact 1740

cttactaagg gtcacaaccg aggaaagaac attttccttg atcaatagac atgctattga 1800

ctttctactc acaaggtggg gaggaacatg caaagtgctt ggacctgatt gttgcatagg 1860

aatagaggac ttgtccagaa atatttcaga acagattgac caaatcaaga aggacgaaca 1920

aaaagagggg actggttggg gtctgggtgg taagtggtgg acatccgact ggggtgttct 1980

tactaacttg ggcatcttgc tactattgtc catagctgtc ttgattgctc tatcctgtat 2040

ttgtcgtatc ttcactaaat atattggata ggctagctgt ttaggcgata tccatgctca 2100

aagaggcctc aattatattt gagtttttaa tttttatgaa aaaaact 2147

<210> 16

<211> 1574

<212> DNA

<213> ArtificialSequence

<220>

<223> Designed transcriptional unit containing an initiation site

transcription, sequence GPMarburgvirus, modified by

removal of the region encoding the mucin-like domain and the signal for termination and

polyadenylation

<400> 16

aacagagatcgatctgtttacgcgtatgtggactacatgcttctttatcagtctcatctt 60

aatccaagggataaaaactctccctattttggagatagccagtaacgatcaaccccaaaa 120

tgtggattcggtatgctccggaactctccagaaaactgaagacgtccatctgatgggatt 180

tacactgagcggtcagaaagttgctgattcccctttggaggcatccaagcgatgggcttt 240

caggacaggtgtacctcctaagaatgttgagtatacggaaggggaggaagccaaaacatg 300

ctacaatataagtgtaacggatccctctggaaaatccttgctgttagatcctcccaccaa 360

cgtccgagactatcctaaatgcaagactatccatcacattcaaggtcaaaaccctcatgc 420

gcaggggattgccctccatttgtggggagcatttttcctatatgatcgcattgcctccac 480

aacaatgtaccgaggcaaagtcttcactgaagggaacatagcagccatgattgtcaataa 540

gacagtgcacaaaatgattttctcgcgtcaaggacaagggtatcgtcacatgaatctgac 600

ttctactaacaagtattggacaagtagcaacggaacgcaaacaaatgacactggatgttt 660

cggtactcttcaagaatacaattctacgaagaaccaaacatgtgctccgtctaaaacacc 720

cccaccaccgcccacagctcatccgaggaggaaacgaagtatcctctggagggaaggcga 780

tatgttccctttcctagatgggttaataaatgctccaattgattttgatccagttccaaa 840

tacaaagacaatctttgatgaatcttctagttctggtgcttcagccgaggaagatcaaca 900

tgcatcctccaatatcagcttgactttatcttatcttcctcatacaagtgaaaacactgc 960

ctactctggagagaatgaaaatgattgtgatgcagagctaagaatttggagcgttcagga 1020

ggacgacctggcagcagggctcagttggataccattcttcggccctggaatcgaaggact 1080

ttataccgctggtttaatcaagaaccaaaacaatttggtctgcaggttgaggcgtctagc 1140

caatcaaactgcaaaatctttggaactcttactaagggtcacaaccgaggaaagaacatt 1200

ttccttgatcaatagacatgctattgactttctactcacaaggtggggaggaacatgcaa 1260

agtgcttggacctgattgttgcataggaatagaggacttgtccagaaatatttcagaaca 1320

gattgaccaaatcaagaaggacgaacaaaaagaggggactggttggggtctgggtggtaa 1380

gtggtggacatccgactggggtgttcttactaacttgggcatcttgctactattgtccat 1440

agctgtcttgattgctctatcctgtatttgtcgtatcttcactaaatatattggataggc 1500

tagctgtttaggcgatatccatgctcaaagaggcctcaattatatttgagtttttaattt 1560

ttatgaaaaa aact 1574

<---

Claims (10)

1. Immunobiological agent for inducing an immune response to human pathogenic filoviruses, comprising a base representing a recombinant human adenovirus of serotype 26, containing an expression cassette SEQIDNO: 1, or SEQIDNO: 2, or SEQIDNO: 3, or SEQIDNO: 4, or SEQIDNO: 5, or SEQIDNO: 6, or SEQIDNO: 7, or SEQIDNO: 8. 2. Immunobiological agent for inducing an immune response to human pathogenic filoviruses, comprising a base representing a recombinant human adenovirus serotype 5 containing an expression cassette SEQIDNO: 1, or SEQIDNO: 2, or SEQIDNO: 3, or SEQIDNO: 4, or SEQIDNO: 5, or SEQIDNO: 6, or SEQIDNO: 7, or SEQIDNO: 8. 3. Immunobiological agent for inducing an immune response to human pathogenic filoviruses, comprising a recombinant vesicular stomatitis virus framework containing a nucleic acid corresponding to the cDNA SEQIDNO: 9, or SEQIDNO: 10, or SEQIDNO: 11, or SEQIDNO: 12, or SEQIDNO: 13, or SEQIDNO: 14, or SEQIDNO: 15, or SEQIDNO: 16. 4. A method of using the immunobiological agent according to claims 1 to 3, which consists in introducing the immunobiological agent according to claims 1 to 3 into the mammalian body in an effective amount to induce an immune response to human pathogenic filoviruses. 5. The method of use according to claim 4, where any of the immunobiological agents according to claim 1, or 2, or 3 is sequentially introduced into the mammalian organism, and then any of the immunobiological agents according to claim 1, or 2, or 3 is administered with an interval of more than in 1 week. 6. The method of use according to claim 4, wherein any of the immunobiological agents according to claim 1, or 2, or 3 and any of the immunobiological agents according to claim 1, or 2, or 3 are simultaneously administered to the mammalian organism. 7. The method of use according to claim 4, wherein the method of administration of the immunobiological agent is intranasal and / or subcutaneous and / or intramuscular. 8. A method of use according to claim 4, comprising introducing into the mammalian body a composition containing any number of immunobiological agents according to any one of claims 1 to 3. 9. A method of use according to claim 8, characterized in that the composition is administered multiple times at intervals of more than 1 week. 10. Immunobiological agent for the induction of an immune response to human pathogenic filoviruses according to PP. 1-3, where the filoviruses are Ebola and / or Marburg viruses.