RU2759427C2 - Subunit vaccine against mycoplasma spp - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, specifically to producing subunit vaccines against Mycoplasma spp.; it can be used in medicine for the prevention of Mycoplasma spp. infection. Vaccine compositions based on EutD protein with SEQ ID NO: 10 in combination with a pharmaceutically acceptable adjuvant or pharmaceutically acceptable additive are proposed.

EFFECT: invention provides for strong immune effects against Mycoplasma spp.

6 cl, 4 dwg, 9 tbl, 3 ex

Description

The technical field to which the invention relates

This disclosure relates to a vaccine against Mycoplasma spp .; in particular, the subunit vaccine against Mycoplasma spp.

State of the art

Mycoplasma spp. is currently known as the smallest bacterium capable of self-replication outside the cells of the host. While porcine enzootic pneumonia should not kill the pig, it reduces feeding efficiency and causes growth retardation, inflammation and immunosuppression, and makes the pig more susceptible to infection with other pathogens, thereby resulting in economic damage to production.

Currently, porcine enzootic pneumonia is prevented by three main strategies, including: drug administration, environmental control and vaccination. Given the poor preventive efficacy of antibiotics from Mycoplasma hyopneumoniae , drug administration can only be used for treatment purposes, and meeting prophylaxis needs is difficult. In addition, in view of the fact that drug dependence can lead to a more severe infection caused by drug-resistant bacteria, the administration of the drug requires precautions and there are many restrictions.

Environmental monitoring forms the basis for the prevention of Mycoplasma spp. Good sanitation and management of the pig housing would be beneficial in reducing the incidence of infection. On the other hand, prevention could be more complete with vaccination.

Conventional vaccines in the art use inactive / dead bacteria as an active ingredient. However, the cost of conventional vaccines is too high due to the fact that Mycoplasma spp. are whimsical bacteria and are difficult to cultivate in the laboratory. In order to reduce the cost of Mycoplasma spp. Vaccines, scientists are constantly trying to develop vaccines of various types, such as: (1) attenuated vaccines, (2) vector vaccines, (3) subunit vaccines, and (4) DNA vaccines. Among them, subunit vaccines show the greatest efficacy due to advantages in ease of manufacture and high safety.

To date, there are several potential candidate proteins that could be used for M. hyopneumoniae vaccines; however, there are no additional reports confirming that such proteins are useful for M. hyopneumoniae vaccines.

Brief description of the invention

In light of the above, one of the objects of the present invention is to provide antigens suitable for use in M. hyopneumoniae vaccines, thereby obtaining new M. hyopneumoniae vaccines, so that the cost of prophylaxis can be reduced.

Another object of the present invention is to provide a combination of antigens that are suitable for use in M. hyopneumoniae vaccines, thereby obtaining subunit vaccines with better characteristics; as a consequence, there will be more options for prevention.

To solve the above objects, the present invention relates to a recombinant protein for the prevention of Mycoplasma spp. Infection, comprising the amino acid sequence of SEQ ID NO: 08, SEQ ID NO: 09, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 , SEQ ID NO: 13, SEQ ID NO: 14, or a combination thereof.

The present invention also relates to a composition for the prevention of Mycoplasma spp. Infection, comprising: an active ingredient comprising the protein PdhA, XylF, EutD, Mhp145, P78, P132, Mhp389, or a combination thereof; and a pharmaceutically acceptable adjuvant.

Preferably, said active ingredient has a concentration of 50 to 3500 μg / ml, based on the total volume of said composition.

Preferably, said active ingredient contains at least two proteins selected from the group consisting of PdhA, XylF, EutD, Mhp145, P78, P132 and Mhp389.

Preferably, said active ingredient contains PdhA and P78.

Preferably, said active ingredient contains XylF and Mhp145.

Preferably, said pharmaceutically acceptable adjuvant is Freund's complete adjuvant, Freund's incomplete adjuvant, alumogel, surfactant, polyanionic adjuvant, peptide, oil emulsion, or a combination thereof.

Preferably, said composition further comprises a pharmaceutically acceptable additive.

Preferably, said pharmaceutically acceptable additive is a solvent, stabilizer, diluent, preservative, antibacterial agent, antifungal agent, isotonic agent, absorption delaying agent, or a combination thereof.

The present invention further relates to a composition for the prevention of Mycoplasma spp. Infection, comprising: an active ingredient comprising the amino acid sequence of SEQ ID NO: 08, SEQ ID NO: 09, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 , SEQ ID NO: 13, SEQ ID NO: 14, or a combination thereof; and a pharmaceutically acceptable adjuvant.

Preferably, said active ingredient has a concentration of 50 to 3500 μg / ml, based on the total volume of said composition.

Preferably, said active ingredient contains at least two amino acid sequences selected from the group consisting of SEQ ID NO: 08, SEQ ID NO: 09, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14.

Preferably, said active ingredient contains the amino acid sequences of SEQ ID NO: and SEQ ID NO: 12.

Preferably, said active ingredient contains the amino acid sequences of SEQ ID NO: 09 and SEQ ID NO: 11.

Preferably, said composition further comprises a pharmaceutically acceptable additive. Preferably, said pharmaceutically acceptable additive is a solvent, stabilizer, diluent, preservative, antibacterial agent, antifungal agent, isotonic agent, absorption delaying agent, or a combination thereof.

The present invention also relates to an expression vector for the prevention of infection with Mycoplasma spp., Comprising: a plasmid; where the specified plasmid contains: a nucleotide sequence containing at least one sequence selected from the group consisting of SEQ ID NO: 01, SEQ ID NO: 02, SEQ ID NO: 03, SEQ ID NO: 04, SEQ ID NO: 05 , SEQ ID NO: 06 and SEQ ID NO: 07; and a regulatory element.

Preferably, said regulatory element contains a promoter and a ribosome binding site.

Preferably, said plasmid is pET-MSY, pET-YjgD, pET-D or pET-SUMO.

Preferably, said plasmid further comprises a gene encoding a fusion partner.

Preferably, said fusion partner is a MsyB E. coli, YjgD E. coli, protein D of bacteriophage lambda or SUMO S. cerevisiae.

Preferably, said expression vector is used in an E. coli gene expression system.

In general, the present invention relates to antigens that are suitable for use as an active ingredient in a M. hyopneumoniae subunit vaccine / composition and to a M. hyopneumoniae subunit vaccine prepared therefrom. The subunit vaccine of the present invention can not only be effectively used for prophylactic purposes to reduce its cost, the disclosure of the present invention also demonstrates that a `` cocktail '' subunit vaccine (i.e., having at least two antigens as active ingredients) using at least the two antigens of the present invention has an improved induction of an immune response.

Brief Description of Drawings

Figure 1 shows the result of two-dimensional electrophoresis of proteins in gel, carried out in the 1st example of the present invention.

Figure 2 shows the result of the color reaction of the Western blot carried out in the 1st example of the present invention.

Figure 3 shows the result of electrophoresis of PCR products obtained in the 2nd example of the present invention.

Figure 4 shows recordings of stimulation experiments conducted in the 3rd example of the present invention.

Detailed description of the invention

One of the key objectives of the present invention was to review potential candidate antigens suitable for subunit vaccines using two-dimensional protein gel electrophoresis along with immunological screening technology, and to identify antigens by mass spectrometer. Then, the performance of the subunit vaccines of this invention was confirmed by animal model experiments.

Briefly, the progress of the present invention was as follows:

(1) Induction of an immune response in experimental pigs by injecting a conventional M. hyopneumoniae vaccine and obtaining serum containing antibodies to M. hyopneumoniae . (2) Preparation of M. hyopneumoniae total protein for two-dimensional protein gel electrophoresis. (3) Conducting hybridization of the result of two-dimensional electrophoresis of proteins in the gel of step (2) using the serum of step (1) as the 1st antibody and then collecting proteins that are positive (i.e., candidate antigens) from the gel after amplification with the 2nd antibody and the subsequent procedure visualization. (4) Identification of candidate antigens obtained in step (3). (5) Expression of these candidate antigens in large quantities using an E. coli gene expression system. (6) Investigation of the efficacy of the subunit vaccines of the present invention in reducing lung lesions by stimulating pigs and thereby testing the value of said candidate antigens when using the subunit vaccine as an active ingredient.

Composition for the prevention of infection with Mycoplasma spp. according to this invention contains an active ingredient and a pharmaceutically acceptable adjuvant. In one embodiment of the present invention, said active ingredient may be PdhA, XylF, EutD, Mhp145, P78, P132, or Mhp389. In an alternative embodiment, provided that the antigenic determinant of any of the above proteins is not disturbed, said active ingredient may be a fusion protein of any two of the above proteins. In another alternative embodiment, the specified active ingredient contains at least two of the above proteins; that is, it is the so-called "cocktail" vaccine according to the present invention.

In another embodiment of the present invention, said active ingredient may comprise the amino acid sequence of SEQ ID NO: 08, SEQ ID NO: 09, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 or a combination of both. In an alternative embodiment, provided that the antigenic determinant formed by the folding of the peptide of the specified amino acid sequence is not disturbed, the specified active ingredient may be a fusion protein with at least two of the specified sequences. In another alternative embodiment, the specified active ingredient contains two or more proteins, respectively containing one of the above amino acid sequences; that is, it is the so-called "cocktail" vaccine according to the present invention.

Said pharmaceutically acceptable adjuvant is used to improve the immune effect of said active ingredient by stabilizing said active ingredient and / or increasing the safety of vaccines. Said pharmaceutically acceptable adjuvant of this invention includes, but is not limited to: Freund's complete adjuvant, Freund's incomplete adjuvant, alumogel, surfactant, polyanionic adjuvant, peptide, oil emulsion, or a combination thereof.

The composition according to this invention may have one or at least two of the specified active ingredients (ie, cocktail vaccine). In one example of a composition according to the invention, said active ingredient has a concentration of 50 to 3500 μg / ml, based on the total volume of said composition. In a preferred embodiment of the invention, when said composition contains only one specified active ingredient, said active ingredient has a concentration of 50 to 500 μg / ml, based on the total volume of said composition. In an alternative embodiment of this invention, the composition according to this invention contains at least one specified active ingredient; where the total concentration of the specified active ingredient (s) contained in the specified composition is from 50 to 1000 μg / ml, from 50 to 1500 μg / ml, from 50 to 2000 μg / ml, from 50 to 2500 μg / ml, from 50 up to 3000 μg / ml or from 50 to 3500 μg / ml, based on the total volume of the specified composition.

Another aspect of the present invention is to provide an expression vector for the prevention of Mycoplasma spp. Infection. Specifically, said expression vector can be used for an E. coli gene expression system. However, without departing from the basic idea of the present invention, one of ordinary skill in the art can modify these vectors based on this discovery and make the specified vector suitable for another gene expression system, which will still be within the scope of this invention.

The specified expression vector contains a plasmid. The specified plasmid contains: a nucleotide sequence containing at least one sequence selected from the group consisting of SEQ ID NO: 01, SEQ ID NO: 02, SEQ ID NO: 03, SEQ ID NO: 04, SEQ ID NO: 05, SEQ ID NO: 06, SEQ ID NO: 07 and combinations thereof; and a regulatory element.

The specified vector is used in the gene expression system of E. coli and for the production of antigens according to this invention by E. coli . In other words, the specified nucleotide sequence can be translated into the amino acid sequence of the antigen of the present invention by the E. coli gene expression system, and then the amino acid sequence can be folded into the antigen of the present invention.

In an alternative embodiment, provided that the operation of the E. coli gene expression system is not blocked and the production of the specified nucleotide sequence and the folding of the resulting amino acid sequence are not disturbed, the specified plasmid may contain two or more of the specified nucleotide sequences.

The specified regulatory element refers to the element required to initiate transcription and translation in the expression system. The specified regulatory element should at least contain a promoter and a ribosome binding site. Preferably, said regulatory element may further comprise: an operator, enhancer sequence, or a combination thereof.

In a preferred embodiment of the present invention, said plasmid further comprises a gene encoding a fusion partner. Said fusion partner includes, but is not limited to E. coli MsyB, E. coli YjgD, bacteriophage lambda protein D, or S. cerevisiae SUMO. Said MsyB has a high content of acidic amino acids and should help to improve the solubility of proteins to be produced.

The following examples set out the tests and experiments of the present invention in order to further explain the features and advantages of the present invention. It should be noted that the following examples are illustrative and should not be used to limit the scope of the invention.

Example 1: Screening for candidate antigens suitable for use as an active ingredient in a subunit vaccine.

Preparation of serum containing anti-porcine antibody Mycoplasm spp.

According to research, seven Mycoplasm spp can be isolated from pigs: Mycoplasm hyopneumoniae , Mycoplasma hyorhinis , Mycoplasma hyosynoviae , Mycoplasma flocculare , Mycoplasma hyopharyngis , Mycoplasma sualvi , Mycoplasma bovigenitalium (Gourlay et al., 1978; Blanko Assassin et al., 1978; Blanko et al., 2005). Among them, M. hyopneumoniae is the main pathogen of porcine enzootic pneumonia with an incidence rate of 25 to 93%. Consequently, the present invention used M. hyopneumoniae (strain PRIT-5) for immune proteomic studies and as sources of genes encoding antigens. Friis's medium (Friis et al., 1975) was used to cultivate M. hyopneumoniae . In accordance with the experimental design, an appropriate amount of antibiotic or 1.5% agar was added to form a solid medium.

Three 4 week old SPF pigs were brought from the Agricultural Technology Research Institute and were fed the same feed and kept under the same environmental and growth conditions in a pigsty prior to experiments. After the pigs were fed to 32 days, 46 days and 60 days of age, the pigs were injected with 2 ml of Bayovac® MH-PRIT-5 vaccine ( M. hyopneumoniae PRIT-5) by intramuscular injection. The pigs were then fed continuously until the age of 74 days and bled from their jugular vein. The collected blood was placed at room temperature for 1 hour and stored at 4 ° C. The next day, the collected blood was centrifuged at 1107 × g for 30 minutes and the supernatant was removed to clean the tube and stored at -20 ° C.

Two-dimensional protein gel electrophoresis of Mycoplasm spp.

The ReadyPrepTM (total protein) protein isolation kit (Bio-Rad, CA, USA) was used to isolate the total protein of Mycoplasm spp. Subsequently, the concentration of the collected protein was determined using a Bio-Rad RC DC Protein Assay Kit (CA, USA). The detailed protocol can be taken from the product description or can be modified from well known protocols in the art.

Two-dimensional protein gel electrophoresis was performed in two stages: isoelectric focusing (IEF) and gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE electrophoresis). IEF was performed to separate proteins in a sample depending on their isoelectric point; SDS-PAGE electrophoresis was performed to separate proteins according to their molecular weight. See figure 1, which shows the result of two-dimensional protein gel electrophoresis.

Hybridization.

The serum obtained in step (1) was used as the 1st antibody for hybridization with the result of two-dimensional protein gel electrophoresis in step (2). After the proteins were amplified with the 2nd antibody and visualized by a subsequent imaging procedure, proteins that were positive were collected. These proteins were recognized by the anti- Mycoplasm spp. and therefore could be useful as candidate antigens for an active ingredient in subunit vaccines.

Hybridization was performed by Western blotting. Briefly, the 2D gel after electrophoresis was transferred to a PVDF membrane. The membrane was then incubated and hybridized sequentially with 1st antibody (serum containing anti- Mycoplasm spp. Antibody) and 2nd antibody (AP-conjugated anti-porcine IgG). Subsequently, a color reaction was carried out using an NBT / BCIP solution.

The result of the color reaction of the Western blot is shown in Figure 2; where 10 proteins positive for immunohybridization with an antibody to Mycoplasm spp. were designated as candidate antigens for use as active ingredients of subunit vaccines.

Identification of the received candidate antigens.

According to the color reaction of Western blotting, the gel corresponding to the positive position on the membrane was cut into micropeptide and analyzed by mass spectroscopy. The resulting mass spectroscopic data were then combined with the amino acid sequence and protein database to identify these proteins.

See the following Table 1 for the 10 indicated proteins that are positive for immunohybridization with an antibody to Mycoplasm spp.

Table 1:
10 proteins positive for immunohybridization with antibody to Mycoplasm spp. and their amino sequence. Candidate Name SEQ ID NO 1 XylF (xylose binding lipoprotein) SEQ ID NO: 09 2 XylF (xylose binding lipoprotein) SEQ ID NO: 09 3 XylF (xylose binding lipoprotein) SEQ ID NO: 09 4 PdhA (E1-alpha subunit of pyruvate dehydrogenase) SEQ ID NO: 5 Mhp145 (periplasmic sugar binding protein) SEQ ID NO: 11 6 EutD (phosphotransacetylase) SEQ ID NO: 10 7 EutD (phosphotransacetylase) SEQ ID NO: 10 eight Mhp389 SEQ ID NO: 14 nine P78 (lipoprotein) SEQ ID NO: 12 ten P132 SEQ ID NO: 13 * XylF and EutD have different states of charge in cells and therefore become 3 and 2 positive positions on the membrane.

Example 2 Expression of Specified Antigen Candidates in Large Amounts by a Gene Expression System E. coli ...

Escherichia coli JM109 was used as host cells for cloning, and Escherichia coli BL21 (DE3) was used as host cells for protein expression. Escherichia coli cells were cultured in LB medium (Luria-Bertani; Difco, Michigan, USA). In accordance with the experimental design, an appropriate amount of antibiotic or 1.5% agar was added to form a solid medium.

Amplification of genes encoding candidate antigens.

After candidate antigens were identified, genes encoding such antigens were searched in the NCBI (National Center for Biotechnology Information) database. Specific primers targeting antigen genes were designed accordingly. The antigen genes were then amplified using specific primers and the M. hyopneumoniae PRIT-5 chromosome as template. The specific primers used are shown in the following table 2.

Table 2:
Primer set. Candidate Primer set sequences PdhA PdhAF (SEQ ID NO: 15)
5'-GATATAGGATCCATGGACAAATTTCGCTATGTAAAGCCT G-3 '
PdhAR (SEQ ID NO: 16)
5'-CAATATGTCGACTTATTTTACTCCTTTAAAAAATTCAAGCG CTTC-3 ' XylF XylFF (SEQ ID NO: 17)
5'-GATATAGGATCCATGAATGGAATAAATTTCTTGGCTTAGGC TTAGTTTTTC-3 '
XylFR (SEQ ID NO: 18)
5'-CAATATGTCGACTTAATTTTTATTAATATCGGTAATTAGTT TGTCTAAGC-3 ' EutD EUTDF (SEQ ID NO: 19)
5'-GATATAGGATCCATGACATACCAAGAATATCTTCAAGCAA
G-3 '
EUTDR (SEQ ID NO: 20)
5'-CAATATGTCGACCTATTTACCTTCTTCAAC
TTGTAGAGCGCT-3 ' Mhp145 Mhp145F (SEQ ID NO: 21)
5'-GATATAGGATCCATAGCTTCAAGGTCGAA TACAACTGC-3 '
Mhp145R (SEQ ID NO: 22)
5'-CAATATGTCGACTTAATTTACCTTTTGGAG TATCCCATTTTC-3 ' P78 P78F (SEQ ID NO: 23)
5'-GATATAGGATCCTTATCCTATAAATTTAGG CGTTTTTTCC-3 '
P78R (SEQ ID NO: 24)
5'-CAATATGTCGACTTATTTTGATTTAAAAGCAGGACCTAA AT-3 ' P132 P132F (SEQ ID NO: 25)
5'-GATATAGGATCCATTGGACTAACAATTTTTGAGAAATCATT TAG-3 '
P132R (SEQ ID NO: 26)
5'-CAATATGTCGACTTATTCCTAAATAGCCCC ATAAAGTG-3 ' Mhp389 Mhp389F (SEQ ID NO: 27)
5'-GATATAGGATCCATGGACAAATTTTCACGA ACTGTTCT-3 '
Mhp389R (SEQ ID NO: 28)
5'-CAATATGTCGACCTAGATTTTAAAGGATTTTTTTAATTCAA TAATATAATC-3 '

Polymerase chain reaction (PCR) was performed with the primer sets shown in Table 2 above to amplify candidate antigen genes. The amplified genes were then used in an E. coli gene expression system. The PCR conditions were as follows: 5 minutes at 98 ° C (one cycle); 30 seconds at 94 ° C, 30 seconds at 55 ° C, X seconds at 68 ° C (35 cycles); 5 minutes at 68 ° C (one cycle). The indicated X was the elongation time for the DNA polymerase and was set depending on the size of the fragment to be amplified. After PCR, electrophoresis was performed to check if the PCR products contained DNA fragments of the expected size. See figure 3, which shows the result of electrophoresis of PCR products; where track 1 was the eutD genome; track 2 was pdhA ; track 3 was xylF ; track 4 was the P78 gene; track 5 was the P132 gene; track 6 was mhp145 ; track 7 was mhp389 .

Cloning of PCR products.

Cloning was performed using a CloneJET PCR cloning kit and the ligation mixture was transformed into E. coli ECOSTM 9-5 (Yeastern, Taipei, Taiwan). The detailed protocol can be obtained from the product description or modified from a well known protocol in the art.

After transformation, bacteria were cultured on solid LB medium containing ampicillin (100 μg / ml) until their colony formed. Then, PCR was performed on colonies to screen strains with successful transformation. The PCR conditions were as follows: 5 minutes at 95 ° C (one cycle); 30 seconds at 95 ° C, 30 seconds at 55 ° C, X seconds at 72 ° C (25 cycles); 7 minutes @ 72 ° C (one cycle). The indicated X was the elongation time for the DNA polymerase and was set depending on the size of the fragment to be amplified. The elongation rate of Taq DNA polymerase (Genomics, Taipei, Taiwan) is 1 kb / min; therefore, if Taq DNA polymerase is used to amplify a 1 kb DNA fragment, the indicated X will be set to 1 minute.

Plasmids from strains for which the presence of a DNA insert in the recombinant plasmid was confirmed were then subjected to DNA sequencing (Total Solution Provider of Systems Biology and Chemoinformatics Ltd.). Plasmids containing eutD , pdhA , xylF , P78 gene, P132 gene, mhp145, and mhp389 were named pJET- eutD , pJET- pdhA , pJET- xylF , pJET-P78, pJET-P132, pJET- mhp145 , pJET- mhp , respectively.

Point mutation and cloning of M. hyopneumoniae antigen genes.

Before amplifying candidate antigens in the E. coli gene expression system, it is necessary to consider the value of the codon in different organisms. Moreover, if a gene contains a codon that will be encoded differently in the organism from which it originates and in E. coli , the gene must be modified by a point mutation.

The genes for the M. hyopneumoniae antigen, pdhA , xylF , gene P78, gene P132, mhp145 and mhp389 contain a TGA codon ( eutD has no codon value problems like others). The TGA codon was translated to tryptophan in Mycoplasma spp. But was translated as a stop codon in E. coli . In order to prevent the inability to produce the whole protein in the E. coli gene expression system, primers were designed to target the TGA site and a point mutation was made to replace TGA with TGG using overlapping extension polymerase chain reaction. As a result, genes to be expressed in the E. coli gene expression system can be accurately translated into the antigen candidate of the present invention. In addition, the Bam HI restriction sites of the P78 gene, the P132 gene and the mhp389 were subject to silent mutations for ease of cloning.

The primers used for the point mutation were designed so that the point mutation site was located in the central part of the primer and that the Tm was above 78 ° C. The Tm value of the point mutation primers was calculated using the formula provided by Invitrogene Co .: Tm = 81.5 + 0.41 (% GC) - 675 / N -% mismatch; where% GC denotes the percentage of GC relative to the total number of nucleotides contained in the primer in question; N denotes the length of the primer in question; % mismatch refers to the percentage of the base that should undergo mutation relative to the total nucleotide content of the primer in question. The primer sets used for the above genes are shown in the following Tables 3-8.

Table 3:
Primer kits for pdhA point mutation. Primer DNA sequence (5'-3 ') PdhAF
SEQ ID NO: 29 GATATAGGATCCATGGACAAATTTCGCTATGTAAAGCCTG PdhAM1
SEQ ID NO: 30 GCTAACAAAAGATGACTGGTTTGTCCCAGCTTTTCG PdhAM2
SEQ ID NO: 31 CGAAAAGCTGGGACAAACCAGTCATCTTTTGTTAGC PdhAM3
SEQ ID NO: 32 CTTGCAAATGCAATATTGGAATGGTAGCGAAAAAGG PdhAM4
SEQ ID NO: 33 CCTTTTTCGCTACCATTCCAATATTGCATTTGCAAG PdhAM5
SEQ ID NO: 34 CGAGGCGCTAAATATTGCAAGTATTTGGAAATGGCCAGTTGTTTTTTTGCGTAAATAAC PdhAM6
SEQ ID NO: 35 GTTATTTACGCAAAAAACAACTGGCCATTTCCAAATACTTGCAATATTTAGCGCCTCG PdhAM7
SEQ ID NO: 36 GTTTTTTGCGTAAATAACAATCAATGGGCAATTTCAACCCCAAATAAATATG PdhAM8
SEQ ID NO: 37 CATATTTATTTGGGGTTGAAATTGCCCATTGATTGTTATTTACGCAAAAAAC PdhAM9
SEQ ID NO: 38 GTTGAGTTTGTAACTTGGCGTCAAGGTGTTCATACC PdhAM10
SEQ ID NO: 39 GGTATGAACACCTTGACGCCAAGTTACAAACTCAAC PdhAM11
SEQ ID NO: 40 GAGAACACGAAAAATGGGAACCAATGCACCGG PdhAM12
SEQ ID NO: 41 CCGGTGCATTGGTTCCCATTTTTCGTGTTCTC PdhAM13
SEQ ID NO: 42 CCGAAAAACAAAAAATTTGGGATGAAGCGCTTGCGATTG PdhAM14
SEQ ID NO: 43 CAATCGCAAGCGCTTCATCCCAAATTTTTTGTTTTTCGG PdhAR
SEQ ID NO: 44 CAATATGTCGACTTATTTTACTCCTTTAAAAAATTCAAGCGCTTC Table 4:
Primer kits for xylF point mutation. Primer DNA sequence (5'-3 ') XylFF
SEQ ID NO: 45 GATATAGGATCCATGAAATGGAATAAATTTCTTGGCTTAGGCTTAGTTTTTC XylFM1
SEQ ID NO: 46 CATTTAACCAATCAAGTTGGGAGGCAATTCAACAACTTGG XylFM2
SEQ ID NO: 47 CCAAGTTGTTGAATTGCCTCCCAACTTGATTGGTTAAATG XylFM3
SEQ ID NO: 48 CTAATACCAACAAAAATGTTTGGGTACTTTCTGGTTTTCAACACG XylFM4
SEQ ID NO: 49 CGTGTTGAAAACCAGAAAGTACCCAAACATTTTTGTTGGTATTAG XylFM5
SEQ ID NO: 50 CGGTGATGCGATCACAAAATGGTTAAAAATCCCTGAAAATAAGC XylFM6
SEQ ID NO: 51 GCTTATTTTCAGGGATTTTTAACCATTTTGTGATCGCATCACCG XylFM7
SEQ ID NO: 52 TTATCATACTCGGAATTGACTGGACTGATACTGAAAATGTAATTC XylFM8
SEQ ID NO: 53 GAATTACATTTTCAGTATCAGTCCAGTCAATTCCGAGTATGATAA XylFM9
SEQ ID NO: 54 GAAGAAGCCGGATGGCTTGCAGGATATGC XylFM10
SEQ ID NO: 55 GCATATCCTGCAAGCCATCCGGCTTCTTC XylFM11
SEQ ID NO: 56 GGTTATCTAGCCGGAATTAAAGCTTGGAATCTAAAAAATTCTGATAAAAAAAC XylFM12
SEQ ID NO: 57 GTTTTTTTATCAGAATTTTTTAGATTCCAAGCTTTAATTCCGGCTAGATAACC XylFR
SEQ ID NO: 58 CAATATGTCGACTTAATTTTTATTAATATCGGTAATTAGTTTGTCTAAGC Table 5:
P78 gene point mutation primer kits. Primer DNA sequence (5'-3 ') P78F
SEQ ID NO: 59 GATATAGGATCCTTATCCTATAAATTTAGGCGTTTTTTCC P78M1
SEQ ID NO: 60 CAATTAATAAAGTTTTGTTTGGTTGGATGATTAATAAAGCACTTGCTGATCC P78M2
SEQ ID NO: 61 GGATCAGCAAGTGCTTTATTAATCATCCAACCAAACAAAACTTTATTAATTG P78M3
SEQ ID NO: 62 GATATTAAAGAAATTGAAAGAATCTGGAAAAAATATGTCTCCGATGATCAAGG P78M4
SEQ ID NO: 63 CCTTGATCATCGGAGACATATTTTTTCCAGATTCTTTCAATTTCTTTAATATC P78M5
SEQ ID NO: 64 GCCCTTTCAGGAGGCTCCACTGATTCGGCA P78M6
SEQ ID NO: 65 TGCCGAATCAGTGGAGCCTCCTGAAAGGGC P78M7
SEQ ID NO: 66 GCCGCAAAAGCTTTTGTTAAATGGCTTTTGACAGAAAAAATAGTCT P78M8
SEQ ID NO: 67 AGACTATTTTTTCTGTCAAAAGCCATTTAACAAAAGCTTTTGCGGC P78R
SEQ ID NO: 68 CAATATGTCGACTTATTTTGATTTAAAAGCAGGACCTAAAT Table 6:
P132 gene point mutation primer kits. Primer DNA sequence (5'-3 ') P132F
SEQ ID NO: 69 GATATAGGATCCATTGGACTAACAATTTTTGAGAAATCATTTAG P132M1
SEQ ID NO: 70 CTAACTTCTCTAAAAGGTTGGAAAGAAGAAGATGATTTTG P132M2
SEQ ID NO: 71 CAAAATCATCTTCTTCTTTCCAACCTTTTAGAGAAGTTAG P132M3
SEQ ID NO: 72 CTTTCTATTACTTTTGAACTCTGGGACCCAAATGGTAAATTAGTATC P132M4
SEQ ID NO: 73 GATACTAATTTACCATTTGGGTCCCAGAGTTCAAAAGTAATAGAAAG P132M5
SEQ ID NO: 74 CCCTGAAGGAGATTGGATAACTTTAGGGAG P132M6
SEQ ID NO: 75 CTCCCTAAAGTTATCCAATCTCCTTCAGGG P132M7
SEQ ID NO: 76 CTACCAGGAACTACCTGGGATTTCCATGTTGAAC P132M8
SEQ ID NO: 77 GTTCAACATGGAAATCCCAGGTAGTTCCTGGTAG P132M9
SEQ ID NO: 78 GGACAACTAATTTGGAGCCAGTTAGCTTCC P132M10
SEQ ID NO: 79 GGAAGCTAACTGGCTCCAAATTAGTTGTCC P132M11
SEQ ID NO: 80 GGAACAAAAAAGGAATGGATTCTTGTAGGATCTGG P132M12
SEQ ID NO: 81 CCAGATCCTACAAGAATCCATTCCTTTTTTGTTCC P132M13
SEQ ID NO: 82 CCAATACGCAAATATGGATAACCCGTCTAGGAAC P132M14
SEQ ID NO: 83 GTTCCTAGACGGGTTATCCATATTTGCGTATTGG P132M15
SEQ ID NO: 84 CCAAGGGGAAGTTCTCTGGACTACTATTAAATCCAAAC P132M16
SEQ ID NO: 85 GTTTGGATTTAATAGTAGTCCAGAGAACTTCCCCTTGG P132M17
SEQ ID NO: 86 CAAAAAACTTCACCTTTGGTGGATTGCTAATGATAGC P132M18
SEQ ID NO: 87 GCTATCATTAGCAATCCACCAAAGGTGAAGTTTTTTG P132R
SEQ ID NO: 88 CAATATGTCGACT TATTCCTAAATAGCCCCATAAAGTG Table 7:
Primer kits for mhp145 point mutation. Primer DNA sequence (5'-3 ') Mhp145F
SEQ ID NO: 89 GATATAGG ATCCAT AGCTTCAAGGTCGAATACAACTGC Mhp145M1
SEQ ID NO: 90 AATAATTGCAGAAAAAATTCTTAAAGATCAATGGAAAACAAGTAAATATTCTGATTTTTATTCACAAT Mhp145M2
SEQ ID NO: 91 ATTGTGAATAAAAATCAGAATATTTACTTGTTTTCCATTGATCTTTAAGAATTTTTTCTGCAATTATT Mhp145R
SEQ ID NO: 92 CAATATGTCGACTTA ATTTACCTTTTGGAGTATCCCATTTTC Table 8:
Primer kits for mhp389 point mutation. Primer DNA sequence (5'-3 ') Mhp389F
SEQ ID NO: 93 GATATAGGATCCATGGACAAATTTTCACGAACTGTTCT Mhp389M1
SEQ ID NO: 94 CAATAGTGACAATGGACCCCCCAAATGTTGGTCG Mhp389M2
SEQ ID NO: 95 CGACCAACATTTGGGGGGTCCATTGTCACTATTG Mhp389M3
SEQ ID NO: 96 GATAAAGGCGCATCATGGCTTGCGCTTGCACCAAC Mhp389M4
SEQ ID NO: 97 GTTGGTGCAAGCGCAAGCCATGATGCGCCTTTATC Mhp389M5
SEQ ID NO: 98 GGAAAACTTAAAGGTAAATGGACTTTTGGACTAACCTATTT Mhp389M6
SEQ ID NO: 99 AAATAGGTTAGTCCAAAAGTCCATTTACCTTTAAGTTTTCC Mhp389R
SEQ ID NO: 100 CAATATGTCGACCTAGATTTTAAAGGATTTTTTTAATTCAATAATATAATC

The point mutation method is briefly explained below. The chromosome of M. hyopneumoniae PRIT-5 was used as a template and the DNA fragments were amplified using the primer sets shown in Tables 3-8 above.

A 50 μL PCR reaction mixture contained 1 × GDP-HiFi PCR buffer, 200 μM mixture of dATP, dTTP, dGTP, and dCTP, 1 μM primers, 100 ng of M. hyopneumoniae PRIT-5 chromosome, and 1 U of GDP-HiFi DNA polymerase. The PCR conditions were as follows: 5 minutes at 98 ° C (one cycle); 30 seconds at 94 ° C, 30 seconds at 55 ° C, X seconds at 68 ° C (35 cycles); 5 minutes at 68 ° C (one cycle). The indicated X was the elongation time for the DNA polymerase and was set depending on the size of the fragment to be amplified. The elongation rate of GDP-HIFI DNA polymerase (GeneDirex, Las Vegas, USA) is 1 kb / 15 seconds; therefore, if GDP-HIFI DNA polymerase is used to amplify a 1 kb DNA fragment, the indicated X will be 15 seconds. After PCR, electrophoresis was performed to check if the PCR products contained DNA fragments of the expected size. The PCR product was then recirculated using the Gel-MTM gel isolation system kit.

Subsequently, the PCR product was used as a template and amplified using the primer sets shown in Table 2 above. The PCR conditions were as follows: 2 minutes at 98 ° C (one cycle); 30 seconds at 94 ° C, 30 seconds at 55 ° C, X seconds at 68 ° C (35 cycles); 5 minutes at 68 ° C (one cycle). The indicated X was the elongation time for the DNA polymerase and was set depending on the size of the fragment to be amplified. The elongation rate of GDP-HIFI DNA polymerase (GeneDirex, Las Vegas, USA) is 1 kb / 15 seconds; therefore, if GDP-HIFI DNA polymerase is used to amplify a 1 kb DNA fragment, the indicated X will be 15 seconds. After the above amplification step, the full-length sequence of the candidate antigen genes with point mutation can be obtained.

The PCR product was then isolated using a PCR-MTM purification system kit (GeneMark, Taichung, Taiwan) and cloned using a CloneJET PCR cloning kit. Colony PCR was performed to confirm that the strains after transformation contained a plasmid having a DNA insert, and then the plasmids were isolated for DNA sequencing (Total Solution Provider of Systems Biology and Chemoinformatics Ltd.). Plasmids containing mutated candidate antigen genes were named pJET- pdhA M, pJET- xylF M, pJET-P78M, pJET-P132M, pJET- mhp145 M, pJET- mhp389 M, respectively.

According to the result of DNA sequencing, the sequences of the candidate antigen genes after point mutation were as shown in SEQ ID NO: 01 ( pdhA ), SEQ ID NO: 02 ( xylF ), SEQ ID NO: 03 ( eutD , was no point mutation) , SEQ ID NO: 04 ( mhp145 ), SEQ ID NO: 05 (P78 gene), SEQ ID NO: 06 (P132 gene), SEQ ID NO: 07 ( mhp389 ).

Construction of Expression Vectors for Expressing M. hyopneumoniae Antigens

In this part of the experiments, the plasmid pET-MSY was used as a backbone to construct an expression vector for expressing the M. hyopneumoniae antigen. pET-MSY is a derivative of pET29a and has E. coli MsyB. As a consequence, the expressed recombinant antigen will have a fusion partner MsyB. MsyB is high in acidic amino acids and is capable of increasing the solubility of the expressed protein.

After pJET- eutD, pJET- pdhA, pJET- xylF , pJET-P78, pJET-P132, pJET- mhp145 and pJET- mhp389 were digested Bam HI and SalI, the resulting DNA fragment was inserted into pET-Msy, previously digested with the same restriction enzymes by ligase. Then pET-Msy with the DNA fragment was transformed into E. coli ECOS 9-5. Colony PCR was performed to confirm the strains after transformation containing a plasmid having a DNA insert, and then the plasmids were isolated therefrom for DNA sequencing (Total Solution Provider of Systems Biology and Chemoinformatics Ltd.). Plasmids with the correct DNA sequence confirmed were named pET-MSYEutD, pET-MSYPdhA, pET-MSYXylF, pET-MSYP78, pET-MSYP132, pET-MSYMhp145 and pET-MSYMhp389, respectively. Such resulting plasmids were examples of expression vectors for the prevention of infection with Mycoplasma spp. according to this invention.

Expression and isolation of M. hyopneumoniae antigens

Antigen expression vectors were transformed into E. coli BL21 (DE3). Single colonies of the strains resulting from transformation were inoculated into liquid LB medium containing kanamycin (working concentration: 30 μg / ml). After cultivation overnight, 37 ° C, 180 rpm. the bacterial suspension was diluted 1: 100 and inoculated again into another liquid LB medium containing kanamycin (working concentration: 30 μg / ml). The bacteria were cultured at 37 ° C, 180 rpm. up to OD600 thereby reaching approximately 0.6 to 0.8. Then added 0.1 mm IPTG to induce expression. After induction for 4 hours, the pellet was collected by centrifugation (10000 × g, 10 minutes, 4 ° C) and the expression was checked by protein electrophoresis.

Subsequently, immobilized metal affinity chromatography (IMAC) was used to isolate the protein through covalent bonding between the His tag of the N-terminus of the recombinant protein and nickel ions or cobalt ions. Protein isolation protocol followed the QIAexpressionistTM product description (fourth edition, Qiagen). The pellet was suspended in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) and disrupted with an ultrasonic homogenizer. After centrifugation (8000 × g, 15 minutes), the supernatant was removed for injection on a column with 1 ml of Ni-NTA resin. The recombinant antigens should be bound on the specified resin. Then, 15 ml of wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0) was injected into the column to wash the resin so that nonspecifically bound proteins were removed. Finally, 20 ml of elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0) was added to wash out the recombinant antigens from the resin; in which the imidazole at a high concentration can compete for the binding site on the resin with the recombinant proteins and thereby cause washout of the recombinant proteins. The result of the isolation was then checked by protein electrophoresis.

The candidate antigens of the present invention, collected by isolation, can then be used for subsequent immunological tests to confirm their usefulness as an active ingredient in subunit vaccines against Mycoplasm spp.

Example 3: Experiments on immune stimulation of pigs with candidate antigens of the present invention.

In this example, the candidate antigens of the present invention were used as an active ingredient for the preparation of subunit vaccines and tested for their immune effects in a live pig.

Vaccine preparation

One isolated recombinant antigen or several isolated recombinant antigens were mixed with alumogel as an adjuvant to prepare a subunit vaccine or a cocktail subunit vaccine. Each dose of the prepared vaccine had a volume of 2 ml, and the content of each type of antigen was 100 µg.

The following Table 9 shows the samples prepared in this example for the experiments of immune stimulation.

Table 9
Vaccine samples prepared in example 3 Sample Active ingredient (Antigen) 1 PdhA 2 XylF 3 EutD 4 Mhp145 5 P78 6 P132 7 Mhp389 eight PdhA + P78 nine XylF + Mhp145

Pig immune stimulation experiments were performed using Bayovac® MH-PRIT-5 (made using M. hyopneumoniae PRIT-5 as a positive control group), subunit vaccines (samples 1-7 of the present invention) and cocktail vaccines (samples 8 and 9 of this invention).

33 SPF pigs, 4 weeks old, were delivered from the Agricultural Technology Research Institute and fed with the same feed, environmental and growth conditions in the pigsty prior to the experiments.

After the pigs were fed to 35 days and 49 days of age, the pigs were injected with 2 ml of the above vaccine by intramuscular injection.

Stimulation experiments

The above pigs, subjected to the induction of an immune response, were stimulated with Mycoplasm spp. at the age of 109 days to confirm the immune effect of the above vaccines.

First, a lung taken from pigs infected with Mycoplasm spp. Was minced in 20 ml of Freese's medium and centrifuged at 148.8 x g for 10 minutes. The supernatant was removed to clean the tube and centrifuged again at 7870 xg for 40 minutes. Then the supernatant was removed and the pellet was suspended in 6 ml of Friese's medium to obtain a suspension. Subsequently, the suspension was filtered through 5 µm and 0.45 µm membranes sequentially to obtain bacterial solutions required for stimulation experiments.

The bacteria solution (5 ml) was administered to the anesthetized pigs through their trachea. After 28 days of administration, the pigs were sacrificed and dissected to collect their lungs. The immune effect was checked by observation of the lung and recorded according to the following criteria: the observed pathological sign in any of the middle upper lobes and the upper lobes of either side of the lung was scored as 10 points; the observed pathological sign in any middle upper lobe and diaphragmatic lobes on either side of the lung was assessed as 5 points. The overall score was 55 points. An observation record is shown in Figure 4.

Compared to the results of non-injected pigs, the seven candidate antigens of the present invention were able to provide immune effects equivalent to the conventional vaccine (Bayovac® MH-PRIT-5). Given the higher safety of subunit vaccines, vaccines containing the candidate antigens of the present invention should be of greater value.

On the other hand, it has not been common to use two or more antigens that are supposed to induce immune effects in one vaccine because two or more antigens may not provide a dual immune effect. In fact, there is a higher likelihood that two or more antigens will interfere with each other and, as a result, reduce the immune effect of the vaccine. In accordance with the result of this example, sample 8 and sample 9 of the present invention (ie cocktail vaccine) unexpectedly provided a significant increase in the immune effect. However, the subunit vaccines of the present invention not only have high safety, but also provide a greater immune effect when the candidate antigens of the present invention are used in combination.

One of ordinary skill in the art can easily understand any possible modifications based on the discovery of the present invention without departing from the basic idea of the present invention. As a consequence, the examples above should not be used to limit the present invention, but are intended to embrace any possible modifications within the basic idea and scope of the present invention in accordance with the following claims.

--->

SEQUENCE LIST

<110> RESEARCH INSTITUTE OF AGRICULTURAL TECHNOLOGY

<120> Mycoplasma Spp Subunit Vaccine

<130> GPI13TW0261-RU-1

<160> 100

<170> PatentIn version 3.5

<210> 1

<211> 1125

<212> DNA

<213> Synthetic sequence

<220>

<223> mutated pdhA gene

<400> 1

atggacaaat ttcgctatgt aaagcctggt caaattatgg caaaagatga agaaatgatt 60

cgctttcttg atattgatgg taatctttta tcttcaactg tttttggacc aatcgacgaa 120

acaaatgata ttcgcttatc aaaacaggaa atcaaaaaag cttatgaatt tatggtttta 180

tctcgccaac aagatacgta tatgacacaa ctacagcgac aaggtagaat gttgactttt 240

gcccctaact ttggtgaaga agctcttcaa gtagcctcag ggatggcgct aacaaaagat 300

gactggtttg tcccagcttt tcgttcaaat gcaacaatgt tatatcttgg cgtgccaatg 360

atcttgcaaa tgcaatattg gaatggtagc gaaaaaggta atgtaattcc cgaaaatgtt 420

aatgttttac ctattaacat tcccatcgga acgcagtttt cccatgctgc cggaattgct 480

tatgcagcaa aactaacagg taaaaaaata gtttcaatga gttttattgg aaacggggga 540

actgccgaag gcgagtttta cgaggcgcta aatattgcaa gtatttggaa atgaccagtt 600

gttttttgcg taaataacaa tcaatgggca atttcaaccc caaataaata tgaaaacggt 660

gcctcaacaa ttgctgcaaa agcaatggca gccggaattc ctggaattcg tgtagacgga 720

aatgaccttt tagcttctta tgaagtaatc aaggaagctg ttgattatgc tcgttctgga 780

aacggtcctg ttcttgttga gtttgtaact tggcgtcaag gtgttcatac ctcttctgat 840

aatccacgaa tttatcgtac tgttgaagag gaaagagaac acgaaaaatg ggaaccaatg 900

caccggattg aaaaatatat gtttgaccgc ggaattcttg attctgccga aaaacaaaaa 960

atttgggatg aagcgcttgc gattgtcaaa gaaacttatg aaaaatctct tgttgggctt 1020

gagtcaacaa ttgatgaaat tttcgatcat acctacaagg ttttaccacc agaacttgaa 1080

gaacaaaaac aagaagcgct tgaatttttt aaaggagtaa aataa 1125

<210> 2

<211> 1344

<212> DNA

<213> Synthetic sequence

<220>

<223> mutated xylF gene

<400> 2

atgaaatgga ataaatttct tggcttaggc ttagtttttc cgctttcagc aatcgcgaca 60

atctctgccg gatgttggga taaagaaaca actaaagaag aaaaatcagc cgataatcaa 120

aataaacaaa tcactgatgt ctcaaaaatt tcaggactag ttaatgagcg aaaatccgaa 180

attatggccg caaaagctga tgcaaacaaa cattttgggc taaatatggc aattgtaacc 240

gctgatggaa cggtaaatga taattcattt aaccaatcaa gttgggaggc aattcaacaa 300

cttggcgctc ttactggagg tgagattact tcagtagata gttcaactgc tgaacttgaa 360

ggaaaatata gctcacttgc taataccaac aaaaatgttt gggtactttc tggttttcaa 420

cacggtgatg cgatcacaaa atggttaaaa atccctgaaa ataagcaatt atttactgaa 480

aaaaatatta tcatactcgg aattgactgg actgatactg aaaatgtaat tccaacaggt 540

cgatatatta atttaaccta taaaactgaa gaagccggat ggcttgcagg atatgcgaat 600

gcttcctttt tggcaaaaaa attcccaagt gatccaacta aaagatcagc aattgttatc 660

ggtggtggga ttttcccagc tgtaactgat tttatcgctg gttatctagc cggaattaaa 720

gcttggaatc taaaaaattc tgataaaaaa acaaagataa caactgataa aatcgaaata 780

aatcttgggt ttgattttca aaatacttca acaaaagaaa gacttgaaca aattgcttca 840

aaagataaac cttcaacact attagcagtc gctggaccac ttactgaaat tttctcggat 900

ataatcgcaa accaaaatga tcgttatctc attggtgttg acaccgacca atcacttgtt 960

tatacaaaaa ctaaaaataa atttttcacc tcaattttga aaaatttagg ttactccgtt 1020

ttcagtgttc ttagtgattt atataccaaa aaatcaaatt caagaaattt agccggcttt 1080

gaatttggta aaaaaagtgc aaccgtttat cttggaatta aagacaagtt tgtcgatatt 1140

gctgatactt ctttagaagg aaatgataaa aaactcgcaa ctgaagccat ttctgaagct 1200

aaaaaagaat ttgaagaaaa aactaagaca actcctgccg aagaagttcg taaaacttta 1260

gaaattccgg aaatgactga taaacaacct gataaacaac aggaaagctt agacaaacta 1320

attaccgata ttaataaaaa ttaa 1344

<210> 3

<211> 954

<212> DNA

<213> Mycoplasma hyopneumoniae

<400> 3

atgacatacc aagaatatct tcaagcaaga cttgagcaac aaaatgagac aaaaagttta 60

cgctcagttc taattattga tggtgctgat ccgcgagcaa ttgccgcggc aaaactttta 120

aaggaaaaaa atttagtaaa accggtttta ctagttgatg aagaaattcc aaatcttgac 180

gttgatcaac atatagttaa ttttcaagaa aaaatggaat ttattaagga atttcttaaa 240

ttccgcaagg gaaaagaaac tcctgagtca gccgaaattc aatttcaatc aaatgctttt 300

tatggaacaa tgctactaag aaagaaaaaa gtagatgcag ttgtcggggg tcttaattac 360

ccaacagccg aaattttacg agcagctttt aaaataatcg ggccaaaacc aaatataaaa 420

acaatttcat cagtaatgat tatgcataaa gatcaggaaa aatatttatt tagtgatatt 480

tcagtaaata ttgctccaaa tgagaatcaa cttgttgata ttgctaaaaa tgcccttgat 540

tttgctattc agttaggttt tgatccaaaa ccagcttttc tttccttttc aacaaaagga 600

tcagcaaaat caccgcagtc agaattagtg gctaaagcga cgcaaatgtt taatgcaaca 660

tccccaattg aagcttatgg tgaaattcag cttgatgccg cccttgatat tgaagttcgc 720

cgccaaaaat atgaagtaaa tgtaggtaaa aacgccaata ttttaatttt cccgaatctt 780

gatgcaggaa atattggcta taaaattgcc caaagattgg gaaattttgg ggcaattggc 840

ccaataatta ccggaattaa tgccccaatt aatgatttat cccggggatc aacaactcaa 900

gatgtcttta ataccgtgct aattagcgct ctacaagttg aagaaggtaa atag 954

<210> 4

<211> 1122

<212> DNA

<213> Synthetic sequence

<220>

<223> mutated mhp145 gene

<400> 4

atagcttcaa ggtcgaatac aactgccaaa gttgccccag ttgctgttgt tttctcaaca 60

agaaataatc cttttttcca aaatgttgaa aaagggattg aaacagcggc aaaagaatta 120

ggagttgact atgaagtcta tgactctgaa aatgactcgg ataaagaagc aagaaatatt 180

tcaaatatta ttgcaaaaca acaaaaagtt gtaattttta acgatgttaa tgaagattca 240

ggaatctcag ctgttaaaaa attaaatcaa gctggaattc cggtaattgc cactgatcat 300

ttactaaatt cgccaaaagc cttagaagca aaaattaaag ttgaagccaa tattgcttct 360

gataataaac aagcaggagt aattcttgcc cagtttatgg cccaaaaaat cggacttcct 420

caagattcac ttacttattc agtctatgga attcccggaa ctgaatcagg ggaatcccga 480

gctcaagggt ttattgaaac agttaaaaat ctaaataatc aagcaataaa atacaacctt 540

ttttcttatg gaaaatacgg aaaagaaaat gcaaatggaa aaacttacat cggaagacaa 600

gctgatgata atcgcgatct agcaaatcaa agagttgcaa atgatgcaac gcaagtattc 660

caagatgctc aaaaaaggcc acttttggtt tttgggacta atgatgaagc tgccttaggt 720

tcaatttctg cccttgaaag tgcccagatt ccattaggag gtggagataa attccttcca 780

ggttcaggaa aagtttatat taccggagtt gattatacaa atgatgctca aaaagcggta 840

ttaaataata aattatcagc aactgttgaa caagatactg atcttttagg aagactttct 900

ttaataattg cagaaaaaat tcttaaagat caatggaaaa caagtaaata ttctgatttt 960

tattcacaat ttcctcagct tgataaagac aaaaatcctg atgatcaagt tgagcaagga 1020

tattatttta aagtaggaac aaaacttttc tggaaaggac cagatggaaa aggtgaaaaa 1080

cttcaagccg atgaaaatgg gatactccaa aaggtaaatt aa 1122

<210> 5

<211> 2076

<212> DNA

<213> Synthetic sequence

<220>

<223> mutated P78 gene

<400> 5

ttatcctata aatttaggcg ttttttccta accagcgcac ttagttttgc tcccttggct 60

ttagttgcaa gttgtgttaa taattcccga tttgattcaa atgaggataa taaattagtt 120

tttggtcata ctttttcatc ttcaggaaaa gaggcaaaag cacttgagaa aattattgaa 180

gtctggaata aaactgcaac taatcaaaaa gattttatca aaatggaagc acaatatttc 240

cagaatggct ataatggatc agcggcttca attacaaact ttttacagac aaaagatcgg 300

ataaaactgc caaatattgt cacaaattat ccttcacttc tggcaatagt taataaatat 360

tcaatgactt ttccgcttgt taaagatttt agttctaatc aagaaccaca agatgaaaat 420

gaaaaagcaa taaaaaagtt cctaaaagag caaggaattt ctgatttcct tgagattaat 480

aaagaagttc ctttccttga tacaaaggga gtttataccc ttccatttgg aaaatcaact 540

gaagttctta caattaataa agttttgttt ggttggatga ttaataaagc acttgctgat 600

ccaaaaaagc cagcaaaaat taaagaagaa gataaacctt attttgccga atttcaaaaa 660

ttaggcaagg aaaaaactgg tgatattaaa gaaattgaaa gaatctggaa aaaatatgtc 720

tccgatgatc aaggacttgc aggctatgaa tttcgccgat ccgatcttga aaattttact 780

gacctacaga aattatcatc acgaattctt cgttcttttc cagaggccct ttcaggaggc 840

tccactgatt cggcaaaatc agttttagga attgataatc aagcaacgct agtttttgct 900

cttgccagat cagtttcaga aggtaatcga tcccaggaag ttactgttct tgataggcaa 960

aagaatttaa ttgattatat atcttttata gataaacctg attcaattag atataaaaat 1020

ttagaaaaaa tttttaattt attaagccaa gggataaaag atcgctcaat ttattataca 1080

tctgcagggg agtataattc aacttttttc cggaatcatc agcaggtttt ctcaattggt 1140

tcaacttcag gctatttcca taattttgtc aaaccaacag cgacaaatta tcaaatcgga 1200

tttaagaaaa atgatggtct taagtcagtt tatagcgtta gctatcccaa atttagcgca 1260

attgtatcac ttgaagatct caaggatata accaaagatc tagaaataac agcaaccgat 1320

ggtagctcta aattaaaaat tgatgctaaa tttttaggaa aactcaaaga atatgcacag 1380

caaaatccag ttaaaaaagt gttttatttt actgatcgat cagaaaaacc ttcaggtatc 1440

ttcgaaaaag attatattgt tttaggcaaa tacaaaaatg ataaaaatga agaatttaat 1500

ggccttgtaa ttccaactta tacagaactc tataaaaatt ctggatcaaa tgcccttaat 1560

gatgatgaac ttgcacttga agccccaccg cataaattcg atgcaaatag taaaatcacc 1620

cccattgtcg cccaaggtcc tgatctaatt tttattcatt caactgaaaa agaagataaa 1680

gccgcaaaag cttttgttaa atggcttttg acagaaaaaa tagtctttga ggaaaatagt 1740

caggaaaaaa tgactccgct tgagtatttt gccagagcaa cctcatattt attgccaata 1800

aaatcaacgc ttgataaaac ccattttagt ccaaaaaata gatctcagaa attcatactt 1860

gaccaattta gtaaatttct taatgctgat tcaaaaggaa aatattcgct tgtctatgat 1920

aatgccgatg caaatgcttc atccttccgt gaatcactag attcttcagt tgcccagatg 1980

caatcattaa aagccagcga tggaaaacta cgtagtttta aagagttttt agaaaaacta 2040

gagggaaatt taggtcctgc ttttaaatca aaataa 2076

<210> 6

<211> 3549

<212> DNA

<213> Synthetic sequence

<220>

<223> mutated P132 gene

<400> 6

attggactaa caatttttga gaaatcattt agttcccaag tttcaggagg ggtcgataag 60

aacaaagttg tggatttaaa atcagattca gatcaaatct tctcagaaga agattttata 120

agagcagttg agaatcttaa actttttgat aaatataaac atctaacagc aagaatggca 180

ttaggacttg ctagggaagc agctaatgcc tttaactttt tagatactta tgactacacc 240

ccaattacaa aacattcatt taagatttct ttggatattt ccgatgcctt tgcggctaat 300

aaagaagtaa aagcggtagt ggttagtgca tattcccaaa aatatcaagt tacctattca 360

agactaactt ctctaaaagg ttggaaagaa gaagatgatt ttggcgatga tattatagat 420

tatcaaatta atcaagagct ttcaggtcta tcactttctt ccttagcccc tgaaagcgcg 480

catcttttag cctcagaaat ggcttttcgg cttgataatg actttcaagt tgcatataaa 540

aaaacaggat caagagccga ggcttttcgt caggccttga taaagaatta tcttggttat 600

aacttagtta accgccaagg tttgcccact atgctccaaa agggttatgt gctagccccc 660

aaaacaattg aaaataaaaa tgcaagcgaa gaaaaattag taaatataaa tgaaaatgac 720

cgtgcaaggg ttaataaact acaaaaagta gaaaatctag cctttaaaaa cttaagtgat 780

ccaaatggaa cgctttctat tacttttgaa ctctgggacc caaatggtaa attagtatcc 840

gaatacgatt ttaaaattaa gggaatcaaa aaacttgatt ttgatcttaa aaaacaagag 900

gaaaaagtac ttcaaaaagt aactgaattt gttgagatta aaccttatgt tcaattaggt 960

ttaatccgtg ataatttatc attgtctgaa attatctata aaaatgataa taatccggag 1020

tatcttagga aaatattagc taaactaaaa gaacacaata acaacaaaag ggtggataat 1080

aatacatcca ctactaaatt tcaagaagag gatcttaaaa acgaaccaaa ttctaatgga 1140

tcagaacaag attctttcga gaaagcaaag gaaaatttcc ttagtttttt tgatctaagg 1200

tcgagactaa ttcctattcc cgatcttcct ttatattatc ttaaagttaa ttcaattaat 1260

tttgatagaa atattgaaga aaatgaaaaa gaaaaattat taaaaaatga acaagtagta 1320

ctcaaagtag attttagtct taaaaaagtt gttagcgata ttagagctcc ttacctagtt 1380

tctagtcagg ttagatcaaa ttatcccccg gttttaaaag cttcgctagc aaaaataggt 1440

aaggggtcaa attcaaaagt tgtcctttta gatcttggaa atttatcttc aagatttaaa 1500

gttcaacttg attatagtgc aaaacaaaga gaaataatta atactttatt aaaggaaaat 1560

ccagaaagag aaaaagaatt acaagctaaa attgaaagta agacgtttag tccaatagat 1620

cttaacaatg atgatctatt agcaatcgaa tttcaatatg aggataaccc tgaaggagat 1680

tggataactt tagggagaat ggaaaagtta gtcaaagagg ttatccaata taaaaaagaa 1740

ggtaaaacct tcttagatga tgaagtcgcg aaaacacttt attatttaga tttccatcat 1800

ctacctcaaa gtaaaaaaga cctcgaagaa tataaagaaa aacacaaaaa caagtttatc 1860

agcgaaataa aacctgctac accagcaagt caagcaaaaa caagtcaagc aaaaaatgaa 1920

aaagaagtaa aacctgaatc agcccaagca gaagcttcat cttcaaattc taatgattct 1980

agtagtaaaa ccacttcttc ttcaagtatg gcgggtacaa cccaaaataa atctacagaa 2040

actccaaatt caagttcaaa ttcaacacca acaagttcag caacaacttc agcaacaact 2100

tcaacaacaa gttcaaattc aagttcaaca acaagttcaa caacaacaac aacttcaaca 2160

caagcagcaa caacttcagc ctcttcggct aaagtaaaaa caactaaatt ccaagaacaa 2220

gtaaaagaac aagaacaaaa acaagaaaaa gcaaaagaaa ctaaccaatt attagatact 2280

aaaagaaata aagaagactc agggcttgga ttaattcttt gggatttcct agtaaattca 2340

aaatataaaa ctctaccagg aactacctgg gatttccatg ttgaaccaga taatttcaat 2400

gatcgtctaa aaataacagc gattctaaaa gaaaatacat cccaggcaaa gtcaaaccca 2460

gatagtaaaa acctaacttc cctatcacga aaccttataa taaaaggggt tatggctaat 2520

aaatacattg actacttagt ccaagaagat ccagtacttc ttgtagatta tacaagaaga 2580

aaccagatta aaaccgaaag agaaggacaa ctaatttgga gccagttagc ttcccctcaa 2640

atggcatctc ctgaatctag tcccgaaaag gctaagctcg agatcaccga ggaaggactc 2700

cgtgttaaaa aaggtggcac taagataaaa gagacaagaa aaagcacaac cagcaatgct 2760

aaaagcaata ctaactccaa accaaataaa aagttagtcc tactaaaagg gtctataaaa 2820

aacccgggaa caaaaaagga atggattctt gtaggatctg ggaataaggc caccaaaaac 2880

ggaagctcca gcaacaactc caatacgcaa atatggataa cccgtctagg aacatctgtt 2940

ggttcattaa aaaccgaagg tgagacagtc cttggaattt cgaataataa ttcccaaggg 3000

gaagttctct ggactactat taaatccaaa ctcgaaaacg aaaataactc agataacaat 3060

caaatccaat actccccaag tacgcatagt ttaacaacca attctcgatc aaatacccaa 3120

caatcagggc gaaatcaaat taaaattaca aacacgcaaa ggaaaacaac aacttcgcca 3180

agccaaaatc taagtcaaaa tcctgatctc aaccaaattg atgtaagact tggtctacta 3240

gtacaagaca aaaaacttca cctttggtgg attgctaatg atagctctga tgagcctgag 3300

catataacaa ttgatttcgc tgaagggaca aaatttaatt atgatgattt aaattatgtc 3360

ggagggcttt taaaaaatac tacaaataat aacaatatgc aaacccaaga cgatgaaggt 3420

gatggatatc ttgccctaaa aggattaggt atctatgaat ttcctgatga tgaaagtatt 3480

gatcaacccg ctactgttga aaaggcagag agattatata aacactttat ggggctattt 3540

agggaataa 3549

<210> 7

<211> 1053

<212> DNA

<213> Synthetic sequence

<220>

<223> mutated mhp389 gene

<400> 7

atggacaaat tttcacgaac tgttctcggt gatattcacc catcggaatt aggtgttgtt 60

gactgtcatg atcatttaat taaaaattat ggaccaaaag ctcacgaaca tccggatttt 120

gtaatgttat caaatgaggc tgcaattgct gaatcacttg aatatgcttc ccggggtgga 180

aaaacaatag tgacaatgga ccccccaaat gttggtcggg atgtctatcg aatgttaaag 240

attgccaaag ctcttgaagg aaaagtgcat attattatgg caactggatt tcataaagcg 300

gctttctatg ataaaggcgc atcatggctt gcgcttgcac caacagatga aattgtaaaa 360

atggttgttg ctgaaattac acagggaatg gatgaatata attattcagg tcctgtggtt 420

agacgttcaa aagccaaagc aggaattatc aaagccggaa ctggatatgg agcaattgat 480

cgacttgaat taaaatcact tgaggttgca gcaagagcct caattgaaac cggggcaccg 540

attttggttc atacccaatt aggaacaatg gcctatgaag cggcaaaata tttaattgat 600

tttggtgcaa atccacggaa aattcagatc tcacatctta ataaaaaccc tgataaatat 660

tattatgcaa aaataattaa agaacttggg gtatctttat gttttgatgg tcctgatcgg 720

gttaagtatt ttcctgatac aactcttgct gaaaatatta aatatcttgt cgatttagga 780

ctagaaaaac atattacctt atcacttgat gccggtcgtg ttttatatca gcgaaattat 840

ggaaaactta aaggtaaatg gacttttgga ctaacctatt tattcgatcg gtttattccg 900

cttttagaac aagttggaat tagcaaggaa acaattaata atattcttgt taataatcca 960

gctgaaattc ttgcctttga tcagccaaga aaatttgatc catcaattct tccagattat 1020

attattgaat taaaaaaatc ctttaaaatc tag 1053

<210> 8

<211> 374

<212> PRT

<213> Mycoplasma hyopneumoniae

<400> 8

Met Asp Lys Phe Arg Tyr Val Lys Pro Gly Gln Ile Met Ala Lys Asp

1 5 10 15

Glu Glu Met Ile Arg Phe Leu Asp Ile Asp Gly Asn Leu Leu Ser Ser

20 25 30

Thr Val Phe Gly Pro Ile Asp Glu Thr Asn Asp Ile Arg Leu Ser Lys

35 40 45

Gln Glu Ile Lys Lys Ala Tyr Glu Phe Met Val Leu Ser Arg Gln Gln

50 55 60

Asp Thr Tyr Met Thr Gln Leu Gln Arg Gln Gly Arg Met Leu Thr Phe

65 70 75 80

Ala Pro Asn Phe Gly Glu Glu Ala Leu Gln Val Ala Ser Gly Met Ala

85 90 95

Leu Thr Lys Asp Asp Trp Phe Val Pro Ala Phe Arg Ser Asn Ala Thr

100 105 110

Met Leu Tyr Leu Gly Val Pro Met Ile Leu Gln Met Gln Tyr Trp Asn

115 120 125

Gly Ser Glu Lys Gly Asn Val Ile Pro Glu Asn Val Asn Val Leu Pro

130 135 140

Ile Asn Ile Pro Ile Gly Thr Gln Phe Ser His Ala Ala Gly Ile Ala

145 150 155 160

Tyr Ala Ala Lys Leu Thr Gly Lys Lys Ile Val Ser Met Ser Phe Ile

165 170 175

Gly Asn Gly Gly Thr Ala Glu Gly Glu Phe Tyr Glu Ala Leu Asn Ile

180 185 190

Ala Ser Ile Trp Lys Trp Pro Val Val Phe Cys Val Asn Asn Asn Gln

195 200 205

Trp Ala Ile Ser Thr Pro Asn Lys Tyr Glu Asn Gly Ala Ser Thr Ile

210 215 220

Ala Ala Lys Ala Met Ala Ala Gly Ile Pro Gly Ile Arg Val Asp Gly

225 230 235 240

Asn Asp Leu Leu Ala Ser Tyr Glu Val Ile Lys Glu Ala Val Asp Tyr

245 250 255

Ala Arg Ser Gly Asn Gly Pro Val Leu Val Glu Phe Val Thr Trp Arg

260 265 270

Gln Gly Val His Thr Ser Ser Asp Asn Pro Arg Ile Tyr Arg Thr Val

275 280 285

Glu Glu Glu Arg Glu His Glu Lys Trp Glu Pro Met His Arg Ile Glu

290 295 300

Lys Tyr Met Phe Asp Arg Gly Ile Leu Asp Ser Ala Glu Lys Gln Lys

305 310 315 320

Ile Trp Asp Glu Ala Leu Ala Ile Val Lys Glu Thr Tyr Glu Lys Ser

325 330 335

Leu Val Gly Leu Glu Ser Thr Ile Asp Glu Ile Phe Asp His Thr Tyr

340 345 350

Lys Val Leu Pro Pro Glu Leu Glu Glu Gln Lys Gln Glu Ala Leu Glu

355 360 365

Phe Phe Lys Gly Val Lys

370

<210> 9

<211> 447

<212> PRT

<213> Mycoplasma hyopneumoniae

<400> 9

Met Lys Trp Asn Lys Phe Leu Gly Leu Gly Leu Val Phe Pro Leu Ser

1 5 10 15

Ala Ile Ala Thr Ile Ser Ala Gly Cys Trp Asp Lys Glu Thr Thr Lys

20 25 30

Glu Glu Lys Ser Ala Asp Asn Gln Asn Lys Gln Ile Thr Asp Val Ser

35 40 45

Lys Ile Ser Gly Leu Val Asn Glu Arg Lys Ser Glu Ile Met Ala Ala

50 55 60

Lys Ala Asp Ala Asn Lys His Phe Gly Leu Asn Met Ala Ile Val Thr

65 70 75 80

Ala Asp Gly Thr Val Asn Asp Asn Ser Phe Asn Gln Ser Ser Trp Glu

85 90 95

Ala Ile Gln Gln Leu Gly Ala Leu Thr Gly Gly Glu Ile Thr Ser Val

100 105 110

Asp Ser Ser Thr Ala Glu Leu Glu Gly Lys Tyr Ser Ser Leu Ala Asn

115 120 125

Thr Asn Lys Asn Val Trp Val Leu Ser Gly Phe Gln His Gly Asp Ala

130 135 140

Ile Thr Lys Trp Leu Lys Ile Pro Glu Asn Lys Gln Leu Phe Thr Glu

145 150 155 160

Lys Asn Ile Ile Ile Leu Gly Ile Asp Trp Thr Asp Thr Glu Asn Val

165 170 175

Ile Pro Thr Gly Arg Tyr Ile Asn Leu Thr Tyr Lys Thr Glu Glu Ala

180 185 190

Gly Trp Leu Ala Gly Tyr Ala Asn Ala Ser Phe Leu Ala Lys Lys Phe

195 200 205

Pro Ser Asp Pro Thr Lys Arg Ser Ala Ile Val Ile Gly Gly Gly Ile

210 215 220

Phe Pro Ala Val Thr Asp Phe Ile Ala Gly Tyr Leu Ala Gly Ile Lys

225 230 235 240

Ala Trp Asn Leu Lys Asn Ser Asp Lys Lys Thr Lys Ile Thr Thr Asp

245 250 255

Lys Ile Glu Ile Asn Leu Gly Phe Asp Phe Gln Asn Thr Ser Thr Lys

260 265 270

Glu Arg Leu Glu Gln Ile Ala Ser Lys Asp Lys Pro Ser Thr Leu Leu

275 280 285

Ala Val Ala Gly Pro Leu Thr Glu Ile Phe Ser Asp Ile Ile Ala Asn

290 295 300

Gln Asn Asp Arg Tyr Leu Ile Gly Val Asp Thr Asp Gln Ser Leu Val

305 310 315 320

Tyr Thr Lys Thr Lys Asn Lys Phe Phe Thr Ser Ile Leu Lys Asn Leu

325 330 335

Gly Tyr Ser Val Phe Ser Val Leu Ser Asp Leu Tyr Thr Lys Lys Ser

340 345 350

Asn Ser Arg Asn Leu Ala Gly Phe Glu Phe Gly Lys Lys Ser Ala Thr

355 360 365

Val Tyr Leu Gly Ile Lys Asp Lys Phe Val Asp Ile Ala Asp Thr Ser

370 375 380

Leu Glu Gly Asn Asp Lys Lys Leu Ala Thr Glu Ala Ile Ser Glu Ala

385 390 395 400

Lys Lys Glu Phe Glu Glu Lys Thr Lys Thr Thr Pro Ala Glu Glu Val

405 410 415

Arg Lys Thr Leu Glu Ile Pro Glu Met Thr Asp Lys Gln Pro Asp Lys

420 425 430

Gln Gln Glu Ser Leu Asp Lys Leu Ile Thr Asp Ile Asn Lys Asn

435 440 445

<210> 10

<211> 317

<212> PRT

<213> Mycoplasma hyopneumoniae

<400> 10

Met Thr Tyr Gln Glu Tyr Leu Gln Ala Arg Leu Glu Gln Gln Asn Glu

1 5 10 15

Thr Lys Ser Leu Arg Ser Val Leu Ile Ile Asp Gly Ala Asp Pro Arg

20 25 30

Ala Ile Ala Ala Ala Lys Leu Leu Lys Glu Lys Asn Leu Val Lys Pro

35 40 45

Val Leu Leu Val Asp Glu Glu Ile Pro Asn Leu Asp Val Asp Gln His

50 55 60

Ile Val Asn Phe Gln Glu Lys Met Glu Phe Ile Lys Glu Phe Leu Lys

65 70 75 80

Phe Arg Lys Gly Lys Glu Thr Pro Glu Ser Ala Glu Ile Gln Phe Gln

85 90 95

Ser Asn Ala Phe Tyr Gly Thr Met Leu Leu Arg Lys Lys Lys Val Asp

100 105 110

Ala Val Val Gly Gly Leu Asn Tyr Pro Thr Ala Glu Ile Leu Arg Ala

115 120 125

Ala Phe Lys Ile Ile Gly Pro Lys Pro Asn Ile Lys Thr Ile Ser Ser

130 135 140

Val Met Ile Met His Lys Asp Gln Glu Lys Tyr Leu Phe Ser Asp Ile

145 150 155 160

Ser Val Asn Ile Ala Pro Asn Glu Asn Gln Leu Val Asp Ile Ala Lys

165 170 175

Asn Ala Leu Asp Phe Ala Ile Gln Leu Gly Phe Asp Pro Lys Pro Ala

180 185 190

Phe Leu Ser Phe Ser Thr Lys Gly Ser Ala Lys Ser Pro Gln Ser Glu

195 200 205

Leu Val Ala Lys Ala Thr Gln Met Phe Asn Ala Thr Ser Pro Ile Glu

210 215 220

Ala Tyr Gly Glu Ile Gln Leu Asp Ala Ala Leu Asp Ile Glu Val Arg

225 230 235 240

Arg Gln Lys Tyr Glu Val Asn Val Gly Lys Asn Ala Asn Ile Leu Ile

245 250 255

Phe Pro Asn Leu Asp Ala Gly Asn Ile Gly Tyr Lys Ile Ala Gln Arg

260 265 270

Leu Gly Asn Phe Gly Ala Ile Gly Pro Ile Ile Thr Gly Ile Asn Ala

275 280 285

Pro Ile Asn Asp Leu Ser Arg Gly Ser Thr Thr Gln Asp Val Phe Asn

290 295 300

Thr Val Leu Ile Ser Ala Leu Gln Val Glu Glu Gly Lys

305 310 315

<210> 11

<211> 373

<212> PRT

<213> Mycoplasma hyopneumoniae

<400> 11

Ile Ala Ser Arg Ser Asn Thr Thr Ala Lys Val Ala Pro Val Ala Val

1 5 10 15

Val Phe Ser Thr Arg Asn Asn Pro Phe Phe Gln Asn Val Glu Lys Gly

20 25 30

Ile Glu Thr Ala Ala Lys Glu Leu Gly Val Asp Tyr Glu Val Tyr Asp

35 40 45

Ser Glu Asn Asp Ser Asp Lys Glu Ala Arg Asn Ile Ser Asn Ile Ile

50 55 60

Ala Lys Gln Gln Lys Val Val Ile Phe Asn Asp Val Asn Glu Asp Ser

65 70 75 80

Gly Ile Ser Ala Val Lys Lys Leu Asn Gln Ala Gly Ile Pro Val Ile

85 90 95

Ala Thr Asp His Leu Leu Asn Ser Pro Lys Ala Leu Glu Ala Lys Ile

100 105 110

Lys Val Glu Ala Asn Ile Ala Ser Asp Asn Lys Gln Ala Gly Val Ile

115 120 125

Leu Ala Gln Phe Met Ala Gln Lys Ile Gly Leu Pro Gln Asp Ser Leu

130 135 140

Thr Tyr Ser Val Tyr Gly Ile Pro Gly Thr Glu Ser Gly Glu Ser Arg

145 150 155 160

Ala Gln Gly Phe Ile Glu Thr Val Lys Asn Leu Asn Asn Gln Ala Ile

165 170 175

Lys Tyr Asn Leu Phe Ser Tyr Gly Lys Tyr Gly Lys Glu Asn Ala Asn

180 185 190

Gly Lys Thr Tyr Ile Gly Arg Gln Ala Asp Asp Asn Arg Asp Leu Ala

195 200 205

Asn Gln Arg Val Ala Asn Asp Ala Thr Gln Val Phe Gln Asp Ala Gln

210 215 220

Lys Arg Pro Leu Leu Val Phe Gly Thr Asn Asp Glu Ala Ala Leu Gly

225 230 235 240

Ser Ile Ser Ala Leu Glu Ser Ala Gln Ile Pro Leu Gly Gly Gly Asp

245 250 255

Lys Phe Leu Pro Gly Ser Gly Lys Val Tyr Ile Thr Gly Val Asp Tyr

260 265 270

Thr Asn Asp Ala Gln Lys Ala Val Leu Asn Asn Lys Leu Ser Ala Thr

275 280 285

Val Glu Gln Asp Thr Asp Leu Leu Gly Arg Leu Ser Leu Ile Ile Ala

290 295 300

Glu Lys Ile Leu Lys Asp Gln Trp Lys Thr Ser Lys Tyr Ser Asp Phe

305 310 315 320

Tyr Ser Gln Phe Pro Gln Leu Asp Lys Asp Lys Asn Pro Asp Asp Gln

325 330 335

Val Glu Gln Gly Tyr Tyr Phe Lys Val Gly Thr Lys Leu Phe Trp Lys

340 345 350

Gly Pro Asp Gly Lys Gly Glu Lys Leu Gln Ala Asp Glu Asn Gly Ile

355 360 365

Leu Gln Lys Val Asn

370

<210> 12

<211> 691

<212> PRT

<213> Mycoplasma hyopneumoniae

<400> 12

Leu Ser Tyr Lys Phe Arg Arg Phe Phe Leu Thr Ser Ala Leu Ser Phe

1 5 10 15

Ala Pro Leu Ala Leu Val Ala Ser Cys Val Asn Asn Ser Arg Phe Asp

20 25 30

Ser Asn Glu Asp Asn Lys Leu Val Phe Gly His Thr Phe Ser Ser Ser

35 40 45

Gly Lys Glu Ala Lys Ala Leu Glu Lys Ile Ile Glu Val Trp Asn Lys

50 55 60

Thr Ala Thr Asn Gln Lys Asp Phe Ile Lys Met Glu Ala Gln Tyr Phe

65 70 75 80

Gln Asn Gly Tyr Asn Gly Ser Ala Ala Ser Ile Thr Asn Phe Leu Gln

85 90 95

Thr Lys Asp Arg Ile Lys Leu Pro Asn Ile Val Thr Asn Tyr Pro Ser

100 105 110

Leu Leu Ala Ile Val Asn Lys Tyr Ser Met Thr Phe Pro Leu Val Lys

115 120 125

Asp Phe Ser Ser Asn Gln Glu Pro Gln Asp Glu Asn Glu Lys Ala Ile

130 135 140

Lys Lys Phe Leu Lys Glu Gln Gly Ile Ser Asp Phe Leu Glu Ile Asn

145 150 155 160

Lys Glu Val Pro Phe Leu Asp Thr Lys Gly Val Tyr Thr Leu Pro Phe

165 170 175

Gly Lys Ser Thr Glu Val Leu Thr Ile Asn Lys Val Leu Phe Gly Trp

180 185 190

Met Ile Asn Lys Ala Leu Ala Asp Pro Lys Lys Pro Ala Lys Ile Lys

195 200 205

Glu Glu Asp Lys Pro Tyr Phe Ala Glu Phe Gln Lys Leu Gly Lys Glu

210 215 220

Lys Thr Gly Asp Ile Lys Glu Ile Glu Arg Ile Trp Lys Lys Tyr Val

225 230 235 240

Ser Asp Asp Gln Gly Leu Ala Gly Tyr Glu Phe Arg Arg Ser Asp Leu

245 250 255

Glu Asn Phe Thr Asp Leu Gln Lys Leu Ser Ser Arg Ile Leu Arg Ser

260 265 270

Phe Pro Glu Ala Leu Ser Gly Gly Ser Thr Asp Ser Ala Lys Ser Val

275 280 285

Leu Gly Ile Asp Asn Gln Ala Thr Leu Val Phe Ala Leu Ala Arg Ser

290 295 300

Val Ser Glu Gly Asn Arg Ser Gln Glu Val Thr Val Leu Asp Arg Gln

305 310 315 320

Lys Asn Leu Ile Asp Tyr Ile Ser Phe Ile Asp Lys Pro Asp Ser Ile

325 330 335

Arg Tyr Lys Asn Leu Glu Lys Ile Phe Asn Leu Leu Ser Gln Gly Ile

340 345 350

Lys Asp Arg Ser Ile Tyr Tyr Thr Ser Ala Gly Glu Tyr Asn Ser Thr

355 360 365

Phe Phe Arg Asn His Gln Gln Val Phe Ser Ile Gly Ser Thr Ser Gly

370 375 380

Tyr Phe His Asn Phe Val Lys Pro Thr Ala Thr Asn Tyr Gln Ile Gly

385 390 395 400

Phe Lys Lys Asn Asp Gly Leu Lys Ser Val Tyr Ser Val Ser Tyr Pro

405 410 415

Lys Phe Ser Ala Ile Val Ser Leu Glu Asp Leu Lys Asp Ile Thr Lys

420 425 430

Asp Leu Glu Ile Thr Ala Thr Asp Gly Ser Ser Lys Leu Lys Ile Asp

435 440 445

Ala Lys Phe Leu Gly Lys Leu Lys Glu Tyr Ala Gln Gln Asn Pro Val

450 455 460

Lys Lys Val Phe Tyr Phe Thr Asp Arg Ser Glu Lys Pro Ser Gly Ile

465 470 475 480

Phe Glu Lys Asp Tyr Ile Val Leu Gly Lys Tyr Lys Asn Asp Lys Asn

485 490 495

Glu Glu Phe Asn Gly Leu Val Ile Pro Thr Tyr Thr Glu Leu Tyr Lys

500 505 510

Asn Ser Gly Ser Asn Ala Leu Asn Asp Asp Glu Leu Ala Leu Glu Ala

515 520 525

Pro Pro His Lys Phe Asp Ala Asn Ser Lys Ile Thr Pro Ile Val Ala

530 535 540

Gln Gly Pro Asp Leu Ile Phe Ile His Ser Thr Glu Lys Glu Asp Lys

545 550 555 560

Ala Ala Lys Ala Phe Val Lys Trp Leu Leu Thr Glu Lys Ile Val Phe

565 570 575

Glu Glu Asn Ser Gln Glu Lys Met Thr Pro Leu Glu Tyr Phe Ala Arg

580 585 590

Ala Thr Ser Tyr Leu Leu Pro Ile Lys Ser Thr Leu Asp Lys Thr His

595 600 605

Phe Ser Pro Lys Asn Arg Ser Gln Lys Phe Ile Leu Asp Gln Phe Ser

610 615 620

Lys Phe Leu Asn Ala Asp Ser Lys Gly Lys Tyr Ser Leu Val Tyr Asp

625 630 635 640

Asn Ala Asp Ala Asn Ala Ser Ser Phe Arg Glu Ser Leu Asp Ser Ser

645 650 655

Val Ala Gln Met Gln Ser Leu Lys Ala Ser Asp Gly Lys Leu Arg Ser

660 665 670

Phe Lys Glu Phe Leu Glu Lys Leu Glu Gly Asn Leu Gly Pro Ala Phe

675 680 685

Lys Ser Lys

690

<210> 13

<211> 1182

<212> PRT

<213> Mycoplasma hyopneumoniae

<400> 13

Ile Gly Leu Thr Ile Phe Glu Lys Ser Phe Ser Ser Gln Val Ser Gly

1 5 10 15

Gly Val Asp Lys Asn Lys Val Val Asp Leu Lys Ser Asp Ser Asp Gln

20 25 30

Ile Phe Ser Glu Glu Asp Phe Ile Arg Ala Val Glu Asn Leu Lys Leu

35 40 45

Phe Asp Lys Tyr Lys His Leu Thr Ala Arg Met Ala Leu Gly Leu Ala

50 55 60

Arg Glu Ala Ala Asn Ala Phe Asn Phe Leu Asp Thr Tyr Asp Tyr Thr

65 70 75 80

Pro Ile Thr Lys His Ser Phe Lys Ile Ser Leu Asp Ile Ser Asp Ala

85 90 95

Phe Ala Ala Asn Lys Glu Val Lys Ala Val Val Val Ser Ala Tyr Ser

100 105 110

Gln Lys Tyr Gln Val Thr Tyr Ser Arg Leu Thr Ser Leu Lys Gly Trp

115 120 125

Lys Glu Glu Asp Asp Phe Gly Asp Asp Ile Ile Asp Tyr Gln Ile Asn

130 135 140

Gln Glu Leu Ser Gly Leu Ser Leu Ser Ser Leu Ala Pro Glu Ser Ala

145 150 155 160

His Leu Leu Ala Ser Glu Met Ala Phe Arg Leu Asp Asn Asp Phe Gln

165 170 175

Val Ala Tyr Lys Lys Thr Gly Ser Arg Ala Glu Ala Phe Arg Gln Ala

180 185 190

Leu Ile Lys Asn Tyr Leu Gly Tyr Asn Leu Val Asn Arg Gln Gly Leu

195 200 205

Pro Thr Met Leu Gln Lys Gly Tyr Val Leu Ala Pro Lys Thr Ile Glu

210 215 220

Asn Lys Asn Ala Ser Glu Glu Lys Leu Val Asn Ile Asn Glu Asn Asp

225 230 235 240

Arg Ala Arg Val Asn Lys Leu Gln Lys Val Glu Asn Leu Ala Phe Lys

245 250 255

Asn Leu Ser Asp Pro Asn Gly Thr Leu Ser Ile Thr Phe Glu Leu Trp

260 265 270

Asp Pro Asn Gly Lys Leu Val Ser Glu Tyr Asp Phe Lys Ile Lys Gly

275 280 285

Ile Lys Lys Leu Asp Phe Asp Leu Lys Lys Gln Glu Glu Lys Val Leu

290 295 300

Gln Lys Val Thr Glu Phe Val Glu Ile Lys Pro Tyr Val Gln Leu Gly

305 310 315 320

Leu Ile Arg Asp Asn Leu Ser Leu Ser Glu Ile Ile Tyr Lys Asn Asp

325 330 335

Asn Asn Pro Glu Tyr Leu Arg Lys Ile Leu Ala Lys Leu Lys Glu His

340 345 350

Asn Asn Asn Lys Arg Val Asp Asn Asn Thr Ser Thr Thr Lys Phe Gln

355 360 365

Glu Glu Asp Leu Lys Asn Glu Pro Asn Ser Asn Gly Ser Glu Gln Asp

370 375 380

Ser Phe Glu Lys Ala Lys Glu Asn Phe Leu Ser Phe Phe Asp Leu Arg

385 390 395 400

Ser Arg Leu Ile Pro Ile Pro Asp Leu Pro Leu Tyr Tyr Leu Lys Val

405 410 415

Asn Ser Ile Asn Phe Asp Arg Asn Ile Glu Glu Asn Glu Lys Glu Lys

420 425 430

Leu Leu Lys Asn Glu Gln Val Val Leu Lys Val Asp Phe Ser Leu Lys

435 440 445

Lys Val Val Ser Asp Ile Arg Ala Pro Tyr Leu Val Ser Ser Gln Val

450 455 460

Arg Ser Asn Tyr Pro Pro Val Leu Lys Ala Ser Leu Ala Lys Ile Gly

465 470 475 480

Lys Gly Ser Asn Ser Lys Val Val Leu Leu Asp Leu Gly Asn Leu Ser

485 490 495

Ser Arg Phe Lys Val Gln Leu Asp Tyr Ser Ala Lys Gln Arg Glu Ile

500 505 510

Ile Asn Thr Leu Leu Lys Glu Asn Pro Glu Arg Glu Lys Glu Leu Gln

515 520 525

Ala Lys Ile Glu Ser Lys Thr Phe Ser Pro Ile Asp Leu Asn Asn Asp

530 535 540

Asp Leu Leu Ala Ile Glu Phe Gln Tyr Glu Asp Asn Pro Glu Gly Asp

545 550 555 560

Trp Ile Thr Leu Gly Arg Met Glu Lys Leu Val Lys Glu Val Ile Gln

565 570 575

Tyr Lys Lys Glu Gly Lys Thr Phe Leu Asp Asp Glu Val Ala Lys Thr

580 585 590

Leu Tyr Tyr Leu Asp Phe His His Leu Pro Gln Ser Lys Lys Asp Leu

595 600 605

Glu Glu Tyr Lys Glu Lys His Lys Asn Lys Phe Ile Ser Glu Ile Lys

610 615 620

Pro Ala Thr Pro Ala Ser Gln Ala Lys Thr Ser Gln Ala Lys Asn Glu

625 630 635 640

Lys Glu Val Lys Pro Glu Ser Ala Gln Ala Glu Ala Ser Ser Ser Asn

645 650 655

Ser Asn Asp Ser Ser Ser Lys Thr Thr Ser Ser Ser Ser Met Ala Gly

660 665 670

Thr Thr Gln Asn Lys Ser Thr Glu Thr Pro Asn Ser Ser Ser Asn Ser

675 680 685

Thr Pro Thr Ser Ser Ala Thr Thr Ser Ala Thr Thr Ser Thr Thr Ser

690 695 700

Ser Asn Ser Ser Ser Thr Thr Ser Ser Thr Thr Thr Thr Thr Ser Thr

705 710 715 720

Gln Ala Ala Thr Thr Ser Ala Ser Ser Ala Lys Val Lys Thr Thr Lys

725 730 735

Phe Gln Glu Gln Val Lys Glu Gln Glu Gln Lys Gln Glu Lys Ala Lys

740 745 750

Glu Thr Asn Gln Leu Leu Asp Thr Lys Arg Asn Lys Glu Asp Ser Gly

755 760 765

Leu Gly Leu Ile Leu Trp Asp Phe Leu Val Asn Ser Lys Tyr Lys Thr

770 775 780

Leu Pro Gly Thr Thr Trp Asp Phe His Val Glu Pro Asp Asn Phe Asn

785 790 795 800

Asp Arg Leu Lys Ile Thr Ala Ile Leu Lys Glu Asn Thr Ser Gln Ala

805 810 815

Lys Ser Asn Pro Asp Ser Lys Asn Leu Thr Ser Leu Ser Arg Asn Leu

820 825 830

Ile Ile Lys Gly Val Met Ala Asn Lys Tyr Ile Asp Tyr Leu Val Gln

835 840 845

Glu Asp Pro Val Leu Leu Val Asp Tyr Thr Arg Arg Asn Gln Ile Lys

850 855 860

Thr Glu Arg Glu Gly Gln Leu Ile Trp Ser Gln Leu Ala Ser Pro Gln

865 870 875 880

Met Ala Ser Pro Glu Ser Ser Pro Glu Lys Ala Lys Leu Glu Ile Thr

885 890 895

Glu Glu Gly Leu Arg Val Lys Lys Gly Gly Thr Lys Ile Lys Glu Thr

900 905 910

Arg Lys Ser Thr Thr Ser Asn Ala Lys Ser Asn Thr Asn Ser Lys Pro

915 920 925

Asn Lys Lys Leu Val Leu Leu Lys Gly Ser Ile Lys Asn Pro Gly Thr

930 935 940

Lys Lys Glu Trp Ile Leu Val Gly Ser Gly Asn Lys Ala Thr Lys Asn

945 950 955 960

Gly Ser Ser Ser Asn Asn Ser Asn Thr Gln Ile Trp Ile Thr Arg Leu

965 970 975

Gly Thr Ser Val Gly Ser Leu Lys Thr Glu Gly Glu Thr Val Leu Gly

980 985 990

Ile Ser Asn Asn Asn Ser Gln Gly Glu Val Leu Trp Thr Thr Ile Lys

995 1000 1005

Ser Lys Leu Glu Asn Glu Asn Asn Ser Asp Asn Asn Gln Ile Gln

1010 1015 1020

Tyr Ser Pro Ser Thr His Ser Leu Thr Thr Asn Ser Arg Ser Asn

1025 1030 1035

Thr Gln Gln Ser Gly Arg Asn Gln Ile Lys Ile Thr Asn Thr Gln

1040 1045 1050

Arg Lys Thr Thr Thr Ser Pro Ser Gln Asn Leu Ser Gln Asn Pro

1055 1060 1065

Asp Leu Asn Gln Ile Asp Val Arg Leu Gly Leu Leu Val Gln Asp

1070 1075 1080

Lys Lys Leu His Leu Trp Trp Ile Ala Asn Asp Ser Ser Asp Glu

1085 1090 1095

Pro Glu His Ile Thr Ile Asp Phe Ala Glu Gly Thr Lys Phe Asn

1100 1105 1110

Tyr Asp Asp Leu Asn Tyr Val Gly Gly Leu Leu Lys Asn Thr Thr

1115 1120 1125

Asn Asn Asn Asn Met Gln Thr Gln Asp Asp Glu Gly Asp Gly Tyr

1130 1135 1140

Leu Ala Leu Lys Gly Leu Gly Ile Tyr Glu Phe Pro Asp Asp Glu

1145 1150 1155

Ser Ile Asp Gln Pro Ala Thr Val Glu Lys Ala Glu Arg Leu Tyr

1160 1165 1170

Lys His Phe Met Gly Leu Phe Arg Glu

1175 1180

<210> 14

<211> 350

<212> PRT

<213> Mycoplasma hyopneumoniae

<400> 14

Met Asp Lys Phe Ser Arg Thr Val Leu Gly Asp Ile His Pro Ser Glu

1 5 10 15

Leu Gly Val Val Asp Cys His Asp His Leu Ile Lys Asn Tyr Gly Pro

20 25 30

Lys Ala His Glu His Pro Asp Phe Val Met Leu Ser Asn Glu Ala Ala

35 40 45

Ile Ala Glu Ser Leu Glu Tyr Ala Ser Arg Gly Gly Lys Thr Ile Val

50 55 60

Thr Met Asp Pro Pro Asn Val Gly Arg Asp Val Tyr Arg Met Leu Lys

65 70 75 80

Ile Ala Lys Ala Leu Glu Gly Lys Val His Ile Ile Met Ala Thr Gly

85 90 95

Phe His Lys Ala Ala Phe Tyr Asp Lys Gly Ala Ser Trp Leu Ala Leu

100 105 110

Ala Pro Thr Asp Glu Ile Val Lys Met Val Val Ala Glu Ile Thr Gln

115 120 125

Gly Met Asp Glu Tyr Asn Tyr Ser Gly Pro Val Val Arg Arg Ser Lys

130 135 140

Ala Lys Ala Gly Ile Ile Lys Ala Gly Thr Gly Tyr Gly Ala Ile Asp

145 150 155 160

Arg Leu Glu Leu Lys Ser Leu Glu Val Ala Ala Arg Ala Ser Ile Glu

165 170 175

Thr Gly Ala Pro Ile Leu Val His Thr Gln Leu Gly Thr Met Ala Tyr

180 185 190

Glu Ala Ala Lys Tyr Leu Ile Asp Phe Gly Ala Asn Pro Arg Lys Ile

195 200 205

Gln Ile Ser His Leu Asn Lys Asn Pro Asp Lys Tyr Tyr Tyr Ala Lys

210 215 220

Ile Ile Lys Glu Leu Gly Val Ser Leu Cys Phe Asp Gly Pro Asp Arg

225 230 235 240

Val Lys Tyr Phe Pro Asp Thr Thr Leu Ala Glu Asn Ile Lys Tyr Leu

245 250 255

Val Asp Leu Gly Leu Glu Lys His Ile Thr Leu Ser Leu Asp Ala Gly

260 265 270

Arg Val Leu Tyr Gln Arg Asn Tyr Gly Lys Leu Lys Gly Lys Trp Thr

275 280 285

Phe Gly Leu Thr Tyr Leu Phe Asp Arg Phe Ile Pro Leu Leu Glu Gln

290 295 300

Val Gly Ile Ser Lys Glu Thr Ile Asn Asn Ile Leu Val Asn Asn Pro

305 310 315 320

Ala Glu Ile Leu Ala Phe Asp Gln Pro Arg Lys Phe Asp Pro Ser Ile

325 330 335

Leu Pro Asp Tyr Ile Ile Glu Leu Lys Lys Ser Phe Lys Ile

340 345 350

<210> 15

<211> 40

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 15

gatataggat ccatggacaa atttcgctat gtaaagcctg 40

<210> 16

<211> 45

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 16

caatatgtcg acttatttta ctcctttaaa aaattcaagc gcttc 45

<210> 17

<211> 51

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 17

gatataggat ccatgaatgg aataaatttc ttggcttagg cttagttttt c 51

<210> 18

<211> 50

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 18

caatatgtcg acttaatttt tattaatatc ggtaattagt ttgtctaagc 50

<210> 19

<211> 41

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 19

gatataggat ccatgacata ccaagaatat cttcaagcaa g 41

<210> 20

<211> 42

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 20

caatatgtcg acctatttac cttcttcaac ttgtagagcg ct 42

<210> 21

<211> 38

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 21

gatataggat ccatagcttc aaggtcgaat acaactgc 38

<210> 22

<211> 42

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 22

caatatgtcg acttaattta ccttttggag tatcccattt tc 42

<210> 23

<211> 40

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 23

gatataggat ccttatccta taaatttagg cgttttttcc 40

<210> 24

<211> 41

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 24

caatatgtcg acttattttg atttaaaagc aggacctaaa t 41

<210> 25

<211> 44

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 25

gatataggat ccattggact aacaattttt gagaaatcat ttag 44

<210> 26

<211> 38

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 26

caatatgtcg acttattcct aaatagcccc ataaagtg 38

<210> 27

<211> 38

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 27

gatataggat ccatggacaa attttcacga actgttct 38

<210> 28

<211> 51

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 28

caatatgtcg acctagattt taaaggattt ttttaattca ataatataat c 51

<210> 29

<211> 40

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 29

gatataggat ccatggacaa atttcgctat gtaaagcctg 40

<210> 30

<211> 36

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 30

gctaacaaaa gatgactggt ttgtcccagc ttttcg 36

<210> 31

<211> 36

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 31

cgaaaagctg ggacaaacca gtcatctttt gttagc 36

<210> 32

<211> 36

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 32

cttgcaaatg caatattgga atggtagcga aaaagg 36

<210> 33

<211> 36

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 33

cctttttcgc taccattcca atattgcatt tgcaag 36

<210> 34

<211> 58

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 34

cgaggcgcta aatattgcaa gtatttggaa atggccagtt gttttttgcg taaataac 58

<210> 35

<211> 58

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 35

gttatttacg caaaaaacaa ctggccattt ccaaatactt gcaatattta gcgcctcg 58

<210> 36

<211> 52

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 36

gttttttgcg taaataacaa tcaatgggca atttcaaccc caaataaata tg 52

<210> 37

<211> 52

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 37

catatttatt tggggttgaa attgcccatt gattgttatt tacgcaaaaa ac 52

<210> 38

<211> 36

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 38

gttgagtttg taacttggcg tcaaggtgtt catacc 36

<210> 39

<211> 36

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 39

ggtatgaaca ccttgacgcc aagttacaaa ctcaac 36

<210> 40

<211> 32

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 40

gagaacacga aaaatgggaa ccaatgcacc gg 32

<210> 41

<211> 32

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 41

ccggtgcatt ggttcccatt tttcgtgttc tc 32

<210> 42

<211> 39

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 42

ccgaaaaaca aaaaatttgg gatgaagcgc ttgcgattg 39

<210> 43

<211> 39

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 43

caatcgcaag cgcttcatcc caaatttttt gtttttcgg 39

<210> 44

<211> 45

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 44

caatatgtcg acttatttta ctcctttaaa aaattcaagc gcttc 45

<210> 45

<211> 52

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 45

gatataggat ccatgaaatg gaataaattt cttggcttag gcttagtttt tc 52

<210> 46

<211> 40

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 46

catttaacca atcaagttgg gaggcaattc aacaacttgg 40

<210> 47

<211> 40

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 47

ccaagttgtt gaattgcctc ccaacttgat tggttaaatg 40

<210> 48

<211> 45

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 48

ctaataccaa caaaaatgtt tgggtacttt ctggttttca acacg 45

<210> 49

<211> 45

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 49

cgtgttgaaa accagaaagt acccaaacat ttttgttggt attag 45

<210> 50

<211> 44

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 50

cggtgatgcg atcacaaaat ggttaaaaat ccctgaaaat aagc 44

<210> 51

<211> 44

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 51

gcttattttc agggattttt aaccattttg tgatcgcatc accg 44

<210> 52

<211> 45

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 52

ttatcatact cggaattgac tggactgata ctgaaaatgt aattc 45

<210> 53

<211> 45

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 53

gaattacatt ttcagtatca gtccagtcaa ttccgagtat gataa 45

<210> 54

<211> 29

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 54

gaagaagccg gatggcttgc aggatatgc 29

<210> 55

<211> 29

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 55

gcatatcctg caagccatcc ggcttcttc 29

<210> 56

<211> 53

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 56

ggttatctag ccggaattaa agcttggaat ctaaaaaatt ctgataaaaa aac 53

<210> 57

<211> 53

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 57

gtttttttat cagaattttt tagattccaa gctttaattc cggctagata acc 53

<210> 58

<211> 50

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 58

caatatgtcg acttaatttt tattaatatc ggtaattagt ttgtctaagc 50

<210> 59

<211> 40

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 59

gatataggat ccttatccta taaatttagg cgttttttcc 40

<210> 60

<211> 52

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 60

caattaataa agttttgttt ggttggatga ttaataaagc acttgctgat cc 52

<210> 61

<211> 52

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 61

ggatcagcaa gtgctttatt aatcatccaa ccaaacaaaa ctttattaat tg 52

<210> 62

<211> 53

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 62

gatattaaag aaattgaaag aatctggaaa aaatatgtct ccgatgatca agg 53

<210> 63

<211> 53

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 63

ccttgatcat cggagacata ttttttccag attctttcaa tttctttaat atc 53

<210> 64

<211> 30

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 64

gccctttcag gaggctccac tgattcggca 30

<210> 65

<211> 30

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 65

tgccgaatca gtggagcctc ctgaaagggc 30

<210> 66

<211> 46

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 66

gccgcaaaag cttttgttaa atggcttttg acagaaaaaa tagtct 46

<210> 67

<211> 46

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 67

agactatttt ttctgtcaaa agccatttaa caaaagcttt tgcggc 46

<210> 68

<211> 41

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 68

caatatgtcg acttattttg atttaaaagc aggacctaaa t 41

<210> 69

<211> 44

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 69

gatataggat ccattggact aacaattttt gagaaatcat ttag 44

<210> 70

<211> 40

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 70

ctaacttctc taaaaggttg gaaagaagaa gatgattttg 40

<210> 71

<211> 40

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 71

caaaatcatc ttcttctttc caacctttta gagaagttag 40

<210> 72

<211> 47

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 72

ctttctatta cttttgaact ctgggaccca aatggtaaat tagtatc 47

<210> 73

<211> 47

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 73

gatactaatt taccatttgg gtcccagagt tcaaaagtaa tagaaag 47

<210> 74

<211> 30

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 74

ccctgaagga gattggataa ctttagggag 30

<210> 75

<211> 30

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 75

ctccctaaag ttatccaatc tccttcaggg 30

<210> 76

<211> 34

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 76

ctaccaggaa ctacctggga tttccatgtt gaac 34

<210> 77

<211> 34

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 77

gttcaacatg gaaatcccag gtagttcctg gtag 34

<210> 78

<211> 30

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 78

ggacaactaa tttggagcca gttagcttcc 30

<210> 79

<211> 30

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 79

ggaagctaac tggctccaaa ttagttgtcc 30

<210> 80

<211> 35

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 80

ggaacaaaaa aggaatggat tcttgtagga tctgg 35

<210> 81

<211> 35

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 81

ccagatccta caagaatcca ttcctttttt gttcc 35

<210> 82

<211> 34

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 82

ccaatacgca aatatggata acccgtctag gaac 34

<210> 83

<211> 34

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 83

gttcctagac gggttatcca tatttgcgta ttgg 34

<210> 84

<211> 38

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 84

ccaaggggaa gttctctgga ctactattaa atccaaac 38

<210> 85

<211> 38

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 85

gtttggattt aatagtagtc cagagaactt ccccttgg 38

<210> 86

<211> 37

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 86

caaaaaactt cacctttggt ggattgctaa tgatagc 37

<210> 87

<211> 37

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 87

gctatcatta gcaatccacc aaaggtgaag ttttttg 37

<210> 88

<211> 38

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 88

caatatgtcg acttattcct aaatagcccc ataaagtg 38

<210> 89

<211> 38

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 89

gatataggat ccatagcttc aaggtcgaat acaactgc 38

<210> 90

<211> 68

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 90

aataattgca gaaaaaattc ttaaagatca atggaaaaca agtaaatatt ctgattttta 60

ttcacaat 68

<210> 91

<211> 68

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 91

attgtgaata aaaatcagaa tatttacttg ttttccattg atctttaaga attttttctg 60

caattatt 68

<210> 92

<211> 42

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 92

caatatgtcg acttaattta ccttttggag tatcccattt tc 42

<210> 93

<211> 38

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 93

gatataggat ccatggacaa attttcacga actgttct 38

<210> 94

<211> 34

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 94

caatagtgac aatggacccc ccaaatgttg gtcg 34

<210> 95

<211> 34

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 95

cgaccaacat ttggggggtc cattgtcact attg 34

<210> 96

<211> 35

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 96

gataaaggcg catcatggct tgcgcttgca ccaac 35

<210> 97

<211> 35

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 97

gttggtgcaa gcgcaagcca tgatgcgcct ttatc 35

<210> 98

<211> 41

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 98

ggaaaactta aaggtaaatg gacttttgga ctaacctatt t 41

<210> 99

<211> 41

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 99

aaataggtta gtccaaaagt ccatttacct ttaagttttc c 41

<210> 100

<211> 51

<212> DNA

<213> Synthetic sequence

<220>

<223> primer

<400> 100

caatatgtcg acctagattt taaaggattt ttttaattca ataatataat c 51

<---

Claims (13)

1. Composition for the prevention of infection with Mycoplasma spp., Containing: an effective amount of EutD protein as an active ingredient in said composition; and pharmaceutically acceptable adjuvant, wherein said EutD has the sequence SEQ ID NO: 10. 2. A composition according to claim 1, wherein the concentration of said active ingredient is from 50 to 3500 μg / ml, based on the total volume of said composition. 3. A composition according to claim 1, wherein said pharmaceutically acceptable adjuvant is Freund's complete adjuvant, Freund's incomplete adjuvant, an alumina gel, a surfactant, a polyanionic adjuvant, a peptide, an oil emulsion, or a combination thereof. 4. Composition for the prevention of infection with Mycoplasma spp., Containing: an effective amount of EutD protein as an active ingredient in said composition; a pharmaceutically acceptable adjuvant, and a pharmaceutically acceptable additive wherein said EutD has the sequence SEQ ID NO: 10. 5. A composition according to claim 4, wherein said pharmaceutically acceptable adjuvant is Freund's complete adjuvant, Freund's incomplete adjuvant, alumina gel, surfactant, polyanionic adjuvant, peptide, oil emulsion, or a combination thereof. 6. A composition according to claim 4, wherein said pharmaceutically acceptable additive is a solvent, stabilizer, diluent, preservative, antibacterial agent, antifungal agent, isotonic agent, absorption delaying agent, or a combination thereof.

Images