RU2755663C1 - Method for measuring number of copies of human mitochondrial dna by digital polymerase chain reaction - Google Patents

Method for measuring number of copies of human mitochondrial dna by digital polymerase chain reaction Download PDF

Info

Publication number
RU2755663C1
RU2755663C1 RU2021109524A RU2021109524A RU2755663C1 RU 2755663 C1 RU2755663 C1 RU 2755663C1 RU 2021109524 A RU2021109524 A RU 2021109524A RU 2021109524 A RU2021109524 A RU 2021109524A RU 2755663 C1 RU2755663 C1 RU 2755663C1
Authority
RU
Russia
Prior art keywords
dna
copies
mitochondrial
vol
mitochondrial dna
Prior art date
Application number
RU2021109524A
Other languages
Russian (ru)
Inventor
Алексей Анатольевич Слепцов
Мария Владимировна Голубенко
Рамиль Ринатович Салахов
Мария Сергеевна Назаренко
Original Assignee
Федеральное государственное бюджетное научное учреждение «Томский национальный исследовательский медицинский центр Российской академии наук» (Томский НИМЦ), НИИ медицинской генетики
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Федеральное государственное бюджетное научное учреждение «Томский национальный исследовательский медицинский центр Российской академии наук» (Томский НИМЦ), НИИ медицинской генетики filed Critical Федеральное государственное бюджетное научное учреждение «Томский национальный исследовательский медицинский центр Российской академии наук» (Томский НИМЦ), НИИ медицинской генетики
Priority to RU2021109524A priority Critical patent/RU2755663C1/en
Application granted granted Critical
Publication of RU2755663C1 publication Critical patent/RU2755663C1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

FIELD: biotechnology.
SUBSTANCE: invention relates to biotechnology and can be used to determine the average number of copies of human mitochondrial DNA per cell in various human biological samples, including previously isolated samples of total DNA from human biological materials.
EFFECT: improvement of method for determining average number of copies of human mitochondrial DNA per cell.
1 cl, 5 dwg, 1 tbl, 1 ex

Description

Изобретение относится к области молекулярной генетики и может быть использовано для определения среднего количества копий митохондриальной ДНК человека, приходящегося на одну клетку, в различных биологических образцах человека, в том числе в ранее выделенных образцах тотальной ДНК из биологических материалов человека.The invention relates to the field of molecular genetics and can be used to determine the average number of copies of human mitochondrial DNA per cell, in various biological samples of humans, including previously isolated samples of total DNA from human biological materials.

Митохондриальная ДНК человека (мтДНК) представляет собой небольшой кольцевой геном (16569 пар оснований), содержащийся в митохондриях, с множеством копий в каждой клетке. Он включает 37 генов, в том числе 13 генов, кодирующих компоненты митохондриальной цепи переноса электронов и комплекса АТФ-синтазы, 22 - митохондриальные транспортные РНК, и 2 - рибосомных РНК [1]. Количество митохондрий на клетку постоянно меняется в зависимости от потребности в энергии, окислительного стресса и патологических состояний [2]. Каждая митохондрия содержит 2-10 копий мтДНК, а в клетке число мтДНК может достигать 1000 [3].Human mitochondrial DNA (mtDNA) is a small circular genome (16,569 bp) found in mitochondria, with multiple copies in each cell. It includes 37 genes, including 13 genes encoding components of the mitochondrial electron transport chain and the ATP synthase complex, 22 - mitochondrial transport RNAs, and 2 - ribosomal RNAs [1]. The number of mitochondria per cell is constantly changing depending on the need for energy, oxidative stress and pathological conditions [2]. Each mitochondrion contains 2-10 copies of mtDNA, and the number of mtDNA in a cell can reach 1000 [3].

Дисфункция митохондрий играет важную роль в развитии ряда заболеваний человека, связанных со старением, включая сердечно-сосудистые заболевания (ССЗ), нейродегенеративные и онкологические заболевания [4]. Низкие уровни количества мтДНК ассоциированы с риском развития ССЗ, включая ишемическую болезнь сердца (ИБС) и инсульт [5, 6], а также нейродегенеративных заболеваний, например, болезни Паркинсона и болезни Альцгеймера [7, 8]. Кроме того, низкий уровень количества мтДНК также наблюдается при нескольких типах онкологических заболеваний, таких как рак молочной железы, почек, печени и прямой кишки [9-11]. Кроме того, показано, что количество мтДНК в образцах ДНК периферической крови в среднем выше у женщин, снижается с возрастом и отрицательно коррелирует с количеством лейкоцитов [12-14].Mitochondrial dysfunction plays an important role in the development of a number of human diseases associated with aging, including cardiovascular diseases (CVD), neurodegenerative and oncological diseases [4]. Low levels of mtDNA are associated with the risk of CVD, including coronary heart disease (CAD) and stroke [5, 6], as well as neurodegenerative diseases such as Parkinson's disease and Alzheimer's disease [7, 8]. In addition, low levels of mtDNA are also observed in several types of cancers, such as breast, kidney, liver, and rectal cancers [9-11]. In addition, it has been shown that the amount of mtDNA in DNA samples from peripheral blood is, on average, higher in women, decreases with age, and negatively correlates with the number of leukocytes [12-14].

В последние годы выдвигается предположение, что количество копий митохондриальной ДНК является потенциальным биомаркером митохондриальной дисфункции [15], а исследования, нацеленные на разнообразие митохондрий, значительно расширились. Количество митохондрий отражает потребность клетки в энергии, обеспечение которой нарушается в результате дисбаланса энергетического метаболизма [16]. Соотношение между митохондриальным и ядерным геномами (мтДНК / яДНК) является подходящей мерой для определения содержания мтДНК в клетке.In recent years, it has been suggested that the copy number of mitochondrial DNA is a potential biomarker of mitochondrial dysfunction [15], and research aimed at mitochondrial diversity has expanded significantly. The number of mitochondria reflects the cell's need for energy, the supply of which is disrupted as a result of an imbalance in energy metabolism [16]. The ratio between mitochondrial and nuclear genomes (mtDNA / nDNA) is a suitable measure for determining the content of mtDNA in a cell.

С другой стороны, отмечается, что неточности в существующей методологии измерения количества копий мтДНК могут быть отчасти ответственны за противоречивые результаты [15]. Более того, на измерение количества копий мтДНК могут влиять различные преаналитические факторы [17, 18]. В настоящее время методом выбора для определения количества копий мтДНК является количественная полимеразная цепная реакция (ПЦР) в реальном времени [15]. Существуют альтернативные методы измерения, позволяющие приблизительно оценить уровень количества копий мтДНК, такие как секвенирование следующего поколения (NGS) [19] и микроматрицы [14].On the other hand, it is noted that inaccuracies in the existing methodology for measuring the number of mtDNA copies may be partly responsible for the conflicting results [15]. Moreover, the measurement of the number of mtDNA copies can be influenced by various preanalytical factors [17, 18]. Currently, the method of choice for determining the number of mtDNA copies is quantitative polymerase chain reaction (PCR) in real time [15]. There are alternative measurement methods that allow an approximate estimate of the level of the mtDNA copy number, such as next generation sequencing (NGS) [19] and microarrays [14].

Однако эти три подхода дороги и чрезвычайно трудоемки, если их применять в эпидемиологических исследованиях с тысячами образцов, а также отличаются невысокой точностью подсчета числа копий. Методы NGS и микроматриц подвержены смещению из-за наличия так называемых «волнообразных паттернов» [20], которые могут затруднять точную оценку количества копий мтДНК и не могут быть полностью исправлены биоинформатически [21]. Кроме того, наличие большого числа ядерных псевдогенов мтДНК (NUMT) создает проблему специфичности ПЦР-праймеров.However, these three approaches are expensive and extremely time-consuming when applied to epidemiological studies with thousands of samples and are not highly accurate in counting the number of copies. NGS and microarray methods are susceptible to bias due to the presence of so-called “wave-like patterns” [20], which can make it difficult to accurately estimate the number of mtDNA copies and cannot be fully corrected bioinformatically [21]. In addition, the presence of a large number of nuclear pseudogenes mtDNA (NUMT) poses the problem of specificity of PCR primers.

Появление технологии цифровой ПЦР (digital PCR, dPCR), в том числе такого варианта как капельная цифровая ПЦР (digital droplet PCR, ddPCR), позволила получить точные (абсолютные) измерения количества копий участков ДНК (copy number variation, CNV) путём проведения двух флуоресцентных анализов (один для определения региона интереса, а другой для определения контрольного эталонного локуса с известным числом копий участка ДНК), одновременно протекающих в десятках тысяч независимых реакций (капель, лунок) [22, 23]. Технология построена таким образом, чтобы в одной реакции участвовала в среднем одна молекула исходной ДНК. Тем самым достигается точная оценка числа молекул ДНК, содержащих исследуемый регион ДНК, в определенном объеме образца. Эта значительно отличает её от эмульсионной ПЦР, в результате которой получаются капли различного объема.The advent of digital PCR (dPCR) technology, including such an option as digital droplet PCR (ddPCR), made it possible to obtain accurate (absolute) measurements of the number of copies of DNA regions (copy number variation, CNV) by conducting two fluorescent analyzes (one to determine the region of interest, and the other to determine the reference reference locus with a known number of copies of the DNA region), simultaneously occurring in tens of thousands of independent reactions (drops, wells) [22, 23]. The technology is designed in such a way that, on average, one molecule of the original DNA participated in one reaction. Thus, an accurate estimate of the number of DNA molecules containing the studied region of DNA in a certain volume of the sample is achieved. This significantly distinguishes it from emulsion PCR, as a result of which drops of various volumes are obtained.

Число копий по технологии dPCR рассчитывается путём сравнения количества флуоресцирующих молекул интересующего региона с количеством молекул эталонного локуса генома. Однако, в отличие от количественной ПЦР в режиме реального времени, измерение флуоресценции по технологии dPCR проводится не во время ПЦР, а «по конечной точке», т.е. по завершению ПЦР. Тем самым достигается высокая точность анализа, который позволяет определить целочисленное количество копий в локусах, по сравнению с другими технологиями [22-24].The dPCR copy number is calculated by comparing the number of fluorescent molecules in the region of interest with the number of molecules in the reference genome locus. However, unlike quantitative real-time PCR, dPCR fluorescence measurements are not performed during PCR, but "by endpoint", i.e. upon completion of PCR. Thus, a high accuracy of the analysis is achieved, which allows one to determine the integer number of copies in loci, in comparison with other technologies [22-24].

Новая техническая задача заключается в подборе последовательностей (структуры) олигонуклеотидных проб и способа преаналитической подготовки образца ДНК, с разработкой протокола проведения цифровой ПЦР для абсолютной квантификации (точного определения количества) копий мтДНК, содержащейся в биологическом образце человека.A new technical challenge is to select the sequences (structure) of oligonucleotide probes and a method for preanalytical preparation of a DNA sample, with the development of a digital PCR protocol for absolute quantification (exact determination of the number) of mtDNA copies contained in a human biological sample.

Данная задача решена путем разработки набора синтетических олигонуклеотидных последовательностей и проб, а также протокола проведения цифровой ПЦР для подсчета количества копий мтДНК человека в клетке.This problem was solved by developing a set of synthetic oligonucleotide sequences and probes, as well as a digital PCR protocol for counting the number of copies of human mtDNA in a cell.

Техническим результатом изобретения является повышение точности измерения количества копий мтДНК в интересующих биологических образцах человека, по сравнению с существующими аналогами.The technical result of the invention is to improve the accuracy of measuring the number of copies of mtDNA in biological samples of interest, in comparison with existing analogues.

Разработан набор праймеров и флюоресцентных пробы (по принципу TaqMan-проб) для генов MT-RNR2 (митохондриальная 16S рибосомальная субъединица) и HBB (бета-глобин, ядерный ген). Учитывая наличие ядерных копий митохондриальных генов, а также возможность делеций части митохондриальной ДНК, ген MT-RNR2 был выбран как участок, практически не подвергающийся делециям. Праймеры и пробы были протестированы на отсутствие сайтов отжига в ядерном геноме с помощью программы BLAST онлайн [25]. Концентрация рабочих растворов праймеров и зондов может варьировать от 100 до 600 нМ на 1 реакционную смесь. Оптимальной концентрацией является 450 нM для каждого праймера и 250 нM для зонда (таб. 1).A set of primers and fluorescent probes (based on TaqMan probes) was developed for the MT-RNR2 (mitochondrial 16S ribosomal subunit) and HBB (beta-globin, nuclear gene) genes. Considering the presence of nuclear copies of mitochondrial genes, as well as the possibility of deletions of a part of mitochondrial DNA, the MT-RNR2 gene was chosen as a region that is practically not subject to deletions. Primers and probes were tested for the absence of annealing sites in the nuclear genome using the BLAST online program [25]. The concentration of working solutions of primers and probes can vary from 100 to 600 nM per 1 reaction mixture. The optimal concentration is 450 nM for each primer and 250 nM for the probe (Table 1).

Генотипирование с помощью набора проб осуществляли по модифицированному протоколу генотипирования методом dPCR и ddPCR следующим образом:Genotyping using a set of probes was carried out according to a modified genotyping protocol by the dPCR and ddPCR methods as follows:

1. В качестве материала для исследования используется препараты геномной ДНК биообразца индивида. Основным требованием к качеству используемой ДНК является отсутствие каких-либо признаков деградации (разрушения) ДНК. Проверка на качество ДНК обязательна с помощью любого метода ДНК электрофореза, при котором должен присутствовать только высокомолекулярный бэнд тотальной ДНК, отсутствие бэндов примесей РНК и любых «шмеров» - признаков деградации ДНК. Выполнение данного требования необходимо во избежание неточности измерений количества копий мтДНК.1. As a material for the study, preparations of the genomic DNA of a biological sample of an individual are used. The main requirement for the quality of the DNA used is the absence of any signs of DNA degradation (destruction). Checking for the quality of DNA is obligatory using any method of DNA electrophoresis, in which only a high-molecular-weight band of total DNA should be present, no bands of RNA impurities and any "shmers" - signs of DNA degradation. This requirement must be met in order to avoid inaccuracies in measuring the number of mtDNA copies.

2. Образец исследуемой ДНК разводят до рабочей концентрации, варьирующей от 5 до 100 нг/мкл, для удобства последующих манипуляций. Образец исследуемой ДНК с рабочей концентрацией обработывают ферментами рестрикции, не разрезающими непосредственно ПЦР-продукты - например, HinfI, в количестве от 0,1 е.а. на образец и условиям инкубации согласно информации производителя. В реакционную смесь могут входить безнуклеазная вода, буферы для фермента рестрикции и иные компоненты, рекомендованные производителем. Фрагментация ДНК проводится с помощью ультразвуковой фрагментации согласно настройкам производителя, при котором средний размер фрагментированной ДНК должен составлять больше 130 п.о., и при этом не более 5% дисперсии фрагментов ниже 130 п.о. ввиду высокой вероятности фрагментации участков матрицы ДНК для формирования ПЦР продуктов и последующим ухудшением качества результатов (Фиг. 1).2. A sample of the analyzed DNA is diluted to a working concentration ranging from 5 to 100 ng / μl, for the convenience of subsequent manipulations. A sample of the studied DNA with a working concentration is treated with restriction enzymes that do not cut directly PCR products - for example, HinfI, in an amount of 0.1 e.a. per sample and incubation conditions according to the manufacturer's information. The reaction mixture may include nuclease-free water, restriction enzyme buffers, and other components recommended by the manufacturer. DNA fragmentation is carried out using ultrasonic fragmentation according to the manufacturer's settings, in which the average size of the fragmented DNA should be more than 130 bp, and at the same time no more than 5% of the fragment dispersion below 130 bp. due to the high probability of fragmentation of the DNA template regions for the formation of PCR products and the subsequent deterioration in the quality of the results (Fig. 1).

3. Протокол программы ПЦР основан по принципу стандартной 2 шаговой ПЦР, включающая: этап денатурации при +94°С - +98°С, этап отжига и элонгации при +57°С (Фиг. 2). Этап денатурации составляет от 20 сек. Этап отжига и элонгации составляет от 1 мин. (Фиг. 3.). Этап «горячего старта» и «горячего завершения» согласно протоколу производителя. Хранение готовых продуктов ПЦР происходит от +4 °С до +12 °С, до суток.3. The protocol of the PCR program is based on the principle of a standard 2-step PCR, including: the stage of denaturation at + 94 ° C - + 98 ° C, the stage of annealing and elongation at + 57 ° C (Fig. 2). The denaturation stage is 20 sec. The stage of annealing and elongation is from 1 min. (Fig. 3.). Hot start and hot end stages according to the manufacturer's protocol. Storage of finished PCR products occurs from +4 ° C to +12 ° C, up to a day.

4. Протокол программы ПЦР основан по принципу стандартной 2 шаговой ПЦР, включающая: этап денатурации при +94°С - +98°С, этап отжига и элонгации при +57°С. Этап денатурации может варьировать от 20 сек до 1 мин, оптимальным является 30 сек. Этап отжига и элонгации может длиться от 20 сек до 2 мин, оптимальным является 1 мин. Этап «горячего старта» и «горячего завершения» может быть добавлен согласно протоколу производителя. Хранение готовых продуктов ПЦР может происходить от +4 °С до +12 °С, до суток.4. The protocol of the PCR program is based on the principle of standard 2-step PCR, including: a denaturation stage at + 94 ° C - + 98 ° C, an annealing and elongation stage at + 57 ° C. The denaturation stage can vary from 20 sec to 1 min, the optimal one is 30 sec. The stage of annealing and elongation can last from 20 sec to 2 min, the optimal one is 1 min. Hot start and hot end phases can be added according to the manufacturer's protocol. Storage of finished PCR products can occur from +4 ° C to +12 ° C, up to a day.

5. Общая методическая постановка dPCR (ddPCR) и получение сигналов флуоресценции производится согласно протоколу производителя технологии ddPCR (капельное, микрофлюидная) или dPCR (на микрокристалле, нанопланшете, иное) [26, 27]. Основным требованием для оценки сигналов флуоресценции нанореакций является достаточное общее количество нанореакций, которое может варьировать от 15000 и более на реакцию. Оптимальным количеством является 18000 сигналов на реакцию (фиг. 4, 5). Количество копий MT-RNR2 (мтДНК) рассчитывается как отношение к 2х копий гена НВВ (ядерной ДНК); полученный результат является количеством копий мтДНК на клетку в исследованном биологическом образце.5. General methodical setting of dPCR (ddPCR) and obtaining fluorescence signals is performed according to the manufacturer's protocol for ddPCR (drop, microfluidic) or dPCR (on a microcrystal, nanoplate, etc.) technology [26, 27]. The main requirement for assessing fluorescence signals of nanoreactions is a sufficient total number of nanoreactions, which can vary from 15000 and more per reaction. The optimal number is 18000 signals per reaction (Fig. 4, 5). The number of copies of MT-RNR2 (mtDNA) is calculated as a ratio to 2 copies of the HBB gene (nuclear DNA); the result obtained is the number of mtDNA copies per cell in the examined biological sample.

Источники информации, принятые во внимание при составлении описания:Sources of information taken into account when compiling the description:

1. Fernández-Silva P., Enriquez J.A., Montoya J. Replication and transcription of mammalian mitochondrial DNA // Experimental Physiology. Cambridge University Press, 2003. Vol. 88, № 1. P. 41–56.1. Fernández-Silva P., Enriquez J. A., Montoya J. Replication and transcription of mammalian mitochondrial DNA // Experimental Physiology. Cambridge University Press, 2003. Vol. 88, No. 1. P. 41–56.

2. Clay Montier L.L., Deng J.J., Bai Y. Number matters: control of mammalian mitochondrial DNA copy number // J. Genet. Genomics. 2009. Vol. 36, № 3. P. 125–131.2. Clay Montier L.L., Deng J.J., Bai Y. Number matters: control of mammalian mitochondrial DNA copy number // J. Genet. Genomics. 2009. Vol. 36, No. 3. P. 125-131.

3. Robin E.D., Wong R. Mitochondrial DNA molecules and virtual number of mitochondria per cell in mammalian cells // J. Cell. Physiol. 1988. Vol. 136, № 3. P. 507–513.3. Robin E. D., Wong R. Mitochondrial DNA molecules and virtual number of mitochondria per cell in mammalian cells // J. Cell. Physiol. 1988. Vol. 136, No. 3. P. 507-513.

4. Gómez-Serrano M. et al. Mitoproteomics: Tackling mitochondrial dysfunction in human disease // Oxidative Medicine and Cellular Longevity. Hindawi Limited, 2018. Vol. 2018.4. Gómez-Serrano M. et al. Mitoproteomics: Tackling mitochondrial dysfunction in human disease // Oxidative Medicine and Cellular Longevity. Hindawi Limited, 2018. Vol. 2018.

5. Ashar F.N. et al. Association of mitochondrial DNA copy number with cardiovascular disease // JAMA Cardiol. American Medical Association, 2017. Vol. 2, № 11. P. 1247–1255.5. Ashar F.N. et al. Association of mitochondrial DNA copy number with cardiovascular disease // JAMA Cardiol. American Medical Association, 2017. Vol. 2, No. 11. P. 1247-1255.

6. Chen S. et al. Association between leukocyte mitochondrial DNA content and risk of coronary heart disease: A case-control study // Atherosclerosis. Elsevier Ireland Ltd, 2014. Vol. 237, № 1. P. 220–226.6. Chen S. et al. Association between leukocyte mitochondrial DNA content and risk of coronary heart disease: A case-control study // Atherosclerosis. Elsevier Ireland Ltd, 2014. Vol. 237, No. 1. P. 220-226.

7. Pyle A. et al. Reduced mitochondrial DNA copy number is a biomarker of Parkinson’s disease // Neurobiol. Aging. Elsevier Inc., 2015. Vol. 38. P. 216.e7-216.e10.7. Pyle A. et al. Reduced mitochondrial DNA copy number is a biomarker of Parkinson's disease // Neurobiol. Aging. Elsevier Inc., 2015. Vol. 38. P. 216.e7-216.e10.

8. Wei W. et al. Mitochondrial DNA point mutations and relative copy number in 1363 disease and control human brains // Acta Neuropathol. Commun. 2017. Vol. 5, № 1. P. 13.8. Wei W. et al. Mitochondrial DNA point mutations and relative copy number in 1363 disease and control human brains // Acta Neuropathol. Commun. 2017. Vol. 5, No. 1. P. 13.

9. Reznik E. et al. Mitochondrial DNA copy number variation across human cancers // Elife. eLife Sciences Publications Ltd, 2016. Vol. 5, № FEBRUARY2016.9. Reznik E. et al. Mitochondrial DNA copy number variation across human cancers // Elife. eLife Sciences Publications Ltd, 2016. Vol. 5, No. FEBRUARY2016.

10. Hertweck K.L., Dasgupta S. The landscape of mtDNA modifications in cancer: A tale of two cities // Frontiers in Oncology. Frontiers Media S.A., 2017. Vol. 7, № NOV.10. Hertweck K.L., Dasgupta S. The landscape of mtDNA modifications in cancer: A tale of two cities // Frontiers in Oncology. Frontiers Media S.A., 2017. Vol. 7, no. NOV.

11. Thyagarajan B. et al. Mitochondrial copy number is associated with colorectal cancer risk // Cancer Epidemiol. Biomarkers Prev. 2012. Vol. 21, № 9. P. 1574–1581.11. Thyagarajan B. et al. Mitochondrial copy number is associated with colorectal cancer risk // Cancer Epidemiol. Biomarkers Prev. 2012. Vol. 21, No. 9. P. 1574-1581.

12. Knez J. et al. Correlates of Peripheral Blood Mitochondrial DNA Content in a General Population // Am. J. Epidemiol. Oxford University Press, 2016. Vol. 183, № 2. P. 138–146.12. Knez J. et al. Correlates of Peripheral Blood Mitochondrial DNA Content in a General Population // Am. J. Epidemiol. Oxford University Press, 2016. Vol. 183, No. 2. P. 138-146.

13. Tin A. et al. Association between mitochondrial DNA copy number in peripheral blood and incident CKD in the atherosclerosis risk in communities study // J. Am. Soc. Nephrol. American Society of Nephrology, 2016. Vol. 27, № 8. P. 2467–2473.13. Tin A. et al. Association between mitochondrial DNA copy number in peripheral blood and incident CKD in the atherosclerosis risk in communities study // J. Am. Soc. Nephrol. American Society of Nephrology, 2016. Vol. 27, No. 8. P. 2467–2473.

14. Ashar F.N. et al. Association of mitochondrial DNA levels with frailty and all-cause mortality // J. Mol. Med. Springer Verlag, 2015. Vol. 93, № 2. P. 177–186.14. Ashar F.N. et al. Association of mitochondrial DNA levels with frailty and all-cause mortality // J. Mol. Med. Springer Verlag, 2015. Vol. 93, No. 2. P. 177-186.

15. Malik A.N., Czajka A. Is mitochondrial DNA content a potential biomarker of mitochondrial dysfunction? // Mitochondrion. 2013. Vol. 13, № 5. P. 481–492.15. Malik A.N., Czajka A. Is mitochondrial DNA content a potential biomarker of mitochondrial dysfunction? // Mitochondrion. 2013. Vol. 13, No. 5. P. 481–492.

16. Melser S., Lavie J., Bénard G. Mitochondrial degradation and energy metabolism // Biochimica et Biophysica Acta - Molecular Cell Research. Elsevier, 2015. Vol. 1853, № 10. P. 2812–2821.16. Melser S., Lavie J., Bénard G. Mitochondrial degradation and energy metabolism // Biochimica et Biophysica Acta - Molecular Cell Research. Elsevier, 2015. Vol. 1853, No. 10. P. 2812-2821.

17. Andreu A.L. et al. Quantification of mitochondrial DNA copy number: Pre-analytical factors // Mitochondrion. 2009. Vol. 9, № 4. P. 242–246.17. Andreu A.L. et al. Quantification of mitochondrial DNA copy number: Pre-analytical factors // Mitochondrion. 2009. Vol. 9, No. 4. P. 242–246.

18. Nacheva E. et al. DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation // PLoS One. Public Library of Science, 2017. Vol. 12, № 7. P. e0180467.18. Nacheva E. et al. DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation // PLoS One. Public Library of Science, 2017. Vol. 12, No. 7. P. e0180467.

19. Sims D. et al. Sequencing depth and coverage: Key considerations in genomic analyses // Nature Reviews Genetics. 2014. Vol. 15, № 2. P. 121–132.19. Sims D. et al. Sequencing depth and coverage: Key considerations in genomic analyzes // Nature Reviews Genetics. 2014. Vol. 15, no. 2. P. 121–132.

20. van Heesch S. et al. Systematic biases in DNA copy number originate from isolation procedures // Genome Biol. BioMed Central Ltd., 2013. Vol. 14, № 4.20. van Heesch S. et al. Systematic biases in DNA copy number originate from isolation procedures // Genome Biol. BioMed Central Ltd., 2013. Vol. 14, no. 4.

21. Diskin S.J. et al. Adjustment of genomic waves in signal intensities from whole-genome SNP genotyping platforms // Nucleic Acids Res. 2008. Vol. 36, № 19. P. 1–12.21. Diskin S.J. et al. Adjustment of genomic waves in signal intensities from whole-genome SNP genotyping platforms // Nucleic Acids Res. 2008. Vol. 36, No. 19. P. 1–12.

22. Hindson B.J. et al. High-throughput droplet digital PCR system for absolute quantitation of DNA copy number // Anal. Chem. 2011. Vol. 83, № 22. P. 8604–8610.22. Hindson B.J. et al. High-throughput droplet digital PCR system for absolute quantitation of DNA copy number // Anal. Chem. 2011. Vol. 83, No. 22. P. 8604–8610.

23. Pinheiro L.B. et al. Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification // Anal. Chem. 2012. Vol. 84, № 2. P. 1003–1011.23. Pinheiro L.B. et al. Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification // Anal. Chem. 2012. Vol. 84, No. 2. P. 1003-1011.

24. Usher C.L. et al. Structural forms of the human amylase locus and their relationships to SNPs, haplotypes and obesity // Nat. Genet. Nature Publishing Group, 2015. Vol. 47, № 8. P. 921–925.24. Usher C.L. et al. Structural forms of the human amylase locus and their relationships to SNPs, haplotypes and obesity // Nat. Genet. Nature Publishing Group, 2015. Vol. 47, No. 8. P. 921-925.

25. Ye J. et al. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. // BMC Bioinformatics. 2012. Vol. 13. P. 134.25. Ye J. et al. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. // BMC Bioinformatics. 2012. Vol. 13.P. 134.

26. Dong L. et al. Comparison of four digital PCR platforms for accurate quantification of DNA copy number of a certified plasmid DNA reference material // Sci. Rep. Nature Publishing Group, 2015. Vol. 5, № 1. P. 1–11.26. Dong L. et al. Comparison of four digital PCR platforms for accurate quantification of DNA copy number of a certified plasmid DNA reference material // Sci. Rep. Nature Publishing Group, 2015. Vol. 5, No. 1. P. 1–11.

27. Farr R.J. et al. Comparative analysis of diagnostic platforms for measurement of differentially methylated insulin DNA // J. Biol. Methods. Journal of Biological Methods, 2019. Vol. 6, № 2. P. 113.27. Farr R.J. et al. Comparative analysis of diagnostic platforms for measurement of differentially methylated insulin DNA // J. Biol. Methods. Journal of Biological Methods, 2019. Vol. 6, No. 2. P. 113.

Способ измерения числа копий митохондриальной ДНК методом цифровой полимеразной цепной реакцииMethod for measuring the number of copies of mitochondrial DNA by digital polymerase chain reaction

Таблица 1. Структура набора синтетических олигонуклеотидных праймеров и пробTable 1. Structure of a set of synthetic oligonucleotide primers and probes

Фигура 1. Градиент входящего количество образца ДНК для проведения ПЦРFigure 1. Gradient of the incoming amount of DNA sample for PCR

Фигура 2. Подбор оптимальной температуры для этапа отжига и элонгации.Figure 2. Selection of the optimal temperature for the stage of annealing and elongation.

Фигура 3. Подбор оптимального времени этапа отжига и элонгации.Figure 3. Selection of the optimal time for the stage of annealing and elongation.

Фигура 4. Одномерный график интенсивностей сигналов флуоресценции цифровой ПЦР и гистограммы распределения интенсивности флюоресценции для зондов на митохондриальный (краситель-1; А, Б) и ядерный (краситель-2; В, Г) гены.Figure 4. One-dimensional graph of the intensities of digital PCR fluorescence signals and histograms of the distribution of fluorescence intensity for probes on the mitochondrial (dye-1; A, B) and nuclear (dye-2; C, D) genes.

Фигура 5. Распределения результатов анализа флюоресценции в цифровой ПЦР: синий цвет точек - FAM-положительные ПЦР-капли; зеленый - HEX-положительные, оранжевый - положительные по обоим красителям; серый - отрицательные по обоим красителям.Figure 5. Distribution of the results of analysis of fluorescence in digital PCR: blue dots - FAM-positive PCR drops; green - HEX-positive, orange - positive for both dyes; gray - negative for both dyes.

Таб.1Tab. 1

ГенGene НазначениеAppointment Структура 5’-3’Structure 5'-3 ' MT-RNR2MT-RNR2 прямой праймерdirect primer AGGTTCGTTTGTTCAACGATTAGGTTCGTTTGTTCAACGATT обратный праймерreverse primer TCGTACAGGGAGGAATTTGAATCGTACAGGGAGGAATTTGAA Зонд*Probe* Краситель1-CCGGAGTAATCCAGGTCGGTTTC-гаситель1Dye1-CCGGAGTAATCCAGGTCGGTTTC-quencher1 HBB HBB прямой праймерdirect primer CTGGGTAGCTCTAAACAATGTATTCACTGGGTAGCTCTAAACAATGTATTCA обратный праймерreverse primer CCATGTACTAACAAATGTCTAAAATGGTCCATGTACTAACAAATGTCTAAAATGGT Зонд*Probe* Краситель2-ATCTTGCCGCCTTCCCTCAA-гаситель2Dye2-ATCTTGCCGCCTTCCCTCAA-quencher2

Примечание: * «краситель1» и «краситель2» являются флуоресцентными метками применяемых для мечения олигонуклеотидов. Подбор необходимо «красителя» осуществляется согласно спецификации производителя dPCR (ddPCR). Гаситель подбирается согласно выбранному красителю.Note: * "dye1" and "dye2" are fluorescent labels used to label oligonucleotides. The selection of the necessary "dye" is carried out according to the manufacturer's specification dPCR (ddPCR). The extinguisher is selected according to the selected dye.

Claims (7)

Способ измерения числа копий митохондриальной ДНК человека методом цифровой полимеразной цепной реакции, включающий выделение геномной ДНК из биологического материала, способом, позволяющим использовать ДНК в качестве матрицы в ПЦР, отличающийся тем, что на одну реакционную смесь с применением цифровой ПЦР используют 0,2-2 нг фрагментированной тотальной ДНК с применением мультиплексного набора праймеров и зондов, специфических для митохондриальной и ядерной ДНК, структура которых имеет следующие характеристики:A method for measuring the number of copies of human mitochondrial DNA by the method of digital polymerase chain reaction, including the isolation of genomic DNA from biological material, by a method that allows using DNA as a template in PCR, characterized in that 0.2-2 is used per reaction mixture using digital PCR ng of fragmented total DNA using a multiplex set of primers and probes specific for mitochondrial and nuclear DNA, the structure of which has the following characteristics: MT-RNR2-F: 5’-AGGTTCGTTTGTTCAACGATT-3’MT-RNR2-F: 5'-AGGTTCGTTTGTTCAACGATT-3 ' MT-RNR2-R: 5’-TCGTACAGGGAGGAATTTGAA-3’MT-RNR2-R: 5'-TCGTACAGGGAGGAATTTGAA-3 ' MT-RNR2-P: 5’-краситель1-CCGGAGTAATCCAGGTCGGTTTC-гаситель1-3’MT-RNR2-P: 5'-dye1-CCGGAGTAATCCAGGTCGGTTTC-quencher1-3 ' HBB-F: 5’-CTGGGTAGCTCTAAACAATGTATTCA-3’HBB-F: 5'-CTGGGTAGCTCTAAACAATGTATTCA-3 ' HBB-R: 5’-CCATGTACTAACAAATGTCTAAAATGGT-3’HBB-R: 5'-CCATGTACTAACAAATGTCTAAAATGGT-3 ' HBB-P: 5’- краситель2-ATCTTGCCGCCTTCCCTCAA-гаситель2-3’HBB-P: 5'-dye2-ATCTTGCCGCCTTCCCTCAA-quencher2-3 '
RU2021109524A 2021-04-07 2021-04-07 Method for measuring number of copies of human mitochondrial dna by digital polymerase chain reaction RU2755663C1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
RU2021109524A RU2755663C1 (en) 2021-04-07 2021-04-07 Method for measuring number of copies of human mitochondrial dna by digital polymerase chain reaction

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
RU2021109524A RU2755663C1 (en) 2021-04-07 2021-04-07 Method for measuring number of copies of human mitochondrial dna by digital polymerase chain reaction

Publications (1)

Publication Number Publication Date
RU2755663C1 true RU2755663C1 (en) 2021-09-20

Family

ID=77745545

Family Applications (1)

Application Number Title Priority Date Filing Date
RU2021109524A RU2755663C1 (en) 2021-04-07 2021-04-07 Method for measuring number of copies of human mitochondrial dna by digital polymerase chain reaction

Country Status (1)

Country Link
RU (1) RU2755663C1 (en)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Ashar F. N. et al. Association of mitochondrial DNA copy number with cardiovascular disease, JAMA cardiology, 2017, Т. 2, No. 11, С. 1247-1255. *
Rooney J. P. et al. PCR based determination of mitochondrial DNA copy number in multiple species, Mitochondrial Regulation, Humana Press, New York, NY, 2015. С. 23-38. *
Rooney J. P. et al. PCR based determination of mitochondrial DNA copy number in multiple species, Mitochondrial Regulation, Humana Press, New York, NY, 2015. С. 23-38. Ashar F. N. et al. Association of mitochondrial DNA copy number with cardiovascular disease, JAMA cardiology, 2017, Т. 2, No. 11, С. 1247-1255. Воропаев Е. В. и др. Метод молекулярно-генетической диагностики процессов клеточной сенесценции на основе количественного анализа генов ядерной и митохондриальной ДНК, Проблемы здоровья и экологии, 2016, номер 1 (47), стр.46-50. *
Voropaev E.V. et al. Method of molecular genetic diagnosis of cell senescence processes based on quantitative analysis of genes of nuclear and mitochondrial DNA, Problems of Health and Ecology, 2016, no. 1 (47), pp. 46-50. *

Similar Documents

Publication Publication Date Title
Valihrach et al. Circulating miRNA analysis for cancer diagnostics and therapy
Dumur et al. Evaluation of quality-control criteria for microarray gene expression analysis
Tam et al. Robust global microRNA expression profiling using next-generation sequencing technologies
Park et al. Genome-wide mRNA profiling and multiplex quantitative RT-PCR for forensic body fluid identification
Mah et al. A comparison of oligonucleotide and cDNA-based microarray systems
US8110363B2 (en) Expression profiles to predict relapse of prostate cancer
Zhang et al. A modified multiplex ligation-dependent probe amplification method for the detection of 22q11. 2 copy number variations in patients with congenital heart disease
EP2982986B1 (en) Method for manufacturing gastric cancer prognosis prediction model
Reinholz et al. Expression profiling of formalin-fixed paraffin-embedded primary breast tumors using cancer-specific and whole genome gene panels on the DASL® platform
Haviv et al. DNA microarrays for assessing ovarian cancer gene expression
CN106591425A (en) Method of multiple-target detection of nucleic acid indicator based on ligation reaction
Ranade et al. Methods for microRNA microarray profiling
RU2755663C1 (en) Method for measuring number of copies of human mitochondrial dna by digital polymerase chain reaction
WO2020174211A1 (en) High-grade serous ovarian carcinoma (hgsoc)
Delmonico et al. Expression concordance of 325 novel RNA biomarkers between data generated by NanoString nCounter and Affymetrix GeneChip
Viale et al. Big results from small samples: evaluation of amplification protocols for gene expression profiling
García-Giménez et al. Epigenetic biomarkers for disease diagnosis
EP1683862B1 (en) Microarray for assessing neuroblastoma prognosis and method of assessing neuroblastoma prognosis
WO2017087735A1 (en) Method for treating crohn's disease
Alvarez et al. Correlating measurements across samples improves accuracy of large-scale expression profile experiments
Gill et al. Cytogenetics to multiomics in biology of cancer
Shou et al. Optimization and validation of small quantity RNA profiling for identifying TNF responses in cultured human vascular endothelial cells
EP4332240A1 (en) Rna-biomarkers for diagnosis of prostate cancer
Lynch et al. Comparison of commercial probe labeling kits for microarray: towards quality assurance and consistency of reactions
JP7032723B2 (en) Drug cardiotoxicity evaluation method and reagents or kits for that purpose