RU2753969C1 - Method for indirect determination of the completeness of fmd virus antigen inactivation in vaccine raw materials using reverse transcriptase polymerase chain reaction in real time with amplification of large-sized fragment - Google Patents

Method for indirect determination of the completeness of fmd virus antigen inactivation in vaccine raw materials using reverse transcriptase polymerase chain reaction in real time with amplification of large-sized fragment Download PDF

Info

Publication number
RU2753969C1
RU2753969C1 RU2021109435A RU2021109435A RU2753969C1 RU 2753969 C1 RU2753969 C1 RU 2753969C1 RU 2021109435 A RU2021109435 A RU 2021109435A RU 2021109435 A RU2021109435 A RU 2021109435A RU 2753969 C1 RU2753969 C1 RU 2753969C1
Authority
RU
Russia
Prior art keywords
rna
fmd
fmd virus
pcr
inactivated
Prior art date
Application number
RU2021109435A
Other languages
Russian (ru)
Inventor
Максим Игоревич Доронин
Дмитрий Валерьевич Михалишин
Алексей Валерьевич Борисов
Антон Александрович Козлов
Original Assignee
Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ")
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") filed Critical Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ")
Priority to RU2021109435A priority Critical patent/RU2753969C1/en
Application granted granted Critical
Publication of RU2753969C1 publication Critical patent/RU2753969C1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/125—Picornaviridae, e.g. calicivirus
    • A61K39/13—Poliovirus
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

FIELD: biotechnology.
SUBSTANCE: invention relates to the field of biotechnology, molecular diagnostics and production of FMD vaccines. Described is a method for indirectly determining the completeness of FMD virus antigen inactivation in raw materials for a vaccine using reverse transcriptase polymerase chain reaction in real time (RT-PCR-RT) with amplification of a large-sized fragment. The study of the completeness of inactivation of the FMD virus antigen in the raw material for inactivated FMD vaccines is determined by elution of viral RNA, assessment of the purity and concentration of RNA using spectral scanning and the formula СRNA = 40.5 × OD260 - 0.7037, reverse transcriptase polymerase chain reaction in real time, with the help of which an intact 7279 nt region of the FMD virus genome is detected. in the range from 5'-NTR to 3D-gene inclusive, the presence of an exponent and, thus, determine the presence of a virulent FMD virus, or reveal the absence of an amplicon of the required size, the absence of an exponent and, thereby, prove the absence of a virulent FMD virus in raw materials for the production of FMD inactivated vaccines.
EFFECT: method is economical, it allows simultaneously examining several tens of samples, and the analysis time can be reduced to 9-10 hours, is characterized by high diagnostic sensitivity - 99.44%, specificity - 100% and overall accuracy - 99.72%.
8 cl, 6 dwg, 9 tbl, 6 ex.

Description

Изобретение относится к области биотехнологии, средствам молекулярной диагностики и производству противоящурных вакцин, а именно к способу опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением обратно-транскриптазной полимеразной цепной реакции в режиме реального времени (ОТ-ПЦР-РВ) при амплификации большеразмерного фрагмента.The invention relates to the field of biotechnology, molecular diagnostics and production of FMD vaccines, namely to a method for indirectly determining the completeness of FMD virus antigen inactivation in vaccine raw materials using a reverse transcriptase polymerase chain reaction in real time (RT-PCR-RT) during amplification large-sized fragment.

Ящур является высококонтагиозным инфекционным заболеванием парнокопытных животных, возбудитель которого - вирус порядка Picornavirales семейства Picornaviridae рода Aphthovirus [1]. Характерной особенностью вируса ящура является наличие 7 типов: А, О, С, Asia-1, SAT-1, SAT-2, SAT-3. В пределах каждого типа существует множество генетических вариантов вируса [2].Foot and mouth disease is a highly contagious infectious disease of cloven-hoofed animals, the causative agent of which is a virus of the order Picornavirales of the Picornaviridae family of the genus Aphthovirus [1]. A characteristic feature of the foot and mouth disease virus is the presence of 7 types: A, O, C, Asia-1, SAT-1, SAT-2, SAT-3. Within each type, there are many genetic variants of the virus [2].

Геном вируса ящура представлен одноцепочечной позитивной молекулой РНК (ssRNA(+)) длиной около 8400 нуклеотидов. РНК одновременно является матрицей для репликации генома и трансляции вирусных белков. РНК вируса ящура включает три отдельные части, а именно относительно длинную 5'-нетранслируемую область (5-UTR), длинную кодирующую область с одной открытой рамкой считывания и 3'-нетранслируемую область (3'-UTR) (Фиг. 1).The FMD virus genome is represented by a single-stranded positive RNA molecule (ssRNA (+)) about 8400 nucleotides long. RNA is simultaneously a template for genome replication and translation of viral proteins. FMD virus RNA comprises three distinct parts, namely a relatively long 5'-untranslated region (5-UTR), a long coding region with one open reading frame and a 3'-untranslated region (3'-UTR) (Fig. 1).

РНК окружена белковой оболочкой (капсидом), состоящей из 60 капсомеров. Каждый капсомер представлен четырьмя структурными полипептидами VP1, VP2, VP3 и VP4. Белки VP1, VP2 и VP3 находятся на поверхности вируса и вносят вклад в антигенные свойства вируса, a VP4 располагается внутри вириона.RNA is surrounded by a protein envelope (capsid), consisting of 60 capsomeres. Each capsomer is represented by four structural polypeptides VP 1 , VP 2 , VP 3 and VP 4 . Proteins VP 1 , VP 2 and VP 3 are located on the surface of the virus and contribute to the antigenic properties of the virus, and VP 4 is located within the virion.

5'-UTR имеет длину около 1300 нуклеотидов [3]. Небольшой белок (длиной 23-24 н.о.), называемый VPg, который кодируется частью 3В области вирусного генома, ковалентно связан с 5'-концом генома. Пептид VPg производится в 3 различных формах (кодируемых генами 3В1-3), которые играют роль праймеров для синтеза РНК. 5'-UTR-область включает несколько различных структурных элементов: S-фрагмент, поли(С) тракт (Cn), 3 или 4 псевдоузла (PK), элемент cre/bus, внутренний сайт для рибосомы (IRES).The 5'-UTR is about 1300 nucleotides in length [3]. A small protein (23-24 nt long) called VPg, which is encoded by part of the 3B region of the viral genome, is covalently linked to the 5 'end of the genome. The VPg peptide is produced in 3 different forms (encoded by genes 3B 1-3 ), which act as primers for RNA synthesis. The 5'UTR region includes several different structural elements: S fragment, poly (C) tract (Cn), 3 or 4 pseudo nodes (PK), cre / bus element, internal ribosome site (IRES).

S-фрагмент находится на 5'-конце, имеет длину 360-370 нуклеотидов и сворачивается с образованием большой шпилечной структуры. Тракт poly С имеет переменную длину (150-250 нуклеотидов), но состоит из более чем 90% остатков С. Окончательно роль тракта poly С не известна. За трактом poly С расположена нетранслируемая область длиной около 720 н.о., в которую входят 3-4 структуры псевдокнот. Их функция неизвестна. Cre/bus - участок представляет собой стабильный элемент типа «стебель-петля» из примерно 55 нуклеотидов и содержит консервативный мотив (АААСА), который действует как матрица для уридилилирования белка VPg вирусной РНК-полимеразой. Таким образом, cre/bus участвует в инициации репликации РНК. Внутренний сайт связывания с рибосомой IRES имеет длину около 450 нуклеотидов и отвечает за инициирование синтеза вирусного белка. Данный участок характеризуется сложной пространственной структурой. Трансляцию инициируют два AUG, расположенные друг от друга на расстоянии 84 н.о.The S-fragment is located at the 5'-end, is 360-370 nucleotides in length and folds to form a large hairpin structure. The poly C tract is variable in length (150-250 nucleotides), but consists of more than 90% C residues. The final role of the poly C tract is not known. Behind the poly C tract, there is an untranslated region with a length of about 720 nt, which includes 3-4 pseudo-note structures. Their function is unknown. The Cre / bus region is a stable stem-loop element of about 55 nucleotides and contains a conserved motif (AAACA) that acts as a template for the uridylation of the VPg protein by viral RNA polymerase. Thus, cre / bus is involved in the initiation of RNA replication. The internal ribosome binding site of IRES is about 450 nucleotides in length and is responsible for initiating viral protein synthesis. This site is characterized by a complex spatial structure. The broadcast is initiated by two AUGs located 84 nt apart.

Транслируемая область следует за 5'-UTR. РНК транслируется в виде единой длинной открытой рамки считывания (ORF) в полипротеин, после чего следует серия посттрансляционных протеолитических расщеплений с образованием как промежуточных, так и зрелых структурных и неструктурных белков [4, 5]. Это основная часть вирусного генома, длина которой составляет около 7000 нуклеотидов и включает 14 генов. Она кодирует большой полипротеин (около 2330 а.о.), который быстро расщепляется вирусными протеазами с образованием четырех различных структурных и одиннадцати неструктурных белков, которые выполняют разные функции. После трансляции первоначально образуются четыре первичных продукта, а именно Lpro (лидерная протеаза), Р1-2А, Р2 и Р3. Lpro представляет собой N-концевой компонент полипротеина. Лидерная протеаза отщепляется от полипротеина автолитически. L-кодирующая область содержит два отдельных инициирующих кодона AUG (обычно 84 нуклеотида друг от друга), которые приводят к образованию двух разных L-протеаз, названных Lab и Lb и отличающихся друг от друга по длине на 28 а.о. Lpro отвечает за ингибирование синтеза белка в клетке-хозяине, индуцируя расщепление белка-хозяина eIF4G, который является фактором инициации трансляции. В результате РНК вируса ящура может свободно использовать аппарат синтеза белка клетки-хозяина для собственного синтеза белка, поскольку IRES ящура может функционировать с остаточным С-концевым фрагментом eIF4G белка. Полипептид Р1-2А расщепляется протеазой 3С (3Cpro) с образованием 1АВ (VP0), 1С (VP3) и ID (VP1), 2А белков. 2А - очень короткий пептид, размер около 20 нуклеотидных остатков. Во время инкапсидации генома VP0 расщепляется с образованием белков VP4 и VP2 автолитически. Протеин VP4 полностью находится внутри вирусной частицы, тогда как VP1, VP2 и VP3 располагаются на поверхности и вносят свой вклад в антигенные свойства вируса [2, 3]. VP1 содержит, по крайней мере, два важных иммуногенных сайта, петлю G-H (в положениях аминокислот 141-160) и С-конец (остатки 200-213). Петля G-H включает мотив аргинин-глицин-аспарагиновая кислота (RGD), который необходим для прикрепления вируса к клетке-хозяину через рецептор интегрина [4, 5]. Интегрины представляют собой группу α-β-гетеродимерных гликопротеинов, которые расположены на поверхности клетки; около 15 а и 8 Р субъединиц объединяются с образованием 20 различных α-β гетеродимеров. Гетеродимер αvβ6 является рецептором белков внеклеточного матрикса, экспрессия которых ограничена эпителиальными клетками, и он также связывается с вирусом ящура посредством взаимодействия с мотивом RGD [6].The broadcast area follows the 5'-UTR. RNA is translated as a single long open reading frame (ORF) into a polyprotein, followed by a series of post-translational proteolytic cleavages with the formation of both intermediate and mature structural and non-structural proteins [4, 5]. This is the main part of the viral genome, which is about 7000 nucleotides long and includes 14 genes. It encodes a large polyprotein (about 2330 amino acid residues), which is rapidly cleaved by viral proteases to form four different structural and eleven non-structural proteins that perform different functions. After translation, four primary products are initially formed, namely Lpro (leader protease), P1-2A, P2 and P3. Lpro is the N-terminal component of a polyprotein. The leader protease is cleaved autolytically from the polyprotein. The L-coding region contains two separate AUG initiation codons (usually 84 nucleotides apart), which lead to the formation of two different L-proteases, named Lab and Lb, differing from each other in length by 28 aa. Lpro is responsible for inhibiting protein synthesis in the host cell by inducing cleavage of the host protein eIF4G, which is a translation initiation factor. As a result, FMDV RNA can freely use the host cell protein synthesis apparatus for its own protein synthesis, since FMDV IRES can function with the residual C-terminal fragment of the eIF4G protein. Polypeptide P1-2A is cleaved by protease 3C (3Cpro) to form proteins 1AB (VP 0 ), 1C (VP 3 ) and ID (VP 1 ), 2A proteins. 2A is a very short peptide, about 20 nucleotide residues in size. During genome encapsidation, VP 0 is cleaved autolytically to form the VP4 and VP 2 proteins. Protein VP 4 is completely inside the viral particle, while VP 1 , VP 2 and VP3 are located on the surface and contribute to the antigenic properties of the virus [2, 3]. VP1 contains at least two important immunogenic sites, the GH loop (amino acid positions 141-160) and the C-terminus (residues 200-213). The GH loop includes the arginine-glycine-aspartic acid (RGD) motif, which is required for the attachment of the virus to the host cell through the integrin receptor [4, 5]. Integrins are a group of α-β-heterodimeric glycoproteins that are located on the cell surface; about 15 a and 8 P subunits combine to form 20 different α-β heterodimers. Heterodimer αvβ6 is a receptor for extracellular matrix proteins, the expression of which is limited to epithelial cells, and it also binds to the FMD virus through interaction with the RGD motif [6].

Белок VP1 является наиболее вариабельным, поскольку на него приходится около 90% мутаций всех структурных генов. Самыми вариабельными областями являются участки 40-60, 130-160 и 190-213 а.о. [7]. Участок поверхностного белка VP1 в регионе 130-160 а.о. отличается высокой вариабельностью, поскольку участвует в процессе связывания с рецепторами клетки-хозяина [8]. Изменчивость данного региона дает возможность вирусу ящура взаимодействовать с рецепторами клеток разных типов и облегчает переход от одного вида хозяина к другому. Нуклеотидные последовательности кодирующей области VP1 используются для генетической характеристики штаммов ящура из-за их значимости для прикрепления и проникновения вируса в клетку, защитного иммунитета и специфичности серотипа. Филогенетический анализ на основе последовательности VP1 широко используется для вывода эволюционной динамики, эпидемиологических отношений между генетическими линиями и для отслеживания происхождения и перемещения штаммов вируса ящура [9].The VP 1 protein is the most variable, since it accounts for about 90% of all structural gene mutations. The most variable regions are regions 40-60, 130-160, and 190-213 amino acid residues. [7]. Site of surface protein VP 1 in the region 130-160 a.a. differs in high variability, since it is involved in the process of binding to receptors of the host cell [8]. The variability of this region allows the FMD virus to interact with receptors of different types of cells and facilitates the transition from one host species to another. The nucleotide sequences of the VP 1 coding region are used for the genetic characterization of FMD strains because of their importance for the attachment and penetration of the virus into the cell, protective immunity and serotype specificity. Phylogenetic analysis based on the VP 1 sequence is widely used to deduce evolutionary dynamics, epidemiological relationships between genetic lines, and to track the origin and movement of FMD virus strains [9].

Белок 2А является вирусной протеазой и по функциям напоминает лидерную протеазу. По всей видимости, данный белок отвечает за расщепление сайта 2А/2В, которое является вторым событием процессинга у вируса ящура [10].Protein 2A is a viral protease and functionally resembles a leader protease. Apparently, this protein is responsible for cleavage of the 2A / 2B site, which is the second processing event in the FMD virus [10].

Области Р2 и Р3 полипротеина процессируются в неструктурные белки (NSP) вируса ящура. Область протеина Р2 расщепляется на белки 2В и 2С. Функция белка 2В не известна. Белок 2С определяет устойчивость вирусной частицы к гуанидину [11]. Протеин Р3 расщепляется с образованием 6 белков: 3А, трех отдельных копий VPg (3B1, 3В2, 3В3), 3Cpro и 3Dpol. Функция белка 3А не известна. Ген 3В кодирует три различные формы белка VPg. Протеаза 3Cpro отвечает за расщепление Р1-2А на белки VP0, VP1, VP3, а также за образование различных неструктурных белков. Белок также осуществляет расщепление клеточного гистона Н3 и, тем самым, ингибирует синтез белков клетки на этапе транскрипции матричной РНК (мРНК) [12]. 3Dpol кодируется высококонсервативным 3D-геном и является РНК-зависимой РНК-полимеразой для репликации вирусной РНК.The P2 and P3 regions of the polyprotein are processed into non-structural proteins (NSPs) of the FMD virus. The P2 protein region is cleaved into proteins 2B and 2C. The function of protein 2B is not known. Protein 2C determines the resistance of the viral particle to guanidine [11]. Protein P3 is cleaved to form 6 proteins: 3A, three separate copies of VPg (3B 1 , 3B 2 , 3B 3 ), 3Cpro and 3Dpol. The function of the 3A protein is not known. Gene 3B encodes three different forms of the VPg protein. Protease 3Cpro is responsible for the cleavage of Р1-2А into proteins VP0, VP1, VP3, as well as for the formation of various non-structural proteins. The protein also cleaves cellular histone H3 and thereby inhibits the synthesis of cell proteins at the stage of messenger RNA (mRNA) transcription [12]. 3Dpol is encoded by a highly conserved 3D gene and is an RNA-dependent RNA polymerase for viral RNA replication.

В трансляции РНК вируса ящура определенная роль отводится клеточным белкам. Luz и Beck в пределах участка IRES вируса ящура определил 2 области, которые взаимодействуют с белком клетки р57, необходимым для сплайсинга ядерных мРНК [13]. В инфицированной клетке-хозяине под действием лидерной протеазы происходит разрушение компонента кеп р220-связывающих комплексов. В результате прекращается синтез клеточных белков и включается трансляция вирусных составляющих [14].In the translation of the FMD virus RNA, a certain role is assigned to cellular proteins. Luz and Beck identified 2 regions within the FMDV IRES region that interact with the p57 cell protein required for nuclear mRNA splicing [13]. In the infected host cell, under the action of the leader protease, the component of the p220-binding complexes is destroyed. As a result, the synthesis of cellular proteins stops and the translation of viral components is turned on [14].

3'-UTR-область намного короче 5' UTR-области, ее длина составляет около 90-100 нуклеотидов. Данный участок сворачивается, образуя специфическую структуру «стебель-петля», за которой следует поли(А)-фрагмент переменной длины [13, 14, 15, 17]. 3'-UTR-область играет важную роль в репликации вирусного генома. На конце 3'-UTR-области расположен poly (А)-участок, длина которого варьирует от 50 до 100 н.о. (Фиг. 1).The 3'UTR region is much shorter than the 5 'UTR region, its length is about 90-100 nucleotides. This region folds, forming a specific stem-loop structure, followed by a poly (A) -fragment of variable length [13, 14, 15, 17]. The 3'-UTR region plays an important role in the replication of the viral genome. At the end of the 3'-UTR region, there is a poly (A) -section, the length of which varies from 50 to 100 bp. (Fig. 1).

Ящур как заболевание причиняет серьезный экономический ущерб в связи с затратами на ликвидацию болезни и введением строгих ограничений, налагаемых на внутреннюю и международную торговлю продукцией животноводства. Система мер для борьбы с данным заболеванием и его профилактики предусматривает стемпинг-аут, массовую иммунизацию восприимчивых животных, а также контроль уровня напряженности поствакцинального иммунитета [1, 2, 16].As a disease, foot and mouth disease causes serious economic damage due to the cost of eradicating the disease and the imposition of strict restrictions on domestic and international trade in livestock products. The system of measures to combat this disease and its prevention provides for stamping out, mass immunization of susceptible animals, as well as control of the level of tension of post-vaccination immunity [1, 2, 16].

В процессе производства противоящурных инактивированных сорбированных и эмульсионных вакцин после инактивации антигена вируса ящура требуется проводить оценку отсутствия вирулентного возбудителя данного заболевания для подтверждения безопасности вакцинного препарата.In the production of FMD inactivated sorbed and emulsion vaccines after inactivation of the FMD virus antigen, it is required to assess the absence of a virulent causative agent of this disease to confirm the safety of the vaccine preparation.

Инактивация вируса ящура может достигаться за счет влияния различных физических и химических факторов. Так, при увеличении температуры прогревания до 45°С уменьшается относительное процентное содержание 146S компонента при сохранении титра инфекционной активности вируса ящура на уровне контрольного образца, хранящегося при температуре 4°С, что свидетельствует о разрушении неинфекционных 146S частиц. Температура 55-60°С вызывает спонтанный распад полных вирионов и резкое снижение титра инфекционной активности вируса ящура. Воздействие ультрафиолетовых лучей инактивирует вирус через 5-10 минут.Солнечный свет при температуре 5-6°С обезвреживает вирус через 5-7 дней, при 16-18°С - через 3-4 дня, при 37°С - через 40 часов [1,18].FMD virus inactivation can be achieved through the influence of various physical and chemical factors. So, with an increase in the heating temperature to 45 ° C, the relative percentage of the 146S component decreases while maintaining the titer of the infectious activity of the foot and mouth disease virus at the level of the control sample stored at 4 ° C, which indicates the destruction of non-infectious 146S particles. Temperature 55-60 ° C causes spontaneous disintegration of complete virions and a sharp decrease in the titer of the infectious activity of the FMD virus. Exposure to ultraviolet rays inactivates the virus after 5-10 minutes. Sunlight at a temperature of 5-6 ° C neutralizes the virus after 5-7 days, at 16-18 ° C - after 3-4 days, at 37 ° C - after 40 hours [ 1.18].

Вирус инактивируют различными химическими агентами: 0,5-1,0% раствор фенола при температуре плюс 4°С через 8 недель, при температуре плюс 18-20°С - через 10-14 дней, при температуре плюс 37°С - через 3 суток; 2% раствор формалина при температуре плюс 4°С - через 2 часа; 45-70% раствор этилового спирта при температуре плюс 4°С - через 1-2 ч [1].The virus is inactivated by various chemical agents: 0.5-1.0% phenol solution at a temperature of plus 4 ° C after 8 weeks, at a temperature of plus 18-20 ° C - after 10-14 days, at a temperature of plus 37 ° C - after 3 days; 2% formalin solution at a temperature of plus 4 ° C - after 2 hours; 45-70% solution of ethyl alcohol at a temperature of plus 4 ° C - after 1-2 hours [1].

В настоящее время в соответствии с требованиями МЭБ (OIE) [2] при изготовлении противоящурных вакцин при достижении достаточной концентрации 146S компонента и титра инфекционной активности вируса ящура, вируссодержащую суспензию осветляют посредством ультрафильтрации. Вирус ящура впоследствии инактивируют, добавляя инактивант первого порядка этиленимин (EI) в форме бинарного этиленимина (BEI), а именно 1,2-аминоэтилэтиленимин [19, 20]. После завершения инактивации любые остатки EI/BEI в инактивированной вирусной суспензии подвергают нейтрализации, например, посредством добавления раствора тиосульфата натрия до получения конечной концентрации 2%.Currently, in accordance with the requirements of the OIE (OIE) [2] in the manufacture of FMD vaccines, upon reaching a sufficient concentration of the 146S component and the titer of the infectious activity of the FMD virus, the vaccinated suspension is clarified by ultrafiltration. FMD virus is subsequently inactivated by the addition of the first order inactivant ethyleneimine (EI) in the form of binary ethyleneimine (BEI), namely 1,2-aminoethylethyleneimine [19, 20]. After completion of the inactivation, any EI / BEI residues in the inactivated viral suspension are neutralized, for example, by adding sodium thiosulfate solution to a final concentration of 2%.

Инактивант 1,2-аминоэтилэтиленимин (АЭЭИ) - азотсодержащее гетероциклическое соединение, которое относится к циклическим аминам. АЭЭИ вступает в реакцию замещения водорода в N-H-связи вирусной молекулой РНК [20]. Данный процесс приводит к деградации генома вируса ящура, в результате этого утрачивается вирулентность возбудителя, но при этом сохраняется структура сформированных 146S иммуногенных частиц и их антигенные свойства.Inactivant 1,2-aminoethylethyleneimine (AEEI) is a nitrogen-containing heterocyclic compound that belongs to cyclic amines. AEE enters into the reaction of hydrogen replacement in the N-H-bond with a viral RNA molecule [20]. This process leads to the degradation of the FMD virus genome, as a result of which the virulence of the pathogen is lost, but at the same time the structure of the formed 146S immunogenic particles and their antigenic properties are preserved.

За счет воздействия 1,2-аминоэтилэтиленимина вирус ящура теряет свою инфекционную активность за счет многочисленных делеций и разрывов вирусной РНК, разрушения вирусного генома до низкомолекулярных фрагментов [19, 20, 21], что блокирует процессы обратной транскрипции, трансляции и процессинга белковых составляющих вируса ящура, тем самым, репродукция вирусной частицы в клеточных системах in vivo и in vitro становится невозможной. Повреждения в 1А, 1В, 1С, ID-генах приводят к прекращению процесса синтеза белков VP4, VP2, VP1, VP3 вируса ящура, соответственно. Разрушения РНК в 3D-гене делает невозможным синтез РНК-зависимой-ДНК-полимеразы, следовательно, и формирование перечисленных выше структурных белков возбудителя ящура. Иными словами, при любом повреждений РНК антиген вируса ящура становится авирулентным. Данный факт можно обнаружить с помощью проведения молекулярно-биологического исследования с оригинальной системой олигонуклеотидных праймеров, зонда и подобранными условиями проведения анализа.Due to the action of 1,2-aminoethylethyleneimine, the FMD virus loses its infectious activity due to numerous deletions and breaks of viral RNA, destruction of the viral genome to low molecular weight fragments [19, 20, 21], which blocks the processes of reverse transcription, translation and processing of protein components of the FMD virus thus, the reproduction of a viral particle in cell systems in vivo and in vitro becomes impossible. Damage in genes 1A, 1B, 1C, ID leads to the termination of the synthesis of proteins VP 4 , VP 2 , VP 1 , VP 3 of the FMD virus, respectively. Destruction of RNA in the 3D gene makes it impossible to synthesize RNA-dependent DNA polymerase, and hence the formation of the above structural proteins of the foot-and-mouth disease pathogen. In other words, with any damage to the RNA, the FMD virus antigen becomes avirulent. This fact can be detected by carrying out a molecular biological study with an original system of oligonucleotide primers, a probe and selected analysis conditions.

В соответствии с требованиями МЭБ (OIE) [2] полноту инактивации верифицируют с использованием теста на остаточное содержание вирулентного вируса ящура. С этой целью суспензией антигена инактивированного вируса ящура инокулируют чувствительную клеточную линию, в частности первичную монослойную культуру клеток почки свиньи СП, с последующим микроскопированием раз в сутки в течение 72 ч. Суспензия инактивированного антигена считается соответствующего качества, если вирулентный вирус в ней не обнаружен. Данный анализ проводят на протяжении 3 последовательных пассажей в чувствительной клеточной линии СП по 72 ч [22].In accordance with the requirements of the OIE (OIE) [2], the completeness of inactivation is verified using a residual FMD virus test. For this purpose, a susceptible cell line is inoculated with a suspension of an inactivated FMD virus antigen, in particular a primary monolayer culture of pig kidney cells of a pig SP, followed by microscopy once a day for 72 hours. A suspension of an inactivated antigen is considered to be of appropriate quality if a virulent virus is not detected in it. This analysis is carried out for 3 consecutive passages in a sensitive cell line SP for 72 h [22].

Существенными недостатками данного метода являются: 1) длительная процедура анализа, связанная с развитием цитопатического действия, 2) определенная степень субъективности при оценке результатов анализа, 3) высокая стоимость первичной монослойной клеточной линии как тест-системы и затраты на ее поддержание. В связи с этим целесообразно провести поиск способа определения полноты инактивации антигена вируса ящура с применением более быстрого и менее затратного метода исследования, который отличается при этом высокой диагностической чувствительностью, специфичностью и общей точностью.Significant disadvantages of this method are: 1) a long analysis procedure associated with the development of cytopathic action, 2) a certain degree of subjectivity in assessing the results of the analysis, 3) the high cost of the primary monolayer cell line as a test system and the cost of maintaining it. In this regard, it is advisable to search for a way to determine the completeness of inactivation of the FMD virus antigen using a faster and less expensive research method, which is characterized by high diagnostic sensitivity, specificity and overall accuracy.

Проблемой является отсутствие чувствительного и специфичного способа опосредованного определения полноты инактивации антигена вируса ящура с целью устранения вышеуказанных недостатков.The problem is the lack of a sensitive and specific method for indirectly determining the completeness of inactivation of the FMD virus antigen in order to eliminate the above disadvantages.

Данная проблема была решена благодаря разработке нового способа опосредованного определения полноты инактивации антигена вируса ящура с применением обратно-транскриптазной полимеразной цепной реакции в режиме реального времени при амплификации болыиеразмерного фрагмента, с его помощью возможно выявлять неповрежденный участок генома вируса ящура размером 7279 п.н. в диапазоне от 5'-NTR до 3D-гена включительно и тем самым определять наличие вирулентного вируса ящура, либо обнаруживать отсутствие ампликонов и, тем самым, доказывать отсутствие вирулентного вируса ящура в сырье для изготовления противоящурных инактивированных вакцин. Данная возможность позволит предварительно определять полноту инактивации антигена вируса ящура, который используется для изготовления противоящурных инактивированных сорбированных и эмульсионных вакцин.This problem was solved due to the development of a new method for indirect determination of the completeness of inactivation of the FMD virus antigen using a reverse transcriptase polymerase chain reaction in real time during amplification of a large fragment, with its help it is possible to identify an intact 7279 bp region of the FMD virus genome. in the range from 5'-NTR to 3D-gene inclusive and thereby determine the presence of a virulent FMD virus, or detect the absence of amplicons and, thereby, prove the absence of a virulent FMD virus in raw materials for the manufacture of inactivated FMD vaccines. This possibility will allow preliminary determination of the completeness of inactivation of the FMD virus antigen, which is used for the manufacture of inactivated anti-FMD sorbed and emulsion vaccines.

Сущность изобретения заключается в новом подходе по опосредованному определению полноты инактивации антигена вируса ящура с применением обратно-транскриптазной полимеразной цепной реакции в режиме реального времени при амплификации болыиеразмерного фрагмента. Заявляемый способ основан на проведении экстрагирования молекул РНК возбудителя ящура до и после процесса инактивации с помощью 5 М гуанидинизотиоцианата (ГТЦ), 0,5% раствора меркаптоэтанола и 80% раствора изопропанола, оценке степени чистоты полученного элюата РНК и ее концентрации методом спектрального сканирования, синтезе комплементарной ДНК (кДНК) и ПЦР в режиме реального времени, предполагающей использование одной системы оригинальных олигонуклеотидных праймеров и зонда, рассчитанных на участки от 5'-NTR до 3D-гена включительно, размером ампликонов 7279 п.н. с применением высокоточных ферментов (ревертазы Maxima Н Minus Reverse Transcriptase и Taq-ДНК-полимеразы Platinum Polymerase High Fidelity). По итогам анализа оценивают наличие или отсутствие продуктов ПЦР-РВ в виде сформированных сигмоидных графиков (экспонент). На основании полученных экспоненциальных функций и значений пороговых циклов амплификации (Ct) делают заключение о целостности анализируемого участка генома вируса ящура, кодирующего структурные и неструктурные протеины возбудителя ящура и, как следствие, о полноте инактивации его антигена.The essence of the invention lies in a new approach for the indirect determination of the completeness of inactivation of the FMD virus antigen using a reverse transcriptase polymerase chain reaction in real time with the amplification of a large fragment. The inventive method is based on the extraction of RNA molecules of the foot and mouth disease causative agent before and after the inactivation process using 5 M guanidine isothiocyanate (GTZ), 0.5% mercaptoethanol solution and 80% isopropanol solution, assessing the purity of the resulting RNA eluate and its concentration by spectral scanning, synthesis complementary DNA (cDNA) and real-time PCR, assuming the use of one system of original oligonucleotide primers and a probe designed for regions from 5'-NTR to 3D-gene inclusive, amplicon size 7279 bp. using high-precision enzymes (Maxima H Minus Reverse Transcriptase and Taq-DNA polymerase Platinum Polymerase High Fidelity). Based on the analysis results, the presence or absence of RT-PCR products is assessed in the form of formed sigmoid graphs (exponentials). Based on the obtained exponential functions and the values of the threshold amplification cycles (C t ), a conclusion is made about the integrity of the analyzed region of the FMD virus genome encoding the structural and non-structural proteins of the FMD pathogen and, as a consequence, the completeness of inactivation of its antigen.

В настоящее время метод ОТ-ПЦР-РВ применяют для проведения молекулярно-биологической диагностики ящура (Reid et al., 2003; Vangrysperre & De Clerq, 1996; Callahan et al., 2002 и др.) [23-27].Currently, RT-PCR-RT is used for molecular biological diagnostics of foot and mouth disease (Reid et al., 2003; Vangrysperre & De Clerq, 1996; Callahan et al., 2002, etc.) [23-27].

Для оценки полноты инактивации антигена вируса ящура для вакцин используют в качестве биологической тест-системы первичную монослойную клеточную линию почки свиньи СП (прототип). По сравнению с прототипом метод ОТ-ПЦР-РВ с амплификацией большеразмерного участка генома вируса ящура отличается высокой чувствительностью и специфичностью, является более экономичным, позволяет одновременно исследовать несколько десятков проб инактивированного вируссодержащего материала для вакцин, а время проведения анализа сократить до 9-10 часов. Исходя из этого, актуально применять метод ОТ-ПЦР-РВ с амплификацией большеразмерного участка генома вируса ящура для опосредованного определения полноты инактивации антигена возбудителя ящура при изготовлении противоящурных инактивированных сорбированных и эмульсионных вакцин.To assess the completeness of inactivation of the FMD virus antigen for vaccines, a primary monolayer pig kidney cell line SP (prototype) is used as a biological test system. Compared to the prototype, the RT-PCR-RT method with amplification of a large-sized region of the FMD virus genome is characterized by high sensitivity and specificity, is more economical, allows to simultaneously examine several tens of samples of inactivated vaccinated material for vaccines, and reduce the analysis time to 9-10 hours. Based on this, it is relevant to use the RT-PCR-RT method with amplification of a large-sized region of the FMD virus genome to indirectly determine the completeness of inactivation of the FMD causative agent antigen in the manufacture of inactivated FMD and emulsion vaccines.

Ключевым элементом заявляемого способа является опосредованное определение полноты инактивации антигена вируса ящура благодаря проведению обратно-транскриптазной и полимеразной цепной реакции в режиме реального времени с использованием одной оригинальной системы олигонуклеотидных праймеров и зонда, позволяющих амплифицировать болыперазмерный участок генома вируса ящура длиной 7279 п.н., который включает в себя гены, кодирующие все структурные и неструктурные протеины вируса ящура (составляет около 7279 п.н./8400 п.н.=86,65% от полной длины РНК вируса ящура, что является высоким значением) (участок от 5'-NTR-участка до 3D-гена включительно). Оценка значения порогового цикла амплификации позволит сделать вывод о появлении повреждений амплифицируемого большеразмерного участка генома вируса ящура и, как следствие, о полноте инактивации антигена возбудителя ящура.The key element of the proposed method is the indirect determination of the completeness of inactivation of the FMD virus antigen due to the reverse transcriptase and polymerase chain reaction in real time using one original system of oligonucleotide primers and a probe, allowing to amplify a large-sized region of the FMD virus genome, which is 7279 bp in length. includes genes encoding all structural and non-structural proteins of the FMD virus (is about 7279 bp / 8400 bp = 86.65% of the total length of the FMD virus RNA, which is a high value) (region from 5'- NTR region up to and including the 3D gene). Assessment of the amplification threshold cycle value will make it possible to draw a conclusion about the appearance of damage to the amplified large-sized region of the FMD virus genome and, as a consequence, the completeness of inactivation of the antigen of the FMD pathogen.

Сопоставительный анализ с прототипом позволяет сделать вывод, что новизна и изобретательский уровень заявляемого изобретения заключаются в применении способа элюирования молекул РНК вируса ящура, оценке степени чистоты полученного экстракта и концентрации РНК методом спектрального сканирования, проведении ОТ-ПЦР-РВ с использованием оригинальной системы олигонуклеотидных праймеров и зонда для синтеза большеразмерного ампликона генома вируса ящура и опосредованного определения полноты инактивации антигена возбудителя, применяемого для изготовления вакцин.Comparative analysis with the prototype allows us to conclude that the novelty and inventive level of the claimed invention lies in the application of the method for elution of RNA molecules of the foot and mouth disease virus, assessment of the purity of the obtained extract and RNA concentration by spectral scanning, RT-PCR-RT using the original system of oligonucleotide primers and a probe for the synthesis of a large-sized amplicon of the FMD virus genome and indirect determination of the completeness of inactivation of the antigen of the pathogen used for the manufacture of vaccines.

Сведений об аналогах предлагаемого способа опосредованного определения полноты инактивации антигена вируса ящура в сырье для противоящурных вакцин авторами не обнаружено. Возможность применения метода ОТ-ПЦР-РВ в иной модификации и с другими системами олигонуклеотидных праймеров и зондом в литературе не представлена. Найдены сведения о применении метода обратно-транскриптазной и полимеразной цепной реакции для определения полноты инактивации вируса классической чумы свиней (КЧС) [28].The authors did not find any information on analogs of the proposed method for indirectly determining the completeness of inactivation of the FMD virus antigen in raw materials for FMD vaccines. The possibility of using the RT-PCR-RT method in a different modification and with other systems of oligonucleotide primers and a probe is not presented in the literature. Information has been found on the use of the reverse transcriptase and polymerase chain reaction method to determine the completeness of inactivation of the classical swine fever virus (CSF) [28].

Сущность изобретения отражена на графических изображениях:The essence of the invention is reflected in the graphic images:

Фиг. 1 - Структура генома вируса ящура с указанием структурных и неструктурных протеинов.FIG. 1 - The structure of the FMD virus genome, indicating the structural and non-structural proteins.

Фиг. 2 - Дизайн оптимальных олигонуклеотидных прямого праймера (А), обратного праймера и зонда (Б) для опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением обратно-транскриптазной полимеразной цепной реакции в режиме реального времени при амплификации большеразмерного фрагмента.FIG. 2 - Design of optimal oligonucleotide forward primer (A), reverse primer and probe (B) for indirect determination of the completeness of FMD virus antigen inactivation in vaccine raw materials using reverse transcriptase polymerase chain reaction in real time with amplification of a large-sized fragment.

Фиг. 3 - Калибровочная кривая для определения концентрации РНК в очищенных элюатах, полученная с применением 9 стандартов в трех повторностях каждый.FIG. 3 - Calibration curve for determining the concentration of RNA in purified eluates, obtained using 9 standards in triplicate each.

Фиг. 4 - Дизайн оригинальных шести олигонуклеотидных праймеров и трех зондов (изначально предложенных для анализа) (А - прямые праймеры, Б - обратные праймеры и зонды) для опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением обратно-транскриптазной полимеразной цепной реакции в режиме реального времени при амплификации большеразмерного фрагмента.FIG. 4 - Design of original six oligonucleotide primers and three probes (originally proposed for analysis) (A - forward primers, B - reverse primers and probes) to indirectly determine the completeness of FMD virus antigen inactivation in vaccine raw materials using reverse transcriptase polymerase chain reaction in real-time mode when amplifying a large-sized fragment.

Фиг. 5 - Экспоненты реакции амплификации в режиме реального времени при тестировании пробы и контролей (ПКОвыд-е РНК - положительный контрольный образец на этапе выделения РНК (исходный не инактивированный вирус ящура) - рыжий цвет графика; ПКОПЦР - положительный контрольный образец на этапе ПЦР-РВ (проверенная кДНК не инактивированного вируса ящура) - зеленый цвет графика; ВКОвыд-е РНК - внутренний контрольный образец на этапе выделения РНК (исходный не инактивированный вирус бешенства) - желтый цвет графика; ВКОПЦР - внутренний контрольный образец на этапе ПЦР-РВ (проверенная кДНК не инактивированного вируса бешенства) - фиолетовый цвет графика; ОКО - отрицательный контрольный образец, контроль фона (деионизированная вода); ОИКОвыд-е РНК - отрицательный инактивированный контрольный образец на этапе выделения РНК (инактивированная суспензия вируса ящура); ОИКОПЦР - отрицательный инактивированный контрольный образец на этапе ПЦР-РВ (проверенная к ДНК вируса ящура, выделенная из инактивированной суспензии)). Неинактивированный контрольный образец - красный цвет графика. Данные представлены до 35 цикла, так как характер графиков с 35 по 45 циклы не изменялся.FIG. 5 - Exponents of the amplification reaction in real time during testing of the sample and controls ( PCR e RNA - positive control sample at the stage of RNA isolation (original non-inactivated FMD virus) - red color of the graph; PCR PCR - positive control sample at the PCR stage - RV (verified cDNA of non-inactivated FMD virus) - green color of the graph; ICD e RNA - internal control sample at the stage of RNA isolation (original non-inactivated rabies virus) - yellow color of the graph; ICR PCR - internal control sample at the stage of RT-PCR (tested cDNA of non-inactivated rabies virus) - purple color of the graph; OKO - negative control sample, background control (deionized water); OICO e RNA - negative inactivated control sample at the stage of RNA isolation (inactivated FMD virus suspension); OICO PCR - negative inactivated control sample at the stage of RT-PCR (tested for FMD virus DNA, isolated from inactivated suspended suspension)). Non-inactivated control sample - red color of the graph. The data are presented up to cycle 35, since the nature of the graphs from cycles 35 to 45 did not change.

Фиг. 6 - Монослойная перевиваемая клеточная линия почки свиньи СП без цитопатического действия (А) и с цитопатическим действием (Б).FIG. 6 - Monolayer transplantable cell line of pig kidney SP without cytopathic action (A) and with cytopathic action (B).

При проведении определения полноты инактивации антигена вируса ящура требуется применять ряд контролей:When determining the completeness of inactivation of the FMD virus antigen, a number of controls are required:

1) ПКОвыд-е РНК- положительный контрольный образец на этапе выделения РНК (исходный не инактивированный вирус ящура);1) PKO output-e RNA - a positive control sample at the stage of RNA isolation (the original non-inactivated FMD virus);

2) ПКОПЦР - положительный контрольный образец на этапе ПЦР-РВ (проверенная кДНК не инактивированного вируса ящура);2) PCR PCR - positive control sample at the stage of RT-PCR (verified cDNA of not inactivated FMD virus);

3) ВКОвыд-е РНК - внутренний контрольный образец на этапе выделения РНК (исходный не инактивированный вирус бешенства штамма РВ-97);3) VKO output-e RNA - internal control sample at the stage of RNA isolation (initial non-inactivated rabies virus strain PB-97);

4) ВКОПЦР - внутренний контрольный образец на этапе ПЦР-РВ (проверенная кДНК не инактивированного вируса бешенства штамма РВ-97);4) VKO PCR - internal control sample at the stage of RT-PCR (verified cDNA of non-inactivated rabies virus strain PB-97);

5) ОКО - отрицательный контрольный образец, контроль фона (деионизированная вода);5) OKO - negative control sample, background control (deionized water);

6) ОИКОвыд-е РНК - отрицательный инактивированный контрольный образец на этапе выделения РНК (инактивированная суспензия вируса ящура);6) OICO release -e RNA - negative inactivated control sample at the stage of RNA isolation (inactivated FMD virus suspension);

7) ОИКОПЦР - отрицательный инактивированный контрольный образец на этапе ПЦР-РВ (проверенная кДНК вируса ящура, выделенная из инактивированной суспензии).7) OICO PCR - negative inactivated control sample at the stage of RT-PCR (verified FMDV cDNA isolated from inactivated suspension).

Из суспензии исследуемого образца, а также из ПКОвыд-е РНК, BKOвыд-e РНК, ОКО и ОИКОвыд-е РНК выделяют РНК в процессе лизиса белков и липопротеинов, очистки нуклеиновой кислоты от примесей, ее концентрирования на стекловолокнистом фильтре и получения готового элюата. Данный метод выделения РНК позволяет достичь высокой стандартизации в процедуре экстракции и получить из образцов высокоочищенные препараты нуклеиновой кислоты. Для работы используют 5 М гуанидинтиоцианат (ГТЦ), сильный денатурирующий агент, который обеспечивает одновременный лизис клеток и денатурации всех клеточных белков (в том числе РНКаз). Усиление эффекта обеспечивается применением 0,5% меркаптоэтанола. Для очистки РНК от примесей дважды применяют 80% раствор изопропанола. Суммарную РНК после экстрагирования на стекловолокнистом фильтре элюируют в 0,2 см3 деионизированной воды. Таким образом, получают по 0,2 см3 элюатов суммарной РНК.RNA is isolated from the suspension of the test sample, as well as from PKO , RNA , BKO out -e RNA , OKO and OICO , RNA is isolated during the lysis of proteins and lipoproteins, purification of nucleic acid from impurities, its concentration on a glass fiber filter and obtaining a finished eluate. This method of RNA isolation allows achieving high standardization in the extraction procedure and obtaining highly purified nucleic acid preparations from samples. For work, 5 M guanidine thiocyanate (GTC) is used, a strong denaturing agent that ensures the simultaneous lysis of cells and denaturation of all cellular proteins (including RNases). Strengthening the effect is provided by the use of 0.5% mercaptoethanol. To purify RNA from impurities, 80% isopropanol solution is used twice. The total RNA after extraction on a glass fiber filter is eluted in 0.2 cm 3 of deionized water. Thus, 0.2 cm 3 of total RNA eluates are obtained.

Для оценки качества и количества РНК в полученных экстрактах проводят спектральное сканирование, определяя поглощение аналитом монохроматического ультрафиолетового света, что позволяет оценить степень чистоты и концентрации продукта, который в последующем используют в ОТ-ПЦР-РВ. Измерения спектральной поглощающей способности образцов осуществляют при длинах волны в диапазоне 205-325 нм и температуре 23-25°С в кювете с длиной оптического пути 10 мм. При измерениях экстинкции нужно учитывать коэффициент разведения раствора исследуемого образца и длину оптического пути (это, чаще всего, компенсируется спектрофотометром).To assess the quality and amount of RNA in the obtained extracts, spectral scanning is carried out, determining the absorption of monochromatic ultraviolet light by the analyte, which makes it possible to assess the degree of purity and concentration of the product, which is subsequently used in RT-PCR-RT. Measurements of the spectral absorption capacity of the samples are carried out at wavelengths in the range 205-325 nm and a temperature of 23-25 ° C in a cuvette with an optical path length of 10 mm. When measuring extinction, it is necessary to take into account the dilution factor of the solution of the test sample and the length of the optical path (this, most often, is compensated by a spectrophotometer).

Индикатором остатков фосфолипидов, полисахаридов и ГТЦ, полипептидов и крупных взвешенных частиц являются значения экстинкции при длинах волны 230, 280 и 320 нм, соответственно [29]. Элюат РНК считают свободным от примесей полипептидов, если OD260/OD280 (коэффициент экстинкции R1) ≥2,0 [29, 30]. Более низкие значения R1 указывают на наличие пептидных связей составляющих в элюате. Более высокие значения коэффициента R1 свидетельствуют о деградации РНК и наличии свободных рибонуклеотидов. Экстракт нуклеиновой кислоты считают незагрязненным полисахаридами, если OD260/OD230 (коэффициент экстинкции R2) ≥2,000 [29, 30]. Более низкие значения указывают, как правило, на загрязнение ГТЦ и углеводными составляющими. При замещении 1% РНК на полисахаридные составляющие R2 снижается на 0,002. Значения коэффициента R2 большие 2,200 могут указывать на деградацию молекул РНК. Отсутствие взвеси крупных частиц в элюате подтверждается, если OD320 приближено к нулевому значению, т.е. OD260/OD320 (коэффициент экстинкции R3) стремится к OD260 [29, 30]. При несоответствии требованиям чистоты повторно проводят этап выделения РНК из исходного материала.An indicator of the residues of phospholipids, polysaccharides and GTZ, polypeptides and large suspended particles are the extinction values at wavelengths of 230, 280, and 320 nm, respectively [29]. The RNA eluate is considered free of polypeptide impurities if OD 260 / OD 280 (extinction coefficient R 1 ) ≥2.0 [29, 30]. Lower R 1 values indicate the presence of peptide bonds of the constituents in the eluate. Higher values of the coefficient R 1 indicate degradation of RNA and the presence of free ribonucleotides. A nucleic acid extract is considered uncontaminated with polysaccharides if OD 260 / OD 230 (extinction coefficient R 2 ) ≥2,000 [29, 30]. Lower values indicate, as a rule, the contamination of GTZ and carbohydrate components. When replacing 1% of RNA with polysaccharide components, R 2 decreases by 0.002. R 2 values greater than 2,200 may indicate degradation of RNA molecules. The absence of a suspension of large particles in the eluate is confirmed if the OD 320 is close to zero, i.e. OD 260 / OD 320 (extinction coefficient R 3 ) tends to OD 26 0 [29, 30]. If the purity requirements are not met, the stage of RNA isolation from the starting material is repeated.

Для определения концентрации молекул РНК в растворе учитывают фактор пересчета (F), равный 40. При этом величина оптической плотности 1,000 о.е. соответствует концентрации примерно 40 мкг/см3 раствора РНК, что обусловлено первичной структурой молекулы. Концентрацию РНК определяли, пользуясь разработанной формулой СРНК=40,5 × OD260 - 0,7037. График по данной формуле представлен на фиг. 3 и выведен эмпирически.To determine the concentration of RNA molecules in solution, a conversion factor (F) equal to 40 is taken into account. The optical density is 1,000 p.u. corresponds to a concentration of about 40 μg / cm 3 RNA solution, which is due to the primary structure of the molecule. The RNA concentration was determined using the developed formula C RNA = 40.5 × OD 260 - 0.7037. The graph for this formula is shown in Fig. 3 and is derived empirically.

На следующем этапе исследования полученные экстракты вирусной РНК исследуемого образца и контролей исследуют в ОТ-ПЦР-РВ. Для постановки реакции готовят ОТ-ПЦР-РВ-смесь, рецептура приготовления которой представлена в таблице 1. В качестве гомологичного 5'-NTR-гену участка вируса ящура используют олигонуклеотидный прямой праймер 5'-NTR-F-fov2 (TTTCCAGGTCTAGAGGGGTGA), олигонуклеотидный обратный праймер 3D-R1-rev (GCGAGTCCTGCCACGGA) и олигонуклеотидный 3DP-rev-зонд (ROX-GTCCCACGGCGTGCAAAGGA-BHQ2), меченый красителем карбокси-Х-родамином (ROX) и гасителем флуоресценции BHQ 2 в концентрации 10 пМ на реакцию с внесением в ОТ-ПЦР-РВ-смесь по 0,1 мкл. Для формирования нуклеотидных цепей продуктов реакции применяют дезоксирибонуклеозидтрифосфаты с концентрацией в ОТ-ПЦР-РВ-смеси по 2,00 мМ. В качестве основы используют Thermo Scientific™ 10Х DreamTaq™ Buffer, содержание которого составляет 10% от общего объема реакционной смеси. DreamTaq™ Buffer специально оптимизирован для ПНР с использованием ДНК-полимеразы DreamTaq™. Буфер содержит как KCl, так и (NH4)2SO4 для обеспечения высокой специфичности отжига праймеров в широком диапазоне концентраций MgCl2. В реакционную смесь добавляют 3,0 мМ хлорида магния. В качестве ферментов применяют ревертазу Maxima Н Minus (Thermo Scientific) (10 е.а.) и ДНК-полимеразу Platinum High Fidelity (Invitrogene) (10 е.a.).At the next stage of the study, the obtained extracts of viral RNA of the test sample and controls are examined in RT-PCR-RT. To set up the reaction, an RT-PCR-RT mixture is prepared, the recipe for which is presented in Table 1. As a homologous to the 5'-NTR gene of the FMD virus region, an oligonucleotide forward primer 5'-NTR-F-fov2 (TTTCCAGGTCTAGAGGGGTGA), oligonucleotide reverse primer 3D-R1-rev (GCGAGTCCTGCCACGGA) and oligonucleotide 3DP-rev-probe (ROX-GTCCCACGGCGTGCAAAGGA-BHQ2) labeled with carboxy-X-rhodamine (ROX) dye and fluorescence quencher BHQ-2 at a concentration of 10 RT-PCR mixture, 0.1 μl. For the formation of nucleotide chains of the reaction products, deoxyribonucleoside triphosphates are used with a concentration of 2.00 mM in the RT-PCR-RT mixture. A Thermo Scientific ™ 10X DreamTaq ™ Buffer is used as a base, the content of which is 10% of the total volume of the reaction mixture. DreamTaq ™ Buffer is specially optimized for PND using DreamTaq ™ DNA Polymerase. The buffer contains both KCl and (NH 4 ) 2 SO 4 to ensure high specificity of primer annealing over a wide range of MgCl 2 concentrations. 3.0 mM magnesium chloride is added to the reaction mixture. The enzymes used are Maxima H Minus revertase (Thermo Scientific) (10 e.a.) and Platinum High Fidelity DNA polymerase (Invitrogene) (10 e.a.).

Ревертаза обладает РНК- и ДНК-зависимой полимеразной активностью, но при этом отсутствует активность РНКазы Н, характеризуется высокой степенью эффективности. Ревертаза Maxima Н Minus (Thermo Scientific) хранится в буфере следующего состава: 50 мМ трис-HCl (рН 7,5), 0,1 М NaCl, 1 мМ ЭДТА, 5 мМ ДТТ, 0,1% Triton Х-100 и 50% глицерина.Revertase has RNA- and DNA-dependent polymerase activity, but there is no RNase H activity, and is characterized by a high degree of efficiency. Revertase Maxima H Minus (Thermo Scientific) is stored in the following buffer: 50 mM Tris-HCl (pH 7.5), 0.1 M NaCl, 1 mM EDTA, 5 mM DTT, 0.1% Triton X-100 and 50 % glycerin.

ДНК-полимераза Platinum High Fidelity (Invitrogene) была выбрана, поскольку данный энзим идеально подходит для амплификации фрагментов ДНК, когда требуются высокий выход ампликонов с большим размером и надежное усиление процесса. Точность данного фермента более чем в шесть раз выше, чем у ДНК-полимераза Taq. Благодаря этому обеспечивается высокой выход полноразмерных продуктов кДНК размером до 20000 п.н. В случае разработанного способа требуется амплифицировать фрагмент размером 7279 п.н. Полимераза Platinum® Taq хранится в буферном растворе (600 мМ Tris-S04 (рН 8,9), 180 мМ (NH4)2SO4).Platinum High Fidelity DNA Polymerase (Invitrogene) was chosen because this enzyme is ideal for amplifying DNA fragments when high yields of large amplicons and reliable amplification are required. The enzyme is more than six times more accurate than Taq DNA polymerase. This ensures a high yield of full-length cDNA products up to 20,000 bp in size. In the case of the developed method, it is required to amplify a 7279 bp fragment. Polymerase Platinum® Taq stored in a buffer (600 mM Tris-S0 4 (pH 8.9), 180 mM (NH 4) 2 SO 4).

Объем ОТ-ПЦР-РВ-смеси компонентов для проведения одной реакции составляет 20 мкл. Элюаты РНК каждого образца добавляют к ОТ-ПЦР-РВ-смеси по 5 мкл. Объем реакционной смеси составляет 25 мкл.The volume of RT-PCR-RT-mixture of components for one reaction is 20 μl. The RNA eluates of each sample are added to the RT-PCR-RT-mixture in 5 μl. The volume of the reaction mixture is 25 μl.

Постановку реакции осуществляют при температурных и временных параметрах, сведения о которых представлены в таблице 1. Обратную транскрипцию проводят при температуре 50°С в течение 30 мин. за 1 цикл, активацию ДНК-полимеразы Platinum High Fidelity - при температуре 95°С за 5 мин. в течение 1 цикла. Реакцию амплификации в режиме реального времени осуществляют в течение 45 циклов, каждый из которых складывается из 3 под этапов: «денатурации», проводимой при температуре 95°С в течение 30 с, этапа «отжига праймеров и зонда» - при температуре 57°С в течение 30 с, этапа «элонгации и аккумулирования флуоресцентного сигнала», осуществляемых при температуре 63°С за 8 минут. Время элонгации увеличено до 8 минут, исходя из ряда проведенных исследований (данные представлены в примере 1). Общее время проведения ОТ-ПЦР-РВ в данном случае составляет 440 мин. или 7 ч 20 мин.The setting of the reaction is carried out at temperature and time parameters, information about which is presented in table 1. Reverse transcription is carried out at a temperature of 50 ° C for 30 minutes. for 1 cycle, activation of Platinum High Fidelity DNA polymerase - at a temperature of 95 ° С for 5 min. within 1 cycle. The amplification reaction in real time is carried out for 45 cycles, each of which consists of 3 sub-stages: "denaturation" carried out at a temperature of 95 ° C for 30 s, the stage of "annealing of primers and probe" - at a temperature of 57 ° C in for 30 s, the stage of "elongation and accumulation of the fluorescent signal", carried out at a temperature of 63 ° C for 8 minutes. The elongation time is increased to 8 minutes, based on a number of studies (data are presented in example 1). The total time for RT-PCR-RT in this case is 440 minutes. or 7 h 20 min.

Процесс основан на использовании 5'-экзонуклеазной активности ДНК-полимеразу Platinum High Fidelity [31]. В отсутствии мишени флуорофор ROX и гаситель флуоресценции BHQ2 в составе 3DP-rev-зонда сближены за счет максимального использования водородных связей между атомами Н, О и N олигонуклеотидов. Благодаря механизму флуоресцентно-резонансного переноса энергии свечение подавлено. За счет 5'-экзонуклеазной активности полимеразы после отжига оригинальных праймеров и зонда происходит разрушение гибридизованного зонда и ампликона, наблюдается их пространственное разделение, что приводит к росту детектируемого сигнала. Увеличение уровня флуоресценции (F1) пропорционально количеству образующихся продуктов реакции. Мониторинг сигнала в течение 45 циклов (С) ПЦР в режиме реального времени позволяет построить кинетическую кривую флуоресценции, которая задана функцией Fl=f (С).The process is based on the use of the 5'-exonuclease activity of Platinum High Fidelity DNA polymerase [31]. In the absence of a target, the ROX fluorophore and the BHQ2 fluorescence quencher in the 3DP rev probe are brought closer together due to the maximum use of hydrogen bonds between the H, O, and N atoms of the oligonucleotides. Due to the mechanism of fluorescence resonance energy transfer, the luminescence is suppressed. Due to the 5'-exonuclease activity of the polymerase, after annealing the original primers and probe, the hybridized probe and amplicon are destroyed, their spatial separation is observed, which leads to an increase in the detected signal. The increase in the level of fluorescence (F1) is proportional to the amount of the resulting reaction products. Monitoring the signal for 45 cycles (C) real-time PCR allows you to build the kinetic fluorescence curve, which is set by the function Fl = f (C).

Осуществляют интерпретацию полученных данных. Важным условием качественно проведенных исследований являются результаты испытания контрольных образцов. Если положительный контрольный образец на этапе выделения РНК (исходный не инактивированный вирус ящура) (ПКОвыд-е РНК); положительный контрольный образец на этапе ПЦР-РВ (проверенная кДНК не инактивированного вируса ящура) (ПКОПЦР); внутренний контрольный образец на этапе выделения РНК (исходный не инактивированный вирус бешенства) (ВКОвыд-е РНК); внутренний контрольный образец на этапе ПЦР-РВ (проверенная кДНК не инактивированного вируса бешенства) (ВКОПЦР) после всех стадий исследования дают положительный результат (наличие экспонент со значением порогового цикла амплификации <40,0 ед.), отрицательный контрольный образец (деионизированная вода) (ОКО); отрицательный инактивированный контрольный образец на этапе выделения РНК (инактивированная суспензия вируса ящура) (ОИКОвыд-е РНК); отрицательный инактивированный контрольный образец на этапе ПЦР-РВ (проверенная кДНК вируса ящура, выделенная из инактивированной суспензии) (ОИКОПЦР) характеризуются в качестве отрицательных образцов (отсутствие экспонент), то в таком случае стадии выделения РНК, получения кДНК и реакции амплификации проведены правильно, и можно учитывать результаты исследуемых проб.Interpretation of the received data is carried out. An important condition for a qualitatively conducted research is the results of testing control samples. If a positive control sample at the stage of RNA isolation (the original non-inactivated FMD virus) (PKO emit RNA ); positive control sample at the stage of RT-PCR (verified cDNA of not inactivated FMD virus) ( PCR PCR ); internal control sample at the stage of RNA isolation (initial non-inactivated rabies virus) (ICR extract RNA ); internal control sample at the stage of RT-PCR (verified cDNA of not inactivated rabies virus) (ICR PCR ) after all stages of the study give a positive result (presence of exponentials with a threshold amplification cycle value <40.0 units), negative control sample (deionized water) (EYE); negative inactivated control sample at the stage of RNA extraction (inactivated suspension of the foot and mouth disease virus) (OICO release of RNA ); negative inactivated control sample at the stage of RT-PCR (verified FMDV cDNA isolated from an inactivated suspension) (OICO PCR ) are characterized as negative samples (no exponents), then the steps of RNA isolation, cDNA production and amplification reactions are carried out correctly, and you can take into account the results of the investigated samples.

Если для исследуемой пробы обнаружены графики ПЦР-РВ с пороговым циклом <40,00 ед., то анализируемый участок нуклеиновой кислоты вируса ящура размером 7279 п.н. не поврежден и поврежден только у части вирусных частиц, следовательно, данный образец считается вирулентным. Если экспонента и, как следствие, накопление ампликона отсутствует, то данный участок генома вируса ящура поврежден, тем самым, репликация вируса не возможна и антиген считается авирулентным. Образцы с показателями порогового значения, находящимися в пределах 40-45 ед., обозначаются как «пограничные» и должны быть протестированы повторно. Иными словами, на основании отсутствия графиков ПЦР-РВ тестируемого образца по сравнению с положительными контролями позволяет сделать заключение о разрушении генома вируса ящура всех вирионов в инактивированных суспензиях и, как следствие, об отсутствии вирулентного вируса.If RT-PCR graphs with a threshold cycle of <40.00 units are found for the test sample, then the analyzed section of the FMD virus nucleic acid measuring 7279 bp. only part of the viral particles are intact and damaged, therefore, this sample is considered virulent. If the exponent and, as a consequence, the accumulation of the amplicon is absent, then this part of the FMD virus genome is damaged, thereby, replication of the virus is not possible and the antigen is considered avirulent. Samples with cut-off values in the 40-45 range are labeled "borderline" and should be retested. In other words, based on the absence of RT-PCR graphs of the test sample in comparison with positive controls, it can be concluded that the FMD virus genome of all virions in inactivated suspensions is destroyed and, as a consequence, that there is no virulent virus.

Таким образом, неинактивированные тестируемые образцы и положительные (неинактивированные) контроли должны иметь показатель порогового цикла (Ct) <40,00 ед. Образцы с показателями порогового значения, находящимися в пределах 40-45 ед., обозначаются как «пограничные» и должны быть протестированы повторно. В том случае, если обнаружены несоответствия в результатах анализа контролей, требуется повторно провести исследование именно того этапа (выделение РНК и ОТ-ПЦР-РВ), на котором выявлено отклонение от нормы.Thus, non-inactivated test samples and positive (non-inactivated) controls should have a cycle threshold (C t ) <40.00 units. Samples with cut-off values in the 40-45 range are labeled "borderline" and should be retested. In the event that discrepancies are found in the results of the analysis of controls, it is required to re-conduct the study of the very stage (isolation of RNA and RT-PCR-RT) at which a deviation from the norm was detected.

Пример 1. Подбор оптимальных олигонуклеотидных праймеров и зонда для синтеза болъшеразмерного фрагмента генома вируса ящура при исследовании полноты инактивации антигена вируса с помощью ОТ-ПЦР-РВ.Example 1. Selection of the optimal oligonucleotide primers and probe for the synthesis of a large-sized fragment of the FMD virus genome in the study of the completeness of inactivation of the virus antigen using RT-PCR-RT.

Оптимизация параметров ОТ-ПЦР-РВ для определения полноты инактивации антигена вируса ящура проведена с использованием часто применяемого в производстве вакцин штамма Азия-1/Шамир/89 (JF739177.1 - адрес последовательности нуклеотидов на сайте https://www.ncbi.nlm.nih.gov/search/all/?term=FMDV).Optimization of RT-PCR-RT parameters to determine the completeness of inactivation of the FMD virus antigen was carried out using the Asia-1 / Shamir / 89 strain (JF739177.1 - the address of the nucleotide sequence on the site https://www.ncbi.nlm), which is often used in the production of vaccines. nih.gov/search/all/?term=FMDV).

С целью подбора олигонуклеотидной системы праймеров и зонда для выявления участка генома вируса ящура длиной 7279 п.н., который включает в себя гены, кодирующие все структурные и неструктурные протеины вируса, были проанализированы полные нуклеотидные последовательности 5'-NTR-участка и 3D-гена, выделенных в период с 1999 по 2021 гг. в странах Африки и Азии и принадлежащих к различным генетическим группам, опубликованные в базе данных GeneBank электронного ресурса NCBI [15]. Множественное выравнивание нуклеотидных последовательностей с использованием алгоритма Clustal W и поиск наиболее консервативных участков проводили с помощью программы BioEdit 7.0. Специфичность праймеров и зондов была оценена с помощью on-line-pecypca Blast (NCBI) (http://blast.ncbi.nlm.nih.gov) [15], с использованием производственных штаммов вируса ящура, отраженных в таблице 2.In order to select an oligonucleotide system of primers and a probe to identify a 7279 bp section of the FMD virus genome, which includes genes encoding all structural and non-structural proteins of the virus, the complete nucleotide sequences of the 5'-NTR region and 3D gene were analyzed allocated in the period from 1999 to 2021. in the countries of Africa and Asia and belonging to different genetic groups, published in the GeneBank database of the electronic resource NCBI [15]. Multiple alignment of nucleotide sequences using the Clustal W algorithm and the search for the most conserved regions were performed using the BioEdit 7.0 software. The specificity of primers and probes was assessed using on-line-pecypca Blast (NCBI) (http://blast.ncbi.nlm.nih.gov) [15], using production strains of the FMD virus, shown in Table 2.

Для сравнительного анализа была сформирована первоначальная выборка из 11 912 нуклеотидных последовательностей 5'-NTR-участка и 3D-гена изолятов и штаммов вируса ящура. После пошаговой оптимизации, удаления из выборки наиболее генетически схожих последовательностей для анализа было выбрано 100 наиболее отличающихся между собой. Для всех последовательностей характерно наличие относительно консервативных участков, расположенных в середине 5'-NTR-участка и в конце 3D-гена. Оптимальной для отжига праймеров и зонда выбраны именно эти области, поскольку количество замен в этих областях наименьшее по сравнению с другими участками гена для всех последовательностей в указанной выборке.For comparative analysis, an initial sample of 11 912 nucleotide sequences of the 5'-NTR region and 3D gene of FMD virus isolates and strains was formed. After step-by-step optimization, removal of the most genetically similar sequences from the sample, the 100 most differing from each other were selected for analysis. All sequences are characterized by the presence of relatively conserved regions located in the middle of the 5'-NTR region and at the end of the 3D gene. These regions were chosen optimal for annealing the primers and the probe, since the number of substitutions in these regions is the smallest in comparison with other regions of the gene for all sequences in the specified sample.

В результате проведенной работы были выбраны и синтезированы 6 олигонуклеотидных праймеров и 3 флуоресцентных зонда для последующего их испытания в ОТ-ПЦР-РВ с целью поиска системы с высокой специфичностью и чувствительностью для производственных штаммов вируса ящура по данным пороговых циклов амплификации (Ct). Дизайн оптимальных оригинальных прямого, обратного праймеров и зонда осуществлен в лаборатории профилактики ящура ФГБУ «ВНИИЗЖ» и отражен в таблице 3 и на фиг. 4. Для тестирования предложены 3 системы олигонуклеотидных праймеров и зондов: 1) 5'-NTR-F-fovl-праймер, 3DP-2 rev-зонд, 3D-R2-rev-npafiMep; 2) 5'-NTR-F2-fov2-праймер, 3DP-rev-зонд, 3D-R1-rev-праймер; 3) 5'-NTR-F3-fov-праймер, 3DP-3 rev-зонд, 3D-R3-rev-праймер (таблица 3).As a result of this work, 6 oligonucleotide primers and 3 fluorescent probes were selected and synthesized for their subsequent testing in RT-PCR-RT in order to search for a system with high specificity and sensitivity for industrial strains of foot and mouth disease according to the data of threshold amplification cycles (C t ). The design of the optimal original forward, reverse primers and probe was carried out in the FMD prevention laboratory of the FGBI "ARRIAH" and is shown in Table 3 and in Fig. 4. For testing, 3 systems of oligonucleotide primers and probes were proposed: 1) 5'-NTR-F-fovl-primer, 3DP-2 rev-probe, 3D-R2-rev-npafiMep; 2) 5'-NTR-F2-fov2 primer, 3DP-rev probe, 3D-R1-rev primer; 3) 5'-NTR-F3-fov-primer, 3DP-3 rev-probe, 3D-R3-rev-primer (Table 3).

Проведена постановка ОТ-ПЦР-РВ с указанными системами праймеров и зондов для анализа производственных штаммов вируса ящура, отраженных в таблице 2. Титр инфекционной активности вируса во всех образцах составлял 7,00-8,00 lg ТЦД50/см3. Исследования с каждым штаммом и системой олигонуклеотидов в ОТ-ПЦР-РВ проводили в пяти повторностях. Полученные данные пороговых циклов амплификации представлены в таблице 4, из которой видно, что вторая система праймеров и зонда (5'-NTR-F2-fov2-праймер, SDP-rev-зонд, 3D-R1-rev-праймер) давала стабильно более высокие значения Ct, при этом были выявлены все исследуемые штаммы вируса ящура.Conducted setting RT-PCR-RT with the specified systems of primers and probes for the analysis of industrial strains of the FMD virus, reflected in table 2. The titer of the infectious activity of the virus in all samples was 7.00-8.00 lg TCD 50 / cm 3 . Studies with each strain and oligonucleotide system in RT-PCR-RT were carried out in five replicates. The obtained data of the threshold amplification cycles are presented in Table 4, from which it can be seen that the second system of primers and probe (5'-NTR-F2-fov2-primer, SDP-rev-probe, 3D-R1-rev-primer) gave consistently higher values of C t , while all investigated strains of the FMD virus were identified.

В ходе экспериментального проведения ОТ-ПЦР-РВ было выявлено, что из указанных олигонуклеотидных систем выбрана наиболее подходящая вторая система праймеров и зонда (в таблице 3 указаны полужирным шрифтом), с которой в дальнейшем проводилась оптимизация реакции для повышения степени ее чувствительности.In the course of the experimental RT-PCR-RT, it was revealed that the most appropriate second system of primers and probe was selected from the indicated oligonucleotide systems (in Table 3 are indicated in bold), with which the reaction was further optimized to increase the degree of its sensitivity.

Пример 2. Подбор условий ОТ-ПЦР-РВ для синтеза большеразмерного фрагмента генома вируса ящура при оценке полноты инактивации антигена вируса.Example 2. Selection of RT-PCR-RT conditions for the synthesis of a large-sized fragment of the FMD virus genome when assessing the completeness of the virus antigen inactivation.

Для достижения высокой чувствительности, специфичности и скорости ОТ-ПЦР-РВ для амплификации большеразмерного участка генома вируса ящура требовалось подобрать оптимальную концентрацию компонентов реакционной смеси и температурно-временной режим реакции. Непосредственно перед осуществлением процесса оптимизации условий постановки ОТ-ПЦР-РВ на участок длиной 7279 п.н. (5'-NTR-участок - 3D-ген) были приготовлены десятикратные разведения (10-1-10-8) выделенной суммарной РНК штамма вируса ящура Азия-1/Шамир 3/89. В целях повышения чувствительности и специфичности ОТ-ПЦР-РВ для амплификации большеразмерного участка генома вируса ящура и определения на основе результатов полноты инактивации антигена вируса основной задачей был подбор концентраций компонентов реакционной смеси. Для этого проведены постановки ОТ-ПЦР-РВ с использованием цельного и десятикратных разведений (10-1-10-8) вакцинного штамма Азия-1/Шамир 3/89. Для постановки реакции использовали тот же температурно-временной режим, что и в ОТ-ПЦР-РВ на ген 3D по данным OIE [2]. В таблицах 5-8 представлены средние значения порогового цикла (Ct) реакции по цельной РНК вируса и ее 8 разведениям (10-1-10-8) (n=3).To achieve high sensitivity, specificity and speed of RT-PCR-RT for amplification of a large-sized region of the FMD virus genome, it was necessary to select the optimal concentration of the components of the reaction mixture and the temperature-time regime of the reaction. Immediately before the process of optimizing the conditions for setting RT-PCR-RT on a 7279 bp section. (5'-NTR-site - 3D-gene) tenfold dilutions (10 -1 -10 -8 ) of the isolated total RNA of the FMD virus strain Asia-1 / Shamir 3/89 were prepared. In order to increase the sensitivity and specificity of RT-PCR-RT for amplification of a large-sized region of the FMD virus genome and determination, based on the results of the completeness of inactivation of the virus antigen, the main task was to select the concentrations of the components of the reaction mixture. For this, RT-PCR-RT was performed using whole and tenfold dilutions (10 -1 -10 -8 ) of the vaccine strain Asia-1 / Shamir 3/89. To set up the reaction, the same temperature-time regime was used as in RT-PCR-RT for the 3D gene according to OIE data [2]. Tables 5-8 show the average values of the threshold cycle (C t ) of the reaction for the whole RNA of the virus and its 8 dilutions (10 -1 -10 -8 ) (n = 3).

Подбор оптимальной концентрации хлорида магния в ОТ-ПЦР-РВ для определения полноты инактивации антигена вируса ящура. Для функционирования ДНК-полимеразу Platinum High Fidelity, являются катионы Mg2+, которые влияют на специфичность гибридизации олигонуклеотидов. Кроме того, катионы Mg2+ формируют растворимые комплексы с дезоксирибонуклеозидтрифосфатами, образуя субстрат для фермента. Оптимальная концентрация катионов Mg2+ может находиться в широком диапазоне в зависимости от используемых систем олигонуклеотидных праймеров и зондов, а также энзимов, и, чаще всего, составляет 1-5 мМ [32]. Как правило, для достижения наилучших результатов концентрацию Mg2+ подбираются эмпирическим путем для применяемой системы олигонуклеотидов и ферментов. Для анализа применяли концентрации хлорида магния 1,0, 2,0, 3,0, 4,0, 5,0 мМ. Результаты исследований представлены в таблице 5. Из представленных в таблице 5 данных видно, что изменение концентрации хлорида магния оказывает значительное влияние на результат реакции амплификации. Выявлено, что оптимальная концентрация MgCl2 для второй системы олигонуклеотидных праймеров и зонда, а также для ДНК-полимеразы Platinum High Fidelity составляет 3 мМ. При указанной концентрации значения пороговых циклов амплификации били наименьшими. При содержании хлорида магния 1,0 мМ выявить продукты реакции амплификации не удалось, при концентрациях 2,0, 4,0 и 5,0 мМ значения пороговых циклов амплификации для элюатов РНК были выше по сравнению с выбранным оптимальным количеством 3,0 мМ MgCl2. Увеличение концентрации соли магния может приводить к уменьшению специфичности реакции, поскольку свободные катионы магния существенно повышают температуру гибридизации двуцепочечной ДНК [33-35].Selection of the optimal concentration of magnesium chloride in RT-PCR-RT to determine the completeness of inactivation of the FMD virus antigen. For the functioning of Platinum High Fidelity DNA polymerase, there are Mg 2+ cations that affect the specificity of hybridization of oligonucleotides. In addition, Mg 2+ cations form soluble complexes with deoxyribonucleoside triphosphates, forming a substrate for the enzyme. The optimal concentration of Mg 2+ cations can be in a wide range, depending on the used systems of oligonucleotide primers and probes, as well as enzymes, and, most often, is 1–5 mM [32]. As a rule, to achieve the best results, the concentration of Mg 2+ is selected empirically for the system of oligonucleotides and enzymes used. For the analysis, concentrations of magnesium chloride of 1.0, 2.0, 3.0, 4.0, 5.0 mM were used. The research results are presented in Table 5. From the data presented in Table 5, it can be seen that a change in the concentration of magnesium chloride has a significant effect on the result of the amplification reaction. It was revealed that the optimal concentration of MgCl 2 for the second system of oligonucleotide primers and probe, as well as for Platinum High Fidelity DNA polymerase is 3 mM. At the indicated concentration, the values of the threshold amplification cycles were the smallest. At a magnesium chloride content of 1.0 mM, the amplification reaction products could not be detected; at concentrations of 2.0, 4.0, and 5.0 mM, the values of the threshold amplification cycles for RNA eluates were higher compared to the selected optimal amount of 3.0 mM MgCl 2 ... An increase in the concentration of magnesium salt can lead to a decrease in the specificity of the reaction, since free magnesium cations significantly increase the hybridization temperature of double-stranded DNA [33-35].

Подбор оптимальной концентрации олигонуклеотидных праймеров в ОТ-ПЦР-РВ для определения полноты инактивации антигена вируса ящура. Оптимальную концентрацию олигонуклеотидных праймеров 5'-NTR-F2-fov2, 3D-R1-rev подбирали экспериментально. С представленными в таблице 6 разведениями РНК вируса ящура штамма Азия-1/Шамир 3/89 готовили реакционные смеси, добавляя в каждую из них разный объем праймеров, а именно 0,1, 0,2, 0,3 и 0,4 мкл. Концентрации исходных растворов олигонуклеотидов составляли по 50 пмоль/мкл. В результате проведенных исследований выявлено, что увеличение концентрации олигонуклеотидов приводит к уменьшению чувствительности реакции, что отражено в таблице 6. Средние пороговые значения отличались на 1,10-2,38 цикла. Наименьшие значения пороговых циклов получены в реакциях, в которых к реакционной смеси добавляли 0,5 мкл каждого из олигонуклеотидов. По литературным данным повышение концентрации праймеров вызывает увеличение вероятности формирования неспецифических продуктов реакции амплификации, в том числе образование димеров праймеров. Уменьшение количества олигонуклеотидов может привести к снижению эффективности реакции и образованию меньшего количества ампликонов [34-38].Selection of the optimal concentration of oligonucleotide primers in RT-PCR-RT to determine the completeness of FMD virus antigen inactivation. The optimal concentration of oligonucleotide primers 5'-NTR-F2-fov2, 3D-R1-rev was selected experimentally. With the dilutions of the FMD virus RNA of the Asia-1 / Shamir 3/89 strain presented in Table 6, reaction mixtures were prepared by adding to each of them a different volume of primers, namely 0.1, 0.2, 0.3 and 0.4 μl. The concentration of the initial solutions of oligonucleotides was 50 pmol / μl. As a result of the studies, it was revealed that an increase in the concentration of oligonucleotides leads to a decrease in the sensitivity of the reaction, which is reflected in Table 6. The average threshold values differed by 1.10-2.38 cycles. The lowest threshold cycle values were obtained in reactions in which 0.5 μl of each of the oligonucleotides was added to the reaction mixture. According to the literature data, an increase in the concentration of primers causes an increase in the probability of the formation of nonspecific products of the amplification reaction, including the formation of primer dimers. A decrease in the number of oligonucleotides can lead to a decrease in the reaction efficiency and the formation of a smaller number of amplicons [34-38].

Подбор оптимальной концентрации флуоресцентного зонда для ОТ-ПЦР-РВ при определении полноты инактивации антигена вируса ящура. С целью повышения эффективности реакции амплификации и увеличения уровня флуоресценции сигмоидных кривых подобран объем вносимого на одну реакцию зонда. Анализ проводили с применением зонда 3DP-rev с вносимыми объемами на одну реакцию 0,10, 0,15, 0,20, 0,30 0,40 мкл с концентрацией исходного раствора зонда 50 пмоль/мкл. Объем праймеров составлял 0,10 мкл на реакцию с концентрацией исходного раствора 50 пмоль/мкл. Исследовали ранее полученные разведения выделенной РНК вируса ящура штамма Азия-1/Шамир 3/89. Значения полученных пороговых циклов реакции амплификации представлены в таблице 7. Выявлено, что при добавлении в реакционную смесь от 0,10 до 0,40 мкл флуоресцентного зонда регистрировали незначительные изменения чувствительности ОТ-ПЦР-РВ. Средние пороговые значения отличались на 0,29-1,63 цикла. Наименьшие значения пороговых циклов амплификации получены при использовании 1,0 мкл 3DP-rev-зонда. При использовании остальных компонентов реакции придерживались рекомендаций производителей.Selection of the optimal concentration of a fluorescent probe for RT-PCR-RT in determining the completeness of inactivation of the FMD virus antigen. In order to increase the efficiency of the amplification reaction and increase the level of fluorescence of the sigmoid curves, the volume of the probe introduced per reaction was selected. The analysis was performed using a 3DP-rev probe with added volumes per reaction of 0.10, 0.15, 0.20, 0.30 0.40 μl with a concentration of the probe stock solution of 50 pmol / μl. The primer volume was 0.10 μl per reaction with a stock solution concentration of 50 pmol / μl. Investigated previously obtained dilutions of the isolated RNA of the FMD virus strain Asia-1 / Shamir 3/89. The values of the obtained threshold cycles of the amplification reaction are presented in Table 7. It was revealed that when a fluorescent probe was added to the reaction mixture from 0.10 to 0.40 μl, insignificant changes in the sensitivity of RT-PCR-RT were recorded. The mean thresholds differed by 0.29-1.63 cycles. The lowest values of the threshold amplification cycles were obtained using 1.0 μl of the 3DP-rev probe. When using the rest of the components, the reactions followed the manufacturer's recommendations.

Подбор температурно-временных параметров ОТ-ПЦР-РВ для определения полноты инактивации антигена вируса ящура. Проводили подбор температурно-временного режима, а именно ПЦР-РВ, поскольку температурный режим обратной транскрипции определяется обратной транскриптазой Maxima Н Minus (Thermo Scientific) [39]. Как правило, данный фермент эффективный синтез кДНК проводит за 15-30 минут [40].Selection of temperature-time parameters of RT-PCR-RT to determine the completeness of inactivation of the FMD virus antigen. The selection of the temperature-time regime, namely, RT-PCR, was carried out, since the temperature regime of reverse transcription is determined by the reverse transcriptase Maxima H Minus (Thermo Scientific) [39]. As a rule, this enzyme efficiently synthesizes cDNA in 15-30 minutes [40].

В работе проводили определении оптимальной температуры отжига для олигонуклеотидов (5'-NTR-F2-fov2-праймер, 3DP-rev-зонд, 3D-R1-rev-праймер). Остальные этапы ПЦР-РВ - денатурация и элонгация -осуществляются в достаточно узком температурном диапазоне. Денатурацию обычно проводят при 90-95°С, а синтез цепи ДНК - при 68-72°С (при этом считается, что скорость работы полимеразы составляет около 50-100 нуклеотидов за секунду) [33].In this work, we determined the optimal annealing temperature for oligonucleotides (5'-NTR-F2-fov2-primer, 3DP-rev-probe, 3D-R1-rev-primer). The remaining stages of RT-PCR - denaturation and elongation - are carried out in a fairly narrow temperature range. Denaturation is usually carried out at 90-95 ° C, and DNA strand synthesis is carried out at 68-72 ° C (it is believed that the rate of polymerase is about 50-100 nucleotides per second) [33].

Температура отжига олигонуклеотидов (Та) является одним из важнейших факторов в разработке высокоспецифичной ПЦР-РВ-системе. При занижении температуры могут образовываться неспецифические продукты реакции амплификации, а при завышении - может значительно снижаться эффективность ПЦР. Отжиг праймеров и зонда для амплификации большеразмерного фрагмента в ОТ-ПЦР-РВ проводили при следующих температурах: 53, 55, 57, 60, 65°С. Результаты подбора температуры отжига олигонуклеотидов при постановке ПЦР-РВ представлены в таблице 8, из которой следует, что сопоставимые значения пороговых циклов амплификации наблюдаются при температуре отжига праймеров и зонда 57°С, что подходит для большинства олигонуклеотидных систем, используемых в ОТ-ПЦР-РВ для молекулярной диагностики ящура. Представляется вполне логичным использование этой же температуры отжига для амплификации фрагмента генома вируса ящура размером 7279 п.н. В разработанном варианте для постановки ОТ-ПЦР-РВ и определения полноты инактивации антигена вируса ящура данным методом устанавливали следующие температурно-временные параметры: 30 мин при 50°С (обратная транскрипция), 5 мин при 95°С (активация ДНК-полимеразы Platinum High Fidelity), далее 45 циклов ПЦР, состоящие из денатурации ДНК в течение 0,5 мин при 95°С, отжига праймеров и зонда - 0,5 мин при 57°С и элонгации кДНК - 8 мин при 72°С. Большое время элонгации в каждом цикле обусловлено длиной амплифицирумого фрагмента (примерно по 1 минуте на 1000 п.н., в данном случае 7279 п.н. - около 8 минут).The annealing temperature of oligonucleotides (T a ) is one of the most important factors in the development of a highly specific RT-PCR system. If the temperature is too low, nonspecific amplification reaction products can be formed, and if the temperature is too high, the PCR efficiency can be significantly reduced. Annealing of primers and a probe for amplification of a large-sized fragment in RT-PCR-RT was carried out at the following temperatures: 53, 55, 57, 60, 65 ° C. The results of the selection of the annealing temperature of oligonucleotides when performing RT-PCR are presented in Table 8, from which it follows that comparable values of the threshold amplification cycles are observed at an annealing temperature of primers and a probe of 57 ° C, which is suitable for most oligonucleotide systems used in RT-PCR-RT. for molecular diagnostics of foot and mouth disease. It seems quite logical to use the same annealing temperature for amplification of a 7279 bp fragment of the FMD virus genome. In the developed version for setting RT-PCR-RT and determining the completeness of FMD virus antigen inactivation by this method, the following temperature-time parameters were established: 30 min at 50 ° C (reverse transcription), 5 min at 95 ° C (activation of Platinum High DNA polymerase Fidelity), then 45 PCR cycles consisting of DNA denaturation for 0.5 min at 95 ° C, annealing of primers and a probe for 0.5 min at 57 ° C, and cDNA elongation for 8 min at 72 ° C. The long elongation time in each cycle is due to the length of the amplified fragment (about 1 minute per 1000 bp, in this case 7279 bp - about 8 minutes).

Пример 3. Инактивация антигена вируса ящура и исследование полученной суспензии в клеточной линии и разработанным способом в ОТ-ПЦР-РВ.Example 3. Inactivation of the antigen of the foot and mouth disease virus and the study of the resulting suspension in the cell line and the developed method in RT-PCR-RT.

Суспензию вируса ящура штамма Азия-1/Шамир 3/89 с титром инфекционной активности 7,75 lg ТЦИД50/см3, по данным титрования в перевиваемой монослойной клеточной линии IB-RS-2 [2], сразу после репродукции в суспензионной культуре клеток ВНК-21 разделяли контроль неинактивированный и исследуемый образец. Тестируемый образец подвергали процессу инактивации с применением аминоэтилэтиленимина в концентрации 0,025%, температура - плюс 37±0,5°С.время экспозиции - 18 ч. Водородный показатель вирусной суспензии поддерживали в диапазоне 7,4-7,6. Суспензию подвергали тщательному перемешиванию в течение 3-5 минут через каждый час. Условия инактивации соответствовали требованиям МЭБ (OIE) [2].Suspension of foot and mouth disease virus strain Asia-1 / Shamir 3/89 with a titer of infectious activity of 7.75 lg TCID 50 / cm 3 , according to titration in a continuous monolayer cell line IB-RS-2 [2], immediately after reproduction in a suspension cell culture VNK-21 separated the non-inactivated control and the test sample. The test sample was subjected to an inactivation process using aminoethylethyleneimine at a concentration of 0.025%, temperature - plus 37 ± 0.5 ° C. Exposure time - 18 hours. The pH of the viral suspension was maintained in the range of 7.4-7.6. The suspension was thoroughly mixed for 3-5 minutes every hour. The inactivation conditions were in accordance with the requirements of the OIE [2].

Параллельно исследовали вирус ящура штамма Азия-1/Шамир 3/89, не подвергнутый инактивации, экспозиция которого проводилась при той же температуре и в тот период времени.In parallel, the FMD virus strain Asia-1 / Shamir 3/89, not subjected to inactivation, was examined, the exposure of which was carried out at the same temperature and during that period of time.

Контрольный (неинактивированный) и опытный (инактивированный) образцы исследовали на наличие инфекционной активности вируса ящура в перевиваемой монослойной культуре клеток почки свиньи IB-RS-2 в соответствии с требованиями МЭБ (OIE) [2]. Исследование каждого образца проводили в 4 повторностях. Анализ монослоя на наличие/отсутствие цитопатического действия осуществляли раз в сутки в течение 3 дней. Изображение монослоя на третьи сутки после инокуляции контрольным и опытным образцами представлено на фиг. 6, на котором видно, что наличие ЦПД характерно для неинактивированного материала и его отсутствие - для инактивированной суспензии вируса ящура.The control (non-inactivated) and experimental (inactivated) samples were examined for the infectious activity of the foot-and-mouth disease virus in a continuous monolayer culture of pig kidney cells IB-RS-2 in accordance with the requirements of the OIE [2]. The study of each sample was carried out in 4 replicates. Analysis of the monolayer for the presence / absence of cytopathic action was carried out once a day for 3 days. The image of the monolayer on the third day after inoculation with control and experimental samples is shown in Fig. 6, which shows that the presence of CPE is characteristic of non-inactivated material and its absence is characteristic of an inactivated suspension of the FMD virus.

Параллельно данные суспензии анализировали с помощью ОТ-ПЦР-РВ для исследования полноты инактивации антигена вируса ящура при амплификации большеразмерного ампликона.In parallel, these suspensions were analyzed using RT-PCR-RT to study the completeness of inactivation of the FMD virus antigen during amplification of a large-sized amplicon.

При проведении оценки полноты инактивации антигена вируса ящура разработанным способом применяли следующие контроли: ПКОвыд-е РНК - положительный контрольный образец на этапе выделения РНК (исходный не инактивированный вирус ящура); ПКОПЦР - положительный контрольный образец на этапе ПЦР-РВ (проверенная кДНК не инактивированного вируса ящура); ВКОвыд-я РНК - внутренний контрольный образец на этапе выделения РНК (исходный не инактивированный вирус бешенства штамма РВ-97); ВКОПЦР - внутренний контрольный образец на этапе ПЦР-РВ (проверенная кДНК не инактивированного вируса бешенства штамма РВ-97); ОКО -отрицательный контрольный образец, контроль фона (деионизированная вода); ОИКОвыд-е РНК- отрицательный инактивированный контрольный образец на этапе выделения РНК (инактивированная суспензия вируса ящура); ОИКОПЦР - отрицательный инактивированный контрольный образец на этапе ПЦР-РВ (проверенная кДНК вируса ящура, выделенная из инактивированной суспензии).When assessing the completeness of inactivation of the FMD virus antigen by the developed method, the following controls were used: PKO emitting RNA - a positive control sample at the stage of RNA isolation (the original non-inactivated FMD virus); PCR PCR - positive control sample at the stage of RT-PCR (verified cDNA of not inactivated FMD virus); VKO vyt-i RNA - internal control sample at the stage of RNA isolation (initial non-inactivated rabies virus strain PB-97); VKO PCR - internal control sample at the stage of RT-PCR (verified cDNA of non-inactivated rabies virus strain PB-97); OKO - negative control sample, background control (deionized water); OICO out -e RNA - negative inactivated control sample at the stage of RNA isolation (inactivated FMD virus suspension); OICO PCR - negative inactivated control sample at the stage of RT-PCR (verified FMDV cDNA isolated from inactivated suspension).

Из суспензии контрольного (инактивированного) и исследуемого (инактивированного) образца, а также из ПКОвыд-е РНК, ВКОвыд-е РНК, ОКО и ОИКОвыд-е РНК выделяли РНК вируса ящура. К 100 мл образца добавляли 400 мкл смеси 5 М гуанидинтиоцианата (ГТЦ) и 0,5% меркаптоэтанола (1:1), инкубировали при комнатной температуре в течение 5 минут. Лизат помещали в колонки на стекловолокнистое волокно. Процесс выполняли на системе Manifold, к которой подключали вакуумный насос Vacuum Pump 2С (Vacuubrand). Для очистки РНК от примесей белков дважды применяли 80% раствор изопропанола, внося его по 800 мкл. Суммарную РНК после экстрагирования на стекловолокнистом фильтре элюировали в 0,2 см3 деионизированной воды. Таким образом, получили по 0,2 см3 элюатов РНК.Control (inactivated) from the slurry and the test (inactivated) sample, and also of FFP vyd th RNA EKR vyd th RNA, NEO and Oikawa vyd th RNA was isolated FMDV RNA. To 100 ml of the sample was added 400 μl of a mixture of 5 M guanidine thiocyanate (GTZ) and 0.5% mercaptoethanol (1: 1), incubated at room temperature for 5 minutes. The lysate was loaded onto glass fiber columns. The process was carried out on a Manifold system to which a Vacuum Pump 2C vacuum pump (Vacuubrand) was connected. To purify RNA from protein impurities, an 80% solution of isopropanol was used twice, adding 800 μL each. The total RNA after extraction on a glass fiber filter was eluted in 0.2 cm 3 of deionized water. Thus, we received 0.2 cm 3 of RNA eluates.

Для оценки качества и количества РНК в полученных экстрактах проводили спектральное сканирование при длинах волны в диапазоне 205-325 нм и температуре 23-25°С в кювете с длиной оптического пути 10 мм. Индикатором остатков фосфолипидов, полисахаридов и ГТЦ, полипептидов и крупных взвешенных частиц являются значения экстинкции при длинах волны 230, 280 и 320 нм, соответственно [29]. Коэффициент экстинкции R1 (OD260/OD280) для полученных элюатов РНК был свободным от примесей полипептидов, поскольку R1 находился в диапазоне 2,002-2,009 о.е. (норма ≥2,000 о.е.) [29, 30]. Экстракты нуклеиновой кислоты считались незагрязненными полисахаридами и ГТЦ так как коэффициенты экстинкции R2 (OD260/OD230) составляли 2,001-2,007 о.е. (норма ≥2,000 о.е.) [29, 30]. В полученных элюатах не обнаружено крупных взвешенных частиц, поскольку OD320 приближено к нулевому значению (0,001-0,004 о.е.) [29, 30].To assess the quality and amount of RNA in the obtained extracts, spectral scanning was performed at wavelengths in the range 205-325 nm and a temperature of 23-25 ° C in a cuvette with an optical path length of 10 mm. An indicator of the residues of phospholipids, polysaccharides and GTZ, polypeptides and large suspended particles are the extinction values at wavelengths of 230, 280, and 320 nm, respectively [29]. The extinction coefficient R 1 (OD 260 / OD 280 ) for the resulting RNA eluates was free of polypeptide impurities, since R 1 was in the range of 2.002-2.009 pu. (norm ≥2,000 p.u.) [29, 30]. The nucleic acid extracts were considered uncontaminated by polysaccharides and GTZ since the extinction coefficients R 2 (OD 260 / OD 230 ) were 2.001-2.007 pu. (norm ≥2,000 p.u.) [29, 30]. No large suspended particles were found in the eluates obtained, since OD 320 is close to zero (0.001-0.004 pu) [29, 30].

Для определения концентрации молекул РНК в элюатах учитывали фактор пересчета (F), равный 40. При этом величина оптической плотности 1,000 о.е. соответствует концентрации примерно 40 мкг/см3 раствора РНК, что обусловлено первичной структурой молекулы.To determine the concentration of RNA molecules in the eluates, a conversion factor (F) equal to 40 was taken into account. corresponds to a concentration of about 40 μg / cm 3 RNA solution, which is due to the primary structure of the molecule.

Изначально эмпирическим путем получили формулу расчета концентрации РНК в элюате. Для этого брали стандарты очищенных элюатов РНК в количестве 9 штук с концентрациями: 0,2, 0,4, 0,6, 0,8, 1,0, 1,2, 1,4, 1,6, 1,8 мкг/мл. Определяли их значения оптических плотностей при длине волны 260 нм. Полученные данные отразили на фиг. 3, на которой изображен линейный график, позволяющий определять по результатам спектрального сканирования концентрацию РНК в экстракте. График представлен формулой: СРНК=40,5 × OD260 - 0,7037. Пользуясь выведенной формулой для исследуемых образцов рассчитали концентрации РНК, которые составили 50,33-57,78 мкг/мл. Все данные по спектральному сканированию отражены в таблице 8, из которой следует, что полученные элюаты очищены и содержат в своем составе РНК.Initially, the formula for calculating the concentration of RNA in the eluate was obtained empirically. For this, we took standards of purified RNA eluates in the amount of 9 pieces with concentrations: 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8 μg / ml. Determined their values of optical densities at a wavelength of 260 nm. The data obtained is reflected in FIG. 3, which shows a line graph that allows you to determine the concentration of RNA in the extract from the results of spectral scanning. The graph is represented by the formula: C RNA = 40.5 × OD 260 - 0.7037. Using the derived formula for the studied samples, the RNA concentrations were calculated, which amounted to 50.33-57.78 μg / ml. All data on spectral scanning are reflected in Table 8, from which it follows that the resulting eluates are purified and contain RNA.

На следующем этапе исследования полученные экстракты РНК исследуемого образца и контролей исследовали в ОТ-ПЦР-РВ. Для постановки реакции готовили ОТ-ПЦР-РВ-смесь, рецептура приготовления которой представлена в таблице 1. Использовали олигонуклеотидный прямой праймер 5'-NTR-F-fov2 (TTTCCAGGTCTAGAGGGGTGA), олигонуклеотидный обратный праймер 3D-R1-rev (GCGAGTCCTGCCACGGA) и олигонуклеотидный 3DP-rev-зонд (ROX-GTCCCACGGCGTGCAAAGGA-В HQ2), меченый красителем карбокси-Х-родамином (ROX) и гасителем флуоресценции BHQ2 в концентрации 10 пМ на реакцию с внесением в ОТ-ПЦР-РВ-смесь по 0,1 мкл. Для формирования нуклеотидных цепей продуктов реакции применяют дезоксирибонуклеозидтрифосфаты с концентрацией в ОТ-ПЦР-РВ-смеси по 2,00 мМ. В качестве основы используют Thermo Scientific™ 10Х DreamTaq™ Buffer, содержание которого составляет 10% от общего объема реакционной смеси. DreamTaq™ Buffer специально оптимизирован для ПЦР с использованием ДНК-полимеразы DreamTaq™. В реакционную смесь добавляли 3,0 мМ хлорида магния. В качестве ферментов применяли ревертазу Maxima Н Minus (Thermo Scientific) (10 е.а.) и ДНК-полимеразу Platinum High Fidelity (Invitrogene) (10 е.а.). Объем ОТ-ПЦР-РВ-смеси компонентов для проведения одной реакции составлял 20 мкл. Элюаты РНК вируса ящура каждого образца добавляли к ОТ-ПЦР-РВ-смеси по 5 мкл. Объем реакционной смеси составляет 25 мкл.At the next stage of the study, the obtained RNA extracts of the test sample and controls were investigated in RT-PCR-RT. To set up the reaction, an RT-PCR-RT mixture was prepared, the preparation formulation of which is shown in Table 1. The oligonucleotide forward primer 5'-NTR-F-fov2 (TTTCCAGGTCTAGAGGGGTGA), the oligonucleotide reverse primer 3D-R1-rev (GCGAGTCCTGCCACGGA) were used. -rev-probe (ROX-GTCCCACGGCGTGCAAAGGA-B HQ2) labeled with carboxy-X-rhodamine (ROX) dye and fluorescence quencher BHQ2 at a concentration of 10 pM for reaction with addition of 0.1 μl to the RT-PCR-RT mixture. For the formation of nucleotide chains of the reaction products, deoxyribonucleoside triphosphates are used with a concentration of 2.00 mM in the RT-PCR-RT mixture. A Thermo Scientific ™ 10X DreamTaq ™ Buffer is used as a base, the content of which is 10% of the total volume of the reaction mixture. DreamTaq ™ Buffer is specially optimized for PCR using DreamTaq ™ DNA Polymerase. 3.0 mM magnesium chloride was added to the reaction mixture. The enzymes used were Maxima H Minus revertase (Thermo Scientific) (10 ea) and Platinum High Fidelity DNA polymerase (Invitrogene) (10 ea). The volume of the RT-PCR-RT mixture of components for one reaction was 20 μL. The eluates of the FMD virus RNA of each sample were added to the RT-PCR-RT-mixture in 5 μl. The volume of the reaction mixture is 25 μl.

Обратную транскрипцию проводили при температуре 50°С в течение 30 мин. за 1 цикл, активацию ДНК-полимеразы Platinum High Fidelity - при температуре 95°С за 5 мин. в течение 1 цикла. Реакцию амплификации в режиме реального времени осуществляли в течение 45 циклов, каждый из которых складывается из 3 под этапов: «денатурации», проводимой при температуре 95°С в течение 30 с, этапа «отжига праймеров и зонда» - при температуре 57°С в течение 30 с, этапа «элонгации и аккумулирования флуоресцентного сигнала», осуществляемых при температуре 63°С за 8 минут.Reverse transcription was performed at 50 ° C for 30 min. for 1 cycle, activation of Platinum High Fidelity DNA polymerase - at a temperature of 95 ° С for 5 min. within 1 cycle. The amplification reaction in real time was carried out for 45 cycles, each of which consists of 3 sub-stages: "denaturation" carried out at a temperature of 95 ° C for 30 s, the stage of "annealing of primers and probe" - at a temperature of 57 ° C in for 30 s, the stage of "elongation and accumulation of the fluorescent signal", carried out at a temperature of 63 ° C for 8 minutes.

Осуществляли интерпретацию полученных данных, учитывая изначально результаты испытания контрольных образцов. Положительный контрольный образец на этапе выделения РНК (исходный не инактивированный вирус ящура) (ПКОвыд-е РНК), положительный контрольный образец на этапе ПЦР (проверенная кДНК не инактивированного вируса ящура) (ПКОПЦР), внутренний контрольный образец на этапе выделения РНК (исходный не инактивированный вирус бешенства) (ВКОвыд-е РНК), внутренний контрольный образец на этапе ПЦР (проверенная кДНК не инактивированного вируса бешенства) (ВКОПЦР) после всех стадий исследования дали положительный результат (наличие экспонент со значением порогового цикла амплификации <40,0 у.е.); отрицательный контрольный образец (деионизированная вода) (ОКО), отрицательный инактивированный контрольный образец на этапе выделения РНК (инактивированная суспензия вируса ящура) (ОИКОвыд-е РНК), отрицательный инактивированный контрольный образец на этапе ПЦР (проверенная кДНК вируса ящура, выделенная из инактивированной суспензии) (ОИКОПЦР) дали отрицательный результат (отсутствие экспонент). Таким образом, этапы выделения РНК, получения кДНК и реакции амплификации проведены правильно, и можно учитывать результаты исследуемой инактивированной пробы суспензии вируса ящура штамма Азия-1/Шамир 3/89. Результаты исследования продемонстрированы на фиг. 5.Interpretation of the obtained data was carried out, taking into account the initial test results of control samples. Positive control sample at the stage of RNA isolation (original non-inactivated FMD virus) ( PCR e RNA ), positive control sample at the PCR stage (tested cDNA of non-inactivated FMD virus) ( PCR PCR ), internal control sample at the stage of RNA isolation (initial not inactivated rabies virus) ( ICR e RNA ), internal control sample at the PCR stage (tested cDNA of non-inactivated rabies virus) (ICV PCR ) after all stages of the study gave a positive result (the presence of exponentials with a threshold amplification cycle value <40.0 cu); negative control sample (deionized water) (DIW), negative inactivated control sample at the stage of RNA isolation (inactivated suspension of FMD virus) (DECV e RNA ), negative inactivated control sample at the PCR stage (tested cDNA of FMD virus isolated from inactivated suspension ) (OICO PCR ) gave a negative result (no exponents). Thus, the stages of RNA isolation, cDNA production and amplification reaction were carried out correctly, and the results of the studied inactivated sample of the FMD virus suspension of the Asia-1 / Shamir 3/89 strain can be taken into account. The results of the study are shown in FIG. 5.

Для исследуемой инактивированной пробы не обнаружено наличия графика ПЦР-РВ, иными словами, накопление ампликона отсутствует, данный участок генома вируса ящура (размером 7279 п.н., диапазон от 5'-NTR-участка до 3D-гена включительно) поврежден, тем самым, репликация вируса не возможна и антиген считается авирулентным. Полученные результаты исследования контрольного (неинактивированного) и опытного (инактивированного) образца разработанным способом и в клеточной линии почки свиньи IB-RS-2 (прототип) согласовывались.For the investigated inactivated sample, the presence of an RT-PCR graph was not detected, in other words, there is no amplicon accumulation, this region of the FMD virus genome (7279 bp in size, the range from the 5'-NTR region to the 3D gene, inclusive) is damaged, thereby , viral replication is not possible and the antigen is considered avirulent. The obtained results of the study of the control (non-inactivated) and experimental (inactivated) sample by the developed method and in the pig kidney cell line IB-RS-2 (prototype) were consistent.

Таким образом, способ опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением ОТ-ПЦР-РВ при амплификации большеразмерного фрагмента не уступает по своей эффективности традиционному биологическому методу и позволяет значительно сократить время проведения исследования.Thus, the method of indirectly determining the completeness of FMD virus antigen inactivation in vaccine raw materials using RT-PCR-RT during amplification of a large-sized fragment is not inferior in its effectiveness to the traditional biological method and can significantly reduce the study time.

Пример 4. Определение диагностической чувствительности способа опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением ОТ-ПЦР-РВ при амплификации болъшеразмерного фрагмента.Example 4. Determination of the diagnostic sensitivity of the method for indirect determination of the completeness of inactivation of the FMD virus antigen in the raw material for the vaccine using RT-PCR-RT with amplification of a large fragment.

Каждый метод анализа имеет свои пределы диагностических возможностей, которые отражены в их основных рабочих характеристиках: чувствительность, специфичность и общая точность [41]. Точность метода определяется, во-первых, его диагностической чувствительностью, то есть выявляется, что проба инактивирована в том случае, если это истина (ДП - достоверно положительный результат), при этом процент выявленных ложноинактивированных проб (ЛП - ложноположительный результат) должен стремиться к нулю; во-вторых, специфичностью, то есть полнота инактивации не выявляется, когда проба вирулентна (неинактивирована) (ДО - достоверно отрицательный результат), при этом процент ложно вирулентных проб (ЛО - ложноотрицательный результат) должен стремиться к нулю.Each method of analysis has its own diagnostic limits, which are reflected in their main performance characteristics: sensitivity, specificity and overall accuracy [41]. The accuracy of the method is determined, firstly, by its diagnostic sensitivity, that is, it is revealed that the sample is inactivated if it is true (DP is a reliably positive result), while the percentage of detected falsely inactivated samples (LP is a false positive result) should tend to zero ; secondly, specificity, that is, the completeness of inactivation is not detected when the sample is virulent (non-inactivated) (DO - reliably negative result), while the percentage of falsely virulent samples (LO - false negative result) should tend to zero.

Чувствительность (истинно положительная пропорция) отражает долю положительных результатов анализа, которые правильно идентифицированы как таковые. Иными словами, чувствительность диагностического теста показывает вероятность того, что инактивированная суспензия вируса ящура будет определена с помощью разработанного способа именно как инактивированная [41]. Чувствительность разработанного теста определяли по формуле: Ч=ДП/(ДП+ЛО), где Ч - диагностическая чувствительность, ДП - достоверноположительный результат, ЛО - ложноотрицательный результат.Sensitivity (true positive proportion) reflects the proportion of positive test results that are correctly identified as such. In other words, the sensitivity of the diagnostic test shows the likelihood that the inactivated suspension of the FMD virus will be determined by the developed method as inactivated [41]. The sensitivity of the developed test was determined by the formula: H = DP / (DP + LR), where H is the diagnostic sensitivity, DP is a reliably positive result, LR is a false negative result.

Для определения чувствительности разработанного способа опосредованного определения полноты инактивации антигена вируса ящура исследовали 360 суспензий, которые являлись истинно инактивированными по данным исследования в монослойной перевиваемой клеточной линии почки свиньи IB-RS-2 (прототип) [2]. Постановку теста проводили, как отражено в примере 3. В результате анализа в ОТ-ПЦР-РВ при амплификации большеразмерного фрагмента генома вируса ящура определили, что из 360 истинно инактивированных суспензий 358 определены в качестве инактивированных, а 2 - в качестве неинактивированных, т.е. количество ДП составило 358, а ЛО - 2 (таблица 9). Таким образом, диагностическая чувствительность разработанного способа опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением ОТ-ПЦР-РВ при амплификации большеразмерного фрагмента составила 99,44%.To determine the sensitivity of the developed method for indirectly determining the completeness of inactivation of the FMD virus antigen, 360 suspensions were investigated, which were truly inactivated according to the study in a monolayer transplantable cell line of pig kidney IB-RS-2 (prototype) [2]. The test was performed as described in example 3. As a result of analysis in RT-PCR-RT during amplification of a large-sized fragment of the FMD virus genome, it was determined that out of 360 truly inactivated suspensions, 358 were identified as inactivated, and 2 - as non-inactivated, i.e. ... the number of DPs was 358, and LOs - 2 (Table 9). Thus, the diagnostic sensitivity of the developed method for indirect determination of the completeness of FMD virus antigen inactivation in vaccine raw materials using RT-PCR-RT with amplification of a large-sized fragment was 99.44%.

Пример 5. Определение диагностической специфичности способа опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением ОТ-ПЦР-РВ при амплификации болъшеразмерного фрагмента.Example 5. Determination of the diagnostic specificity of the method for indirect determination of the completeness of inactivation of the FMD virus antigen in the raw material for the vaccine using RT-PCR-RT with amplification of a large fragment.

Специфичность (истинно отрицательная пропорция) отражает долю отрицательных результатов, которые правильно идентифицированы как таковые, то есть вероятность того, что неинактивированные суспензии будут классифицированы именно как авирулентные [41]. Диагностическую специфичность разработанного теста определяли по формуле: Сп=ДО/(ДО+ЛП), где Сп - диагностическая специфичность, ДО - достоверноотрицательный результат, ЛП - ложноположительный результат.Specificity (truly negative proportion) reflects the proportion of negative results that are correctly identified as such, that is, the probability that non-inactivated suspensions will be classified exactly as avirulent [41]. The diagnostic specificity of the developed test was determined by the formula: Cn = DO / (DO + LP), where Cp is the diagnostic specificity, DO is a reliably negative result, and LP is a false positive result.

Для исследования специфичности разработанного способа опосредованного определения полноты инактивации антигена вируса ящура тестировали 360 суспензий, которые являлись истинно неинактивированными по данным исследования в монослойной перевиваемой клеточной линии почки свиньи IB-RS-2 (прототип) [2]. Анализ проводили, как отражено в примере 3. В результате исследования в ОТ-ПЦР-РВ при амплификации большеразмерного фрагмента генома вируса ящура определили, что из 360 истинно неинактивированных суспензий 360 определены в качестве неинактивированных, статус инактивированных суспензий присвоен не был, т.е. количество ДО составило 360 (таблица 9). Таким образом, диагностическая специфичность разработанного способа опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением ОТ-ПЦР-РВ при амплификации большеразмерного фрагмента составила 100,00%.To study the specificity of the developed method for indirectly determining the completeness of inactivation of the FMD virus antigen, 360 suspensions were tested, which were truly non-inactivated according to the study in a monolayer transplanted pig kidney IB-RS-2 cell line (prototype) [2]. The analysis was carried out as described in example 3. As a result of the study in RT-PCR-RT during amplification of a large-sized fragment of the FMD virus genome, it was determined that out of 360 truly non-inactivated suspensions, 360 were identified as non-inactivated, the status of inactivated suspensions was not assigned, i.e. the number of POs was 360 (Table 9). Thus, the diagnostic specificity of the developed method for indirectly determining the completeness of FMD virus antigen inactivation in vaccine raw materials using RT-PCR-RT with amplification of a large-sized fragment was 100.00%.

Пример 6. Определение общей точности способа опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением ОТ-ПЦР-РВ при амплификации болъшеразмерного фрагмента.Example 6. Determination of the overall accuracy of the method for indirect determination of the completeness of inactivation of the FMD virus antigen in the raw material for the vaccine using RT-PCR-RT with amplification of a large fragment.

Исследовали общую точность способа опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением ОТ-ПЦР-РВ при амплификации большеразмерного фрагмента.Investigated the overall accuracy of the method for indirect determination of the completeness of inactivation of the FMD virus antigen in the raw material for the vaccine using RT-PCR-RT with amplification of a large-sized fragment.

Общая точность показывает соотношение числа достоверноположительных (ДП) и достоверноотрицательных (ДО) результатов анализа к общему числу окончательных результатов, заключенных с помощью разработанного способа. Понятие «общая точность теста» является объективным отражением процесса выдачи ложноотрицательных (ЛО) и ложноположительных (ЛП) результатов исследования с помощью разработанного способа [41].The overall accuracy shows the ratio of the number of reliably positive (DP) and reliably negative (DO) analysis results to the total number of final results concluded using the developed method. The concept of "overall test accuracy" is an objective reflection of the process of issuing false negative (LO) and false positive (LP) research results using the developed method [41].

Обитую точность разработанного способа определяли по формуле: Т=(ДП+ДО)/(ДП+ДО+ЛП+ЛО), где Т - общая точность, ДП - достоверноположительный результат, ДО - достоверноотрицательный результат, ЛП - ложноположительный результат, ЛО - ложноотрицательный результат.Данные для расчета общей точности представлены в примерах 4 и 5. ДП составляло 358, ДО - 360, ЛП - 0, ЛО - 2. Иными словами, общая точность разработанного способа опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением ОТ-ПЦР-РВ при амплификации большеразмерного фрагмента составила 99,72%.The inhabited accuracy of the developed method was determined by the formula: T = (DP + DO) / (DP + DO + LP + LO), where T is the overall accuracy, DP is a reliably positive result, DO is a reliably negative result, LP is a false positive result, LO is a false negative result. The data for calculating the overall accuracy are presented in examples 4 and 5. DP was 358, DO - 360, LP - 0, LO - 2. In other words, the overall accuracy of the developed method for indirectly determining the completeness of FMD virus antigen inactivation in raw materials for vaccines using RT-PCR-RT during amplification of a large-sized fragment was 99.72%.

Основным преимуществом предлагаемого изобретения является возможность одновременного исследования большого количества проб для опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцин с применением обратно-транскриптазной полимеразной цепной реакции в режиме реального времени при амплификации большеразмерного фрагмента в течение 9-10 часов. В предлагаемом изобретении для исследования полноты инактивации вируса ящура проводят выделение его нуклеиновой кислоты, анализ полученного элюата на степень чистоты и количество РНК с помощью спектрального сканирования, применяется оптимизированной по компонентам и температурно-временным параметрам ОТ-ПЦР-РВ с использованием системы оригинальных праймеров и зонда, позволяющих амплифицировать участок генома вируса ящура размером 7279 п.н. (от диапазон от 5'-NTR-участка до 3D-гена включительно). Данный подход дает возможность выявить поврежден ли геном вируса ящура в амплифицируемой зоне и, тем самым, опосредованно определить полноту инактивации антигена вируса ящура в сырье для вакцины.The main advantage of the present invention is the ability to simultaneously study a large number of samples to indirectly determine the completeness of inactivation of the FMD virus antigen in vaccine raw materials using reverse transcriptase polymerase chain reaction in real time with amplification of a large-sized fragment for 9-10 hours. In the present invention, to study the completeness of FMD virus inactivation, its nucleic acid is isolated, the resulting eluate is analyzed for the purity and the amount of RNA using spectral scanning, RT-PCR-RT optimized in terms of components and temperature-time parameters is used using a system of original primers and a probe allowing amplification of a 7279 bp section of the FMD virus genome. (from the range from 5'-NTR-region to 3D-gene inclusive). This approach makes it possible to detect whether the FMD virus genome is damaged in the amplified zone and, thereby, to indirectly determine the completeness of the FMD virus antigen inactivation in the vaccine raw material.

Предлагаемый способ опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением обратно-транскриптазной полимеразной цепной реакции в режиме реального времени при амплификации большеразмерного фрагмента характеризуется высокими показаниями диагностической чувствительности, специфичности и общей точности.The proposed method for indirect determination of the completeness of FMD virus antigen inactivation in raw materials for a vaccine using reverse transcriptase polymerase chain reaction in real time with amplification of a large-sized fragment is characterized by high indications of diagnostic sensitivity, specificity and overall accuracy.

Источники информации, принятые во внимание при составлении описания изобретения к заявке на выдачу патента РФ на изобретение «Способ опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением обратно-транскриптазной полимеразной цепной реакции в режиме реального времени при амплификации большеразмерного фрагмента»:Sources of information taken into account in the preparation of the description of the invention to the application for the grant of a patent of the Russian Federation for the invention "A method for indirectly determining the completeness of inactivation of the FMD virus antigen in raw materials for a vaccine using a reverse transcriptase polymerase chain reaction in real time with amplification of a large-sized fragment":

1. Пономарев А.П., Узюмов В.Л., Груздев К.Н. Вирус ящура: структура, биологические и физико-химические свойства. Владимир: Фолиант, 2006. - 250 с.1. Ponomarev A.P., Uzyumov V.L., Gruzdev K.N. FMD virus: structure, biological and physicochemical properties. Vladimir: Foliant, 2006 .-- 250 p.

2. OIE. Manual of diagnostic tests and vaccines for terrestrial animals. - 7th ed. - Paris, 2018. - Vol.1, Chap. 2.1.8.2. OIE. Manual of diagnostic tests and vaccines for terrestrial animals. - 7 th ed. - Paris, 2018. - Vol.1, Chap. 2.1.8.

3. Acharia R., Fry E., Stuard D et al. The three-dimensional structure of FMDV at 2.9 A resolution // Nature (London). - 1989. - V. 337. - P. 709-716.3. Acharia R., Fry E., Stuard D et al. The three-dimensional structure of FMDV at 2.9 A resolution // Nature (London). - 1989. - V. 337. - P. 709-716.

4. Grubman, M.J. Biochemical map of polypeptides specified by foot-and-mouth disease virus / M.J. Grubman, В.H. Robertson, D.O. Morgan // J. Virol. - 1984. - V. 50. - P. 579-586.4. Grubman, M.J. Biochemical map of polypeptides specified by foot-and-mouth disease virus / M.J. Grubman, B.H. Robertson, D.O. Morgan // J. Virol. - 1984. - V. 50. - P. 579-586.

5. Rueckert, R.R. Systematic nomenclature of picornavirus proteins / R.R. Rueckert, E. Wimmer // J. Virol. - 1984. - V. 50. - P. 957-959.5. Rueckert, R.R. Systematic nomenclature of picornavirus proteins / R.R. Rueckert, E. Wimmer // J. Virol. - 1984. - V. 50. - P. 957-959.

6. Cottam E. M. Transmission pathways of foot-and-mouth disease virus in the United Kingdom in 2007 / E.M. Cottam, J. Wadsworth, A.E. Shaw, R.J. Rowlands // PLoS Pathog. - 2008. - V. 4: e100005010.1371/journal.ppat.1000050.6. Cottam E. M. Transmission pathways of foot-and-mouth disease virus in the United Kingdom in 2007 / E.M. Cottam, J. Wadsworth, A.E. Shaw, R.J. Rowlands // PLoS Pathog. - 2008. - V. 4: e100005010.1371 / journal.ppat.1000050.

7. Cheung A. Comparision of the major antigenic determinants of different serotypes of FMDV / A. Cheung, J. DeLamarter, S. Weiss // J. Virol. -1983. - V. 48. - P. 451-459.7. Cheung A. Comparision of the major antigenic determinants of different serotypes of FMDV / A. Cheung, J. DeLamarter, S. Weiss // J. Virol. -1983. - V. 48. - P. 451-459.

8. Marquardt O. Sequences of capsid protein VP1 of two type A FMDV / O. Marquardt, K.-H. Adam // Virus genes. - 1988. - V. 2. - P. 283-291.8. Marquardt O. Sequences of capsid protein VP 1 of two type A FMDV / O. Marquardt, K.-H. Adam // Virus genes. - 1988. - V. 2. - P. 283-291.

9. Jamal S.M. Evolutionary analysis of serotype A foot-and-mouth disease viruses circulating in Pakistan and Afghanistan during 2002-2009 / S.M. Jamal, G. Ferrari, S. Ahmed // J. Gen. Virol. - 2011. - V. 92. - P.2 849-2864.9. Jamal S.M. Evolutionary analysis of serotype A foot-and-mouth disease viruses circulating in Pakistan and Afghanistan during 2002-2009 / S.M. Jamal, G. Ferrari, S. Ahmed // J. Gen. Virol. - 2011. - V. 92. - P.2 849-2864.

10. Ryan M.D. Cleavage of FMD polyprotein is mediated by residues located withig a 19 amino acid sequence / M.D. Ryan, A.M.Q. King, G.P. Thomas // J. Gen. Virol. - 1991. - V. 72. - P. 2727-2732.10. Ryan M.D. Cleavage of FMD polyprotein is mediated by residues located withig a 19 amino acid sequence / M.D. Ryan, A.M.Q. King, G.P. Thomas // J. Gen. Virol. - 1991. - V. 72. - P. 2727-2732.

11. Saunders K. Recombination and oligonucleotide analisis of guanidine-resistant FMDV mutants / K. Saunders, A.M.Q. King, D. McCahon // J. Virol. - 1985. - V. 56. - P. 921-929.11. Saunders K. Recombination and oligonucleotide analisis of guanidine-resistant FMDV mutants / K. Saunders, A.M.Q. King, D. McCahon // J. Virol. - 1985. - V. 56. - P. 921-929.

12. Falk M.M. FMDV protease 3C inducing specific proteolitic cleavage of host cell histon H3 / M.M. Falk, P.R. Crigera, J.E. Bergmann // J. Virol. - 1990. - V. 64, N. 2. - P. 748-756.12. Falk M.M. FMDV protease 3C inducing specific proteolitic cleavage of host cell histon H3 / M.M. Falk, P.R. Crigera, J.E. Bergmann // J. Virol. - 1990. - V. 64, N. 2. - P. 748-756.

13. Luz N. A cellular 57 kD protein binds to two region of the internal translation initiation site of FMDV / N. Luz, E. Beck // FEBS. - 1990. - V. 269, N. 2. - P. 311-314.13. Luz N. A cellular 57 kD protein binds to two region of the internal translation initiation site of FMDV / N. Luz, E. Beck // FEBS. - 1990. - V. 269, N. 2. - P. 311-314.

14. Belsham G.J. Translation and replication of FMDV RNA // Curr Top Microbiol Immunol. - 2005. - V.288. - P. 43-70.14. Belsham G.J. Translation and replication of FMDV RNA // Curr Top Microbiol Immunol. - 2005. - V.288. - P. 43-70.

15. National Library of Medicine. FMDV genome. [Электронный ресурс]. - Режим доступа: https://www.ncbi.nlm.nih.gov/search/all/?term=FMDV (Дата обращения: 13 декабря 2020 г.).15. National Library of Medicine. FMDV genome. [Electronic resource]. - Access mode: https://www.ncbi.nlm.nih.gov/search/all/?term=FMDV (Date accessed: December 13, 2020).

16. Alexandersen, S. The pathogenesis and diagnosis of foot and mouth disease / S. Alexandersen, Z. Zhang, A.L. Donaldson // J. Compr. Pathol. - 2003 - V. 129. - P. 268-282.16. Alexandersen, S. The pathogenesis and diagnosis of foot and mouth disease / S. Alexandersen, Z. Zhang, A.L. Donaldson // J. Comp. Pathol. - 2003 - V. 129. - P. 268-282.

17. Shaw A. Implementation of a one-step real-time RT-PCR protocol for diagnosis of foot-and-mouth disease / A. Shaw, S. M. Reid, K. Ebert [et al.] // J. Virol. Methods. - 2007. - Vol. 143, N 1. - P. 81-85.17. Shaw A. Implementation of a one-step real-time RT-PCR protocol for diagnosis of foot-and-mouth disease / A. Shaw, S. M. Reid, K. Ebert [et al.] // J. Virol. Methods. - 2007. - Vol. 143, No. 1. - P. 81-85.

18. Lubroth, J., Rodriguez, L. and Dekker, A. Vesicular diseases. In: Straw, B.E., Zimmerman, J.J., D'Allaire, S. and Taylor, D.J., editors. Diseases of Swine. // Blackwell Publishing Professional, Ames, Iowa, USA. - 2006. - 9th ed. - P. 517-536.18. Lubroth, J., Rodriguez, L. and Dekker, A. Vesicular diseases. In: Straw, BE, Zimmerman, JJ, D'Allaire, S. and Taylor, DJ, editors. Diseases of Swine. // Blackwell Publishing Professional, Ames, Iowa, USA. - 2006 .-- 9th ed. - P. 517-536.

19. Bahnemann H.G. Inactivation of viral antigens for vaccine preparation with particular reference to the application of binary ethylenimine // Vaccine. - 1990. - V. 8(4). - P. 299-303.19. Bahnemann H.G. Inactivation of viral antigens for vaccine preparation with particular reference to the application of binary ethylenimine // Vaccine. - 1990. - V. 8 (4). - P. 299-303.

20. Ethyleneimine [Электронный ресурс]. - Режим доступа: http://www.cdc.gov/niosh/npg/npgd0274.html (Дата обращения: 21 декабря 2020 г.).20. Ethyleneimine [Electronic resource]. - Access mode: http://www.cdc.gov/niosh/npg/npgd0274.html (Date of access: December 21, 2020).

21. Курашова С.С. Сравнительная характеристика инактивирующих агентов для создания вакцин против геморрагичексой лифхорадки с печечным синдромом / С.С. Курашова, А.А. Ишмухаметов, М.С. Егорова [и др.] // Эпидемиология и вакцинопрофилактика. - 2018. - №17(4). - С. 26-29.21. S. S. Kurashova. Comparative characteristics of inactivating agents for creating vaccines against hemorrhagic fever with hepatic syndrome / S.S. Kurashova, A.A. Ishmukhametov, M.S. Egorova [et al.] // Epidemiology and vaccine prevention. - 2018. - No. 17 (4). - S. 26-29.

22. Жильцова М.В. Биологические свойства эпизоотических изолятов вируса ящура типов А, О и Азия-1: Дис.… канд. ветер, наук: 16.00.03. - Владимир, 2008. - 146 с.22. Zhiltsova M.V. Biological properties of epizootic isolates of the FMD virus types A, O and Asia-1: Dis .... Cand. wind, sciences: 16.00.03. - Vladimir, 2008 .-- 146 p.

23. Reid S. Primary diagnosis of foot-and-mouth disease by reverse transcription polymerase chain reaction / S. Reid, N.P. Ferris, G.H. Hutchings // J. Virol. Methods. - 2000. - V. 89. - P. 167-176.23. Reid S. Primary diagnosis of foot-and-mouth disease by reverse transcription polymerase chain reaction / S. Reid, N.P. Ferris, G.H. Hutchings // J. Virol. Methods. - 2000. - V. 89. - P. 167-176.

24. Vangrysperre W., De Clerco K. Rapid and sensitive polymerase chain reaction based detection and typing of foot-and-mouth disease virus in clinical samples and cell culture isolates, combined with a simultaneous differentiation with other genomically and/or symptomatically related viruses / Vangrysperre W., De Clerco K. // Arch. Virol. - 1996. - V. 141. - P. 331-344.24. Vangrysperre W., De Clerco K. Rapid and sensitive polymerase chain reaction based detection and typing of foot-and-mouth disease virus in clinical samples and cell culture isolates, combined with a simultaneous differentiation with other genomically and / or symptomatically related viruses / Vangrysperre W., De Clerco K. // Arch. Virol. - 1996. - V. 141. - P. 331-344.

25. Callahan J.D. Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus / J.D. Callahan, F. Brown, F.A. Csorio // J. Am. Vet. Med. Assoc. - 2002. - V. 220. - P. 1636-1642.25. Callahan J.D. Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus / J.D. Callahan, F. Brown, F.A. Csorio // J. Am. Vet. Med. Assoc. - 2002. - V. 220. - P. 1636-1642.

26. Калмыкова М.С, Калмыков M.B., Белоусова P.B. Основы полимеразной цепной реакции с разными формами детекции: Учебное пособие. - СПб.: Издательство «Лань». - 2009. - 80 с.26. Kalmykova MS, Kalmykov M.B., Belousova P.B. Fundamentals of polymerase chain reaction with different forms of detection: a tutorial. - SPb .: Publishing house "Lan". - 2009 .-- 80 p.

27. Shaw A.E. Enhanced laboratory diagnosis of foot-and-mouth disease by real-time polymerase chain reaction / A.E. Shaw, S.M. Reid, D.P. King [et al.] // Rev. Sci. Techn. OIE. - 2004. - Vol. 23, №3. - P. 1003-1009.27. Shaw A.E. Enhanced laboratory diagnosis of foot-and-mouth disease by real-time polymerase chain reaction / A.E. Shaw, S.M. Reid, D.P. King [et al.] // Rev. Sci. Techn. OIE. - 2004. - Vol. 23, no. 3. - P. 1003-1009.

28. Федоров Д.Г. Усовершенствование технологии изготовления и контроля инактивированной вакцины против классической чумы свиней // Автореферат.… канд-та ветер, наук. - 1999. - Покров. - 24 с.28. Fedorov D.G. Improvement of manufacturing technology and control of inactivated vaccine against classical swine fever // Abstract. ... Candidate of Wind, Sciences. - 1999. - Cover. - 24 p.

29. The Analysis of DNA or RNA using Its Wavelengths: 230 nm, 260 nm, 280 nm. Bioteachnology.com [Электронный ресурс]. - Режим доступа: http://bioteachnology.com/dna/analysis-dna-rna-wavelengths-230-260-280-nm. (Дата обращения 01 ноября 2020 г.).29. The Analysis of DNA or RNA using Its Wavelengths: 230 nm, 260 nm, 280 nm. Bioteachnology.com [Electronic resource]. - Access mode: http://bioteachnology.com/dna/analysis-dna-rna-wavelengths-230-260-280-nm. (Date of treatment November 01, 2020).

30. WPA BioChrom. [Электронный ресурс]. - Режим доступа: https://www.biochemmack.ru/upload/uf/f4d/f4daefea6a77965d02ddbe780a813aad.pdf (Дата обращения 14 ноября 2020 г.).30. WPA BioChrom. [Electronic resource]. - Access mode: https://www.biochemmack.ru/upload/uf/f4d/f4daefea6a77965d02ddbe780a813aad.pdf (Date of treatment November 14, 2020).

31. ДНК-полимераза Taq Platinum High Fidelity [Электронный ресурс]. - Режим доступа: https://www.laboratorii.com/reaktivy/reaktivy-invitrogen/1241/ (Дата обращения 184 ноября 2020 г.).31. DNA polymerase Taq Platinum High Fidelity [Electronic resource]. - Access mode: https://www.laboratorii.com/reaktivy/reaktivy-invitrogen/1241/ (Retrieved 184 November 2020).

32. Burgers P. Eukaryotic DNA polymerases: proposal for a revised nomenclature (англ.) / P. Burgers, E. Koonin, E. Bruford [et al.] // J. Biol. Chem.: Journal. - 2001. - Vol. 276, no. 47. - P. 43487-43490.32. Burgers P. Eukaryotic DNA polymerases: proposal for a revised nomenclature (English) / P. Burgers, E. Koonin, E. Bruford [et al.] // J. Biol. Chem .: Journal. - 2001. - Vol. 276, no. 47. - P. 43487-43490.

33. Rebrikov D.V., Samatov G.A., Trofimov D. Yu. Real-time PCR. Ed. by D.V. Rebrikov. M.: BINOM. Laboratoriya znaniy. 2009. 223 p.(in Russian).33. Rebrikov D. V., Samatov G. A., Trofimov D. Yu. Real-time PCR. Ed. by D.V. Rebrikov. M .: BINOM. Laboratoriya znaniy. 2009.223 p. (In Russian).

34. Bogdanova E.A. Normalization of full-length enriched cDNA / E.A. Bogdanova, D.A. Shagin, S.A. Lukyanov // Mol. Biosyst. - 2008. - V. 4(3). - P. 205-212.34. Bogdanova E.A. Normalization of full-length enriched cDNA / E.A. Bogdanova, D.A. Shagin, S.A. Lukyanov // Mol. Biosyst. - 2008. - V. 4 (3). - P. 205-212.

35. Shcheglov A., Zhulidov P., Bogdanova E. Generation of normalized cDNA libraries. In: Nucleic Acids Hybridization: Modern Applications. Buzdin, Anton; Lukyanov, Sergey (Eds.) Hardcover. - 2007. - P. 97-124.35. Shcheglov A., Zhulidov P., Bogdanova E. Generation of normalized cDNA libraries. In: Nucleic Acids Hybridization: Modern Applications. Buzdin, Anton; Lukyanov, Sergey (Eds.) Hardcover. - 2007. - P. 97-124.

36. Lukyanov S., Lukyanov K., Gurskaya N. Selective suppression of polymerase chain reaction and its most popular applications. In: Nucleic Acids Hybridization: Modern Applications. Buzdin, Anton; Lukyanov, Sergey (Eds.) Hardcover. - 2007. - P. 29-51.36. Lukyanov S., Lukyanov K., Gurskaya N. Selective suppression of polymerase chain reaction and its most popular applications. In: Nucleic Acids Hybridization: Modern Applications. Buzdin, Anton; Lukyanov, Sergey (Eds.) Hardcover. - 2007. - P. 29-51.

37. Zhulidov P.A. A method for the preparation of normalized cDNA libraries enriched with full-length sequences / P.A. Zhulidov, E.A. Bogdanova, A.S. Shcheglov // Bioorg Khim. - 2005. - V. 31(2). - P. 186-194.37. Zhulidov P.A. A method for the preparation of normalized cDNA libraries enriched with full-length sequences / P.A. Zhulidov, E.A. Bogdanova, A.S. Shcheglov // Bioorg Khim. - 2005. - V. 31 (2). - P. 186-194.

38. Bogdanova E.A. A family of genes of multidomain free lectins from a planarian: structure, expression, and use as markers for regeneration monitoring / E.A. Bogdanova, E.V. Barsova, N.I. Pounkova // Bioorg. Khim. - 2004. - V. 30(6). - P. 626-637.38. Bogdanova E.A. A family of genes of multidomain free lectins from a planarian: structure, expression, and use as markers for regeneration monitoring / E.A. Bogdanova, E.V. Barsova, N.I. Pounkova // Bioorg. Khim. - 2004. - V. 30 (6). - P. 626-637.

39. Wiame I. Irreversible heat inactivation of DNase I without RNA degradation // BioTechniques. - 2000. - V. 29. - P. 252-256.39. Wiame I. Irreversible heat inactivation of DNase I without RNA degradation // BioTechniques. - 2000. - V. 29. - P. 252-256.

40. Ревертаза Maxima H Minus (Thermo Scientific) [Электронный ресурс]. - Режим доступа: https://www.thermofisher.com/document-connect/document-connect.html?url=https%3A%2F%2Fassets.thermofisher. com%2FTFS-Assets%2FLSG%2Fmanuals%2FMAN0012047_TS_Maxima_H_Minus_Reverse_Transcriptase_2000U_UG.pdf&title=VXNlciBHdWlkZTogVF MgTWF4aWlhIEggTWludXMgUmV2ZXJzZSBUcmFuc2NyaXB0YXNlLCAyMDAwIFU=(Дата обращения: 06 октября 2020 г.).40. Revertase Maxima H Minus (Thermo Scientific) [Electronic resource]. - Access mode: https://www.thermofisher.com/document-connect/document-connect.html?url=https%3A%2F%2Fassets.thermofisher. com% 2FTFS-Assets% 2FLSG% 2Fmanuals% 2FMAN0012047_TS_Maxima_H_Minus_Reverse_Transcriptase_2000U_UG.pdf & title = VXNlciBHdWlkZTogVF MgTWF4aWlhIEggTWVlud2XFLCMgUmz

41. Сиделев, С.И. Математические методы в биологии и экологии: введение в элементарную биометрию: учебное пособие / С.И. Сиделев; Яросл. гос. ун-т им. П.Г. Демидова. - Ярославль: ЯрГУ, 2012. - 140 с.41. Sidelev, S.I. Mathematical methods in biology and ecology: an introduction to elementary biometrics: a tutorial / S.I. Sidelev; Yarros. state un-t them. P.G. Demidov. - Yaroslavl: YarsU, 2012 .-- 140 p.

Figure 00000001
Figure 00000001

Figure 00000002
Figure 00000002

Figure 00000003
Figure 00000003

Figure 00000004
Figure 00000004

Figure 00000005
Figure 00000005

Figure 00000006
Figure 00000006

Figure 00000007
Figure 00000007

Figure 00000008
Figure 00000008

Figure 00000009
Figure 00000009

Claims (15)

1. Способ опосредованного определения полноты инактивации антигена вируса ящура в сырье для вакцины с применением обратно-транскриптазной полимеразной цепной реакции в режиме реального времени при амплификации большеразмерного фрагмента, отличающийся тем, что с его помощью возможно выявлять неповрежденный участок генома вируса ящура размером 7279 п.н., наличие экспоненты с пороговым циклом амплификации Ct<40,0 ед. в диапазоне от 5'-NTR до 3D-гена включительно с помощью оригинальных специфических олигонуклеотидов 5'-NTR-F-fov2-праймера, 3D-R1-rev-праймера и 3DP-rev-зонда со следующими последовательностями:1. A method for indirectly determining the completeness of FMD virus antigen inactivation in raw materials for a vaccine using reverse transcriptase polymerase chain reaction in real time during amplification of a large-sized fragment, characterized in that it can detect an intact 7279 bp section of the FMD virus genome. ., the presence of an exponent with a threshold amplification cycle Ct <40.0 units. in the range from 5'-NTR to 3D-gene, inclusive, using the original specific oligonucleotides 5'-NTR-F-fov2 primer, 3D-R1-rev primer and 3DP-rev-probe with the following sequences: 5'-ТТТСС AGGTCTAGAGGGGTGA-3',5'-TTTSS AGGTCTAGAGGGGTGA-3 ', 5'-GCGAGTCCTGCC ACGGA-3',5'-GCGAGTCCTGCC ACGGA-3 ', ROX-GTCCCACGGCGTGCAAAGGA-BHQ2, соответственно,ROX-GTCCCACGGCGTGCAAAGGA-BHQ2, respectively, и, тем самым, определять наличие вирулентного вируса ящура, либо выявлять отсутствие ампликона или отсутствие экспоненты - отсутствие вирулентного вируса ящура в сырье при изготовлении противоящурных инактивированных вакцин.and, thereby, to determine the presence of a virulent FMD virus, or to reveal the absence of an amplicon or the absence of an exponent - the absence of a virulent FMD virus in the raw material in the manufacture of inactivated FMD vaccines. 2. Способ по п. 1, отличающийся тем, что основан на проведении экстрагирования молекул РНК возбудителя ящура до и после процесса инактивации с помощью 5 М гуанидинизотиоцианата (ГТЦ), 0,5% раствора меркаптоэтанола и 80% раствора изопропанола.2. The method according to claim 1, characterized in that it is based on the extraction of RNA molecules of the foot and mouth disease causative agent before and after the inactivation process using 5 M guanidine isothiocyanate (GTZ), 0.5% mercaptoethanol solution and 80% isopropanol solution. 3. Способ по п. 1, отличающийся тем, что степень чистоты элюата вирусной РНК определяют методом спектрального сканирования, а концентрацию РНК, пользуясь разработанной формулой СРНК = 40,5 × OD260 - 0,7037.3. The method according to claim 1, characterized in that the purity of the viral RNA eluate is determined by spectral scanning, and the RNA concentration using the developed formula C RNA = 40.5 × OD 260 - 0.7037. 4. Способ по п. 1, отличающийся тем, что смесь компонентов для проведения реакции включает в свой состав следующие компоненты: олигонуклеотидный прямой праймер 5'NTR-F-fov2, обратный праймер 3D-R1-rev и олигонуклеотидный 3DP-rev-зонд - 10 пМ, дезоксирибонуклеозидтрифосфаты - 2,00 мМ, Thermo Scientific™ 10Х DreamTaq™ Buffer - 10% от общего объема реакционной смеси, хлорид магния - 3,0 мМ, ревертаза Maxima Н Minus - 10 е.а., ДНК-полимераза Platinum High Fidelity - 10 е.а.4. The method according to claim 1, characterized in that the mixture of components for carrying out the reaction includes the following components: oligonucleotide forward primer 5'NTR-F-fov2, reverse primer 3D-R1-rev and oligonucleotide 3DP-rev-probe - 10 pM, deoxyribonucleoside triphosphates - 2.00 mM, Thermo Scientific ™ 10X DreamTaq ™ Buffer - 10% of the total volume of the reaction mixture, magnesium chloride - 3.0 mM, Maxima H Minus reverse transcriptase - 10 u.a., Platinum High DNA polymerase Fidelity - 10 e.a. 5. Способ по п. 1, отличающийся тем, что применяются высокоточные ферменты: ревертаза Maxima Н Minus, которая обладает РНК- и ДНК-зависимой полимеразной активностью с отсутствием активности РНКазы Н и характеризуется высокой степенью эффективности; ДНК-полимераза Platinum High Fidelity, позволяющая амплифицировать фрагмент генома вируса ящура размером 7279 п.н. с надежным усилением процесса.5. The method according to claim 1, characterized in that high-precision enzymes are used: Maxima H Minus reverse transcriptase, which has RNA- and DNA-dependent polymerase activity with no RNase H activity and is characterized by a high degree of efficiency; Platinum High Fidelity DNA polymerase, which allows amplification of a 7279 bp fragment of the FMD virus genome. with reliable process amplification. 6. Способ по п. 1, отличающийся тем, что реакцию проводят с соблюдением следующих режимов и количеством циклов амплификации - 45:6. The method according to claim 1, characterized in that the reaction is carried out in compliance with the following modes and the number of amplification cycles - 45: - обратная транскрипция: температура 50°С в течение 30 мин;- reverse transcription: temperature 50 ° С for 30 min; - активация ДНК-полимеразы Platinum High Fidelity, температура 95°С в течение 1 мин;- activation of Platinum High Fidelity DNA polymerase, temperature 95 ° С for 1 min; - ОТ-ПЦР-РВ: денатурация: температура 95°С в течение 30 с, отжиг олигонуклеотидов: температура 57°С в течение 30 с, элонгация: температура 63°С в течение 8 мин.- RT-PCR-RT: denaturation: temperature 95 ° C for 30 s, annealing of oligonucleotides: temperature 57 ° C for 30 s, elongation: temperature 63 ° C for 8 min. 7. Способ по п. 1, отличающийся тем, что является экономичным, позволяет одновременно исследовать несколько десятков проб инактивированного вируссодержащего материала для вакцин, а время проведения анализа сократить до 9-10 часов.7. The method according to claim. 1, characterized in that it is economical, allows you to simultaneously examine several tens of samples of inactivated vaccinated material for vaccines, and reduce the analysis time to 9-10 hours. 8. Способ по п. 1, отличающийся тем, что его диагностическая чувствительность составляет 99,44%, диагностическая специфичность - 100%, общая точность - 99,72%.8. The method according to claim 1, characterized in that its diagnostic sensitivity is 99.44%, the diagnostic specificity is 100%, and the overall accuracy is 99.72%.
RU2021109435A 2021-04-05 2021-04-05 Method for indirect determination of the completeness of fmd virus antigen inactivation in vaccine raw materials using reverse transcriptase polymerase chain reaction in real time with amplification of large-sized fragment RU2753969C1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
RU2021109435A RU2753969C1 (en) 2021-04-05 2021-04-05 Method for indirect determination of the completeness of fmd virus antigen inactivation in vaccine raw materials using reverse transcriptase polymerase chain reaction in real time with amplification of large-sized fragment

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
RU2021109435A RU2753969C1 (en) 2021-04-05 2021-04-05 Method for indirect determination of the completeness of fmd virus antigen inactivation in vaccine raw materials using reverse transcriptase polymerase chain reaction in real time with amplification of large-sized fragment

Publications (1)

Publication Number Publication Date
RU2753969C1 true RU2753969C1 (en) 2021-08-24

Family

ID=77460399

Family Applications (1)

Application Number Title Priority Date Filing Date
RU2021109435A RU2753969C1 (en) 2021-04-05 2021-04-05 Method for indirect determination of the completeness of fmd virus antigen inactivation in vaccine raw materials using reverse transcriptase polymerase chain reaction in real time with amplification of large-sized fragment

Country Status (1)

Country Link
RU (1) RU2753969C1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2773654C1 (en) * 2021-09-27 2022-06-07 Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") Method for indirect control of completeness of fmd virus antigen inactivation using nested reverse transcriptase polymerase chain reaction followed by electrophoresis of amplicons in agarose gel

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2089893C1 (en) * 1995-06-27 1997-09-10 Всероссийский научно-исследовательский институт ветеринарной вирусологии и микробиологии Method of technological control over completeness inactivation of the killed vaccines using as copper sulfate as inactivating agent
CN102230029A (en) * 2011-06-17 2011-11-02 河南省动物疫病预防控制中心 Ternary RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent and method of type O, type A and type Asial foot and mouth disease viruses
RU2492452C1 (en) * 2012-02-29 2013-09-10 Государственное научное учреждение Всероссийский научно-исследовательский институт ветеринарной вирусологии и микробиологии Российской академии сельскохозяйственных наук Method of control of completeness of inactivation of antirabic inactivated vaccine

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2089893C1 (en) * 1995-06-27 1997-09-10 Всероссийский научно-исследовательский институт ветеринарной вирусологии и микробиологии Method of technological control over completeness inactivation of the killed vaccines using as copper sulfate as inactivating agent
CN102230029A (en) * 2011-06-17 2011-11-02 河南省动物疫病预防控制中心 Ternary RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent and method of type O, type A and type Asial foot and mouth disease viruses
RU2492452C1 (en) * 2012-02-29 2013-09-10 Государственное научное учреждение Всероссийский научно-исследовательский институт ветеринарной вирусологии и микробиологии Российской академии сельскохозяйственных наук Method of control of completeness of inactivation of antirabic inactivated vaccine

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
КУДАШЕВА Э.Ю., СОВРЕМЕННЫЕ ТЕХНОЛОГИЧЕСКИЕ ПОДХОДЫ К ОБЕСПЕЧЕНИЮ ВИРУСНОЙ БЕЗОПАСНОСТИ ПРЕПАРАТОВ ИММУНОГЛОБУЛИНОВ ЧЕЛОВЕКА, Успехи современного естествознания, 2015, N 5, С. 132-138. *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2773654C1 (en) * 2021-09-27 2022-06-07 Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") Method for indirect control of completeness of fmd virus antigen inactivation using nested reverse transcriptase polymerase chain reaction followed by electrophoresis of amplicons in agarose gel

Similar Documents

Publication Publication Date Title
Guo et al. Detection and molecular characterization of cultivable caliciviruses from clinically normal mink and enteric caliciviruses associated with diarrhea in mink
Sanchez et al. Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates
Bonami et al. Viral diseases of the giant fresh water prawn Macrobrachium rosenbergii: a review
Blake et al. Detection and identification of aquatic birnaviruses by PCR assay
Monaco et al. Differentiation between field and vaccine strain of bluetongue virus serotype 16
Elschner et al. Nested reverse transcriptase‐polymerase chain reaction for the detection of group A rotaviruses
Sykes et al. Detection and strain differentiation of feline calicivirus in conjunctival swabs by RT-PCR of the hypervariable region of the capsid protein gene
JPH09511914A (en) Nucleotide sequences of pestivirus strains, polypeptides encoded by those sequences, and their use for the diagnosis and prevention of pestivirus infections
ES2969020T3 (en) Compositions and procedures for the detection of Zika virus
Zhang et al. Development of a novel reverse transcription droplet digital PCR assay for the sensitive detection of Senecavirus A
CN105886663A (en) Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses
El-Matbouli et al. Detection of Cyprinid herpesvirus-3 (CyHV-3) DNA in infected fish tissues by nested polymerase chain reaction
RU2753969C1 (en) Method for indirect determination of the completeness of fmd virus antigen inactivation in vaccine raw materials using reverse transcriptase polymerase chain reaction in real time with amplification of large-sized fragment
Yeo et al. Molecular identification of coxsackievirus A24 variant, isolated from an outbreak of acute hemorrhagic conjunctivitis in Singapore in 2005
CN101178350B (en) Detect the kit of rabies viruses
Lin et al. Detection of swine vesicular disease virus RNA by reverse transcription-polymerase chain reaction
Qi et al. Genetic characteristics and pathogenicity of the first bluetongue virus serotype 20 strain isolated in China
CN115094164A (en) Multiple qPCR (quantitative polymerase chain reaction) kit and detection method for ASFV (advanced specific immunodeficiency syndrome) with different gene deletion types
KR102201869B1 (en) Oligonucleotide and plasmid for simultaneous detection of four types of dengue virus, and the analysis method of dengue virus serotype using them
RU2809224C1 (en) Method of indirect determining of titer of infectious activity of canine alpha-coronavirus production strain named rich in raw materials for vaccine using real-time rt-pcr
US8048630B2 (en) Methods and agents for detecting Parechovirus
RU2773654C1 (en) Method for indirect control of completeness of fmd virus antigen inactivation using nested reverse transcriptase polymerase chain reaction followed by electrophoresis of amplicons in agarose gel
RU2725862C1 (en) Method for quantitative assessment of virions of foot-and-mouth disease virus in non-inactivated raw vaccine when comparing maximum extrema of graphs of second derivative for amplification reaction curves in real time
Wang et al. RT‐PCR amplification and sequence analysis of extra small virus associated with white tail disease of Macrobrachium rosenbergii (de Man) cultured in Taiwan
KR20170036980A (en) Method and kit for detecting Rotavirus and Astrovirus using real-time PCR