RU2750818C1 - Viral strain for obtaining attenuated live culture vaccine for prevention and treatment of herpes zoster for adult population - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of medical biotechnology. The invention is a cold-adapted strain "vZelVax" of herpes zoster virus, deposited in the State collection of viruses of the FSBI Research Institute of Virology named after Ivanovsky D.I. of the Ministry of Health and Social Development of Russia under the number 2936 of 03.03.2020, intended for obtaining a live cultural vaccine for the prevention and treatment of herpes zoster in the adult population.

EFFECT: creation of vaccines against herpes zoster.

1 cl, 1 dwg, 5 tbl, 5 ex

Description

The field of technology.

The invention relates to the field of medical biotechnology and can be used to obtain a monovaccine against herpes zoster (herpes zoster - HZ).

State of the art.

The Varicella zoster virus (VZV) belongs to the herpesvirus family and causes an illness with two distinct symptoms (chickenpox and shingles or herpes zoster). After a primary chickenpox infection, the virus is localized in the sensitive nerve ganglia. Under certain circumstances, it recurs and goes into a latent state. Herpes zoster is manifested by such symptoms as rashes on the body of various localization, the development of ganglioneuritis with damage to the posterior roots of the intervertebral ganglia.

Typically, viral diseases can be prevented by administering vaccines derived from inactivated or live attenuated pathogenic viruses.

A viral strain VZV is known from the prior art (the name of the strain is not specified), produced in the cells of the Chinese hamster, the antigenic components of this virus strain are included in the recombinant subunit vaccine against herpes zoster - the Shingrix vaccine for the prevention of HZ and postherpetic neuralgia (PHN) for adults at age over 50 years old. The Shingrix vaccine consists of a glycoprotein E derived from the VZV virus and an adjuvant system (AS018) consisting of Quillaja saponaria Molina, fraction 21 (QS - 21) and 3-0-deacyl-4-monophosphoryl lipid A (MPL) from Salmonella Minnesota. Antigen gE (glycoprotein E) - the lyophilized powder must be reconstituted with an adjuvant (liposomal composition) immediately before use; upon reconstitution, each 0.5 ml dose contains 50 μg of each of gE, QS - 21, and MPL.

The subunit vaccine elicits a strong immune response while being safe for people for whom live attenuated vaccines are contraindicated (Yahiya Y. Syed // Recombinant zoster vaccine (Shingrix): A review in Herpes zoster. Drugs et aging, https://doi.org/10.1007 / s40266-018-0603-x).

The authors draw attention to the side effects of this vaccine in the form of a reaction at the injection site, myalgia, fatigue. This is an inactivated vaccine and, as a rule, inactivated vaccines are less immunogenic than live attenuated vaccines.

Considering that the varicella-zoster virus viral glycoprotein E is the main inducer of specific immunity in this vaccine, and it is expressed from tumor cells of the Chinese hamster, therefore, the safety of this vaccine for the respondents cannot be completely ruled out.

Also known strain MAV / 06, obtained by isolating the Varicella virus from the vesicles of a patient aged 33 months from Korea, infected with chickenpox in 1989, and the primary cultivation of the isolated VZV was carried out in human embryonic lung cells (Hwang, KK, Park, SY, Kim , SJ, Ryu, YW, & Kim, KH, Restriction Fragment Length Polymorphism Analysis of Varicella-Zoster Virus isolated in Korea. J. Kor. Soc. Virol. 21, 201-210, 1991).

Protein molecules of this strain are included in the vaccine composition against chickenpox and shingles as an active component (patent RU 2580003 C2, publ. 10.04.2016).

The main disadvantage of this vaccine, in our opinion, is that the varicella virus strain MAV / 06 was cultured 55 times in human embryonic lung and guinea pig cells at 34-36 ° C. In this regard, this vaccine strain is hyperattenuated and cannot be a candidate for a live cultural vaccine against chickenpox and herpes zoster. As a rule, hyperattenuated viral strains are characterized by weak immunogenicity.

Closest to the claimed is the Japanese attenuated strain vOka / Megk (USA). This virus was isolated in 1974 in Japan from a 6-year-old healthy boy named Oka who fell ill with chickenpox (Takahashi M. Clinical overview of varicella vaccine: development and early studies. Pediatrics 1986; 78: 736-741). The sequence of the vaccine strain vOka showed that it represents a mixture of genomes and has nucleotide polymorphism at 31 sites (Gomi., Sunamachi N., Mori Y., et al. Comparison of the complete DNA sequences of the OKA varicella vaccine and its parental virus. J . Virol 2002; 76: 11447-11459). A sequence comparison of the vOka vaccine strain with its wild parent pOka strain revealed 42 nucleotide differences, which suggest 20 amino acid substitutions. Based on this strain, a vaccine for herpes zoster called Zostavax is also made by increasing the child's dose by 14 times.

The Zostavax vaccine is given subcutaneously or intramuscularly and one 0.65 ml vaccine dose contains 19,400 plaque-forming units (PFU) of the vOka / Merk strain of the Varicella-zoster virus (VZV). Zostavax is listed on vaccination schedules in several European countries, including the UK, France and Austria.

Zostavax was approved by the WHO following completion of the HZ prevention study in a double-blind, placebo-controlled study in 38,546 people over the age of 60. The study results showed that Zostavax reduced the incidence of HZ disease by 51% and PHN and associated pain by 66.5% in subjects aged 60 years. The efficacy of this HZ vaccine declines with age and is 18% for those over 80 years of age.

Adverse reactions of Zostavax vaccine include mainly pain and inflammation at the injection site (Gillian M. Keating // Shingles (Herpes Zoster) vaccine (Zostavax): A review in the prevention of herpes zoster and postherpetic neuralgia. BioDrugs (2016) 30: 243-254 / DOi 10.1007 / s40259-016-0180-7).

The main disadvantage of this protorototype is the revealed neurotropic nature of the viral strain from which this vaccine is produced (Nagieva F.G., Barkova E.P., Stroeva A.D., Sidorov A.V., Lotte V.D., Zverea V.V. Characteristics of the binding of vaccine strains of the Varicella zoster virus with preparations of membrane receptors in the brain of mice. ZhMEI, 2020; 97 (2), pp. 125-133).

The objective of the present invention is to create a domestic vaccine strain isolated directly from a patient with recurrent herpes zoster. There is no analogue of such a viral strain, both in Russia and abroad.

It is preferable for the Russian Federation to have vaccine strains isolated on its territory.

To solve this problem, we offer a cold-adapted strain "vZelVax" of the herpes zoster virus, deposited in the State collection of viruses at the V.I. DI. Ivanovsky of the Ministry of Health and Social Development of Russia under number 2936, intended for obtaining a live cultural vaccine for the prevention and treatment of herpes zoster in the adult population.

Clinical isolate HZ was isolated in Moscow in 2013 from the vesicle crust of a 63-year-old patient during the period of HZ reactivation. In 2016, the clinical isolate lpZel (latent parent) was named vZelVax after the stages of attenuation at low temperatures were completed. Strain "vZelVax" HZ (Master seed) passed at low temperatures of cultivation (300 ° C) 12 passages in the culture of diploid cells LEC - 3, 6 passages in the primary cell culture of guinea pig embryos (FEMS) and 2 more passages in the cell culture of diploid cells LECH - 3.

The strain was deposited in the State Collection of Viruses of the Institute of Virology named after DI. Ivanovsky Federal State Budgetary Institution “NITsEM named after N.F. Gamalea "of the Ministry of Health of Russia under the number 2936 03.03.2020.

The technical result of the proposed invention is as follows:

The claimed attenuated strain for a live cultural vaccine has the following biological markers:

- the lack of reproduction in a sensitive cell culture at a temperature of 39 ° C (ts mutation) and a higher level of reproduction in a sensitive cell culture at a low temperature of 30 ° C (self-mutation);

- has a more pronounced immune response compared to the latent variant of the virus during immunization of guinea pigs;

- higher reproductive capacity compared to the latent variant of the virus in the culture of fibroblast cells of the embryo of guinea pigs (FEMS);

Brief description of drawings and other explanatory materials.

Table 1 - Determination of ts and ca markers of biological attenuation of the candidate for the vaccine strain "vZelVax" HZ on the cells of the musculocutaneous tissue of the human embryo (KM-27).

Table 2 - Determination of ts and ca markers of biological attenuation of the candidate for the vaccine strain "vZelVax" HZ on FEMS cells.

Fig. 1 - Immune response of SPF - BALB / c mice to the attenuated strain "vZelax" HZ. The abscissa axis indicates the sera study time from the moment of drug administration. The ordinate is the OD450. The values were evaluated on a Thermo Scientific Varioskan Flash photometer. Serum dilutions are indicated on the right colored squares.

Table 3 - Assessment of the immunogenicity of the attenuated strain "vZelVax" HZ.

Table 4 - Comparative evaluation of the results of indirect immunofluorescence of the domestic vaccine strain "vZelVax" HZ with the sera of guinea pigs immunized with various VZV strains.

Table 5 - Comparative evaluation of the binding of VZV strains with MPM SPF preparations of BALB / c mice

Disclosure of the essence of the invention.

The vZelVax strain is characterized by the following features.

Morphological features - VZV virions are spherical, from 150 - 200 nm in diameter and consist of an internal icosadeltahedral capsid of 162 capsomeres surrounded by a tegument and an envelope consisting of two or more membranes containing lipids.

Cultural traits - during the reproduction of a viral strain in a permissive cell culture such as KM 27, Me Wo (human melanoma), Vero, the virus causes degenerative changes in the form of cell cytolysis.

The infectious activity of the viral strain in cell culture is 7.5-8.0 lg GADE50 / 0.1 ml.

Antigenic properties - the virus induces the production of specific antibodies in the body of SPF mice of the BALB / c line and in the body of guinea pigs with subcutaneous, intramuscular and intraperitoneal injections. Virus-specific antibodies are detected in an enzyme-linked immunosorbent assay (ELISA), in an immunofluorescence assay (IF), in a neutralization reaction (PH) and a hemagglutination inhibition reaction (RTGA).

Virulent properties (att phenotype) - the attenuated viral strain is avirulent, causing whitepoxes on the chorion-allantoic membrane of developing chick embryos, in contrast to its parental variant, which, when injected on the chorion-allantoic membrane of developing chick embryos, causes the death of chick embryos or extensive hemorrhages.

Molecular genetic peculiarity of the strain -

Partial sequencing of the conserved region of the Orf 0-1 gene:

(133) AACCCGCGCCTTTTGCGTCCACCCCTCGTTTACTGCTCGGATGGCG

ACCGTGCACTACTCCCGCCGACCTGGGACCCCGCCGGTCACCCTCACGT

CGTCCCCCAGCATGGATGACGTTGCGACCCCCATCCCCTACCTACCCAC

ATACGCCGAGGCCGTGGCAGACGCGCCCCCCCCTTACAGAAGCCGCGA

GAGTCTGGTGTTCTCCCCGCCTCTTTTTCCTCACGTGGAGAATGGCACC

ACCCAACAGTCTTACGATTGCCTAGACTGCGCTTATGATGGAATCCACA

GACTTCAGCTGGCTTTTCTAAGAATTCGCAAATGCTGTGTACCGGCTTT

TTTAATTCTTTTTGGTATTCTCACCCTTACTGCTGTCGTGGTCGCCATTG

TTGCCGTTTTTCCCGAGGAACCTCCCAACTCAACTACA (559)

Comparative genetic analysis showed that by nucleotide sequence it belongs to the European variant Varicella zoster.

Storage conditions - stored at a temperature not lower than 70 ° C.

Stability of the main properties of the viral strain - persist for 5 years (observation period).

Implementation of the invention.

The biological properties of the strain are illustrated by the following examples.

Example 1. Comparative characteristics of ts and ca markers of biological attenuation of the candidate for the vaccine strain "vZelVax" HZ, established on cell cultures KM 27 (musculocutaneous tissue of a human embryo) and FEMS (fibroblasts of guinea pig embryos) at different temperature conditions.

The results presented in Tables 1 and 2 showed that the candidate for the vaccine strain "vZelVax", both the extracellular virus and the intracellular virus, did not reproduce at a high temperature of 39 °, in contrast to the latent variant of the virus, that is, the strain "vZelVax »Possessed temperature sensitivity - ts phenotype. At the same time, the attenuated strain reproduced more actively at a suboptimal temperature at 30 ° C compared to the latent variant, that is, it had cold adaptability - the ca-phenotype.

The result presented in Table 2 also showed that the attenuated strain "vZelVax" had a higher reproductive activity in the cells of guinea pig embryos in comparison with the latent variant - this is another biological marker of attenuated strains for live viral vaccines, which we called the cell - phenotype.

Example 2. Comparative assessment of virulence (att - phenotype) of the candidate for the vaccine strain "vZelVax" HZ, established by infection of the chorion-allantoic membrane (CHAO) of 12-day-old developing chicken embryos.

The attenuated vaccine strain "vZelVax" was found to be avirulent in contrast to its parental variant lpZel. Chorion-allantoic membranes of developing chick embryos, infected with the parental variant of the virus, caused the death of embryos, and those infected with the attenuated vaccine strain "vZelVaz" caused white pock marks on the chorion-allantoic membranes.

Example 3. Evaluation of the antigenicity of the candidate vaccine strain "vZelVax" HZ, established by subcutaneous immunization with SPF of BALB / c mice. one vaccination dose for a person.

In fig. 1 shows the results of a study of the sera of SPF mice of the BALB / c line, immunized subcutaneously with a virus-containing liquid (VVF) of the attenuated strain "vZelVax" HZ. BALB / c mice were injected subcutaneously with 0.5 ml of VSF HZ; sera from the mice were collected from the tail vein at different time intervals, starting from 2 weeks and for 8 months (observation period). Immune sera were studied in ELISA in a solid-phase version of the immune analysis, where the lysate of KM-27 cells infected with the laboratory strain "Ellen" VZV was sorbed on the solid phase. The immune complex was detected with an anti-mouse peroxidase conjugate in working dilution (Sigma).

Shown in Fig. 1, the results of the study showed that the attenuated viral strain "vZelVax" HZ had optimal antigenicity for 8 months of the observation period in the body of immunized mice.

Example 4. Characterization of the immunogenicity of the candidate for the vaccine strain "VZelVax"

To assess the immunogenicity of the attenuated strain "vZelVax" HZ, guinea pigs were immunized subcutaneously with a single inoculation dose. Guinea pigs were injected subcutaneously into the withers, 0.5 ml (one inoculation dose) of the VSF of the attenuated vZelVax HZ strain at the 20 passage level. Immune sera were collected 2, 3 and 5 months after immunization (blood sampling was performed by cardiac puncture).

Table 3 shows the results of a study in the reaction of inhibition of hemagglutination (RTGA) and in the reaction of neutralization (RN).

According to the results of the study, it was clearly established that the attenuated strain "vZelVax" HZ in the body of guinea pigs induces a high level of antihemagglutins (RTGA results) and neutralisins (PH results). It should be noted that neutralisins are stably maintained at a high level for 5 months (observation period), in contrast to hemolysins.

Table 4 shows the results of an indirect reaction of immunofluorescence of immune sera of guinea pigs obtained on days 37 and 80 from the moment of immunization. Antigens were prepared on diploid cells of guinea pigs infected with vaccine viral strains "vZelVax" and "vOka" from different manufacturers.

The results presented in table 4 showed that all 3 immune sera to the vaccine strain "vZelVax" and to the vaccine strain "vOka" from different manufacturers detected viral antigen prepared from the domestic strain "vZelVax". It should be noted that the immune sera obtained at a later date revealed a greater number of infectious foci.

Example 5. Comparative characteristics of the neurotropicity of various strains of the Varicella zoster virus.

The study of the neurotropicity of attenuated viral strains "vZelVax" was evaluated by the method described in the patent "Method for attenuating viruses" (Authors: Barrett A., Ryman K., NI Haolin (USA). The method consisted of mixing the virus with the membrane receptors of the brain, centrifuging the mixture and determining residual viral infectivity Membrane receptors were obtained from the brains of 4-week-old SPF BALB / c mice

It is known that a virus cannot infect a susceptible cell if its viral attachment protein does not bind on the cell surface to a molecule that serves as a receptor for the virus.

If the virus binds to the membrane receptors of the brain (MRM), then after the precipitation of the membrane receptors by centrifugation, the infectivity of the virus under study should decrease in the supernatant. The residual viral infectivity is used to judge the degree of neurotropicity of the investigated virus. Residual viral infectivity was determined by the limiting dilution method in FEMS cell cultures susceptible to the Varicella zoster virus. The results of infectivity were assessed on the 7th day from the moment of infection of the cell culture and were expressed in lg GADE50 / 0.1 ml. Table 5 shows the average values based on the results of 2 experiments.

Experiments on the binding of the cold-adapted vaccine viral strain vZelVax and its latent parental virus lpZel showed that both viruses lost their tropism to the neural tissue of the brain of BALb / c mice. The American variant of the viral strain "vOka / Megk" after treatment with neuroreceptors in the brain of mice, reduced infectivity by 1.0 lg GADE50 / 0D ml, that is, it turned out to be neurotropic.

Thus, our claimed domestic strain, isolated on the territory of Russia (Moscow) with cold adaptability properties, that is, possessing the main markers of biological attenuation (ts and ca phenotype, cell phenotype, att phenotype), having high antigenicity and immunogenicity, and that does not have a tropism for the SPF brain neuroreceptors of BALB / c mice and, by partial genetic sequencing of the main VZV gene, belonging to the European variant Varicella zoster, can be used to create vaccines against herpes zoster.

Claims (1)

The cold-adapted strain "vZelVax" of the herpes zoster virus deposited in the State collection of viruses at the V.I. DI. Ivanovsky of the Ministry of Health and Social Development of Russia under number 2936 of 03.03.2020, intended for obtaining a live cultural vaccine for the prevention and treatment of herpes zoster in the adult population.

Images