RU2750818C1 - Viral strain for obtaining attenuated live culture vaccine for prevention and treatment of herpes zoster for adult population - Google Patents
Viral strain for obtaining attenuated live culture vaccine for prevention and treatment of herpes zoster for adult population Download PDFInfo
- Publication number
- RU2750818C1 RU2750818C1 RU2020137980A RU2020137980A RU2750818C1 RU 2750818 C1 RU2750818 C1 RU 2750818C1 RU 2020137980 A RU2020137980 A RU 2020137980A RU 2020137980 A RU2020137980 A RU 2020137980A RU 2750818 C1 RU2750818 C1 RU 2750818C1
- Authority
- RU
- Russia
- Prior art keywords
- strain
- vaccine
- herpes zoster
- vzelvax
- virus
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/245—Herpetoviridae, e.g. herpes simplex virus
- A61K39/25—Varicella-zoster virus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
- C12N7/04—Inactivation or attenuation; Producing viral sub-units
Abstract
Description
Область техники.The field of technology.
Изобретение относится к области медицинской биотехнологии и может быть использовано при получении моновакцины против опоясывающего герпеса (герпес зостер - HZ).The invention relates to the field of medical biotechnology and can be used to obtain a monovaccine against herpes zoster (herpes zoster - HZ).
Уровень техники.State of the art.
Вирус Varicella zoster (VZV) относится к семейству герпесвирусов и является причиной болезни с двумя различными симптомами (ветряная оспа и опоясывающий лишай или опоясывающий герпес). После перенесенной первичной инфекции ветряной оспы вирус локализуется в чувствительных нервных ганглиях. При определенных обстоятельствах он рецидивирует и переходит в латентное состояние. Опоясывающий герпес проявляется такими симптомами, как высыпания на теле различной локализации, развитие ганглионеврита с поражением задних корешков межпозвоночных ганглиев.The Varicella zoster virus (VZV) belongs to the herpesvirus family and causes an illness with two distinct symptoms (chickenpox and shingles or herpes zoster). After a primary chickenpox infection, the virus is localized in the sensitive nerve ganglia. Under certain circumstances, it recurs and goes into a latent state. Herpes zoster is manifested by such symptoms as rashes on the body of various localization, the development of ganglioneuritis with damage to the posterior roots of the intervertebral ganglia.
Как правило, вирусные заболевания можно предотвратить путем введения в организм вакцин, полученных из инактивированных или живых ослабленных патогенных вирусов.Typically, viral diseases can be prevented by administering vaccines derived from inactivated or live attenuated pathogenic viruses.
Из уровня техники известен вирусный штамм VZV (название штамма не указано), продуцируемый в клетках китайского хомячка, антигенные компоненты этого штамма вируса входят в состав рекомбинантной субъединичной вакцины против опоясывающего герпеса - вакцина Shingrix для профилактики HZ и постгерпетической невралгии (PHN) для взрослых в возрасте старше 50 лет. Вакцина Shingrix состоит из гликопротеина Е, получаемого из вируса VZV, и адъювантной системы (AS018), состоящей из Quillaja saponaria Molina, фракции 21 (QS - 21) и 3-0-деацил -4 -монофосфориллипида A (MPL) от Salmonella Minnesota. Антиген gE (гликопротеин Е) - лиофилизированный порошок должен быть восстановлен с адъювантом (липосомальная композиция) непосредственно перед использованием; после восстановления каждая доза 0,5 мл содержит 50 мкг каждого из gE, QS - 21 и MPL.A viral strain VZV is known from the prior art (the name of the strain is not specified), produced in the cells of the Chinese hamster, the antigenic components of this virus strain are included in the recombinant subunit vaccine against herpes zoster - the Shingrix vaccine for the prevention of HZ and postherpetic neuralgia (PHN) for adults at age over 50 years old. The Shingrix vaccine consists of a glycoprotein E derived from the VZV virus and an adjuvant system (AS018) consisting of Quillaja saponaria Molina, fraction 21 (QS - 21) and 3-0-deacyl-4-monophosphoryl lipid A (MPL) from Salmonella Minnesota. Antigen gE (glycoprotein E) - the lyophilized powder must be reconstituted with an adjuvant (liposomal composition) immediately before use; upon reconstitution, each 0.5 ml dose contains 50 μg of each of gE, QS - 21, and MPL.
Субъединичная вакцина вызывает сильный иммунный ответ, будучи безопасной для людей, которым противопоказаны живые ослабленные вакцины (Yahiya Y. Syed // Recombinant zoster vaccine (Shingrix): A review in Herpes zoster. Drugs et aging, https: // doi.org/10.1007/s40266-018-0603-x).The subunit vaccine elicits a strong immune response while being safe for people for whom live attenuated vaccines are contraindicated (Yahiya Y. Syed // Recombinant zoster vaccine (Shingrix): A review in Herpes zoster. Drugs et aging, https://doi.org/10.1007 / s40266-018-0603-x).
Авторы обращают внимание на побочные эффекты указанной вакцины в виде реакции в месте инъекции, миалгии, усталости. Это вакцина инактивированная и, как правило, инактивированные вакцины обладают более слабой иммуногенностью в отличие от живых аттенуированных вакцин.The authors draw attention to the side effects of this vaccine in the form of a reaction at the injection site, myalgia, fatigue. This is an inactivated vaccine and, as a rule, inactivated vaccines are less immunogenic than live attenuated vaccines.
Учитывая, что вирусный гликопротеин Е вируса ветряной оспы является основным индуктором специфического иммунитета в этой вакцине, а он экспрессируется из опухолевых клеток китайского хомячка, в связи с этим нельзя полностью исключить безопасность этой вакцины для респондентов.Considering that the varicella-zoster virus viral glycoprotein E is the main inducer of specific immunity in this vaccine, and it is expressed from tumor cells of the Chinese hamster, therefore, the safety of this vaccine for the respondents cannot be completely ruled out.
Известен также штамм MAV/06, получен при выделении вируса Varicella из везикул пациента в возрасте 33 месяца из Кореи, зараженного ветряной оспой в 1989 году, и первичное культивирование выделенного VZV проведено в человеческих эмбриональных клетках легкого (Hwang, K.K., Park, S.Y., Kim, S.J., Ryu, Y.W., & Kim, K.H., Restriction Fragment Length Polymorphism Analysis of Varicella-Zoster Virus isolated in Korea. J. Kor. Soc. Virol. 21, 201-210, 1991).Also known strain MAV / 06, obtained by isolating the Varicella virus from the vesicles of a patient aged 33 months from Korea, infected with chickenpox in 1989, and the primary cultivation of the isolated VZV was carried out in human embryonic lung cells (Hwang, KK, Park, SY, Kim , SJ, Ryu, YW, & Kim, KH, Restriction Fragment Length Polymorphism Analysis of Varicella-Zoster Virus isolated in Korea. J. Kor. Soc. Virol. 21, 201-210, 1991).
Белковые молекулы данного штамма входят в вакцинную композицию против ветряной оспы и опоясывающего лишая в качестве активного компонента (патент RU 2580003 С2, опубл. 10.04.2016).Protein molecules of this strain are included in the vaccine composition against chickenpox and shingles as an active component (patent RU 2580003 C2, publ. 10.04.2016).
Основным недостатком этой вакцины, на наш взгляд, считается то, что вирусный штамм ветряной оспы MAV/06 культивировали 55 раз в человеческих эмбриональных клетках легкого и морской свинки при температуре 34-36°С. В связи с этим данный вакцинный штамм является гиператтенуированным и не может быть кандидатом для создания живой культуральной вакцины против ветряной оспы и опоясывающего герпеса. Как правило, гиператтенуированные вирусные штаммы характеризуются слабой иммуногенностью.The main disadvantage of this vaccine, in our opinion, is that the varicella virus strain MAV / 06 was cultured 55 times in human embryonic lung and guinea pig cells at 34-36 ° C. In this regard, this vaccine strain is hyperattenuated and cannot be a candidate for a live cultural vaccine against chickenpox and herpes zoster. As a rule, hyperattenuated viral strains are characterized by weak immunogenicity.
Наиболее близким к заявляемому является японский аттенуированный штамм vОка/ Мегк (США). Данный вирус изолирован в 1974 году в Японии от 6-летнего здорового мальчика по имени Ока, заболевшего ветряной оспой (Takahashi М. Clinical overview of varicella vaccine: development and early studies. Pediatrics 1986; 78: 736-741). Сиквенс вакцинного штамма vOka показал, что он представляет смесь геномов и имеет нуклеотидный полиморфизм на 31 сайте (Gomi., Sunamachi Н., Mori Y., et al. Comparison of the complete DNA sequences of the OKA varicella vaccine and its parental virus. J.Virol 2002; 76: 11447-11459). Сравнение последовательностей вакцинного штамма vOka с его диким родительским штаммом рОка выявил 42 нуклеотидных различия, которые предполагают 20 аминокислотных замен. На основе этого штамма изготавливается также вакцина для опоясывающего герпеса под названием Zostavax путем увеличения детской дозы в 14 раз.Closest to the claimed is the Japanese attenuated strain vOka / Megk (USA). This virus was isolated in 1974 in Japan from a 6-year-old healthy boy named Oka who fell ill with chickenpox (Takahashi M. Clinical overview of varicella vaccine: development and early studies. Pediatrics 1986; 78: 736-741). The sequence of the vaccine strain vOka showed that it represents a mixture of genomes and has nucleotide polymorphism at 31 sites (Gomi., Sunamachi N., Mori Y., et al. Comparison of the complete DNA sequences of the OKA varicella vaccine and its parental virus. J . Virol 2002; 76: 11447-11459). A sequence comparison of the vOka vaccine strain with its wild parent pOka strain revealed 42 nucleotide differences, which suggest 20 amino acid substitutions. Based on this strain, a vaccine for herpes zoster called Zostavax is also made by increasing the child's dose by 14 times.
Вакцина Zostavax вводится подкожно или внутримышечно, и одна прививочная доза в 0,65 мл содержит 19400 бляшкообразующих единиц (БОЕ) штамма vOka/Merk вируса Varicella-zoster (VZV). Вакцина Zostavax включена в списки вакцинации в нескольких европейских странах, включая Великобританию, Францию и Австрию.The Zostavax vaccine is given subcutaneously or intramuscularly and one 0.65 ml vaccine dose contains 19,400 plaque-forming units (PFU) of the vOka / Merk strain of the Varicella-zoster virus (VZV). Zostavax is listed on vaccination schedules in several European countries, including the UK, France and Austria.
Zostavax была одобрена ВОЗ после завершения исследования по профилактике HZ в двойном слепом плацебо - контролируемом исследовании, в котором приняли участие 38 546 человек в возрасте старше 60 лет. Результаты исследования показали, что Zostavax снизил заболеваемость HZ на 51%, a PHN и связанную с ней боль на 66,5% у субъектов в возрасте 60 лет. Эффективность этой вакцины против HZ снижается с увеличением возраста и составляет 18% для лиц в возрасте более 80 лет.Zostavax was approved by the WHO following completion of the HZ prevention study in a double-blind, placebo-controlled study in 38,546 people over the age of 60. The study results showed that Zostavax reduced the incidence of HZ disease by 51% and PHN and associated pain by 66.5% in subjects aged 60 years. The efficacy of this HZ vaccine declines with age and is 18% for those over 80 years of age.
Побочные реакции вакцины Zostavax включают, в основном, боль и воспаление в месте инъекции (Gillian М. Keating // Shingles (Herpes Zoster) vaccine (Zostavax): A review in the prevention of herpes zoster and postherpetic neuralgia. BioDrugs (2016) 30: 243 -254/ DOi 10. 1007/ s40259 -016-0180-7).Adverse reactions of Zostavax vaccine include mainly pain and inflammation at the injection site (Gillian M. Keating // Shingles (Herpes Zoster) vaccine (Zostavax): A review in the prevention of herpes zoster and postherpetic neuralgia. BioDrugs (2016) 30: 243-254 / DOi 10.1007 / s40259-016-0180-7).
Основным недостатком данного проторототипа является выявленная нейротпопность вирусного штамма, из которого производится эта вакцина (Нагиева Ф.Г., Баркова Е.П., Строева А.Д., Сидоров А.В., Лотте В.Д.. Звереа В.В. Характеристика связывания вакцинных штаммов вируса Varicella zoster с препаратами мембранных рецепторов мозга мышей. ЖМЭИ, 2020; 97(2), с. 125 -133).The main disadvantage of this protorototype is the revealed neurotropic nature of the viral strain from which this vaccine is produced (Nagieva F.G., Barkova E.P., Stroeva A.D., Sidorov A.V., Lotte V.D., Zverea V.V. Characteristics of the binding of vaccine strains of the Varicella zoster virus with preparations of membrane receptors in the brain of mice. ZhMEI, 2020; 97 (2), pp. 125-133).
Задачей настоящего изобретения является создание отечественного вакцинного штамма, изолированного непосредственно от пациента с рецидивирующим опоясывающим герпесом. Аналога такому вирусному штамму, как в России, так и за рубежом не существует.The objective of the present invention is to create a domestic vaccine strain isolated directly from a patient with recurrent herpes zoster. There is no analogue of such a viral strain, both in Russia and abroad.
Для Российской Федерации предпочтительно иметь вакцинные штаммы, изолированные на ее территории.It is preferable for the Russian Federation to have vaccine strains isolated on its territory.
Для решения данной задачи мы предлагаем холодоадаптированный штамм «vZelVax» вируса опоясывающего герпеса, депонированный в Государственной коллекции вирусов ФГБУ НИИ вирусологии им. Д.И. Ивановского Минздравсоцразвития России под номером 2936, предназначенный для получения живой культуральной вакцины для профилактики и лечения опоясывающего герпеса у взрослого населения.To solve this problem, we offer a cold-adapted strain "vZelVax" of the herpes zoster virus, deposited in the State collection of viruses at the V.I. DI. Ivanovsky of the Ministry of Health and Social Development of Russia under number 2936, intended for obtaining a live cultural vaccine for the prevention and treatment of herpes zoster in the adult population.
Клинический изолят HZ был выделен в Москве в 2013 г. из корочки от везикул пациента 63 лет в период реактивации HZ. В 2016 г. клиническому изоляту lpZel (latent parent) после завершения этапов аттенуации при низких температурах дали название «vZelVax». Штамм «vZelVax» HZ (Master seed) прошел при низких температурах культивирования (300°С) 12 пассажей в культуре диплоидных клеток ЛЭЧ - 3, 6 пассажей в первичной культуре клеток эмбрионов морских свинок (ФЭМС) и еще 2 пассажа в клеточной культуре диплоидных клеток ЛЭЧ - 3.Clinical isolate HZ was isolated in Moscow in 2013 from the vesicle crust of a 63-year-old patient during the period of HZ reactivation. In 2016, the clinical isolate lpZel (latent parent) was named vZelVax after the stages of attenuation at low temperatures were completed. Strain "vZelVax" HZ (Master seed) passed at low temperatures of cultivation (300 ° C) 12 passages in the culture of diploid cells LEC - 3, 6 passages in the primary cell culture of guinea pig embryos (FEMS) and 2 more passages in the cell culture of diploid cells LECH - 3.
Штамм депонирован в Государственной коллекции вирусов Института вирусологии им. Д.И. Ивановского ФГБУ «НИЦЭМ им. Н.Ф. Гамалеи» Минздрава России под номером 2936 03.03.2020.The strain was deposited in the State Collection of Viruses of the Institute of Virology named after DI. Ivanovsky Federal State Budgetary Institution “NITsEM named after N.F. Gamalea "of the Ministry of Health of Russia under the number 2936 03.03.2020.
Технический результат предлагаемого изобретения состоит в следующем:The technical result of the proposed invention is as follows:
Заявляемый аттенуированный штамм для живой культуральной вакцины обладает следующими биологическими маркерами:The claimed attenuated strain for a live cultural vaccine has the following biological markers:
- отсутствием размножения в чувствительной культуре клеток при температуре 39°С (ts мутация) и более высоким уровнем размножения в чувствительной культуре клеток при низкой температуре 30°С (самутация);- the lack of reproduction in a sensitive cell culture at a temperature of 39 ° C (ts mutation) and a higher level of reproduction in a sensitive cell culture at a low temperature of 30 ° C (self-mutation);
- имеет более выраженный иммунный ответ по сравнению с латентным вариантом вируса при иммунизации морских свинок;- has a more pronounced immune response compared to the latent variant of the virus during immunization of guinea pigs;
- более высокой репродуктивностью по сравнению с латентным вариантом вируса в культуре клеток фибробластов эмбриона морских свинок (ФЭМС);- higher reproductive capacity compared to the latent variant of the virus in the culture of fibroblast cells of the embryo of guinea pigs (FEMS);
Краткое описание чертежей и иных поясняющих материалов.Brief description of drawings and other explanatory materials.
Таблица 1 - Определение ts и са маркеров биологической аттенуации кандидата в вакцинный штамм «vZelVax» HZ на клетках кожно-мышечной ткани эмбриона человека (КМ-27).Table 1 - Determination of ts and ca markers of biological attenuation of the candidate for the vaccine strain "vZelVax" HZ on the cells of the musculocutaneous tissue of the human embryo (KM-27).
Таблица 2 - Определение ts и са маркеров биологической аттенуации кандидата в вакцинный штамм «vZelVax» HZ на клетках ФЭМС.Table 2 - Determination of ts and ca markers of biological attenuation of the candidate for the vaccine strain "vZelVax" HZ on FEMS cells.
Рис. 1 - Иммунный ответ SPF - мышей линии BALB/c на аттенуированный штамм «vZelax» HZ. По оси абцисс указаны сроки исследования сывороток с момента введения препарата. По оси ординат -значения ОП450. Показатели оценены на фотометре Thermo Scientific Varioskan Flash. Справа на цветных квадратах указаны разведения сывороток.Fig. 1 - Immune response of SPF - BALB / c mice to the attenuated strain "vZelax" HZ. The abscissa axis indicates the sera study time from the moment of drug administration. The ordinate is the OD450. The values were evaluated on a Thermo Scientific Varioskan Flash photometer. Serum dilutions are indicated on the right colored squares.
Таблица 3 - Оценка иммуногенности аттенуированного штамма «vZelVax» HZ.Table 3 - Assessment of the immunogenicity of the attenuated strain "vZelVax" HZ.
Таблица 4 - Сравнительная оценка результатов непрямой иммунофлуоресценции отечественного вакцинного штамма «vZelVax» HZ с сыворотками морских свинок, иммунизированных различными штаммами VZV.Table 4 - Comparative evaluation of the results of indirect immunofluorescence of the domestic vaccine strain "vZelVax" HZ with the sera of guinea pigs immunized with various VZV strains.
Таблица 5 - Сравнительная оценка связывания штаммов VZV с препаратами МРМ SPF мышей линии BALB/cTable 5 - Comparative evaluation of the binding of VZV strains with MPM SPF preparations of BALB / c mice
Ракрытие сущности изобретения.Disclosure of the essence of the invention.
Штамм vZelVax характеризуется следующими признаками.The vZelVax strain is characterized by the following features.
Морфологические признаки - вирионы VZV являются сферическими, от 150 - 200 nm в диаметре и состоят из внутреннего икосадельтаэдрического капсида из 162 капсомеров, окруженных тегументом и оболочкой, состоящей из двух или более мембран, содержит липиды.Morphological features - VZV virions are spherical, from 150 - 200 nm in diameter and consist of an internal icosadeltahedral capsid of 162 capsomeres surrounded by a tegument and an envelope consisting of two or more membranes containing lipids.
Культуральные признаки - при репродукции вирусного штамма в пермиссивной клеточной культуре типа КМ 27, Me Wo (меланома человека), Vero, вирус вызывает дегенеративные изменения в виде цитолиза клеток.Cultural traits - during the reproduction of a viral strain in a permissive cell culture such as KM 27, Me Wo (human melanoma), Vero, the virus causes degenerative changes in the form of cell cytolysis.
Инфекционная активность вирусного штамма в культуре клеток - 7,5-8,0 lg ГАДЕ50/0,1 мл.The infectious activity of the viral strain in cell culture is 7.5-8.0 lg GADE50 / 0.1 ml.
Антигенные свойства - вирус индуцирует выработку специфических антител в организме SPF мышей линии BALB/c и в организме морских свинок при подкожном, внутримышечном и внутрибрюшинном введениях. Вирусспецифические антитела выявляются в иммуноферментном анализе (ИФА), в иммунофлуоресцентном анализе (ИФ), в реакции нейтрализации (РН) и реакции торможения гемагглютинации (РТГА).Antigenic properties - the virus induces the production of specific antibodies in the body of SPF mice of the BALB / c line and in the body of guinea pigs with subcutaneous, intramuscular and intraperitoneal injections. Virus-specific antibodies are detected in an enzyme-linked immunosorbent assay (ELISA), in an immunofluorescence assay (IF), in a neutralization reaction (PH) and a hemagglutination inhibition reaction (RTGA).
Вирулентные свойства (att- фенотип) - аттенуированный вирусный штамм авирулентен, вызывая на хорион-аллантоисной оболочке развивающихся куриных эмбрионов белые оспины, в отличие от его родительского варианта, вызывающего при введении на хорион-аллантоисную оболочку развивающихся куриных эмбрионов гибель куриных эмбрионов или обширную геморрагию.Virulent properties (att phenotype) - the attenuated viral strain is avirulent, causing whitepoxes on the chorion-allantoic membrane of developing chick embryos, in contrast to its parental variant, which, when injected on the chorion-allantoic membrane of developing chick embryos, causes the death of chick embryos or extensive hemorrhages.
Молекулярно-генетическая особенность штамма -Molecular genetic peculiarity of the strain -
Частичное секвенирование консервативного участка гена Orf 0-1:Partial sequencing of the conserved region of the Orf 0-1 gene:
(133)AACCCGCGCCTTTTGCGTCCACCCCTCGTTTACTGCTCGGATGGCG(133) AACCCGCGCCTTTTGCGTCCACCCCTCGTTTACTGCTCGGATGGCG
ACCGTGCACTACTCCCGCCGACCTGGGACCCCGCCGGTCACCCTCACGTACCGTGCACTACTCCCGCCGACCTGGGACCCCGCCGGTCACCCTCACGT
CGTCCCCCAGCATGGATGACGTTGCGACCCCCATCCCCTACCTACCCACCGTCCCCCAGCATGGATGACGTTGCGACCCCCATCCCCTACCTACCCAC
ATACGCCGAGGCCGTGGCAGACGCGCCCCCCCCTTACAGAAGCCGCGAATACGCCGAGGCCGTGGCAGACGCGCCCCCCCCTTACAGAAGCCGCGA
GAGTCTGGTGTTCTCCCCGCCTCTTTTTCCTCACGTGGAGAATGGCACCGAGTCTGGTGTTCTCCCCGCCTCTTTTTCCTCACGTGGAGAATGGCACC
ACCCAACAGTCTTACGATTGCCTAGACTGCGCTTATGATGGAATCCACAACCCAACAGTCTTACGATTGCCTAGACTGCGCTTATGATGGAATCCACA
GACTTCAGCTGGCTTTTCTAAGAATTCGCAAATGCTGTGTACCGGCTTTGACTTCAGCTGGCTTTTCTAAGAATTCGCAAATGCTGTGTACCGGCTTT
TTTAATTCTTTTTGGTATTCTCACCCTTACTGCTGTCGTGGTCGCCATTGTTTAATTCTTTTTGGTATTCTCACCCTTACTGCTGTCGTGGTCGCCATTG
TTGCCGTTTTTCCCGAGGAACCTCCCAACTCAACTACA(559)TTGCCGTTTTTCCCGAGGAACCTCCCAACTCAACTACA (559)
Сравнительный генетический анализ показал, что по нуклеотидной последовательности он принадлежит европейскому варианту Varicella zoster.Comparative genetic analysis showed that by nucleotide sequence it belongs to the European variant Varicella zoster.
Условия хранения - хранится при температуре не ниже 70°С.Storage conditions - stored at a temperature not lower than 70 ° C.
Стабильность основных свойств вирусного штамма - сохраняются в течение 5 лет (период наблюдения).Stability of the main properties of the viral strain - persist for 5 years (observation period).
Осуществление изобретения.Implementation of the invention.
Биологические свойства штамма иллюстрируются следующими примерами.The biological properties of the strain are illustrated by the following examples.
Пример 1. Сравнительная характеристика ts и са маркеров биологической аттенуации кандидата в вакцинный штамм «vZelVax» HZ, установленная на клеточных культурах КМ 27 (кожно-мышечная ткань эмбриона человека) и ФЭМС (фибробласты эмбрионов морских свинок) при различных температурных режимах.Example 1. Comparative characteristics of ts and ca markers of biological attenuation of the candidate for the vaccine strain "vZelVax" HZ, established on cell cultures KM 27 (musculocutaneous tissue of a human embryo) and FEMS (fibroblasts of guinea pig embryos) at different temperature conditions.
Представленные в табл.1 и 2 результаты показали, что кандидат в вакцинный штамм «vZelVax», как внеклеточный вирус, так и внутриклеточный вирус не репродуцировался при высокой температуре 39° в отличие от латентного варианта вируса, то есть аттенуированный при низкой температуре штамм «vZelVax» обладал температурочувствительностью - ts фенотипом. В то же время аттенуированный штамм более активно репродуцировался при субоптимальной температуре при 30°С по сравнению с латентным вариантом, то есть обладал холодоадаптируемостью - са -фенотипом.The results presented in Tables 1 and 2 showed that the candidate for the vaccine strain "vZelVax", both the extracellular virus and the intracellular virus, did not reproduce at a high temperature of 39 °, in contrast to the latent variant of the virus, that is, the strain "vZelVax »Possessed temperature sensitivity - ts phenotype. At the same time, the attenuated strain reproduced more actively at a suboptimal temperature at 30 ° C compared to the latent variant, that is, it had cold adaptability - the ca-phenotype.
Результат представленный в табл.2 также показал, что аттенуированный штамм «vZelVax» обладал более высокой репродуктивной активностью в клетках эмбрионов морской свинки в сравнении с латентным вариантом - это еще один биологический маркер аттенуированных штаммов для живых вирусных вакцин, названный нами cell - фенотипом.The result presented in Table 2 also showed that the attenuated strain "vZelVax" had a higher reproductive activity in the cells of guinea pig embryos in comparison with the latent variant - this is another biological marker of attenuated strains for live viral vaccines, which we called the cell - phenotype.
Пример 2. Сравнительная оценка вирулентности (att - фенотип) кандидата в вакцинный штамм «vZelVax» HZ, установленная путем инфицирования хорион-аллантоисной оболочки (ХАО) 12-дневных развивающихся куриных эмбрионов.Example 2. Comparative assessment of virulence (att - phenotype) of the candidate for the vaccine strain "vZelVax" HZ, established by infection of the chorion-allantoic membrane (CHAO) of 12-day-old developing chicken embryos.
Аттенуированный вакцинный штамм «vZelVax» оказался авирулентным в отличие от его родительского варианта lpZel. Хорион- аллантоисные оболочки развивающихся куриных эмбрионов, инфицированные родительским вариантом вируса, вызывали гибель эмбрионов, а инфицированные аттенуированным вакцинным штаммом «vZelVaz» вызывали на хорион - аллантоисных оболочках белые оспины.The attenuated vaccine strain "vZelVax" was found to be avirulent in contrast to its parental variant lpZel. Chorion-allantoic membranes of developing chick embryos, infected with the parental variant of the virus, caused the death of embryos, and those infected with the attenuated vaccine strain "vZelVaz" caused white pock marks on the chorion-allantoic membranes.
Пример 3. Оценка антигенности кандидата в вакцинный штамм «vZelVax» HZ, установленная путем подкожной иммунизации SPF мышей линии BALB/c. одной прививочной дозой для человека.Example 3. Evaluation of the antigenicity of the candidate vaccine strain "vZelVax" HZ, established by subcutaneous immunization with SPF of BALB / c mice. one vaccination dose for a person.
На рис. 1 представлены результаты исследования сывороток SPF -мышей линии BALB/c, иммунизированных подкожно вируссодержащей жидкостью (ВСЖ) аттенуированного штамма «vZelVax» HZ. Мышам линии BALB/c вводили подкожно по 0,5 мл ВСЖ HZ, сыворотки от мышей собирали из хвостовой вены в различные интервалы времени, начиная с 2-х недель и в течение 8 месяцев (период наблюдения). Иммунные сыворотки исследовали в ИФА в твердофазном варианте иммунного анализа, где на твердой фазе был сорбирован лизат клеток КМ-27, инфицированных лабораторным штамм «Ellen» VZV. Иммунный комплекс детектировали антимышиным пероксидазным конъюгатом в рабочем разведении (фирма Sigma).In fig. 1 shows the results of a study of the sera of SPF mice of the BALB / c line, immunized subcutaneously with a virus-containing liquid (VVF) of the attenuated strain "vZelVax" HZ. BALB / c mice were injected subcutaneously with 0.5 ml of VSF HZ; sera from the mice were collected from the tail vein at different time intervals, starting from 2 weeks and for 8 months (observation period). Immune sera were studied in ELISA in a solid-phase version of the immune analysis, where the lysate of KM-27 cells infected with the laboratory strain "Ellen" VZV was sorbed on the solid phase. The immune complex was detected with an anti-mouse peroxidase conjugate in working dilution (Sigma).
Представленные на рис. 1 результаты исследования показали, что аттенуированный вирусный штамм «vZelVax» HZ обладал оптимальной антигенностью на 8 месяцев периода наблюдения в организме иммунизированных мышей.Shown in Fig. 1, the results of the study showed that the attenuated viral strain "vZelVax" HZ had optimal antigenicity for 8 months of the observation period in the body of immunized mice.
Пример 4. Характеристика иммуногенности кандидата в вакцинный штамм «VZelVax»Example 4. Characterization of the immunogenicity of the candidate for the vaccine strain "VZelVax"
Для оценки иммуногенности аттенуированного штамма «vZelVax» HZ, проведена иммунизация морских свинок подкожно одной прививочной дозой. Морским свинкам ввели подкожно в холку по 0,5 мл (одна прививочная доза) ВСЖ аттенуированного штамма «vZelVax» HZ на 20 пассажном уровне. Иммунные сыворотки собраны через 2, 3 и 5 месяцев после иммунизации (забор крови проведен путем кардиальной пункции).To assess the immunogenicity of the attenuated strain "vZelVax" HZ, guinea pigs were immunized subcutaneously with a single inoculation dose. Guinea pigs were injected subcutaneously into the withers, 0.5 ml (one inoculation dose) of the VSF of the attenuated vZelVax HZ strain at the 20 passage level. Immune sera were collected 2, 3 and 5 months after immunization (blood sampling was performed by cardiac puncture).
В табл. 3 представлены результаты исследования в реакции торможения гемагглютинации (РТГА) и в реакции нейтрализации (РН).Table 3 shows the results of a study in the reaction of inhibition of hemagglutination (RTGA) and in the reaction of neutralization (RN).
По результатам исследования четко установлено, что аттенуированный штамм «vZelVax» HZ в организме морских свинок индуцирует высокий уровень антигемагглютинов (результаты РТГА) и нейтрализинов (результаты РН). При этом необходимо отметить, что нейтрализины стабильно сохраняются на высоком уровне в течение 5 месяцев (период наблюдения) в отличие от гемолизинов.According to the results of the study, it was clearly established that the attenuated strain "vZelVax" HZ in the body of guinea pigs induces a high level of antihemagglutins (RTGA results) and neutralisins (PH results). It should be noted that neutralisins are stably maintained at a high level for 5 months (observation period), in contrast to hemolysins.
В табл.4 представлены результаты непрямой реакции иммунофлуоресценции иммунных сывороток морских свинок, полученных на 37 и 80 дни с момента иммунизации. Антигены приготовлены на диплоидных клетках морских свинок, инфицированных вакцинными вирусными штаммами «vZelVax» и «vOka» разных производителей.Table 4 shows the results of an indirect reaction of immunofluorescence of immune sera of guinea pigs obtained on days 37 and 80 from the moment of immunization. Antigens were prepared on diploid cells of guinea pigs infected with vaccine viral strains "vZelVax" and "vOka" from different manufacturers.
Результаты, представленные в таблице 4, показывали, что все 3 иммунные сыворотки к вакцинному штамму «vZelVax» и к вакцинному штамму «vOka» разных производителей выявляли вирусные антиген, приготовленный из отечественного штамма «vZelVax». При этом необходимо отметить, что иммунные сыворотки, полученные в более поздние сроки, выявляли большее количество инфекционных фокусов.The results presented in table 4 showed that all 3 immune sera to the vaccine strain "vZelVax" and to the vaccine strain "vOka" from different manufacturers detected viral antigen prepared from the domestic strain "vZelVax". It should be noted that the immune sera obtained at a later date revealed a greater number of infectious foci.
Пример 5. Сравнительная характеристика нейротропности различных штаммов вируса Varicella zoster.Example 5. Comparative characteristics of the neurotropicity of various strains of the Varicella zoster virus.
Изучение нейротропности аттенуированных вирусных штаммов «vZelVax» оценивали способом, описанным в патенте «Способ аттенуации вирусов» (Авторы: Баррет А., Райман К., НИ Хаолин (США). Способ заключался в смешивании вируса с мембранными рецепторами мозга, центрифугировании смеси и определении остаточной вирусной инфекционности. Мембранные рецепторы получали из мозга 4- недельных SPF мышей линии BALB/cThe study of the neurotropicity of attenuated viral strains "vZelVax" was evaluated by the method described in the patent "Method for attenuating viruses" (Authors: Barrett A., Ryman K., NI Haolin (USA). The method consisted of mixing the virus with the membrane receptors of the brain, centrifuging the mixture and determining residual viral infectivity Membrane receptors were obtained from the brains of 4-week-old SPF BALB / c mice
Известно, что вирус не может заражать восприимчивую клетку, если его вирусный белок прикрепления не соединяется на клеточной поверхности с молекулой, которая служит в качестве рецептора для данного вируса.It is known that a virus cannot infect a susceptible cell if its viral attachment protein does not bind on the cell surface to a molecule that serves as a receptor for the virus.
Если вирус соединяется с мембранными рецепторами мозга (МРМ), то после осаждения мембранных рецепторов центрифугированием, в надосадочной жидкости должен снизиться показатель инфекционности исследуемого вируса. По остаточной вирусной инфекционности судят о степени нейротропности исследуемого вируса. Остаточную вирусную инфекционность определяли методом предельного разведения на чувствительных к вирусу Varicella zoster клеточных культурах ФЭМС. Результаты инфекционности оценивали на 7-е сутки с момента инфицирования клеточной культуры и выражали в lg ГАДЕ50/ 0,1 мл. В табл. 5 представлены средние показатели по результатам 2-х экспериментов.If the virus binds to the membrane receptors of the brain (MRM), then after the precipitation of the membrane receptors by centrifugation, the infectivity of the virus under study should decrease in the supernatant. The residual viral infectivity is used to judge the degree of neurotropicity of the investigated virus. Residual viral infectivity was determined by the limiting dilution method in FEMS cell cultures susceptible to the Varicella zoster virus. The results of infectivity were assessed on the 7th day from the moment of infection of the cell culture and were expressed in lg GADE50 / 0.1 ml. Table 5 shows the average values based on the results of 2 experiments.
Эксперименты по связыванию холодоадаптированного вакцинного вирусного штамма vZelVax и его латентного родительского вируса lpZel показали, что оба вируса утратили тропизм к нервной ткани мозга мышей линии BALb/c. Американский вариант вирусного штамма «vOka/Мегк» после обработки нейрорецепторами мозга мышей, снизил инфекционность на 1,0 lg ГАДЕ50/0Д мл, то есть оказался нейротропным.Experiments on the binding of the cold-adapted vaccine viral strain vZelVax and its latent parental virus lpZel showed that both viruses lost their tropism to the neural tissue of the brain of BALb / c mice. The American variant of the viral strain "vOka / Megk" after treatment with neuroreceptors in the brain of mice, reduced infectivity by 1.0 lg GADE50 / 0D ml, that is, it turned out to be neurotropic.
Таким образом, заявляемый нами отечественный штамм, изолированный на территории России (г.Москва) со свойствами холодоадаптированности, то есть, обладающий основными маркерами биологической аттенуации (ts и са фенотипом, cell -фенотипом, att- фенотипом), обладающий высокой антигенностью и иммуногенностью, и не имеющий тропизма к нейрорецепторам мозга SPF мышей линии BALB/c и по частичному генетическому секвенированию основного гена VZV, принадлежащий европейскому варианту Varicella zoster, может применяться для создания вакцинных препаратов против опоясывающего герпеса.Thus, our claimed domestic strain, isolated on the territory of Russia (Moscow) with cold adaptability properties, that is, possessing the main markers of biological attenuation (ts and ca phenotype, cell phenotype, att phenotype), having high antigenicity and immunogenicity, and that does not have a tropism for the SPF brain neuroreceptors of BALB / c mice and, by partial genetic sequencing of the main VZV gene, belonging to the European variant Varicella zoster, can be used to create vaccines against herpes zoster.
Claims (1)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2020137980A RU2750818C1 (en) | 2020-11-19 | 2020-11-19 | Viral strain for obtaining attenuated live culture vaccine for prevention and treatment of herpes zoster for adult population |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2020137980A RU2750818C1 (en) | 2020-11-19 | 2020-11-19 | Viral strain for obtaining attenuated live culture vaccine for prevention and treatment of herpes zoster for adult population |
Publications (1)
Publication Number | Publication Date |
---|---|
RU2750818C1 true RU2750818C1 (en) | 2021-07-05 |
Family
ID=76755842
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2020137980A RU2750818C1 (en) | 2020-11-19 | 2020-11-19 | Viral strain for obtaining attenuated live culture vaccine for prevention and treatment of herpes zoster for adult population |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2750818C1 (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE122007000003I1 (en) * | 1993-11-19 | 2007-05-24 | Glaxosmithkline Biolog Sa | Against mumps vaccine containing a virus of the Jeryl-Lynn strain |
EA011884B1 (en) * | 2005-03-03 | 2009-06-30 | Глаксосмитклайн Байолоджикалс С.А. | Varicella zoster virus vaccine |
US20160008458A1 (en) * | 2012-09-14 | 2016-01-14 | The Regents Of The University Of Colorado, A Body Corporate | Conditionally replication deficient herpes virus and use thereof in vaccines |
US20200046827A1 (en) * | 2018-08-08 | 2020-02-13 | The Regents Of The University Of California | Protection Against Recurrent Genital Herpes by Therapeutic Immunization with Herpes simplex virus type 2 Ribonucleotide Reductase Protein Subunits |
-
2020
- 2020-11-19 RU RU2020137980A patent/RU2750818C1/en active
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE122007000003I1 (en) * | 1993-11-19 | 2007-05-24 | Glaxosmithkline Biolog Sa | Against mumps vaccine containing a virus of the Jeryl-Lynn strain |
EA011884B1 (en) * | 2005-03-03 | 2009-06-30 | Глаксосмитклайн Байолоджикалс С.А. | Varicella zoster virus vaccine |
EP2281831B1 (en) * | 2005-03-03 | 2018-04-18 | GlaxoSmithKline Biologicals S.A. | Varicella Zoster virus vaccine |
US20160008458A1 (en) * | 2012-09-14 | 2016-01-14 | The Regents Of The University Of Colorado, A Body Corporate | Conditionally replication deficient herpes virus and use thereof in vaccines |
US20200046827A1 (en) * | 2018-08-08 | 2020-02-13 | The Regents Of The University Of California | Protection Against Recurrent Genital Herpes by Therapeutic Immunization with Herpes simplex virus type 2 Ribonucleotide Reductase Protein Subunits |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Miller et al. | Antibodies to measles, mumps and rubella in UK children 4 years after vaccination with different MMR vaccines | |
JP7337935B2 (en) | Recombinant Varicella Zoster Virus Vaccine | |
Meignier et al. | Immunization of experimental animals with reconstituted glycoprotein mixtures of herpes simplex virus 1 and 2: protection against challenge with virulent virus | |
JP6523955B2 (en) | Recombinant modified vaccinia virus Ankara (MVA) RS virus (RSV) vaccine | |
RU2611198C2 (en) | Conditionally replicating cytomegalovirus as vaccine against cmv | |
US20080171688A1 (en) | Recombinant Vaccine from gE, gI, and gB Proteins of the Varicella-Zoster Virus for the Treatment and Prevention of Multiple Sclerosis | |
Rupprecht et al. | Ineffectiveness and comparative pathogenicity of attenuated rabies virus vaccines for the striped skunk (Mephitis mephitis) | |
EP0334530B1 (en) | A recombinant marek's disease virus and a vaccine | |
Welter et al. | Mucosal vaccination with recombinant poxvirus vaccines protects ferrets against symptomatic CDV infection | |
US20200345836A1 (en) | Vaccines against genital herpes simplex infections | |
Weeks et al. | Herpes simplex virus type-1 and-2 pathogenesis is restricted by the epidermal basement membrane | |
KR20210114941A (en) | Norovirus vaccine formulations and methods | |
CA2918644A1 (en) | Methods and compositions for dengue virus vaccines | |
KR101813017B1 (en) | West Nile Virus vaccine | |
KR20110053340A (en) | Vaccine against hpv | |
Zhaori et al. | Nasopharyngeal secretory antibody response to poliovirus type 3 virion proteins exhibit different specificities after immunization with live or inactivated poliovirus vaccines | |
Klockmann et al. | Preclinical investigations of the safety, immunogenicity and efficacy of a purified, inactivated tick-borne encephalitis vaccine | |
RU2750818C1 (en) | Viral strain for obtaining attenuated live culture vaccine for prevention and treatment of herpes zoster for adult population | |
US5614193A (en) | Hantavirus vaccine | |
RU2693440C1 (en) | STRAIN "vFIRAVAX" FOR PRODUCING AN ATTENUATED ALIVE CULTURE VACCINE FOR PREVENTING VARICELLA | |
EP4163378A1 (en) | Fusion protein of pentamer and gb of cytomegalovirus, and vaccine containing said fusion protein | |
KR19990082360A (en) | Vaccine against varicella zoster virus gene 63 product | |
RU2290204C1 (en) | Recombinant fused protein, preparation for immunotherapy based on thereof and method for immunotherapy of relapsing larynx papillomatosis | |
Grose et al. | Pathogenesis of primary infection | |
Kankanamge et al. | Mapping of the Low pH‐Sensitive Conformational Epitope of Rabies Virus Glycoprotein Recognized by a Monoclonal Antibody# 1‐30‐44 |