RU2749361C1 - Method for predicting recurrence of serous ovarian carcinoma - Google Patents
Method for predicting recurrence of serous ovarian carcinoma Download PDFInfo
- Publication number
- RU2749361C1 RU2749361C1 RU2020137026A RU2020137026A RU2749361C1 RU 2749361 C1 RU2749361 C1 RU 2749361C1 RU 2020137026 A RU2020137026 A RU 2020137026A RU 2020137026 A RU2020137026 A RU 2020137026A RU 2749361 C1 RU2749361 C1 RU 2749361C1
- Authority
- RU
- Russia
- Prior art keywords
- mir
- hsa
- expression
- recurrence
- ovarian carcinoma
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к медицине, а именно к молекулярной онкологии, и может найти применение для прогнозирования рецидива у больных раком яичников.The invention relates to medicine, namely to molecular oncology, and can be used to predict relapse in patients with ovarian cancer.
Рак яичников (РЯ) является седьмым по распространенности злокачественным новообразованием у женщин в развитых странах, вторым по распространенности гинекологическим раком (9,4/100 000), но самое главное, ведущей причиной смертности от рака у женщин (5,1/100 000). 90% всех случаев опухолей яичников составляет эпителиальный рак яичников. Это агрессивная форма РЯ с 5-летней общей выживаемостью менее 50% (см. Chien J., Neums L., Powell A.F.L.A., et al. Genetic Evidence for Early Peritoneal Spreading in Pelvic High-Grade Serous Cancer. Front Oncol. 2018;8:58). Средний возраст постановки первичного диагноза составляет от 55 до 65 лет, при этом пожизненный риск развития рака яичников составляет 1,5%. Основными факторами риска РЯ являются возраст и наличие семейного анамнеза РЯ и/или молочной железы (см. Torre L.A., Trabert В., DeSantis С.Е., et al. Ovarian cancer statistics, 2018. CA Cancer J Clin. 2018; 68(4):284-296).Ovarian cancer (OC) is the seventh most common malignant neoplasm in women in developed countries, the second most common gynecological cancer (9.4 / 100,000), but most importantly, the leading cause of cancer deaths in women (5.1 / 100,000) ... 90% of all cases of ovarian tumors are epithelial ovarian cancer. It is an aggressive form of OC with a 5-year overall survival of less than 50% (see Chien J., Neums L., Powell AFLA, et al. Genetic Evidence for Early Peritoneal Spreading in Pelvic High-Grade Serous Cancer. Front Oncol. 2018; 8 : 58). The median age at initial diagnosis is 55 to 65 years, with a lifetime risk of ovarian cancer of 1.5%. The main risk factors for OC are age and family history of OC and / or breast (see Torre LA, Trabert B., DeSantis C.E., et al. Ovarian cancer statistics, 2018. CA Cancer J Clin. 2018; 68 ( 4): 284-296).
Летальность РЯ обусловлена аберрантным ростом клеток и перитонеальным диссеминированным метастазированием (см. Zhang L.Y., Chen Y., Jia J., Zhu X., He Y., Wu L.M. MiR-27a promotes EMT in ovarian cancer through active Wnt/β-catenin signalling by targeting FOXO1. Cancer Biomark. 2019; 24(1):31-42). Поскольку заболевание протекает бессимптомно на ранних стадиях, большинство случаев, как правило, выявляется на поздней стадии и, таким образом, серьезно влияет на выживаемость пациентов (см. James N.E., Chichester С, Ribeiro J.R. Beyond the Biomarker: Understanding the Diverse Roles of Human Epididymis Protein 4 in the Pathogenesis of Epithelial Ovarian Cancer. Front Oncol. 2018; 8:124).OC lethality is due to aberrant cell growth and peritoneal disseminated metastasis (see Zhang LY, Chen Y., Jia J., Zhu X., He Y., Wu LM MiR-27a promotes EMT in ovarian cancer through active Wnt / β-catenin signaling by targeting FOXO1 Cancer Biomark 2019; 24 (1): 31-42). Because the disease is asymptomatic in the early stages, most cases are usually diagnosed late and thus have a serious impact on patient survival (see James NE, Chichester C, Ribeiro JR Beyond the Biomarker: Understanding the Diverse Roles of Human Epididymis Protein 4 in the Pathogenesis of Epithelial Ovarian Cancer. Front Oncol. 2018; 8: 124).
Несмотря на большой прогресс в химиотерапии и хирургическом лечении этого заболевания, у большинства пациентов все еще развивается рецидив или метастазирование, а 5-летняя выживаемость пациентов, у которых диагностируется перитонеальное метастазирование, составляет около 30%, инвазия и метастазирование РЯ на ранней стадии являются ведущими причинами его высокой смертности и плохого прогноза (см. Zhang Y., Zhao F.J., Chen L.L., et al. MiR-373 targeting of the Rab22a oncogene suppresses tumor invasion and metastasis in ovarian cancer. Oncotarget. 2014; 5(23):12291-12303).Despite the great progress in chemotherapy and surgical treatment of this disease, most patients still develop relapse or metastasis, and the 5-year survival rate of patients diagnosed with peritoneal metastasis is about 30%, invasion and metastasis of OC at an early stage are the leading causes its high mortality and poor prognosis (see Zhang Y., Zhao FJ, Chen LL, et al. MiR-373 targeting of the Rab22a oncogene suppresses tumor invasion and metastasis in ovarian cancer. Oncotarget. 2014; 5 (23): 12291- 12303).
В последнее время было достигнуто согласие в отношении того, что различные микроРНК (миРНК) экспрессируются аномальным образом в опухолевой клетке и функционируют в качестве онкогенов или генов-супрессоров при РЯ, и поэтому являются потенциальными мишенями для диагностики и лечения опухолей (см. Nagaraj А.В., Joseph P., DiFeo A.. miRNAs as prognostic and therapeutic tools in epithelial ovarian cancer. Biomark Med. 2015; 9(3):241-257).Recently, it has been agreed that various microRNAs (miRNAs) are expressed abnormally in the tumor cell and function as oncogenes or suppressor genes in OC, and therefore are potential targets for the diagnosis and treatment of tumors (see Nagaraj A. B., Joseph P., DiFeo A .. miRNAs as prognostic and therapeutic tools in epithelial ovarian cancer. Biomark Med. 2015; 9 (3): 241-257).
Из патентных источников известен «Способ определения продолжительности безрецидивного периода при серозном раке яичников» (см. Патент на изобретение RU №2613302 С1, опубл. 15.03.2017, Бюл. №8). Для этого во время проведения больным раком яичников операции полного объема в гомогенате ткани опухоли определяют уровень НЕ4, и при его значении от 4768 пМ/г до 5674 пМ/г сырой ткани прогнозируют продолжительность безрецидивного периода 6 и более месяцев, а при его значении от 7995 пМ/г до 9339 пМ/г сырой ткани прогнозируют продолжительность безрецидивного периода менее 6 месяцев. Способ позволяет оценить биологическую активность первичной опухоли яичника, индивидуальный прогноз заболевания и тактику дальнейшего ведения пациенток при возможности многократного воспроизведения в лечебных учреждениях онкологического профиля, располагающих биохимическими лабораториями. Недостатками известного способа является возможность проведения предлагаемого анализа только после оперативного вмешательства.From patent sources known "Method for determining the duration of a relapse-free period in serous ovarian cancer" (see Patent for invention RU No. 2613302 C1, publ. 03/15/2017, bull. No. 8). To do this, during a full-volume operation of a patient with ovarian cancer, the level of HE4 in the tumor tissue homogenate is determined, and with its value from 4768 pM / g to 5674 pM / g of raw tissue, the duration of a relapse-free period is predicted for 6 months or more, and with its value from 7995 pM / g to 9339 pM / g wet tissue predict a relapse-free period of less than 6 months. The method makes it possible to assess the biological activity of the primary ovarian tumor, the individual prognosis of the disease and the tactics of further management of patients with the possibility of repeated reproduction in oncological medical institutions with biochemical laboratories. The disadvantages of this method is the possibility of carrying out the proposed analysis only after surgery.
Так же известен «Способ для прогнозирования метастазирования рака яичников на основе группы генов микроРНК» (см. Патент RU №2666911 А, опубл. 24.05.2018, Бюл. №15) путем выявления метилирования по крайней мере трех маркеров из пяти и отличается тем, что маркерами системы являются гены: miR-137, miR-193a, miR-1258, miR-203 и miR-127. Заявляемый способ позволяет выявить рак яичников и прогнозировать его метастазирование с высокой клинической чувствительностью и специфичностью. Недостатками известного способа является возможность проведения предлагаемого анализа только после оперативного вмешательства.Also known is the "Method for predicting metastasis of ovarian cancer based on a group of microRNA genes" (see Patent RU No. 2666911 A, publ. 05.24.2018, bull. No. 15) by detecting methylation of at least three markers out of five and differs in that that the system's markers are genes: miR-137, miR-193a, miR-1258, miR-203, and miR-127. The inventive method makes it possible to detect ovarian cancer and predict its metastasis with high clinical sensitivity and specificity. The disadvantages of this method is the possibility of carrying out the proposed analysis only after surgery.
Известен «Способ прогнозирования исхода распространенного рака яичников после адъювантной химиотерапии по схеме АР» (см. Патент RU №2699561 С1, опубл. 06.09.2019 Бюл. №25), который может быть использован для прогнозирования исхода распространенного рака яичников после адъюватной химиотерапии по схеме АР (цисплатин 75 мг/м2 + доксорубицин 50 мг/м2). Для этого проводят одномоментное определение уровней матричной РНК (мРНК) эндотелиального фактора роста A (Vascular endothelial growth factor (VEGF-A)) и кросс- комплементирующих генов эксцизионной репарации (ERCC - excision repair cross complementing (ERCC1)). Определение уровней матричной РНК проводят в опухолевой ткани первичной больной, полученной интраоперационно, с последующим расчетом интегрального показателя I по предложенной формуле, и при значении I<2 прогноз считается положительным с вероятностью 81%, а при значении I>2 прогноз считается неблагоприятным в 75% случаев. Однако, изобретение обеспечивает прогнозирование исхода рака яичников только после адъювантной химиотерапии по схеме АР для индивидуализации тактики и улучшения результатов лечения больных.Known "Method for predicting the outcome of advanced ovarian cancer after adjuvant chemotherapy according to the AR scheme" (see Patent RU No. 2699561 C1, publ. 09/06/2019 bull. No. 25), which can be used to predict the outcome of advanced ovarian cancer after adjuvant chemotherapy according to the scheme AR (cisplatin 75 mg / m2 + doxorubicin 50 mg / m2). For this, the levels of messenger RNA (mRNA) of Vascular endothelial growth factor A (VEGF-A) and excision repair cross complementing (ERCC1) cross complementing genes (ERCC) are carried out at once. The determination of the levels of messenger RNA is carried out in the tumor tissue of the primary patient, obtained intraoperatively, with the subsequent calculation of the integral indicator I according to the proposed formula, and with a value of I <2, the prognosis is considered positive with a probability of 81%, and with a value of I> 2, the prognosis is considered unfavorable in 75% cases. However, the invention provides a prediction of the outcome of ovarian cancer only after adjuvant chemotherapy according to the AR regimen for individualization of tactics and improvement of patient outcomes.
Известен «Способ прогнозирования длительности безрецидивного интервала после завершения первичного лечения больных раком яичников» (см. Патент RU №2018111101, опубл.: 10.01.2019 Бюл. №1), который может быть использован при раке яичников для улучшения результатов лечения путем увеличения количества курсов или изменения тактики адъювантной химиотерапии при неблагоприятных значениях маркеров. По совокупности результатов оценки уровней опухолеассоциированных маркеров прогнозируют длительность безрецидивного интервала, и если: у пациенток моложе 40 лет концентрация СА125 выше 35 ед/мл и/или концентрация НЕ4 выше 70 пмоль/л; у пациенток в возрасте 40-50 концентрация СА125 выше 35 ед/мл и/или концентрация НЕ4 выше 100 пмоль/л; у пациенток старше 50 лет концентрация СА125 выше 35 ед/мл и/или концентрация НЕ4 выше 120 пмоль/л, то время безрецидивного течения после окончания первичного лечения не превысит одного года. Недостатком способа является определение безрецидивного периода только после окончания первичного лечения заболевания.The known "Method for predicting the duration of the recurrence-free interval after the completion of primary treatment of patients with ovarian cancer" (see Patent RU No. 2018111101, publ .: 10.01.2019 bull. No. 1), which can be used in ovarian cancer to improve treatment results by increasing the number of courses or a change in the tactics of adjuvant chemotherapy with unfavorable markers. On the basis of the results of assessing the levels of tumor-associated markers, the duration of the relapse-free interval is predicted, and if: in patients under 40 years of age, the CA125 concentration is higher than 35 U / ml and / or the HE4 concentration is higher than 70 pmol / L; in patients aged 40-50, CA125 concentration is higher than 35 U / ml and / or HE4 concentration is higher than 100 pmol / L; in patients over 50 years of age, the concentration of CA125 is higher than 35 U / ml and / or the concentration of HE4 is higher than 120 pmol / l, then the time of relapse-free course after the end of the primary treatment will not exceed one year. The disadvantage of this method is the definition of a relapse-free period only after the end of the primary treatment of the disease.
Известен способ «Количественной оценки hsa-miR-16-5p, hsa-miR-425-5р, hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-101-Зр, hsa-miR-30d-5p и hsa-miR-93-5p в плазме периферической крови женщин как способ неинвазивной диагностики серозных пограничных цистаденом и цистаденокарценом яичника» (см. Патент RU №2688189 С9, опубл. 20.05.2019, Бюл. №14). Предложена количественная оценка hsa-miR-16-5р, hsa-miR-425-5p, hsa-miR-17-5р, hsa-miR-20a-5p, hsa-miR-101-3р, hsa-miR-30d-5p и hsa-miR-93-5p в плазме периферической крови женщин. Методом количественной ПНР в реальном времени в образце плазмы крови женщины определяют уровень экспрессии семи микроРНК (hsa-miR-16-5р, hsa-miR-425-5p, hsa-miR-17-5р, hsa-miR-20a-5p, hsamiR-101-Зр, hsa-miR-30d-5p и hsa-miR-93-5p) с предпочтительным использованием стандартных ДНК для последующего расчета оценочного параметра (ОП) при построении модели PLS-DA. При значении 0<ОП<4,5 делают заключение о высокой вероятности наличия серозной опухоли яичников у женщины (серозных пограничных цистаденом и серозных цистаденокарцином высокой степени злокачественности). При значении -1,8<ОП<0 делают заключение о высокой вероятности отсутствия серозной опухоли яичников. Изобретение обеспечивает дифференциальную диагностику серозных опухолей яичников с высокой точностью и диагностической значимостью, однако не связано с прогнозированием рака яичников.The known method "Quantification of hsa-miR-16-5p, hsa-miR-425-5p, hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-101-Zp, hsa-miR-30d -5p and hsa-miR-93-5p in the peripheral blood plasma of women as a method of non-invasive diagnosis of serous borderline cystadenomas and ovarian cystadenocarcene "(see Patent RU No. 2688189 C9, publ. 20.05.2019, bull. No. 14). Proposed quantitative assessment of hsa-miR-16-5p, hsa-miR-425-5p, hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-101-3p, hsa-miR-30d-5p and hsa-miR-93-5p in the peripheral blood plasma of women. The expression level of seven microRNAs (hsa-miR-16-5p, hsa-miR-425-5p, hsa-miR-17-5p, hsa-miR-20a-5p, hsamiR -101-Zp, hsa-miR-30d-5p and hsa-miR-93-5p) with the preferred use of standard DNA for the subsequent calculation of the estimated parameter (OD) when constructing the PLS-DA model. With a value of 0 <OD <4.5, a conclusion is made about the high probability of the presence of a serous ovarian tumor in a woman (serous borderline cystadenomas and serous cystadenocarcinomas of a high degree of malignancy). With a value of -1.8 <OD <0, a conclusion is made about a high probability of the absence of a serous ovarian tumor. The invention provides differential diagnosis of serous ovarian tumors with high accuracy and diagnostic value, but is not associated with the prediction of ovarian cancer.
Определяющими отличиями заявляемого способа, по сравнению с вышеописанными, являются:The defining differences of the proposed method, in comparison with the above, are:
- метод основан на оценке относительной экспрессии экспериментально подобранной сигнатуры микроРНК: hsa-miR-150-5р, hsa-miR-140-3р, hsa-miR-221-3р;- the method is based on the assessment of the relative expression of the experimentally selected microRNA signature: hsa-miR-150-5p, hsa-miR-140-3p, hsa-miR-221-3p;
- определение уровня относительной экспрессии микроРНК в образцах трепан-биопсии яичников проводят методом RT-PCR с использованием экзогенной референсной микроРНК cel-miR-39-5p (экзогенный контроль) с известной последовательностью, не характерной для человека, которая вносится перед проведением анализа в стандартном количестве во все образцы для нормализации эффективности выделения и обратной транскрипции (использование данного подхода повышает воспроизводимость и достоверность получаемых данных);- determination of the level of relative expression of miRNA in samples of trephine biopsy of ovaries is carried out by RT-PCR using exogenous reference miRNA cel-miR-39-5p (exogenous control) with a known sequence that is not characteristic of humans, which is introduced before analysis in a standard amount in all samples to normalize the efficiency of isolation and reverse transcription (using this approach increases the reproducibility and reliability of the data obtained);
- заключение о прогнозировании периода безрецидивной выживаемости пациентов с раком яичником делают на основании тестирования образцов трепан-биопсии яичников;- the conclusion about predicting the period of relapse-free survival of patients with ovarian cancer is made on the basis of testing samples of trephine-biopsy of the ovaries;
- получение комплементарной ДНК реализуется при помощи poly(A)-RT технологии с использованием универсального RT-праймера.- obtaining complementary DNA is carried out using poly (A) -RT technology using a universal RT primer.
Техническим результатом заявляемого изобретения является создание нового, эффективного, специфичного способа прогнозирования безрецидивной выживаемости больных серозной карциномой яичников.The technical result of the claimed invention is the creation of a new, effective, specific method for predicting disease-free survival of patients with serous ovarian carcinoma.
Технический результат достигается тем, что проводят анализ экспрессии микро-РНК в образце трепан-биопсии яичников, включающий внесение экзогенного контроля и выделение тотальной РНК, обратную транскрипцию с последующей амплификацией в режиме реального времени, при этом используют высокоспецифичные праймеры для hsa-miR-150-5р, hsa-miR-140-3р, hsa-miR-221-3р, анализируют полученные данные и вычисляют прогностический коэффициент RS (risk score), используя значения относительной экспрессии hsa-miR-150-5р, hsa-miR-140-3р, hsa-miR-221-3р: RS = (1,96 * экспрессия hsa-miR-140-3р)+(-2,7 * экспрессия hsa-miR-150-5р) + (2,13 * экспрессия hsa-miR-221-3р), и при значениях RS≥13 прогнозируют безрецидивный период течения заболевания в течение 6 месяцев после окончания лечения.The technical result is achieved by analyzing the expression of micro-RNA in a sample of ovarian trephine biopsy, including the introduction of exogenous control and isolation of total RNA, reverse transcription followed by amplification in real time, while using highly specific primers for hsa-miR-150- 5p, hsa-miR-140-3p, hsa-miR-221-3p, analyze the obtained data and calculate the prognostic coefficient RS (risk score) using the values of the relative expression hsa-miR-150-5p, hsa-miR-140-3p , hsa-miR-221-3p: RS = (1.96 * expression of hsa-miR-140-3p) + (- 2.7 * expression of hsa-miR-150-5p) + (2.13 * expression of hsa- miR-221-3p), and with values of RS≥13, a relapse-free period of the disease is predicted within 6 months after the end of treatment.
Способ основан на патогенетическом факторе канцерогенеза -аберрантной экспрессии микроРНК, ассоциированных с инициацией и развитием злокачественного процесса, что приводит к прогрессированию опухоли.The method is based on the pathogenetic factor of carcinogenesis - aberrant expression of microRNAs associated with the initiation and development of a malignant process, which leads to tumor progression.
Заявленный способ включает следующие этапы: гомогенизация биоптата, внесение экзогенного контроля, выделение тотальной РНК; проведение обратной транскрипции для наработки комплементарной ДНК (кДНК), RT-PCR полученной кДНК в присутствии специфичных праймеров; обработку данных для оценки изменения относительной экспрессии в образце.The claimed method includes the following steps: homogenization of biopsy, introduction of exogenous control, isolation of total RNA; conducting reverse transcription to generate complementary DNA (cDNA), RT-PCR of the obtained cDNA in the presence of specific primers; data processing to evaluate changes in relative expression in the sample.
Заявляемый способ осуществляется следующим образом.The inventive method is carried out as follows.
Полученный образец трепан-биопсии гомогенизируют в Trizol LS® (Life Technologies, Пейсли, Великобритания) с добавлением 0,2 М уксусной кислоты для предотвращения контаминации с ДНК. В смесь объемом 200 мкл вносят 3.5 мкл экзогенного контроля (начальная концентрация 1*108 копий/мкл). Выделение тотальной РНК из ткани проводят подходящим методом экстракции. Выделенную РНК подвергают обратной транскрипции. Обратная транскрипция микроРНК проводится одновременно с полиаденилированием РНК, с использованием универсального RT-праймера (см. таблица 1).The resulting trephine biopsy sample is homogenized in Trizol LS® (Life Technologies, Paisley, UK) with the addition of 0.2 M acetic acid to prevent DNA contamination. 3.5 μL of exogenous control (initial concentration 1 * 10 8 copies / μL) is added to the mixture with a volume of 200 μl. Isolation of total RNA from tissue is performed by a suitable extraction method. The isolated RNA is subjected to reverse transcription. Reverse transcription of microRNA is carried out simultaneously with RNA polyadenylation using a universal RT primer (see table 1).
Анализируемые последовательности генетических локусов амплифицируют в 20 мкл PCR-смеси, содержащей 1х PCR-буфер, 1х EvaGreen, 0.25 mM dNTPs, 2 мМ MgCl2, 1 ед. акт. Taq-DNАполимеразы, по 0,5 мкМ прямого и обратного праймеров. Программа амплификации: 95°С - 5 минут, затем 40 циклов (60°С - 60 секунд и 95°С - 15 сек.). Последовательности PCR-праймеров подобраны с использованием баз данных MirBase (http://www.mirbase.org/) приведены в таблице 1. Постановку RT-PCR каждого образца проводят в трех повторах.The analyzed sequences of genetic loci are amplified in 20 μl PCR mixture containing 1x PCR buffer, 1x EvaGreen, 0.25 mM dNTPs, 2 mM MgCl2, 1 unit. Act. Taq-DNA polymerase, 0.5 μM forward and reverse primers. Amplification program: 95 ° С - 5 minutes, then 40 cycles (60 ° С - 60 seconds and 95 ° С - 15 seconds). The sequences of PCR primers were selected using the MirBase databases (http://www.mirbase.org/) are shown in Table 1. The RT-PCR of each sample is performed in triplicate.
Для оценки риска прогрессирования рассчитывают прогностический коэффициент RS по формуле: RS = (1,96 * экспрессия hsa-miR-140-3р) + (-2,7 * экспрессия hsa-miR-150-5р) + (2,13 * экспрессия hsa-miR-221-3р)To assess the risk of progression, the prognostic coefficient RS is calculated using the formula: RS = (1.96 * expression of hsa-miR-140-3p) + (-2.7 * expression of hsa-miR-150-5p) + (2.13 * expression hsa-miR-221-3p)
При коэффициенте ≥13 больную относят в группу повышенного риска (OR=1,5, р=0,0002).If the coefficient is ≥13, the patient is referred to the high-risk group (OR = 1.5, p = 0.0002).
Предлагаемый способ был апробирован на 30 больных в возрасте от 25 до 76 лет, проходивших лечение на базе ФГБУ «НМИЦ онкологии» Минздрава России. На основании длительности безрецидивного периода течения заболевания больные были разделены на две группы: группа 1 (12 человек) с безрецидивной формой заболевания, группа 2 (18 человек) с агрессивной быстропрогрессирующей формой заболевания.The proposed method was tested on 30 patients aged 25 to 76 years, who were treated on the basis of the Federal State Budgetary Institution "National Medical Research Center of Oncology" of the Ministry of Health of Russia. Based on the duration of the disease-free period of the disease, the patients were divided into two groups: group 1 (12 people) with a disease-free form of the disease, group 2 (18 people) with an aggressive rapidly progressing form of the disease.
В целях оценки потенциальной значимости выбранных маркеров была рассчитана их чувствительность и специфичность, которые составили 92% и 98%, соответственно.In order to assess the potential significance of the selected markers, their sensitivity and specificity were calculated, which amounted to 92% and 98%, respectively.
Работоспособность способа прогнозирования рецидивирования серозной карциномы яичников иллюстрируется следующими клиническими примерами.The efficiency of the method for predicting recurrence of serous ovarian carcinoma is illustrated by the following clinical examples.
Пример 1.Example 1.
Больная К., 64 года госпитализирована в отделение онкогинекологии ФГБУ НМИЦ онкологии в июне 2019 года с жалобами на боли внизу живота, увеличение живота в размерах, выраженную слабость, одышку при физической нагрузке.Patient K., 64 years old, was hospitalized in the Department of Oncogynecology of the Federal State Budgetary Institution of National Medical Research Center of Oncology in June 2019 with complaints of pain in the lower abdomen, an increase in abdominal size, severe weakness, shortness of breath during exercise.
Анамнез заболевания: считает себя больной с мая 2019 года, когда находилась на лечении в дневном стационаре ЦРБ г. Ставрополь по поводу болей в правой ноге. 14.05.2019 отметила появление одышки, слабость. Выполнена рентгенограмма ОГК от 01.06.2019: справа от переднего отрезка 4 ребра, слева от переднего отрезка 6 р. интенсивное гомогенное затемнение с косой верхней границей. Справа купол диафрагмы не дифференцируется. Корень справа не просматривается, слева структурный.Medical history: considers herself ill since May 2019, when she was treated at the day hospital of the Central Regional Hospital in Stavropol for pain in her right leg. 05/14/2019 noted the appearance of shortness of breath, weakness. An X-ray of the OGK from 06/01/2019 was performed: to the right of the anterior segment of 4 ribs, to the left of the anterior segment of 6 r. intense homogeneous darkening with an oblique upper border. On the right, the dome of the diaphragm is not differentiated. The root is not visible on the right, structural on the left.
Средостение по средней линии. Аорта без особенностей.Mediastinum in the midline. The aorta was unremarkable.
03.06.2019 выполнен торакоцентез, эвакуировано около 2 л жидкости, ц/а плевральной жидкости: элементы рака из железистого эпителия.On 03.06.2019, thoracocentesis was performed, about 2 liters of fluid, c / a of pleural fluid: elements of cancer from the glandular epithelium were evacuated.
КТ СКТ ОГК от 04.06.19: справа определяется участок консолидации легочной ткани, спаянный с м/долевой плеврой, в котором прослеживаются частично просветы субсегментарных ветвей В8. Слева в S8 участок плевропневмофиброза. Органы средостения без особенностей. В плевральных полостях наличие жидкости, больше справа. ФБС от 05.06.2019: дистония трахеи, главных бронхов 1 степени. Двусторонний диффузный атрофический бронхит. УЗИ брюшной полости от 05.06.2019: умеренное увеличение размеров печени, диффузные изменения ее паренхимы. Асцит.CT SCT OGK dated 06/04/19: on the right, the area of consolidation of the lung tissue is determined, welded to the m / lobar pleura, in which the lumens of the subsegmental branches of B8 are partially traced. On the left in S8 there is a site of pleuropneumofibrosis. The organs of the mediastinum were unremarkable. There is fluid in the pleural cavities, more on the right. FBS dated 06/05/2019: dystonia of the trachea, the main bronchi of the 1st degree. Bilateral diffuse atrophic bronchitis. Ultrasound of the abdominal cavity from 06/05/2019: a moderate increase in the size of the liver, diffuse changes in its parenchyma. Ascites.
КТ органов брюшной полости от 06.06.2019: КТ данных за объемный процесс в печени, поджелудочной железе, селезенке не выявлено. Признаки канцероматоза брюшины. Двусторонний гидроторакс, небольшие синусовые кисты почек. МРТ органов малого таза от 08.06.2019: MP- признаки канцероматоза брюшины с наличием единичного узла в малом тазу. Значительное количество свободной жидкости в полости таза, брюшной полости. Анализ крови на онкомаркеры СА-125-216,3, Не-4 больше 1500 пмоль/л, индекс ROMA 96,9% от 14.06.2019 г. CT scan of the abdominal organs from 06/06/2019: CT data for the volumetric process in the liver, pancreas, spleen were not detected. Signs of peritoneal carcinomatosis. Bilateral hydrothorax, small sinus cysts of the kidneys. MRI of the pelvic organs from 06/08/2019: MP- signs of carcinomatosis of the peritoneum with the presence of a single node in the small pelvis. A significant amount of free fluid in the pelvic cavity, abdominal cavity. Blood test for tumor markers CA-125-216.3, He-4 more than 1500 pmol / l, ROMA index 96.9% from 14.06.
14.06.2019 выполнены: лапароцентез (эвакуировано 3 л асцитической жидкости), трепан-биопсия яичника. УЗИ ОМТ, ОБП от 17.06.2020, заключение: асцит, объемные новообразования в малом тазу четко не определяются. Асцит. Диффузные изменения паренхимы печени (по типу жирового гепатоза), поджелудочной железы. Кисты почечного синуса с двух сторон. Диффузные изменения паренхимы щитовидной железы.06/14/2019 performed: laparocentesis (evacuated 3 liters of ascitic fluid), trephine biopsy of the ovary. Ultrasound OMT, OBP dated 06/17/2020, conclusion: ascites, volumetric neoplasms in the small pelvis are not clearly defined. Ascites. Diffuse changes in the liver parenchyma (by the type of fatty hepatosis), pancreas. Renal sinus cysts on both sides. Diffuse changes in the parenchyma of the thyroid gland.
Объективный статус: общее состояние средней степени тяжести. Сознание ясное. АД 125/80 мм. рт.ст. Т=36,6 0 С.Кожные покровы бледные, сухие. Лимфоузлы, доступные пальпации, не увеличены. Живот увеличен за счет асцита, напряжен, безболезненный. Умеренно выраженное варикозное расширение подкожных вен нижних конечностей. С-м раздражения брюшины отрицательный. Одышка при ходьбе, в покое нет. Справа дыхание везикулярное, хрипов нет, ясный легочной звук. Слева - дыхание выслушивается до 6 ребра, ниже 6 ребра тупой перкуторный звук, дыхание не выслушивается.Objective status: general condition of moderate severity. Consciousness is clear. HELL 125/80 mm. Hg T = 36.6 0 C. The skin is pale, dry. Palpable lymph nodes are not enlarged. The abdomen is enlarged due to ascites, tense, painless. Moderately pronounced varicose expansion of the saphenous veins of the lower extremities. Negative peritoneal irritation. Shortness of breath when walking, not at rest. On the right, vesicular breathing, no wheezing, clear pulmonary sound. Left - breathing is heard up to the 6th rib, below the 6th rib there is a dull percussion sound, breathing is not heard.
Физиологические отправления: стул нормальный, диурез - олигурия. Моча светло-желтого цвета. Периферических отеков нет. Рост = 160 см, вес = 89 кг. ППТ = 1,99 м2.Physiological functions: stool is normal, diuresis is oliguria. Light yellow urine. No peripheral edema. Height = 160 cm, weight = 89 kg. PPT = 1.99 m 2 .
Status genitalis: наружные половые органы без видимой патологии. Шейка матки эрозирована вокруг наружного зева, цилиндрической формы. Матка с придатками четко не пальпируются из-за напряженного асцита. Паховые лимфоузлы не увеличены. При осмотре через прямую кишку: на уровне, достижимом пальцем, патологии не выявлено. На перчатке следы кала.Status genitalis: external genital organs without visible pathology. The cervix is eroded around the outer os, cylindrical in shape. The uterus with appendages is not clearly palpable due to tense ascites. Inguinal lymph nodes are not enlarged. When viewed through the rectum: at the level attainable with a finger, no pathology was revealed. There are traces of feces on the glove.
Лабораторные данные: общий анализ крови от 01.06.2020: гемоглобин - 136 г/л, эритроциты - 4,36*1012/л., лейкоциты - 6,84*109/л., тромбоциты - 278*109/л., палочкоядерные - 4%, сегментоядерные - 63%, эозинофилы - 4%, моноциты - 7%, лимфоциты 22%. Биохимический анализ крови от 01.06.2019 г: общий билирубин 13,2 моль/л, креатинин - 78 ммоль/л, глюкоза - 4,7 моль/л, общий белок - 53,7 г/л.Laboratory data: general blood test from 01.06.2020: hemoglobin - 136 g / l, erythrocytes - 4.36 * 1012 / l., Leukocytes - 6.84 * 109 / l., Platelets - 278 * 109 / l., Stab - 4%, segmented - 63%, eosinophils - 4%, monocytes - 7%, lymphocytes - 22%. Biochemical blood test from 06/01/2019: total bilirubin 13.2 mol / l, creatinine - 78 mmol / l, glucose - 4.7 mol / l, total protein - 53.7 g / l.
После проведенного обследования выставлен диагноз: рак яичников T3cNxM1, полисерозит, (мтс в плевру, канцероматоз брюшины) гр. 2.After the examination, the diagnosis was made: ovarian cancer T3cNxM1, polyserositis, (mts in the pleura, peritoneal carcinomatosis) gr. 2.
Пациентке выполнено исследование относительной экспрессии микроРНК hsa-miR- 150-5р, hsa-miR-140-3р, hsa-miR-221-3р в биоптате яичника (см. таблица 2).The patient underwent a study of the relative expression of microRNA hsa-miR-150-5p, hsa-miR-140-3p, hsa-miR-221-3p in an ovarian biopsy (see Table 2).
risk score = (1,96*7,5)+(-2,7*6,74)+(2,13*8,17)=13,9risk score = (1.96 * 7.5) + (- 2.7 * 6.74) + (2.13 * 8.17) = 13.9
Риск прогрессирования рака яичников определен как высокий (risk score > 13).The risk of progression of ovarian cancer is defined as high (risk score> 13).
Учитывая местно-распространенный процесс: асцит, плеврит консилиумом врачей НМИЦ онкологии рекомендовано начать лечение с проведения курсов неоадъювантной химиотерапии по схеме: паклитаксел 175 мг/м2 в/в в 1-ый день, карбоплатин АИС 6 в/в в 1-ый день 21-дневного курса. С июня 2019 года проведено 3 курса неоадьювантной полихимиотерапии (НАПХТ), хирургическое лечение в объеме оптимальной циторедукции: субтотальной гистерэктомии с придатками, экстирпации большого сальника, аппендэктомии. В послеоперационном периоде проведено 6 курсов АПХТ.Considering the locally widespread process: ascites, pleurisy, a council of doctors of the National Medical Research Center of Oncology recommended starting treatment with courses of neoadjuvant chemotherapy according to the following scheme: paclitaxel 175 mg / m2 IV on the 1st day, carboplatin AIS 6 IV on the 1st day 21 -day course. Since June 2019, 3 courses of neoadjuvant polychemotherapy (NAPCT) have been carried out, surgical treatment in the amount of optimal cytoreduction: subtotal hysterectomy with appendages, extirpation of the greater omentum, appendectomy. In the postoperative period, 6 courses of APCT were carried out.
Морфологическое исследование послеоперационного материала - в яичниках комплексы желез аденокарциномы с дистрофическими изменениями. Выраженный фиброз стромы яичников. Гиалиноз белых тел и стенок сосудов. Выраженный ответ на проведенное неоадъювантное химиотерапевтическое лечение. В маточных трубах- атрофия слизистой оболочки, склероз подслизистого слоя. Гипопластичный эндометрий. В миометрии- лейомиомы. В жировой клетчатке сальника на фоне фиброзной ткани одиночные фрагменты раковых желез с дистроффическими изменениями. Большое количество псаммомных тел. Метастазы серозной карциномы высокой степени злокачественности. В аппендиксе метастазы одиночных раковых желез, большое количество псаммомных тел. Метастазы в серозу аппендикса.Morphological examination of the postoperative material - in the ovaries, complexes of adenocarcinoma glands with dystrophic changes. Severe fibrosis of the ovarian stroma. Hyalinosis of the white bodies and vascular walls. A pronounced response to the performed neoadjuvant chemotherapy treatment. In the fallopian tubes - atrophy of the mucous membrane, sclerosis of the submucosa. Hypoplastic endometrium. In the myometrium - leiomyomas. In the fatty tissue of the omentum against the background of fibrous tissue, there are single fragments of cancerous glands with dystrophic changes. A large number of psammological bodies. Metastases of high-grade serous carcinoma. In the appendix there are metastases of single cancerous glands, a large number of psammary bodies. Metastases in the serosa of the appendix.
Лечение закончила в январе 2020 года. Через 4 месяца после окончания лечения при контрольном обследовании выявлено прогрессирование заболевания: асцит, гидроторакс, канцероматоз брюшины. Выставлен диагноз: рак яичников pT3cNoM1, St IVв, полисерозит, (мтс в плевру, канцероматоз брюшины), состояние после комбинированного лечения 2019-2020 годы, платинорезистентная форма, прогрессирование заболевания: гидроторакс, асцит, канцероматоз брюшины, гр. 2.She finished her treatment in January 2020. 4 months after the end of treatment, the follow-up examination revealed the progression of the disease: ascites, hydrothorax, peritoneal carcinomatosis. Diagnosed with ovarian cancer pT3cNoM1, St IVc, polyserositis, (mts in the pleura, peritoneal carcinomatosis), condition after combined treatment 2019-2020, platinum-resistant form, disease progression: hydrothorax, ascites, peritoneal carcinomatosis, gr. 2.
В связи с рецидивом, консилиумом врачей НМИЦ онкологии рекомендовано проведение курсов ПХТ 2 линии.In connection with the relapse, the council of doctors of the National Medical Research Center of Oncology recommended conducting courses of PCT of the 2nd line.
Пример 2.Example 2.
Больная Ш., 41 год госпитализирована в отделение онкогинекологии ФГБУ НМИЦ онкологии в июле 2018 года с жалобами на боли внизу живота, увеличение живота в размерах, чувство дискомфорта в эпигастрии после приема пищи.Patient Sh., 41 years old, was admitted to the Department of Oncogynecology of the Federal State Budgetary Institution of National Medical Research Center of Oncology in July 2018 with complaints of pain in the lower abdomen, an increase in abdominal size, a feeling of epigastric discomfort after eating.
Анамнез заболевания: считает себя больной в середины мая 2018 года, когда появились боли внизу живота, стала отмечать увеличение живота в размерах, чувство дискомфорта в эпигастрии после приема пищи. Обратилась к гинекологу по месту жительства в г. Зверево, выполнено УЗИ ОМТ от 22.05.18, заключение: асцит, аденомиоз, структурные изменения обоих яичников. УЗИ ОБП и почек от 22.05.2018, заключение: диффузные изменения в печени, жировой гепатоз, диффузные изменения ПЖЖ, асцит, микролитиаз справа.Medical history: considers himself ill in mid-May 2018, when pains in the lower abdomen appeared, she began to notice an increase in abdomen in size, a feeling of discomfort in the epigastrium after eating. I consulted a gynecologist at the place of residence in Zverevo, an ultrasound scan was performed on 05/22/18, conclusion: ascites, adenomyosis, structural changes in both ovaries. Ultrasound of the OBP and kidneys from 05/22/2018, conclusion: diffuse changes in the liver, fatty hepatosis, diffuse changes in the pancreas, ascites, microlithiasis on the right.
Выполнена ФГДС от 28.05.2018 г: катаральный эзофагит, гиперемированная эрозивная гастропатия, ФКС от 30.05.2018: сигмоидит, внутренний геморрой. Выполнена трепан-биопсия образования яичника 29.06.2018 г: г/а - серозная карцинома яичника high grade. Анализ крови на онкомаркеры Са-125- 1767 Ед/мл, Не-4- 1211.2 пмоль/л, индекс ROMA-99,5%.FGDS performed on 05/28/2018: catarrhal esophagitis, hyperemic erosive gastropathy, FCC from 05/30/2018: sigmoiditis, internal hemorrhoids. Trepan biopsy of the ovarian formation was performed on June 29, 2018: h / a - high grade serous ovarian carcinoma. Blood test for tumor markers Ca-125 - 1767 U / ml, He-4 - 1211.2 pmol / l, ROMA index - 99.5%.
Рентгенограмма ОГК от 10.06.18: рентггенологически правосторонний гидроторакс. В условиях КДО НМИЦ онкологии повторно выполнено УЗИ ОМТ и БП от 10.06.2018, заключение: асцит, диффузные изменения паренхимы печени и поджелудочной железы. Уплотнение стенки желчного пузыря. Умеренно выраженные признаки аденомиоза. Придатки четко не визуализируются.Roentgenogram of the OGK from 10.06.18: roentgenologic right-sided hydrothorax. Under the conditions of the CDO of the National Medical Research Center of Oncology, ultrasound of OMT and BP was performed again on 10.06.2018, conclusion: ascites, diffuse changes in the parenchyma of the liver and pancreas. Consolidation of the wall of the gallbladder. Moderately expressed signs of adenomyosis. The appendages are not clearly visualized.
Объективный статус: общее состояние средней степени тяжести. Сознание ясное. АД 125/80 мм. рт.ст. Т=36,6 0 С.Кожные покровы бледные, сухие. Лимфоузлы, доступные пальпации, не увеличены. Живот мягкий, незначительно увеличен, безболезненный при пальпации. При физикальном исследовании данных за наличие свободной жидкости в брюшной полости и в малом тазу нет. С-м раздражения брюшины отрицательный. Варикозного расширения подкожных вен нижних конечностей не выявлено. Слева дыхание везикулярное, хрипов нет, ясный легочной звук. Справа - дыхание выслушивается до 5 ребра, ниже 5 ребра тупой перкуторный звук, дыхание не выслушивается. Физиологические отправления: стул нормальный, диурез - адекватный водной нагрузке. Моча светло-желтого цвета. Периферических отеков нет.Objective status: general condition of moderate severity. Consciousness is clear. HELL 125/80 mm. Hg T = 36.6 0 C. The skin is pale, dry. Palpable lymph nodes are not enlarged. The abdomen is soft, slightly enlarged, painless on palpation. On physical examination, there is no data for the presence of free fluid in the abdominal cavity and in the small pelvis. Negative peritoneal irritation. Varicose expansion of the saphenous veins of the lower extremities was not revealed. On the left, vesicular breathing, no wheezing, clear pulmonary sound. On the right - breathing is heard up to the 5th rib, below the 5th rib there is a dull percussion sound, breathing is not heard. Physiological functions: stool is normal, diuresis is adequate to water load. Light yellow urine. No peripheral edema.
Рост = 170 см, вес = 65 кг. ППТ = 1,75 м2.Height = 170 cm, weight = 65 kg. PPT = 1.75 m2.
Status genitalis: наружные половые органы без видимой патологии. В зеркалах: шейка матки маленькая, наличие единичных ретенционных кист. При вагинальном исследовании матка нормальных размеров, плотная, подвижная, в заднем своде мтс образование до 2 см. В проекции придатков матки объемные образования не исследуются. Паховые лимфоузлы не увеличены. При осмотре через прямую кишку: на уровне, достижимом пальцем, патологии не выявлено. На перчатке следы кала.Status genitalis: external genital organs without visible pathology. In the mirrors: the cervix is small, the presence of single retention cysts. During vaginal examination, the uterus is of normal size, dense, mobile, in the posterior fornix of the mts formation of up to 2 cm. In the projection of the uterine appendages, volumetric formations are not investigated. Inguinal lymph nodes are not enlarged. When viewed through the rectum: at the level attainable with a finger, no pathology was revealed. There are traces of feces on the glove.
Лабораторные данные: ЭКГ от 11.06.2018 - синусовый ритм, ЧСС 87 в мин, ирригоскопия от 10.06.2018 г: убедительных данных за t-r кишечника не выявлено. Ц/а мазков с шейки матки от 11.06.2018 г: АК не обнаружены. Общий анализ крови от 11.06.2018 г: гемоглобин - 124 г/л, эритроциты - 3,94*1012/л., лейкоциты - 8,0*109/л., тромбоциты - 353*109/л., палочкоядерные - 3%, сегментоядерные - 71%, эозинофилы - 4%, моноциты - 6%), лимфоциты 20%). Биохимический анализ крови от 11.06.2019 г: общий билирубин 23,2 моль/л, креатинин - 83,1 ммоль/л, глюкоза - 5,6 моль/л, общий белок - 63,7 г/лLaboratory data: ECG from 06/11/2018 - sinus rhythm, heart rate 87 per minute, irrigoscopy from 06/10/2018: no convincing data for the t-r of the intestine were found. C / a smears from the cervix from 06/11/2018: AK were not detected. General blood test from 11.06.2018: hemoglobin - 124 g / l, erythrocytes - 3.94 * 1012 / l., Leukocytes - 8.0 * 109 / l., Platelets - 353 * 109 / l., Stab - 3 %, segmented - 71%, eosinophils - 4%, monocytes - 6%), lymphocytes 20%). Biochemical blood test from 06/11/2019: total bilirubin 23.2 mol / l, creatinine - 83.1 mmol / l, glucose - 5.6 mol / l, total protein - 63.7 g / l
После проведенного обследования выставлен диагноз: рак яичников T3cNxM1, гр.2, полисерозит (гидроторакс, асцит).After the examination, the diagnosis was made: ovarian cancer T3cNxM1, group 2, polyserositis (hydrothorax, ascites).
Пациентке выполнено исследование относительной экспрессии микроРНК hsa-miR-150-5р, hsa-miR-140-3р, hsa-miR-221-3р в биоптате яичника (табл. 3).The patient underwent a study of the relative expression of microRNA hsa-miR-150-5p, hsa-miR-140-3p, hsa-miR-221-3p in an ovarian biopsy (Table 3).
risk score = (1,96*7,32)+(-2,7*8,62)+(2,13*6,91)=5,8risk score = (1.96 * 7.32) + (- 2.7 * 8.62) + (2.13 * 6.91) = 5.8
Риск прогрессирования рака яичников определен как низкий (risk score < 13).The risk of progression of ovarian cancer is defined as low (risk score <13).
Учитывая местно-распространенный процесс: асцит, гидроторакс-консилиумом врачей НМИЦ онкологии решено начать лечение с курсов неоадъювантной химиотерапии по схеме карбоплатин + паклитаксел. С июля 2018 года проведено 3 курса НАПХТ. В августе 2018 года выполнено хирургическое лечение в объеме оптимальной циторедуктивной операции: субтотальной гистерэктомии с придатками, экстирпации большого сальника.Considering the locally widespread process: ascites, the hydrothorax consultation of doctors of the National Medical Research Center of Oncology decided to start treatment with courses of neoadjuvant chemotherapy according to the carboplatin + paclitaxel regimen. Since July 2018, 3 courses of NAPHT have been carried out. In August 2018, surgical treatment was performed in the amount of optimal cytoreductive surgery: subtotal hysterectomy with appendages, extirpation of the greater omentum.
В послеоперационном периоде проведено 6 курсов АГТХТ. Лечение закончила в декабре 2018 года.In the postoperative period, 6 courses of AGTHT were carried out. She finished her treatment in December 2018.
Морфологическое исследование послеоперационного материала - в яичниках комплексы желез аденокарциномы. В опухоли - обширные очаги некроза (G3). В маточных трубах - атрофия слизистой оболочки, склероз подслизистого слоя, в жировой клетчатке сальника - обширные метастазы карциномы вышеописанного строения. В опухоли признаки терапевтического патоморфоза 2 степени.Morphological examination of the postoperative material - in the ovaries, adenocarcinoma gland complexes. The tumor has extensive foci of necrosis (G3). In the fallopian tubes - atrophy of the mucous membrane, sclerosis of the submucous layer, in the fatty tissue of the omentum - extensive metastases of carcinoma of the above-described structure. In the tumor there are signs of a therapeutic pathomorphosis of the 2nd degree.
При контрольном обследовании в сентябре 2020 года по данным СРКТ органов грудной клетки и МРТ брюшной полости и малого таза: данных за рецидив и прогрессирование не выявлено. Анализ крови на онкомаркеры Са-125 и Не-4 в норме.At the follow-up examination in September 2020, according to the SRCT of the chest organs and MRI of the abdominal cavity and small pelvis: data for relapse and progression were not revealed. A blood test for tumor markers Ca-125 and He-4 is normal.
Диагноз: рак яичников, St IV (pT3cN0M1), полисерозит, (гидроторакс, асцит), состояние после 3 курсов НАПХТ, хирургического лечения, 6 курсов АПХТ, кл.гр.2. Клиническая ремиссия. Рекомендовано динамическое наблюдение у онколога по месту жительства.Diagnosis: ovarian cancer, St IV (pT3cN0M1), polyserositis, (hydrothorax, ascites), condition after 3 courses of NAPHT, surgical treatment, 6 courses of APCT, class group 2. Clinical remission. Dynamic observation by an oncologist at the place of residence is recommended.
Анализ представленных клинических случаев свидетельствует о возможности определения продолжительности безрецидивного интервала заболевания с использованием оценки экспрессии микроРНК hsa-miR-150-5р, hsa-miR-140-3р, hsa-miR-221-3р относительно экзогенного контроля cel-miR-39-5р.The analysis of the presented clinical cases indicates the possibility of determining the duration of the disease-free interval of the disease using the assessment of the expression of microRNA hsa-miR-150-5p, hsa-miR-140-3p, hsa-miR-221-3p relative to the exogenous control of cel-miR-39-5p ...
Предлагаемым способом было осуществлено определение продолжительности безрецидивного периода заболевания у 30 больных, результаты молекулярно-генетических исследований в дальнейшем подтверждены данными из анамнеза и дополнительных инструментальных обследований пациенток.The proposed method was carried out to determine the duration of the disease-free period in 30 patients, the results of molecular genetic studies were further confirmed by data from the anamnesis and additional instrumental examinations of the patients.
«Способ прогнозирования рецидивирования серозной карциномы яичников» позволяет прогнозировать риск развития рецидива заболевания в течение первых шести месяцев после завершения лечения."A method for predicting recurrence of serous ovarian carcinoma" allows you to predict the risk of recurrence of the disease within the first six months after completion of treatment.
Заявляемый способ является экономически оправданным для диагностики и дает возможность формирования тактики лечения еще в дооперационном периоде пациента; обладает высокой чувствительностью (98%) и специфичностью (92%), его осуществление возможно малоинвазивным способом с использованием трепан-биопсии яичника, реализация способа на базе стандартной ПЦР-лаборатории занимает менее 8 часов.The inventive method is economically justified for diagnosis and makes it possible to formulate treatment tactics even in the preoperative period of the patient; has a high sensitivity (98%) and specificity (92%), its implementation is possible in a minimally invasive way using trephine biopsy of the ovary, the implementation of the method on the basis of a standard PCR laboratory takes less than 8 hours.
--->--->
Перечень последовательностейSequence listing
<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii
<120> A method for predicting recurrence of serous ovarian carcinoma<120> A method for predicting recurrence of serous ovarian carcinoma
<160> 1<160> 1
<210> 1<210> 1
<211> 20<211> 20
<212> DNA<212> DNA
<213> Homo sapiens<213> Homo sapiens
<400> 1<400> 1
GCAGTCTCCCAACCCTTGTA 20GCAGTCTCCCAACCCTTGTA 20
<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii
<120> A method for predicting recurrence of serous ovarian carcinoma<120> A method for predicting recurrence of serous ovarian carcinoma
<160> 1<160> 1
<210> 2<210> 2
<211> 27<211> 27
<212> DNA<212> DNA
<213> Homo sapiens<213> Homo sapiens
<400> 1<400> 1
GTCCAGTTTTTTTTTTTTTTTCACTGG 27GTCCAGTTTTTTTTTTTTTTTCACTGG 27
<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii
<120> A method for predicting recurrence of serous ovarian carcinoma <120> A method for predicting recurrence of serous ovarian carcinoma
<160> 1<160> 1
<210> 3<210> 3
<211> 19<211> 19
<212> DNA<212> DNA
<213> Homo sapiens<213> Homo sapiens
<400> 1<400> 1
CGCAGTACCACAGGGTAGA 19CGCAGTACCACAGGGTAGA 19
<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii
<120> A method for predicting recurrence of serous ovarian carcinoma <120> A method for predicting recurrence of serous ovarian carcinoma
<160> 1<160> 1
<210> 4<210> 4
<211> 26<211> 26
<212> DNA<212> DNA
<213> Homo sapiens<213> Homo sapiens
<400> 1<400> 1
CCAGTTTTTTTTTTTTTTTCCGTGGT 26CCAGTTTTTTTTTTTTTTTTCCGTGGT 26
<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii
<120> A method for predicting recurrence of serous ovarian carcinoma<120> A method for predicting recurrence of serous ovarian carcinoma
<160> 1<160> 1
<210> 5<210> 5
<211> 20<211> 20
<212> DNA<212> DNA
<213> Homo sapiens<213> Homo sapiens
<400> 1<400> 1
CGCAGAGCTACATTGTCTGC 20CGCAGAGCTACATTGTCTGC 20
<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii
<120> A method for predicting recurrence of serous ovarian carcinoma <120> A method for predicting recurrence of serous ovarian carcinoma
<160> 1<160> 1
<210> 6<210> 6
<211> 28<211> 28
<212> DNA<212> DNA
<213> Homo sapiens<213> Homo sapiens
<400> 1<400> 1
TCCAGTTTTTTTTTTTTTTTGAAACCCA 28TCCAGTTTTTTTTTTTTTTTTGAAACCCA 28
<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii
<120> A method for predicting recurrence of serous ovarian carcinoma<120> A method for predicting recurrence of serous ovarian carcinoma
<160> 1<160> 1
<210> 7<210> 7
<211> 26<211> 26
<212> DNA<212> DNA
<213> Homo sapiens<213> Homo sapiens
<400> 1<400> 1
CAGGTCCAGTTTTTTTTTTTTTTTVN 26CAGGTCCAGTTTTTTTTTTTTTTTTVN 26
<---<---
Claims (4)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2020137026A RU2749361C1 (en) | 2020-11-10 | 2020-11-10 | Method for predicting recurrence of serous ovarian carcinoma |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2020137026A RU2749361C1 (en) | 2020-11-10 | 2020-11-10 | Method for predicting recurrence of serous ovarian carcinoma |
Publications (1)
Publication Number | Publication Date |
---|---|
RU2749361C1 true RU2749361C1 (en) | 2021-06-09 |
Family
ID=76301597
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2020137026A RU2749361C1 (en) | 2020-11-10 | 2020-11-10 | Method for predicting recurrence of serous ovarian carcinoma |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2749361C1 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2290078C1 (en) * | 2005-07-25 | 2006-12-27 | Евгений Владимирович Новичков | Method for predicting the relapse of serous ovarian cancer |
WO2020051293A1 (en) * | 2018-09-07 | 2020-03-12 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Recurrence gene signature across multiple cancer types |
-
2020
- 2020-11-10 RU RU2020137026A patent/RU2749361C1/en active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2290078C1 (en) * | 2005-07-25 | 2006-12-27 | Евгений Владимирович Новичков | Method for predicting the relapse of serous ovarian cancer |
WO2020051293A1 (en) * | 2018-09-07 | 2020-03-12 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Recurrence gene signature across multiple cancer types |
Non-Patent Citations (1)
Title |
---|
CHEN S.F. et al. Identification of core aberrantly expressed microRNAs in serous ovarian carcinoma. Oncotarget. 2018; 9(29): 20451-20466. * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Powrózek et al. | Plasma circulating microRNA-944 and microRNA-3662 as potential histologic type-specific early lung cancer biomarkers | |
Templeton et al. | Prognosis in Kaposi's sarcoma | |
Nakamura et al. | A liquid biopsy signature for the detection of patients with early-onset colorectal cancer | |
Xie et al. | Saliva supernatant miR-21: a novel potential biomarker for esophageal cancer detection | |
Schwandner et al. | Apoptosis in rectal cancer: prognostic significance in comparison with clinical, histopathologic, and immunohistochemical variables | |
Sun et al. | Higher Ki67 index, nodal involvement, and invasive growth were high risk factors for worse prognosis in conventional mammary analogue secretory carcinoma | |
Guo et al. | Plasma miR-1273g-3p acts as a potential biomarker for early Breast Ductal Cancer diagnosis | |
RU2749361C1 (en) | Method for predicting recurrence of serous ovarian carcinoma | |
Takizawa et al. | Su1366 A NON-RANDOMIZED SINGLE-ARM CONFIRMATORY TRIAL OF ENDOSCOPIC SUBMUCOSAL DISSECTION TO EXPAND ITS INDICATION FOR EARLY GASTRIC CANCER OF UNDIFFERENTIATED TYPE: JAPAN CLINICAL ONCOLOGY GROUP STUDY (JCOG1009/1010) | |
US20190316207A1 (en) | Mir-320e and colorectal cancer | |
Wang | Serum miR-885-5p can be used as a marker for efficacy prediction and prognosis of advanced liver cancer | |
CN112646886B (en) | Application of FOXD1 in invasive breast cancer | |
Parente et al. | Colorectal adenosquamous carcinoma: peculiar morphologic features and distinct immunoprofiles in squamous and glandular components | |
CN111778333B (en) | Application of reagent for determining EDAR expression level and kit | |
Kojimahara et al. | Identifying prognostic factors in Japanese women with pseudomyxoma peritonei: a retrospective clinico-pathological study of the Tohoku gynecologic cancer unit | |
CN107858424A (en) | Applications of the 3p of miRNA 4731 as primary lung cancer diagnosis marker | |
Garrigós et al. | MicroRNAs as potential predictors of extreme response to tyrosine kinase inhibitors in renal cell cancer | |
RU2762493C1 (en) | Method for preoperative prediction of the risk of recurrence in patients with stage t1 endometrial cancer | |
RU2772207C1 (en) | Method for predicting the risk of an unfavorable outcome of colon and rectosigmoid cancer | |
Yang et al. | The correlation between tumor tissue mir-373 and mir-124 expressions and prognosis in patients with endometrial cancer | |
Sadiq et al. | 47P A novel serum MicroRNA-based diagnostic panel for breast cancer | |
CN108588229A (en) | Applications of the LINC01703 as the molecular marker of diagnosing liver cancer | |
RU2782104C1 (en) | Method for predicting disease progression after chemoradiotherapy for clear cell uterine cancer | |
Merino et al. | Inverted colonic diverticulum: an infrequent and dangerous endoscopic finding | |
RU2769927C2 (en) | METHOD FOR DIAGNOSING MELANOMA USING EXOSOMAL microRNA |