RU2749361C1 - Method for predicting recurrence of serous ovarian carcinoma - Google Patents

Abstract

FIELD: medicine; molecular oncology.SUBSTANCE: invention relates to the field of medicine, in particular to molecular oncology, it is intended for predicting the recurrence of serous ovarian carcinoma. The analysis of micro-RNA expression in an ovarian trepan biopsy sample is performed, including the introduction of exogenous control and isolation of total RNA, reverse transcription with subsequent amplification in real time, and primers for hsa-miR-150-5p, hsa-miR-140-3p, and hsa-miR-221-3p are used. The obtained data are analyzed and the prognostic coefficient RS is calculated using the formula: RS = (1.96 * hsa-miR-140-3p expression) + (-2.7 * hsa-miR-150-5p expression) + (2.13 * hsa-miR-221-3p expression). At values of RS ≥13, the risk of developing a recurrence of the disease is predicted within the first six months after the end of treatment.EFFECT: invention provides for the creation of a new, effective, specific method for predicting recurrence-free survival in patients with serous ovarian carcinoma.4 cl, 3 tbl, 2 ex

Description

The invention relates to medicine, namely to molecular oncology, and can be used to predict relapse in patients with ovarian cancer.

Ovarian cancer (OC) is the seventh most common malignant neoplasm in women in developed countries, the second most common gynecological cancer (9.4 / 100,000), but most importantly, the leading cause of cancer deaths in women (5.1 / 100,000) ... 90% of all cases of ovarian tumors are epithelial ovarian cancer. It is an aggressive form of OC with a 5-year overall survival of less than 50% (see Chien J., Neums L., Powell AFLA, et al. Genetic Evidence for Early Peritoneal Spreading in Pelvic High-Grade Serous Cancer. Front Oncol. 2018; 8 : 58). The median age at initial diagnosis is 55 to 65 years, with a lifetime risk of ovarian cancer of 1.5%. The main risk factors for OC are age and family history of OC and / or breast (see Torre LA, Trabert B., DeSantis C.E., et al. Ovarian cancer statistics, 2018. CA Cancer J Clin. 2018; 68 ( 4): 284-296).

OC lethality is due to aberrant cell growth and peritoneal disseminated metastasis (see Zhang LY, Chen Y., Jia J., Zhu X., He Y., Wu LM MiR-27a promotes EMT in ovarian cancer through active Wnt / β-catenin signaling by targeting FOXO1 Cancer Biomark 2019; 24 (1): 31-42). Because the disease is asymptomatic in the early stages, most cases are usually diagnosed late and thus have a serious impact on patient survival (see James NE, Chichester C, Ribeiro JR Beyond the Biomarker: Understanding the Diverse Roles of Human Epididymis Protein 4 in the Pathogenesis of Epithelial Ovarian Cancer. Front Oncol. 2018; 8: 124).

Despite the great progress in chemotherapy and surgical treatment of this disease, most patients still develop relapse or metastasis, and the 5-year survival rate of patients diagnosed with peritoneal metastasis is about 30%, invasion and metastasis of OC at an early stage are the leading causes its high mortality and poor prognosis (see Zhang Y., Zhao FJ, Chen LL, et al. MiR-373 targeting of the Rab22a oncogene suppresses tumor invasion and metastasis in ovarian cancer. Oncotarget. 2014; 5 (23): 12291- 12303).

Recently, it has been agreed that various microRNAs (miRNAs) are expressed abnormally in the tumor cell and function as oncogenes or suppressor genes in OC, and therefore are potential targets for the diagnosis and treatment of tumors (see Nagaraj A. B., Joseph P., DiFeo A .. miRNAs as prognostic and therapeutic tools in epithelial ovarian cancer. Biomark Med. 2015; 9 (3): 241-257).

From patent sources known "Method for determining the duration of a relapse-free period in serous ovarian cancer" (see Patent for invention RU No. 2613302 C1, publ. 03/15/2017, bull. No. 8). To do this, during a full-volume operation of a patient with ovarian cancer, the level of HE4 in the tumor tissue homogenate is determined, and with its value from 4768 pM / g to 5674 pM / g of raw tissue, the duration of a relapse-free period is predicted for 6 months or more, and with its value from 7995 pM / g to 9339 pM / g wet tissue predict a relapse-free period of less than 6 months. The method makes it possible to assess the biological activity of the primary ovarian tumor, the individual prognosis of the disease and the tactics of further management of patients with the possibility of repeated reproduction in oncological medical institutions with biochemical laboratories. The disadvantages of this method is the possibility of carrying out the proposed analysis only after surgery.

Also known is the "Method for predicting metastasis of ovarian cancer based on a group of microRNA genes" (see Patent RU No. 2666911 A, publ. 05.24.2018, bull. No. 15) by detecting methylation of at least three markers out of five and differs in that that the system's markers are genes: miR-137, miR-193a, miR-1258, miR-203, and miR-127. The inventive method makes it possible to detect ovarian cancer and predict its metastasis with high clinical sensitivity and specificity. The disadvantages of this method is the possibility of carrying out the proposed analysis only after surgery.

Known "Method for predicting the outcome of advanced ovarian cancer after adjuvant chemotherapy according to the AR scheme" (see Patent RU No. 2699561 C1, publ. 09/06/2019 bull. No. 25), which can be used to predict the outcome of advanced ovarian cancer after adjuvant chemotherapy according to the scheme AR (cisplatin 75 mg / m2 + doxorubicin 50 mg / m2). For this, the levels of messenger RNA (mRNA) of Vascular endothelial growth factor A (VEGF-A) and excision repair cross complementing (ERCC1) cross complementing genes (ERCC) are carried out at once. The determination of the levels of messenger RNA is carried out in the tumor tissue of the primary patient, obtained intraoperatively, with the subsequent calculation of the integral indicator I according to the proposed formula, and with a value of I <2, the prognosis is considered positive with a probability of 81%, and with a value of I> 2, the prognosis is considered unfavorable in 75% cases. However, the invention provides a prediction of the outcome of ovarian cancer only after adjuvant chemotherapy according to the AR regimen for individualization of tactics and improvement of patient outcomes.

The known "Method for predicting the duration of the recurrence-free interval after the completion of primary treatment of patients with ovarian cancer" (see Patent RU No. 2018111101, publ .: 10.01.2019 bull. No. 1), which can be used in ovarian cancer to improve treatment results by increasing the number of courses or a change in the tactics of adjuvant chemotherapy with unfavorable markers. On the basis of the results of assessing the levels of tumor-associated markers, the duration of the relapse-free interval is predicted, and if: in patients under 40 years of age, the CA125 concentration is higher than 35 U / ml and / or the HE4 concentration is higher than 70 pmol / L; in patients aged 40-50, CA125 concentration is higher than 35 U / ml and / or HE4 concentration is higher than 100 pmol / L; in patients over 50 years of age, the concentration of CA125 is higher than 35 U / ml and / or the concentration of HE4 is higher than 120 pmol / l, then the time of relapse-free course after the end of the primary treatment will not exceed one year. The disadvantage of this method is the definition of a relapse-free period only after the end of the primary treatment of the disease.

The known method "Quantification of hsa-miR-16-5p, hsa-miR-425-5p, hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-101-Zp, hsa-miR-30d -5p and hsa-miR-93-5p in the peripheral blood plasma of women as a method of non-invasive diagnosis of serous borderline cystadenomas and ovarian cystadenocarcene "(see Patent RU No. 2688189 C9, publ. 20.05.2019, bull. No. 14). Proposed quantitative assessment of hsa-miR-16-5p, hsa-miR-425-5p, hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-101-3p, hsa-miR-30d-5p and hsa-miR-93-5p in the peripheral blood plasma of women. The expression level of seven microRNAs (hsa-miR-16-5p, hsa-miR-425-5p, hsa-miR-17-5p, hsa-miR-20a-5p, hsamiR -101-Zp, hsa-miR-30d-5p and hsa-miR-93-5p) with the preferred use of standard DNA for the subsequent calculation of the estimated parameter (OD) when constructing the PLS-DA model. With a value of 0 <OD <4.5, a conclusion is made about the high probability of the presence of a serous ovarian tumor in a woman (serous borderline cystadenomas and serous cystadenocarcinomas of a high degree of malignancy). With a value of -1.8 <OD <0, a conclusion is made about a high probability of the absence of a serous ovarian tumor. The invention provides differential diagnosis of serous ovarian tumors with high accuracy and diagnostic value, but is not associated with the prediction of ovarian cancer.

The defining differences of the proposed method, in comparison with the above, are:

- the method is based on the assessment of the relative expression of the experimentally selected microRNA signature: hsa-miR-150-5p, hsa-miR-140-3p, hsa-miR-221-3p;

- determination of the level of relative expression of miRNA in samples of trephine biopsy of ovaries is carried out by RT-PCR using exogenous reference miRNA cel-miR-39-5p (exogenous control) with a known sequence that is not characteristic of humans, which is introduced before analysis in a standard amount in all samples to normalize the efficiency of isolation and reverse transcription (using this approach increases the reproducibility and reliability of the data obtained);

- the conclusion about predicting the period of relapse-free survival of patients with ovarian cancer is made on the basis of testing samples of trephine-biopsy of the ovaries;

- obtaining complementary DNA is carried out using poly (A) -RT technology using a universal RT primer.

The technical result of the claimed invention is the creation of a new, effective, specific method for predicting disease-free survival of patients with serous ovarian carcinoma.

The technical result is achieved by analyzing the expression of micro-RNA in a sample of ovarian trephine biopsy, including the introduction of exogenous control and isolation of total RNA, reverse transcription followed by amplification in real time, while using highly specific primers for hsa-miR-150- 5p, hsa-miR-140-3p, hsa-miR-221-3p, analyze the obtained data and calculate the prognostic coefficient RS (risk score) using the values of the relative expression hsa-miR-150-5p, hsa-miR-140-3p , hsa-miR-221-3p: RS = (1.96 * expression of hsa-miR-140-3p) + (- 2.7 * expression of hsa-miR-150-5p) + (2.13 * expression of hsa- miR-221-3p), and with values of RS≥13, a relapse-free period of the disease is predicted within 6 months after the end of treatment.

The method is based on the pathogenetic factor of carcinogenesis - aberrant expression of microRNAs associated with the initiation and development of a malignant process, which leads to tumor progression.

The claimed method includes the following steps: homogenization of biopsy, introduction of exogenous control, isolation of total RNA; conducting reverse transcription to generate complementary DNA (cDNA), RT-PCR of the obtained cDNA in the presence of specific primers; data processing to evaluate changes in relative expression in the sample.

The inventive method is carried out as follows.

The resulting trephine biopsy sample is homogenized in Trizol LS® (Life Technologies, Paisley, UK) with the addition of 0.2 M acetic acid to prevent DNA contamination. 3.5 μL of exogenous control (initial concentration 1 * 10 ⁸ copies / μL) is added to the mixture with a volume of 200 μl. Isolation of total RNA from tissue is performed by a suitable extraction method. The isolated RNA is subjected to reverse transcription. Reverse transcription of microRNA is carried out simultaneously with RNA polyadenylation using a universal RT primer (see table 1).

The analyzed sequences of genetic loci are amplified in 20 μl PCR mixture containing 1x PCR buffer, 1x EvaGreen, 0.25 mM dNTPs, 2 mM MgCl2, 1 unit. Act. Taq-DNA polymerase, 0.5 μM forward and reverse primers. Amplification program: 95 ° С - 5 minutes, then 40 cycles (60 ° С - 60 seconds and 95 ° С - 15 seconds). The sequences of PCR primers were selected using the MirBase databases (http://www.mirbase.org/) are shown in Table 1. The RT-PCR of each sample is performed in triplicate.

To assess the risk of progression, the prognostic coefficient RS is calculated using the formula: RS = (1.96 * expression of hsa-miR-140-3p) + (-2.7 * expression of hsa-miR-150-5p) + (2.13 * expression hsa-miR-221-3p)

If the coefficient is ≥13, the patient is referred to the high-risk group (OR = 1.5, p = 0.0002).

The proposed method was tested on 30 patients aged 25 to 76 years, who were treated on the basis of the Federal State Budgetary Institution "National Medical Research Center of Oncology" of the Ministry of Health of Russia. Based on the duration of the disease-free period of the disease, the patients were divided into two groups: group 1 (12 people) with a disease-free form of the disease, group 2 (18 people) with an aggressive rapidly progressing form of the disease.

In order to assess the potential significance of the selected markers, their sensitivity and specificity were calculated, which amounted to 92% and 98%, respectively.

The efficiency of the method for predicting recurrence of serous ovarian carcinoma is illustrated by the following clinical examples.

Example 1.

Patient K., 64 years old, was hospitalized in the Department of Oncogynecology of the Federal State Budgetary Institution of National Medical Research Center of Oncology in June 2019 with complaints of pain in the lower abdomen, an increase in abdominal size, severe weakness, shortness of breath during exercise.

Medical history: considers herself ill since May 2019, when she was treated at the day hospital of the Central Regional Hospital in Stavropol for pain in her right leg. 05/14/2019 noted the appearance of shortness of breath, weakness. An X-ray of the OGK from 06/01/2019 was performed: to the right of the anterior segment of 4 ribs, to the left of the anterior segment of 6 r. intense homogeneous darkening with an oblique upper border. On the right, the dome of the diaphragm is not differentiated. The root is not visible on the right, structural on the left.

Mediastinum in the midline. The aorta was unremarkable.

On 03.06.2019, thoracocentesis was performed, about 2 liters of fluid, c / a of pleural fluid: elements of cancer from the glandular epithelium were evacuated.

CT SCT OGK dated 06/04/19: on the right, the area of consolidation of the lung tissue is determined, welded to the m / lobar pleura, in which the lumens of the subsegmental branches of B8 are partially traced. On the left in S8 there is a site of pleuropneumofibrosis. The organs of the mediastinum were unremarkable. There is fluid in the pleural cavities, more on the right. FBS dated 06/05/2019: dystonia of the trachea, the main bronchi of the 1st degree. Bilateral diffuse atrophic bronchitis. Ultrasound of the abdominal cavity from 06/05/2019: a moderate increase in the size of the liver, diffuse changes in its parenchyma. Ascites.

CT scan of the abdominal organs from 06/06/2019: CT data for the volumetric process in the liver, pancreas, spleen were not detected. Signs of peritoneal carcinomatosis. Bilateral hydrothorax, small sinus cysts of the kidneys. MRI of the pelvic organs from 06/08/2019: MP- signs of carcinomatosis of the peritoneum with the presence of a single node in the small pelvis. A significant amount of free fluid in the pelvic cavity, abdominal cavity. Blood test for tumor markers CA-125-216.3, He-4 more than 1500 pmol / l, ROMA index 96.9% from 14.06.

06/14/2019 performed: laparocentesis (evacuated 3 liters of ascitic fluid), trephine biopsy of the ovary. Ultrasound OMT, OBP dated 06/17/2020, conclusion: ascites, volumetric neoplasms in the small pelvis are not clearly defined. Ascites. Diffuse changes in the liver parenchyma (by the type of fatty hepatosis), pancreas. Renal sinus cysts on both sides. Diffuse changes in the parenchyma of the thyroid gland.

Objective status: general condition of moderate severity. Consciousness is clear. HELL 125/80 mm. Hg T = 36.6 0 C. The skin is pale, dry. Palpable lymph nodes are not enlarged. The abdomen is enlarged due to ascites, tense, painless. Moderately pronounced varicose expansion of the saphenous veins of the lower extremities. Negative peritoneal irritation. Shortness of breath when walking, not at rest. On the right, vesicular breathing, no wheezing, clear pulmonary sound. Left - breathing is heard up to the 6th rib, below the 6th rib there is a dull percussion sound, breathing is not heard.

Physiological functions: stool is normal, diuresis is oliguria. Light yellow urine. No peripheral edema. Height = 160 cm, weight = 89 kg. PPT = 1.99 m ² .

Status genitalis: external genital organs without visible pathology. The cervix is eroded around the outer os, cylindrical in shape. The uterus with appendages is not clearly palpable due to tense ascites. Inguinal lymph nodes are not enlarged. When viewed through the rectum: at the level attainable with a finger, no pathology was revealed. There are traces of feces on the glove.

Laboratory data: general blood test from 01.06.2020: hemoglobin - 136 g / l, erythrocytes - 4.36 * 1012 / l., Leukocytes - 6.84 * 109 / l., Platelets - 278 * 109 / l., Stab - 4%, segmented - 63%, eosinophils - 4%, monocytes - 7%, lymphocytes - 22%. Biochemical blood test from 06/01/2019: total bilirubin 13.2 mol / l, creatinine - 78 mmol / l, glucose - 4.7 mol / l, total protein - 53.7 g / l.

After the examination, the diagnosis was made: ovarian cancer T3cNxM1, polyserositis, (mts in the pleura, peritoneal carcinomatosis) gr. 2.

The patient underwent a study of the relative expression of microRNA hsa-miR-150-5p, hsa-miR-140-3p, hsa-miR-221-3p in an ovarian biopsy (see Table 2).

risk score = (1.96 * 7.5) + (- 2.7 * 6.74) + (2.13 * 8.17) = 13.9

The risk of progression of ovarian cancer is defined as high (risk score> 13).

Considering the locally widespread process: ascites, pleurisy, a council of doctors of the National Medical Research Center of Oncology recommended starting treatment with courses of neoadjuvant chemotherapy according to the following scheme: paclitaxel 175 mg / m2 IV on the 1st day, carboplatin AIS 6 IV on the 1st day 21 -day course. Since June 2019, 3 courses of neoadjuvant polychemotherapy (NAPCT) have been carried out, surgical treatment in the amount of optimal cytoreduction: subtotal hysterectomy with appendages, extirpation of the greater omentum, appendectomy. In the postoperative period, 6 courses of APCT were carried out.

Morphological examination of the postoperative material - in the ovaries, complexes of adenocarcinoma glands with dystrophic changes. Severe fibrosis of the ovarian stroma. Hyalinosis of the white bodies and vascular walls. A pronounced response to the performed neoadjuvant chemotherapy treatment. In the fallopian tubes - atrophy of the mucous membrane, sclerosis of the submucosa. Hypoplastic endometrium. In the myometrium - leiomyomas. In the fatty tissue of the omentum against the background of fibrous tissue, there are single fragments of cancerous glands with dystrophic changes. A large number of psammological bodies. Metastases of high-grade serous carcinoma. In the appendix there are metastases of single cancerous glands, a large number of psammary bodies. Metastases in the serosa of the appendix.

She finished her treatment in January 2020. 4 months after the end of treatment, the follow-up examination revealed the progression of the disease: ascites, hydrothorax, peritoneal carcinomatosis. Diagnosed with ovarian cancer pT3cNoM1, St IVc, polyserositis, (mts in the pleura, peritoneal carcinomatosis), condition after combined treatment 2019-2020, platinum-resistant form, disease progression: hydrothorax, ascites, peritoneal carcinomatosis, gr. 2.

In connection with the relapse, the council of doctors of the National Medical Research Center of Oncology recommended conducting courses of PCT of the 2nd line.

Example 2.

Patient Sh., 41 years old, was admitted to the Department of Oncogynecology of the Federal State Budgetary Institution of National Medical Research Center of Oncology in July 2018 with complaints of pain in the lower abdomen, an increase in abdominal size, a feeling of epigastric discomfort after eating.

Medical history: considers himself ill in mid-May 2018, when pains in the lower abdomen appeared, she began to notice an increase in abdomen in size, a feeling of discomfort in the epigastrium after eating. I consulted a gynecologist at the place of residence in Zverevo, an ultrasound scan was performed on 05/22/18, conclusion: ascites, adenomyosis, structural changes in both ovaries. Ultrasound of the OBP and kidneys from 05/22/2018, conclusion: diffuse changes in the liver, fatty hepatosis, diffuse changes in the pancreas, ascites, microlithiasis on the right.

FGDS performed on 05/28/2018: catarrhal esophagitis, hyperemic erosive gastropathy, FCC from 05/30/2018: sigmoiditis, internal hemorrhoids. Trepan biopsy of the ovarian formation was performed on June 29, 2018: h / a - high grade serous ovarian carcinoma. Blood test for tumor markers Ca-125 - 1767 U / ml, He-4 - 1211.2 pmol / l, ROMA index - 99.5%.

Roentgenogram of the OGK from 10.06.18: roentgenologic right-sided hydrothorax. Under the conditions of the CDO of the National Medical Research Center of Oncology, ultrasound of OMT and BP was performed again on 10.06.2018, conclusion: ascites, diffuse changes in the parenchyma of the liver and pancreas. Consolidation of the wall of the gallbladder. Moderately expressed signs of adenomyosis. The appendages are not clearly visualized.

Objective status: general condition of moderate severity. Consciousness is clear. HELL 125/80 mm. Hg T = 36.6 0 C. The skin is pale, dry. Palpable lymph nodes are not enlarged. The abdomen is soft, slightly enlarged, painless on palpation. On physical examination, there is no data for the presence of free fluid in the abdominal cavity and in the small pelvis. Negative peritoneal irritation. Varicose expansion of the saphenous veins of the lower extremities was not revealed. On the left, vesicular breathing, no wheezing, clear pulmonary sound. On the right - breathing is heard up to the 5th rib, below the 5th rib there is a dull percussion sound, breathing is not heard. Physiological functions: stool is normal, diuresis is adequate to water load. Light yellow urine. No peripheral edema.

Height = 170 cm, weight = 65 kg. PPT = 1.75 m2.

Status genitalis: external genital organs without visible pathology. In the mirrors: the cervix is small, the presence of single retention cysts. During vaginal examination, the uterus is of normal size, dense, mobile, in the posterior fornix of the mts formation of up to 2 cm. In the projection of the uterine appendages, volumetric formations are not investigated. Inguinal lymph nodes are not enlarged. When viewed through the rectum: at the level attainable with a finger, no pathology was revealed. There are traces of feces on the glove.

Laboratory data: ECG from 06/11/2018 - sinus rhythm, heart rate 87 per minute, irrigoscopy from 06/10/2018: no convincing data for the t-r of the intestine were found. C / a smears from the cervix from 06/11/2018: AK were not detected. General blood test from 11.06.2018: hemoglobin - 124 g / l, erythrocytes - 3.94 * 1012 / l., Leukocytes - 8.0 * 109 / l., Platelets - 353 * 109 / l., Stab - 3 %, segmented - 71%, eosinophils - 4%, monocytes - 6%), lymphocytes 20%). Biochemical blood test from 06/11/2019: total bilirubin 23.2 mol / l, creatinine - 83.1 mmol / l, glucose - 5.6 mol / l, total protein - 63.7 g / l

After the examination, the diagnosis was made: ovarian cancer T3cNxM1, group 2, polyserositis (hydrothorax, ascites).

The patient underwent a study of the relative expression of microRNA hsa-miR-150-5p, hsa-miR-140-3p, hsa-miR-221-3p in an ovarian biopsy (Table 3).

risk score = (1.96 * 7.32) + (- 2.7 * 8.62) + (2.13 * 6.91) = 5.8

The risk of progression of ovarian cancer is defined as low (risk score <13).

Considering the locally widespread process: ascites, the hydrothorax consultation of doctors of the National Medical Research Center of Oncology decided to start treatment with courses of neoadjuvant chemotherapy according to the carboplatin + paclitaxel regimen. Since July 2018, 3 courses of NAPHT have been carried out. In August 2018, surgical treatment was performed in the amount of optimal cytoreductive surgery: subtotal hysterectomy with appendages, extirpation of the greater omentum.

In the postoperative period, 6 courses of AGTHT were carried out. She finished her treatment in December 2018.

Morphological examination of the postoperative material - in the ovaries, adenocarcinoma gland complexes. The tumor has extensive foci of necrosis (G3). In the fallopian tubes - atrophy of the mucous membrane, sclerosis of the submucous layer, in the fatty tissue of the omentum - extensive metastases of carcinoma of the above-described structure. In the tumor there are signs of a therapeutic pathomorphosis of the 2nd degree.

At the follow-up examination in September 2020, according to the SRCT of the chest organs and MRI of the abdominal cavity and small pelvis: data for relapse and progression were not revealed. A blood test for tumor markers Ca-125 and He-4 is normal.

Diagnosis: ovarian cancer, St IV (pT3cN0M1), polyserositis, (hydrothorax, ascites), condition after 3 courses of NAPHT, surgical treatment, 6 courses of APCT, class group 2. Clinical remission. Dynamic observation by an oncologist at the place of residence is recommended.

The analysis of the presented clinical cases indicates the possibility of determining the duration of the disease-free interval of the disease using the assessment of the expression of microRNA hsa-miR-150-5p, hsa-miR-140-3p, hsa-miR-221-3p relative to the exogenous control of cel-miR-39-5p ...

The proposed method was carried out to determine the duration of the disease-free period in 30 patients, the results of molecular genetic studies were further confirmed by data from the anamnesis and additional instrumental examinations of the patients.

"A method for predicting recurrence of serous ovarian carcinoma" allows you to predict the risk of recurrence of the disease within the first six months after completion of treatment.

The inventive method is economically justified for diagnosis and makes it possible to formulate treatment tactics even in the preoperative period of the patient; has a high sensitivity (98%) and specificity (92%), its implementation is possible in a minimally invasive way using trephine biopsy of the ovary, the implementation of the method on the basis of a standard PCR laboratory takes less than 8 hours.

--->

Sequence listing

<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii

<120> A method for predicting recurrence of serous ovarian carcinoma

<160> 1

<210> 1

<211> 20

<212> DNA

<213> Homo sapiens

<400> 1

GCAGTCTCCCAACCCTTGTA 20

<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii

<120> A method for predicting recurrence of serous ovarian carcinoma

<160> 1

<210> 2

<211> 27

<212> DNA

<213> Homo sapiens

<400> 1

GTCCAGTTTTTTTTTTTTTTTCACTGG 27

<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii

<120> A method for predicting recurrence of serous ovarian carcinoma

<160> 1

<210> 3

<211> 19

<212> DNA

<213> Homo sapiens

<400> 1

CGCAGTACCACAGGGTAGA 19

<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii

<120> A method for predicting recurrence of serous ovarian carcinoma

<160> 1

<210> 4

<211> 26

<212> DNA

<213> Homo sapiens

<400> 1

CCAGTTTTTTTTTTTTTTTTCCGTGGT 26

<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii

<120> A method for predicting recurrence of serous ovarian carcinoma

<160> 1

<210> 5

<211> 20

<212> DNA

<213> Homo sapiens

<400> 1

CGCAGAGCTACATTGTCTGC 20

<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii

<120> A method for predicting recurrence of serous ovarian carcinoma

<160> 1

<210> 6

<211> 28

<212> DNA

<213> Homo sapiens

<400> 1

TCCAGTTTTTTTTTTTTTTTTGAAACCCA 28

<110> Verenikina, Ekaterina; Natsional'nyy meditsinskiy issledovatel'skiy tsentr onkologii

<120> A method for predicting recurrence of serous ovarian carcinoma

<160> 1

<210> 7

<211> 26

<212> DNA

<213> Homo sapiens

<400> 1

CAGGTCCAGTTTTTTTTTTTTTTTTVN 26

<---

Claims (4)

1. A method for predicting recurrence of serous ovarian carcinoma, which consists in the analysis of the expression of micro-RNA in a sample of trephine biopsy of the ovary, including the introduction of exogenous control and isolation of total RNA, reverse transcription followed by amplification in real time, using primers for hsa-miR-150-5p, hsa-miR-140-3p, hsa-miR-221-3p, analyze the data obtained and calculate the predictive coefficient RS by the formula: RS = (1.96 * expression of hsa-miR-140- 3p) + (-2.7 * expression of hsa-miR-150-5p) + (2.13 * expression of hsa-miR-221-3p), where 1.96, -2.7, 2.13 are the coefficients, and with RS values ≥ 13, predict the risk of disease recurrence within the first six months after completion of treatment. 2. The method according to claim 1, characterized in that primers are used to assess the expression of hsa-miR-150-5p: seq id 1 and seq id 2. 3. The method according to claim 1, characterized in that primers are used to assess the expression of hsa-miR-140-3p: seq id 3 and seq id 4. 4. The method according to claim 1, characterized in that primers are used to assess the expression of hsa-miR-221-3p: seq id 5 and seq id 6.