RU2746362C9 - Combined drug with antiviral effect against new sars-cov-2 coronavirus - Google Patents

Abstract

FIELD: medicine; biotechnology; virology; immunology.SUBSTANCE: combined drug (CD) with an antiviral effect against SARS-CoV-2 coronavirus and related viruses is presented, provided that the genetic target, against which the specific component of this drug is directed, is identical. The combined drug for the prevention or treatment of coronavirus infection caused by SARS-CoV-2 contains: (i) the effective number of siRNA molecules directed against the genome of the SARS-CoV-2 virus, represented as two complementary chains characterized by the (+G)GAAGGAAGUUCUGUUGAA(+T)(+T)dT and UUCAACAGAACUUCCUUCC(+T)(+T)dT structure, where the modified nucleotides in the sense and antisense strand are represented by the LNA modification, (ii) a dendrimer cationic peptide with transfection activity characterized by the R8K4X4K2H2KZC structure, where R is arginine; K is lysine; X is SEQ ID NO 3; H is histidine; Z is phenylalanine (F); C is cysteine or cysteine amide, (iii) a pharmacologically acceptable auxiliary agent (solvent).EFFECT: invention suppresses the replication of SARS-CoV-2 virus, which provides a new opportunity for treatment of COVID19 infection caused by this virus.14 cl, 12 dwg, 9 ex

Description

Technology area

The invention relates to medicine, namely biotechnology, virology, immunology and pharmacology, namely the present invention, in general, relates to the production of a combined drug (CLS) with an antiviral effect against the new coronavirus SARS-CoV-2 and related viruses, provided the identity of the genetic target against which the specific component of the drug is directed. The antiviral effect of CLS is based on the mechanism of RNA interference (RNAi) and includes the specific recognition of the genomic targets of the virus, followed by the involvement of the cell's own protein complexes that destroy the viral genome (and its mRNA transcripts) and thereby disrupt the process of virus reproduction (replication). CLS can be used both in hospital and outpatient to suppress the replication of the SARS-CoV-2 virus, reduce viral load, reduce the risk of airborne transmission of infection, alleviate the symptoms of COVID-19 associated with viral replication, and reduce the risk of developing caused by viral infection clinical complications.

State of the art

In December 2019, an outbreak of severe acute respiratory infection COVID-19 was recorded in the Chinese city of Wuhan, which later became a pandemic. The etiological factor in this pandemic is a new strain of the SARS-CoV-2 coronavirus. The SARS-CoV-2 virus and its related viruses SARS-CoV and MERS-CoV can cause severe respiratory illness in humans and have resulted from the transspecific transition from animals to humans.

SARS-CoV-2, like the SARS-CoV and MERS-CoV viruses, belongs to the Coronaviridae family, genus Beta-coronavirus. In general, coronaviruses are enveloped viruses that have a relatively large (about 30,000 bases) unsegmented genome, represented by single-stranded (+) RNA. Genomic (+) RNA of coronaviruses directly serves as a matrix for the translation of viral proteins. Unlike many other RNA viruses, genomic RNA of coronaviruses is similar in general structure to cellular mRNA: it has a cap structure at the 5 'end and a polyadenyl tail at the 3' end.

After the virus enters the cell, viral replicase (RNA-dependent RNA polymerase) is translated on the matrix of the genomic (+) RNA of the virus, which synthesizes (-) RNA complementary to the genomic RNA. The viral replicase complex includes exonucleases that correct RNA polymerase errors (proofreading activity), and therefore the frequency of mutations in the coronavirus genome is relatively low. On the (-) RNA template, the same replicase synthesizes new copies of genomic (+) RNA, which are incorporated into new virions, as well as shorter subgenomic (+) RNAs, which serve as templates for the translation of viral proteins.

As part of the fight against the new infection, a number of preventive vaccines have been developed, as well as non-specific therapies that facilitate the course of the disease. However, in addition to existing therapies, specific drugs are needed that have a direct effect on the virus, leading to relief of symptoms of the disease, accelerated resolution of the disease, blocking the transmission of infection and reducing the risk of developing clinical complications.

Currently, the patent literature contains data on the successful use of small interfering RNAs (miRNAs) against infections caused by various viruses, including coronaviruses.

In patent CN 101173275 B (07.05.2008) an invention is described, which is two double-stranded RNA molecules (dsRNA) directed to two separate regions of the viral RNA encoding the protein M of the SARS-1 virus (SARS-CoV-1). One of the siRNA molecules is directed to the region with coordinates 220-241 of the viral RNA encoding the SARS M-protein, while the second is directed to the region 460-480. The combination of these two miRNA molecules inhibited the expression of viral genes by more than 70%.

Document CN 1648249A (03.08.2005) describes siRNA sequences designed to suppress the expression of the M, N, and E genes of the SARS-CoV-1 virus. It was shown that three of them (No. 15, 58 and 90) inhibit the expression of fusion proteins GFP-M, GFP-N and GFP-E, respectively. Three more siRNA molecules (# 8 *, 51 * and 56 *) contained a modification at the 3 'end of the sense strand. These modified siRNAs more efficiently inhibited the expression of genes from the SARS-CoV-1 virus compared to the original siRNAs.

In the document US 20050004063 A1 (06.01.2005) six siRNA molecules (SARSi-1-b) are disclosed directed to the genome region encoding the replicase 1A of the SARS-CoV-1 virus. It was shown that the most efficient siRNA was SARSi-4 (5'-gcacuugucuaccuugaugtt-3 '). In addition, this patent describes siRNAs (SARSi-7-ll) directed to the region of the genome encoding the S, E, N and M genes of the SARS-CoV-1 virus. The authors showed that SARSi-2, SARSi-3, SARSi-4 and SARSi-7-ll inhibited the replication of SARS-CoV-1 coronavirus in FRhk-4 cell culture. The most effective was siRNA SARSi-4, which almost completely inhibited viral replication. It was followed by SARSi-2 and SARSi-3.

Also known are siRNA sequences designed to suppress the expression of genes encoding RNA-dependent RNA polymerase, helicase, nucleoprotein N and proteolytic enzymes of the SARS-CoV-1 virus. These siRNAs inhibited the replication of the SARS-CoV-1 coronavirus strain BJ01 by 50-90%. The most effective were miRNAs directed to genes encoding proteolytic enzymes (CN 1569233A, January 26, 2005). The sequences of three siRNA molecules directed to the gene encoding ORF3a of the SARS-CoV-1 virus (CN 101085986B, 12.12.2007) are disclosed. This gene plays an important role in viral replication, so the engineered siRNA molecules effectively suppress viral replication.

The effectiveness of 62 siRNA molecules (the ability to inhibit the replication of SARS-CoV-1) directed to different regions of the genome of the SARS-CoV-1 virus was tested in a Vero and / or FRhk-4 cell culture (US 20070270360 A1, 22.11.2007).

Document CN 101182517 A (05/21/2008) describes a mixture of miRNA molecules directed to different targets. In particular, to the region of the SARS-CoV-1 virus genome encoding the Spike protein (5'-AAGCTCCTAATTACACTCAAC-3 '), nsp-9 protein (5-AAGGATGAGGAAGGCAATTTA-3'), nsp-10 (5'-AAGGATAAGTCAGCTCAATGC-3 ' ) and nsp-13 (5'-ACTGGCACACTACTTGTCGA-3 '). The efficiency of the miRNA mixture was tested in a FRhK-4 cell culture infected with the SARS-CoV-1 virus.

A study is known that was carried out on rhesus monkeys infected with SARS-CoV-1. A mixture of siRNA preparations was injected in an amount of 30 mg (5% glucose solution) per animal (US 2007/0203082 A, 30.08.2007).

In document WO 2004092383 A2 (10.02.2005), the invention includes several types of nucleic acids such as siRNA, microRNA (miRNA) and short hairpin RNA (shRNA), as well as methods used to modulate the expression of SARS virus RNA CoV-1. Similar inventions are described in US patent 20040192626 A1 (30.09.2004) and in US patent 20050020525 A1 (27.01.2005). The difference from the drug under development is that it contains only miRNAs that inhibit the reproduction of SARS-CoV-2.

Patent CN 102453712 B (19.02.2014) describes an invention based on siRNA for inhibiting the replication of the SARS-CoV-1 virus by siRNA molecules directed to the host gene encoding PI4KB (phosphatidylinositol 4-kinase IIIβ). This enzyme mediates the entry of the virus into the cell. In contrast to the drug under development, the siRNAs described in patent No. CN 102453712 B are directed not to the viral genome, but to the genome of the host cell.

US patent 7339051 B2 (03/04/2008) describes oligomeric compounds consisting of 8-80 nitrogenous bases directed to the SARS-CoV-1 genome. These compounds hybridize to viral nucleic acid and reduce SARS-CoV-1 replication by at least 50%. They are aimed at the reading frames of the genome of the SARS-CoV-1 virus and, when hybridized with viral RNA, regulate the process of ribosomal shift of the reading frame. In contrast to the preparation under development, US Pat. No. 7,339,051 B2 describes antisense RNAs and ribozymes.

The closest in technical solution are the inventions CN 111139241 A from 05/12/2020 and CN 111139242 A from 05/12/2020, disclosing small interfering nucleic acids for inhibiting the new SARS-CoV-2 coronavirus strain. The difference between the claimed agent is a new, previously not described composition of miRNA molecules directed against the SARS-CoV-2 genome in the regions encoding RNA-dependent RNA polymerase (RdRP), leader protein (nsp1) and gene N, which inhibit the replication of this virus.

However, it should be noted that the introduction of siRNA-based drugs into clinical practice is limited by a number of factors, which include insufficient efficiency and safety of siRNA delivery vehicles to target cells. In addition, an important limitation is the need to control the specificity of the miRNAs used and to reduce the nonspecific effect of miRNAs on the activity of other genes, including genes in the human genome.

It is known that siRNA can be delivered to mammalian cells in in vitro and in vivo experiments in a variety of ways known to those skilled in the art, including direct contact with cells ("deproteinized" siRNA) or the use of a combination with one or more agents.

Currently known inventions for intracellular delivery of nucleic acids (NK), incl. miRNA, by transfection, based on lipids, polymers, cationic peptides. The most promising among them are dendrimeric cationic peptides (DCP). DCPs are branched three-dimensional structures with a dense hydrophobic core and an outer layer of positively charged groups (for example, amino or guanidine groups). The presence of a large number of terminal cationic groups allows DCP to effectively bind and condense NC. The use of DCPs for transfection largely eliminates the problem of proteolytic resistance due to the fact that they contain unnatural ε-amide bonds that are inaccessible to natural enzymes.

Many methods for the preparation of complexes of dendrimers with siRNA and plasmids and protocols for their delivery into cells are widely published, but most sources use dendrimeric derivatives of diamino ethane / propane / butane as a dendrimeric base, which do not have a definite structure and are incapable of biodegradation (for example, in patent PCT / GB02 / 04706 dated 04.24.2003 "Dendrimers for use in targeted delivery").

In US patent 6376248 from 23.04.2002 "Peptide-enhanced transfections" describes numerous compositions for transfection of eukaryotic cells, including complexes of NK with peptides, where the nucleic acid is covalently linked to a linear cationic TAT peptide (from HIV), dendrimer or lipopeptide. The dendrimers are derivatives of the non-peptide dendrimer PAMAM (from Dendritech Inc.), to the end groups of which lysine (LysDmer) or arginine (ArgDmer) residues are attached. However, the known solution is highly toxic, difficult to obtain, and has a limited shelf life.

Known publication [1], which describes the use of DCP, a variant of the polylysine dendrimer, where phenyl-imidazole residues are introduced into the terminal branches of the dendrimer to increase the amphipathicity of the molecule. The highest efficiency in terms of protecting NK (for example, plasmid DNA) from degradation by nucleases was obtained using a polylysine dendrimer with a branching degree of 5 (G5 generation), the same drug, the only one, showed acceptable transfection efficiency. In another work by the same authors [2], dendrimers with the generation of G5, with terminal arginine residues, showed high efficiency in transfection of cells with plasmid DNA and subsequent expression of the GFP (green fluorescent protein) or pGL3 (luciferase) gene. The dendrimer with G6 generation, although it was also effective, turned out to be much more toxic, probably due to the high density of the positive charge. It should be noted that the yield in the synthesis of such dendrimers is rather low and the preparations were not used to suppress gene expression (using RNAi).

Patent CN 102911252 B from 06.02.2013 "Cationic lipid containing peptide dendrimer, transgenic carrier and preparation method and application of transgenic carrier" describes compounds as carriers for intracellular delivery of plasmids containing GFP or pGL3 genes. The structure of the described carriers contains a short arginine-containing dendrimer with a lipid moiety containing cholesterol. However, transfection in the RNA interference (miRNA) format is not described in the patent.

In patent RU 2575603 dated 20.02.2016 (PCT: EP 2011/003719) "Obtaining complexes of nucleic acids and cationic components cross-linked by disulfide bonds, intended for transfection and stimulation", the authors propose to use a composition containing a polymer carrier and a carrier molecule in as an immunostimulating agent or adjuvant. Including claimed oligopeptides and proteins with the general formula (Arg) ₁ ; (Lys) _m ; (His) _n ; (Orn) _o ; (Xaa) _x , however, the authors do not indicate whether these are linear peptides or dendrimers. Single-stranded RNA is used as NK in order to induce innate or adaptive immunity.

The article [3] describes G3-generated LTR for transfection of cells with miRNA molecules. Lysine-based dendrimeric peptides contain a hydrophobic region, represented by either hydrophobic amino acids or fatty acids, in order to more efficiently exit from the endosome into the cytoplasm after the internalization of the cell by the NK / peptide complex. Among them, the most active DCTs in _{miRNA transfection were: (KL) 8} (KKL) ₄ (KLL) ₂ KK (C ₁₆ ) K (C ₁₆ ) and (KL) ₈ (KKL) ₄ (KLL) ₂ KLLLL) However, it must be emphasized that the synthesis and purification of such peptides (37 and 39 amino acids long + fatty acids) is a rather complicated and extremely expensive procedure (done by hand), resulting in very low yields (less than 10 percent).

The article [4] describes the use of polylysine dendrimers containing more than 40 lysine residues for improved delivery of DNA (plasmids) into cells as agents for antitumor therapy, indicates a high rate and efficiency of transfection, as well as relatively low toxicity to healthy tissue. Their use for RNAi has not been described. Obviously, due to the high molecular weight, the yields of peptides during solid-phase synthesis were very low.

The dendrimeric peptide LTP, described in patent RU 2572575 C1 dated 20.01.2016, has transfection activity in the formation of complexes with NA, low toxicity to mammalian cells. However, compared to the liposomal delivery vehicle for in vitro studies Lipofectamine ^® 2000, LTP has a transfection activity 2-3 orders of magnitude lower.

Thus, there is currently an urgent need to develop a new antiviral agent effective against the new SARS-CoV-2 coronavirus. One of the ways to achieve this goal is the creation of CLS with a specific antiviral action, which suppresses the reproduction of the virus by the RNAi mechanism.

The CLS according to the present invention includes a DCT that delivers siRNAs directed against the genome of the SARS-CoV-2 virus into the cell. DCT forms complexes with negatively charged miRNAs and condenses them into compact nanostructures, and this, on the one hand, protects miRNAs from the action of nucleases, and on the other hand, promotes their translocation across cell membranes due to endocytosis. As part of CLS, DCP is in excess, providing a total positive charge of the entire complex, which increases the efficiency of its penetration into cells, because the cell surface usually carries a negative charge.

Summary of the invention

The present invention generally provides a novel treatment for conditions and disorders associated with COVID-19 symptoms.

The objective underlying the present invention is to provide a novel etiotropic antiviral agent with high efficacy against SARS-CoV-2.

The solution to this problem is provided by obtaining a combined drug with created miRNA molecules capable of mediating the target-specific suppression of the replication of the SARS-CoV-2 virus through the RNAi mechanism, and DCT, which has increased transfection activity and acts as a carrier for miRNA molecules.

In a general embodiment, CLS for the prevention or treatment of coronavirus infection caused by SARS-CoV-2 comprises: (i) an effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus, presented as two complementary strands with nucleotide sequences SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 4 - SEQ ID NO 33, or containing a modification of LNA in one or more positions of the sense and antisense chains of these sequences, (ii) dendrimeric cationic peptide KK-46), which has transfection activity and is characterized by structural formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is 5 amino acids in any order, where the amino acids are: tryptophan (W), leucine (L), isoleucine (I), threonine (T), valine (V), proline (P), glutamic acid (E); H - histidine; Z is a hydrophobic amino acid residue containing alanine (A) or phenylalanine (F); C is cysteine or cysteinamide, (iii) a pharmaceutically acceptable excipient (solvent).

и

где знаком «+» отмечены LNA-модифицированные нуклеотиды, a dT - обозначен дезокситимидин.The effective number of miRNA molecules directed against the genome of the SARS-CoV-2 virus is also presented in the form of two complementary strands of the structure

and

where "+" marks LNA-modified nucleotides, and dT indicates deoxythymidine.

An effective amount of a dendrimeric cationic peptide having transfection activity contains a linear stretch of amino acid residues represented by SEQ ID NO 3.

CLS (siRk-12-EM / KK-46) according to the present invention contains: (i) an effective amount of siRNA molecules (siRk-12-EM) directed against the genome of the SARS-CoV-2 virus, presented in the form of two complementary strands characterized by structure (+ G) GAAGGAAGUUCUGUUGAA (+ T) (+ T) dT and UUCAACAGAACUUCCUUCC (+ T) (+ T) dT, where the modified nucleotides in the sense and antisense strand are represented by the LNA modification (ii) LTR, which has transfection activity and is characterized by the structure R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is SEQ ID NO 3; H - histidine; Z is phenylalanine (F); C - cysteine or cysteinamide.

The effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus in CLS is from 1 μg to 10 g, preferably from 1 μg to 100 mg, in particular from 10 μg to 10 mg and cationic dendrimeric peptide from 1 μg up to 10 g, preferably from 10 μg to 1 g, in particular from 1 mg to 100 mg.

The combined medicinal product is intended for inhalation or intranasal administration.

A method of treating the prevention or treatment of coronavirus infection caused by SARS-CoV-2 includes introducing the claimed CLS into the mammalian body in an effective amount. The combination drug is administered simultaneously, separately, or sequentially with other therapeutic agents. In this case, the method of treatment includes inhalation or intranasal administration of CLS.

The kit for preparing a combination medicament contains at least two sulfur containers, where the first container contains component (A): an effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus, presented as two complementary strands with nucleotide sequences SEQ ID NO 1 , SEQ ID NO 2, SEQ ID NO 4 - SEQ ID NO 33, or containing a modification of LNA in one or more positions of the sense and antisense strands of these sequences, the second container contains component (B): a dendrimeric cationic peptide with transfection activity and characterized by structural formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is 5 amino acids in any order, where the amino acids are: tryptophan (W), leucine (L), isoleucine (I), threonine (T), valine (V), proline (P), glutamic acid (E); H - histidine; Z is a hydrophobic amino acid residue containing alanine (A) or phenylalanine (F); C - cysteine or cysteinamide, and instructions for use.

The kit additionally contains one or more containers with a pharmaceutically acceptable excipient. In the set, components (A) and component (B) are in lyophilized form.

и

где модифицированные нуклеотиды в смысловой и антисмысловой цепи представлены модификацией LNA. Компонент (В) представляет собой катионный дендримерный пептид со структурной формулой R₈K₄X₄K₂H₂KZC, где R - аргинин; K - лизин; X - SEQ ID NO 3; Н - гистидин; Z - фенилаланин (F);C - цистеин или цистеинамид, в виде биосовместимой соли или основания.In one embodiment of the invention, the kit contains component (A), where the effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus is presented in the form of two complementary strands characterized by the structure

and

where the modified nucleotides in the sense and antisense strand are represented by the LNA modification. Component (B) is a cationic dendrimeric peptide with the structural formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is SEQ ID NO 3; H - histidine; Z - phenylalanine (F); C - cysteine or cysteinamide, in the form of a biocompatible salt or base.

The technical result consists in creating an effective antiviral agent that suppresses the replication of the SARS-CoV-2 virus and its safe delivery to target cells.

This technical result is achieved in that synthetic miRNAs, which are duplexes of complementary single-stranded RNAs with the nucleotide sequences of SEQ ID NO 1 and SEQ ID NO 2 or, in embodiments, the sequences of SEQ ID NO 4 - SEQ ID NO 33, specifically affect one or more sites in the genome of the SARS-CoV-2 virus or on the mRNA transcripts of the virus. The technical result according to the present invention is achieved in that synthetic siRNAs with the sequences SEQ ID NO 1 and SEQ ID NO 2 are created, where these siRNAs are directed against the region in the SARS-CoV-2 genome encoding RdRp.

и

где знаком «+» отмечены LNA-модифицированные нуклеотиды, a dT - обозначен дезокситимидин, где указанные миРНК осуществляют более эффективное блокирование репликативного цикла вируса по сравнению с не модифицированными миРНК. При этом модификация молекулы миРНК нуклеотидами LNA приводит к увеличению резистентности миРНК, к воздействию нуклеаз с сохранением антивирусного эффекта, что в итоге обеспечивает пролонгированный противовирусный эффект.Also, the specified technical result is achieved by creating a CLS containing modified synthetic miRNA structures

and

where the "+" sign indicates LNA-modified nucleotides, and dT - denotes deoxythymidine, where these siRNAs perform more efficient blocking of the viral replicative cycle compared to unmodified siRNAs. At the same time, modification of the miRNA molecule with LNA nucleotides leads to an increase in miRNA resistance, to the action of nucleases while maintaining the antiviral effect, which ultimately provides a prolonged antiviral effect.

Also, the specified technical result is achieved by the fact that efficient and safe delivery of the obtained synthetic miRNAs is ensured using DCP, which has transfection activity, which provides a total positive charge of the entire complex, which increases the efficiency of its penetration into cells and is characterized by the structure R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is SEQ ID NO 3; H - histidine; Z is phenylalanine (F); C - cysteine or cysteinamide, which allows antiviral therapy based on the RNAi mechanism.

The essence of the claimed group of inventions is illustrated by drawings.

Brief description of graphic materials

FIG. 1. Schematic representation of the genome of the SARS-CoV-2 virus indicating the targets against which the siRNA of the present invention is directed and its variants (nsp1 - leader protein, RdRp - RNA polymerase, N - nucleoprotein).

FIG. 2. Schematic representation of the mechanism of the biological effect of drugs based on siRNA molecules directed against genomic targets of coronaviruses.

FIG. 3. Modified siRNA has increased resistance to nuclease degradation: a) The stability of unmodified siRk-12 (round marker) and modified siRk-12-EM (square marker) in 50% mouse serum was compared for 264 h at 37 ° C (N = four). b) For this, aliquots of each sample (3 μg siRNA per gel lane) were analyzed by 1.5% agarose gel electrophoresis. The amount of miRNA at different time points was calculated by the analysis of electrophoregrams using the ImageLab software (BioRad). Differences between several groups were analyzed by ANOVA with Dunnets' test.

FIG. 4. Plasmid constructs and the position of binding sites for siRNA molecules in the SARS-CoV-2 genome. Diagram of a bicistronic expression plasmid encoding firefly luciferase (Luc) and full-length RdRp enzyme (pVAX1-pRdRp-full-IRES-LUC) (a) Nsp1 (pVAX1-LP-IRES-LUC) (b), or N (pVAX1-N- IRES-LUC) (c), d) positions of siRNA binding sites in the SARS-CoV-2 genome. The region of the ORF1 gene (nsp1-leader protein), on which the RT-PCR-RT test system was created for the quantitative detection of viral load in cells, was marked.

FIG. 5. Antiviral effect of miRNA molecules in in vitro experiments on a model using recombinant plasmids. Hep-2 cells were transfected with each of the plasmids encoding the SARS-CoV-2 genes and the firefly luciferase gene (pVAX1-pRdRp-full-IRES-LUC) (a), pVAX1-N-IRES-LUC (b) or pVAX-LP -IRES-LUC (c) followed by specific transfection directed against the genome of SARS-CoV-2 or control siRNA. As positive and negative controls, siRNAs directed against the luciferase gene (siLuc) and the fluorescent protein GFP gene (siGFP) were used. Lipofectamine3000 has been used as a delivery vehicle for plasmids and siRNA. After 24 hours, the cells were harvested, lysed and the luciferase activity in the lysates was assessed. Data are expressed as relative luminescence units (RLU) per 10,000 cells. Differences between several groups were assessed using the Kruskal-Wallis test followed by the use of the unpaired Mann-Whitney U-test (if necessary). The diagram shows the medians of five independent experiments ± SD.

FIG. 6. Antiviral effect of miRNA molecules in in vitro experiments on a model of infection of Vera E6 cells with the SARS-CoV-2 virus. Vero E6 cells were transfected with siRNA / Lipofectamine3000 complexes. The complexed medium was removed four hours after transfection and the cells were infected with SARS-CoV-2 at an MOI of 0.0001. The viral load was determined by RT-PCR-RT. Results are expressed as virus RNA copies per ml. Differences between several groups were assessed using the Kruskal-Wallis test followed by the use of the unpaired Mann-Whitney U-test (if necessary). The diagram shows the medians of five independent experiments ± SD.

FIG. 7. Inhibition of SARS-CoV-2 replication in in vitro experiments by complexes consisting of unmodified or LNA-modified siRNAs (siRk-12 and siRk-12-EM) and DCT KK-46. Vero E6 cells were transfected with siRk-12 / KK-46 or siRk-12-EM / KK-46 complexes at three concentrations (x-axis). Complexed media were removed four hours after transfection and cells were infected with SARS-CoV-2 at MOI = 0.0001. Supernatants and cells were harvested after 48 hours. Viral load was determined by RT-PCR-RT in cell lysates (a) and cell supernatants (b). Results are expressed as viral RNA copies per ml. Differences between several groups were assessed using the Kruskal-Wallis test followed by the use of the unpaired Mann-Whitney U-test (if necessary). The diagram shows the medians of five independent experiments ± SD.

FIG. 8. Evaluation of transfection activity of DCP KK-46 on Vero C1008 (E6), HEK293, A549, HepG2, HEP, HeLa cells. Cells were transfected with DCP in 3 dilutions (with mass ratios of peptide to NK - 50: 1, 25: 1, and 12.5: 1) in a complex with the pGL3 Luciferase Reporter Vector plasmid (0.3 μg). The commercial transfection agent Lipofectamine2000 (Lf) in complex with pGL3 was used as a positive control. Plasmid pGL3 without carrier (P1) was used as a negative control. Data are expressed in relative luminescence units (RLU). Differences between several groups were analyzed using Student's t test using Statistica 8.0 software. The diagram shows the medians of five independent experiments.

FIG. 9. Chemical scheme for the synthesis of DCP KK-46.

FIG. 10. Transfection properties of DCT KK-46. Hep-2 cells were transfected with pGL3 Luciferase Reporter Vector (0.25 μg) and KK-46 DCT (x-axis) in various mass ratios 100: 1, 50: 1, 25: 1, 20: 1, 12.5: 1 , 5: 1. The luciferase activity was assessed one day after transfection. The pGL3 / Lipofectamin3000 complex was used as a positive control. Data are expressed in relative luminescence units (RLU). Differences between groups were analyzed by ANOVA using Tukey's test. The diagram shows the medians of five independent experiments, * P <0.05, ** P <0.01.

FIG. 11. Dose-dependent inhibition of SARS-CoV-2 replication in the lungs of hamsters after inhalation of siRk-12-EM / KK-46 CLS, consisting of modified siRNA molecules (siRk-12-EM) and KK-46 DCT in in vivo experiments. Syrian hamsters were infected with SARS-CoV-2 at a dose of ¹⁰ May PFU per animal and treated with three doses KLS siRk-12-EM / KK-46 (0.7, 1.96 and 5.6 mg / kg). Inhalations with complexes were repeated daily for six days. Two and six days after infection, animals were sacrificed and the viral titer (a) and gross assessment plus assessment of histopathology (b) in the lungs were performed. Hydroxychloroquine was administered per os (within 1 hour after infection at a dose of 3.8 mg / animal, and then daily for 6 days after infection at 1.5 mg / animal). The results are expressed as pfu per ml (a) or points (b) obtained for histological analysis of pathological changes in the lungs of hamsters; c) a dose-response curve of viral titer in the lungs on the sixth day after infection, where the ED ₅₀ is ˜3.453 mg / kg. Differences between multiple groups were assessed using the Kruskal-Wallis test followed by testing using the unpaired Mann-Whitney U test. The chart shows the medians of one experiment (five animals per group) ± SDs.

FIG. 12. Influence of multiple inhalation injections of siRk-12-EM / KK-46 KLS (containing modified siRk-12-EM miRNA molecules and KK-46 DCT) at low doses in Syrian hamsters. Syrian hamsters were infected with SARS-CoV-2 at a dose of 10 ⁵ PFU / animal and subjected to aerosol treatment with various doses of the drug (0.175, 0.35 and 1.0 mg / kg) twice a day with an interval of two hours. Thus, the daily dose of the drug was 0.35, 0.7 and 2 mg / kg. Two and six days after infection, animals were sacrificed, viral titers were analyzed (a), and macroscopic assessment and assessment of histopathological lesions (b) in the lung were performed. Favipiravir was administered per os (1 hour after infection, a dose of 1.2 mg per animal was administered twice a day, and then daily for 6 days after infection, 0.4 mg per animal twice a day). The results are expressed as pfu per ml (a) or points (b) obtained for histological analysis of pathological changes in the lungs. Differences between multiple groups were assessed using the Kruskal-Wallis test followed by testing using the unpaired Mann-Whitney U test. The chart shows the medians of one experiment (five animals per group) ± SDs.

Detailed description of the invention

Variants of CLS provided herein include, but are not limited to, the pharmaceutical compositions of this invention. The expression "pharmaceutical composition" refers to a composition with one or more pharmaceutically acceptable carriers, diluents, or excipients generally acceptable in the art for delivering a compound or drug to a mammal, eg, a human.

"Pharmaceutically acceptable" refers to those compounds, materials, compositions and / or dosage forms that, within the limits of reasonable medical judgment, are suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic reaction or complication.

Pharmaceutical dosage forms may additionally contain a pharmaceutically acceptable excipient, which in this context includes, but is not limited to, any solvents, dispersion media, diluents or other liquid carriers, dispersion or suspension additives, surfactants, isotonic agents, thickeners or emulsifiers , preservatives and the like, in accordance with the specific required dosage form.

Accordingly, the dosage forms according to the present invention may contain one or more auxiliary substances, each in an amount that can increase the stability of siRNA, increase the cellular transfection of siRNA.

Dosage forms of the pharmaceutical compositions described herein can be prepared by any known method. In general, such preparation methods include the step of contacting the active ingredient with an adjuvant and / or one or more adjuvants.

In specific embodiments, a pharmaceutical composition provided herein is formulated such that the active ingredients contained therein are bioavailable upon administration of the composition to a subject. In embodiments, pharmaceutical compositions can be prepared by combining siRNA and DCP molecules with an appropriate pharmaceutically acceptable carrier, diluent or excipient, and can be formulated as solid (lyophilized) or liquid formulations. However, in certain embodiments, these compounds can be dissolved or suspended in sterile water, saline, phosphate buffered saline, or any other solvent designed to provide physiological conditions for the functioning of CLS.

CLS of the present invention can be produced in a dosage form intended for inhalation administration. In one embodiment of the present invention, the solid dosage form (lyophilisate) is dissolved or dispersed in a liquid medium prior to use, and the resulting suspension, emulsion or solution is administered by inhalation. The inhalation procedure is carried out for 5-20 minutes using a nebulizer.

Such pharmaceutical compositions can be prepared, packaged as lyophilisates, solutions and / or suspensions, optionally sterile, containing the active ingredients, and can conveniently be administered using any nebulization and / or atomization device.

Such formulations may further contain one or more additional ingredients, including, but not limited to, a flavoring agent such as sodium saccharin, volatile oil, buffering agent, surfactant and / or preservative.

The formulations described herein as suitable for intrapulmonary delivery are also suitable for intranasal delivery of a pharmaceutical composition and may be formulated as nasal drops or nasal spray.

Formulations suitable for inhalation or nasal administration may contain, for example, from only about 0.1% (w / w) and up to 100% (w / w) active ingredient, and may contain one or more additional ingredients specified in the present description.

According to the present invention, CLS can be used for the prevention or treatment of COVID-19 caused by SARS-CoV-2.

The term "treatment" refers to partially or completely reducing, ameliorating, ameliorating, ameliorating, delaying, inhibiting progression, decreasing the severity, and / or decreasing the incidence of one or more symptoms or signs of a particular infection, disease, disorder and / or condition. Treatment can be administered to a subject showing no signs of disease, infection, disorder and / or pathological condition, and / or a subject showing only early signs of disease, infection, disorder and / or pathological condition to reduce the risk of developing pathology associated with the disease, infection , disorder and / or pathological condition.

Of particular interest is the treatment of an existing disease where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient.

As used herein, the phrase "improving at least one symptom" refers to ameliorating one or more symptoms of a disease or condition for which a subject is being treated.

CLS can be administered early in the infection during the incubation phase, or during active infection after the onset of symptoms.

In one of the embodiments according to the present invention, siRNAs in the CLS composition can be administered in a therapeutically effective amount, as well as with other prophylactic or therapeutic compounds.

In this context, the term "therapeutically effective amount" means an amount of an agent to be delivered (eg, siRNA) that is sufficient when administered to a subject suffering from or susceptible to infection, disease, disorder and / or pathological condition, for the purpose of treating, improving symptoms, prevention and / or delay of the onset of infection, disease, disorder and / or pathological condition.

The "therapeutically effective amount" can vary depending on factors such as the condition of the disease, the age, sex, and weight of the individual, and the means for obtaining the desired response from the individual. A therapeutically effective amount also refers to one in which any toxic or deleterious effects of the agent are outweighed by the therapeutically beneficial effects.

CLS is administered simultaneously, separately, sequentially with other therapeutic agents, or in combination with other known methods of treating viral infection, in particular with respect to the new SARS-CoV-2 coronavirus or related viruses, provided that the genetic target against which the CLS is directed is identical. Such therapeutic agents can be adopted in the art as standard treatment for a particular condition described herein, such as COVID-19.

The siRNA molecules of the present invention can be prepared by conventional methods in this field, including chemical synthesis or expression of nucleic acid in vitro or in vivo. In one embodiment, siRNA is prepared using solid phase chemical synthesis.

The siRNA molecules of the invention are double-stranded and contain 21 (in the unmodified version of SEQ ID NO 28, SEQ ID NO: 29) or 22 (in the modified version of SEQ ID NO 1, SEQ ID NO 2) base pairs.

The effective amount of small interfering RNA molecules is the amount required to effect at least 25% reduction in a parameter, for example, inhibiting the replication of coronavirus genes. The range of the effective amount of siRNA is 0.001-5.0 mg / ml.

In some embodiments, "suppression" or "silencing" or "inhibition" are used interchangeably to refer to down-regulation of the expression of a target sequence product relative to its normal expression level in a wild-type organism. Suppression includes expression that decreases by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the wild-type expression level.

In certain embodiments, the composition can reduce the level of expression in a cell by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 20%, about 25%, about 30%, about 35 %, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80% ", about 85%, about 90%, about 95% , approximately 100% compared to a cell that was not in contact with the composition.

As used herein, the terms "decrease" or "decrease" or "decrease" or "decrease" or "attenuation" refer generally to the ability of the provided compositions to produce or elicit a lesser physiological response as compared to the response elicited by a control molecule / composition, for example, A "decreased" or "decreased" response is usually a "statistically significant" response and may include a decrease of 1.1, 1.2, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times.

In general embodiments, nucleotides in one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22) positions independently in one or both strands of the miRNA molecule are modified, which does not lead to a change in the property of specific targeting to the viral genome.

In another embodiment of the present invention, the siRNA molecule may contain at least one modified nucleotide analog. Nucleotide analogs can be located at positions that do not substantially determine target-specific activity, for example, RNA mediating activity, for example, in the region at the 5'-end and / or 3'-end of the double-stranded RNA molecule. The modified siRNA of the present invention may contain one or more chemically modified ribonucleotides of an antisense strand or a sense strand, or both at the same time.

Modifications can be used to improve in vitro or in vivo characteristics such as stability, potency, immunogenicity, and / or bioavailability.

In particular, each siRNA nucleotide sequence may contain at least one modified nucleotide analog.

Modifications in accordance with the present invention can be modifications of ribonucleic acids (RNA), for example, modified with blocked nucleic acids (LNA).

The sequence of the double-stranded RNA molecule of the present invention has sufficient identity to the target nucleic acid molecule to mediate target-specific RNAi.

Identity means the degree of sequence relatedness between nucleotide sequences, which is determined based on the coincidence of the order and nature of nucleotides in the sequences. In one embodiment, an antisense siRNA strand having 80% and 80% up to 100% complementarity, e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92% complementarity , 93%, 94%, 95%, 96%, 97%, 98% or 99% with the target mRNA sequence is considered substantially complementary and can be used in the present invention. Percentage of complementarity describes the percentage of consecutive nucleotides in a first nucleic acid molecule that can form base pairs according to the Watson-Crick rule with a group of consecutive nucleotides in the second nucleic acid molecule.

DCT variants according to the present invention are represented by the general formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where

R is arginine;

K is lysine;

X is 5 amino acids in any order, where the amino acids are: tryptophan (W), leucine (L), isoleucine (I), threonine (T), valine (V), proline (P), glutamic acid (E);

H - histidine;

Z is a hydrophobic amino acid residue, preferably alanine (A) or phenylalanine (F);

C - cysteine or cysteinamide.

The cationic dendrimeric peptide is represented by the structural formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is SEQ ID NO 3; H - histidine; Z is phenylalanine (F); C - cysteine or cysteinamide, in the form of a biocompatible salt or base.

In basic embodiments, the L - amino acids at one or more positions can be replaced by D - isomeric residues, the C - end of the peptide can be either in the carboxyl or in the amide form, which does not lead to a change in the specific transfection properties.

In another embodiment of the present invention, the DCP molecule may contain a different order from a set of amino acids located at positions that substantially determine the transfection activity by a complex of hydrophobic properties, for example, between the second and third branch points.

Any of the variants of the DCP can be obtained in the form of a biocompatible salt (for example, trifluoroacetate, acetate, chloride, phosphate) or base.

The range of effective amount of DCP is 0.01-50.0 mg / ml.

The mass ratio of small interfering RNA molecules to DCP as a whole can be from 2: 1 to 1: 2000, for example, from 1: 1 to 1: 1000, from 1: 2 to 1: 100, or from 1: 5 to 1:50. More preferably, this ratio is from 1:10 to 1:50, for example from 1:15 to 1:25.

Solvents include, but are not limited to, phosphate buffers, pyrogen-free water, isotonic saline.

In another aspect, the present invention relates to a method for the manufacture of a combination medicament for use in inhibiting the replicative cycle of the SARS-CoV-2 virus in living individuals in need thereof, comprising combining i) an effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus, presented as two complementary strands with nucleotide sequences SEQ ID NO 1, SEQ ID NO 2 or SEQ ID NO 4 - SEQ ID NO 33, containing LNA modifications in the sense and / or antisense strand of these sequences, (ii) DCT with transfection activity and characterized by the structural formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC, as a pharmaceutical carrier.

The invention also provides kits for use in the present methods.

The kit may further include a description of the selection of an individual suitable for treatment. The instructions supplied with the kits of the invention are usually written instructions on a label or packing insert (eg, a piece of paper included in the kit).

The kits of the invention are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, flexible packaging, and the like. The instructions generally include information regarding dosage, administration schedule, and route of administration for the intended treatment.

The kit for obtaining CLS includes at least 2 containers (vials) with freeze-dried component (A) and component (B), represented by white powder. In another embodiment, the kit contains a solvent.

Kit options can be represented by the following containers, but are not limited to them.

Option 1: Vial 1) siRk-12-EM siRNA. Bottle 2) KK-46 peptide.

Option 2: Vial 1) siRk-12-EM siRNA, NaCl, KCl, Na ₂ HPO ₄ , KH ₂ PO ₄ . Bottle 2) peptide KK-46, NaCl, KCl, Na ₂ HPO ₄ , KH ₂ PO ₄ .

Option 3: Vial 1) siRk-12-EM siRNA, NaCl, Vial 2) KK-46 peptide, NaCl.

Option 4: Vial 1) siRk-12-EM siRNA. Bottle 2) KK-46 peptide. Bottle 3-4) Water for injection.

Option 5: Vial 1) siRk-12-EM siRNA, NaCl, KCl, Na ₂ HPO ₄ , KH ₂ PO ₄ . Bottle 2) peptide KK-46, NaCl, KCl, Na ₂ HPO ₄ , KH ₂ PO ₄ . Bottle 3-4) Water for injection.

Option 6: Vial 1) siRk-12-EM siRNA. Bottle 2) KK-46 peptide. Bottle 3-4) Phosphate buffered saline.

Option 7: Vial 1) siRk-12-EM siRNA. Bottle 2) KK-46 peptide. Bottle 3-4) Isotonic NaCl solution.

Option 8: Two-chamber vial 1) siRk-12-EM siRNA complete with a solvent. Two-chamber vial 2) KK-46 peptide complete with a solvent.

Implementation of the invention

The following is a detailed description of experimental examples confirming the effectiveness of the obtained agent for the prevention or treatment of diseases in accordance with this invention, where the above examples are not intended to limit the scope of the invention.

EXAMPLE 1. Synthesis of miRNAs with antiviral activity against SARS-CoV-2 coronavirus and confirmation of biological activity.

The viral genome of SARS-CoV-2 is represented by a single-stranded positive ribonucleic acid RNA (+ ssRNA) molecule with a length of about 30 kb, encoding at least 5 Open Reading Frames (ORF). The first ORF (ORF1a / b) occupies about 70% of the entire genome and encodes 16 non-structural proteins (nsp1-16), including the RNA-dependent RdRp RNA polymerase, which is necessary for viral replication. The remaining 30% of the genome encode 4 major structural proteins required for assembly of the virion: styloid protein (S), membrane protein (M), envelope protein (E), nucleocapsid protein (N) (FIG. 1). This entire complex of proteins is required for the reproduction of the virus, including the replication of the genome and the assembly of new viral particles.

The viral reproduction process can be suppressed by the RNAi mechanism for therapeutic purposes. RNAi is based on down-regulation of gene expression at the post-transcriptional level. The essence of the process is to block the translation of viral proteins due to the complementary binding of the target RNA to short (21-26 bp) double-stranded miRNA molecules. The antiviral effect is due to the recruitment of cellular enzymes (DICER, Ago, multisubunit RISC complex) responsible for the degradation of the target RNA of the virus (FIG. 2).

The synthesis of RNA oligonucleotides was carried out by solid-phase amidophosphate synthesis on an automatic DNA / RNA synthesizer (Polygen, Germany). The essence of the method is to add one nucleotide unit to the immobilized protected nucleoside or oligonucleotide. The nucleoside component is covalently bound to an insoluble polymer (CPG, controlled pore glass) used as a polymer support, and the nucleotide component and the required reagents were supplied in a dissolved state. In the synthesis of RNA, 2'-O-TBDMS-phosphoramidites (ChemGenes, USA) of the corresponding nitrogenous bases were used. The presence of the TBDMS-protecting group at the 2'-end of ribose prevents degradation of the molecule during the synthetic process. After its removal by a complex of triethylamine and triethylamine trihydrofluoride (TEA / TEA * 3HF), a 2'-hydroxyl corresponding to the "natural" RNA molecule is formed.

Purification of RNA oligonucleotides was carried out by reversed-phase HPLC (high performance liquid chromatography). This purification method was chosen on the basis that only the target component (synthetic RNA oligonucleotide) contains a hydrophobic dimethoxytrityl group at the 5'-end. All lower molecular weight byproducts that could arise from solid phase synthesis do not carry a dimethoxytrityl group at the 5'-end. The optimal isolation method for such a component is gradient chromatography on a C18 reversed-phase column with a polar solvent (50% acetonitrile) as an eluent, where the target component will have the longest retention time and, therefore, can be easily separated from non-target products. The RNA oligonucleotide contains modified groups that increase its stability (FIG. 3).

The resulting RNA oligonucleotide was dried under mild conditions (no higher than 15 ° C) and diluted in deionized water MQ / DEPC (DNAse / RNAse free) at a concentration of 600 nmol / L, the oligonucleotides are combined in equimolar amounts, mixed and subjected to duplexing, i.e. ... the formation of hydrogen bonds between the nitrogenous bases of the nucleotides of the two chains, in accordance with the standard technique, in the following combinations:

A nucleic acid molecule according to any one of the embodiments, wherein

a) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

или

or

b) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

или

or

c) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

d) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

e) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

f) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

g) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

h) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

i) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

j) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

k) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

l) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

m) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

n) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

o) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

p) the first fragment of contiguous nucleotides contains the following nucleotide sequence:

,

,

the second fragment of contiguous nucleotides contains the following nucleotide sequence:

.

...

Thus, the designed and synthesized siRNA molecules are directed against conserved regions of the SARS-CoV-2 virus genome with a reduced mutation frequency.

The primary screening of miRNA antiviral activity was performed in a non-infectious in vitro model using vectors expressing viral genes combined with a reporter gene (firefly luciferase gene). Three vectors were constructed expressing full-length genes and gene fragments of the leader protein SARS-CoV-2 (NCBI RefSeq NC_045512.2) NSP1 (540 i.o.), RdRp RNA-dependent RNA polymerase (2796 bp) and nucleocapsid protein N (1260 bp) (pVAX1-LP-IRES-LUC, pVAX1-RdRp-full-IRES-LUC and pVAX1-N-IRES-LUC, respectively) (FIGS.4a-c). The siRNA molecules of the invention are directed against genomic targets within the ORF1 / 2 gene (RdRp - RNA-dependent RNA polymerase gene region) (FIG. 4d). The biological effect of miRNA molecules was determined by the decrease in luciferase activity in cell lysates. (FIG. 4d).

Confirmation of the biological activity of miRNA molecules was carried out in in vitro experiments on an infectious model of infection of Vero cells with the SARS-CoV-2 virus, and quantitative assessment was carried out using a RT-PCR test system designed for the nsp1 gene (FIG.4d).

For the primary determination of the biological activity of miRNA molecules under in vitro conditions, Hep-2 cells were seeded in a 24-well plate in the amount of 100 thousand cells per well in 600 μL of complete DMEM culture medium (10% fetal bovine serum, 2% HEPES buffer solution, 0 , 1% antibiotic gentamicin, 0.6% L-glutamine) on the eve of transfection and incubated for 24 hours at 37 ° C in a CO ₂ incubator until 75% confluence was reached. Before introducing the transfection mixture in the wells with cells, complete DMEM culture medium was replaced with serum-free DMEM medium (2% HEPES buffer solution, 0.1% antibiotic gentamicin, 0.6% L-glutamine) with intermediate washing of cells with saline (0.9% sodium chloride solution). Transfection was carried out in two stages. The first dispersion of the transfection agent in a total volume of 80 μl, consisting of 0.25 μg of the plasmid encoding a specific region of the SARS-CoV-2 virus genome and 0.5 μl of the commercial transfection agent Lipofectamine3000 (supplemented with P3000), was prepared in serum-free OPTIMEM medium. The prepared mixtures were kept for 15 min at room temperature and added to the wells with a monolayer of cells. A second dispersion of the transfection agent in a total volume of 87.5 μl, consisting of 7.5 μl of the corresponding siRNA and 1.5 μl of the commercial transfection agent Lipofectamine3000, was prepared in serum-free OPTIMEM medium. As a control, no siRNA was added to one of the wells after 1 transfection. SiUTR, siIL4, siGFP were used as plasmid-nonspecific siRNAs, and siLuc was used as specific siLuc. The prepared mixtures were kept for 15 min at room temperature and added to the wells with a monolayer of cells. The cells were incubated at 37 ° C in a CO ₂ incubator. After 4 hours, 60 μl of 10% fetal bovine serum was added to each well. Thereafter, the cells were incubated at 37 ° C in a CO ₂ incubator for 20 hours, and then the luciferase activity was determined by the luciferase test. The test was performed using a commercial Luciferase Assay System (Promega) according to the manufacturer's recommendations. For this, the growth medium was removed from the wells, then 150 μL of lysis buffer Glo lysis byffer, lx (USA) was added. The cells were incubated for 15 minutes at 37 ° C in a CO ₂ incubator to achieve complete lysis. Then they were scraped off from the bottom of the wells and the cell suspension was transferred into 1.5 ml eppendorf tubes. To precipitate cell debris, the resulting lysate was centrifuged for 2 minutes at 10,000 revolutions. We took 50 μl of the supernatant into separate 1.5 ml eppendorf tubes and added the luciferase substrate to them in a 1: 1 ratio. The efficiency of transfection was assessed by the level of luminescence on a Glomax 20/20 luminometr. For all quantitative data, the arithmetic mean (M) and standard error of the mean (m) were calculated. Intergroup differences were determined and the significance of differences between groups was assessed using Student's t test using Statistica 8.0 software.

To confirm the activity of miRNA molecules, in vitro experiments were carried out using the SARS-CoV-2 replication model in Vero C1008 (E6) cells (Green monkey kidney). Cells were seeded in a 24-well plate in the amount of 100-150 thousand cells per well in 600 μl of complete DMEM culture medium (10% fetal bovine serum, 2% HEPES buffer solution, 0.1% antibiotic gentamicin, 0.6% L- glutamine) on the eve of the experiment and incubated for 24 hours at 37 ° C in a CO ₂ incubator until 75% confluence was reached. Before siRNA addition, complete DMEM medium was replaced with serum-free DMEM medium in an amount of 500 μl (2% HEPES buffer solution, 0.1% gentamicin antibiotic, 0.6% L-glutamine) in the wells with cells. A dispersion of the test preparation with a total volume of 100 μl, consisting of 0.5 μg of siRNA and 1 μl of the commercial transfection reagent Lipofectamme3000, was prepared in serum-free OPTIMEM medium. The prepared mixtures were kept for 15 min at room temperature and added to the wells with a monolayer of cells. As a negative control, cells were treated with 100 μl of serum-free OPTIMEM medium containing no siRNA molecules. The cells were incubated at 37 ° C in a CO ₂ incubator for 4 hours. After that, the MHPHK / Lipofectamine3000 / optiMEM mixtures were removed and the cells were infected with SARS-CoV-2 at a minimum infection dose of 0.001 in a serum-free medium with a volume of 500 μl, incubated for 1 hour at 37 ° C in a CO ₂ incubator. Then, the culture medium was replaced with a complete nutrient medium of DMEM in an amount of 400 μl to create optimal conditions for cell cultivation. Then the cells were re-treated with a mixture of 0.5 mg of siRNA and 1 μl of Lipofectamine3000 in 100 μl of OPTIMEM serum-free medium. The viral load was assessed by RT-PCR 1 and 4 days after infection. For this, supernatants and cell lysates were collected, from which RNA was then isolated for the subsequent setting of the RT-PCR reaction in order to determine the number of copies of the viral RNA. The cells were lysed directly in the well without the use of mechanical and enzymatic separation methods. Each variant of miRNA was studied in 1 concentration in duplicates in 4 independent repeats. The data are presented as the number of copies of viral RNA per 1 ml of supernatant and per 100 thousand cells, and were also normalized in% relative to nonspecific miRNA molecules, taken as 100%.

Based on the results of the primary screening, eight of the 15 developed siRNAs (SEQ ID NO 4 - SEQ ID NO 33) significantly reduced the activity of luciferase in vitro compared to nonspecific siRNA (siGFP) and / or cells transfected with the plasmid alone (FIG. 5). SEQ ID NO 4 / SEQ ID NO 5, SEQ ID NO 8 / SEQ ID NO 9, SEQ ID NO 10 / SEQ ID NO 11, SEQ ID NO 12 / SEQ ID NO 13, SEQ ID NO 16 / SEQ ID NO 17, SEQ ID NO 20 / SEQ ID NO 21, SEQ ID NO 28 / SEQ ID NO 29 and SEQ ID NO 30 / SEQ ID NO 31 significantly reduced the level of luminescence, in%: 82.43 (P <0.05), 74.53 (P < 0.01), 69.21 (P <0.05), 84.03 (P <0.01), 67.95 (P <0.05), 88.28 (P <0.01), 68.77 (P = 0.0519) and 65.17 (P = 0.0519), respectively, compared with cells transfected only with the plasmid and 84.67 (P <0.05), 76.35 (P <0.05), 64.88 (P = 0.0568), 81.78 (P <0.05), 63.45 (P = 0.0666) , 89.12 (P <0.01), 71 (P <0.05), and 67.66 (P <0.05), respectively, compared with cells transfected with nonspecific miRNAs. The control siLuc siLuc significantly reduced the expression of firefly luciferase, in%: 70.24 (P <0.001), 77.69 (P <0.05), and 53.1 (NS) compared to cells transfected with the pRdRp-full plasmid alone. pVAX-N-IRES-LUC and pVAX-LP-IRES-LUC, respectively; in%: 72.37 (P <0.01), 74.56 (P <0.05) and 56.63 (ND) compared with cells transfected with pVAX-N-IRES-LUC and pVAX-LP-IRES -LUC, respectively, followed by siGFP transfection. According to the results shown in FIG. 6, SEQ ID NO 8 / SEQ ID NO 9, SEQ ID NO 10 / SEQ ID NO 11, SEQ ID NO 28 / SEQ ID NO 29 and SEQ ID NO 30 / SEQ ID NO 31 significantly reduced luciferase expression in plasmid-co-transfected cells and miRNA. These molecules were selected as the most effective against the SARS-CoV-2 virus.

The generated synthetic siRNA sequences SEQ ID NO 1 and SEQ ID NO 2 in the combination drug are directed against the region of the RdRp gene.

According to the results of experiments aimed at confirming the activity of miRNA molecules selected during the primary screening, a significant difference in the concentration of viral RNA between cells treated with specific miRNA SEQ ID NO 28 / SEQ ID NO 29 directed against the RdRp gene was revealed, as compared to cells transfected with nonspecific miRNA (siLuc) and infected cells (P <0.05) (FIG. 6).

Thus, the authors of the present invention have found that a nucleic acid molecule SEQ ID NO 28 / SEQ ID NO 29 containing a double-stranded structure, where the double-stranded structure is formed by the first strand and the second strand, where the first strand contains a fragment of contiguous nucleotides, and the second strand contains a fragment of contiguous nucleotides, where the first strand consists of:

(SEQ ID NO: 28),(i) nucleotide sequence

(SEQ ID NO: 28),

and the second chain consists of:

(SEQ ID NO: 29) способна вызывать максимальную РНК-интерференцию.(ii) nucleotide sequence

(SEQ ID NO: 29) is capable of causing maximum RNA interference.

This nucleic acid comprising strands with these sequences will be referred to herein as siRk-12 (or siRk-12-EM in its modified version), a nucleic acid molecule according to the invention.

EXAMPLE 2. Obtaining modified siRNAs.

The synthesis of modified RNA oligonucleotides was carried out by solid-phase amidophosphate synthesis on an automatic DNA / RNA synthesizer (Polygen, Germany) in accordance with the preparation method specified in EXAMPLE 1. The difference of the method is the addition of one or more modified nucleotide units to the immobilized protected nucleoside or oligonucleotide.

The composition of miRNA includes modified nucleotides (LNA, Locked Nucleic Acids), which ensure reliable binding of miRNA to the target and increase the stability of duplexes. To confirm the structure of the obtained RNA molecules, a BRUKER microflex LT mass spectrometer (3-HPA matrix) was used.

A siRk-12-EM nucleic acid molecule is obtained according to any one of the embodiments, wherein the nucleic acid molecule consists of

a) the first fragment of contiguous nucleotides having the following structure:

,

,

a second fragment of contiguous nucleotides having the following structure:

, где dT - дезокситимидин, «+» отмечены LNA-модифицированные нуклеотиды.

, where dT is deoxythymidine, “+” marks LNA-modified nucleotides.

These chains form a duplex region with full complementarity and / or partially non-complementary, as well as having fragments outside the duplex region.

In one embodiment, the duplex region contains one or more modified nucleotides, referred to herein as "modified groups", where each modified group consists of one or more identically modified nucleotides. In one embodiment, each modified group in the duplex region is identical, i. E. each modified group consists of an equal number of identically modified nucleotides located immediately next to each other, in terminal positions, or in any of positions 1-22. In another embodiment, the modified group may have a terminal position and extend beyond the complementary portion of the RNA duplex

A nucleic acid of this structure, including all of these embodiments, will be referred to herein as siRk-12-EM, a nucleic acid molecule of the invention.

EXAMPLE 3. Comparison of the stability of modified and unmodified siRNA.

When using siRNA, it is preferable to use modifications that increase the efficiency of molecules and their resistance to enzymatic degradation by RNases. One of the possible ways of modification is the synthesis of covalently closed nucleic acids (LNA - "locked nucleic acid"). This modification leads to the formation of stronger duplexes, as well as resistance to nuclease degradation. The introduction of such modifications into the oligonucleotide sequence makes it possible to prolong the residence time of miRNA in biological media (blood serum, mucous membranes, cell cytoplasm, etc.), which enhances their biological effect.

The increased stability of the modified miRNAs was confirmed experimentally by mixing miRNA (C = 1 mg / ml) with FBS in a 1: 1 ratio and subsequent incubation of the miRNA / FBS mixture at + 37 ° C for 5 days. Detection of non-degraded miRNA was carried out by electrophoresis in 1.5% agarose gel. The quantification of siRNA was determined using Image Lab software (BioRad) (FIG. 3). It has been shown that LNA modification of the miRNA molecule leads to an increase in the stability of miRNA duplexes and the retention of their structure for 264 hours, which is, on average, 2-3 times more than in unmodified miRNA. On the other hand, the modification does not result in a loss of siRNA activity (FIG. 7).

Thus, the use of modified miRNAs to suppress gene expression is one of the options for achieving a prolonged antiviral effect.

EXAMPLE 4. Synthesis of dendrimeric peptides and confirmation of transfection activity.

To deliver miRNA to target cells, a peptide vector was introduced into the CLS, which plays the role of an miRNA transporter (DCP, which forms complexes with negatively charged miRNA molecules and condenses them into compact nanostructures).

The optimal ratio of DCT / siRNA is 12.5-50 / 1 by weight. Delivery of the active siRNA substance into the cell (transfection) is carried out due to the translocation of the miRNA complex with the peptide vector through the cell membranes by the mechanism of endocytosis. For the manifestation of specific activity, miRNAs in the composition of the siRk-12-EM / KK-46 agent penetrate into the cytoplasm of the target cell, providing a therapeutic effect.

Reagents and solvents for the preparation of dendrimeric peptides were obtained from Sigma-Aldrich / Merck, Anaspec, ApexBio, Gyros Proteins, Alfa Aesar, Merck, Fluka AG, Reachem, Novabiotech, Protein Technologies Inc, Carl Roth GmbH, Scharlau, Fisher Chemical with quality either for peptide synthesis, or HPLC, or GLC / MS, or for analysis. An automatic PS3 peptide synthesizer (Protein Technologies Inc., USA) or manual synthesis was used to synthesize peptides.

High performance liquid chromatography (HPLC) was used to purify the peptides. One of the systems used consisted of a 321-H binary pump (Gilson), a Vydac 218TP1022 column (Grace), a Spectroflow 757 photometric detector (Kratos Analytical), a 2210 recorder (LKB) and a Multirac 2111 fraction collector (LKB), another HPLC-Series system LC-20 Prominence (Shimadzu, Japan). Elution used a linear gradient of 5-70% eluent B (25 minutes) at 10 ml / min with detection at 226/280 nm. Eluent A contained 0.1% TFA / H20; eluent B contained pure acetonitrile (Sigma-Aldrich).

The functional groups of the side chains of Fmoc-amino acids (AnaSpec, USA / Sigma Aldrich, Germany / Iris Biotech, Germany) were protected by tert-butyl (t-Bu) for hydroxyl and carboxyl groups, tert-butyloxycarbonyl (Boc) or fluorenylmethoxycarbonyl (Fmoc) for the ε-amino group of lysine, a trityl group (Trt) for the SH-group of cysteine and the imidazole group of histidine, and 2,2,4,6,7-pentamethyl-dihydrobenzofuran-5-sulfonyl (Pbf) for the guanidine group of arginine. The synthesis was carried out either manually or automatically on a PS3 peptide synthesizer (Protein Technologies Inc., USA) using styrene-MBHA resin (Rink-amide-MBHA resin) or PEG-based resins (Rink-amide chemmatrix, TGR-, TGA- ). In the manual version, the DIC / HBT mixture was used for the condensation reaction, while in the automatic synthesis, the HBTU / NMM mixture was used for the condensation. The solvent used for all steps of the synthesis, in both cases, was N, N-dimethylformamide (DMF) or a mixture of DMF with N-methylpyrrolidone (NMP); Fmoc deprotection after each condensation step was carried out in a solution of 4-methylpiperidine (for Fmoc), and complete deprotection was carried out using trifluoroacetic acid (TFA) (all side chain protecting groups except Fmoc were labile for TFA).

The solid-phase synthesis scheme is based on a repetitive cycle of standard operations, which includes:

1) At the start, a weighed portion of the initial resin, for example Rink Amide, is introduced into the reactor, DMF is added, the suspension is vigorously stirred until the resin is completely swollen, the operation is repeated 3 times for 10-30 min, removing the solvent by filtration under pressure.

2) Removal of Fmoc-protection with 20% solution of 4-methylpiperidine (MPP) for 10-20 minutes 2 times.

3) Rinsing the resin.

4) Attachment of the amino acid by adding the activated Fmoc-amino acid to the reactor in DMF or N-methylpyrrolidone (MP) medium and incubation for 30 min - 2 h.

5) Washing the resin with peptide.

6) Operations on points 2-5 are repeated.

Cleavage of peptides from the resin was carried out in 95% TFA solution with the addition of scavengers, for example, thioanisole, 1,2-ethanedithiol or triisopropylsilane and deionized water. The crude peptide products were precipitated with diethyl ether, extracted with dilute acetic acid, and then freeze-dried. The claimed DCT are stable substances when stored in dry form. Their synthesis can be carried out using an automatic peptide synthesizer or manually. As a result, variants of the dendrimeric peptide of the general formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC were obtained, where

R is arginine;

K is lysine;

X is 5 amino acids in any order, where the amino acids are: tryptophan (W), leucine (L), isoleucine (I), threonine (T), valine (V), proline (P), glutamic acid (E);

H - histidine;

Z is a hydrophobic amino acid residue, preferably alanine (A) or phenylalanine (F);

C - cysteine or cysteinamide.

To analyze the transfection activity of DCP, Vero C1008 (E6), HEK293, A549, HepG2, HEP, HeLa cells were seeded into a 48-well plate in an amount of 4-104 cells per well in 300 μl of the corresponding complete nutrient medium (DMEM, or F12, or Igla-Mem, or RPMI containing 10% fetal bovine serum, 2% HEPES buffer solution, 0.1% antibiotic gentamicin, 0.6% L-glutamine) on the eve of transfection and incubated for 24 hours at 37 ° C in a CO ₂ incubator until achieving 75% confluence. Dispersion of the transfection agent in 3 dilutions (with mass ratios of peptide to NA - 50: 1, 25: 1 and 12.5: 1) with a total volume of 80 μl, consisting of 0.3 μg of plasmid pGL3 and a peptide solution at an appropriate concentration according to mass ratios to NK, prepared in serum-free OPTIMEM medium. The commercial transfection agent Lipofectamine2000 (Lf) was used as a positive control. Plasmid pGL3 without carrier (P1) was used as a negative control. The prepared mixtures were kept for 15 min at room temperature and added to the wells with a monolayer of cells. Before the introduction of the transfection mixture in the wells with cells, the complete nutrient medium was replaced with a serum-free one. The cells were incubated at 37 ° C in a CO ₂ incubator for 4 hours. Then, 30 μl of 10% fetal bovine serum was added to the cells. The cells were incubated at 37 ° C in a CO ₂ incubator for 24 hours and then the luciferase activity was determined by the luciferase assay. The test was performed using a commercial Luciferase Assay System (Promega) according to the manufacturer's recommendations. For this, the growth medium was removed from the wells, then 100 μL of lysis buffer (Glo lysis buffer, lx, USA) was added. The cells were incubated for 15 minutes at 37 ° C in a CO ₂ incubator to achieve complete lysis. Then they were scraped off from the bottom of the wells and the cell suspension was transferred into 1.5 ml eppendorf tubes. To precipitate the cell debris, the resulting lysate was centrifuged for 2 minutes at 10,000 revolutions. We took 50 μl of the supernatant into separate 1.5 ml eppendorf tubes and added the luciferase substrate to them in a 1: 1 ratio. The efficiency of transfection was assessed by the level of luminescence on a Glomax 20/20 luminometr. For all quantitative data, the arithmetic mean (M) and the standard error of the mean (m) were calculated (FIG. 8). Intergroup differences were determined and the significance of differences between groups was assessed using Student's t test using Statistica 8.0 software.

The synthesis of DCP (KK-46), characterized in that in the formula X - SEQ ID NO 3, was carried out in accordance with Example 4 according to the chemical scheme shown in FIG. nine.

Thus, efficient and safe delivery of the obtained synthetic miRNAs is ensured using DCT, which has transfection activity, provides a total positive charge of the entire complex, which increases the efficiency of its penetration into cells, and is characterized by the structure R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is SEQ ID NO 3; H - histidine; Z is phenylalanine (F); C - cysteine or cysteinamide, which allows antiviral therapy based on RNAi.

EXAMPLE 5. Optimization of the composition of the siRNA / peptide carrier complex.

To assess the optimal ratio of peptide to nucleic acid, Hep-2 cells were transfected with pGL3 Luciferase Reporter Vector complexes (0.25 μg) and various amounts of the peptide dendrimer KK-46 in various mass ratios of 100: 1, 50: 1, 25: 1, 20: 1.12.5: 1.5: 1. The luciferase activity was assessed. The pGL3 / Lipofectamine3000 complex was used as a positive control. The test results are shown in FIG. 10. The range of optimal weight ratios in the nucleic acid / KK-46 complex is in the range from 1 / 12.5 to 100/1.

EXAMPLE 6. Obtaining a combination drug siRk-12-EM / KK-46 and its composition.

To obtain a drug, an effective amount of siRNA (siRk-12 or siRk-12-EM) and peptide KK-46 are dissolved in equal volumes of a suitable solvent (for example, 2.5 ml or 3.5 ml for each), the contents of each vial are mixed with using a syringe, vortex or shaking and combine. Freezing of the solution is not allowed.

Option 1: 1) siRk-12 or siRk-12 EM siRNA - 0.088 mg; 2) peptide KK-46 - 1.762 mg.

Option 2: 1) siRk-12 or siRk-12 EM siRNA - 0.176 mg; 2) peptide KK-46 - 3.524 mg.

Option 3: 1) siRk-12 or siRk-12 EM siRNA - 0.528 mg; 2) peptide KK-46 - 10.572 mg.

Option 4: 1) siRk-12 or siRk-12 EM siRNA - 1.056 mg; 2) peptide KK-46 - 21.144 mg.

Option 5: 1) siRk-12 or siRk-12 EM siRNA - 3.168 mg; 2) peptide KK-46 - 63.432 mg.

Where in option 1-5, physiological solution (0.9% NaCl) is added - 5 ml.

Where in option 1-5, physiological solution (0.9% NaCl) is added - 7 ml.

Where in option 1-5 sterile purified water is added - 5 ml.

Where in option 1-5 sterile purified water is added - 7 ml.

Where in option 1-5 add phosphate buffer solution - 5 ml.

Where in option 1-5 add phosphate buffer solution - 7 ml.

Option 6: 1) siRk-12 or siRk-12 EM siRNA - as in option 1-5, together with NaCl - 20 mg, KCl - 0.5 mg, Na ₂ HPO ₄ - 3.6 mg, KH ₂ PO ₄ - 0.6 mg; 2) peptide KK-46 - as in option 1-5, together with NaCl - 20 mg, KCl - 0.5 mg, Na ₂ HPO ₄ - 3.6 mg, KH ₂ PO ₄ - 0.6 mg.

Option 7: 1) siRk-12 or siRk-12 EM siRNA - as in option 1-5, NaCl - 20 mg, KCl - 0.5 mg, Na ₂ HPO ₄ - 3.6 mg, KH ₂ PO ₄ - 0 .6 mg; 2) peptide KK-46 - as in option 1-5, NaCl - 20 mg, KCl - 0.5 mg, Na ₂ HPO ₄ - 3.6 mg, KH ₂ PO ₄ - 0.6 mg.

Option 8: 1) siRk-12 or siRk-12 EM siRNA - as in option 1-5, NaCl - 20 mg, KCl - 0.5 mg, Na ₂ HPO ₄ - 3.6 mg, KH ₂ PO ₄ - 0 .6 mg; 2) peptide KK-46 - as in option 1-5, NaCl - 20 mg, KCl - 0.5 mg, Na ₂ HPO ₄ - 3.6 mg, KH ₂ PO ₄ - 0.6 mg; 3) Solvent - as above.

EXAMPLE 7 In vivo confirmation of the antiviral activity of a combination drug.

Syrian hamsters (females aged 4-5 weeks, weight 40-60 g) were used to confirm the activity of CLS siRk-12-EM / KK-46 in vivo. Six groups of animals were formed (N = 10). Five of the six groups were intranasally infected with 105 PFU / individual of strain B SARS-CoV-2 on day 0. On the same day (one hour after infection) and on day 1, infected animals received siRk-12-EM / KK46 aerosol at three doses: 0.7, 1.96 or 5.6 mg / kg. The hamsters were anesthetized and placed in an inhalation chamber. Aerosols were formed using a conventional Xiaomi Andon VP-M3A Micro Mesh Nebulizer. The positive control group consisted of animals taking hydroxychloroquine resuspended in 1% starch solution orally (1 hour after infection at a dose of 3.8 mg / individual, and then daily for 6 days after infection at a dose of 1.5 mg / individual). The control group included animals infected with the SARS-CoV-2 virus. The intact group received no treatment and served as a negative control. Five animals from each group were sacrificed on the 2nd day after infection, the lungs were removed. A macroscopic assessment of the state of the lungs was carried out. The right lobe of the lung was homogenized and the viral titer was assessed using plaque counts to determine the number of pfu. The five animals remaining in each group were exposed to siRk-12-EM / KK-46 aerosol on days 3, 4, 5 and were sacrificed on day 6 after infection. The lungs were removed and processed as described above (FIG. 11).

According to the results of the study, it was shown that inhalation of siRk-12-EM / KK-46 CLS at doses of 0.7, 1.96 and 5.6 mg / kg leads to a statistically significant relief of pathological changes in the lungs on days 2 and 6 after infection. The most pronounced effect on macroscopic changes in the lungs was observed in group 3 (dose 5.6 mg / kg) on days 2 and 6 of observation. At the same time, the minimum dose of the drug KLS siRk-12-EM / KK-46, leading to an improvement in the condition of the lungs, is 0.7 μg / kg.

The index of suppression of the production of the SARS-CoV-2 virus in the lungs of infected Syrian hamsters was determined by the method of the formation of negative colonies in the culture of Vero cells. CLS siRk-12-EM / KK-46 at a dose of 5.6 mg / kg provided a decrease in the level of viral load in the target organ (lungs) of treated animals by 2.3 lg on the 6th day after infection, which indicates inhibition of its reproduction. In this case, the minimum dose that provides a statistically significant suppression of viral reproduction in the lungs is 0.7 mg / kg.

The second series of in vivo experiments was carried out according to the same scheme with two exceptions. First, we exposed animals to aerosol siRk-12-EM / KK-46 at a dose of 0.175, 0.35 and 1.0 mg / kg twice a day with an interval of two hours, which gave a daily dose of antiviral complexes of 0.35 , 0.7 and 2.0 mg / kg / day, respectively. The second control group of animals received oral favipiravir (within 1 hour after infection, a dose of 1.2 mg per animal was administered twice a day, and then daily for 6 days after infection, twice a day, 0.4 mg per individual) (FIG. 12).

In infected animals that received inhalations with KLS siRk-12-EM / KK-46 at doses of 0.35; 0.7 and 2.0 mg / kg / day, there was a statistically significant relief of pathological changes in the lungs on days 2 and 6 after infection. The highest coefficient of protection for macroscopic changes in the lungs was noted in group 3 (dose 2.0 mg / kg) on the 6th day of observation. The minimum dose of KLS siRk-12-EM / KK-46, leading to a statistically significant improvement in lung condition, is 0.35 μg / kg / day.

On the 2nd day after infection by inhalation with siRk-12-EM / KK-46 at doses of 0.35; 0.7 and 2.0 mg / kg / day, the viral replication inhibition index was 1.7; 1.8 and 1.9 lg, respectively; on the 6th day after infection, the viral replication inhibition index was 1.4, 1.5 and 1.9 lg, respectively.

Thus, KLS siRk-12-EM / KK-46 at a dose of 2.0 mg / kg when administered by inhalation for 7 days, 2 inhalations per day with an interval of 2 hours, provided a pronounced decrease in the viral load in the target organ (lungs) by 1.9 lg on days 2 and 6 after infection, which indicates inhibition of the reproduction of the virus.

The minimum dose that provides statistically significant suppression of viral reproduction in the lungs is 0.35 mg / kg / day.

Thus, CLS containing modified synthetic miRNA structures (+ G) GAAGGAAGUUCUGUUGAA (+ T) (+ T) dT and UUCAACAGAACUUCCUUCC (+ T) (+ T) dT modified miRNAs. At the same time, modification of the miRNA molecule with LNA nucleotides leads to an increase in the resistance of miRNA to nucleases while maintaining the antiviral effect, which ultimately provides a prolonged antiviral effect.

EXAMPLE 8. Rationale for choosing a dose of a drug for the treatment of COVID-19 in humans.

In studies on the study of specific activity on Syrian hamsters weighing 40-60 g (average animal weight 50 g), it was found that the drug in a single dose of 0.175 mg / kg has a statistically significant antiviral effect. The drug was administered for 7 days, 2 inhalations per day at a dose of 0.175 mg / kg. Thus, the daily dose is 0.35 mg / kg / day. To generate aerosol, a mesh nebulizer model XIAOMI ANDON VP-M3A was used with the following characteristics: solution nebulization rate 0.2 ml / min, flow rate 5 l / min; those. from 0.2 ml of the drug solution, 5 liters of aerosol are generated.

Taking into account that the coefficient of interspecies conversion of doses for Syrian hamsters is 8.1 [5], the single therapeutic dose for humans is 0.022 mg / kg (1.54 mg) (0.175 mg / kg / 8.1), and the daily therapeutic dose is 0.044 mg / kg / day (3.08 mg / day).

Pulmonary ventilation for humans is 8.732 l / min according to [6-8]. Thus, for 20 minutes of inhalation, a person will receive ~ 175 liters of aerosol (8.732 l / min * 20 minutes = 174.6 liters). The nebulizer generates 100 liters of aerosol in 20 minutes (flow rate 5 l / min). Accordingly, 100 liters should contain 1.54 mg of the drug; the aerosol concentration in this case should be 0.015 mg / l (1.54 mg / 100 l = 0.015 mg / l).

Taking into account that an aerosol with a drug concentration of 0.04 mg / L is generated from a solution with a concentration of 1 mg / ml, it is necessary to reduce the concentration of the solution by 2.7 times (0.04 mg / L / 0.015 mg / L = 2 , 7) to obtain an aerosol with a concentration of 0.015 mg / L. Thus, the concentration of the drug solution required for human inhalation will be 0.37 mg / ml (1 mg / ml / 2.7 = 0.37 mg / ml).

Taking into account the nebulizer atomization rate of 0.2 ml / min and the generated flow rate of 5 l / min, an aerosol with a drug concentration of 0.04 mg / l (0.2 ml * 1 mg / ml / 5 l = 0.04 mg / l).

Taking into account the performance of the nebulizer 0.2 ml / min, the required volume of the drug solution for the inhalation procedure lasting 20 minutes will be 4 ml (0.2 ml / min * 20 minutes = 4 ml). The residual volume of the drug solution in the nebulizer chamber is 0.1-0.5 ml (depending on the model). Thus, a 20 minute inhalation will require ~ 5 ml.

Since the required concentration of the drug solution is 0.37 mg / ml, then 1.85 mg of the drug is needed to obtain 5 ml.

EXAMPLE 9. A kit for preparing a pharmaceutical composition for the prevention or treatment of coronavirus infection caused by SARS-CoV-2.

The kit for preparing a combination drug contains two containers, where the first container contains component (A): an effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus, presented as two complementary strands with the nucleotide sequences SEQ ID NO 1 and SEQ ID NO 2, the second container contains component (B): the cationic dendrimeric peptide KK-46, which has transfection activity, and instructions for use.

The kit is a combination of 2 components (siRk-12-EM and KK-46), packed in individual vials in a mass ratio of 1/20, where the packaging of siRNA (siRk-12-EM) is 0.088 mg / vial, and the packaging of the KK peptide is 46 is 1.762 mg / vial.

The foregoing description of the present invention has been presented for purposes of illustration, and a person skilled in the art to which the present invention relates will understand that the present invention can be easily modified into other specific forms without changing the technical concept or essential features of the present invention. Thus, it should be understood that the above examples are only illustrative in all respects and not limiting.

Literature Cited

1. Luo K., Li C, Wang G., Nie Y., He B., Wu Y., Gu Z. Peptide dendrimers as efficient and biocompatible gene delivery vectors: Synthesis and in vitro characterization. J. Control Release, 2011, 55 (1): 77-87. doi: 10.1016 / j.jconrel.2010.10.006.

2. Luo K., et al. "Arginine functionalized peptide dendrimers as potential gene delivery vehicles" Biomaterials, 2012, 33 (19) 4917-4927.

3. Heitz M., et al. Stereoselective pH responsive peptide dendrimers for siRNA "(Bioconjug. Chem. 2019, 30 (8): 2165-2182.

4. Gorzkiewicz M., Konopka M., Janaszewska A., Tarasenko I.I., Klajnert-Maculewicz B. Application of new lysine-based peptide dendrimers D3K2 and D3G2 for gene delivery: Specific cytotoxicity to cancer cells and transfection in vitro. Bioorg. Chem., 2020, 95, 103504.

5. Van Hoosier GJ, McPherson C. Laboratory Hamsters. 1 ^st ed. 1987.400 p.

6. Mironov A.H. Guidelines for conducting preclinical studies of drugs. 2012.

7. Trakhtenberg I.M. and others. The problem of norms in toxicology (modern concepts and methodological approaches, basic parameters and constants). Moscow: Medicine, 1991, 208 p.

8. Karkischenko N.N., Gracheva S.V. A guide to laboratory animals and alternative models in biomedical technology. Moscow, 2010.

--->

Sequence listing

<110> FSBI "SSC Institute of Immunology" FMBA of Russia

<120> "Combined drug with an antiviral

the effect on the new coronavirus SARS-CoV-2 "

<160> NUMBER OF SEQ ID NOS: 33

<210> SEQ ID NO 1

<211> 22

<212> RNA

<213> artificial

<400> SEQUENCE 1:

GGAAGGAAGUUCUGUUGAATTT

<210> SEQ ID NO 2

<211> 22

<212> RNA

<213> artificial

<400> SEQUENCE 2:

UUCAACAGAACUUCCUUCCTTT

<210> SEQ ID NO 3

<211> 5

<212> Peptide

<213> artificial

<400> SEQUENCE 3:

Trp Thr Pro Glu Val

<210> SEQ ID NO 4

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 4:

AGACGUGGUCCAGAACAAAtt

<210> SEQ ID NO 5

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 5:

UUUGUUCUGGACCACGUCUtt

<210> SEQ ID NO 6

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 6:

ACUGAGGGAGCCUUGAAUAtt

<210> SEQ ID NO 7

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 7:

UAUUCAAGGCUCCCUCAGUtt

<210> SEQ ID NO 8

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 8:

CCCACCAACAGAGCCUAAAtt

<210> SEQ ID NO 9

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 9:

UUUAGGCUCUGUUGGUGGGtt

<210> SEQ ID NO 10

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 10:

GCAUAUUGACGCAUACAAAtt

<210> SEQ ID NO 11

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 11:

UUUGUAUGCGUCAAUAUGCtt

<210> SEQ ID NO 12

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 12:

GUAGUUGAAGUUGUUGAUAtt

<210> SEQ ID NO 13

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 13:

UAUCAACAACUUCAACUACtt

<210> SEQ ID NO 14

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 14:

GAAUAGAGCUCGCACCGUAtt

<210> SEQ ID NO 15

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 15:

UACGGUGCGAGCUCUAUUCtt

<210> SEQ ID NO 16

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 16:

GGUGUCUCUAUCUGUAGUAtt

<210> SEQ ID NO 17

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 17:

UACUACAGAUAGAGACACCtt

<210> SEQ ID NO 18

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 18:

GGUGUACUGACAUUAGAUAtt

<210> SEQ ID NO 19

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 19:

UAUCUAAUGUCAGUACACCtt

<210> SEQ ID NO 20

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 20:

CUUCGUAAGAACGGUAAUAtt

<210> SEQ ID NO 21

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 21:

UAUUACCGUUCUUACGAAGtt

<210> SEQ ID NO 22

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 22:

GUUACGAUGGUGGCUGUAUtt

<210> SEQ ID NO 23

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 23:

AUACAGCCACCAUCGUAACtt

<210> SEQ ID NO 24

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 24:

GUAAGGCUAGACUUUAUUAtt

<210> SEQ ID NO 25

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 25:

UAAUAAAGUCUAGCCUUACtt

<210> SEQ ID NO 26

<211> 25

<212> RNA

<213> artificial

<400> SEQUENCE 26:

AUGGGGUAAGGCUAGACUUUAUUAT

<210> SEQ ID NO 27

<211> 27

<212> RNA

<213> artificial

<400> SEQUENCE 27:

AUAAUAAAGUCUAGCCUUACCCCAUUU

<210> SEQ ID NO 28

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 28:

GGAAGGAAGUUCUGUUGAAtt

<210> SEQ ID NO 29

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 29:

UUCAACAGAACUUCCUUCCtt

<210> SEQ ID NO 30

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 30:

UCAGGAGUAUGCUGAUGUCtt

<210> SEQ ID NO 31

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 31:

GACAUCAGCAUACUCCUGAtt

<210> SEQ ID NO 32

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 32:

UGUUGGACUGAGACUGACCtt

<210> SEQ ID NO 33

<211> 21

<212> RNA

<213> artificial

<400> SEQUENCE 33:

GGUCAGUCUCAGUCCAACAtt

<---

Claims (14)

1. Combined drug for the prevention or treatment of coronavirus infection caused by SARS-CoV-2, containing: (i) an effective amount of miRNA molecules directed against the genome of the SARS-CoV-2 virus, presented as two complementary strands with nucleotide sequences SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 4 - SEQ ID NO 33 or containing an LNA modification in one or more positions of the sense and antisense chains of these sequences, (ii) a dendrimeric cationic peptide with transfection activity and characterized by the structural formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is 5 amino acids in any order, where the amino acids are: tryptophan (W), leucine (L), isoleucine (I), threonine (T), valine (V), proline (P), glutamic acid (E); H - histidine; Z is a hydrophobic amino acid residue containing alanine (A) or phenylalanine (F); C is cysteine or cysteinamide, (iii) a pharmaceutically acceptable adjuvant. 2. Combination drug according to claim 1, where the effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus is presented in the form of two complementary chains of the structure (+ G) GAAGGAAGUUCUGUUGAA (+ T) (+ T) dT and UUCAACAGAACUUCCUUCC (+ T) (+ T) dT. 3. Combination medicament according to claim 1, wherein the effective amount of a dendrimeric cationic peptide having transfection activity comprises a linear portion of amino acid residues represented by SEQ ID NO 3. 4. Combined drug according to claim 1, containing: (i) an effective amount of miRNA molecules directed against the genome of the SARS-CoV-2 virus, presented in the form of two complementary chains characterized by the structure (+ G) GAAGGAAGUUCUGUUGAA (+ T) (+ T) dT and UUCAACAGAACUUCCUUCC (+ T) (+ T) dT, where the modified nucleotides in the sense and antisense strands are represented by the LNA modification, (ii) a dendrimeric cationic peptide with transfection activity and characterized by the structure R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is SEQ ID NO 3; H - histidine; Z is phenylalanine (F); C - cysteine or cysteinamide. 5. Combination drug of claim 1, wherein the effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus is from 1 μg to 100 mg, preferably from 10 μg to 10 mg, and the cationic dendrimeric peptide is from 10 μg to 1 d, preferably 1 mg to 100 mg. 6. Combined medicinal product according to claim 1, intended for inhalation or intranasal administration. 7. A method for the prevention or treatment of coronavirus infection caused by SARS-CoV-2, including the introduction into the mammalian body of a combined drug according to PP. 1-6 in an effective amount. 8. A method for preventing or treating a coronavirus infection caused by SARS-CoV-2 according to claim 7, wherein the combination drug is administered simultaneously, separately or sequentially with other therapeutic agents. 9. A method for the prevention or treatment of coronavirus infection caused by SARS-CoV-2, according to claim 7, comprising inhalation or intranasal administration of a combination drug. 10. A kit for preparing a combination medicament according to claim 1, containing at least two containers, where the first container contains component (A): an effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus, presented in the form of two complementary strands with nucleotide sequences SEQ ID NO 1, SEQ ID NO 2 or SEQ ID NO 4 - SEQ ID NO 33, containing the LNA modification in one or more positions of the sense and antisense chains of the indicated sequences, the second container contains component (B): dendrimeric cationic peptide, possessing transfection activity and characterized by the structural formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is 5 amino acids in any order, where the amino acids are: tryptophan (W), leucine (L), isoleucine (I), threonine (T), valine (V), proline (P), glutamic acid (E); H - histidine; Z is a hydrophobic amino acid residue containing alanine (A) or phenylalanine (F); C - cysteine or cysteinamide, and instructions for use. 11. A kit according to claim 10, which at least contains one or more containers with a pharmaceutically acceptable excipient. 12. The kit of claim 10, wherein component (A) and component (B) are in lyophilized form. 13. The kit according to claim 10, where component (A) contains an effective amount of siRNA molecules directed against the genome of the SARS-CoV-2 virus, presented in the form of two complementary chains characterized by the structure (+ G) GAAGGAAGUUCUGUUGAA (+ T) (+ T ) dT and UUCAACAGAACUUCCUUCC (+ T) (+ T) dT, where the modified nucleotides in the sense and antisense strand are represented by the LNA modification. 14. The kit according to claim 10, where component (B) is a cationic dendrimeric peptide with the structural formula R ₈ K ₄ X ₄ K ₂ H ₂ KZC, where R is arginine; K is lysine; X is SEQ ID NO 3; H - histidine; Z is phenylalanine (F); C - cysteine or cysteamide, in the form of a biocompatible salt or base.

Images