RU2746126C9 - Method for preparing dna library - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology. Disclosed is a method for preparing a DNA library from DNA isolated from a biological sample for subsequent sequencing by new generation sequencing methods. The method is represented by the following stages: (1) DNA isolated from the sample is fragmented to obtain a mixture of DNA fragments; (2) the terminal sequences of DNA fragments obtained in step (1) are restored (the ends are blunted) and the resulting mixture of DNA fragments is enriched with target DNA sequences by means of magnetic particles with oligonucleotide probes that are covalently attached to them and that are specific to the target DNA sequences; (3) ligating the target DNA sequences obtained in step (2) with oligonucleotide adapters containing the oligonucleotide sequence used in the next generation sequencing method; (4) purifying the DNA sequences obtained in step (3) by means of the magnetic particles characterized by the fact that the magnetic particles are magnetic particles to which oligonucleotide probes having nucleotide sequences of SEQ ID NO: 1 - 387 are covalently attached.

EFFECT: invention expands a range of tools for preparing DNA libraries for sequencing a new generation.

11 cl, 1 dwg

Description

TECHNICAL FIELD OF THE INVENTION

The invention relates to medicine, in particular to molecular biological diagnostics, namely to the identification of genetically determined hereditary diseases.

LEVEL OF TECHNOLOGY

Hereditary diseases are diseases based on mutations in nuclear or mitochondrial DNA.

The modern classification highlights:

- genetic;

- chromosomal;

- mitochondrial disorders.

Diagnostics is performed by cytogenetic, molecular-cytogenetic and molecular-genetic methods. Gene diseases represent the widest group of hereditary diseases; most of these pathologies are caused by mutations in genes that lead to dysfunction of their products - proteins. Despite the rarity of individual nosologies, the overall frequency of genetic diseases in the population is 1-2%, which makes it extremely important to have an accessible and timely diagnosis.

The existing methods either have serious limitations on the spectrum of the studied genetic loci (capillary electrophoresis), or are extremely complex, laborious and expensive (new generation sequencing based on foreign reagents for the preparation of libraries).

At the moment, there are two most common ways to find mutations:

1) capillary electrophoresis (Sanger sequencing), which allows you to analyze individual genes;

2) new generation sequencing (NGS), which allows the analysis of gene panels, but requires multi-stage preparation of libraries of DNA fragments for sequencing (2-5 days), high costs for analysis due to the non-optimal gene composition of the panels, special requirements for personnel qualifications due to for the need for an independent bioinformatic analysis of the data obtained, the typical analysis time is at least 14-20 days.

All commercially available next generation sequencing (NGS) technologies require the preparation of DNA libraries, which consist of the target sequence and service adapters required to perform sequencing on the instrument. Most adapters have three domains:

1) primers for clonal amplification;

2) primers for sequencing;

3) a unique index to identify the sample.

Depending on the sequencing method (sequencing by synthesis - Illumina Genome Analyzer, Illumina or semiconductor sequencing - Life Technologies, Thermo Fisher Scientific), several methods for constructing DNA libraries have been developed, but all of them are multistage, time-consuming and include the following steps:

1) DNA fragmentation;

2) enrichment with target sequences;

3) restoration of terminal sequences;

4) the addition of adenine to the terminal regions of DNA;

5) ligation of adapters with indices;

6) selection by the size of fragments;

7) amplification of the library.

In this case, the most difficult steps are 2-6, which are carried out in the form of separate reactions, between which it is necessary to repeatedly purify the reaction mixture with the help of magnetic particles. All this leads to the fact that the total preparation time for libraries is at least 24-48 hours and requires a lot of manual labor.

A serious drawback of the current protocols for the preparation of DNA libraries is the fact that the methods used are based on the attachment of service sequences of adapters using a ligase, but in addition to the fact that the ligation reaction itself has limited efficiency, most enzyme mixtures lack enzymes for repairing damaged 5'- ends of the target DNA fragments, and the presence of a phosphate group at this end is a prerequisite for the ligase to work. Thus, for the above reasons, about half of the DNA molecules present in the solution cannot take part in the ligation reaction and do not get into the library, which has an extremely unfavorable effect on the efficiency of the assay.

A number of techniques have been developed to overcome some disadvantages (for example, a modification of the ligation process that does not require separate phosphorylation of the 5'-ends), but due to the need to preserve universality, these techniques inherit the basic principles of the original approaches and do not solve problems with the duration and complexity of laboratory manipulations.

To increase the speed of analysis, its reliability and reduce the cost, methods were proposed for preparing libraries of DNA fragments of a given size using only PCR and standard methods for purifying PCR products, but they have limitations in the number of studied loci and genome regions difficult for amplification.

Thus, at present, the relevance of creating a method for creating DNA libraries for subsequent sequencing and diagnostics of hereditary diseases, which has advantages over the aforementioned methods in terms of reliability and speed of obtaining diagnostic results, remains relevant.

SUMMARY OF THE INVENTION

The object of the present invention is to provide a method for preparing DNA libraries for sequencing the sequences of genes, alleles of which are associated with hereditary diseases, superior to the above methods in terms of reliability and speed of obtaining diagnostic results.

The above problem is solved due to the fact that in the proposed method for preparing a DNA library from DNA isolated from a biological sample, for subsequent sequencing by new generation sequencing methods:

(1) fragmenting the DNA isolated from the sample to obtain a mixture of DNA fragments;

(2) restoring the terminal sequences of DNA fragments obtained in step (1) (blunting the ends) and enriching the resulting mixture of DNA fragments with target DNA sequences by means of magnetic particles with covalently attached oligonucleotide probes that are specific to the target DNA sequences;

(3) ligating the target DNA sequences obtained in step (2) with oligonucleotide adapters containing the oligonucleotide sequence (index) used in said next generation sequencing method;

(4) purify the DNA sequences obtained in step (3) by means of said magnetic particles.

The DNA fragmentation in step (1) is preferably performed by ultrasound, preferably to a fragment size of about 150 base pairs (bp).

The restoration of the terminal sequences of the DNA fragments in step (2) is preferably carried out by means of E. coli DNA polymerase I (Klenow fragment) and T4 DNA polymerase.

Said probes preferably have nucleotide sequences SEQ ID NO: 1-388 specific for the MYH7, TTN, KCNQ1, DSP and SCN5A genes.

The attachment of said adapters to the ends of the DNA is preferably accomplished by ligating the first adapter to the intermediate adapter, disrupting the intermediate adapter and ligating the second adapter.

Coli DNA polymerase I (Klenow's fragment), T4 DNA polymerase, uracil-DNA glycosylase, DNA ligase T4 and Taq DNA polymerase.

Said oligonucleotide adapters preferably have the sequence 5P-ACTGTCTCTTATACACATCTCCGAGCCCACGAGAC-TAAGGCGAATCTCGTATGCCGTCTTCTGCTTG-C3, the intermediate adapter has the sequence GAGAUGUGUAUAAGAGACAGddT, and the second adapter has the sequence GAGAUGGUGUAUAAGAGACAGddT, and the second adapter has the sequence:

After step (3) or (4), it is preferred to select target DNA fragments by size.

After step (3) or (4), the target DNA fragments are preferably amplified by polymerase chain reaction (PCR).

The amplification is preferably carried out by polymerase chain reaction (PCR).

In yet another aspect, the invention relates to magnetic particles for use in the above-described method, to which oligonucleotide probes having nucleotide sequences of SEQ ID NO: 1-388 are covalently attached.

Preferably, said probes have sequences specific for the MYH7, TTN, KCNQ1, DSP and SCN5A genes.

The invention can be used for genetic diagnosis of hereditary diseases by determining the presence of pathogenic mutations using new generation sequencing.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows an example of the result of sequencing exons 1-7 of the MYH7 gene in the IGV 2.4.1 browser. Pink - direct readings, blue - reverse.

CARRYING OUT THE INVENTION

The following abbreviations are used in this text: PCR - polymerase chain reaction, bp. - base pairs.

Next generation sequencing (NGS) is a technique for determining the nucleotide sequence of DNA and RNA to obtain a formal description of its primary structure. The technology of new generation sequencing methods (NPS) allows you to “read” several genome regions at once, which is the main difference from earlier sequencing methods.

Trimmomatic is a program for removing adapter strings and strings with poor read quality.

BWA (Burrows-Wheeler Aligner) is a software package for mapping short readings to reference genomes (such as, for example, the human genome). It is one of the widely used alignment algorithms and is also recommended for data analysis by Illumina manufacturers. BWA consists of three main algorithms: BWA-BackTrack, BWA-SW, and BWA-MEM.

BWA-MEM is the latest implemented algorithm in the BWA package. It uses a strategy in which the read alignment algorithm is selected automatically on a case-by-case basis: local or global alignment. Pair-end readings and chimeric readings alignments are supported. The algorithm is robust to sequencing errors and is applicable to a wide range of sequences from 70 bp. up to several megabases. And for mapping sequences with a length of 100 bp. BWA-MEM performs better than some of the advanced read alignment algorithms.

Readings (reads) - from the English. read - "reading, reading" - individual DNA fragments obtained as a result of the sequencer (sequencing).

FastQC is a program for evaluating the quality of high-throughput sequencing data.

BamQC is an application for evaluating the quality of BAM files.

The BAM format is a binary format for storing mapping data.

Genome Analysis Toolkit (GATK) is a software package developed by the Broad Institute for analyzing large amounts of data with high processing power.

HaplotypeCaller, UnifiedGenotyper - GATK operating modes.

SnpSift is a program that filters variations in a VCF file.

SnpEff is software for annotating variants and predicting their effect on genes.

ANNOVAR is an efficient software tool that allows you to use updated information for the functional annotation of genetic variants found in various genomes (including the hgl8, hgl9, hg38 human genome, as well as mouse, worm, fly, yeast and many others).

PolyPhen2 is a tool that predicts the possible impact of amino acid substitution on the structure and function of a human protein.

SIFT, MutationTaster, FATMM, CADD, DANN, Eigen is the name of algorithms for predicting pathogenicity.

Alamut Batch is a VCF file annotation tool with splicing site prediction function.

ClinVar is a publicly available archive of reports on associations between genomic variants and phenotypes.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4832236/

HGMD Professional - Human Gene Mutation Database, a database of mutations in the human genome, http://www.hgmd.cf.ac.uk/ac/index.php

dbSNP is the SNP Database, a free public archive containing data on genetic variation of various species, developed and maintained by the NCBI (National Center for Biotechnology Information).

The objective of the present invention is to provide a method for preparing genomic libraries of DNA fragments for sequencing a new generation and a diagnostic kit for its implementation, which allows genetic diagnosis of hereditary diseases with high sensitivity, reliability, speed and low cost.

The main method of sequencing a new generation is the preparation of libraries of DNA fragments from a sample and sequencing using one of the technologies - pyrosequencing (454 Life Sciences, Roche), synthesis sequencing (Illumina Genome Analyzer, Illumina), semiconductor sequencing (Life Technologies, Thermo Fisher Scientific ).

A key step in preparing libraries of the required size is to attach service adapter oligonucleotide sequences to the target DNA fragments, for which most protocols use expensive foreign enzymes, and the protocols themselves are multi-step multi-day processes with high labor intensity or requirements for process automation.

The problem was solved by combining the steps of restoring the end regions and enriching the target sequences, eliminating the adenylation step and modifying the adapter ligation step in order to increase the efficiency of DNA library generation.

This made it possible to reduce the number of manipulations, to speed up the preparation of the library to several hours, to significantly reduce the cost of the library by reducing the cost of reagents and labor costs, to increase the reliability of the analysis by improving the quality of the coverage, since only the target regions of genes responsible for the development of hereditary pathology are sequenced.

The first adapter is a sequence complementary to the standard P7 primer (Illumina) with the index and looks like this:

5P-ACTGTCTCTTATACACATCTCCGAGCCCACGAGAC TAAGGCGA ATCTCGTATGCCGTCTTCTGCTTG-С3,

where the fragment corresponding to the index i7 is highlighted in bold.

The intermediate adapter is a sequence complementary to the 5'-end of the first adapter and looks like this:

GAGAUGUGUAUAAGAGACAGddT

The second adapter is a sequence complementary to the standard primer P5 (Illumina) with the index and looks like this:

С3-AATGATACGGCGACCACCGAGATCTACAC CTCTCTAT TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGT,

where the sequence corresponding to the index i7 is highlighted in bold.

Dual indexes i5 and i7 are matched according to the Illumina sequencer manufacturer's documentation.

Enzymatic reactions are carried out in two stages, this is achieved due to the fact that:

(a) No need for adenylation step;

(b) The reactions of preparation of DNA ends for ligation and ligation of adapter sequences are combined in one step.

The proposed kits can contain ready-made mixtures of all the necessary probes on magnetic particles, which allows you to quickly prepare a library of DNA fragments for sequencing a new generation in relation to one or more genes with alleles associated with hereditary diseases.

The preferred sequencing method comprises the following steps:

(1) carry out the extraction of DNA from the sample;

(2) performing fragmentation of the sample using ultrasound into target fragments of about 150 bp;

(3) completing the ends with E. coli DNA polymerase I (Klenow Fragment) and T4 DNA polymerase;

(4) purification of PCR products from unused reagents with simultaneous enrichment of target sequences using magnetic particles with covalently linked oligonucleotide probes of the following structure: particle-T10-C6-3'-XXXXXXXXXXX-5 ', where XXXXXXXX is the probe sequence;

(5) simultaneous ligation of the first adapter, degradation of the intermediate adapter and ligation of the second adapter with uracil DNA glycosylase, T4 DNA ligase and Taq DNA polymerase;

(6) purify PCR products from unused reagents and short DNA fragments on magnetic particles;

(7) assessing the concentration of the resulting library and, if necessary (in the case of a low concentration), carry out PCR;

(8) sequencing the resulting library using a MiSeq device (Illumina);

(7) carry out bioinformatic processing of the sequence results as follows:

(a) Removing adapters and sequences with poor read quality.

(b) Mapping of reads to the reference sequence of the human genome (GRch37 / hg19) using the BWA-MEM algorithm and removing duplicates.

(c) Checking the quality of the initial data, leveling, enrichment and coverage of target regions using Fast-QC, BAMQC and NGSrich. The expected coverage of target regions is from 70x to 150x, the share of target regions with coverage above 50x is at least 98%. Automated assessment of the quality of coverage of target regions with the generation of a list of potentially missed loci.

(d) Search for nucleotide variations for terminal mutations using GATK HaplotypeCaller + UnifiedGenotyper (yielding a merged VCF file).

(e) Processing a consensus VCF file using the SnpSift program (filtering criterion - reading depth more than 10).

(f) Annotation with SnpEff (analysis of all transcripts), ANNOVAR (analysis of allele frequencies in ExAC, 1000G and ESP6500, functional significance test algorithms SIFT, PolyPhen2, MutationTaster, FATMM, CADD, DANN, Eigen) and Alamut Batch (influence on splicing , databases dbSNP, ClinVar, HGMD Professional).

This method provides high specificity and diagnostic accuracy without using expensive methods for preparing genomic libraries, since all consumables are available from Russian suppliers.

To validate the developed panel of genes and bioinformatics approach, a new generation sequencing was carried out with the known result of molecular genetic testing for samples of four patients P001, P002, P003, and P007, each with a clinical diagnosis of DCM.

DNA from peripheral blood leukocytes is isolated using a QIAamp DNA Blood Mini QIAcube Kit (Qiagen, Germany) according to the manufacturer's instructions on an automated QIAcube station (Qiagen, Germany). DNA concentration was measured on a NanoVue Plus spectrophotometer (GE Healthcare). The preparation of libraries for sequencing was carried out as follows:

1) DNA fragmentation was carried out using a Covaris M220 ultrasonic homogenizer with a target length of 150 bp fragments.

2) Completed the ends in a reaction volume of 50 μl containing 1x SE-buffer for polymerases, 100 μM of each triphosphate, 3 units. T4 DNA polymerase and 5 units. E. coli DNA polymerase I (Klenow Fragment).

3) Purified PCR products from unused reagents with simultaneous enrichment of target sequences using magnetic particles with covalently linked oligonucleotide probes of the following structure: particle-T10-C6-3'-XXXXXXXXXXXX-5 ', where XXXXXXXX is the probe sequence using a standard purification procedure on magnetic particles.

4) Conducted simultaneous ligation of the first adapter, degradation of the intermediate adapter and ligation of the second adapter in a 50 μl reaction mixture containing 1x SE buffer, 200 μM each triphosphate, 5 units. uracil-DNA-glycosylase, 10 units Taq DNA polymerase, 10 units DNA ligase T4, 200 pmol of the first adapter, 200 pmol of the intermediate adapter, and 200 pmol of the second adapter.

5) Conducted purification of PCR products from unspent reagents using AMPure magnetic particles according to the manufacturer's instructions.

6) The presence and concentration of library fragments was checked using agarose electrophoresis (expected lengths 240-280 bp)

7) Sequencing was performed on a MiSeq instrument (Illumina). The total time spent on preparing the libraries was 4 hours.

The resulting library is characterized by high uniformity of coverage; an example of the result of sequencing exons 1-7 of the MYH7 gene is shown in Fig. one.

The average coverage for blood was 570x, the proportion of correctly mapped reads was 99.3%, and the proportion of target regions with coverage above 100x was 99.7%.

Automated bioinformatic analysis is carried out as follows:

1) Removing adapters and sequences with poor read quality using Trimmomatic.

2) Mapping of reads to the reference sequence of the human genome (GRch37 / hg19) using the BWA-MEM algorithm, removing duplicates using Picard.

3) Checking the quality of the initial data, leveling, enrichment and coverage of target regions using FastQC, BAMQC.

4) Search for nucleotide variations for terminal mutations using GATK HaplotypeCaller + UnifiedGenotyper (with obtaining a combined VCF file).

5) Processing consensus VCF files using the SnpSift program (filtering criterion - reading depth more than 10).

6) Annotation using SnpEff (analysis of all transcripts), ANNOVAR (analysis of allele frequencies in ExAC, 1000G and ESP6500, algorithms for checking the functional significance of SIFT, PolyPhen2, MutationTaster, FATMM, CADD, DANN, Eigen) and Alamut Batch (influence on splicing, databases dbSNP, ClinVar, HGMD Professional).

The total time of bioinformation processing was 1 hour.

Sequencing results for four samples:

Patient sequencing data P001 -

Gene: TTN

Genomic coordinate: chr2: 179567340

Transcript: NM_001267550.2

cDNA: С.30274C> T

Amino acid: p.His10092Tyr

Patient sequencing data P002 -

Gene: KCNQ1

Genomic coordinate: chr11: 2610069

Transcript: NM_000218.2

cDNA: S.13780A

Amino acid: p.Gly460Ser

Patient sequencing data P003 -

Gene: DSP

Genomic coordinate: chr6: 7570791

Transcript: NM_004415.3

cDNA: c.1696G> A

Amino acid: p.A1a566Thr

Patient sequencing data P007 -

Gene: SCN5A

Genomic coordinate: chr3: 38674747

Transcript: NM_001099404.1

cDNA: s.52C> T

Amino acid: p.Arg18Trp

All pathogenic mutations were confirmed by capillary electrophoresis.

Amplification of polymorphic regions of the studied genes was carried out on a Veriti amplifier (Life Technologies, Applied Biosystems) in 20 μL of the reaction mixture for complex matrices KAPA2G Robust PCR Kit (Kara Biosystems), oligonucleotide primers were synthesized by ZAO Evrogen, Moscow. Conditions for amplification of DNA fragments: 95 ° C / 2 min - 1 cycle; 94 ° C / 10 sec, 60 ° C / 30 sec, 72 ° C / 1 min - 40 cycles; 72 ° C / 5 min - 1 cycle.

Primers were designed with M13 adapters (M13-F: 5'-GTAAAACGACGGCCAGT-3 ', M13-R: 5'-CAGGAAACAGCTATGAC-3'). Purification was carried out using alkaline alkaline phosphatase (SAP) and Exonuclease I. Reaction mixture: SAP - 0.05 units; 10 × SAP buffer - 0.35 μl; Exol - 0.5 units; PCR product - 10 μl; sterile water - up to 20 μl. Temperature-time profile: 37 ° С - 30 min, 80 ° С - 15 min.

Purification of the sequential PCR product was carried out using the BigDye Xterminator kit (Life Technologies, Applied Biosystems).

Automatic sequencing of DNA fragments was performed on an ABI PRISM 3500 genetic analyzer (sequencer) using primers M13 (-20) and M13R-pUC (-40) in forward and backward directions for each amplicon. For the sequencing PCR reaction, from 50 to 100 fmol of the DNA template, 3.2 pmol primer, and 2 μl of the BigDye® Terminator v1.1 Cycle Sequencing Kit (Life Technologies, Applied Biosystems, USA) were taken for sequencing. The reaction was set in 10 μL according to the program: 96 ° C / 20 sec - 1 cycle; 50 ° C / 20 sec, 60 ° C / 4 min - 27 cycles.

Thus, the sequencing procedure using the proposed primers takes significantly less time than sequencing by alternative methods and gives a result consistent with the results obtained by these methods.

--->

SEQUENCE LIST

<110> LLC "Testgen"

<120> METHOD FOR PREPARING DNA LIBRARIES FOR SEQUENCING

FOR DIAGNOSING HEREDITARY DISEASES

<130> 13391048

<160> 387

<170> PatentIn version 3.5

<210> 1

<211> 60

<212> DNA

<213> Homo sapiens

<400> 1

ttttttgaag aggcgcagtc tactgaagca tacctgaagg ggctccagga ctccatcagg 60

<210> 2

<211> 60

<212> DNA

<213> Homo sapiens

<400> 2

tttttcagcc gctcatccag ctgctgcttg tcattctcca ggtccatgat gctctcctgg 60

<210> 3

<211> 60

<212> DNA

<213> Homo sapiens

<400> 3

ttttgggctg tggtcttccg gatatcacgg cacagaagcg ggcaggcttg ccagactgca 60

<210> 4

<211> 60

<212> DNA

<213> Homo sapiens

<400> 4

ttttaattct tgttccttgg ctttatcggc ggccactact accttagtta cagcagtctt 60

<210> 5

<211> 60

<212> DNA

<213> Homo sapiens

<400> 5

tttgtaataa agtaaggcgc ggcaggttct ccaggccctg cttgttcctc tgtgaggcta 60

<210> 6

<211> 60

<212> DNA

<213> Homo sapiens

<400> 6

tttggtcatc tgtctccacc atcatggtca ccatattcaa gcagatcaga aacatgatgg 60

<210> 7

<211> 60

<212> DNA

<213> Homo sapiens

<400> 7

tttgccatgg agggcgtggc caggagccga ggttccggga ctgggctgtc cctgggcact 60

<210> 8

<211> 60

<212> DNA

<213> Homo sapiens

<400> 8

tttctgcaag tggctctatg atgctaaacg ccgccaggat tccttagaat ccatgaaatt 60

<210> 9

<211> 60

<212> DNA

<213> Homo sapiens

<400> 9

tttctacaga gagattacag ttggtttcaa ctctgccaac tatcagcttg taaggtcctt 60

<210> 10

<211> 60

<212> DNA

<213> Homo sapiens

<400> 10

ttgggcaagt tcggtgaaaa agtcacacag ctgacagacc gctggcaaag gatagataaa 60

<210> 11

<211> 60

<212> DNA

<213> Homo sapiens

<400> 11

ttggcctcct cgagctcctc agtccgctga atggcgtccg tctcatactt ggtcctccac 60

<210> 12

<211> 19

<212> DNA

<213> Homo sapiens

<400> 12

ttgccacgtc ggccatcag 19

<210> 13

<211> 60

<212> DNA

<213> Homo sapiens

<400> 13

ttgcacggtg gcagcacccc cggcagcggc ggccccccca gagagggcgg ggcccacatc 60

<210> 14

<211> 60

<212> DNA

<213> Homo sapiens

<400> 14

ttctttggct ttagctgcgg aaattactac ctttggtaca aatgtttttt cagtttcttt 60

<210> 15

<211> 60

<212> DNA

<213> Homo sapiens

<400> 15

ttccagcatc ttccttagtc atgtcttcaa tgagcagcat atgagattgt ttgtctatca 60

<210> 16

<211> 60

<212> DNA

<213> Homo sapiens

<400> 16

ttatgaagcc aggctcactg aggaggaaac tgtctgcctg gacctggata aagtggaagc 60

<210> 17

<211> 60

<212> DNA

<213> Homo sapiens

<400> 17

ttaagttaag gtgagtgctg caaagctctc agccattcct gatttgtttg tagctacaca 60

<210> 18

<211> 60

<212> DNA

<213> Homo sapiens

<400> 18

tgttgtagtc cacgatgccg gcatagtgga tcagggagaa gtgggcttca ggcttcccct 60

<210> 19

<211> 60

<212> DNA

<213> Homo sapiens

<400> 19

tgttcccagt tcaaagcgaa gcttgcgagc ctggaggagc tgaagagaca ggctgagctg 60

<210> 20

<211> 60

<212> DNA

<213> Homo sapiens

<400> 20

tgtgtttgtc acttggctta atttccacac tcttatggaa ccattttact ggaacagtgt 60

<210> 21

<211> 60

<212> DNA

<213> Homo sapiens

<400> 21

tgtgtctgac tcggccacag cgatgggcac acacacgggc tctggatccc cgggggtgcc 60

<210> 22

<211> 60

<212> DNA

<213> Homo sapiens

<400> 22

tgtgtcgttc ttgaacttgg aaattgattt caatgccatc tttataccag tgggcatcaa 60

<210> 23

<211> 60

<212> DNA

<213> Homo sapiens

<400> 23

tgtgcggggg cgtttatcca catggactaa tctttccgtt gttagatctg tagttttctt 60

<210> 24

<211> 60

<212> DNA

<213> Homo sapiens

<400> 24

tgtcatctaa tttggtggca gcaatgataa gtctcctttt gtggccatca gactcacttc 60

<210> 25

<211> 60

<212> DNA

<213> Homo sapiens

<400> 25

tgtattctcc agcatcatca gcaaaagtca tagaaatcac cagcttgcat tcaccggttt 60

<210> 26

<211> 60

<212> DNA

<213> Homo sapiens

<400> 26

tgtagaaagt ccatttggta tctttctcca tgtttgatgc gcttgccatc tttgtaccaa 60

<210> 27

<211> 60

<212> DNA

<213> Homo sapiens

<400> 27

tgtaagttcc ttcatcttct ggataagctt cggcaatttc cagttgataa gtgtcttcaa 60

<210> 28

<211> 60

<212> DNA

<213> Homo sapiens

<400> 28

tgggccacct ccgagttggc cttggaaagg acgcgctgca gctcggcctt ggcctccgtc 60

<210> 29

<211> 46

<212> DNA

<213> Homo sapiens

<400> 29

tgggatcaga aggcggtgga catatttctc cttctgaatc tttatt 46

<210> 30

<211> 43

<212> DNA

<213> Homo sapiens

<400> 30

tggagattcc aacacagtca tgcggttttt gaatgagcag aag 43

<210> 31

<211> 60

<212> DNA

<213> Homo sapiens

<400> 31

tgcttcttga gttacttgtt tctgtttctt agtaatttct tcagaaattc tagtttcttg 60

<210> 32

<211> 31

<212> DNA

<213> Homo sapiens

<400> 32

tgcgttgaga gcattcagct caaagtcttt t 31

<210> 33

<211> 60

<212> DNA

<213> Homo sapiens

<400> 33

tgccgcagca agtacgtggg cctctggggg cggctgcgct ttgcccggaa gcccatttcc 60

<210> 34

<211> 60

<212> DNA

<213> Homo sapiens

<400> 34

tgcccccttc ctgctatcaa tgaactgtcc ctcagggatg gccgctgggt tcaggatgcg 60

<210> 35

<211> 60

<212> DNA

<213> Homo sapiens

<400> 35

tgcaggcaga agcctcgagc cagaatcttg accagagact caaaggtgta aatggcggtg 60

<210> 36

<211> 60

<212> DNA

<213> Homo sapiens

<400> 36

tgcactggcc tcggcctcag aggaggcagt cgctgacacc tggctccagg tcctggaatc 60

<210> 37

<211> 60

<212> DNA

<213> Homo sapiens

<400> 37

tgatgttgtt agtcagtggt aggtgtttgc catccctcaa ccattcgcct ttggaatctg 60

<210> 38

<211> 60

<212> DNA

<213> Homo sapiens

<400> 38

tgatgctggc agagtcctca gcagtcacat ctcttatgac caattcacaa acattgtctt 60

<210> 39

<211> 60

<212> DNA

<213> Homo sapiens

<400> 39

tgatattgcg tggcttctgg aagttggcgg atttgcccag gtggttgtca aacagcttgg 60

<210> 40

<211> 55

<212> DNA

<213> Homo sapiens

<400> 40

tgagttcacc aaacatgtca ccagtgaatg tttggggtgg atgaggcagc aaagg 55

<210> 41

<211> 60

<212> DNA

<213> Homo sapiens

<400> 41

tgacttgatg gggcccatct cggcaaagcc cagggtgttg gccaccaggc tgaccagaga 60

<210> 42

<211> 55

<212> DNA

<213> Homo sapiens

<400> 42

tgacgtcaaa ggcctgcttg gtcacaatgt cgaatatgaa gccctggtac ttgtt 55

<210> 43

<211> 60

<212> DNA

<213> Homo sapiens

<400> 43

tgacaaatgg ttctgaagtt tcacattcaa aggttgccat agtgtctttt tccttagcaa 60

<210> 44

<211> 60

<212> DNA

<213> Homo sapiens

<400> 44

tgaacttttc actcatctca atttccacac cattcttcag ccacatggaa gggacattga 60

<210> 45

<211> 60

<212> DNA

<213> Homo sapiens

<400> 45

tctctcttct gtcctgatct gagtagaggt tgtcagcgtt gtctctctca tctcagcctc 60

<210> 46

<211> 60

<212> DNA

<213> Homo sapiens

<400> 46

tctccacgtg cagtctggca ctggctccaa gccttccaag cctgaagcca taaacagact 60

<210> 47

<211> 60

<212> DNA

<213> Homo sapiens

<400> 47

tctccacaaa cagttttgct ttgcattcca attgcccgac cacagctgtg tattccccag 60

<210> 48

<211> 54

<212> DNA

<213> Homo sapiens

<400> 48

tctatattca atttctttaa taagtctctc ttcaaaggaa gaaatatgga attc 54

<210> 49

<211> 60

<212> DNA

<213> Homo sapiens

<400> 49

tctataattc ttgattcttg aatcaaatcc tgattcaaca gcttcagatt cagaaatgtc 60

<210> 50

<211> 60

<212> DNA

<213> Homo sapiens

<400> 50

tcggaaaact gtaataagaa caaattcctg gatcagaacc tgcagaaata ccaggcagag 60

<210> 51

<211> 60

<212> DNA

<213> Homo sapiens

<400> 51

tcgccgagga cctggacctg gaaggggaga ctctgctgac acccatcacc cacatctcac 60

<210> 52

<211> 60

<212> DNA

<213> Homo sapiens

<400> 52

tcgacatact tggtccaggg tggagggtcg tgctgggcca tgaacacgca gttggtgagg 60

<210> 53

<211> 60

<212> DNA

<213> Homo sapiens

<400> 53

tcctcttctt gccccggtag gcagccacca cctcaggagt gtacaccggc agccacttgt 60

<210> 54

<211> 60

<212> DNA

<213> Homo sapiens

<400> 54

tcctcctcgt actgctcccg cagcaggtcg cagtcatgcc gggccgactg cagtgcgtgg 60

<210> 55

<211> 60

<212> DNA

<213> Homo sapiens

<400> 55

tccattcccc agaatcactg ggtgtggcag ggacaataat tagtgattga gtaccatctt 60

<210> 56

<211> 60

<212> DNA

<213> Homo sapiens

<400> 56

tccagggaga tcatgtggat caatgactgc gaggaggagg agctgctgta cgactggagc 60

<210> 57

<211> 60

<212> DNA

<213> Homo sapiens

<400> 57

tccaacttta ggttcttgaa caaatgcagt cacttgtgtc tgataaagca tttcttgctg 60

<210> 58

<211> 60

<212> DNA

<213> Homo sapiens

<400> 58

tcacacgatg gactcacggt ccctgtccgg agaagggggg aagtcggcga gatcttcact 60

<210> 59

<211> 60

<212> DNA

<213> Homo sapiens

<400> 59

tcaaaccggc acgatgtcca ggcaccagaa ccagaacacc atccaggagc tgctgcagaa 60

<210> 60

<211> 60

<212> DNA

<213> Homo sapiens

<400> 60

tattgtttct tgttctttgg ctttagcagt agcaactgct attgtagaca aggcagtttt 60

<210> 61

<211> 60

<212> DNA

<213> Homo sapiens

<400> 61

tatatttgcc attggattta agctccacat cattatgata ccattttcct tctatatttt 60

<210> 62

<211> 60

<212> DNA

<213> Homo sapiens

<400> 62

tatatttaga actgggcttg atttccttgt ccttaaaatt ccacaggaca tcaattccag 60

<210> 63

<211> 60

<212> DNA

<213> Homo sapiens

<400> 63

tatagactgc cgcatcctct gggaaggctt caattagcaa aagcgtgtat tcttgcccat 60

<210> 64

<211> 60

<212> DNA

<213> Homo sapiens

<400> 64

tatagacaga gacacgccca ctggtggaga ggccaagggc tggaatggtg aaagagtaat 60

<210> 65

<211> 60

<212> DNA

<213> Homo sapiens

<400> 65

tagggtgtgt aagctcgaca gtgaaaacag catcctgtgt ttctgtcact gtgaggttct 60

<210> 66

<211> 60

<212> DNA

<213> Homo sapiens

<400> 66

tactaaatct tgttctttga ctttgggtgt ggcaactatg actttaggta caactgtttt 60

<210> 67

<211> 60

<212> DNA

<213> Homo sapiens

<400> 67

tacgtgacgg gcccgggagg cgttgacatg cttgttccct ctgtggggct gatcatccct 60

<210> 68

<211> 60

<212> DNA

<213> Homo sapiens

<400> 68

tacctggctg agaaggacgc ggtgaacgag tcaggccgcg tggagttcgg cagctacgca 60

<210> 69

<211> 60

<212> DNA

<213> Homo sapiens

<400> 69

tacagcgctg atcactggtt ctctcactct ggccatatca acggcagcaa caacagtcgc 60

<210> 70

<211> 60

<212> DNA

<213> Homo sapiens

<400> 70

taaggaagag cccaacactg ctggaagtga gcatgcccca tttcatgaga accaacagct 60

<210> 71

<211> 60

<212> DNA

<213> Homo sapiens

<400> 71

taaatcgccc gctgtcttcc gcaaatgctt cgcgaatcat aagacgagca attccactct 60

<210> 72

<211> 60

<212> DNA

<213> Homo sapiens

<400> 72

taaaggagat ctgcacgccg ggcagagtgg aagtggaaat cacctggcca tccctaaacc 60

<210> 73

<211> 60

<212> DNA

<213> Homo sapiens

<400> 73

gtttcatctt taatttacag gttgtctttt tcccgtcgat gacaaagctg tattctccct 60

<210> 74

<211> 60

<212> DNA

<213> Homo sapiens

<400> 74

gttgttgcgc cgctccacga tggcgatgtt ctccttcagg tcgtcgttgg cacggactgc 60

<210> 75

<211> 33

<212> DNA

<213> Homo sapiens

<400> 75

gttggcctgg atgatctggt cctccagggt gcc 33

<210> 76

<211> 60

<212> DNA

<213> Homo sapiens

<400> 76

gttgcgcttc tgctcggcct ccagctcatt ctccagctcc cgcacccgcg cttccagctt 60

<210> 77

<211> 60

<212> DNA

<213> Homo sapiens

<400> 77

gttcaccagg tagaaggacc ccaggaagat gacaagcatg aagaagatca tgtagatctt 60

<210> 78

<211> 60

<212> DNA

<213> Homo sapiens

<400> 78

gttatgggac ctggagaaac aaatcaagca attgaggaat tatcgtgata actatcaggc 60

<210> 79

<211> 60

<212> DNA

<213> Homo sapiens

<400> 79

gtgtagattc cttcatcttc tggaagaaca acaggtatac gcagactagc tctgccatct 60

<210> 80

<211> 60

<212> DNA

<213> Homo sapiens

<400> 80

gtggctgtag tcagaccccc gcacctggag gttatcgctg gtggctctag tgacactgtc 60

<210> 81

<211> 60

<212> DNA

<213> Homo sapiens

<400> 81

gtggctgagc tggatctcca tctcattgag gtctccttcc atcttcttct tcaccctcag 60

<210> 82

<211> 28

<212> DNA

<213> Homo sapiens

<400> 82

gtgatcagga tggactggtt ttctctgt 28

<210> 83

<211> 60

<212> DNA

<213> Homo sapiens

<400> 83

gtgacgcagc tggaccagag gctggcactc atcaccgaca tgcttcacca gctgctctcc 60

<210> 84

<211> 60

<212> DNA

<213> Homo sapiens

<400> 84

gtctctcaag ttgtgactca tctgtctcct ccagcctacg tccaggggac attcttgcag 60

<210> 85

<211> 60

<212> DNA

<213> Homo sapiens

<400> 85

gtctacgatg aggaagtcga gccagcacca ggcattggtg aagtacttct tgaagccgta 60

<210> 86

<211> 54

<212> DNA

<213> Homo sapiens

<400> 86

gtcgagggca atgatcttga aggtcatctc tgctgtgaaa atccctgtga agac 54

<210> 87

<211> 22

<212> DNA

<213> Homo sapiens

<400> 87

gtcgacggct atgacagttc tg 22

<210> 88

<211> 35

<212> DNA

<213> Homo sapiens

<400> 88

gtccaccgca cagcagggac agcgccggac acagc 35

<210> 89

<211> 60

<212> DNA

<213> Homo sapiens

<400> 89

gtccaccatc aagtcctcga tctcattctg tagccggtgc ttggtcttct ccagcgagga 60

<210> 90

<211> 60

<212> DNA

<213> Homo sapiens

<400> 90

gtcagcttca ggtcgccctc cagcttccgc ttcgctcgct ccaggtccat gcgcaccttc 60

<210> 91

<211> 60

<212> DNA

<213> Homo sapiens

<400> 91

gtcagcgaag gggaactgtg gcaagggtgt gggctctgcc cttactctag tctcactggg 60

<210> 92

<211> 60

<212> DNA

<213> Homo sapiens

<400> 92

gtcacagtca ccaccatcgg ctatggggac aaggtgcccc agacgtgggt cgggaagacc 60

<210> 93

<211> 59

<212> DNA

<213> Homo sapiens

<400> 93

gtagcgctgg gcgagacggt tccagcatgg tggacacttg tggcgagact cctctaact 59

<210> 94

<211> 60

<212> DNA

<213> Homo sapiens

<400> 94

gtagatcatc caggagccgt agcgatcctt gaggttgtag agcaccgcgg gctcatgcag 60

<210> 95

<211> 60

<212> DNA

<213> Homo sapiens

<400> 95

gtagagcttc atccagggcc aattcttgac ccccatgaag gcccgaatgt tccactggat 60

<210> 96

<211> 45

<212> DNA

<213> Homo sapiens

<400> 96

gtacttcttc tgctcctctg tcatgaagat gtcctggccc cctaa 45

<210> 97

<211> 60

<212> DNA

<213> Homo sapiens

<400> 97

gtacacggtc atcaggcttg atttgttcat catttaagta ccacttaaca gaagtcacat 60

<210> 98

<211> 60

<212> DNA

<213> Homo sapiens

<400> 98

gtaaagaaaa aaaagttcaa gctggacaaa gacaatgggg tgactcctgg agagaagatg 60

<210> 99

<211> 60

<212> DNA

<213> Homo sapiens

<400> 99

ggttggcaac ttcacattca aacacagctt cctgggattc agctacggtc tgatctgtga 60

<210> 100

<211> 60

<212> DNA

<213> Homo sapiens

<400> 100

ggtctccagg gtggcattga tgcgcgtcac catccagttg aacatcctct catacactgc 60

<210> 101

<211> 60

<212> DNA

<213> Homo sapiens

<400> 101

ggtcctcctt ggttacatcc ttgaccgtga ggttctgacg tccacgacga gatgtaattg 60

<210> 102

<211> 60

<212> DNA

<213> Homo sapiens

<400> 102

ggtccggcgc aggggccagg gcaccagcag tgatgtgtgg tggctctcgc tctcccccgc 60

<210> 103

<211> 57

<212> DNA

<213> Homo sapiens

<400> 103

ggtcagcttg gcaatgatct catccagccc agccatctcc tctgtcaggt ttttcac 57

<210> 104

<211> 60

<212> DNA

<213> Homo sapiens

<400> 104

gggttggggt tacccgtagc tctgactttc atttcaagtc gggaaccttc ctttatattg 60

<210> 105

<211> 60

<212> DNA

<213> Homo sapiens

<400> 105

gggtgactgt cagggtggca ctgacttggt cattgccaca gacaaatgtg tattctgccg 60

<210> 106

<211> 60

<212> DNA

<213> Homo sapiens

<400> 106

gggcatccgc ttcctgcaga tcctgaggat gctacacgtc gaccgccagg gaggcacctg 60

<210> 107

<211> 60

<212> DNA

<213> Homo sapiens

<400> 107

gggattcttg gctcggggtt tgccctgaag gtgcagcaga agcagaggca gaagcacttc 60

<210> 108

<211> 60

<212> DNA

<213> Homo sapiens

<400> 108

gggaggctca gctacctttg cggcggaaat gcgttcctta tatccgtact ccaaagtggt 60

<210> 109

<211> 60

<212> DNA

<213> Homo sapiens

<400> 109

gggacatccg tgcaggagac atccttgcag gtgacatccg tgcaggagac atgcgtatag 60

<210> 110

<211> 60

<212> DNA

<213> Homo sapiens

<400> 110

ggcttgttct ttttcatact ctttttcata ctcagagtat acaaatccag gtgctgtttc 60

<210> 111

<211> 60

<212> DNA

<213> Homo sapiens

<400> 111

ggctccacat acaatttccc tgagcaaatt gcatttcctt taatattgct ggcaaatgca 60

<210> 112

<211> 60

<212> DNA

<213> Homo sapiens

<400> 112

ggcgatgggg actgctgccg agccagctgt gctttggcag caatagacgg tggtgttggg 60

<210> 113

<211> 60

<212> DNA

<213> Homo sapiens

<400> 113

ggcctcgttg cggctgcgtg tctctgcgtc cagggaggtc tgcagcgagt ccaccacccg 60

<210> 114

<211> 29

<212> DNA

<213> Homo sapiens

<400> 114

ggccagccct gtgatgctta ccagaaaag 29

<210> 115

<211> 60

<212> DNA

<213> Homo sapiens

<400> 115

ggccacccac ttgagcagca tctccagcac gaagacatat gtgaacatct tgtcggcata 60

<210> 116

<211> 60

<212> DNA

<213> Homo sapiens

<400> 116

ggcagcaccc gcagcaccac tgatggtcac ttgctcctgg acaccgtatc tcccttccca 60

<210> 117

<211> 60

<212> DNA

<213> Homo sapiens

<400> 117

ggcacttgtc agttgatttg atttccacac cattctttaa ccatttgtaa gagatgcctt 60

<210> 118

<211> 60

<212> DNA

<213> Homo sapiens

<400> 118

ggagctcagc ggtgttggtc atgtctgctg tgctgccctc ggagcaactg tcctctgggg 60

<210> 119

<211> 60

<212> DNA

<213> Homo sapiens

<400> 119

ggagaagttc tcactcatca cgtaggcgat gaggccctct cgctcagggg catcctcttc 60

<210> 120

<211> 60

<212> DNA

<213> Homo sapiens

<400> 120

ggaaggttat ctggaagtca atggaacttt cgatttggta gtcttccctg taccatgtca 60

<210> 121

<211> 60

<212> DNA

<213> Homo sapiens

<400> 121

gcttcttcag ctccaagagc aaatgcgagc cctttataaa gccatcagtg tccctcgagt 60

<210> 122

<211> 47

<212> DNA

<213> Homo sapiens

<400> 122

gctggaccag tccattggga agccctcact gttcatctcc gtctcag 47

<210> 123

<211> 31

<212> DNA

<213> Homo sapiens

<400> 123

gctgcgtaaa cgtcggtgct tgagttgtca t 31

<210> 124

<211> 60

<212> DNA

<213> Homo sapiens

<400> 124

gctgcgggaa caccatcggg ccaccattaa ggtcattcga cgcatgcagt actttgtggc 60

<210> 125

<211> 60

<212> DNA

<213> Homo sapiens

<400> 125

gctcttctcc ttctccagct tctgcttcac ccgctgcagg ttgtcgatct gctcgcccag 60

<210> 126

<211> 46

<212> DNA

<213> Homo sapiens

<400> 126

gctccgactg cgactcctca tacttctgct tccactcggc caggat 46

<210> 127

<211> 60

<212> DNA

<213> Homo sapiens

<400> 127

gctcacccct acttcctttt tcacctcaac gccagcttca ctcttgtaag tatctggtgt 60

<210> 128

<211> 60

<212> DNA

<213> Homo sapiens

<400> 128

gctaaggatg acgatgatgc tgtcgaagat gttccagccc tgttggaagt agtagtaggg 60

<210> 129

<211> 60

<212> DNA

<213> Homo sapiens

<400> 129

gcggcaccat ctatgaccat ctcaactgtt gcaattgatc tggcatcaaa gtgggcttca 60

<210> 130

<211> 60

<212> DNA

<213> Homo sapiens

<400> 130

gcggagggcg gcccggcggg cggcgcgctc tacgcgccca tcgcgcccgg cgccccaggt 60

<210> 131

<211> 60

<212> DNA

<213> Homo sapiens

<400> 131

gcggagatgg acatggtggc ctggggtgtg gacctggcct cagtggagca gcacattaac 60

<210> 132

<211> 60

<212> DNA

<213> Homo sapiens

<400> 132

gcgcatcagc cccagcatag ttggcaaaca gggtgctgag cagcttgagg gaagacttct 60

<210> 133

<211> 59

<212> DNA

<213> Homo sapiens

<400> 133

gcctcgggtc agctgggaga tcagtgcctc cttctcatcc agctgccggg acagctcac 59

<210> 134

<211> 60

<212> DNA

<213> Homo sapiens

<400> 134

gcctatatgg acactctgca gacgcagtgg agttggattc ttcagatcac caagtgcatt 60

<210> 135

<211> 60

<212> DNA

<213> Homo sapiens

<400> 135

gcccaggcca atgaccaaat ggaaatcctc gacagcttga tcagagagat gcggcagatg 60

<210> 136

<211> 60

<212> DNA

<213> Homo sapiens

<400> 136

gccatgataa tcacactaaa gtccagccag ttccatgggt cccgaaggaa agtgaacgcg 60

<210> 137

<211> 60

<212> DNA

<213> Homo sapiens

<400> 137

gccactttcc tcaacagtga accttcttcc ttggactaat tttccatctt tgtaccagta 60

<210> 138

<211> 60

<212> DNA

<213> Homo sapiens

<400> 138

gccaacttca gaggttctga aaagtactgc tatttacaga atgaagtatt tggactattt 60

<210> 139

<211> 60

<212> DNA

<213> Homo sapiens

<400> 139

gcatctaata ggattcagga atcaaagaat cagtgtactc aggtggtaca ggaaagagag 60

<210> 140

<211> 60

<212> DNA

<213> Homo sapiens

<400> 140

gcacttggca ttaacagcct ccacggcctc ctcagcttcc tgcagccgct gggccagctt 60

<210> 141

<211> 60

<212> DNA

<213> Homo sapiens

<400> 141

gattgagcag tactacgaag ccatcttggc tctgtggaac cagctctaca tcaacatgaa 60

<210> 142

<211> 60

<212> DNA

<213> Homo sapiens

<400> 142

gattatgagc tccagctggc ctcatacacc tcaggactgg aaactctgct gaacatacct 60

<210> 143

<211> 36

<212> DNA

<213> Homo sapiens

<400> 143

gatgttcatc tgaaagaaaa tgctgcctac tttcag 36

<210> 144

<211> 60

<212> DNA

<213> Homo sapiens

<400> 144

gatgtccctt ttgagctctg agcactcatc ttccagcttg cgcttcttgg cagtgagctc 60

<210> 145

<211> 60

<212> DNA

<213> Homo sapiens

<400> 145

gatgggaagt cggctaagca aaatctagac aagtgctacg gccaaataaa agaactcaat 60

<210> 146

<211> 21

<212> DNA

<213> Homo sapiens

<400> 146

gatgcgctgt ggtggggggt g 21

<210> 147

<211> 60

<212> DNA

<213> Homo sapiens

<400> 147

gatgccctcc ttcttgtact cctcctgctc cagcacaaac atgtggtggt tgaagaactg 60

<210> 148

<211> 60

<212> DNA

<213> Homo sapiens

<400> 148

gatgagctga atcgtgcaaa atcaactcta gaggcagaaa ccagggtgaa acagcgcctg 60

<210> 149

<211> 44

<212> DNA

<213> Homo sapiens

<400> 149

gatgaatgca taatcgtagg ggttgttggt gatcagcagc atgt 44

<210> 150

<211> 60

<212> DNA

<213> Homo sapiens

<400> 150

gatcttgact ttggcttcgg aggaatcctg ggaggtgttt tatgtggcag ctgttgccca 60

<210> 151

<211> 60

<212> DNA

<213> Homo sapiens

<400> 151

gatacaagcc cacgacagtc tcattgagag gatccttgtt cttctgcagc cagccaatga 60

<210> 152

<211> 60

<212> DNA

<213> Homo sapiens

<400> 152

gagtgtgaga aacagcaaat tcagaatgac ctgaatcagt ggaagactca atattcccgc 60

<210> 153

<211> 60

<212> DNA

<213> Homo sapiens

<400> 153

gagtgaacca gaatcttcac agccgctctc cggatggggt ggaagggact gaggacatac 60

<210> 154

<211> 37

<212> DNA

<213> Homo sapiens

<400> 154

gaggctcctg ggctccgtgg tcttcatcca ccgccag 37

<210> 155

<211> 60

<212> DNA

<213> Homo sapiens

<400> 155

gaggaaggca tgaaagaagt ccatcatgtg ccagcgaggc agcaggcctg agtcgctgtc 60

<210> 156

<211> 60

<212> DNA

<213> Homo sapiens

<400> 156

gagctgataa ccaccctgta catcggcttc ctgggcctca tcttctcctc gtactttgtg 60

<210> 157

<211> 60

<212> DNA

<213> Homo sapiens

<400> 157

gagcctggtg tcctggcact actgcatgat tgacatagag aagatcaggg ccatgacaat 60

<210> 158

<211> 60

<212> DNA

<213> Homo sapiens

<400> 158

gagatcgtgc tggtggtgtt cttcgggacg gagtacgtgg tccgcctctg gtccgccggc 60

<210> 159

<211> 60

<212> DNA

<213> Homo sapiens

<400> 159

gactgtttct agttttgtgg actttgcagt ggcaactacc accatggatg cagcagttat 60

<210> 160

<211> 60

<212> DNA

<213> Homo sapiens

<400> 160

gaccaccaac ttcactccct gcttgatgga catccacagc gggcagcact cccagatcag 60

<210> 161

<211> 45

<212> DNA

<213> Homo sapiens

<400> 161

gaccaacttg tcctcaatca gcatccagct tcagacaaaa ttgag 45

<210> 162

<211> 42

<212> DNA

<213> Homo sapiens

<400> 162

gacaagaaca ccaacatcgc tcagaaacag gaggccttct cc 42

<210> 163

<211> 60

<212> DNA

<213> Homo sapiens

<400> 163

gacaaactcc tgtttgtcat caggcacgaa gacatccttc ttgaggtcaa aaggcctggt 60

<210> 164

<211> 60

<212> DNA

<213> Homo sapiens

<400> 164

gaattgaagt atggagatgg aatacaactg actcggagtc gagaattgga tgagtgtttt 60

<210> 165

<211> 60

<212> DNA

<213> Homo sapiens

<400> 165

gaaggtcagc atggccatgt cctcgatttt gtcgaacttg ggtgggttct gctgcatcac 60

<210> 166

<211> 60

<212> DNA

<213> Homo sapiens

<400> 166

gaagcggggt gatgatggca ggtggataaa caggcatttc ctgatcagga gacacaactt 60

<210> 167

<211> 60

<212> DNA

<213> Homo sapiens

<400> 167

gaagcgggag gagttgtcgt tccggacggt cttggcattg ccaaaggcct ccagagcagg 60

<210> 168

<211> 24

<212> DNA

<213> Homo sapiens

<400> 168

gaactttgcg ccaattcaat taag 24

<210> 169

<211> 60

<212> DNA

<213> Homo sapiens

<400> 169

gaaagaccca aagatgatga aaatgacaaa atagatgtac atgtagaggt tgtattccca 60

<210> 170

<211> 60

<212> DNA

<213> Homo sapiens

<400> 170

gaaacttcac attcaaacat ggctcgcttc ttctccagta ccttaatgtc cttaatgtgt 60

<210> 171

<211> 60

<212> DNA

<213> Homo sapiens

<400> 171

ctttttcttc tgttggttga agttgtcaat gatgacacca ataaagaggt tcagggtgaa 60

<210> 172

<211> 26

<212> DNA

<213> Homo sapiens

<400> 172

ctttttagca ggtacttctt cttcac 26

<210> 173

<211> 60

<212> DNA

<213> Homo sapiens

<400> 173

cttttcataa cttaggtgca tttgatcttg ttgtgtggta gtttcttctt gagctcccgg 60

<210> 174

<211> 60

<212> DNA

<213> Homo sapiens

<400> 174

cttttcaatt cgggtttgtc ttgattctga gatctgagca gtcgaaacaa ttgtctttgt 60

<210> 175

<211> 60

<212> DNA

<213> Homo sapiens

<400> 175

ctttggtaat ggatatccag acatcttgca atgaaaagtg acacccatcc cctcaagaat 60

<210> 176

<211> 60

<212> DNA

<213> Homo sapiens

<400> 176

ctttccatgg gtaacttgga tttgttcttg tctagtagcc atagtttctc tagttctcag 60

<210> 177

<211> 57

<212> DNA

<213> Homo sapiens

<400> 177

ctttcatttc catctcaatc tcttgttcaa tcctctcatg caaaattgat tcaggag 57

<210> 178

<211> 39

<212> DNA

<213> Homo sapiens

<400> 178

ctttcagctg gaaaataact ctggattttt ccagaagat 39

<210> 179

<211> 60

<212> DNA

<213> Homo sapiens

<400> 179

ctttcacgag aagctcagca gtactagtcg cttgtccaga tccattggtg gctttcaggg 60

<210> 180

<211> 45

<212> DNA

<213> Homo sapiens

<400> 180

ctttaatgac tactttatgg gtatagtcat tgacaatttg ctggc 45

<210> 181

<211> 60

<212> DNA

<213> Homo sapiens

<400> 181

cttgttctct gttgcgtgtt tctccttctc cactttggcc agtgtcagct ccagatcatc 60

<210> 182

<211> 60

<212> DNA

<213> Homo sapiens

<400> 182

cttgtgaaat ttggaaatca agggagctct ggatttcggc tccatcccgg tagaacttca 60

<210> 183

<211> 60

<212> DNA

<213> Homo sapiens

<400> 183

cttgtcgaag ttcctctgct tcttgtccag ggctgcagca gcagcattgg agcgctctac 60

<210> 184

<211> 60

<212> DNA

<213> Homo sapiens

<400> 184

cttggtgtgg ccaaacttgt actggttgtg atcaatgtcc agggagctga gcagcttctc 60

<210> 185

<211> 60

<212> DNA

<213> Homo sapiens

<400> 185

cttggcttcg cgtccgtgca gtacttcaaa gcgctcttca cggacggtgg tgccagtgat 60

<210> 186

<211> 60

<212> DNA

<213> Homo sapiens

<400> 186

cttggccttg atgatctgct ccatgttgga ggtgacgtca tccagctcca gcttgaactc 60

<210> 187

<211> 60

<212> DNA

<213> Homo sapiens

<400> 187

cttggacaag taagaatgcg tgactggagg tttctccagc tatgttgatg gcttttacca 60

<210> 188

<211> 60

<212> DNA

<213> Homo sapiens

<400> 188

cttgcccggg ctctggtcct tcttgctgcg gtccccaatg gctgcaataa cagcaaagta 60

<210> 189

<211> 60

<212> DNA

<213> Homo sapiens

<400> 189

cttgccatac tcggtctcgg cagtgacttt gccaccctct cgagacacga tcttggcctt 60

<210> 190

<211> 60

<212> DNA

<213> Homo sapiens

<400> 190

cttgaaccag taattcagca gtcgaagtag ctcttccaac gctattggtg gcatttactg 60

<210> 191

<211> 60

<212> DNA

<213> Homo sapiens

<400> 191

cttcttcaag caaggaagca gatgcagaag tttctccatg cttattgcga acaacaatag 60

<210> 192

<211> 60

<212> DNA

<213> Homo sapiens

<400> 192

cttctcgatg aggtcaatgc aggcctgcag gtccatgcca aagtcaatga atgtccactc 60

<210> 193

<211> 60

<212> DNA

<213> Homo sapiens

<400> 193

cttctcctga gttatttgca cttgttctct tttggtagta atgccttctc tacctcttga 60

<210> 194

<211> 60

<212> DNA

<213> Homo sapiens

<400> 194

cttctccagc tcatggatag tctttccgct ggaacccaac tgctcagtca agtcggagat 60

<210> 195

<211> 60

<212> DNA

<213> Homo sapiens

<400> 195

cttcgtgcca atgtcacggc tcttggcccg cagcttgttg acctgggact cggcgatgtc 60

<210> 196

<211> 60

<212> DNA

<213> Homo sapiens

<400> 196

cttcctcatc gtcctggtct gcctcatctt cagcgtgctg tccaccatcg agcagtatgc 60

<210> 197

<211> 60

<212> DNA

<213> Homo sapiens

<400> 197

cttccagtgc gctggtgagg acgctgactg cgctgagggc ccgctgccgt gctcctggct 60

<210> 198

<211> 60

<212> DNA

<213> Homo sapiens

<400> 198

cttccagact caggttggct gtgcttgata cttggcctac agcattacta gcaacaaacg 60

<210> 199

<211> 60

<212> DNA

<213> Homo sapiens

<400> 199

cttccactga gagtgaagct gatgttgtgg caacaccata gtcattcttg gcttcacagg 60

<210> 200

<211> 60

<212> DNA

<213> Homo sapiens

<400> 200

cttccacata aagtgtggct gttgatgttg cttttccagc cacaaaggtg tagtcagcag 60

<210> 201

<211> 60

<212> DNA

<213> Homo sapiens

<400> 201

cttccacagt taaaatcact gaaattgaag atctgcctgc cctgttttgg gcaaccacag 60

<210> 202

<211> 60

<212> DNA

<213> Homo sapiens

<400> 202

cttcatggag gccatctcct tctctctttc tgcactcttc agcagcggct tgatcttgaa 60

<210> 203

<211> 60

<212> DNA

<213> Homo sapiens

<400> 203

cttcagtgcc gtctggctcc gcctgctcct cccgctgctt cagcttgaac ttcatgtttc 60

<210> 204

<211> 60

<212> DNA

<213> Homo sapiens

<400> 204

cttcagtgaa gcagtcctct gggtccttga catcctggcc gaggtcaggg atctgctcca 60

<210> 205

<211> 60

<212> DNA

<213> Homo sapiens

<400> 205

cttcacagta ggagccttca ccgatttggt gatcttctga gcagaagatg tggctgacaa 60

<210> 206

<211> 60

<212> DNA

<213> Homo sapiens

<400> 206

cttcaacttt gagtttggca gatgttttgg aggtggccac cttgtaggta tattctccaa 60

<210> 207

<211> 60

<212> DNA

<213> Homo sapiens

<400> 207

cttcaacaat aagtttagca gtcgttttga cattttcatc ttccacaagt acacagctgt 60

<210> 208

<211> 60

<212> DNA

<213> Homo sapiens

<400> 208

cttcaacaag ctctggaggc tcttgacttg cttctgggcc tcggcggcca tgcggttggc 60

<210> 209

<211> 60

<212> DNA

<213> Homo sapiens

<400> 209

cttatgcaca gtaagggcac tgctccaggc tattctccaa acagaagaca tgttaaaggt 60

<210> 210

<211> 60

<212> DNA

<213> Homo sapiens

<400> 210

cttaacctcc tcctccagct gcctcttgag gtcctccagc tgctgggtgt aggtgagctt 60

<210> 211

<211> 60

<212> DNA

<213> Homo sapiens

<400> 211

ctgttcttga gcaggttgga tgtgcacagc agtcgtggtt gtcctctgag cagtctgctc 60

<210> 212

<211> 60

<212> DNA

<213> Homo sapiens

<400> 212

ctgttccaga aacccggcat tgaaaacggg ctggctgccc ttcagaagtg acagtgtcct 60

<210> 213

<211> 60

<212> DNA

<213> Homo sapiens

<400> 213

ctgtgatgat atgtgcattc ccttttgatc agtagttttg atatgagtct cagaaggagc 60

<210> 214

<211> 60

<212> DNA

<213> Homo sapiens

<400> 214

ctgtgaagat ggccacaaag agcaggttga tcttggccaa gatgttgatt ttctcaggac 60

<210> 215

<211> 60

<212> DNA

<213> Homo sapiens

<400> 215

ctgtctgtga tctgcagttc ctggtcatct ttcatccact gtacagtgat gtcaggttca 60

<210> 216

<211> 60

<212> DNA

<213> Homo sapiens

<400> 216

ctgtcgggga tgggtatcca gagatgtggc actccaaggt gacagattca ccttctatga 60

<210> 217

<211> 60

<212> DNA

<213> Homo sapiens

<400> 217

ctgtcagcat gtactgatag gcgttgtcgg agatggagaa gatgtggggc ggggcctcgc 60

<210> 218

<211> 60

<212> DNA

<213> Homo sapiens

<400> 218

ctgtatccag tggttagagg aacaccagat tttttccagt atacatgggg ctttgggttg 60

<210> 219

<211> 24

<212> DNA

<213> Homo sapiens

<400> 219

ctggtcctcc ttcacggtca ctgt 24

<210> 220

<211> 60

<212> DNA

<213> Homo sapiens

<400> 220

ctggtaggtg agctccttga tgcgccgctc gctcttcctc atgcccttca ccgactctgc 60

<210> 221

<211> 60

<212> DNA

<213> Homo sapiens

<400> 221

ctggggatac aatgcactct aattctcctg aatatgattc tggaacttct atgtcctgaa 60

<210> 222

<211> 60

<212> DNA

<213> Homo sapiens

<400> 222

ctgggataac tgaaatagtt tttagagctc tcaggactct gaaagttcga agagccgaca 60

<210> 223

<211> 60

<212> DNA

<213> Homo sapiens

<400> 223

ctgggaatgc agcagctgca cccgctcact agtctcaatc agctcctgct ccgccagctt 60

<210> 224

<211> 60

<212> DNA

<213> Homo sapiens

<400> 224

ctggcctggt tgctcgcctt cctcaaaccg tgtttccttg cgggtgggag gcaccttctc 60

<210> 225

<211> 60

<212> DNA

<213> Homo sapiens

<400> 225

ctggattact ctaggcttga ctgctttagg gacaacgtgg ggttctgagg ctggacgttg 60

<210> 226

<211> 49

<212> DNA

<213> Homo sapiens

<400> 226

ctggatgacc ctcttggtgt tgactgtctt ccctgctccg gattctccg 49

<210> 227

<211> 60

<212> DNA

<213> Homo sapiens

<400> 227

ctggagactt tgtctcatta gggatgatac aacgtacaaa gtggggatgg gtggagcgca 60

<210> 228

<211> 60

<212> DNA

<213> Homo sapiens

<400> 228

ctgcttgctg gactcctcct ccgtgcccag gctgttctcc tcatcttctt cttggtcatc 60

<210> 229

<211> 60

<212> DNA

<213> Homo sapiens

<400> 229

ctgctggaca ttctgcccct tggtgacgta ctcattgccc actttcaccc gagggtggca 60

<210> 230

<211> 60

<212> DNA

<213> Homo sapiens

<400> 230

ctgctgatag aggcgctccc agcagtcctg cgtcatcagg cggaagagtg caagaaaggc 60

<210> 231

<211> 60

<212> DNA

<213> Homo sapiens

<400> 231

ctgctgagca taggattctt caagatgccc aggctctctg ggctctctga ctcgggcctg 60

<210> 232

<211> 43

<212> DNA

<213> Homo sapiens

<400> 232

ctgctccgac tgcttgatgc gagcagagct catcgtgcag cct 43

<210> 233

<211> 60

<212> DNA

<213> Homo sapiens

<400> 233

ctgctcatga gttacgtgca tctgctcttg ctttgtggta attacttctt tggttcttga 60

<210> 234

<211> 60

<212> DNA

<213> Homo sapiens

<400> 234

ctgcgcttct agccgctcct tctctgactt gcgcaggtag ggggcggcag ccccaaagac 60

<210> 235

<211> 57

<212> DNA

<213> Homo sapiens

<400> 235

ctgcccacct acgagcagct gaccgtgccc aggaggggcc ccgatgaggg gtcctga 57

<210> 236

<211> 60

<212> DNA

<213> Homo sapiens

<400> 236

ctgccacagt aagttttcca gatgtcatat tttctcccgc gtaaaatgtg tattttcctt 60

<210> 237

<211> 51

<212> DNA

<213> Homo sapiens

<400> 237

ctgcagcttc tcgttggtga agttgatgca gagctgctca aagctgttga a 51

<210> 238

<211> 60

<212> DNA

<213> Homo sapiens

<400> 238

ctgcagctgc ttcttgccgc ccttgagggc gatctgctcg gcttcgtcca gccggtgctg 60

<210> 239

<211> 36

<212> DNA

<213> Homo sapiens

<400> 239

ctgcagccgc agcaggtttt tcctgtcctc ctccgt 36

<210> 240

<211> 60

<212> DNA

<213> Homo sapiens

<400> 240

ctgattttgg gatatttatg aggcacaatg atgtcactgt ttttcaacca tacaatgtca 60

<210> 241

<211> 60

<212> DNA

<213> Homo sapiens

<400> 241

ctgattctgc tcactggctc tagtgtggga atgtaagtcg gagctccaag tggtgcagca 60

<210> 242

<211> 60

<212> DNA

<213> Homo sapiens

<400> 242

ctgatcttct acataagttc tgaccactac agtatctttg gccattttct tcctaattaa 60

<210> 243

<211> 60

<212> DNA

<213> Homo sapiens

<400> 243

ctgaccggag atggggtcgg tgcccgcacg tgtctgaccg gggaagggga gtgtcttatg 60

<210> 244

<211> 60

<212> DNA

<213> Homo sapiens

<400> 244

ctgaatcttg tttttgatca gctgatcaca gcgctcctca gcatctgcca ggttgtcttg 60

<210> 245

<211> 60

<212> DNA

<213> Homo sapiens

<400> 245

ctgaagctcc ttgagcttct tctgcagctg gctgccgagg gcctgttcat cctcaatcct 60

<210> 246

<211> 60

<212> DNA

<213> Homo sapiens

<400> 246

ctgaacctcc tttttaatac ttcggatgcg aacatctctg ccttctacaa agagttttgc 60

<210> 247

<211> 60

<212> DNA

<213> Homo sapiens

<400> 247

ctgaaaacaa tgcggcagga agattacatg aagacgatag ccgaccttga gttacattac 60

<210> 248

<211> 60

<212> DNA

<213> Homo sapiens

<400> 248

ctgaaaaata ccaagatcga agttttggaa gaggagctca gactggcccg agatgccaac 60

<210> 249

<211> 60

<212> DNA

<213> Homo sapiens

<400> 249

ctctttagca ccagtggcaa cagcctctgc tgcgtagcta gcactggccg acacactggc 60

<210> 250

<211> 60

<212> DNA

<213> Homo sapiens

<400> 250

ctctgggtcg cctgccccca gtaatgagac caccccattg cagtccacag tgctgttctt 60

<210> 251

<211> 60

<212> DNA

<213> Homo sapiens

<400> 251

ctctgccgga agtccccgta gaggatgcgg ttggggaagc ctttcctgca gatgcggatg 60

<210> 252

<211> 60

<212> DNA

<213> Homo sapiens

<400> 252

ctcgtgttct ttcttgagca tttccatggc ctcctggaag cgcttttcct tctcctcggt 60

<210> 253

<211> 60

<212> DNA

<213> Homo sapiens

<400> 253

ctcggcctga aggtcatcca gagcctgttg gtgggcctct tgcagagctt tcttctcctt 60

<210> 254

<211> 60

<212> DNA

<213> Homo sapiens

<400> 254

ctcggcctcc tccagggctg actgcagctc catcttctcg gcctccagct gctttcggac 60

<210> 255

<211> 60

<212> DNA

<213> Homo sapiens

<400> 255

ctcggccacg ctgtcggcgt gcttcttgcg cagggccgcg gcagtggcct cgtgctgcag 60

<210> 256

<211> 60

<212> DNA

<213> Homo sapiens

<400> 256

ctcatatcca tgttctgtct taggaacaga aatttttgaa acagtaaagt gagggctagc 60

<210> 257

<211> 60

<212> DNA

<213> Homo sapiens

<400> 257

ctcagcgatg gtggcttggt tttgctcctc ataggccatt gcgaccacgg ccaggatcag 60

<210> 258

<211> 33

<212> DNA

<213> Homo sapiens

<400> 258

ctcagagctc tctgtgacta caaacaagat cag 33

<210> 259

<211> 60

<212> DNA

<213> Homo sapiens

<400> 259

ctcaccgcac cctggggcct ggggttccgc tttccactgc tgccgccagt cggcctgaga 60

<210> 260

<211> 60

<212> DNA

<213> Homo sapiens

<400> 260

ctcacagtcc cccatatcac gtgcgacccc ccagaagagc ggcggctgga ccacttctct 60

<210> 261

<211> 54

<212> DNA

<213> Homo sapiens

<400> 261

ctcaagcaga accttgatgg tcttccgctc ctctaggtag atgtcctcga aggc 54

<210> 262

<211> 18

<212> DNA

<213> Homo sapiens

<400> 262

ctactcctca ttcaagcc 18

<210> 263

<211> 60

<212> DNA

<213> Homo sapiens

<400> 263

ctacgttcca gcagcttttt gtactccatt ctggcgagca cacctcggga ctgggcctgg 60

<210> 264

<211> 60

<212> DNA

<213> Homo sapiens

<400> 264

cgtttctctt ctgtagtaaa tttctcagtc acggctgtgg tttccttttc aaattcttct 60

<210> 265

<211> 60

<212> DNA

<213> Homo sapiens

<400> 265

cgttcttgag tttgaagagc tctgtgctga gggagcgagc ctccttctgc gaggactcca 60

<210> 266

<211> 60

<212> DNA

<213> Homo sapiens

<400> 266

cgtgtctggc gggtgctcta gcatcacagg gcggaggagg tggcttcctg gggatgtggc 60

<210> 267

<211> 60

<212> DNA

<213> Homo sapiens

<400> 267

cgtggcctcc tccaggtccc gccgcatctt ctggaactcg gcctcgcgct tcttgttcat 60

<210> 268

<211> 60

<212> DNA

<213> Homo sapiens

<400> 268

cgtctgaagc atgagttcgg ttaatgacta gtcgctgttt agtacctttc acaatggcct 60

<210> 269

<211> 60

<212> DNA

<213> Homo sapiens

<400> 269

cgtctctggg ggtggcgggg agtagggggt ggcaatgcag ctgggcagct ggccctgggc 60

<210> 270

<211> 60

<212> DNA

<213> Homo sapiens

<400> 270

cgggccagta ccagtagatc cggtcagacc gttcaatttt gacaccattt ttgtaccatt 60

<210> 271

<211> 39

<212> DNA

<213> Homo sapiens

<400> 271

cggaggggcc tctgggccac cggacacagg ctgggattc 39

<210> 272

<211> 60

<212> DNA

<213> Homo sapiens

<400> 272

cggaaggccc cccggagcca cactctgctg tcacccagcc ccaaacccaa gaagtctgtg 60

<210> 273

<211> 51

<212> DNA

<213> Homo sapiens

<400> 273

cgcgagaaat ctgctatcta ccagttggag gaggagtatg aaaacctgct g 51

<210> 274

<211> 60

<212> DNA

<213> Homo sapiens

<400> 274

cgcctgcact tggagctgca ggtcattctt ctcctgcagc agggacacca tcttctcctc 60

<210> 275

<211> 60

<212> DNA

<213> Homo sapiens

<400> 275

cgcctcctcg gcctggcgct tgtaggcctt gacctttagc tgcagcttgt ctaccaggtc 60

<210> 276

<211> 31

<212> DNA

<213> Homo sapiens

<400> 276

cgccctggcc acggggactc tcttctggat g 31

<210> 277

<211> 60

<212> DNA

<213> Homo sapiens

<400> 277

cgcccgctcc tctgcctcat ccagctcgtg ctgcaccttg cggaacttgg acaggttggt 60

<210> 278

<211> 60

<212> DNA

<213> Homo sapiens

<400> 278

cgagaccaaa gttggtggag taacaggaat ttcaacaggt gctggtactc ttgctgtttc 60

<210> 279

<211> 60

<212> DNA

<213> Homo sapiens

<400> 279

cctgtgcaga gctgacacag tctgaaagga cgagcctttc ttggccttgc ctttgccctt 60

<210> 280

<211> 60

<212> DNA

<213> Homo sapiens

<400> 280

cctgcaggtt tttgttctcc cgcttgaagg tctccagatg ttccagggac tcctcatagg 60

<210> 281

<211> 60

<212> DNA

<213> Homo sapiens

<400> 281

cctgcacagc cagatagcag gatgtgctga cggttccagc ctcatttaca gcactgcaag 60

<210> 282

<211> 60

<212> DNA

<213> Homo sapiens

<400> 282

cctcgaagcc atctacacac ggagcctggg aggtcagcat ctggggcccg cctggctcct 60

<210> 283

<211> 60

<212> DNA

<213> Homo sapiens

<400> 283

cctccgcctt gctccggtgc tcattcatct ggtcttccaa ggtccggcac atcttctcca 60

<210> 284

<211> 35

<212> DNA

<213> Homo sapiens

<400> 284

cctccgaacc cactggccgt ggacctctct tgcaa 35

<210> 285

<211> 60

<212> DNA

<213> Homo sapiens

<400> 285

cctcatgccc tcaaatcgtg acagagctct cagaggacgg agtgcacgca gcgtccgcag 60

<210> 286

<211> 60

<212> DNA

<213> Homo sapiens

<400> 286

cctcagctcc gagtagttct tgccaaagag ctgcatgccc accacagcaa agatgaacac 60

<210> 287

<211> 60

<212> DNA

<213> Homo sapiens

<400> 287

cctatactct ccttcatcac tctttactaa gcttgttata aacaggttat ggaaccctgt 60

<210> 288

<211> 60

<212> DNA

<213> Homo sapiens

<400> 288

ccgggaccgc tctgtctgct ccaccacggc acgcaactcc tccagctcag cctgcagcag 60

<210> 289

<211> 60

<212> DNA

<213> Homo sapiens

<400> 289

ccgccaactt ggcatccaaa caccacgctc ccaccttcca ccagtttctg gaccactggt 60

<210> 290

<211> 60

<212> DNA

<213> Homo sapiens

<400> 290

ccgcagggcc agctccaagg gtggtggagg ctacacttgt cagagtggct ctggctggga 60

<210> 291

<211> 58

<212> DNA

<213> Homo sapiens

<400> 291

ccctccagca caccattgca gcgcagctgg tgcatgacca gggggttgtc catcaccc 58

<210> 292

<211> 60

<212> DNA

<213> Homo sapiens

<400> 292

cccgcgcccc ctgcgtcccc ggccgcgccc gccgcgcccc cagttgcctc cgaccttggc 60

<210> 293

<211> 54

<212> DNA

<213> Homo sapiens

<400> 293

ccccctggag tccacagctg catacataat gtccatccag cctttaaatg ttgc 54

<210> 294

<211> 60

<212> DNA

<213> Homo sapiens

<400> 294

ccaggcgccc ggcggggcag cgcgggcctg gccaagaagt gccccttctc gctggagctg 60

<210> 295

<211> 60

<212> DNA

<213> Homo sapiens

<400> 295

ccaggcaaag gaatcgaagc tggtgtagcc gtggtcgggg ttctcgcctg cctttaggca 60

<210> 296

<211> 60

<212> DNA

<213> Homo sapiens

<400> 296

ccagcgtcag agctgttccc acacagtaac acatcagagg tgccgttctt gagcaggtaa 60

<210> 297

<211> 60

<212> DNA

<213> Homo sapiens

<400> 297

ccagcagctc aggctttttg ttagacagga tttggtagaa aatgtgataa tctctctctg 60

<210> 298

<211> 60

<212> DNA

<213> Homo sapiens

<400> 298

ccacaggtgt agggattcca gtcactctca cttggagtct cacttggctt ccttgtctca 60

<210> 299

<211> 60

<212> DNA

<213> Homo sapiens

<400> 299

cattgctctg ggaccatctt ctgagtcaga cttggggagc ctgtcctccc cacactcctc 60

<210> 300

<211> 60

<212> DNA

<213> Homo sapiens

<400> 300

cattgacata gagagtgaca gaactcctgt tccttcctgc cacaaaggtg tattctcctg 60

<210> 301

<211> 60

<212> DNA

<213> Homo sapiens

<400> 301

cattctcggt ttgcaacttg gcccgctggc tggtgaggtc gttgacagaa cgctgggtct 60

<210> 302

<211> 60

<212> DNA

<213> Homo sapiens

<400> 302

catgggaaac actaacttca aaggcaacag tggcattttc caaggctgtc acatcctttg 60

<210> 303

<211> 60

<212> DNA

<213> Homo sapiens

<400> 303

catgaagagt gtgttgagta cgatgcacat agtgatggtg aggtcagtaa acgggtccat 60

<210> 304

<211> 60

<212> DNA

<213> Homo sapiens

<400> 304

catgaagaaa tttgcacttg aagccagtgg aaagcagctg ctcttccttg taccaggaaa 60

<210> 305

<211> 60

<212> DNA

<213> Homo sapiens

<400> 305

catctgaggg ggagatgttc tgcagcatca gcttgtggac tttcctttct gagaccagtc 60

<210> 306

<211> 52

<212> DNA

<213> Homo sapiens

<400> 306

catcgtcttc attgacctca aattcaacaa cagcacgctg tttctcaatg ac 52

<210> 307

<211> 60

<212> DNA

<213> Homo sapiens

<400> 307

catcgctctg tctggtctca gagataaaca ttcggtggat tcttctttcc actacatatt 60

<210> 308

<211> 60

<212> DNA

<213> Homo sapiens

<400> 308

catccccaaa gtgaacattc ctgatgttca gtgagtgtgt gagctttttg gttctcatct 60

<210> 309

<211> 60

<212> DNA

<213> Homo sapiens

<400> 309

catccacgat ggcacagttt ttaatcctca gagagtaaat tgttcctttg acagagatag 60

<210> 310

<211> 60

<212> DNA

<213> Homo sapiens

<400> 310

catcatgaaa ccagaacgtc tctggcatag gtctaccaac aacctttaag tcaaatctgg 60

<210> 311

<211> 60

<212> DNA

<213> Homo sapiens

<400> 311

catcatcttt catcatattt agaactgtca atttatatat ttttccatgt gcttcaattt 60

<210> 312

<211> 60

<212> DNA

<213> Homo sapiens

<400> 312

catagttcac tgtcacctca aaagtaatag tgtctttttc ttcagcgttg atgtctttca 60

<210> 313

<211> 60

<212> DNA

<213> Homo sapiens

<400> 313

catacttttc attggattcc agcacaactc catttttgat ccactggaca cctttgacat 60

<210> 314

<211> 60

<212> DNA

<213> Homo sapiens

<400> 314

cagtttgccc ttctaaacat ttgaaagaaa caggttttaa cacaaagact ggtttatata 60

<210> 315

<211> 60

<212> DNA

<213> Homo sapiens

<400> 315

caggtttccg acctgcagca tctcctcgaa ttcacttgtc atgttgtagt gctccagcgc 60

<210> 316

<211> 60

<212> DNA

<213> Homo sapiens

<400> 316

caggtggttg cgcttggcct gttccatctc ctcgtccttc tctgccagct tccgctcgat 60

<210> 317

<211> 60

<212> DNA

<213> Homo sapiens

<400> 317

caggtcctta atggtctgtt ccatgttctt cttcatgcgc tccaggtggg cgctggtgtc 60

<210> 318

<211> 60

<212> DNA

<213> Homo sapiens

<400> 318

caggggccgt gggatgggct tctggggctt cttggagccc agcttcttca tggcattgta 60

<210> 319

<211> 60

<212> DNA

<213> Homo sapiens

<400> 319

cagggactga caccttacat tcaagcacag ccttggtgcc ttcaatcaca ttaacatctt 60

<210> 320

<211> 60

<212> DNA

<213> Homo sapiens

<400> 320

caggcggaag gagcgcagca ccgacaagtt gctcatgcgg gacaggccca gctccatgag 60

<210> 321

<211> 60

<212> DNA

<213> Homo sapiens

<400> 321

cagctccttg cggcgagcct cggacttctc tagcgcctct ttgaggcgtg tgaactcctc 60

<210> 322

<211> 60

<212> DNA

<213> Homo sapiens

<400> 322

cagcgctcca ctgctgagta ggatcatgaa gatgatgaat gtctcgaacc agctgtgctc 60

<210> 323

<211> 59

<212> DNA

<213> Homo sapiens

<400> 323

cagccccttg agcaggtcgg ctgagttcag ccccatgagg taggcagact tgtcagcct 59

<210> 324

<211> 60

<212> DNA

<213> Homo sapiens

<400> 324

cagaaagccc agcagatcca ctctcagact tcacagcagt atccacttta tgatctggac 60

<210> 325

<211> 47

<212> DNA

<213> Homo sapiens

<400> 325

cagaaactgg aaaatatcaa tggtgttaca gatggctact taaatag 47

<210> 326

<211> 60

<212> DNA

<213> Homo sapiens

<400> 326

cactttccaa ggagacttta acttcaagct gaacaatgtc accctcacag actttttggt 60

<210> 327

<211> 60

<212> DNA

<213> Homo sapiens

<400> 327

cacttcagtc tggagctggg acaggtcagc atccatcttc ttcttctggt tgatgaggct 60

<210> 328

<211> 60

<212> DNA

<213> Homo sapiens

<400> 328

cactaatgtg agcctcaaag gttgcggtac taccctccag taccacaacg ctttgtaacg 60

<210> 329

<211> 60

<212> DNA

<213> Homo sapiens

<400> 329

cacgatgtgg tagcaggtct tgcgcaaccg ccaccagacc ttccctgggg cctgtgtggt 60

<210> 330

<211> 60

<212> DNA

<213> Homo sapiens

<400> 330

cacctccatg cagtcccaca tggtctcgat ccactctcca cagaggatgc ggaagatgat 60

<210> 331

<211> 60

<212> DNA

<213> Homo sapiens

<400> 331

cacattcggg gtctggtttc cccacgactc tgacccggaa gtgtgcatca gatccttggc 60

<210> 332

<211> 60

<212> DNA

<213> Homo sapiens

<400> 332

cacaaggttg ccaatgacca taacaagcaa gaagaccagc aggcataatg actgccccga 60

<210> 333

<211> 60

<212> DNA

<213> Homo sapiens

<400> 333

caatgtgaac cctgtcactg ggctgcactt cttggccgtc tttcatccag acgccttcca 60

<210> 334

<211> 60

<212> DNA

<213> Homo sapiens

<400> 334

caagcgcgga agccttacga tgtgcgggac gtcattgagc agtactcgca gggccacctc 60

<210> 335

<211> 60

<212> DNA

<213> Homo sapiens

<400> 335

caagagttca tcagaaatag ccaaggctca gagatgtttg gagatgatga caagcggaaa 60

<210> 336

<211> 16

<212> DNA

<213> Homo sapiens

<400> 336

caagaagaaa ttccag 16

<210> 337

<211> 60

<212> DNA

<213> Homo sapiens

<400> 337

caaagtgcat gatggcgcct gtcagcttat acatggagtt tttctcctct gaagtgaagc 60

<210> 338

<211> 60

<212> DNA

<213> Homo sapiens

<400> 338

caaaggggac atctccaagg agctacggga cacggtatcc acacccctga tggtgagggc 60

<210> 339

<211> 60

<212> DNA

<213> Homo sapiens

<400> 339

attgagtcat tctaaagaac cgagatggct tgattttctt gtctttgctg taccacgaca 60

<210> 340

<211> 30

<212> DNA

<213> Homo sapiens

<400> 340

atggtgcaca tgatgagcat gttgaagagc 30

<210> 341

<211> 60

<212> DNA

<213> Homo sapiens

<400> 341

atggccgcgg cctcctcccc gcccagggcc gagaggaagc gctggggttg gggccgcctg 60

<210> 342

<211> 51

<212> DNA

<213> Homo sapiens

<400> 342

atcgcctcct gcttctctgt ctttgccatc tccttctttg cgctcccagc g 51

<210> 343

<211> 60

<212> DNA

<213> Homo sapiens

<400> 343

atcgaagatc tcgaagccag cgatgtccag gactcctatg aagtactggc gtggctgctt 60

<210> 344

<211> 60

<212> DNA

<213> Homo sapiens

<400> 344

atccgtgatg gccttcttgg ccttctcctc agcattcctg cactcctgca ctgcctcctc 60

<210> 345

<211> 60

<212> DNA

<213> Homo sapiens

<400> 345

atcatccact tgctgctcca gcttgacttt ggccttagtc agggtgttga ccttgtcctc 60

<210> 346

<211> 60

<212> DNA

<213> Homo sapiens

<400> 346

atcagtggcc atgagctcct cagcgtcatc aatggaggcc acggtggtct ctccttggga 60

<210> 347

<211> 48

<212> DNA

<213> Homo sapiens

<400> 347

atcaagagga ccatgattca gtccccttct ggggtgattc tgcaagag 48

<210> 348

<211> 60

<212> DNA

<213> Homo sapiens

<400> 348

ataggagggt gggaaggaag tggaggagat ggaggagctg gagggtgggc caaggggtcg 60

<210> 349

<211> 60

<212> DNA

<213> Homo sapiens

<400> 349

atacgcgtga tgatgcggct cagcctctcg tccctcattt cctccagcag ccccagcagc 60

<210> 350

<211> 60

<212> DNA

<213> Homo sapiens

<400> 350

atacgcatga gtcaactgga agttaaagaa aaagagctca ataagctgaa acaagaaagt 60

<210> 351

<211> 60

<212> DNA

<213> Homo sapiens

<400> 351

atacagtctc agttcaccga tgcccagaag cattaccaga ccctggtcat tcagctccct 60

<210> 352

<211> 28

<212> DNA

<213> Homo sapiens

<400> 352

agttggtcat cagcttgttc agattttc 28

<210> 353

<211> 60

<212> DNA

<213> Homo sapiens

<400> 353

agttgacacg ttgcctcctg ccaccactgt gtacttccca gcatcagaca tccgggtgga 60

<210> 354

<211> 60

<212> DNA

<213> Homo sapiens

<400> 354

agttcctgaa gacatccgtt ttctcctctt gcttcttctc tcatggctgt ttactggggc 60

<210> 355

<211> 60

<212> DNA

<213> Homo sapiens

<400> 355

agtgtgcaga atgattcaca agcaattgct gaggttctca accagcttaa agatatgctt 60

<210> 356

<211> 60

<212> DNA

<213> Homo sapiens

<400> 356

agtgggacag ctcaacctca aacaccacat tttgagtttc tgtacaggta aggtcacgaa 60

<210> 357

<211> 60

<212> DNA

<213> Homo sapiens

<400> 357

agtgggacac ctcacactca aaagaggcag ttttggtctc aggcacctcg atatttttca 60

<210> 358

<211> 60

<212> DNA

<213> Homo sapiens

<400> 358

agtgcatcct gtatttatct ccctcatgaa cctccatacc atctttatac catttcactt 60

<210> 359

<211> 60

<212> DNA

<213> Homo sapiens

<400> 359

agtcctctgt gctggtgttc atgatgatca gctgatggag ttttccctgc acaactatct 60

<210> 360

<211> 60

<212> DNA

<213> Homo sapiens

<400> 360

aggtctctat gtctgcagat gccaactttc ctgttgcccc aaaatgaatt cgaatgaatt 60

<210> 361

<211> 60

<212> DNA

<213> Homo sapiens

<400> 361

agccttctgg tgaaaatcaa agtcctggag caagacaagg caaggctgca gaggctggag 60

<210> 362

<211> 60

<212> DNA

<213> Homo sapiens

<400> 362

agccaccggg gcatccacaa ctccatcggc gactatcgct ggcagctgga caaaatcaaa 60

<210> 363

<211> 60

<212> DNA

<213> Homo sapiens

<400> 363

agcattcatc tcctcctcat cctccagcct ctcgttcatc tccttcacct tggcctccag 60

<210> 364

<211> 60

<212> DNA

<213> Homo sapiens

<400> 364

agatgaggag gccacgtagc cctcttgctt ccaaggggga ggcacttcag gacctgtggc 60

<210> 365

<211> 60

<212> DNA

<213> Homo sapiens

<400> 365

acctcatcgt ggtcgtggcc tccatggtgg tcctctgcgt gggctccaag gggcaggtgt 60

<210> 366

<211> 60

<212> DNA

<213> Homo sapiens

<400> 366

accgcatgga ggtgctatgc tgccgagaac cccgactcct ccacctggaa gatctacatc 60

<210> 367

<211> 60

<212> DNA

<213> Homo sapiens

<400> 367

acccagccct gcggcagtgg cggctccgtc gaccctgagc tcttcctgcc cagcaacacc 60

<210> 368

<211> 49

<212> DNA

<213> Homo sapiens

<400> 368

acatttttca gtttttctac aaacatcggt tttacctgat gttccacag 49

<210> 369

<211> 32

<212> DNA

<213> Homo sapiens

<400> 369

aattgcctag ttttatattt tctgatacat ac 32

<210> 370

<211> 60

<212> DNA

<213> Homo sapiens

<400> 370

aatcttcagc atcagacgta tcaatggtca gtatggagag gaagtgaacc tttctgtcag 60

<210> 371

<211> 60

<212> DNA

<213> Homo sapiens

<400> 371

aatatcgtcc actgttggct ttagtcacgg cggggatcgt cagtttagcg cggccatcgc 60

<210> 372

<211> 60

<212> DNA

<213> Homo sapiens

<400> 372

aataggtccc tgagtcctca gggtatgctt ctgcaatcag taagctgtag aggtcgcctt 60

<210> 373

<211> 37

<212> DNA

<213> Homo sapiens

<400> 373

aagggttgac ggtgacacag aagaggcccg agtaggt 37

<210> 374

<211> 59

<212> DNA

<213> Homo sapiens

<400> 374

aaggcgttgg tggcactgaa ccggaagatg gtcttgcctt tattcagtac gatgaaagt 59

<210> 375

<211> 60

<212> DNA

<213> Homo sapiens

<400> 375

aagaagtacc cctgcgacaa gaacatgccc ctgcagcacc tgctggaaca gatcaaggag 60

<210> 376

<211> 60

<212> DNA

<213> Homo sapiens

<400> 376

aagaagattg tacagctgaa gcctcgtaac ccagactaca gaagcaataa acccattatt 60

<210> 377

<211> 60

<212> DNA

<213> Homo sapiens

<400> 377

aacttgcaca gtgaaatatc tggcaaacga gacaaatcag aggaagtaca aaaaattgct 60

<210> 378

<211> 60

<212> DNA

<213> Homo sapiens

<400> 378

aactgccatc ttttcttctc catcttcttc aagaagttct tctaatgtag tctttattat 60

<210> 379

<211> 35

<212> DNA

<213> Homo sapiens

<400> 379

aacctcatgg tgcgcatcaa ggagctgcag aggag 35

<210> 380

<211> 60

<212> DNA

<213> Homo sapiens

<400> 380

aaccgtgggt cttggagagc cacgaactaa gcactgaaaa tatgctgctg tacctattgg 60

<210> 381

<211> 36

<212> DNA

<213> Homo sapiens

<400> 381

aaccggcaga tcccggcggc agcctcactc attcag 36

<210> 382

<211> 33

<212> DNA

<213> Homo sapiens

<400> 382

aacagctgca cttttgtcag catcttgttt cac 33

<210> 383

<211> 60

<212> DNA

<213> Homo sapiens

<400> 383

aaagcgtcct ttgagaggat ggatcacctg cgacagctgc agaacatcat tcaggccacg 60

<210> 384

<211> 60

<212> DNA

<213> Homo sapiens

<400> 384

aaagaacgag agaaaatcct tgaatacaag cgtcaggtgc agaacttggt aaacaagtct 60

<210> 385

<211> 60

<212> DNA

<213> Homo sapiens

<400> 385

aaaatcgtgc ataaggggga tgagtgtatc ctgaaggaca acaacgagcg cagcaagtgg 60

<210> 386

<211> 60

<212> DNA

<213> Homo sapiens

<400> 386

aaaataaaaa atgacttgaa cttgaagaag tcgttgttgg ccactatgaa gacagaacta 60

<210> 387

<211> 60

<212> DNA

<213> Homo sapiens

<400> 387

aaaagagcaa ggatcgcggc agcaacacga tcggcgcccg cctgaaccga gtagaagaca 60

<---

Claims (16)

1. A method for preparing a DNA library from DNA isolated from a biological sample for subsequent sequencing using new generation sequencing methods, in which: (1) fragmenting the DNA isolated from the sample to obtain a mixture of DNA fragments; (2) restoring the terminal sequences of DNA fragments obtained in step (1) (blunting the ends) and enriching the resulting mixture of DNA fragments with target DNA sequences by means of magnetic particles with covalently attached oligonucleotide probes that are specific to the target DNA sequences; (3) ligating the target DNA sequences obtained in step (2) with oligonucleotide adapters containing the oligonucleotide sequence used in said next generation sequencing method; (4) purify the DNA sequences obtained in step (3) by means of said magnetic particles, characterized in that said magnetic particles are magnetic particles to which oligonucleotide probes having nucleotide sequences SEQ ID NO: 1 to 387 are covalently attached. 2. A method according to claim 1, wherein the fragmentation of the DNA in step (1) is performed by means of ultrasound. 3. The method of claim 1, wherein the DNA fragmentation in step (1) is performed to a fragment size of about 150 base pairs (bp). 4. The method according to claim 1, wherein the restoration of the terminal sequences of the DNA fragments in step (2) is carried out by means of E. coli DNA polymerase I (Klenow fragment) and T4 DNA polymerase. 5. The method of claim 1, wherein said probes have nucleotide sequences of SEQ ID NO: 1 to 387. 6. The method of claim 1, wherein the attachment of said adapters to the ends of the DNA is accomplished by ligating the first adapter to the intermediate adapter, disrupting the intermediate adapter, and ligating the second adapter. 7. The method according to claim 6, in which to attach the first adapter and the second adapter with a complementary intermediate adapter at the other end of the DNA fragment with subsequent destruction of the intermediate adapter, E. coli DNA polymerase I (Klenow's fragment), T4 DNA polymerase, uracil DNA glycosylase, T4 DNA ligase and Taq DNA polymerase. . 8. The method of claim 1, wherein said adapters are oligonucleotide sequence 5P- ACTGTCTCTTATACACATCTCCGAGCCCACGAGAC TAAGGCGA ATCTCGTATGCCGTCTTCTGCTTG-C3, an intermediate adapter having a sequence GAGAUGUGUAUAAGAGACAGddT, and a second adapter has the sequence: C3- AATGATACGGCGACCACCGAGATCTACAC CTCTCTAT TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGT. 9. The method according to claim 1, wherein after step (3) or (4), the target DNA fragments are selected by size. 10. The method according to claim 1, wherein after step (3) or (4) the target DNA fragments are amplified by polymerase chain reaction (PCR). 11. The method of claim 10, wherein the amplification is carried out by polymerase chain reaction (PCR).

Images