RU2743586C1 - Method of determining efficiency of enrichment of ngs library with exon sections for sequencing human exome - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology and can be used to check the quality of samples prepared for high-throughput DNA sequencing. To determine efficiency of NGS-library enrichment with exon sections for human exome sequencing qPCR with human DNA of the same NGS-library is performed before and after enrichment procedure. Each PCR reaction is carried out with at least 50 pg DNA of the NGS library. Efficiency of the qPCR reaction and the threshold cycles of the fluorescent signal of the NGS-library samples before and after the enrichment procedure are determined. Enrichment efficiency of the NGS library is then calculated using the given formula.EFFECT: technical result consists in improvement of NGS-library enrichment efficiency evaluation accuracy.1 cl, 2 ex, 4 dwg

Description

The invention relates to biotechnology and can be used to check the quality of samples prepared for high-throughput DNA sequencing.

It is known that high throughput sequencing (NGS) requires the preparation of the so-called. NGS libraries - DNA fragments with a typical length of 200-500 bp. of the investigated genome, flanked by certain sequences (adapters).

In a number of applications (complete exome sequencing, transcriptome sequencing), the NGS library is "enriched" with specific regions of the genome, i.e. its composition - the relative representation of genome regions - changes. So, for the enrichment of the human exome, the fraction of the genome, including exons and their surroundings, which are the subject of enrichment, is 1-1.5%. These regions, initially equal to other regions, after enrichment represent most of the fragments (about 80%) in the NGS library.

The success of enrichment depends on many factors and the accuracy of the procedure, and may vary (be less than the target level). There is some difficulty in determining the efficiency of enrichment prior to direct sequencing.

First, there are a limited number of methods that can measure the efficiency of enrichment itself. Secondly, the amount of the enriched library taken for the test should be small (within two ng). This limitation is accompanied by a small total of the entire enriched library, since the production of large amounts of it, as a rule, lowers the quality of the library.

The qPCR (real-time PCR) method has been proposed to evaluate the enrichment efficiency in exome sequencing (Life tech TargetSeq ™ Exome Enrichment System, Revision Date 15 July 2011, Publication Part Number MAN0004396). The method involves making a judgment about the degree of enrichment by measuring the number of target fragments (exons) and fragments near exons (which are not enriched in the NGS library for sequencing the human exome, the so-called negative tests) by qPCR for a sample before and after enrichment.

However, the described method has several disadvantages. First, the protocol requires 500 pg of library DNA for each qPCR reaction to a final in vitro concentration of 25 pg / μL. In addition, this protocol does not imply the measurement of the efficiency of one cycle of the PCR reaction, which means that it does not allow quantitative assessment of the difference in enrichment of the fragments involved in PCR, but only qualitatively assess the overall level of enrichment.

A similar panel of qPCR reactions has been described to assess enrichment efficiency (NimbleGen SeqCap EZ Library SR User's Guide, 2011). The advantage of this system is the determination of the effectiveness of each PCR reaction, which allows you to quantify and adjust different levels of enrichment for different PCR targets. The disadvantages include a large amount of DNA for each PCR reaction (5 ng, up to a concentration of 333 pg / μl in the reaction); the absence of PCR reactions for non-enriched regions (negative tests), and the presence of qPCR reactions only for regions of exons.

Thus, for all such systems, there is a technical limitation: if you use a small (~ 50 pg) amount of DNA per PCR test, then a sample enriched with exome sequences to a level of 80% will contain, on average, only 2 copies of an unenriched test site. Since the NGS library consists of DNA fragments typically no more than 400 bp in length, the probability that a sample will contain at least one fragment that completely contains the amplicon PCR sequence is well below 100%.

In other words, there is a high probability that there will be no DNA template for the PCR reaction in the sample, and the test will not take place. It is this circumstance that obliges the described protocols to use a relatively large amount of DNA for the test.

Known multipoint test for the efficiency of target enrichment (MMTE) with separation by capillary electrophoresis (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5341873/). Despite the high accuracy of the method itself, the results presented in the article have a strong discrepancy with the actual data of NGS sequencing, which is possibly caused by the amplification of the probe connected by ligation necessary in the PCR method. Also, this method provides for both the purchase of ready-made kits, that is, it limits the adaptation of protocols, and requires a capillary electrophoresis instrument in the laboratory, a much more expensive device than a PCR amplifier with real-time signal detection.

A method is described that involves a qPCR system to determine the efficiency of enrichment, in which selective enrichment of target regions (one gene of your choice) by hybridization and their sequencing is carried out (CN 103667254, B, SHAO YANG et al., January 11, 2017). The invention is aimed at working with both genomic DNA and transcriptome (with the translation of mRNA into cDNA). In this case, the assessment of the efficiency of enrichment is performed by qPCR on the target gene.

The disadvantage of this method is that the system used has only a positive test for 1 gene (eg K.RAS, EGFR, BRAF genes), not taking into account all other genes. This approach can give an inaccurate estimate of enrichment, since not every fragment of the library containing the target gene will contain the qPCR amplicon sequence. This, in turn, distorts the quantification of beneficiation efficiency.

The closest to the patent is a method for assessing the enrichment of an NGS library with target sites (US 8663924, B2, AGILENT TECHNOLOGIES INC [US]; ONG JOSEPH HOANG HAI HAPPE SCOTT, 03/04/2014 - prototype). The system used involves the use of repetitive sequences as a negative control to determine the overall level of enrichment in target fragments. To assess the efficiency of enrichment, it was proposed to carry out a qPCR reaction on samples before and after enrichment, using a negative test for repeated sequences. Standard curves are used to calibrate and measure the efficiency of PCR reactions for each amplicon.

The disadvantage is that the known method does not imply a specific calculation of the enrichment efficiency, but only describes the experimental procedure as a general principle, suggesting that the obtained difference between the cycles of the negative test should be converted into the enrichment efficiency. In addition, the system uses sequences of previously unknown human specificity.

Thus, primers for SINE repeats can also give a PCR product on repeats of other species, which lowers the specificity of the PCR reaction in the case of DNA contamination. The system does not perform better on repetitive sequences than on those occurring once in the genome, and does not demonstrate an extended limit on DNA concentrations per qPCR test.

The present invention is directed to solving the problem of improving the accuracy of determining the efficiency of enrichment of NGS libraries prior to direct sequencing. This allows you to weed out unsuccessful enrichments and, thus, save resources. In addition, it allows you to calculate the amount of HPP data you need per sample while quantifying the enrichment efficiency.

The technical result achieved by the implementation of the invention consists in:

- increasing the accuracy of assessing the efficiency of NGS library enrichment through the use of original primers complementary to repeating sequences of the human genome that are not exons;

- the ability to determine the number of target fragments of NGS-library enrichment for sequencing of human exome, measured as a percentage of the total number of NGS-library fragments;

- reducing the required amount of DNA per test, which allows you to save the total amount of the NGS library sample and thus improve the overall quality of sequencing.

A method for assessing the efficiency of the NGS library enrichment with exon regions (for sequencing the human exome) is proposed, which approaches in a new way to the qPCR test of regions that should not be enriched: instead of PCR for unique regions of the genome that are not subject to enrichment, the patent invention uses repeating regions of the genome repetitions of a transposon nature). Due to their frequent representation in the genome (up to 11% of the genome are occupied by identical Alu repeats), such regions are almost 100% likely to remain in the enriched library (even in the case of an unattainable enrichment efficiency of 99.9%).

The essence of the invention is as follows.

To determine the efficiency of enriching an NGS library with regions of exons for sequencing the human exome, qPCR is performed with human DNA of the same NGS library before and after its enrichment procedure. When carrying out qPCR reactions, primers 5'-GGTGAAACCCCGTCTCTACTA-3 'and 5'-GGTTCAAGCGATTCTCCTGCC-3' are used, which are complementary to repeating sequences of the human genome that are not exons.

Each qPCR reaction is performed with at least 50 pg of NGS library DNA. The efficiency of the qPCR reaction and the threshold cycles of the fluorescent signal of the NGS library samples before and after the enrichment procedure are determined. Then the efficiency of enrichment E (%) of the NGS library is calculated by the formula:

where: E is the efficiency of the qPCR reaction with a pair of the indicated primers for repeating sequences of the human genome;

Ct1, Ct2 - values of the threshold cycle of the fluorescent signal of the qPCR reaction for the NGS library sample after enrichment and before enrichment, respectively.

The method is carried out as follows.

Real-time PCR is performed in any qPCR device capable of detecting the FAM channel (the method is optimized but not limited by the use of the SYBR Green I dye intercalating in DNA, excitation wavelength - 497 nm, fluorescence - 521 nm).

In case of results shown, the volume of each reaction is 40 μL (to minimize pipetting errors and better signal sensitivity). However, the invention extends to any other volumes of the PCR mixture, since its principle does not change from this. The PCR mixture is prepared according to the principle of a common solution for all PCR reactions of one DNA template (one sample).

Thus, the same concentration of all components of the PCR reaction is achieved, including PCR buffer, DNA, polymerase, dNTP. Primers are added separately to each tube using a single or multichannel pipette. The primer volume (and concentration) is adjusted to minimize pipetting error.

The direct result of measuring the PCR reaction are the threshold cycles (Ct) of the sample before and after enrichment (Fig. 1) and control without template DNA. FIG. 1 shows an example of qPCR reaction results on a pair of primers for samples before and after enrichment (two technical replicates), as well as on a control without a DNA template. The intersection of the fluorescence signal curves with the threshold fluorescence level determines the value of the threshold cycles Ct. One can see the consistency of technical replicates and the difference in the mean values of the threshold cycles for the samples before and after enrichment. There is no signal for control without DNA template.

For each PCR reaction, a standard straight line is constructed to determine the efficiency of the reaction under these conditions, to recalculate the difference in cycles into the difference in the concentrations of specific regions of the genome in the NGS library.

The overall result of the system is the final estimate of the efficiency of enrichment E (%) according to the proposed formula.

At the same time, the used reactions to Alu repeats are key for determining the level of unenriched DNA with high accuracy.

The intermediate enrichment result is presented in the form of cycle difference and absolute difference (Fig. 2 and Fig. 3):

where Co is the concentration of fragments amplified in a specific qPCR reaction in an enriched sample;

Cn is the concentration of fragments amplified in a particular qPCR reaction in the sample before enrichment;

E _i - the efficiency of a specific qPCR reaction (for a specific pair of primers);

ΔCt _i is the difference between the threshold cycles of the fluorescent signal for the enriched sample and the sample before enrichment.

The error limits are the standard deviation of the replicates of the samples, recalculated into the total interval of the standard deviation of their difference:

where: σ ₁ is the standard deviation of technical repeats of the threshold cycles of the sample before enrichment for a particular PCR reaction;

σ ₂ - standard deviation of technical repetitions of the threshold cycles of the sample after enrichment for a specific PCR reaction;

σ _Σ is the total error limit for measuring the difference in the threshold cycles of the qPCR reaction.

The proposed method includes the following steps:

1. Before carrying out the enrichment of the NGS library (or mixture of libraries), a sample of the unenriched library (or mixture of libraries) is selected, in an amount of 100 pg or more.

2. After enrichment, the same library (or a mixture of libraries) is selected in an amount of 100 pg or more.

3. Prepared qPCR reaction using

5'-GGTGAAACCCCGTCTCTACTA-3 'and 5'-GGTTCAAGCGATTCTCCTGCC-3'.

The total volume of one reaction is 40 μl. The reaction is collected according to the recipe:

All components of the qPCR reaction, except for the primers, are added immediately to all tubes of the PCR reactions in technical repeats (at least two per sample). Primers are added 5 μl to each tube (plate well). V is taken from the calculation that at least 3 μl of DNA template is added to the entire PCR reaction solution.

4. The efficiency of the qPCR reaction along the standard straight line is calculated in advance:

where: E is the efficiency of the qPCR reaction (exponential factor);

K is the slope coefficient of the straight line of the standard calibration straight line of the qPCR reaction (logarithm of the matrix DNA concentration along the horizontal axis, the average threshold cycle of the fluorescent signal along the vertical axis).

5. qPCR reaction is put on the 95 ° C program for 5 minutes; 40 cycles: 95 ° C 20 seconds, 59 ° C 15 seconds, 72 ° C 25 seconds; melting curve from 45 ° C to 95 ° C, an increase of 0.5 ° C in 15 seconds. The measurement of fluorescence is performed after each elongation phase (72 ° C). FAM fluorescent signal detection channel.

6. Data interpretation begins with checking the melting curves, the melting point of the amplicon of each reaction is checked against the reference, if the melting temperature is lower by more than 2 degrees, this indicates the amplification of primer-dimers; if higher, this indicates the amplification of a long non-specific product. Repeat negative PCR controls may have the same melting point or higher.

An example of reference (determined in a knowingly correct PCR reaction) melting temperatures:

7. Checking Ct threshold cycles for tests and negative controls (without DNA template for amplification). The negative control must either not come out on any cycle (have no Ct), or have a different melting point on melting curve analysis.

8. The threshold value of fluorescence for determining Ct is set for reasons higher than the background, but at the stage of exponential growth of the signal for all qPCR reactions. The standard deviation of each PCR reaction is calculated by technical repeats, the difference between the threshold cycles for the unenriched and enriched samples and the total deviation are calculated using the formula above. FIG. 2 shows an example of the differences in the threshold cycles of qPCR reactions in the samples before and after enrichment with a standard deviation range.

9. Calculate the absolute difference in the concentration of the fragments using the formula above. FIG. 3 shows an example of the ratio of the concentrations of fragments amplified during qPCR in samples before and after enrichment. These values are calculated in this clause of the described procedure of the invention. Positive values indicate an increase in the concentration of fragments after enrichment, while negative values indicate a decrease.

10. The efficiency of enrichment E (%) is calculated by the formula:

Example 1

Items 1-3, 5-7 do not differ from those described above. Result 4 points:

Result of 8 points:

Result of 9 points:

10 point result: efficiency is 79%, Actual efficiency measured after high throughput sequencing is 80%.

Example 2

A comparison of the patented method with already existing methods described in analogues is carried out. For this, we used additional qPCR reactions with primers that amplify regions of exons and regions near exons. Used for this pair of primers, in addition to those described in the invention:

Items 1-3, 5-7 do not differ from those described above. Result 4 points:

Result of 8 points:

“No” in the table means that the reaction did not go through (the fluorescent signal did not exceed the threshold value in 40 PCR cycles). As seen in FIG. 4, qPCR for non-repeating (and non-exons) sequences failed for 50 pg DNA per qPCR reaction on an enriched library (E2, E3). As already noted, the probability that for 50 pg of DNA from an enriched library there is at least 1 fragment containing this region completely is significantly less than 100%. This demonstrates that the methods described in the prior art are indeed limited in the amount of input material, whereas the present invention operates at concentrations of 1.2 pg / μl of starting DNA in a PCR mixture.

Result of 9 points:

Result of 10 points:

The efficiency is 68%. The actual efficiency measured after high throughput sequencing is 70%.

Thus, the presented data confirm the achievement of the technical result in terms of increasing the accuracy of assessing the efficiency of NGS library enrichment, the possibility of determining the number of target fragments of NGS library enrichment for sequencing the human exome and reducing the required amount of DNA per test.

--->

List of nucleotide sequences

“Method for determining the efficiency of enrichment of NGS-library by regions

exons for sequencing the human exome ”

Sheets 3

Copyright holder:

- Federal State Autonomous Educational Institution of Higher

education "Russian National Research Medical

Pirogov University "of the Ministry of Health of the Russian

Federation (FGAOU VO RNIMU named after N.I. Pirogov of the Ministry of Health of Russia);

Authors: Krivoy A.A.

Cheranev V.V.

D.O. Korostin

Moscow, 2020

List of used DNA primers 5 '→ 3':

Alu_F

GGTGAAACCCCGTCTCTACTA

Alu_R

GGTTCAAGCGATTCTCCTGCC

RUNX2_F

CGCATTCCTCATCCCAGTATG

RUNX2_R

AAAGGACTTGGTGCAGAGTTCAG

PRKG1_F

CCCACCGCCTTCGACAT

PRKG1_R

CCTGCTTACTGTGGGCTCTTG

SMG1_F

CTCGCTTAACCAGACTCATCTACTGT

SMG1_R

ACTTGGCTCAGCTGTATGAAGGT

PLAU_F

GTGGCCAAAAGACTCTGAGG

PLAU_R

CCTCCACACACGTAGGTGAC

PLAU 3 'UTR_F

CAAATCTCCCTGGTGCTTGT

PLAU 3 'UTR_R

CCTGCCCTACAGCTCTCCTA

PLAU Promoter_F

AGCTGGGCGAGGTAGAGAGT

PLAU Promoter_R

CAGCGTCTGGACTGAGGAAT

LINE1_F

AAAGCCGCTCAACTACATGG

LINE1_R

TGCTTTGAATGCGTCCCAGAG

Adapter_F

TGTGAGCCAAGGAGTTG

Adapter_R

GAACGACATGGCTACGA

<---

Claims (5)

A method for determining the efficiency of enriching an NGS library with sections of exons for sequencing the human exome, including carrying out real-time PCR reactions (qPCR) with human DNA of the same NGS library before and after the procedure for its enrichment, characterized in that when qPCR reactions are performed use primers 5'-GGTGAAACCCCGTCTCTACTA-3 'and 5'-GGTTCAAGCGATTCTCCTGCC-3', complementary to repeating sequences of the human genome, which are not exons, and each qPCR reaction is carried out with at least 50 pg DNA NGS library, determine the efficiency of qPCR reactions and threshold cycles of the fluorescent signal of the NGS library samples before and after the enrichment procedure, after which the efficiency of the NGS library enrichment is calculated by the formula:

where: E - efficiency of NGS-library enrichment in%; E - efficiency of qPCR reaction with a pair of primers for repeating sequences of the human genome; Ct1, Ct2 - values of the threshold cycle of the fluorescent signal of the qPCR reaction for the NGS library sample after enrichment and before enrichment, respectively.

Images