RU2728317C1 - Method for eliminating false-positive results caused by contamination of dna polymerase with foreign dna fragments, with identification of blatem genes - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention relates to molecular biology, microbiology and medicine. Invention includes a set of original oligonucleotide primers for method implementation, as well as an algorithm for selecting primers which are non-specific to the detected DNA fragments and capable of amplifying another fragment of the blaTEM gene in the analysed sample.

EFFECT: invention provides a method for eliminating false-positive results caused by contamination of DNA polymerases when detecting blaTEM genes of resistance to β-lactam antibiotics.

2 cl, 2 dwg, 1 tbl, 1 ex

Description

The technical field to which the invention relates

The invention relates to molecular biology, microbiology and medicine and provides a method for eliminating false positive results caused by contamination of DNA polymerases with foreign DNA, when detecting blaTEM genes responsible for resistance to β-lactam antibiotics.

State of the art

The ubiquity of detection methods based on the technology of amplification of nucleic acids is due to their high sensitivity and high detection rate compared to most traditional methods. The most commonly used method for amplifying specific DNA sequences is polymerase chain reaction (PCR). PCR is widely used in molecular biology, virology, medicine, and microbiology, including for mutation identification, cloning, sequencing, and expression analysis. Laboratory diagnostics of pathogens of infectious diseases is one of the main areas using high-precision methods based on PCR amplification.

Over more than 30 years of using PCR-based methods in scientific research and medical laboratory diagnostics, numerous facts of contamination of PCR reagents, consumables and reagents used for concomitant molecular biological studies of foreign bacterial DNA have been accumulated (Rand K.H. ., Houck H. Taq polymerase contains bacterial DNA of unknown origin Mol Cell Probes. 1990, v. 4 (6), p. 445-50; Carroll NM, Adamson P., Okhravi N. Elimination of bacterial DNA from Taq DNA polymerases by restriction endonuclease digestion. J Clin Microbiol. 1999, v. 37 (10), p. 3402-3404; Corless CE, Guiver M, Borrow R, et al. Contamination and sensitivity issues with a real-time universal 16S rRNA PCR. J Clin Microbiol. 2000, v. 38 (5), pp. 1747-1752; Zhang T., Fang HH Applications of real-time polymerase chain reaction for quantification of microorganisms in environmental samples. Appl Microbiol Biotechnol. 2006, v. 70 (3), pp. 281-289). The Taq DNA polymerase enzyme (one of the key reagents for PCR) is the most vulnerable to contamination with fragments of foreign DNA, the source of which is the plasmid and genomic DNA of bacterial cells, on the basis of which the bioengineered production of this enzyme is carried out (Nogami T., Onto T., Kawaguchi O., et al. Estimation of bacterial contamination in ultrapure water: application of the anti-DNA antibody. Anal Chem. 1998, v. 70 (24), p. 5296-5301; Kulakov LA, McAlister MB, Ogden KL, et al. Analysis of bacteria contaminating ultrapure water in industrial systems. Appl Environ Microbiol. 2002, v. 68 (4), pp. 1548-1555). For selective selection in the production of recombinant DNA polymerase in Escherichia coli cells, vector sequences containing antibiotic resistance genes are most often used (Joseph S., David WR Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 3rd Edition. 2001, ISBN 0879695773) ... Purification from contaminating DNA sequences is a laborious and expensive process, and it is not possible to achieve complete purification in practice. Even the so-called DNA-free commercially available highly purified reagents ("DNA-free" reagents) are accompanied by a documented copy number of contaminating DNA molecules that can be detected by PCR (Humphrey B., McLeod N., Turner C, et al. Removal of Contaminant DNA by Combined UV-EMA Treatment Allows Low Copy Number Detection of Clinically Relevant Bacteria Using Pan-Bacterial Real-Time PCR.PLoS One. 2015, v. 10 (7), p.e0132954).

The presence of DNA polymerase containing fragments of antibiotic resistance genes in a Taq PCR mixture can lead to false positive results, dramatically reducing the specificity of the used detection and diagnostic methods.

The methods known to date to eliminate the consequences of DNA polymerase contamination with fragments of genomic and plasmid foreign bacterial DNA are directed directly at the contaminating DNA with the aim of modifying, cleaving and subsequent elimination from a commercial enzyme solution. These methods are classified into physical, chemical, enzymatic, and various combinations of these methods.

Physical methods are based on the inactivation of contaminated DNA by exposure to UV radiation, gamma radiation treatment, or ultrafiltration. Chemical methods include treatment with chemical reagents that cleave or inactivate contaminating DNA. In enzymatic methods, the digestion of the foreign DNA contained is carried out by enzymes.

The following are the main disadvantages of these methods:

1) Physical method of inactivation based on UV irradiation (Ou CY, Moore JL, Schochetman G. Use of UV irradiation to reduce false positivity in polymerase chain reaction. Biotechniques. 1991, v. 10 (4), p. 442- 446), has the following disadvantages: small depth of effective action in solution, shielding of radiation by various types of laboratory plastic and glass, the need for additional equipment and standardization of its characteristics, loss of activity of protein reagents due to ionization of the storage medium;

2) Physical method of inactivation based on gamma irradiation (Deragon JM, Sinnett D., Mitchell G., et al. Use of gamma irradiation to eliminate DNA contamination for PCR. Nucleic Acids Res. 1990, v. 18 (20) , p. 6149.), has the following disadvantages: high penetrating ability of radiation requires shielding measures to avoid harm to health, the need for additional expensive equipment and standardization of its characteristics, loss of activity of protein reagents due to ionization of the storage medium;

3) Physical method of ultrafiltration (Mohammadi T., Reesink HW, Vandenbroucke-Grauls S.M., Savelkoul R.N. Optimization of real-time PCR assay for rapid and sensitive detection of eubacterial 16S ribosomal DNA in platelet concentrates. J Clin Microbiol . 2003, v. 41 (10), p. 4796-4798) has the following disadvantages: the need for additional equipment, the inevitable loss of the purified enzyme during the concentration;

4) The chemical method based on the treatment with hydroxylamine hydrochloride (Aslanzadeh J. Application of hydroxylamine hydrochloride for post-PCR sterilization. Mol Cell Probes. 1993, v. 7 (2), p. 145-150), has the following disadvantages: the need for deactivation of hydroxylamine, toxicity of the substance, inability to use the treated reagents without deactivation for subsequent PCR;

5) The chemical method based on the treatment with ethidium monoazide (Rueckert A., Morgan HW Removal of contaminating DNA from polymerase chain reaction using ethidium monoazide. J Microbiol Methods. 2007, v. 68 (3), p. 596-600) has the following disadvantages: the need to deactivate ethidium monoazide, toxicity, the impossibility of using treated reagents without deactivation for subsequent PCR;

6) Enzymatic method based on restriction endonuclease digestion (Carroll NM, Adamson P., Okhravi N. Elimination of bacterial DNA from Taq DNA polymerases by restriction endonuclease digestion. J Clin Microbiol. 1999, v. 37 (10), p. 3402 -3404) has the following disadvantages: the need for a sufficient number of restriction sites in the sequence of the contaminating DNA and, as a consequence, the possibility of the formation of detectable products giving false positive results, the need for thermal inactivation, the risk of cleavage of the amplification products with incomplete deactivation of the restriction endonuclease;

7) Enzymatic method based on treatment with DNase I (Rochelle P.A., Weightman AJ, Fry J.C. DNase I treatment of Taq DNA polymerase for complete PCR decontamination. Biotechniques. 1992, v. 13 (4), p. 520) has the following disadvantages: the need for thermal inactivation, the risk of cleavage of the amplification products with incomplete deactivation of DNase I;

8) A combined method based on photosensitization treatment with psoralens and subsequent UV treatment (Jinno Y., Yoshiura K., Niikawa N. Use of psoralen as extinguisher of contaminated DNA in PCR. Nucleic Acids Res. 1990, v. 18 (22) , p. 6739) has the following disadvantages: the need for additional equipment and the standardization of its characteristics, the loss of activity of reagents of protein nature due to ionization of the storage medium.

A common disadvantage of these methods and their possible combinations is direct interference with the PCR reaction mixture, which imposes serious restrictions on the design of the study and on the use of reagents.

One of the available ways to avoid these additional manipulations is the use of ultrapure, commercially available reagents free of foreign DNA, however, this leads to a significant increase in costs, which is unacceptable for performing routine laboratory diagnostic procedures.

The method according to the present invention is aimed at preventing or completely avoiding the amplification of contaminating DNA without any pretreatment of the enzyme preparation. The use of this method does not directly or indirectly affect the efficiency of the PCR, and also does not require additional equipment, specific means and protection measures, in addition to the typical equipment and reagents used when setting up PCR, and can be used both in scientific research and in laboratory diagnostics are generally available, standard DNA polymerases that have not undergone an expensive and time-consuming purification procedure.

Disclosure of the essence of the invention

The invention proposes a method for detecting foreign contaminating DNA in commercial DNA polymerases in order to eliminate false positive results when carrying out PCR using a set of oligonucleotide primers, with the sequences shown by SEQ ID NO 1-4 and subsequent interpretation of the contamination pattern of the investigated aliquot of DNA polymerase. The proposed method compares favorably with the methods known from the prior art by the ability to use in the course of scientific research and laboratory diagnostics generally available DNA polymerases that have not undergone an expensive and laborious purification procedure, does not directly or indirectly affect the efficiency of PCR, does not require expensive additional equipment, except basic, required for PCR, and does not require highly qualified personnel. The data obtained using the method can be used both when choosing reagents for PCR, in particular, DNA polymerase when planning a study or laboratory diagnostics regarding resistance genes of the blaTEM family, and for determining a target within the blaTEM gene that is not contained in a contaminating foreign DNA polymerase. The genes of the blaTEM family are among the most common resistance genes, the products of which break down broad spectrum beta-lactam antibiotics. Their timely identification is required for the rational choice of antibacterial drugs.

The method is based on carrying out a polymerase chain reaction with a set of specific oligonucleotide primers, followed by separation of the reaction products by electrophoresis in agarose gel, analysis of the electrophoretic pattern of product separation and interpretation of the results.

Interpretation of the results includes the unambiguous identification of contaminating fragments of the blaTEM gene, and, as a consequence, allows the selection of a pair of primers that are nonspecific for the detected fragments of contaminating DNA, but capable of amplifying another fragment of the blaTEM gene in the studied sample to eliminate false positive results.

The present invention also provides an original set of specific primers for performing the identification of regions of the blaTEM family of resistance genes. The primers included in the kit have original oligonucleotide sequences and allow specific identification of regions of the blaTEM family of resistance genes.

Elimination of false positive results of contamination is based on the analysis of electrophoretic separation of amplification products of the blaTEM gene fragment with an original set of specific primers, followed by interpretation of the contamination pattern of a specific sample of the used DNA polymerase.

The invention will now be described in detail with reference to figures and examples, which are given solely for the purpose of illustrating and explaining the essence of the claimed invention, but which are not intended to limit the scope of the claims.

Summary of tables and shapes

Table 1. List of oligonucleotide primers used in the method for eliminating false positive results caused by contamination of DNA polymerases during the detection of blaTEM genes for resistance to β-lactam antibiotics. FIG. 1. presents a picture of the electrophoretic separation of PCR products obtained by amplification of contaminating DNA contained in polymerase samples: Polymerase No. 1, Polymerase No. 2 and Polymerase No. 3, with the corresponding original oligonucleotide primers SEQ ID N11-4. FIG. 2. presents a picture of the electrophoretic separation of PCR products obtained by amplification of a reference sample of bacterial DNA containing the blaTEM-1 gene using the corresponding original nucleotide primers SEQ ID NO 1-4.

Implementation of the invention

The aim of the present invention is to provide a method for preventing false positive results caused by contamination of DNA polymerases with foreign bacterial DNA during the detection of blaTEM genes for resistance to β-lactam antibiotics.

The claimed method proposes the use of a polymerase chain reaction for preliminary amplification of the sequences of fragments of blaTEM-genes of resistance to β-lactam antibiotics, potentially present in an aliquot of DNA polymerases, followed by interpretation of the electrophoretic pattern of separation of amplification products. The claimed method involves the use of an original set of specific oligonucleotide primers (Table 1), but is not limited to them. In the claimed method, primers of a different nucleotide sequence of complementary regions of genes of the blaTEM family can also be used, the number of primer pairs used in the method also does not limit the scope of claims.

An aliquot of the tested DNA polymerase is used as a sample. The method does not require additional procedures for processing the test sample and changing its amount per unit volume of the PCR reaction mixture.

The selection of oligonucleotide primers is performed based on the systematization of sequences encoding genes of the blaTEM family. Systematization is carried out on the basis of analysis of literature sources and gene sequences in databases (GenBank). Further, multiple alignment of the target gene sequences is carried out. A consensus sequence is assigned to each alignment. Sequence alignment is carried out using specialized software, for example, BioEdit Sequence Alignment Editor (version 7.1.9) using the ClustalW algorithm, the consensus sequence was assigned with a threshold frequency)) equal to 100%. Further, using the appropriate software, for example, Oligo v. 6.3 (Molecular Biology Insights Inc., USA) or Fast PCR (http://www.biocenter.helsinki.fi/bi/ Programs / fastpcr.htm), the primer annealing temperature is calculated. When selecting primers, they are guided by generally known techniques, for example, avoiding the selection of sequences capable of forming secondary structures of the hairpin type with high melting temperatures. The specificity of the selected primers is checked by searching the databases of nucleotide sequences (GenBank, Silva) using software that supports the BLAST algorithm (for example, www.ncbi.nlm.nih.gov/5Zv4ST).

Amplification products obtained by polymerase chain reaction using this primer set are separated by electrophoresis in agarose gel. Next, the analysis of the obtained images of electrophoregrams is carried out. By the presence and location of specific bands for amplification products, the electrophoretogram is interpreted and an unambiguous conclusion is made about the presence in the analyzed DNA polymerase sample of certain foreign fragments of blaTEM genes that contaminate the enzyme.

Based on the unambiguous identification of the contaminating fragments of the blaTEM gene present as foreign DNA in the polymerase, a target within the blaTEM gene, which is absent in the enzyme sample, is selected for subsequent analysis of samples by PCR. Accordingly, a pair of primers is also selected that is nonspecific to the detected contaminating DNA fragment, but is capable of amplifying a different fragment of the blaTEM gene in the sample under study.

Hereinafter the invention will be illustrated by examples, which are intended to provide a better understanding of the essence of the claimed invention, but should not be construed as limiting the invention.

Example 1. Conducting a polymerase chain reaction to study the contamination of DNA polymerases with fragments of blaTEM genes.

Primers for the polymerase chain reaction were synthesized on an automatic 394 DNA / RNA synthesizer (Applied Biosystems, USA). A list of primers is shown in Table 1.

The composition of the reaction mixture for PCR included the following reagents:

- reaction buffer recommended by the manufacturer of DNA polymerases;

- a mixture of deoxynucleoside triphosphates: dATP, dGTP, dCTP and dUTP, 250 μM each (Sileks, Russia);

- a mixture of forward and reverse primers at a concentration of 5 pM each;

- deionized water to a final volume of 25 μl.

As a positive control for amplification, 1 μl of a bacterial DNA solution containing the blaTEM-1 gene was used.

In 24.5 μl of the corresponding PCR mixture, 2.5 units of a sample of the tested DNA polymerases were added - Polymerase No. 1 (HotStarTaa Plus DNA Polymerase, Qiagen, Chatsworth, CA, USA), Polymerase No. 2 (HS Taq DNA polymerase, Evrogen, Moscow, Russia), and Polymerase No. 3 (Taq DNA polymerase, Fermentas, Vilnius, Lithuania).

Amplification was carried out on a C1000 Touch Thermal Cycler thermal cycler (Biorad, Hercules, CA, USA) with the following regime: 95 ° C - 30 s, 55 ° C - 30 s, 72 ° C - 30 s; 45 cycles (in the first cycle, the denaturation time was increased to 5 min, in the last - the completion time to 5 min).

10 μl of the reaction mixture obtained after the PCR was used for electrophoretic separation.

Example 2. Conducting electrophoretic separation of amplification products of contaminating fragments of genes of the blaTEM family in an agarose gel.

1) 1 × TAE buffer was prepared by fifty-fold dilution of 50 × TAE buffer (2 M Tris, 1 M acetic acid, 50 mM EDTA, pH 8.4) in a volume sufficient to fill the electrophoresis chamber and prepare a gel (1000 ml);

2) agarose was added to 1 × TAE buffer in the amount necessary to obtain a 2% solution, and heated in a microwave oven until the agarose was completely melted;

3) cooled the mixture to 50 ° C;

4) ethidium bromide was added to the agarose solution to a final concentration of 0.5 μg / ml and gently mixed;

5) the resulting solution was poured into a gel cuvette and evenly distributed throughout the cuvette volume;

6) a comb was inserted into the cuvette in a vertical position so that its teeth did not reach the bottom of about 1.5 mm;

7) left the cuvette with the agarose gel for 30 min at room temperature to solidify the gel. Next, the comb was carefully removed and the cuvette with the gel was placed in an electrophoresis chamber containing the required amount of 1 × TAE buffer.

8) 10 μl of samples obtained in Example 1 were mixed with 3 μl of loading buffer (10 mM Tris-HCl, pH 7.8, 40% glycerol, 40 mM EDTA, 0.01% bromophenol blue, 0.01% xylene cyanol) and carefully put into the wells of the gel;

9) electrophoresis was carried out at a gradient of 1.5 V per 1 cm of gel for 30 min;

10), the gel was removed from the electrophoresis chamber and viewed in UV light on a transilluminator. The results were documented by photographing the gel and saving the resulting images.

Example 3. Interpretation of the results of electrophoretic separation of amplification products of contaminating fragments of blaTEM genes.

The images obtained in clause 10 of Example 2 were interpreted as follows. As a result of PCR, amplification of four types of products of different lengths is possible using the appropriate primers:

- a product with a length of 830 bp - fragment A obtained using primers SEQ ID NO 1 and SEQ ID NO 4

- a product with a length of 517 bp - fragment B obtained using primers SEQ ID NO 1 and SEQ ID NO 3

- a product with a length of 290 bp - fragment B obtained using primers SEQ ID NO 2 and SEQ ID NO 3

- a product with a length of 603 bp - fragment D obtained using primers SEQ ID NO 2 and SEQ ID NO 4

By the presence of an optical density band corresponding to a product with a length of 830 bp. in the lane on an agarase gel, it was concluded that Fragment "A" was present in the sample under study. By the presence of an optical density band corresponding to a product with a length of 517 bp. in the lane on an agarase gel, it was concluded that Fragment B was present in the sample under study. The presence of an optical density band corresponding to the product with a length of 290 bp in the lane on the agarase gel, it was concluded that the Fragment "B" was present in the sample under study. By the presence of an optical density band corresponding to a product with a length of 603 bp. in the lane on an agarose gel, it was concluded that the Fragment "G" was present in the sample under study. The absence of an optical density band indicated that the sample under study did not carry the corresponding contaminating fragment. An aliquot of each DNA polymerase was tested in 5 replicates, relative to each potential contamination fragment.

FIG. 1. shows an image of the most typical picture of the electrophoretic separation of PCR products in agarose gel when analyzing DNA polymerase samples (Polymerase No. 1, Polymerase No. 2 and Polymerase No. 3) using the corresponding primer pairs. Each number corresponds to the following track:

1) DNA length marker 100 bp;

2) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 4 in the analysis of the sample Polymerase No. 1 is absent. The absence of an optical density band indicates the absence of the contaminating Fragment "A" in the sample Polymerase No. 1;

3) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 3 when analyzing the sample Polymerase No. 1. The presence of an optical density band indicates the presence of a contaminating Fragment "B" in the sample Polymerase No. 1;

4) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 3 when analyzing the sample Polymerase No. 1. The presence of an optical density band indicates the presence of a contaminating Fragment "B" in the sample Polymerase No. 1;

5) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 4 when analyzing the sample Polymerase No. 1. The presence of an optical density band indicates the presence of the contaminating Fragment "D" in the sample Polymerase No. 1;

6) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 4 when analyzing the sample Polymerase No. 2 is absent. The absence of an optical density band indicates the absence of the contaminating Fragment "A" in the Polymerase # 2 sample;

7) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 3 when analyzing the sample Polymerase No. 2. The presence of an optical density band indicates the presence of the contaminating Fragment "B" in the sample Polymerase No. 2;

8) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 3 when analyzing the sample Polymerase No. 2. The presence of an optical density band indicates the presence of the contaminating Fragment "B" in the sample Polymerase No. 2;

9) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 4 when analyzing the sample Polymerase No. 2. The presence of an optical density band indicates the presence of a contaminating Fragment "D" in the sample Polymerase No. 2;

10) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 4 when analyzing the sample Polymerase No. 3 is absent. The absence of an optical density band indicates the absence of the contaminating Fragment "A" in the Polymerase No. 3 sample;

11) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 3 in the analysis of the sample Polymerase No. 3 is absent. The absence of an optical density band indicates the absence of the contaminating Fragment "B" in the sample Polymerase No. 3;

12) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 3 in the analysis of the sample Polymerase No. 3 is absent. The absence of an optical density band indicates the absence of the contaminating Fragment "B" in the sample Polymerase No. 3;

13) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 4 in the analysis of the sample Polymerase No. 3 is absent. The absence of an optical density band indicates the absence of the contaminating Fragment "D" in the sample Polymerase No. 3;

14) DNA length marker 100 bp.

FIG. 2. shows an image of the most typical picture of electrophoretic separation of PCR products in agarose gel when analyzing samples of reference bacterial DNA carrying the blaTEM-1 gene using DNA polymerases (Polymerase No. 1, Polymerase No. 2 and Polymerase No. 3) and the corresponding primers. Each track has the following number:

1) DNA length marker 100 bp;

2) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 4 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 1;

3) the product of amplification from primers SEQ ID NO 1 and SEQ ID NO 3 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 1;

4) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 3 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 1;

5) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 4 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 1;

6) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 4 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 2;

7) the product of amplification from primers SEQ ID NO 1 and SEQ ID NO 3 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 2;

8) the product of amplification from primers SEQ ID NO 2 and SEQ ID NO 3 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 2;

9) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 4 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase # 2;

10) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 4 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 3;

11) the product of amplification from the primers SEQ ID NO 1 and SEQ ID NO 3 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 3;

12) the product of amplification from primers SEQ ID NO 2 and SEQ ID NO 3 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase No. 3;

13) the product of amplification from the primers SEQ ID NO 2 and SEQ ID NO 4 when analyzing a DNA sample containing blaTEM-1 using polymerase Polymerase # 3;

14) DNA length marker 100 bp.

Example 4. Elimination of false positive results arising from the use of DNA polymerases contaminated with fragments of genes of the blaTEM family.

The analysis of polymerase samples (Polymerase No. 1, Polymerase No. 2 and Polymerase No. 3) revealed the following features:

1) fragment "A" was not found in polymerases: Polymerase No. 1, Polymerase No. 2 and Polymerase No. 3;

2) fragment "B" was found in polymerases: Polymerase No. 1 and Polymerase No. 2;

3) the "B" fragment was found in polymerases: Polymerase No. 1 and Polymerase No. 2;

4) the "D" fragment was found in polymerases: Polymerase No. 1 and Polymerase No. 2;

5) no fragments A, B, C, D were found in polymerase Polymerase No. 3. Based on features 1-5, the following conclusions can be drawn:

1) Polymerase No. 3 can be used without restrictions for research and laboratory diagnosis of the presence of blaTEM genes using electrophoretic separation in agarose gel as a method for interpreting the results;

2) Polymerases Polymerase No. 1 and Polymerase No. 2 have limitations for research and laboratory diagnosis of the presence of blaTEM genes using electrophoretic separation in agarose gel, as a method for interpreting the results;

3) When using polymerases Polymerase No. 1 and Polymerase No. 2 for research and laboratory diagnostics of the presence of blaTEM genes using electrophoretic separation in agarose gel as a method for interpreting the results, it is necessary to select the target and the amplified product so that contaminating sequences are not amplified during PCR and did not lead to false positive results;

4) When using polymerases Polymerase No. 1 and Polymerase No. 2 for research and laboratory diagnosis of the presence of blaTEM genes using electrophoretic separation in agarose gel as a method for interpreting the results, it was shown that the amplification product from the primers SEQ ID NO 1 and SEQ ID NO 4 is most suitable for detecting blaTEM genes and does not give false positive results when analyzing the presence of blaTEM genes.

Method for eliminating false positive results caused by contamination of DNA polymerases with fragments of foreign DNA during identification of blaTEM genes.

Method for eliminating false positive results caused by contamination of DNA polymerases with fragments of foreign DNA during gene identification bla TEM

Table 1.

SEQ ID NO Nucleotide sequence 5 '-> 3' 1 CCTTATTCCCTTTTTTGCGGCATT 2 GGCAAGAGCAACTCGGTC 3 AATGCTTAATCAGTGAGGCACC 4 AGGCATCGTGGTGTCAC

Claims (10)

1. A method for eliminating false positive results caused by contamination of DNA polymerases with foreign DNA during the detection of blaTEM genes responsible for resistance to β-lactam antibiotics, including: 1.1. amplification of several contaminating fragments of genes of the blaTEM family by carrying out a polymerase chain reaction with an original set of specific oligonucleotide primers; 1.2. separation of reaction products by electrophoresis in agarose gel; 1.3. analysis of the electrophoretic picture of the separation of amplification products; 1.4. interpretation of the analysis results, including the unambiguous identification of contaminating fragments of the blaTEM gene, according to the results of which, to eliminate false positive results, a pair of primers is selected that is nonspecific for the detected contaminating DNA fragment, but is capable of amplifying another fragment of the blaTEM gene in the sample under study. 2. A set of specific oligonucleotide primers for implementing the method for eliminating false positive results caused by contamination of DNA polymerases during the detection of blaTEM genes for resistance to β-lactam antibiotics, represented by the sequences SEQ ID NO 1-4, including: 2.1. one pair of specific oligonucleotide primers for amplification of a contaminating 830 bp blaTEM family gene fragment represented by SEQ ID NO 1 and SEQ ID NO 4; 2.2. one pair of specific oligonucleotide primers for amplification of a contaminating fragment of genes of the blaTEM family of 517 bp, represented by SEQ ID NO 1 and SEQ ID NO 3; 2.3. one pair of specific oligonucleotide primers for amplification of a contaminating fragment of genes of the blaTEM family of 290 bp, represented by SEQ ID NO 2 and SEQ ID NO 3; 2.4. one pair of specific oligonucleotide primers for amplification of a contaminating 603 bp blaTEM family gene fragment represented by SEQ ID NO 2 and SEQ ID NO 4.

Images