RU2728228C1 - Murine hybridoma ykl-40, clone 2g8 c10 - producer of monoclonal antibody possessing specificity to cytoplasmic antigens ykl-39, ykl-40 and si-clp of human - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: disclosed is murine hybridoma YKL-40, clone 2G8 C10, collection number of GKPM-Obolensk H-90. Hybridoma is a producer of a monoclonal antibody specific for cytoplasmic human proteins YKL-39, YKL-40 and SI-CLP. Hybridoma-produced antibodies can potentially be used for diagnosing glioblastoma.

EFFECT: invention enables to obtain antibodies specifically detecting YKL-39, YKL-40 and SI-CLP by immunoassay, immunocytochemistry, immunohistochemistry, immunoblotting and immunofluorescence.

1 cl, 1 tbl, 3 ex, 5 dwg

Description

The invention relates to biotechnology, biology and medicine and is intended to detect human cytoplasmic proteins YKL-39 (CHI3L2), YKL-40 (CHI3L1) and SI-CLP (CHID1) in the blood plasma of cancer patients by ELISA, in neoplastic cells and glioblastoma cell lines and other tissues by immunocytochemical, immunohistochemical and immunofluorescence methods, as well as by the method of immunoblotting for research and clinical laboratory purposes.

Today, antibodies are one of the main tools for studying fundamental issues of oncology, widely used in the diagnosis and therapy of various types of this pathology.

One of the main problems of modern oncology is the early and non-invasive diagnosis of the disease, which allows for a reliable diagnosis and immediate treatment. To solve this problem, many studies in recent years have been devoted to the search for new molecular markers of the disease that freely circulate in the bloodstream. Proteins, nucleic acids, vesicles secreted by tumor cells, and tumor cells themselves can be used as such markers. Basically, such diagnostics is carried out by the method of enzyme immunoassay and allows detecting diseases at an early stage.

Chitinase-like proteins in mammals are proteins formed in the area of inflammation and tumor growth. Recently, individual members of the family have been studied as potential biomarkers of various human diseases, including solid tumors (gliomas, prostate and ovarian cancers). To date, there is no clinically relevant and available method for determining the concentrations of these biomarkers in the circulating blood.

Chitinase-like proteins are expressed by various types of cells in both normal and pathological conditions (Schmidt et al., 2006; Biggar et al., 2008; Roslind et al., 2008; Iwamoto et al., 2011; Xiao et al., 2014) ... For example, YKL-40 is expressed by a variety of cells, including macrophages, neutrophils, epithelial and synovial cells, as well as cancer cells of various origins. YKL-40 can be secreted into the extracellular space or directly into the bloodstream, making it a potential marker for many pathologies. It has been shown that this protein increases the ability of tumor cells to proliferate and invade in a model of glioblastomas and colorectal cancer (Ku, BM, Lee, YK, Ryu, J., Jeong, JY, Choi, J., Eun, KM, Shin, HY, Kim, DG, Hwang, EM, Yoo, JC, Park, JY, Roh, GS, Kim, HJ, Cho, GJ, Choi, WS, Paek, SH and Kang, SS (2011). CHI3L1 (YKL-40) is expressed in human gliomas and regulates the invasion, growth and survival of glioma cells. Int J Cancer 128, 1316-1326; Kawada, M., Seno, H., Kanda, K., Nakanishi, Y., Akitake, R., Komekado, H., Kawada, K., Sakai, Y., Mizoguchi, E. and Chiba, T. (2012). Chitinase 3-like 1 promotes macrophage recruitment and angiogenesis in colorectal cancer. Oncogene 31, 3111-3123). YKL-39 is a secretory protein of chondrocytes belonging to the glycosyl hydrolase family 18. Its highest expression is observed in chondrocytes, synoviocytes, lungs and heart, and macrophages. Today it can be considered a marker of osteoarthritis in synovial fluid and serum (Hu, B., Trinh, K., Figueira, WF and Price, PA (1996). Isolation and sequence of a novel human chondrocyte protein related to mammalian members of the chitinase protein family J Biol Chem 271, 19415-19420; Steck, E., Breit, S., Breusch, SJ, Axt, M. and Richter, W. (2002). Enhanced expression of the human chitinase 3-like 2 gene (YKL-39) but not chitinase 3-like 1 gene (YKL-40) in osteoarthritic cartilage Biochem Biophys Res Commun 299, 109-115; Knorr, T., Obermayr, F., Bartnik, E., Zien , A. and Aigner, T. (2003). YKL-39 (chitinase 3-like protein 2), but not YKL-40 (chitinase 3-like protein 1), is up regulated in osteoarthritic chondrocytes. Ann Rheum Dis 62. 995-998). It is not found in the spleen, pancreas, and liver. YKL-39 can also be expressed in the developing brain and placenta. Also, increased expression of the YKL-39 gene has been shown in patients with Alzheimer's disease and in glioblomas (Colton, CA, Mott, RT, Sharpe, H., Xu, Q., Van Nostrand, WE and Vitek, MP (2006). Expression profiles for macrophage alternative activation genes in AD and in mouse models of AD. J Neuroinflammation 3, 27). What functional role this protein can play in glioblastomas is not known at the moment, however, it is assumed that it may be responsible for the proliferative ability of cells and remodeling of the extracellular matrix (Miyatake, K., Tsuji, K., Yamaga, M., Yamada, J. , Matsukura, Y., Abula, K., Sekiya, I. and Muneta, T. (2013). Human YKL39 (chitinase 3-like protein 2), an osteoarthritis-associated gene, enhances proliferation and type II collagen expression in ATDC5 cells Biochem Biophys Res Commun 431, 52-57) Due to the secretion of this protein, hopes are pinned on it as a potential marker of glioblastomas. A similar picture is observed for the SI-CLP protein. SI-CLP is expressed in most normal cells and is secreted. There are data indicating its expression in some types of tumors (in particular, in glioblastomas), which in the future, with a more detailed study, will make it possible to use a change in the amount of this protein in the blood as a marker. There are publications showing that the introduction of chitinase-like proteins into a panel of markers of various tests leads to an increase in both the sensitivity and specificity of the tests. This characteristic of chitinase-like proteins significantly expands their field of application.

For the detection of YKL-39, YKL-40 and SI-CLP proteins in humans, there are currently several commercial polyclonal and monoclonal antibodies available. Known mouse and rabbit hybridomas producing monoclonal antibodies to human cytoplasmic antigens YKL-39, YKL-40, and SI-CLP were obtained by immunizing animals with both full-length recombinant human YKL-39, YKL-40, and SI-CLP proteins, and various recombinant and synthetic polypeptide regions of these human proteins. The disadvantages of the described clones include the high cost of monoclonal antibodies produced by these hybridomas due to their foreign origin, as well as the lack of data for some of them on testing in immunohistochemistry reactions, immunofluorescence used in daily clinical diagnostic practice, as well as immunoblotting. Also, antibodies that specifically recognize one separate antigen are most often presented on the market.

The objective of the invention is to expand the range of monoclonal antibodies and obtain antibodies with specificity simultaneously to human proteins YKL-39, YKL-40 and SI-CLP, used for immunodiagnostics and prognostic assessment of the course of tumor diseases in humans.

The task is solved due to the mouse hybridoma YKL-40, clone 2G8 C10 - the producer of monoclonal antibodies that detect YKL-39, YKL-40 and SI-CLP by enzyme immunoassay, immunocytochemistry, immunohistochemistry, immunofluorescence and immunoblotting / Balb line of mice obtained by immunization with a recombinant full-length protein, and fusion of sensitized splenocytes from immunized mice with sp2 / 0 mouse myeloma cells using polyethylene glycol with a molecular weight of 1500.

The monoclonal antibodies produced by the hybridoma 2G8 C10 to human YKL-39, YKL-40 and SI-CLP proteins have a selective ability to bind human YKL-39, YKL-40 and SI-CLP proteins in an enzyme-linked immunosorbent assay (Table 1), on immunoblots (Fig. . 5), at the cellular (Fig. 1, Fig. 4) and tissue levels (on paraffin sections) (Fig. 2, Fig. 3), and expand the existing available range of monoclonal antibodies to proteins YKL-39, YKL-40 and SI-CLP. It should also be noted that each newly obtained hybridoma is unique. Monoclonal antibodies produced by different hybridomas differ in their primary structure, specificity for various antigenic determinants, affinity, and other properties. Therefore, obtaining as many monoclonal antibodies as possible to human YKL-39, YKL-40 and SI-CLP proteins is important from a scientific and practical point of view.

The technical result of the invention is to obtain a line of mouse hybridomas 2G8 C10 producing monoclonal antibodies to human cytoplasmic antigens YKL-39, YKL-40 and SI-CLP, available for domestic clinical diagnostic laboratories, suitable for enzyme immunoassay, immunocytochemistry, immunohistochemistry and immunoblotting , and allowing to be used for the diagnosis of glioblastomas.

Mouse hybridoma YKL-40, clone 2G8 C10 was prepared as follows:

To obtain a bacterial strain expressing the recombinant YKL-40 protein, its coding sequence was cloned into the pET45b (+) vector. The human YKL-40 gene (the nucleotide sequence of the human YKL-40 cDNA is available in the GeneBank database at http://www.ncbi.nlm.nih.gov/genbank/ with serial number NM_001276.2) is amplified on a cDNA template obtained from mRNA of LN229 cells using gene-specific primers (YKL-40 F3005 Xho ACTTCTCGAGACCATGGGTGTGAAGGCG, YKL-40 R3005 Hind TAGAAAGCTTCGTTGCAGCGAGTGC, inserted XhoI / HindIII restriction endonuclease sites). The amplified DNA fragments were purified and cloned into the pET45b (+) vector at the sites created by restriction endonucleases. As a result, a plasmid carrying the human YKL-40 protein gene was obtained. The plasmid was tested for the presence of nucleotide substitutions by automatic DNA sequencing. Competent cells of E. coli strain BL21 DE3 were chemically transformed with the obtained plasmid pET45b (+) - YKL-40, plated on LB agar plates containing 100 μg / ml ampicillin, and incubated at 37 ° C for 16 h. ml of LB medium was transferred to a single colony and grown at 37 ° С for 16 h with constant stirring. Further, from an overnight culture, the expression of proteins in bacteria E. coli BL21 DE3 was stimulated with IPTG at a final concentration of 1 mM for 4-5 hours at 37 ° C. After the stimulation time had elapsed, the bacterial cells were lysed, sonified by ultrasound and subjected to a purification procedure.

In the first step, inclusion bodies were extracted with 5M urea in PBST for 1 hour at room temperature. At the same time, the target proteins did not dissolve, however, many impurities were separated and a significant decrease in the mass of the inclusion body sediment was observed.

объема лизирующего буфера с последующем центрифугированием и объединением супернатантов. Рефолдинг белков проводили путем перевода гельфильтрацией на колонке Сефадекса G-25 в буфер следующего состава с последующей инкубацией в течение 12-36 часов при 4°С: (NaCL - 0.5 М, Мочевина 4 (1) М*, Аргинин - 0.5 (0.05) М*, ЭДТА - 1 мМ, Цистеамин - 10 мМ, Имидазол - 2 мМ, PBST - до 50 мл. * - начальные значения (в скобках) по результатам эксперимента были корректированы в сторону увеличения)). Дальнейшую очистку белков производили метал-хелатной хроматографией (IMAC) на колонке IMAC Sepharose 6 Fast Flow (GEHealthCare, 17-0921-08). Для этого белки переводили гельфильтрацией на колонке Сефадекса G-25 в IMAC-буфер следующего состава: (NaCL - 0.5 М, Мочевина - 1М, Имидазол - 5 мМ, Аргинин - 50 мМ, PBST - до 50 мл). Белок наносили на колонку IMAC Sepharose 6 Fast Flow, уравновешенную буфером, приведенного выше состава. Колонку промывали ступенчатым градиентом концентрации имидазола. Было установлено, что до концентрации имидазола 20 мМ видимой элюции целевого белка не происходит. Эффективная элюция белка YKL-40 с минимальными примесями происходит при 75 мМ имидазола. Полученный в результате процедуры очистки белок YKL-40 был использован в качестве антигена для дальнейшей иммунизации мышей.At the second stage, a buffer of the following composition was used for lysis of inclusion bodies: (Arginine - 0.5 M, Urea - 6 M, Tris - 20 mM, pH 10.0, Dithiothreitol - 50 mM, EDTA - 5 mM, Glycine 10 mM). Lysis was carried out for 12 hours at + 4 ° C. The solution was centrifuged at 10,000 rpm for 5 minutes at + 4 ° C. If a precipitate remained, it was re-extracted

the volume of lysis buffer, followed by centrifugation and pooling of supernatants. Protein refolding was carried out by transferring by gel filtration on a Sephadex G-25 column into a buffer of the following composition, followed by incubation for 12-36 hours at 4 ° C: (NaCL - 0.5 M, Urea 4 (1) M *, Arginine - 0.5 (0.05) M *, EDTA - 1 mM, Cysteamine - 10 mM, Imidazole - 2 mM, PBST - up to 50 ml. * - initial values (in parentheses) were adjusted upward according to the results of the experiment)). Further purification of proteins was performed by metal chelate chromatography (IMAC) on an IMAC Sepharose 6 Fast Flow column (GEHealthCare, 17-0921-08). For this, proteins were transferred by gel filtration on a Sephadex G-25 column into an IMAC buffer of the following composition: (NaCL - 0.5 M, Urea - 1 M, Imidazole - 5 mM, Arginine - 50 mM, PBST - up to 50 ml). The protein was applied to an IMAC Sepharose 6 Fast Flow column equilibrated with the above buffer composition. The column was washed with a stepwise gradient of imidazole concentration. It was found that up to an imidazole concentration of 20 mM, no visible elution of the target protein occurs. Effective elution of YKL-40 protein with minimal impurities occurs at 75 mM imidazole. The YKL-40 protein obtained as a result of the purification procedure was used as an antigen for further immunization of mice.

Primary immunization was performed in Balb / c mice (females, 18 g) by injecting about 30 μg of antigen (recombinant YKL-40 protein) with complete Freund's adjuvant (1: 1) into the paws and withers. Antigen boosting with incomplete Freund's adjuvant was performed two weeks after primary immunization. Hybridization (fusion) of mouse splenocytes with the Sp 2/0 cell line was done 3 days (on the 4th day) after boosting with PEG 1500. HAT was added to the hybridoma planting medium (RPMI-1640 with 15% FetalClone I) according to with the manufacturer's recommendations. The resulting hybridomas were plated onto three 96-well plates, 150 μl of suspension per well and left for 10 days, after which they were tested by ELISA. As a result of testing, 21 clones were selected that bind well to the antigen. The first cloning was carried out for all clones. According to the ELISA results, 3 subclones for 21 clones were deposited for interaction with full-length recombinant YKL-40, and then strong subclones were selected. As a result, 20 clones were selected and frozen. As additional ELISA tests, there were tests for interaction with non-conserved sequences (NCR) YKL-39, YKL-40, SI-CLP, with N and C-terminal parts of YKL-39, with full-length YKL-40, peptide 2 YKL-39 (226-241), peptide 4 SI-CLP (259-276). Based on the results of ELISA tests showing the interaction of antibodies with other antigens, 4 final clones were selected for the production of antibodies and freezing: 3A12H12, 2G8C10, 1B1A12, 1H7C1 (Table 1).

Then the antibodies selected by ELISA were tested by the method of immunocytochemistry and immunofluorescence. Antibodies of all 4 clones were tested on LN229 cells. Only one antibody showed clear binding to YKL-39 antigens in cells in the form of granules in the cytoplasm - clone 2G8 C10 (Fig. 1, 3, 4).

Antibodies to the YKL-40 protein, clone 2G8 C10, were tested by immunohistochemistry on sections of normal kidney (Fig. 2). There was a clear cytoplasmic coloration of the renal tubule cells.

Additionally, immunoblotting was performed (Fig. 4) to test antibodies on total lysates of the glioblastoma cell line LN229 and bacterial inclusion bodies containing the recombinant proteins YKL-39, YKL-40 and SI-CLP and it was shown that antibodies to YKL-40, clone 2G8 C10 proteins bind YKL-39, YKL-40 and SI-CLP.

Thus, the antibodies produced by the YKL-39 hybridoma, clone 2G8 C10, were tested by enzyme immunoassay, immunocytochemistry, indirect immunofluorescence, immunohistochemistry, and immunoblotting. Antibodies bind to full-length proteins YKL-39, YKL-40 and SI-CLP, with non-conserved sequences YKL-39, YKL-40 and SI-CLP, with N-terminal and C-terminal sequences of YKL-39, specifically work in immunocytochemistry and immunohistochemistry on LN229 cells, immunohistochemistry on kidney tissues, and immunoblotting on total LN229 lysates and corresponding recombinant proteins.

Mouse hybridoma YKL-40, clone 2G8 C10 was accepted for deposition in the form of "National Patent Deposition" on September 13, 2019 by the State Collection of Pathogenic Microorganisms and Cell Cultures "GKPM-Obolensk" with collection number H-90.

Mouse hybridoma YKL-40, clone 2G8 C10 - the producer of the monoclonal antibody YKL-40 - has the following characteristics:

Morphological features: The culture looks like a suspension, where the cells are collected in conglomerates and weakly attached to the substrate.

Conditions for routine cultivation of hybridoma cells YKL-40, clone 2G8 C10: Culture medium - RPMI-1640 (HyClone, USA), 7.5% fetal calf serum FetalClone 1 (HyClone, USA), 4 mM L-glutamine , 100 μg / ml gentamicin. Cultivation conditions: 37 ° C, absolute humidity and 5% CO ₂ in the atmosphere. Passing frequency - every 3-4 days, sieving ratio 1: 5-1: 10.

Method for cryopreservation of YKL-40 hybridoma cells, clone 2G8 C10. 7-10% DMSO (PanEco, Russia) is added to a cell suspension in a conditioned medium. Cryotubes with cell suspension are mixed and placed in a refrigerator at -80 ° C for a day, then transferred to liquid nitrogen for long-term storage. Cell viability after thawing is 80%. After thawing, the cells are cultured at a density of 0.2-0.3⋅10 ⁶ cells / ml.

Bacteria, fungi, yeast and mycoplasma were not found in the culture.

Isotype of monoclonal antibody YKL-40, clone 2G8 C10: monoclonal antibody secreted by hybridoma 2G8 C10 belongs to immunoglobulins of the IgG2b class.

Specificity of YKL-40 monoclonal antibody, clone 2G8 C10. Monoclonal antibody detects proteins YKL-39, YKL-40 and SI-CLP in human kidney tissues (Fig. 2), in a number of cell lines of different tissue origin, for example, in the line LN229 (glioblastoma) (Fig. 1, 3, 4) ... Antibody 2G8 C10 also recognizes native proteins YKL-39, YKL-40 and SI-CLP in total cell lysates of the glioblastoma cell line LN229 and recombinant YKL-39, YKL-40 and SI-CLP on immunoblots (Fig. 5).

Optimal dilutions of YKL-40 antibodies, clone 2G8 C10, determined in the supernatant by immunohistochemistry - 1: 1, by indirect immunofluorescence - 1: 2, by immunoblots - 1: 2.

The monoclonal antibody produced by the hybridoma 2G8 C10 is recommended for the specific detection of YKL-39, YKL-40 and SI-CLP antigens in blood and other fluids by enzyme immunoassay, in tissues containing this antigen by immunohistochemistry, as well as in the cytoplasm of neoplastic cells of human glioblastoma by methods immunocytochemistry, immunofluorescence, immunoblotting.

The invention is illustrated by the following photographs and a table:

Tab. 1. ELISA showing the binding of antibodies to YKL-40, clone 2G8 C10, in addition to full-length YKL-39, YKL-40 and SI-CLP with various antigens: non-conserved sequences (NCR) YKL-39, YKL-40, SI-CLP, c N and C-terminal portions of YKL-39, with full-length YKL-40, peptide 2 YKL-39 (226-241), peptide 4 SI-CLP (259-276).

FIG. 1. The specificity of the antibody produced by the hybridoma 2G8 C10 to the proteins YKL-39, YKL-40 and SI-CLP in human LN229 cells, detected by immunofluorescence. The arrows indicate the antigen stained with the 2G8 C10 antibody located in the vesicles of the epithelial cells of the LN229 line. To detect antigen-bound antibodies, secondary antibodies to mouse immunoglobulins conjugated to the Alexa Fluor 488 fluorochrome (Molecular Probes, USA) were used, as described in Example 1.

FIG. 2. The specificity of the YKL-40 antibody, clone 2G8 C10, produced by the hybridoma 2G8 C10, to the proteins YKL-39, YKL-40, and SI-CLP in kidney cells, detected by immunohistochemistry. Secondary antibodies to mouse immunoglobulins conjugated with polymeric horseradish peroxidase (PrimeBioMed, Russia) and DAB substrate, as described in Example 2. Specific granular staining of the cytoplasm of tubular cells on a paraffin tissue section fixed by the form the presence of cells expressing YKL-39, YKL-40 and SI-CLP.

FIG. 3. The specificity of the antibody produced by the hybridoma 2G8 C10 to the proteins YKL-39, YKL-40 and SI-CLP in human LN229 cells, detected by immunohistochemistry. Secondary antibodies to mouse immunoglobulins conjugated with polymeric horseradish peroxidase (PrimeBioMed, Russia) and DAB substrate, as described in Example 2. Specific granular staining of the cytoplasm of tubular cells on a paraffin tissue section fixed by the form the presence of cells expressing YKL-39, YKL-40 and SI-CLP.

FIG. 4. The specificity of the antibody produced by the hybridoma YKL-40, clone 2G8 C10, to the proteins YKL-39, YKL-40 and SI-CLP in human LN229 cells, detected by immunocytochemistry. Dark dots represent antibody-stained antigens YKL-39, YKL-40 and SI-CLP located in the vesicles of LN229 cells. Secondary antibodies to mouse immunoglobulins conjugated with polymeric horseradish peroxidase (PrimeBioMed, Russia) and DAB substrate were used to detect antigen-bound antibodies as described in Example 2.

FIG. 5. The specificity of the antibody produced by the hybridoma YKL-40, clone 2G8 C10, to proteins YKL-39, YKL-40 and SI-CLP on total lysates of the glioblastoma cell line LN229 and recombinant proteins is detected on immunoblots. Binding of YKL-39, YKL-40, and SI-CLP proteins by the 2G8 C10 antibody after protein transfer to the membrane. Protein lysates were prepared and the membrane developed as described in Example 3. The electrophoretic mobility of the protein was as calculated.

The invention is illustrated by the following examples.

Example 1. Preparation of sections for the immunohistochemical detection of YKL-39, YKL-40 and SI-CLP proteins.

Immunohistochemical study is carried out on the operating material, fixed with 10% neutral formalin, buffered phosphate buffer, for 24 hours. After histological tracing, the material is embedded in paraffin and then sections with a thickness of 2-4 microns are prepared. Sections are mounted on special highly adhesive glasses (SuperFrost Plus, ApexLab) and dried for 18 hours at 37 ° C.

Paraffin is further removed from the sections in three xylene changes, 10 minutes in each change. Sections are carried out through alcohols with a volume fraction of isopropanol 100% (I), 100% (II), 70%, 50% for 5 minutes each and washed in distilled water. Endogenous peroxidase blocking is carried out in 3% hydrogen peroxide for 10 minutes. Sections are incubated with antibodies YKL-40, clone 2G8 C10, and then with antibodies to mouse immunoglobulins conjugated with polymeric horseradish peroxidase (PrimeBioMed, Russia). Staining appears when the DAB chromogen substrate is added for 5-10 minutes (PrimeBioMed, Russia). The result is shown in FIG. 2 and 3.

Example 2. Methods of cell fixation for the detection of proteins YKL-39, YKL-40 and SI-CLP in the reaction of indirect immunofluorescence and immunocytochemistry.

The LN229 culture is grown on coverslips until reaching 30% confluency. The cells are fixed by placing in 3.7% paraformaldehyde for 15 min, followed by washing in PBS (PanEko, Russia) for 10 min. After fixation and washing, the cells are incubated with the YKL-40 antibody, clone 2G8 C10 for 1 h at room temperature, and then with goat antibodies to mouse immunoglobulins conjugated with the Alexa488 fluorochrome (JacksonImmunoresearch, USA), or polymeric horseradish peroxidase (PrimeBioMedium, Russia) or 15 minutes, respectively, at room temperature. To visualize staining in a non-fluorescent method, add the substrate DAB chromogen for 5-10 minutes (PrimeBioMed, Russia) The preparations are enclosed in a water-based confinement medium and examined in an Olympus BX53 microscope (Cheminst, Germany) coupled to a 2 MP camera Infinity 2 (Lumenera , USA) using the U PlanFL N × 40 / CHA 0.75 and U PlanFL N × 100 / CHA 1.30 lenses. Filters, U-FUNA and U-FGNA (Olympus, Japan) are used for immunofluorescence. The results are shown in FIG. 1 and 4.

Example 3. A method of obtaining total cell lysates and detecting native proteins YKL-39, YKL-40 and SI-CLP by immunoblotting.

5 × 10 ⁵ LN229 cells are lysed on ice in a buffer containing 50 mM Tris- (hydroxymethyl) -aminomethane (pH 7.5), 150 mM NaCl, 10% glycerol, 0.5% Triton X-100, and a cocktail of protease inhibitors (Roche, USA ). The total concentration of proteins in lysates is determined by the Bradford method using the Protein Assay Kit (Bio-Rad, USA), following the manufacturer's recommendations.

Before electrophoretic separation, 5 × Laemmli buffer containing 250 mM Tris- (hydroxymethyl) -aminomethane (pH 6.8), 50% glycerol, 10% sodium dodecyl sulfate (SDS), 500 mM beta-mercaptoethanol, 0.5% bromophenol is added to the prepared lysates. blue. The samples are heat treated at 95 ° C for 5 minutes. In each well of a 10% polyacrylamide gel with SDS (SDS-PAGE), lysates containing at least 15 μg of total protein are applied. Electrophoretic separation of proteins in SDS-PAGE is carried out for 30 min at 60 V and 60 min at 120 V for further separation in an electrophoresis chamber. The gel is then incubated in a blotting buffer containing 50 mM Tris- (hydroxymethyl) -aminomethane, 38 mM glycine, 0.1% SDS, and 20% methanol. The transfer of proteins to a nitrocellulose membrane (0.22 μm, Millipore, USA) is carried out at a constant current of 250 mA for 60 min. The membrane is blocked with 5% milk (Bio-Rad, USA) for 1 hour, incubated with antibodies YKL-40, clone 2G8 C10 (overnight at + 4 ° C), and then with antibodies to mouse immunoglobulins conjugated with horseradish peroxidase (dilution 1: 5000, Abcam, USA) - 1 hour. Milk powder (Bio-Rad, USA) and antibodies are diluted in TBST buffer containing 20 mM Tris- (hydroxymethyl) -aminomethane (pH 7.6), 150 mM NaCl, 0.05% Tween-20. The membrane is developed by chemiluminescence using the ECL + Plus kit (Millipore, UK) according to the manufacturer's instructions. The chemiluminescent response is recorded on a ChemiDoc MP instrument (Bio-Rad, UK) followed by processing using the ChemiDoc XRS + imaging systems. The results are shown in FIG. five.

Tab. 1

YKL-39 YKL-40 YKL-39 C-end YKL-39 NCR YKL-40 NCR SI-CLP NCR YKL-39 N-end peptide 2 YKL-39 (226-241) peptide 4 SI-CLP (259-276) 2G8C10 2.3682 1.8529 2.1542 1.8032 2.101 2.3812 n / a 0.0104 0.2561

Claims (1)

Mouse hybridoma YKL-40, clone 2G8 C10, collection number GKPM-Obolensk H-90, is a producer of a monoclonal antibody that recognizes proteins YKL-40, YKL-39 and SI-CLP by enzyme immunoassay, as well as in neoplastic glioblastoma cells and in cells other organs containing these antigens, by immunocytochemistry, immunohistochemistry, immunoblotting and immunofluorescence, obtained by immunizing Balb / c mice with a full-length recombinant human YKL-40 protein and fusing sensitized splenocytes using 50% sp2 / 0 myeloma immunized mice with sp2 / 0 cells solution of polyethylene glycol with a molecular weight of 1500.

Images