RU2723390C1 - Method for prediction of risk of developing diseases associated with level of immunoglobulin e (ige) in human blood serum - Google Patents
Method for prediction of risk of developing diseases associated with level of immunoglobulin e (ige) in human blood serum Download PDFInfo
- Publication number
- RU2723390C1 RU2723390C1 RU2019120964A RU2019120964A RU2723390C1 RU 2723390 C1 RU2723390 C1 RU 2723390C1 RU 2019120964 A RU2019120964 A RU 2019120964A RU 2019120964 A RU2019120964 A RU 2019120964A RU 2723390 C1 RU2723390 C1 RU 2723390C1
- Authority
- RU
- Russia
- Prior art keywords
- risk
- ige
- diseases associated
- alleles
- probe
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к молекулярной биологии и медицине, а именно к медицинской генетике, диагностике, иммунологии и аллергологии. Изобретение представляет собой способ прогнозирования риска возникновения болезней, связанных с уровнем иммуноглобулина Е (IgE) в сыворотке крови человека, таких как атопический дерматит, хроническая крапивница, астма, аллергический ринит, аллергический риноконъюнктивит, аллергический конъюнктивит. С выделенной из биологического материала человека ДНК проводят полимеразно-цепную реакцию в реальном времени в присутствии олигонуклеотидных зондов и праймеров и анализируют полиморфизмы rs2251746 и rs2427837 гена FCER1A методом аллельной дискриминации.The invention relates to molecular biology and medicine, namely to medical genetics, diagnostics, immunology and allergology. The invention is a method for predicting the risk of diseases associated with the level of immunoglobulin E (IgE) in human serum, such as atopic dermatitis, chronic urticaria, asthma, allergic rhinitis, allergic rhinoconjunctivitis, allergic conjunctivitis. Real-time polymerase chain reaction is carried out with DNA extracted from human biological material in the presence of oligonucleotide probes and primers, and rs2251746 and rs2427837 polymorphisms of the FCER1A gene are analyzed by allelic discrimination.
Изобретение обеспечивает получение новых критериев оценки риска развития заболеваний, связанных с уровнем сывороточного IgE на основе данных о сочетаниях генетических вариантов локусов rs2251746 и rs2427837.The invention provides new criteria for assessing the risk of developing diseases associated with the level of serum IgE based on data on combinations of genetic variants of the rs2251746 and rs2427837 loci.
IgE был открыт в связи с его участием в развитии аллергических реакций, связанных с I-типом гиперчувствительности, при котором первичное поступление аллергена вызывает продукцию плазмоцитами специфичного IgE, вызывающего каскад реакций, приводящих к клиническим проявлениям аллергии. [1, 2]IgE was discovered in connection with its participation in the development of allergic reactions associated with I-type hypersensitivity, in which the initial intake of an allergen causes plasmocytes to produce specific IgE, causing a cascade of reactions leading to clinical manifestations of allergies. [12]
Позже было показано, что доминирующая роль IgE с точки зрения эволюции заключается в защите хозяина от паразитарных инфекций, в особенности гельминтозов, представлявших большую опасность для выживания человека в природных условиях. [1, 3]It was later shown that the dominant role of IgE in terms of evolution is to protect the host from parasitic infections, especially helminthiases, which pose a great danger to human survival in natural conditions. [13]
С развитием цивилизации частота заражения паразитами существенно снизилась, а высокий уровень сывороточного IgE, закрепившийся в популяции, при частом контакте с различными агентами стал приводить к возникновению аллергических реакций. [4, 5]With the development of civilization, the frequency of infection with parasites significantly decreased, and the high level of serum IgE, fixed in the population, with frequent contact with various agents, began to lead to allergic reactions. [4, 5]
Дальнейшие исследования обнаружили связь между концентрацией IgE в крови и некоторыми заболеваниями человека. Высокие уровни IgE в крови повышают риск развития таких заболеваний, как атопический дерматит, хроническая крапивница, астма, аллергический ринит, аллергический риноконъюнктивит, аллергический конъюнктивит.[6, 7, 8, 9, 10, 11] В свою очередь, низкие уровни IgE связывают с меньшей устойчивостью к паразитарным заболеваниям и токсинам животного происхождения. [1, 12, 13, 14]Further studies have found a relationship between the concentration of IgE in the blood and some human diseases. High levels of IgE in the blood increase the risk of developing diseases such as atopic dermatitis, chronic urticaria, asthma, allergic rhinitis, allergic rhinoconjunctivitis, allergic conjunctivitis. [6, 7, 8, 9, 10, 11] In turn, low levels of IgE bind with less resistance to parasitic diseases and animal toxins. [1, 12, 13, 14]
Таким образом, можно говорить о том, что высокие уровни сывороточного IgE связаны с развитием аллергических реакций и являются маркерами некоторых заболеваний, в то время как низкие уровни сывороточного IgE связаны с пониженной устойчивостью к паразитарным заболеваниям и токсинам животного происхождения.Thus, it can be said that high levels of serum IgE are associated with the development of allergic reactions and are markers of some diseases, while low levels of serum IgE are associated with reduced resistance to parasitic diseases and animal toxins.
rs2251746 и rs2427837 - это однонуклеотидные полиморфизмы (SNP) в гене, кодирующем альфа-цепь высокоаффинного рецептора IgE (FCER1A) на хромосоме 1q23. Различные исследования показали высокий уровень корреляции между присутствием в геноме человека rs2251746 или rs2427837 и уровнем IgE в сыворотке крови, а также вероятностью развития аллергических реакций. [3, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26]rs2251746 and rs2427837 are single nucleotide polymorphisms (SNPs) in the gene encoding the alpha chain of the high affinity IgE receptor (FCER1A) on chromosome 1q23. Various studies have shown a high level of correlation between the presence of rs2251746 or rs2427837 in the human genome and the level of serum IgE, as well as the likelihood of allergic reactions. [3, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26]
В изученной научно-медицинской и доступной патентной литературе авторами не было обнаружено способа прогнозирования риска развития заболеваний, связанных с уровнем сывороточного IgE на основе генетических полиморфизмов rs2251746 и rs2427837.In the studied medical and patent literature, the authors did not find a method for predicting the risk of developing diseases associated with the level of serum IgE based on the genetic polymorphisms rs2251746 and rs2427837.
В патенте RU2275863 C1 (дата публикации 10.04.2015) предложен «Способ прогнозирования риска возникновения бронхиальной астмы», заключающийся в проведении аллергических проб и определении таких показателей как: наличие родственников, страдающих астмой; подверженность пациента респираторным инфекциям более двух раз в году и подверженность вазомоторному риниту, наличие атонического дерматита, экземы, крапивницы и других аллергических синдромов, заболеваний желудочно-кишечного тракта или печени, а также наличие профессиональной вредности и рассчитывают риск возникновения бронхиальной астмы по формуле. [27] Недостатком данного метода является его трудоемкость, необходимость сбора анамнеза, субъективность оценки, непосредственное присутствие пациента для постановки аллергических проб, невозможность оценить риски развития других заболеваний, связанных с уровнем сывороточного IgE и недостаточная информативность, так как метод не включает генетические маркеры и не позволяет оценить передачу данного признака потомкам.Patent RU2275863 C1 (publication date 04/10/2015) proposes “A method for predicting the risk of bronchial asthma”, which consists in carrying out allergic tests and determining such indicators as: the presence of relatives suffering from asthma; susceptibility of the patient to respiratory infections more than twice a year and susceptibility to vasomotor rhinitis, the presence of atonic dermatitis, eczema, urticaria and other allergic syndromes, diseases of the gastrointestinal tract or liver, as well as the presence of occupational hazards and calculate the risk of bronchial asthma according to the formula. [27] The disadvantage of this method is its complexity, the need for an anamnesis, the subjectivity of the assessment, the direct presence of the patient for allergy tests, the inability to assess the risks of developing other diseases associated with serum IgE level and lack of information, as the method does not include genetic markers and does not allows you to evaluate the transmission of this trait to descendants.
В патенте RU 2424528 C2 (дата публикации 10.04.2015) предложен «Способ прогнозирования формирования бронхиальной астмы у детей раннего возраста, перенесших острый обструктивный бронхит», заключающийся в проведении исследования периферического кровообращения у детей раннего возраста, перенесших 1-2 эпизода острого обструктивного бронхита, методом компьютерной капилляроскопии капилляров ногтевого ложа и определении отклонения различных показателей микроциркуляторного русла от доверительного среднего показателя. [28] Недостатком данного метода является его трудоемкость, применимость только для небольшой группы населения, невозможность оценить риски развития других заболеваний, связанных с уровнем сывороточного IgE и недостаточная информативность, так как метод не включает генетические маркеры и не позволяет оценить передачу данного признака потомкам.Patent RU 2424528 C2 (publication date 04/10/2015) proposes “A method for predicting the formation of bronchial asthma in young children who have experienced acute obstructive bronchitis”, which consists in conducting a study of peripheral circulation in young children who have suffered 1-2 episodes of acute obstructive bronchitis, by computer capillaroscopy of the nail bed capillaries and determining the deviation of various indicators of the microvasculature from the confidence average. [28] The disadvantage of this method is its complexity, its applicability only to a small group of the population, the inability to assess the risks of developing other diseases associated with the level of serum IgE and lack of information, since the method does not include genetic markers and does not allow to evaluate the transmission of this trait to posterity.
В патенте RU 2330291 C1 (дата публикации 27.07.2008) предложен «Способ прогнозирования развития атопического дерматита у новорожденных», заключающийся в определении в пуповинной крови новорожденных абсолютного количества мононуклеаров, синтезирующих интерферон-гамма (INFγ) и не имеющих маркера активации CD69 (фенотип клеток - INFγ+CD69-). [29] Недостатком данного метода является необходимость сохранения пуповинной крови новорожденного ребенка, применимость только для небольшой группы населения, невозможность оценить риски развития других заболеваний, связанных с уровнем сывороточного IgE и недостаточная информативность, так как метод не включает генетические маркеры и не позволяет оценить передачу данного признака потомкам.Patent RU 2330291 C1 (publication date 07/27/2008) proposes a “Method for predicting the development of atopic dermatitis in newborns”, which consists in determining the absolute number of mononuclear cells synthesizing interferon-gamma (INFγ) in cord blood of newborns that do not have an activation marker CD69 (cell phenotype - INFγ + CD69-). [29] The disadvantage of this method is the need to preserve the umbilical cord blood of a newborn child, applicability only for a small group of the population, the inability to assess the risks of developing other diseases associated with serum IgE level and lack of information, as the method does not include genetic markers and does not allow to evaluate the transmission of this trait to posterity.
В патенте RU 2568738 C1 (дата публикации 20.11.2015) предложен «Способ прогнозирования формирования атопического дерматита у детей», заключающийся в определении таких прогностических предикторов, как наличие затянувшейся неонатальной желтухи, пневмонии на 1 -м году жизни ребенка, острой респираторной вирусной инфекции на 1-м году жизни ребенка, паратрофии, синдрома избыточного бактериального роста кишечника на 1-м году жизни ребенка, лямблиоза кишечника на 1-м году жизни, острого простого бронхита на 2-м году жизни, хронического тонзилофарингита на 2-м году жизни ребенка, острого простого бронхита в возрасте после 2-х лет жизни ребенка, бронхообструктивного синдрома в возрасте после 2-х лет жизни ребенка, хронического тонзилофарингита в возрасте после 2-х лет жизни ребенка, хронического аденоидита в возрасте после 2-х лет жизни ребенка, внутричерепной гипертензии, хронического гастродуоденита, аллергического ринита у отца ребенка, бронхиальной астмы у родственников матери пациента и расчете зависимой переменной по математической формуле. [30] Недостатком данного метода является его трудоемкость, необходимость сбора анамнеза, субъективность оценки, невозможность оценить риски развития других заболеваний, связанных с уровнем сывороточного IgE и недостаточная информативность, так как метод не включает генетические маркеры и не позволяет оценить передачу данного признака потомкам.Patent RU 2568738 C1 (publication date 11/20/2015) proposes a “Method for predicting the formation of atopic dermatitis in children”, which consists in determining prognostic predictors such as the presence of prolonged neonatal jaundice, pneumonia in the 1st year of a child’s life, and acute respiratory viral infection in 1st year of a child’s life, paratrophy, a syndrome of excessive bacterial growth of the intestine in the 1st year of a child’s life, intestinal giardiasis in the 1st year of life, acute simple bronchitis in the 2nd year of life, chronic tonsilopharyngitis in the 2nd year of a child’s life acute acute bronchitis after 2 years of a child’s life, bronchial obstructive syndrome after 2 years of a child’s life, chronic tonsilopharyngitis after 2 years of a child’s life, chronic adenoiditis after 2 years of a child’s life, intracranial hypertension, chronic gastroduodenitis, allergic rhinitis in the father of the child, bronchial asthma in relatives of the patient’s mother and the calculation of the dependent variable using a mathematical formula. [30] The disadvantage of this method is its complexity, the need for an anamnesis, the subjectivity of the assessment, the inability to assess the risks of developing other diseases associated with serum IgE level and lack of information, as the method does not include genetic markers and does not allow the transmission of this trait to descendants to be assessed.
В патенте RU 2187817 C2 предложен «Способ прогнозирования риска развития аллергических реакций у детей раннего возраста», заключающийся в том, что выделяют лейкоциты из пуповинной крови новорожденного, тестируют их количество при жизнеспособности 95-98%, образец инкубируют раздельно с аллергеном домашней пыли и фактором активации тромбоцитов, в надосадочной жидкости с помощью жидкостной хроматографии высокого разрешения выявляют лейкотриены, и при их обнаружении в пробе с аллергеном и/или при уровне лейкотриена Е4 более 3 нг/107 лейкоцитов и лейкотриена E4 более 4 нг/10 7 лейкоцитов в пробе с фактором активации тромбоцитов прогнозируют развитие аллергической патологии на первом году жизни. [31] Недостатками данного метода являются необходимость сохранения пуповинной крови новорожденного ребенка, применимость только для небольшой группы населения, невозможность оценить риски развития других заболеваний, связанных с уровнем сывороточного IgE и недостаточная информативность, так как метод не включает генетические маркеры и не позволяет оценить передачу данного признака потомкам.Patent RU 2187817 C2 proposes “A method for predicting the risk of allergic reactions in young children,” which consists in isolating leukocytes from the umbilical cord blood of a newborn, testing their number at a viability of 95-98%, and incubating the sample separately with house dust allergen and factor platelet activation, leukotrienes are detected in the supernatant by high-resolution liquid chromatography, and when detected in a sample with an allergen and / or at a leukotriene level of E4 greater than 3 ng / 107 leukocytes and leukotriene E4 more than 4 ng / 10 7 leukocytes in a sample with factor platelet activation predict the development of allergic pathology in the first year of life. [31] The disadvantages of this method are the need to preserve the umbilical cord blood of a newborn baby, applicability only for a small group of the population, the inability to assess the risks of developing other diseases associated with serum IgE level and lack of information, as the method does not include genetic markers and does not allow to evaluate the transmission of this trait to posterity.
Методом, позволяющим проанализировать состояние полиморфизмов rs2251746 и rs2427837 является секвенирование по Сэнгеру - метод, применяемый для детекции любых изменений нуклеотидной последовательности, разработанный Ф. Сэнгером в 1977 году и широко использующийся для изучения нуклеотидной последовательности ДНК человека. [15] Недостатками данного метода являются его трудоемкость, необходимость в приобретении дорогостоящего оборудования и реактивов, значительно более долгое получение результатов и повышенные риски контаминации лаборатории продуктами полимеразно-цепной реакции (ПНР) и реакций секвенирования.The method that allows us to analyze the state of the rs2251746 and rs2427837 polymorphisms is Sanger sequencing, a method used to detect any changes in the nucleotide sequence developed by F. Sanger in 1977 and widely used to study the nucleotide sequence of human DNA. [15] The disadvantages of this method are its complexity, the need to purchase expensive equipment and reagents, significantly longer results and increased risks of laboratory contamination by products of polymerase chain reaction (NDP) and sequencing reactions.
За прототип нами был выбран патент US 5538848 A (US 5538848 A, Kenneth J. Livak, Susan J., A. Flood, Jeffrey Marmaro, Method for detecting nucleic acid amplification using self-quenching fluorescence probe, 23.07.1996), представляющий собой метод анализа ДНК путем проведения полимеразно-цепной реакции в реальном времени в присутствии меченых флуорофорами, аллель-специфичных (TaqMan) зондов и праймеров. [32] Недостатком прототипа является то, что для использования описанного в прототипе метода на практике, с целью исследования различных полиморфизмов, требуется разработка TaqMan зондов и праймеров для каждого отдельного исследуемого полиморфизма.For the prototype, we chose US patent 5538848 A (US 5538848 A, Kenneth J. Livak, Susan J., A. Flood, Jeffrey Marmaro, Method for detecting nucleic acid amplification using self-quenching fluorescence probe, 07.23.1996), which is DNA analysis method by real-time polymerase chain reaction in the presence of fluorophore-labeled, allele-specific (TaqMan) probes and primers. [32] The disadvantage of the prototype is that in order to use the method described in the prototype in practice, in order to study various polymorphisms, the development of TaqMan probes and primers for each individual polymorphism to be studied is required.
Новизна и изобретательский уровень нашего исследования заключаются в том, что на данный момент не известна возможность индивидуального прогноза риска развития заболеваний, связанных с уровнем сывороточного IgE по данным о сочетании полиморфизмов rs2251746 и rs2427837.The novelty and inventive step of our study lies in the fact that the possibility of an individual prognosis of the risk of developing diseases associated with the level of serum IgE according to the combination of rs2251746 and rs2427837 polymorphisms is not currently known.
Техническим результатом изобретения является разработка TaqMan зондов и праймеров для анализа полиморфизмов rs2251746 и rs2427837 методом аллельной дискриминации, что позволит расширить число способов прогнозирования развития IgE-зависимых заболеваний.The technical result of the invention is the development of TaqMan probes and primers for the analysis of polymorphisms rs2251746 and rs2427837 by allelic discrimination, which will expand the number of methods for predicting the development of IgE-dependent diseases.
Для достижения указанного технического результата был разработан способ прогнозирования риска развития IgE-зависимых заболеваний, который осуществляется следующим образом:To achieve the specified technical result, a method for predicting the risk of development of IgE-dependent diseases was developed, which is carried out as follows:
1. Выделение ДНК из биологического материала пациента1. Isolation of DNA from the biological material of the patient
Выделение ДНК из биологического материала пациента осуществляется при помощи коммерческого набора GeneJet Whole Blood Genomic DNA Purification Mini Kit фирмы ThermoFisher Scientific или любым альтернативным методом выделения ДНК, например, методом фенол-хлороформной экстракции по Мэтью.DNA is extracted from the patient’s biological material using a commercial GeneJet Whole Blood Genomic DNA Purification Mini Kit from ThermoFisher Scientific or any alternative DNA extraction method, for example, Matthew phenol-chloroform extraction.
2. Анализ полиморфизмов rs2251746 и rs24278372. Analysis of polymorphisms rs2251746 and rs2427837
Анализ полиморфизмов rs2251746 и rs2427837 проводят методом ПЦР в реальном времени на амплификаторе Bio-Rad CFX96 Real-Time System с последующим анализом методом аллельной дискриминации.The analysis of rs2251746 and rs2427837 polymorphisms is carried out by real-time PCR on a Bio-Rad CFX96 Real-Time System amplifier with subsequent analysis by allelic discrimination.
Для исследования полиморфизма rs2251746 авторами были разработаны следующие TaqMan зонды и праймеры:To study rs2251746 polymorphism, the authors developed the following TaqMan probes and primers:
Зонды:Probes:
Probe 1: FAM - ATATGATACAGAAAACATTTCCTTCTGCT - BHQ-1Probe 1: FAM - ATATGATACAGAAAACATTTCCTTCTGCT - BHQ-1
Probe 2: ROX - ATATGACACAGAAAACATTTCCTTCTGCT - BHQ-2Probe 2: ROX - ATATGACACAGAAAACATTTCCTTCTGCT - BHQ-2
Праймеры: Pr Fw: CACAGCTGATGGGTTAAPrimers: Pr Fw: CACAGCTGATGGGTTAA
Pr rev: CTGGAGAGATCTAAGGCPr rev: CTGGAGAGATCTAAGGC
Реакционная смесь объемом 18 мкл включает в себя:The reaction mixture with a volume of 18 μl includes:
1. ДНК=2.5 мкл,1. DNA = 2.5 μl,
2. Pr Fw=2 мкл,2. Pr Fw = 2 μl,
3. Pr rev=2 мкл,3. Pr rev = 2 μl,
4. Probe 1=0.5 мкл,4.
5. Probe 2=0.5 мкл,5.
6. DreamTaq PCR Master Mix фирмы ThermoFisher Scientific=9 мкл,6. DreamTaq PCR Master Mix from ThermoFisher Scientific = 9 μl,
7. MgCl2=1,5 мкл.7. MgCl 2 = 1.5 μl.
После денатурации (3 минуты при t=95°C) выполняют 40 циклов амплификации по схеме: 10 секунд при t=95°C, 30 секунд при t=64°C, регистрация флуоресценции Для исследования полиморфизма rs2427837 были разработаны следующие TaqMan зонды и праймеры:After denaturation (3 minutes at t = 95 ° C), 40 amplification cycles are performed according to the scheme: 10 seconds at t = 95 ° C, 30 seconds at t = 64 ° C, fluorescence registration. The following TaqMan probes and primers were developed to study rs2427837 polymorphism :
Зонды:Probes:
Probe 1: FAM - AGTTCATCATGGGGAGAAAGTCAATTAAAAA - BHQ1Probe 1: FAM - AGTTCATCATGGGGGAGAAAGTCAATTAAAAA - BHQ1
Probe 2: ROX - AGTCCATCATGGGGAGAAAGTCAATTAAAAA - BHQ2Probe 2: ROX - AGTCCATCATGGGGAGAGAAAGTCAATTAAAAA - BHQ2
Праймеры:Primers:
Pr Fw: CTACTGTAGGTCTCTCTGTGTTACTACCPr Fw: CTACTGTAGGTCTCTCTGTGTTACTACC
Pr rev: CAGGACCAAGGAAAGGATGAGPr rev: CAGGACCAAGGAAAGGATGAG
Реакционная смесь объемом 18 мкл включает в себя:The reaction mixture with a volume of 18 μl includes:
1. ДНК = 2.5 мкл,1. DNA = 2.5 μl,
2. PrFw = 2 мкл,2. PrFw = 2 μl,
3. Prrev = 2 мкл,3. Prrev = 2 μl,
4. Probe 1 = 0.5 мкл,4.
5. Probe 2 = 0.5 мкл,5.
6. DreamTaq PCR Master Mix фирмы ThermoFisher Scientific = 9 мкл,6. DreamTaq PCR Master Mix from ThermoFisher Scientific = 9 μl,
7. MgCl2 = 1,5 мкл.7. MgCl 2 = 1.5 μl.
После денатурации (3 минуты при t=95°C) выполняют 40 циклов амплификации по схеме: 10 секунд при t=95°C, 45 секунд при t=64°C, регистрация флуоресценцииAfter denaturation (3 minutes at t = 95 ° C), 40 amplification cycles are performed according to the scheme: 10 seconds at t = 95 ° C, 45 seconds at t = 64 ° C, registration of fluorescence
При проведении ПЦР в амплификаторе Bio-Rad CFX96 Real-Time System с флюоресцентной детекцией генотипирование осуществляют методом TaqMan зондов по величине RFU (относительных единиц флуоресценции). Для rs2251746 зонд с флуоресцентным красителем FAM соответствует аллелю Т, зонд с красителем ROX - аллелю С. Для rs2427837 зонд с флуоресцентным красителем FAM соответствует аллелю А, зонд с красителем ROX - аллелю G.When performing PCR in a Bio-Rad CFX96 Real-Time System amplifier with fluorescence detection, genotyping is carried out using TaqMan probes in terms of RFU (relative fluorescence units). For rs2251746, a probe with a fluorescent dye FAM corresponds to the T allele, a probe with a ROX dye corresponds to allele C. For rs2427837, a probe with a fluorescent dye FAM corresponds to allele A, a probe with a ROX dye corresponds to allele G.
Изобретение охарактеризовано на фигурах 1 и 2.The invention is characterized in figures 1 and 2.
Фиг. 1. Аллельная дискриминация методом детекции TaqMan зондов по данным величин RFU каждого зонда на амплификаторе CFX96 с детектирующей системой в режиме реального времени полиморфизма rs2251746: 
Фиг. 2. Аллельная дискриминация методом детекции TaqMan зондов по данным величин RFU каждого зонда на амплификаторе CFX96 с детектирующей системой в режиме реального времени полиморфизма rs2427837:
3. Прогнозирование риска развития заболеваний, связанных с уровнем сывороточного IgE3. Prediction of the risk of developing diseases associated with the level of serum IgE
rs2251746rs2251746
В случае выявления аллеля ТТ в гене прогнозируется высокое содержание IgE в сыворотке крови человека.If a TT allele is detected in the gene, a high IgE content in human serum is predicted.
В случае выявления аллеля СТ прогнозируется сниженное содержание IgE в сыворотке крови человека.In case of detection of the CT allele, a reduced IgE content in human serum is predicted.
В случае выявления аллеля СС прогнозируется низкое содержание IgE в сыворотке крови человека.In case of detection of the CC allele, a low IgE content in human serum is predicted.
rs2427837rs2427837
В случае выявления аллеля GG в гене прогнозируется высокое содержание IgE в сыворотке крови человека.If a GG allele is detected in a gene, a high IgE content in human serum is predicted.
В случае выявления аллеля AG прогнозируется сниженное содержание IgE в сыворотке крови человека.If the AG allele is detected, a reduced IgE content in human serum is predicted.
В случае выявления аллеля АА прогнозируется низкое содержание IgE в сыворотке крови человека.If the AA allele is detected, a low IgE content in human serum is predicted.
Интерпретация результатов:Interpretation of results:
При сочетании аллелей ТТ (rs2251746) и GG (rs2427837) прогнозируется высокий риск развития заболеваний, связанных с высоким уровнем сывороточного IgE и высокая устойчивость к гельминтозам и токсинам животного происхождения.With the combination of TT alleles (rs2251746) and GG (rs2427837), a high risk of developing diseases associated with a high level of serum IgE and high resistance to helminthiases and animal toxins is predicted.
При сочетании аллелей ТТ (rs2251746) и AG (rs2427837) или СТ (rs2251746) и GG (rs2427837) прогнозируется повышенный риск развития заболеваний, связанных с высоким уровнем IgE и повышенная устойчивость к гельминтозам и токсинам животного происхождения.With the combination of TT (rs2251746) and AG (rs2427837) or CT (rs2251746) and GG (rs242717837) alleles, an increased risk of developing diseases associated with high levels of IgE and increased resistance to helminthiasis and animal toxins is predicted.
При сочетании аллелей СТ (rs2251746) и AG (rs2427837) или СС (rs2251746) и GG (rs2427837) или ТТ (rs2251746) и АА (rs2427837) прогнозируется средний риск развития заболеваний, связанных с высоким уровнем IgE и средняя устойчивость к гельминтозам и токсинам животного происхождения.When the alleles CT (rs2251746) and AG (rs2427837) or CC (rs2251746) and GG (rs2427837) or TT (rs2251746) and AA (rs2427837) are combined, the average risk of developing diseases associated with high levels of IgE and average resistance to helminthiasis and toxins is predicted animal origin.
При сочетании аллелей СС (rs2251746) и AG (rs2427837) или СТ (rs2251746) и АА (rs2427837) прогнозируется сниженный риск развития заболеваний, связанных с высоким уровнем IgE и сниженная устойчивость к гельминтозам и токсинам животного происхождения.With a combination of the CC (rs2251746) and AG (rs2427837) or CT (rs2251746) and AA (rs2251746) and AA (rs2427837) alleles combination, a reduced risk of developing diseases associated with a high level of IgE and a reduced resistance to helminth infections and animal toxins is predicted.
При сочетании аллелей СС (rs2251746) и АА (rs2427837) прогнозируется низкий риск развития заболеваний, связанных с высоким уровнем IgE и низкая устойчивость к гельминтозам и токсинам животного происхождения.With the combination of the CC alleles (rs2251746) and AA (rs2427837), a low risk of developing diseases associated with high levels of IgE and low resistance to helminthiases and animal toxins is predicted.
К заболеваниям, связанным с высоким уровнем IgE в сыворотке крови относят: атопический дерматит, хроническую крапивницу, астму, аллергический ринит, аллергический риноконъюнктивит, аллергический конъюнктивит.Diseases associated with high serum IgE include: atopic dermatitis, chronic urticaria, asthma, allergic rhinitis, allergic rhinoconjunctivitis, allergic conjunctivitis.
Для интерпретации результатов можно воспользоваться таблицей 1.To interpret the results, you can use table 1.
В качестве примеров применения разработанного способа приведено исследование ДНК добровольцев, не являющихся родственниками, для которых был проведен анализ полиморфизма генов rs2251746 и rs2427837.As examples of the application of the developed method, a DNA study of volunteers who are not relatives is given, for which an analysis of the polymorphism of the rs2251746 and rs2427837 genes was carried out.
Пример 1.Example 1
У пациента O22 была взята венозная кровь, при генотипировании ДНК-маркеров было выявлено, что генотип пациента по локусу rs2251746 - СС, генотип по локусу rs2427837 - AG. Сочетание аллелей СС (rs2251746) и AG (rs2427837) позволяет отнести пациента в группу с пониженным риском развития заболеваний, связанных с высоким уровнем сывороточного IgE. Полученные результаты были подтверждены секвенированием.Venous blood was taken from patient O22, and genotyping of DNA markers revealed that the patient's genotype at the rs2251746 locus is CC, and the locus at the rs2427837 locus is AG. The combination of the CC alleles (rs2251746) and AG (rs2427837) allows the patient to be assigned to a group with a reduced risk of developing diseases associated with high levels of serum IgE. The results were confirmed by sequencing.
Пример 2.Example 2
У пациента 015 была взята венозная кровь, при генотипировании ДНК-маркеров было выявлено, что генотип пациента по локусу rs2251746 - СТ, генотип по локусу rs2427837 - GG. Сочетание аллелей СТ (rs2251746) и GG (rs2427837) позволяет отнести пациента в группу с повышенным риском развития заболеваний, связанных с высоким уровнем сывороточного IgE. Полученные результаты были подтверждены секвенированием.Venous blood was taken from patient 015, and genotyping of DNA markers revealed that the patient’s genotype at the rs2251746 locus is CT, and the locus at the rs2427837 locus is GG. The combination of CT alleles (rs2251746) and GG (rs2427837) allows the patient to be assigned to a group with an increased risk of developing diseases associated with high serum IgE levels. The results were confirmed by sequencing.
Пример 3.Example 3
У пациента N9 была взята венозная кровь, при генотипировании ДНК-маркеров было выявлено, что генотип пациента по локусу rs2251746 - ТТ, генотип по локусу rs2427837 - GG. Сочетание аллелей ТТ (rs2251746) и GG (rs2427837) позволяет отнести пациента в группу с высоким риском развития заболеваний, связанных с высоким уровнем сывороточного IgE. Полученные результаты были подтверждены секвенированием.Venous blood was taken from patient N9, and genotyping of DNA markers revealed that the patient’s genotype at the rs2251746 locus is TT, and the locus at the rs2427837 locus is GG. The combination of TT alleles (rs2251746) and GG (rs2427837) allows the patient to be assigned to a group with a high risk of developing diseases associated with high levels of serum IgE. The results were confirmed by sequencing.
Разработанный нами метод обладает следующими преимуществами:The method developed by us has the following advantages:
1. Позволяет охватить широкий спектр IgE зависимых заболеваний,1. Allows you to cover a wide range of IgE dependent diseases,
2. Является точным, простым, быстрым и недорогим в исполнении,2. It is accurate, simple, fast and inexpensive to execute,
3. Не требует медицинских знаний, сбора анамнеза или присутствия пациента,3. Does not require medical knowledge, medical history or the presence of the patient,
4. Может быть проведен с использованием различных видов биологического материала, содержащих ДНК пациента (венозная кровь, буккальный эпителий, волосяные фолликулы и др.),4. Can be carried out using various types of biological material containing the patient’s DNA (venous blood, buccal epithelium, hair follicles, etc.),
5. Может использоваться для любой группы населения,5. Can be used for any population
6. Позволяет оценить вероятность передачи данного признака потомкам,6. Allows you to evaluate the likelihood of passing this trait to descendants
7. Результат исследования не зависит от образа жизни и состояния здоровья пациента.7. The result of the study does not depend on the lifestyle and health status of the patient.
Применение данного способа позволит формировать на доклиническом этапе группы риска по развитию заболеваний, связанных с уровнем сывороточного IgE и своевременно реализовывать в этих группах необходимые лечебно-профилактические мероприятия по предупреждению развития этих заболеваний.The use of this method will allow to form at the preclinical stage risk groups for the development of diseases associated with the level of serum IgE and timely implement in these groups the necessary therapeutic and preventive measures to prevent the development of these diseases.
Список литературы:List of references:
1. Amarasekera М. "Immunoglobulin Е in health and disease". Asia Рас Allergy. 2011;1(1):12-151. Amarasekera M. "Immunoglobulin E in health and disease". Asia Ras Allergy. 2011; 1 (1): 12-15
2. Galli SJ, Tsai M. "IgE and mast cells in allergic disease". Nat Med. 2012;18(5):693-704.2. Galli SJ, Tsai M. "IgE and mast cells in allergic disease". Nat Med. 2012; 18 (5): 693-704.
3. Weidinger S. et al. "Genome-wide scan on total serum IgE levels identifies FCER1A as novel susceptibility locus". PLoS Genet. 2008 Aug;4(8):el000166.3. Weidinger S. et al. "Genome-wide scan on total serum IgE levels identifies FCER1A as novel susceptibility locus." PLoS Genet. 2008 Aug; 4 (8): el000166.
4. https://www.ncbi.nlm.nih.gov/variation/tools/1000genomes/4. https://www.ncbi.nlm.nih.gov/variation/tools/1000genomes/
5. Satwani H, Rehman A, Ashraf S, Hassan A. "Is serum total IgE levels a good predictor of allergies in children?" J Pak Med Assoc. 2009 Oct;59(10):698-7025. Satwani H, Rehman A, Ashraf S, Hassan A. "Is serum total IgE levels a good predictor of allergies in children?" J Pak Med Assoc. 2009 Oct; 59 (10): 698-702
6. 
7. Kessel A, Helou W, Bamberger E, Sabo E, Nusem D, Panassof J, Toubi E. Elevated serum total IgE-a potential marker for severe chronic urticaria. Int Arch Allergy Immunol. 2010;153:288-2937. Kessel A, Helou W, Bamberger E, Sabo E, Nusem D, Panassof J, Toubi E. Elevated serum total IgE-a potential marker for severe chronic urticaria. Int Arch Allergy Immunol. 2010; 153: 288-293
8. 
9. Sudha S Deo et al. "Relationship of Total IgE, Specific IgE, Skin Test Reactivity and Eosinophils in Indian Patients with Allergy". JIACM 2010; 11(4): 265-719. Sudha S Deo et al. "Relationship of Total IgE, Specific IgE, Skin Test Reactivity and Eosinophils in Indian Patients with Allergy." JIACM 2010; 11 (4): 265-71
10. Akikatsu K., Tetsuo K. "The Clinical Significance of Serum IgE in Allergic Rhinitis". Auris Nasus Larynx, Volume 1, Issue 1, 1974, Pages 43-51, ISSN 0385-814610. Akikatsu K., Tetsuo K. "The Clinical Significance of Serum IgE in Allergic Rhinitis." Auris Nasus Larynx,
11. Miguel A. Sanjuan, Divya Sagar, Roland Kolbeck. "Role of IgE in autoimmunity". Journal of Allergy and Clinical Immunology vol. 137, 6. 2016:1651-166111. Miguel A. Sanjuan, Divya Sagar, Roland Kolbeck. "Role of IgE in autoimmunity." Journal of Allergy and Clinical Immunology vol. 137.6.2016: 1651-1661
12. Mukai, Kaori et al. "IgE and mast cells in host defense against parasites and venoms." Seminars in immunopathology vol. 38,5 (2016): 581-60312. Mukai, Kaori et al. "IgE and mast cells in host defense against parasites and venoms." Seminars in immunopathology vol. 38.5 (2016): 581-603
13. Marichal, Thomas et al. "A beneficial role for immunoglobulin E in host defense against honeybee venom." Immunity vol. 39,5 (2013): 963-7513. Marichal, Thomas et al. "A beneficial role for immunoglobulin E in host defense against honeybee venom." Immunity vol. 39.5 (2013): 963-75
14. Tsai, Mindy et al. "Testing the 'toxin hypothesis of allergy': mast cells, IgE, and innate and acquired immune responses to venoms." Current opinion in immunology vol. 36 (2015): 80-7. doi:10.1016/j.coi.2015.07.00114. Tsai, Mindy et al. "Testing the 'toxin hypothesis of allergy': mast cells, IgE, and innate and acquired immune responses to venoms." Current opinion in immunology vol. 36 (2015): 80-7. doi: 10.1016 / j.coi.2015.07.07.001
15. Sanger F. "Determination of nucleotide sequences in DNA". Biosci Rep. - 2004. - V. 24(4-5). - P.237-25315. Sanger F. "Determination of nucleotide sequences in DNA". Biosci Rep. - 2004 .-- V. 24 (4-5). - P.237-253
16. Zhou J. et al. "Association of polymorphisms in the promoter region of FCER1A gene with atopic dermatitis, chronic uticaria, asthma, and serum immunoglobulin E levels in a Han Chinese population." PLoS Genet. 2008 Aug;4(8):el00016616. Zhou J. et al. "Association of polymorphisms in the promoter region of FCER1A gene with atopic dermatitis, chronic uticaria, asthma, and serum immunoglobulin E levels in a Han Chinese population." PLoS Genet. 2008 Aug; 4 (8): el000166
17. Chen CM et al. "Common variants in FCER1A influence total serum IgE levels from cord blood up to six years of life." Allergy. 2009 Sep;64(9): 1327-32.17. Chen CM et al. "Common variants in FCER1A influence total serum IgE levels from cord blood up to six years of life." Allergy. 2009 Sep; 64 (9): 1327-32.
18. Hindorff LA et al. "Potential etiologic and functional implications of genome-wide association loci for human diseases and traits." Proc Natl Acad Sci USA. 2009 Jun 9;106(23):9362-718. Hindorff LA et al. "Potential etiologic and functional implications of genome-wide association loci for human diseases and traits." Proc Natl Acad Sci USA. 2009 Jun 9; 106 (23): 9362-7
19. Niwa Y et al. "FcepsilonRIalpha gene (FCER1A) promoter polymorphisms and total serum IgE levels in Japanese atopic dermatitis patients." Int J Immunogenet. 2010 Apr;37(2): 139-4119. Niwa Y et al. "FcepsilonRIalpha gene (FCER1A) promoter polymorphisms and total serum IgE levels in Japanese atopic dermatitis patients." Int J Immunogenet. 2010 Apr; 37 (2): 139-41
20. Nica AC et al. "Candidate causal regulatory effects by integration of expression QTLs with complex trait genetic associations." PLoS Genet. 2010 Apr 1;6(4):e1 00089520. Nica AC et al. "Candidate causal regulatory effects by integration of expression QTLs with complex trait genetic associations." PLoS Genet. 2010
21. Potaczek DP et al. "Different FCER1A polymorphisms influence IgE levels in asthmatics and non-asthmatics." Pediatr Allergy Immunol. 2013 Aug; 24(5):441-9.21. Potaczek DP et al. "Different FCER1A polymorphisms influence IgE levels in asthmatics and non-asthmatics." Pediatr Allergy Immunol. 2013 Aug; 24 (5): 441-9.
22. Hsieh CW et al. "A disease marker for aspirin-induced chronic urticaria." Int J Mol Sci. 2014 Jul 15;15(7):12591-60322. Hsieh CW et al. "A disease marker for aspirin-induced chronic urticaria." Int J Mol Sci. 2014 Jul 15; 15 (7): 12591-603
23. Liao EC et al. "An Exploratory Pilot Study of Genetic Marker for IgE-Mediated Allergic Diseases with Expressions of FcsRla and Ce." Int J Mol Sci. 2015 Apr27; 16(5):9504-1923. Liao EC et al. "An Exploratory Pilot Study of Genetic Marker for IgE-Mediated Allergic Diseases with Expressions of FcsRla and Ce." Int J Mol Sci. 2015 Apr27; 16 (5): 9504-19
24. Amo G et al. "FCERI and Histamine Metabolism Gene Variability in Selective Responders to NSAIDS." Front Pharmacol. 2016 Sep 29;7:353. eCollection 201624. Amo G et al. "FCERI and Histamine Metabolism Gene Variability in Selective Responders to NSAIDS." Front Pharmacol. 2016 Sep 29; 7: 353. eCollection 2016
25. Dar SA et al. "FcεR1α gene polymorphism shows association with high IgE and anti- FcεR1α in Chronic Rhinosinusitis with Nasal Polyposis." J Cell Biochem. 2018 May;119(5):4142-414925. Dar SA et al. "FcεR1α gene polymorphism shows association with high IgE and anti- FcεR1α in Chronic Rhinosinusitis with Nasal Polyposis." J Cell Biochem. 2018 May; 119 (5): 4142-4149
26. Sharma V et al. "A role of FCER1 A and FCER2 polymorphisms in IgE regulation." Allergy. 2014 Feb; 69(2):231-626. Sharma V et al. "A role of FCER1 A and FCER2 polymorphisms in IgE regulation." Allergy. 2014 Feb; 69 (2): 231-6
27. RU 2275863 C1, 10.05.2006. Углева Елена Михайловна (RU), Способ прогнозирования риска возникновения бронхиальной астмы, МПК А61В 10/00, Бюл. №13, 10.05.200627. RU 2275863 C1, 05/10/2006. Ugleva Elena Mikhailovna (RU), A method for predicting the risk of bronchial asthma, IPC А61В 10/00, Bull. No.13, 05/10/2006
28. RU 2548140 C, Бережанский Павел Вячеславович (RU), Мельникова Ирина Михайловна (RU), Мизерницкий Юрий Леонидович (RU), Способ прогнозирования формирования бронхиальной астмы у детей раннего возраста, перенесших острый обструктивный бронхит, МПК А61В 5/00, Бюл. №10, 10.04.201528. RU 2548140 C, Berezhansky Pavel Vyacheslavovich (RU), Melnikova Irina Mikhailovna (RU), Misernitsky Yuri Leonidovich (RU), A method for predicting the formation of bronchial asthma in young children who have experienced acute obstructive bronchitis, IPC A61B 5/00, Bull. No.10, 04/10/2015
29. RU 330291 C1, 26.02.2004, Терещенко Сергей Юрьевич (RU) Васильева Людмила Викторовна (RU) Исаков Игорь Викторович (RU) Новицкий Иван Александрович (RU) Ольховский Игорь Алексеевич (RU) Шакина Наталья Александровна (RU) Прохоренко Виктор Иванович (RU), Способ прогнозирования развития атопического дерматита у новорожденных, МПК G01N 33/53, Бюл. №21, 27.07.200829. RU 330291 C1, 02.26.2004, Tereshchenko Sergey Yurievich (RU) Vasilieva Lyudmila Viktorovna (RU) Isakov Igor Viktorovich (RU) Novitsky Ivan Alexandrovich (RU) Olkhovsky Igor Alekseevich (RU) Shakina Natalya Aleksandrovna (RU) Prokhorenko Viktor Ivanovich ( RU), A method for predicting the development of atopic dermatitis in newborns, IPC G01N 33/53, Bull. No.21, 07/27/2008
30. RU2568738C, 16.09.2014, Левашева Светлана Владимировна (RU), Эткина Эсфирь Исааковна (RU), Фазылова Алла Аркадьевна (RU), Сакаева Гульнара Дабировна (RU), Бабенкова Любовь Иосифовна (RU), Орлова Наталья Анатольевна (RU), Способ прогнозирования формирования атопического дерматита у детей, МПК А61В 5/00; А61В 10/00, Бюл. №32, 20.11.201530. RU2568738C, September 16, 2014, Levasheva Svetlana Vladimirovna (RU), Etkina Esfir Isaakovna (RU), Fazylova Alla Arkadyevna (RU), Sakaeva Gulnara Dabirovna (RU), Babenkova Lyubov Iosifovna (RU), Orlova Natalya Anatolyevna (RU) A method for predicting the formation of atopic dermatitis in children, IPC A61B 5/00; A61B 10/00, Bull. No 32, 11/20/2015
31. RU2187817C2, 15.05.2000, Погомий Н.Н., Святкина О.Б., Пампура А.Н., Чебуркин А.А., Морозова О.В., Окунева Т.С., Способ прогнозирования развития аллергических реакций у детей раннего возраста, МПК G01N 33/53, 20.08.200231. RU2187817C2, 05.15.2000, Pogomiy NN, Svyatkina OB, Pampura AN, Cheburkin AA, Morozova OV, Okuneva TS, A method for predicting the development of allergic reactions in young children, IPC G01N 33/53, 08/20/2002
32. US 5538848 A, Kenneth J. Livak, Susan J., A. Flood, Jeffrey Marmaro, Method for detecting nucleic acid amplification using self-quenching fluorescence probe, 23.07.199632. US 5538848 A, Kenneth J. Livak, Susan J., A. Flood, Jeffrey Marmaro, Method for detecting nucleic acid amplification using self-quenching fluorescence probe, 07.23.1996
Claims (12)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2019120964A RU2723390C1 (en) | 2019-07-04 | 2019-07-04 | Method for prediction of risk of developing diseases associated with level of immunoglobulin e (ige) in human blood serum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2019120964A RU2723390C1 (en) | 2019-07-04 | 2019-07-04 | Method for prediction of risk of developing diseases associated with level of immunoglobulin e (ige) in human blood serum |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2723390C1 true RU2723390C1 (en) | 2020-06-11 |
Family
ID=71095791
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2019120964A RU2723390C1 (en) | 2019-07-04 | 2019-07-04 | Method for prediction of risk of developing diseases associated with level of immunoglobulin e (ige) in human blood serum |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2723390C1 (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5538848A (en) * | 1994-11-16 | 1996-07-23 | Applied Biosystems Division, Perkin-Elmer Corp. | Method for detecting nucleic acid amplification using self-quenching fluorescence probe |
| RU2330291C1 (en) * | 2007-02-26 | 2008-07-27 | ГУ Научно-исследовательский институт медицинских проблем Севера СО РАМН | Method of newborns atopic dermatitis forecasting |
-
2019
- 2019-07-04 RU RU2019120964A patent/RU2723390C1/en active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5538848A (en) * | 1994-11-16 | 1996-07-23 | Applied Biosystems Division, Perkin-Elmer Corp. | Method for detecting nucleic acid amplification using self-quenching fluorescence probe |
| RU2330291C1 (en) * | 2007-02-26 | 2008-07-27 | ГУ Научно-исследовательский институт медицинских проблем Севера СО РАМН | Method of newborns atopic dermatitis forecasting |
Non-Patent Citations (2)
| Title |
|---|
| WEIDINGER S. et al. Genome-wide scan on total serum IgE levels identifies FCER1A as novel susceptibility locus. PLoS Genet. 2008 Aug; 4(8): e1000166. * |
| ZHOU J. et al. Association of polymorphisms in the promoter region of FCER1A gene with atopic dermatitis, chronic uticaria, asthma, and serum immunoglobulin E levels in a Han Chinese population. Hum Immunol. 2012 Mar; 73(3): 301-5. * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Choufani et al. | DNA methylation signature for EZH2 functionally classifies sequence variants in three PRC2 complex genes | |
| Ram et al. | Systematic evaluation of genes and genetic variants associated with type 1 diabetes susceptibility | |
| Schönfelder et al. | The influence of IFITM3 polymorphisms on susceptibility to SARS-CoV-2 infection and severity of COVID-19 | |
| Munthe-Kaas et al. | CD14 polymorphisms and serum CD14 levels through childhood: a role for gene methylation? | |
| US20150225788A1 (en) | Risk assessment for phenytoin-induced adverse drug reactions | |
| Sharp et al. | Role of PTPN2/22 polymorphisms in pathophysiology of Crohn’s disease | |
| Teruel et al. | Integrative epigenomics in Sjögren´ s syndrome reveals novel pathways and a strong interaction between the HLA, autoantibodies and the interferon signature | |
| Kothari et al. | Role of local CpG DNA methylation in mediating the 17q21 asthma susceptibility gasdermin B (GSDMB)/ORMDL sphingolipid biosynthesis regulator 3 (ORMDL3) expression quantitative trait locus | |
| Indhumathi et al. | Investigation of association of the IL-12B and IL-23R genetic variations with psoriatic risk in a South Indian Tamil cohort | |
| Borte et al. | Combined newborn screening for familial hemophagocytic lymphohistiocytosis and severe T-and B-cell immunodeficiencies | |
| JP5899527B2 (en) | Method for examining drug eruption risk with antiepileptic drugs based on single nucleotide polymorphism of chromosome 13 short arm 21.33 region | |
| Yang et al. | Prevalence of hyperuricemia among the Chinese population of the southeast coastal region and association with single nucleotide polymorphisms in urate‑anion exchanger genes: SLC22A12, ABCG2 and SLC2A9 | |
| Zhou et al. | The-137G/C single nucleotide polymorphism in IL-18 gene promoter contributes to tuberculosis susceptibility in Chinese Han population | |
| Chang et al. | Different genetic associations of the IgE production among fetus, infancy and childhood | |
| RU2723390C1 (en) | Method for prediction of risk of developing diseases associated with level of immunoglobulin e (ige) in human blood serum | |
| US20240011075A1 (en) | Immune profiling using small volume blood samples | |
| Saeed et al. | Amplification of Brugia malayi DNA using Hha1 Primer as a Tool | |
| Ammar et al. | Failure to find evidence for deletion of LCE3C and LCE3B genes at PSORS4 contributing to psoriasis susceptibility in Tunisian families | |
| TWI351436B (en) | Method for detecting a risk of the development of | |
| Bae et al. | Meta-analysis of gene expression profiles of peripheral blood cells in systemic lupus erythematosus | |
| JP5895317B2 (en) | Method for examining bone / joint disease based on single nucleotide polymorphism of chromosome 10 long arm 24 region | |
| Yaa et al. | Toll-like receptor 4 polymorphisms and risk of gram-negative bacteremia after allogeneic stem cell transplantation. A prospective pilot study | |
| AU2016281193A1 (en) | Method of measuring chimerism | |
| CN101135667B (en) | Reagent kit for detecting elevated plain pneumochysis susceptibility based on mitochondria DNA G3010A mononucleotide polymorphism | |
| Timasheva et al. | Association between allelic variants of IL2, IL2RA, and IL7R genes and multiple sclerosis |