RU2721123C1 - Recombinant pseudo-adenoviral particle strain expressing the chlamydia trachomatis chimeric gene mbl-ct666, a method for preparing it, an immunogenic composition for protection against human urogenital chlamydiosis - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology and concerns a strain of recombinant pseudo adenoviral particle expressing a chimeric gene MBL-CT666 Chlamydia trachomatis after its introduction into an individual's body. A recombinant pseudo adenoviral particle strain expressing the chimeric gene MBL-CT666 Chlamydia trachomatis is obtained, which contains the nucleotide sequence SEQ ID NO: 1 chimeric gene MBL-CT666 Chlamydia trachomatis, which after introduction into an individual's body produces a chimeric protein MBL-CT666 Chlamydia trachomatis in the form of the amino acid sequence SEQ ID NO: 2, inducing protection against human urogenital chlamydiosis. Method of obtaining a strain of recombinant pseudo adenoviral particle expressing chimeric gene MBL-CT666 Chlamydia trachomatis consists in that strain is obtained by homologous recombination in E. coli strain BJ5183 between plasmid pShuttle-CMV (#240007, pShuttle-CMV vector, Agilent, US), carrying cassette with chimeric gene MBL-CT666 Chlamydia trachomatis, cloned from plasmid pAL2-T, and adenovirus DNA of human serotype 5 with deletion in region E1 and E3 of adenovirus genome, wherein assembly of recombinant pseudo adenoviral nanoparticles is carried out in cells of line HEK293, Human embryonic kidney 293, after transfection of recombinant DNA pAd-MBL-CT666, wherein as a result of construction, the expression cassette comprises a human cytomegalovirus CMV promoter, target gene – chimeric gene MBL-CT666 Chlamydia trachomatis, pA signal of polyadenylation and is in the region of E1 deletion of adenovirus genome, wherein polymerase chain reaction with specific primers is used, obtaining an immunogenic composition containing a recombinant pseudo adenoviral particle strain expressing the chimeric gene MBL-CT666 Chlamydia trachomatis, for use in an amount of not less than 2×10⁸ PFU/ml, wherein it contains a pharmaceutically acceptable buffer solution of up to 0.5–1.0 ml, a dose volume of 0.5–1.0 ml in a flask.

EFFECT: invention enables to apply an immunogenic composition containing a strain of a recombinant pseudo adenoviral particle expressing a chimeric gene MBL-CT666 Chlamydia trachomatis, as a prime component of a chlamydial vaccine for protection against human urogenital chlamydiosis.

4 cl, 11 dwg, 2 tbl, 7 ex

Description

Technical field

The invention relates to biotechnology and medicine, and relates to a strain of a recombinant pseudo-adenoviral particle expressing the chimeric gene MBL-CT666 of Chlamydia trachomatis after its introduction into the body of the subject. The proposed strain of a recombinant pseudo-adenovirus particle expressing the chlamydia trachomatis MBL-CT666 chimeric gene can be used as an immunogenic component for the manufacture of vaccines for the prevention of urogenital chlamydial infection caused by Chlamydia trachomatis .

State of the art

Chlamydia infection is the most common bacterial sexually transmitted infection. According to the World Health Organization, more than 100 million new cases of the disease are diagnosed annually in the world, the incidence continues to grow even in developed countries and amounts to more than 500 cases of the disease per 100 thousand people per year (WHO "Initiative for Vaccine Research (IVR), Sexually Transmitted Diseases. "2012.). In the risk group, 14-25 years old, the incidence reaches 11%. Existing statistics do not reflect the true situation, because up to 90% in women and up to 50% in men, chlamydial infection is asymptomatic. Such cases are not diagnosed, not treated, but contribute to the spread of infection.

Especially severe complications and consequences of chlamydia can cause in women. Thus, the ascending course of infection leads to the development of inflammatory diseases of the pelvic organs, the development of infertility, against the background of inflammation, the risk of pregnancy pathology increases (Haggerty CL et al. Risk of sequelae after Chlamydia trachomatis genital infection in women // J. Infect. Dis. 2010. V. 201. No. 2. P. 134-155; Kisina V.I., Kolieva G.L. Urogenital chlamydia // Gynecology. 2003. V. 5. No. 2. P. 82-86.).

A scientifically based method for the prevention of chlamydia is vaccination. According to published data, when modeling the situation, it was found that effective vaccination would eliminate the chlamydia epidemic within 20 years, and partially effective could reduce the incidence in both men and women. It is also noted that vaccination of only women would be more cost-effective (Gray RT, Beagley KW, Timms P., Wilson DP Modeling the impact of potential vaccines on epidemics of sexually transmitted Chlamydia trachomatis infection // J. Infect. Dis. 2009. No. 199.R. 1680-8.).

To date, not a single commercial vaccine aimed at the prevention and treatment of diseases caused by C. trachomatis has been registered. The difficulties in creating the vaccine are explained by the characteristics of the immune response in chlamydial infections. It is believed that the creation of an effective vaccine against chlamydial infection involves the formation of a response of specific T-helpers of the first type (Th1), which can efficiently reach the pathogen localization sites in tissues and organs, and contribute to the formation of specific systemic and local antibodies [Beagley KW, Timms P. Chlamydia trachomatis infection: incidence, health costs and prospects for vaccine development // J Reprod Immunol. 2000. V. 48. No. 1. P. 47-68.].

Thus, due to the peculiarities of the immunopathogenesis of chlamydial infection and the difficulties that arise because of this, the development of highly effective vaccines, obtaining strains and immunogenic compositions using modern approaches that allow solving the existing problems of creating antichlamydia drugs are an urgent problem.

Currently, the outer membrane protein (MOMP) of C. trachomatis prevails as antichlamydia compositions. MOMP induces a protective cellular and antibody response (Farris, 2010), necessary to eliminate chlamydia. MOMP immunization has been shown to induce a protective response that suppresses infection and pathology in animal studies, including studies in mice, guinea pigs, pigs, koalas and primates (Berry, 2004; Skelding, 2006; Sun, 2009; Andrew, 2011; Cheng , 2011b; Schautteet, 2011; Kollipara, 2012; Schautteet, 2012). It should be noted that, despite its high immunogenicity, MOMP is highly variable depending on the serovar C. trachomatis, which makes it difficult to develop a universal vaccine based on it (Zhang, 1989; Ramsey, 2009; Mossman, 2008).

In addition to MOMP, one of the main vaccine candidates is the highly immunogenic outer membrane protein, OmcB (outer membrane protein B). OmcB C. trachomatis is one of the main adhesins providing specific adhesion of chlamydia to the membrane of a eukaryotic cell (Moelleken, 2008). OmcB is an immunodominant protein and causes a pronounced immune response in both humans and animals. Due to the fact that this protein is well represented in the composition of the cell wall and possesses immunogenic properties, OmcB serves as an effective target for serodiagnosis and is considered as a promising target gene for creating subunit vaccines (Fadel, 2007; Hou, 2012).

Protein CPAF - a protease with proteasome-like activity is also being studied as a vaccine preparation. The use of recombinant CPAF protein in combination with IL-12 as an adjuvant reduced the bacterial load in the genital tract and led to the rapid elimination of C. trachomatis compared to the control group of animals. Moreover, in animals immunized with rCPAF + IL-12, suppression of the development of hydrosalpinx and tubal pathology was observed (Murthy, 2009; Zhong, 2001).

Thus, chlamydial outer membrane proteins and secreted proteins appear to be good candidates for vaccines capable of inducing protective immunity. However, it became apparent that subunit vaccines lack immunogenicity and, as a result, the use of such vaccines implies the need for multiple vaccinations and the use of adjuvants.

Known technical solution according to patent EP2976355A1. The active ingredient of the described antichlamydia vaccine is the recombinant protein CTH522, consisting of segments of the main chlamydial protein of the outer membrane (MOMP), including immunogenic repeats of fragments of amino acid sequences from four C. trachomatis serovars (D, E, F and G). Recombinant protein CTH522 was obtained by genetic engineering methods and for the preparation of the drug is grown using E. coli.

In 2019, data were published on the success of the first phase of clinical trials of the candidate vaccine. (S. Abraham, H. Juel et.al. Safety and immunogenicity of the chlamydia vaccine candidate CTH522 adjuvanted with CAF01 liposomes or aluminum hydroxide: a first-in-human, randomized, double-blind, placebo-controlled, phase 1 trial / / Published online August 12, 2019 http://dx.doi.org/10.1016/S1473-3099(19)30279-8).

This technical solution, described in patent EP2976355A1 and the article, is considered by the authors and the applicant as the closest analogue.

Although the analogue containing the active ingredient CTH522 recombinant protein, according to the results of the studies, it caused the formation of a sufficient antichlamydial immune response and was well tolerated in humans, this technical solution has significant disadvantages:

- the recombinant protein CTH522 as the active substance of the vaccine, required the introduction of an adjuvant, which served either CAF01 or aluminum hydroxide, to strengthen the immune response. The introduction of adjuvants affects the increase in production costs and causes reactogenicity at the site of intramuscular injection;

- to create a tense immunity to C. trachomatis, a vaccine containing recombinant CTH522 protein as an active substance is administered to people a total of 5 times - first, administration is carried out three times by intramuscular injection, after which two intranasal administration of the drug without adjuvant is carried out. The proposed scheme is very complex, lengthy and time-consuming to practical implementation;

- the need to maintain the native conformation of the MOMP antigen in the composition of the vaccine creates significant technological difficulties and makes the production process of such a vaccine unnecessarily expensive (Sun, 2009; Schautteet, 2012).

In addition, this antigen is variable, which also significantly limits the effectiveness of the immune response against various serotypes of C. trachomatis (Zhang YX et al. Protective monoclonal antibodies to Chlamydia trachomatis serovar- and serogroup-specific major outer membrane protein determinants. // Infect Immun. 1989.V. 57. No. 2. P. 636-8; Ramsey, 2009; Mossman D. et al. Genotyping of urogenital Chlamydia trachomatis in Regional New South Wales, Australia. Sex Transm Dis. 2008. 35: 614 -616).

Disclosure of invention

The objective of the present invention is directed to obtaining the active substance of an immunogenic composition against human urogenital chlamydia - a strain of a recombinant pseudo-adenovirus particle, which can be used to create an immunogenic composition without the use of adjuvants, effective for a single administration as a priming component of an antichlamydia vaccine to a person, due to the fact that the antigen it is produced directly in the cells of the human body and has a wide spectrum of action in relation to various serotypes of C. Trachomatis.

The technical result is achieved due to the fact that a strain of a recombinant pseudo-adenovirus particle is obtained that expresses the chlamydia trachomatis MBL-CT666 chimeric gene, which contains the nucleotide sequence SEQ ID NO: 1 of the Chlamydia trachomatis MBL-CT666 chimeric gene, which, after introduction into the subject, is produced Chlamydia trachomatis chimeric protein MBL-CT666 in the form of the amino acid sequence of SEQ ID NO: 2, which induces protection against human urogenital chlamydia.

A method for producing a recombinant pseudo-adenovirus particle strain expressing the chlamydia trachomatis MBL-CT666 chimeric gene is that the strain is obtained by homologous recombination in E. coli cells of strain BJ5183 between pShuttle-CMV plasmid (# 240007, pShuttle-CMV vector, Agilent, US, Agilent, US, carrying a cassette with the chlamydia trachomatis MBL-CT666 chimeric gene , cloned from the pAL2-T plasmid and human adenovirus 5 serotype DNA with a deletion in the E1 and E3 regions of the adenovirus genome, and recombinant pseudo-adenovirus nanoparticles were assembled in HEK293, Human embryo cells after transfection with recombinant pAd-MBL-CT666 DNA, the expression cassette contains the CMV promoter of human cytomegalovirus, the target gene is the chlamydia trachomatis MBL-CT666 chimeric gene, the pA polyadenylation signal is located in the E1 deletion region of the adenovirus genome, use a polymerase chain reaction with specific primers:

on adenovirus hexon:

ADH01 ACTACAAYATTGGCTACCAGG;

ADH02 CAAAACATAAAGAAGKGTGGGC.

for the chimeric gene MBL-CT666 of Chlamydia trachomatis:

CT666-For CAAGGACTGAGAGGCTTGCA;

CT666-Rev TCTCGGTGTTCACAGCTGTC.

An immunogenic composition is obtained containing a recombinant pseudo-adenovirus particle strain expressing the chimeric gene MBL-CT666Chlamydia trachomatisfor application in an amount of at least 2 × 10⁸-BOU / ml, while it contains a pharmaceutically acceptable buffer solution up to 0.5-1.0 ml, the dose volume is 0.5-1.0 ml in a bottle.

The use of an immunogenic composition containing a recombinant pseudo-adenovirus particle strain expressing the chlamydia trachomatis po MBL-CT666 chimeric gene as a prime component of the chlamydia vaccine to protect against human urogenital chlamydia is claimed.

Description of figures

In the figure 1

presents the nucleotide sequence of the chimeric gene MBL-CT666 Chlamydia trachomatis with a length of 717 bp (base pairs), modified for enhanced expression in human cells, designated SEQ ID NO: 1.

In figure 2

The amino acid sequence of the chlamydia trachomatis MBL-CT666 chimeric gene is shown as SEQ ID NO: 2.

In figure 3

со вставкой экспрессионной кассеты, несущей химерный ген MBL-CT666 Chlamydia trachomatis в месте делеции гена Е1 (ΔE1). ΔE3 - удаленный ген E3.The scheme of a recombinant pseudo-adenovirus particle strain based on the human adenovirus genome 5 serotype is shown, which carries the chimeric gene MBL-CT666Chlamydia trachomatis,derived from human adenovirus genome 5 serotype

 with insertion of an expression cassette carrying the chimeric gene MBL-CT666Chlamydia trachomatis at the deletion site of the E1 gene (ΔE1). ΔE3 is the deleted E3 gene.

Expression cassette contains:

CMV promoter of human cytomegalovirus,

PA signal polyadenylation,

C. trachomatis gene (CT666),

Glycine - Serine Spacer

Mus musculus mannose-binding lectin gene (MBL).

In figure 4

The results of determining the authenticity of the created strain of a recombinant pseudo-adenoviral particle based on the genotype 5 human adenovirus genome carrying the chimeric gene MBL-CT666 Chlamydia trachomatis by PCR are presented. On the tracks of the polyacrylamide gel are shown: PCR for the adenovirus genome (adenovirus hexon): 1 - negative control; 2 - positive control; 3 is a sample of a preparation of a recombinant pseudo-adenovirus particle strain based on the human adenovirus genome 5 serotype, carrying the chlamydia trachomatis MBL-CT666 chimeric gene. PCR for the chimeric gene (MBL-CT666): 5 - negative control; 6 - positive control; 7 is a sample of a preparation of a recombinant pseudo-adenovirus particle strain based on the human adenovirus genome 5 serotype carrying the chimeric gene MBL-CT666 of Chlamydia trachomatis ; M is a molecular weight marker.

Detection was carried out using a pair of specific primers.

- AdH01 / AdH02 per adenovirus hexon (magnitude of the amplified fragment 440 bp);

- CT666-for / CT666-rev for the chlamydia trachomatis MBL-CT666 chimeric gene (magnitude of the amplified fragment 478 bp).

The presence of the genome of the recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome and the target chimeric gene MBL-CT666 of Chlamydia trachomatis is confirmed by visualization in the form of bands with a molecular weight of 440 bp and 478 bp, respectively. Similar bands are present on the tracks of the positive control and are absent on the tracks of the negative control.

In figure 5

The results of the analysis of the expression of the chimeric Chlamydia trachomatis protein by immunoblotting are presented. The analysis was performed under denaturing conditions in a HEK293 cell culture after infection with a recombinant pseudo-adenovirus particle strain based on the human adenovirus genome 5 serotype carrying the chlamydia trachomatis MBL-CT666 chimeric gene, in reaction with specific antibodies to the Chlamydia trachomatis CdSf protein (antibody specificity 1) binding to a recombinant CdSf protein of Chlamydia trachomatis with a molecular weight of about 10 kDa) . The immunoreplicate contains a zone of specific interaction of proteins with a molecular mass of about 24 kDa with rabbit antibodies on track 2, and there is no binding to a negative control sample on track 3.

On the blot tracks are located:

1 - Positive control - recombinant protein rMBL-CT666 C. trachomatis , standard SOP.

2 - A test sample, HEK293 cells infected with a strain of recombinant pseudo-adenovirus particles based on the human serotype 5 adenovirus genome carrying the Chlamydia trachomatis chimeric gene MBL-CT666, the sample was heated at 100 ° C in the presence of DTT.

3 - Negative control, HEK293 cells uninfected with a recombinant pseudo-adenovirus particle strain based on the genotype 5 human adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene .

The molecular weight marker was protein color markers of molecular weights PageRuler ™ 10-200 kDa (ThermoScientific, USA).

In figure 6

depicts the results of the evaluation of specific IgG antibodies to CdsF antigen on day 14 (A) and day 28 (B) after intranasal immunization of the experimental group of mice with an immunogenic composition containing a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome carrying the chimeric gene MBL-CT666 Chlamydia trachomatis (Ad-MBL-CT666). The controls were groups of mice that were injected with an adenoviral vector without insertion (Ad-null) and physiological saline (OK).

In the figure 7

EIA evaluation of specific IgG antibodies of the IgG2a (A) and IgG1 (B) isotypes against the CdsF (CT666) antigen of C. trachomatis in the blood serum of immunized mice according to the prime boost scheme (Ad-MBL-CT666 + rMBL-CT666 ) Blood serum from a prime boost immunized mice was obtained on day 14 after boosting.

Priming component protivohlamidiynoy vaccine served immunogenic composition comprising a strain of recombinant psevdoadenovirusnyh based particles of human adenovirus 5 genome serotype bearing chimeric gene MBL-CT666 Chlamydia trachomatis (Ad- MBL-CT666), bustiruyuschim - recombinant protein rMBL-CT666 Chlamydia trachomatis with MPLA (monophosphoryl lipid A, monophosphoryl lipid A) . The controls were groups of mice that were injected with an adenoviral vector without insertion (Ad-null) and physiological saline (OK).

In figure 8

The results of determining the number of T-lymphocytes producing IFγ by ELISPOT in vitro are shown.

The first group of mice was injected with the priming component of the anti-chlamydia vaccine, which was an immunogenic composition containing a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome containing the Chlamydia trachomatis chimeric gene MBL-CT666 , and the recombinant protein rMBL-CTLch666 chasting component of the chlamydia trachomatis . The controls were groups of mice that were injected with an adenoviral vector without insertion (Ad-null) and physiological saline (OK). Three options for setting up the experiment are presented: without stimulation with antigen, with stimulation with the recombinant CdsF protein and with stimulation of Chlamydia trachomatis .

In figure 9

presents the results of evaluating the proliferation of T cells obtained from mice vaccinated according to the “prime boost” scheme in response to stimulation with the CdsF or C. trachomatis antigen.

A - Proliferation of Ag-specific CD4 + T cells in response to CdsF;

B - Proliferation of Ag-specific CD4 + T cells in response to C. trachomatis;

B - Proliferation of Ag-specific CD8 + T cells in response to CdsF;

D - Proliferation of Ag-specific CD8 + T cells in response to C. Trachomatis.

In figure 10

displayed pathological changes in the uterus and ovaries, evaluated by direct visualization. Introduced substances to groups of mice:

A. Ad-MBL-CT666 + rMBL-CT666 (the priming component of the anti-chlamydia vaccine, which was an immunogenic composition containing a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome, carrying the Chlamydia trachomatis chimeric gene MBL-CT666, the recombinant protein recombin MBL recombin -CT666 Chlamydia trachomatis with MPLA);

B. Ad-null (negative control)

B. C. trachomatis (positive control).

In figure 11

The results of evaluating the suppression of chlamydial infection in the lower parts of the urogenital tract after infection with C. trachomatis are presented. A. on day 3 (* p ≤ 0.05); B. on day 6 (* p ≤ 0.05); B. on day 9 (* p ≤ 0.001); G. on day 15 (* p ≤ 0.001); D. on day 20 (* p ≤ 0.001).

The implementation of the invention.

A promising antigen for antichlamydia vaccines is the structural protein CdsF (CT666) of the third type secretion system (CCT) of Chlamydia trachomatis , which is the dominant pathogenicity factor. Being the main injectosome protein of the third chlamydial transport system, CdsF protein concentrates on the outer membrane of chlamydial elementary bodies (ETs) and reticular bodies (PTs) and forms a surface structure, designated as a “needle” (Dai W., Li Z. Conserved type III secretion system exerts important roles in Chlamydia trachomatis // Int J Clin Exp Pathol. 2014. Vol. 7 (9). P. 5404-5414.). During contact with a eukaryotic cell, the CdsF protein polymerizes and, as a result, the injection (assembly) of the injectosome. The formation of an immune response against this key component of CCT chlamydia seems extremely promising. Being a structural protein of CCTT, CdsF is expressed on the chlamydial membrane at all stages of the development of the pathogen, including both in acute and chronic infections. In addition, the CdsF CCTT “needle” chlamydial protein contains cysteine residues that are unique to the CCTT “needle” proteins (Betts HJ et al. Bioinformatic and biochemical evidence for the identification of the type III secretion system needle protein of Chlamydia trachomatis // J Bacteriol. 2008. V. 190, P. 1680-1690). Disulfide bonds in the polymerized “needle” of CCTT are associated with the oxidation state of the chlamydial membrane and the stages of pathogen development (Betts HJ and Fields KA The Chlamydial Type III Secretion Mechanism: Reveiling Cracks in a Tough Nut // Front Microbiol. 2010. V. 1. P. 114). Disulfide bonds found in CdsF localized in elementary bodies (ETs) are involved in the functioning of the chlamydial secretory apparatus.

Due to the conservatism of the structures of the CCT system in all representatives of the genus Chlamydia, the CdsF protein introduced as a vaccine antigen or immunogenic composition will induce broad-spectrum immunity (Zigangirova N.A., Zayakin E.S. et al. Development of inhibitors of type secretion system III C. trachomatis, inhibiting the development of acute and chronic chlamydial infection // Acta naturae, T.4, No. 2 (13), 2012, pp. 90-100).

The combination of these data makes the CdsF protein (CT666 Chlamydia trachomatis ) conditionally used as an antigen for immunogenic compositions against urogenital chlamydia.

Since antigens with the greatest protective potential are not always highly immunogenic, the development of effective and safe delivery systems that are permitted in clinical practice is an extremely urgent task.

Viral vectors are a promising approach to developing effective and safe delivery systems. Of these, the most widely used and studied are adenoviruses. Vaccines based on such vectors are currently undergoing or are undergoing clinical trials.

The use of adenoviral vectors as a platform for creating vaccines and immunogenic compositions against chlamydial infection is due to the fact that immunization with such drugs effectively activate cytotoxic T-lymphocytes, which is especially important when vaccinating against intracellular pathogens. In addition, their feature is the ability to deliver antigen through the mucous membranes, which is significant against sexually transmitted infections (STIs). [Schagena F.H.E. et al. Immune responses against adenoviral vectors and their transgene products: a review of strategies for evasion, Critical Reviews. // Oncology / Hematology. 2004. V. 50. No. 1. P. 51-70. ]

They have several advantages. Recombinant adenoviral vectors are replicatively defective and not capable of causing disease. The safety of human adenoviruses of the fifth serotype with deleted E1 and E3 regions of the genome is confirmed by clinical trials of various vaccine and therapeutic drugs based on them. They do not require multiple additional introductions, since the expression of the target antigen occurs directly in the body of the immunized subject. It is also important for urogenital chlamydia that the intranasal immunization with recombinant adenovirus vectors induces the formation of a mucosal immune response, including on the mucous membranes of the genital tract.

Recombinant adenoviral vectors, compared with recombinant proteins obtained in eukaryotic culture, are cheaper and highly immunogenic, since their small dose allows significant amounts of protein to be produced in the body. Fast and flexible technologies for the production of recombinant adenoviral vectors have been developed, which allow the large-scale production of various candidate vaccines based on them to be implemented on one technological line.

Examples of the claimed invention

Examples are provided to illustrate the present invention in more detail and do not limit the scope of the invention:

Example 1

The creation of the chimeric gene MBL-CT666 Chlamydia trachomatis .

Example 2

Construction of a strain of a recombinant pseudo-adenovirus particle expressing the chlamydia trachomatis MBL-CT666 chimeric gene .

Example 3

The study of the expression of the chlamydia trachomatis MBL-CT666 chimeric gene of the recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene.

Example 4

Obtaining an immunogenic composition containing a strain of a recombinant pseudo-adenovirus particle based on the genotype 5 human adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene.

Example 5

Study of the immunogenic properties of a recombinant pseudo-adenovirus particle strain based on the genotype 5 human adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene.

Example 6

Immunogenic properties of the urogenital chlamydia vaccine containing the recombinant pseudo-adenovirus particle strain based on the human adenovirus genome 5 serotype, carrying the chlamydia trachomatis MBL-CT666 chimeric gene as a prime component.

Example 7

The protective properties of the urogenital chlamydia vaccine containing a recombinant pseudo-adenovirus particle strain based on the genotype 5 human adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene as a prime component.

Example 1

The creation of the chimeric gene MBL-CT666 Chlamydia trachomatis

This example describes the process of obtaining the chlamydia trachomatis MBL-CT666 chimeric gene by the in silico method, which is necessary for further incorporation into the recombinant pseudo-adenovirus particle as a target antigen capable of inducing specific humoral and cellular immunity to Chlamydia trachomatis when introduced into the body.

For this, a unique sequence of the chimeric gene MBL-CT666 of Chlamydia trachomatis SEQ ID NO: 1 , consisting of several parts, was developed in silico :

1) Bsu15I site (ATCGAT) and methylated XbaI (TCTAGA);

2) 133 N-terminal amino acids of mannose binding lectin (MBL) (amino acid sequence No. P11226 taken from the UniProtKB open protein sequence database, nucleotide — NCBI ID CAA33462.1). This collagen domain oligomerizes (octagons of six trimeric subunits) an antigen to enhance the immunogenic properties of the Chlamydia trachomatis chimeric protein, and also helps to secrete it from the cell.

3) Spacer (flexible glycine-serine). Serves to separate the two functional domains and, therefore, the correct folding of the protein.

4) BcuI restriction site (ACTAGT);

5) Actually CT666 antigen of Chlamydia trachomatis (amino acid sequence according to No. O84673 taken from the UniProtKB open database). The work was carried out with the nucleotide sequence encoding it;

6) Stop - codon - TAA;

7) XbaI restriction site (TCTAGA).

To improve the further expression of the Chlamydia trachomatis MBL-CT666 chimeric gene by recombinant pseudo-adenovirus particles, the nucleotide sequence consisting of 7 parts mentioned above was first taken, the codons of which were modified for enhanced expression in Homo sapiens cells, preserving the BcuI site (ACTAGT).

Thus, as a result of construction, the nucleotide sequence of the chimeric gene MBL-CT666 of Chlamydia trachomatis with a length of 717 bp was obtained. (bp), modified for enhanced expression in human cells, designated SEQ ID NO: 1 (Figure 1). The chlamydia trachomatis MBL-CT666 chimeric protein produced by the recombinant pseudo-adenovirus particle strain has the amino acid sequence of SEQ ID NO: 2 (Figure 2).

Next, the nucleotide sequence of SEQ ID NO: 1 of the modified chlamydia trachomatis MBL-CT666 chimeric gene was chemically synthesized and obtained using the plasmid pAL2-T (Eurogen, RF) and was used to construct the strain.

As a result, the nucleotide sequence of SEQ ID NO: 1 (coding for the amino acid sequence of SEQ ID NO: 2) of the Chlamydia trachomatis MBL-CT666 chimeric gene, which was necessary for incorporation into the recombinant pseudo-adenovirus particle as the target gene, was developed using the in silica method. obtaining the claimed strain of a recombinant pseudo-adenovirus particle based on the human adenovirus genome 5 serotype carrying the chimeric gene MBL-CT666 Chlamydia trachomatis .

Example 2

Construction of a strain of a recombinant pseudo-adenovirus particle expressing the chlamydia trachomatis MBL-CT666 chimeric gene

The example describes the process of constructing a recombinant pseudo-adenovirus particle (RPAN), with the insertion of the chlamydia trachomatis MBL-CT666 chimeric gene in the region of the E1 deletion of the human adenovirus genome 5 serotype.

A quantitative assessment (titer) of recombinant pseudo-adenovirus particles obtained in the work was determined by plaque formation on the 293-HEK cell line (human embryo kidney cells, human embryo kidney), titer was assessed by PFU (plaque-forming units).

The process of obtaining a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome carrying the chimeric gene MBL-CT666 of Chlamydia trachomatis consisted of several main steps, the essence of which is known to the person skilled in the art, based on well-known techniques (e.g., Sambrook J. et al., Molecular cloning: a laboratory manual, 3rd ed., Russell, 2001, volume 1, 2, 3 — Molecular cloning — a laboratory manual) and therefore is not considered in detail in this example, pointing only to the most basic steps.

The strain was obtained by homologous recombination in E. coli cells of strain BJ5183 (e.g., # 200154, Skygen, RF) between the pShuttle-CMV plasmid (# 240007 (pShuttle-CMV vector, Agilent, US) carrying the Chlamydia chimeric gene MBL-CT666 trachomatis (cloned from pAL2-T plasmid) and human adenovirus DNA serotype 5 with a deletion in the E1 and E3 regions of the adenovirus genome. Recombinant pseudo-adenovirus nanoparticles were assembled in HEK293 cells (Human embryonic kidney 293) after transfection with recombinant CT-p66-MB MBL DNA DNA-AD66 The transfection was performed with Lipofectamin reagent (Invitrogen, USA) according to the attached manual in a 24-well plate on HEK293 cells with 90% confluency. The scheme of the obtained construct is shown in Figure 3. As a result of construction, the expression cassette contained the human cytomegalovirus CMV promoter, target gene - chimeric gene MBL-CT666 Chlamydia trachomatis , pA signal of polyadenylation and was in the region of deletion E1 ge nome of adenovirus.

Ten days after transfection, the cytopathic effect of the virus was observed. The resulting viral samples, in the form of a suspension of infected cells with a titer of 10 ⁸ PFU / ml, were stored at a temperature of minus 70 ° C in a DMEM cultivation medium (Invitrogen, Cat. No. 52100-047, USA) with 10% fetal bovine serum (Hy Clone Cat. No. SV30160.03, UK). As such, a strain of a recombinant pseudo-adenovirus particle based on the human adenovirus genome 5 serotype carrying the chimeric gene MBL-CT666 of Chlamydia trachomatis was deposited.

The preparation of a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene was confirmed by PCR with specific primers (shown in FIG. 4).

Used a pair of primers for adenovirus hexon:

ADH01 ACTACAAYATTGGCTACCAGG;

ADH02 CAAAACATAAAGAAGKGTGGGC.

A pair of primers for the chimeric gene MBL-CT666 Chlamydia trachomatis:

CT666-For CAAGGACTGAGAGGCTTGCA;

CT666-Rev TCTCGGTGTTCACAGCTGTC.

The resulting strain of a recombinant pseudo-adenovirus particle based on the human adenovirus genome 5 serotype carrying the chimeric gene MBL-CT666 Chlamydia trachomatis (Ad-MBL-CT666) is registered in the State collection of microorganisms at the Federal State Budgetary Institution Scientific Research Center for Epidemiology and Microbiology named after N.F. Gamalei ”(Museum of Genetically Modified Microorganisms) under number 22. The strain produces Chlamydia trachomatis chimeric protein MBL-CT666 in the subject's body cells.

Thus, a recombinant pseudo-adenovirus particle strain was created based on the human adenovirus genome 5 serotype carrying the chlamydia trachomatis MBL-CT666 chimeric gene.

Example 3

Study of the expression of the chlamydia trachomatis MBL-CT666 chimeric gene of a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genotype carrying the chlamydia trachomatis MBL-CT666 chimeric gene

In this example, the method shown in vitro ability to express chimeric gene MBL-CT666 Chlamydia trachomatis strain created by the inventive recombinant psevdoadenovirusnyh based particles of human adenovirus serotype 5 genome harboring the chimeric gene MBL-CT666 Chlamydia trachomatis.

The analysis of the expression of the target chimeric Chlamydia trachomatis protein was performed by immunoblotting electrophoresis. To this end, HEK 293 cells were infected with a strain of recombinant pseudo-adenovirus particles based on the human serotype 5 adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene. On the 1st day, the cells were removed by pipetting, cf suspension at 3000 rpm for 10 min. Lysing buffer was added to the precipitate in a ratio of 2: 1, shaken on ice for 50 minutes. Then cf at 10,000 rpm for 10 minutes at + 4 ° C, and the supernatant was used for analysis. Cells that were not infected with adenovirus were treated in the same way, then the sample was used as a negative control.

To each sample taken, to a negative control and a positive control, electrophoresis was supplemented with a 1: 1 by volume buffer for the sample (to prepare a buffer, mix 2.5 ml 0.5 M Tris-HCl, pH 6.8; 4 ml 10% - solution of SDS in water; 310 mg of dithiothreitol; 2 ml of glycerol; 32 μl of a 0.5 M Na-salt of EDTA in water (pH 6.8), 75 μl of a 2.5% solution of bromphenol blue in water, or commercial buffer) and incubated at 95 ° C for 5 min. After incubation, the obtained samples were used for application of concentrated PAG to the pockets. Electrophoresis was carried out for 40 min at a constant current of 20 mA, using an electrode buffer of the following composition: 25 mM Tris; 0.25 M glycine; 0.1% SDS, pH not adjusted.

After electrophoresis, the proteins were transferred from the gel to the Hybond-C extra nitrocellulose membrane by electro-blotting in the direction perpendicular to the direction of protein separation. When the bromophenol blue (dye) reached the border with the buffer, the gel was removed from the glasses, the concentrating gel was separated from the separating gel (the angle was marked) and transferred to distilled water for 5-10 minutes.

Filters pre-cut to the size of the gel separator (6 sheets of Whatman 3mm filter paper) and Hybond-C extra nitrocellulose membrane were soaked for at least 10 min in transfer buffer (5.81 g Tris (hydroxymethyl) aminomethane, 2.93 g glycine, 0.375 g SDS, 20% ethyl alcohol per 1 liter of distilled water).

The nitrocellulose membrane (the angle was marked, combined with the labeled angle on the PAG), Whatman 3 mm sheets and separating PAG were collected in a pile (3 sheets of filter paper, nitrocellulose, gel, 3 sheets of filter paper) in Trans-Blot SD semi-dry Transfer Cell electric shutter ( Bio-Rad), rolled with a roller to remove air bubbles and carried out protein electro-transfer for 15 min at a voltage of no more than 15. The membrane was placed in a buffer to block non-specific protein sorption sites (0.5 mg / ml egg albumin (YA) in - 1 × TBS-TW buffer) and incubated overnight on a shaker at 4 ° C, or 1 hour at 37 ° C. Composition of 10 × TBS-TW buffer: 1.5 M NaCl; 0.5% Tween-20; 100 mM Tris-HCl, pH 7.5.

The membrane was incubated on a shaker at room temperature for an hour with a solution of antiserum (primary antibodies) at a dilution of 1: 2500 in TBS-TW with 0.5 mg / ml BSA. After incubation, the membrane was washed 3 times for 10 min in 1 × TBS-TW buffer, transferred to a clean square Petri dish and incubated on a shaker at room temperature for 1 hour with antibodies conjugated to horseradish peroxidase (Sigma) at a dilution of 1: 5000. The membrane was then washed in 1 × TBS-TW buffer 3 times for 10 minutes. Next, the membrane was stained with ECL Prime Western Blotting Detection Reagent chemiluminescent dye according to the protocol and scanned on an Amersham Imager 600, GE instrument.

When immunoblot analysis is performed, primary serum antibodies should detect the recombinant positive control protein, stain with the specific chlamydia trachomatis MBL-CT666 chimeric protein, and not stain the negative control.

The figure 5 presents the results of evaluating the expression of the chimeric gene MBL-CT666 Chlamydia trachomatis by electrophoresis with immunoblotting.

According to the results of the analysis, it is obvious that a specific signal of binding to the Chlamydia trachomatis protein of about 24 kDa (calculated molecular weight is 23742.76 Da) is present in track 2, containing a sample of infected cells under denaturing conditions. In the negative control signal is not observed. This fact indicates the presence of the expression of the chimeric gene MBL-CT666 of Chlamydia trachomatis in vitro . A positive control on track 1 indicates the specificity of the reaction by the presence of antibody binding to the recombinant CdSf protein of Chlamydia trachomatis.

Thus, it was shown that the inventive strain of recombinant pseudo-adenovirus particles based on the genotype 5 human adenovirus genome carrying the Chlamydia trachomatis MBL-CT666 chimeric gene is capable of producing the corresponding Chlamydia trachomatis MBL-CT666 chimeric protein.

The task of obtaining a strain of recombinant pseudo-adenovirus particles based on the human adenovirus genome 5 serotype expressing the chlamydia trachomatis MBL-CT666 chimeric gene has been completed.

Example 4

Obtaining an immunogenic composition containing a strain of a recombinant pseudo-adenovirus particle based on the genotype 5 human adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene .

To conduct experiments on the study of immunogenicity and protective properties, a further increase in the strain of recombinant pseudo-adenoviral particles and the preparation of an immunogenic composition based on it were required.

For this, a strain of recombinant pseudo-adenovirus particles based on the human serum adenovirus genome 5 serotype carrying the chimeric gene MBL-CT666 of Chlamydia trachomatis , for administration to the subject in order to form immunity against urogenital chlamydia, the recombinant pseudo-adenovirus particles were increased, the multi-stage concentrated solutions were purified and formulated to an acceptable . This process is described in detail in well-known sources.

In essence, the cultivation process included the growth of a HEK293 cell suspension to a concentration of 2 × 10 ⁶ cells / ml (24-48 hours) and inoculation with a strain (with a titer of at least 10 ⁸ PFU / ml, 5-10 PFU / cell) with subsequent cultivation 36 -60 hours to a final concentration of at least 2 × 10 ⁸ -PFU / ml, in an amount of at least 3 × 10 ¹⁰ f.p./ml.

For sterilization, the resulting preparation was filtered through a filter system with a pore size of 0.22 μM and diluted with a sterile pharmaceutical acceptable buffer solution, for example: 10 mM TrisHCl, 75 mM NaCl, 1 mM MgCl2, 5% sucrose, 0.05% polysorbate 80, 0, 5% ethanol, 100 μm EDTA, pH 8.0, to obtain the active component, taking into account the required final activity of at least 2 × 10 ⁸ PFU / ml of recombinant adenoviral particles. The resulting volume of the drug was poured into 0.5 ml vials.

Thus, the task of obtaining an immunogenic composition containing a strain of recombinant pseudo-adenovirus particles based on the genome of the human adenovirus 5 serotype, carrying the chlamydia trachomatis MBL-CT666 chimeric gene according to the invention was completed.

It is possible to obtain an immunogenic composition containing a dose of 0.5 ml:

- a strain of recombinant pseudo-adenovirus particles based on the human adenovirus genome 5 serotype, carrying the chimeric gene MBL-CT666 of Chlamydia trachomatis at least 1 × 10 ⁸ PFU;

- pharmaceutically acceptable buffer solution - up to 0.5 ml.

The immunogenic composition obtained according to the invention, containing the recombinant pseudo-adenovirus particles strain with the insert of the chlamydia trachomatis MBL-CT666 chimeric gene as the active substance, was used for further experiments to study the characteristics of the strain.

Example 5

Study of the immunogenic properties of a strain of a recombinant pseudo-adenovirus particle based on the human adenovirus genome 5 serotype carrying the chimeric gene MBL-CT666 Chlamydia trachomatis

In this example, the immunogenicity of the created strain of recombinant pseudo-adenovirus particles based on the human serotype 5 adenovirus genome carrying the chimeric MBL-CT666 Chlamydia trachomatis gene was evaluated by determining its ability to induce specific antibodies in the composition of the immunogenic composition.

Specific IgG antibodies to the CdsF antigen were determined by ELISA (as described previously). Mice were immunized intranasally with 50 μl of an immunogenic composition containing a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene at a dose of 2 × 10 ⁸ PFU per ml. Blood serum was obtained on days 14 and 28 after immunization. As controls, we used blood serum from mice immunized with a / n adenoviral vector that did not carry an insert (Ad-null) and serum from mice that were injected with saline (negative control). The results are presented in figure 6.

It was shown that on the 28th day after immunization with the composition created according to the invention, specific antibodies of the IgG class were determined after 14 and 28 days, which indicates the presence of immunogenic properties in the strain of recombinant pseudo-adenovirus particles based on the human adenovirus genome 5 serotype carrying the chimeric gene MBL-CT666 Chlamydia trachomatis to the specific causative agent of urogenital chlamydia Chlamydia trachomatis .

Thus, the task of obtaining a strain of recombinant pseudo-adenovirus particles based on the genome of the human adenovirus 5 serotype carrying the chimeric gene MBL-CT666 Chlamydia trachomatis has been completed.

Example 6

Immunogenic properties of the urogenital chlamydia vaccine containing a recombinant pseudo-adenovirus particle strain based on the human adenovirus genome 5 serotype carrying the chlamydia trachomatis MBL-CT666 chimeric gene as a prime component

In this example, the possibility of using the recombinant pseudo-adenovirus particle strain obtained according to the invention based on the human serotype 5 adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene as a component of the antichlamydia vaccine was evaluated. The specified vaccine should consist of two components in different vials - the prime component and boost component, which are administered once after a certain period of time, in turn, for the implementation of the so-called prime boost immunization to obtain protective immunity. The strain-based composition of the invention was used as a component for prime immunization, then a component based on the recombinant CdsF protein was boosted. The vaccine-induced humoral (specific antibodies of the IgG1 and IgG2a class) and the T-cell immune response were studied.

Intranasal immunization with a priming component containing a recombinant pseudo adenovirus particle strain based on the human serotype 5 adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene at a dose of 2 × 10 ⁸ PFU / ml was performed on a DBA / 2 mouse line of 14-16 g female mice. (10 mice / group) once. Two weeks after immunization, subcutaneous boosting with rMBL-CT666 protein was performed at a dose of 10 μg / mouse in combination with MPLA. As control groups of mice were used that received (intranasally) a recombinant human adenovirus of the fifth serotype that did not carry a transgene - Ad-null and physiological saline NaCl.

1) Class specific antibodiesIgG1andIgG2a.

Determined by indirect enzyme-linked immunosorbent assay (ELISA). For these purposes, we used the serum obtained on the 14th day after the prime boost immunization of mice.

ELISA was performed by the conventional method. The recombinant protein rMBL-CT666 of C. trachomatis was used as antigen. The obtained sera from immunized mice were titrated in dilutions of 1: 100, 1: 200, 1: 400, 1: 800. To determine specific antibodies of the IgG class (IgG1, IgG2a), rabbit monoclonal anti-mouse antibodies of the IgG1 and IgG2a class (Sigma-Aldrich, USA) at a dilution of 1: 10,000 labeled with horseradish peroxidase and tetramethylbenzidine (TM) were used as conjugate. (Biolegend, USA). The reaction was taken into account at a wavelength of 450 nm. The results are presented in figure 7.

As a result of the study, the production of specific antibodies of IgG isotypes: IgG2a and IgG1 was shown in response to a single immunization with a composition containing a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome containing the Chlamydia trachomatis chimeric gene MBL-CT666 with a single boost of r66BL666. At a dilution of 1: 800, a significant difference was shown between the group of animals immunized according to the prime boost scheme with the vaccine components (Ad-MBL-CT666 + rMBL-CT666) (OD ~ 0.5155, p <0.05) and Ad- controls null and OK (OD ~ 0.188, OD ~ 0.0985). The production of antibodies of the IgG2a isotype was most pronounced, which mediates effector functions, including antibody-dependent cell-mediated cytotoxicity (ADCC), which contributes to the early elimination of chlamydial infection from the body. In addition, ADCC is associated with an improved presentation of the chlamydia trachomatis MBL-CT666 chimeric gene capable of enhancing CD4 + T cell responses. IgG1 isotype antibodies were also induced in response to immunization (OD ~ 0.4515, at a dilution of 1: 100); however, their level did not differ significantly from the level of antibodies of the Adnull and OK control groups (OD ~ 0.23675, OD ~ 0 , 2685). In addition, the ratio of IgG2a to IgG1 was> 1, which indicates the differentiation of the immune response towards Tx1 - type and, accordingly, mainly the development of cellular immunity. These data indicate the immunogenicity of the antichlamydia vaccine, as a prime component comprising an immunogenic composition containing a strain of recombinant pseudo-adenovirus particles based on the human serotype 5 adenovirus genome carrying the chlamydia trachomatis chimeric gene MBL-CT666, and also indicates the presence of protective activity against chlamydia trachomatis .

2). Determination of the number of T-lymphocytes producing IFγ by ELISPOT in vitro.

The number of IFγ-producing cells in the spleen and lymph nodes of vaccinated and control mice was determined using the ELISPOT method.

To assess the cellular immune response by ELISPOT, a suspension of spleen cells and lymph nodes was obtained from mice immunized with the priming component of the vaccine containing the recombinant pseudo-adenovirus particles strain based on the human serotype 5 adenovirus genome containing the Chlamydia trachomatis chimeric gene MBL-CT666 and the boosting component 666BL on day 14 after boosting. Cells were stimulated with CdsF and C. trachomatis serovar D. antigen. As a control, spleen and lymph node cells from mice immunized with intranasally empty Adnull adenovirus, intact mice, and non-stimulated cells were used (Figure 8).

Immobilized monoclonal antibodies to IFγ (Anti-Mouse IFN-γ 250x Capture Antibody, Ready-Set-Go!, EBioscience, San Diego, CA), diluted in sterile buffer (ELISA / ELISPOT Coating Buffer), were added to the wells of a 96-well plate (Millipore, MAIPS4510, USA) in a volume of 100 μl / well and incubated for 18-20 hours at 4 ° C. At the end of the incubation period, the contents of the wells were removed and washed 2 times with sterile buffer (ELISA / ELISPOT Coating Buffer). Then, 200 μl / well of RPMI culture medium containing 5% FCS was added, incubated at 37 ° C. After 1 hour, the medium was removed from the wells, the studied cells were introduced into them in doublets at a concentration of 2 × 10 ⁵ / well with or without antigen (10 μg / ml) and incubated for 24 hours at 37 ° C in 5% CO ₂ . The plates were washed 5 times with phosphate buffer (ELISA / ELISPOT Coating Buffer) at 200 μl / well, once with distilled water, 100 μl of biotinylated developing antibodies (Biotin anti-mouse IFN-γ (250x), Biolegend) in Assay Diluent buffer and incubated for 2 hours at a temperature of 2-8 ° C. At the end of the incubation period, the plates were washed 6 times with phosphate buffer and streptavidin AP conjugate (Streptavidin-Alkaline Phosphatase Conjugate, Affymetrix) diluted in phosphate buffer at a concentration of 1: 1000, 100 μl / well, was added and incubated for 1 hour at room temperature. After incubation, the wells were washed 3 times with 100 μl of phosphate buffer and another 3 times with distilled water. Next, a BCIP® / NBT Liquid Substrate System (Sigma) substrate was added. After 5-60 minutes, the reaction was stopped with water and the plates were dried. The number of spots in the wells was counted using an ELISPOT AID ELISpot Reader (Autoimmun Diagnostika GmbH, Strassberg, Germany).

The ELISPOT method was used to demonstrate the induction of a T-cell immune response that produces IFγ, a key component of a protective immune response in chlamydial infections.

3). The study of cell proliferation by flow cytometry.

The resulting suspensions of splenocytes and lymph node cells from vaccinated and control mice on day 30 after immunization were labeled with CFSE and incubated in the presence of rMBL-CT666 or C. trachomatis antigen for 48 hours. Cell proliferation was analyzed by flow cytometry on a FACSCALIBUR instrument (BD, USA) using the BD CellQuest ™ Pro program (Bioline) (Figure 9).

As shown in figure 9, CD4 + T cells obtained from a group of prime boost immunized mice had a statistically significant increase in subpopulations that passed 4 and 5 divisions in response to CdsF antigen and passed 4 divisions in response to stimulation of C. trachomatis ( p <0.5). In this case, CD4 + T cells obtained from mice injected with Ad-null and intact mice did not have an increase in the subpopulations proliferating in response to the CdsF antigen during all 5 stages of division.

CD8 + T cells obtained from mice immunized with Ad-MBL-CT666 boosted with rMBL-CT666 also had a statistically significant increase in the subpopulations that underwent 3 divisions in response to the CdsF antigen (Fig. Xb) (p <0.5), and 3 and 4 division in response to stimulation of C. trachomatis (Fig. Xb). CD8 + T cells obtained from control mice, like CD4 + T cells, did not have an increase in subpopulations proliferating in response to antigen or C. trachomatis .

Thus, in this study, the ability of the studied vaccine preparation to induce a specific response of CD4 + and CD8 + T cells in the proliferation reaction was demonstrated and the immunogenicity of this drug was confirmed.

Thus, the possibility of using the anti- Chlamydia vaccine as a prime component of an immunogenic composition containing a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome carrying the chimeric Chlamydia trachomatis MBL-CT666 gene was shown.

Example 7

The protective properties of the urogenital chlamydia vaccine containing a recombinant pseudo-adenovirus particle strain based on the genotype 5 human adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene as a prime component.

A study was conducted of the efficacy (effectiveness) of the vaccine against urogenital chlamydial infection, representing, as a prime component, an immunogenic composition with a recombinant pseudo-adenovirus particle strain based on the human serotype 5 adenovirus genome carrying the chlamydia trachomatis MBL-CT666 chimeric gene.

The vaccine was administered according to the scheme described in example 6.

1) Assessment in the neutralization reaction.

The most important studied in vitro immune responses include the neutralization reaction. Assessment of the neutralizing activity of antibodies in serum obtained from mice immunized with Ad-MBL-CT666 with rMBL-CT666 boosting was evaluated using a neutralization reaction.

Mouse sera obtained 14 days after boosting were incubated with C. trachomatis and their neutralizing effect was evaluated in an in vitro cell culture. As a control of infection, C. trachomatis serovar D was used at a dose of 10 ⁵ VOU / ml (with incubation at 37 ° C and without t). For the neutralization reaction, McCoy cells were used. The obtained sera from immunized animals were incubated with C. trachomatis in various dilutions (1:32; 1:64; 1: 128; 1: 256) for 20 minutes at t = 37 ° C in an incubator. Then, the cells were infected with pre-incubated chlamydia samples and centrifuged at 2000 rpm, t = 25 ° C for 60 min. Incubation was carried out in a CO2 atmosphere at a temperature of 37 ° C for 48 hours. A quantitative assessment of the effect of neutralization of chlamydial inclusions in the McCoy cell culture was performed by immunofluorescence method after staining of chlamydial inclusions with species-specific FITC-labeled monoclonal antibodies.

To calculate the chlamydial inclusion of forming units (BOE) under the microscope, the standard formula was used (Scidmore M.A., 2005). The results of the study are presented in table 1.

Table 1 - Assessment of the neutralizing activity of antibodies obtained from mice immunized with Ad-MBL-CT666 followed by boosting of rMBL-CT666 in a cell culture infected with C. trachomatis.

The percentage of chlamydia suppression,% Groups \ Serum Dilutions 1:32 1:64 1: 128 1: 256 Ad-MBL-CT666 + rMBL-CT666 65 63 60 53 Ad null 35 thirty 25 25

Immunization with Ad-MBL-CT666 followed by boosting rMBL-CT666 was shown to produce specific antibodies with neutralizing activity against C. trachomatis infection in vitro (Table 1). The antibody titer causing 50% neutralization of the infection was 1: 256.

2) Assessment of the pathology of the reproductive organs by direct visualization

Evaluation of the pathology of the reproductive organs was carried out after infection with C. trachomatis in immunized animals. Photographs were taken to visually assess the pathology of the reproductive tract of mice. Pathology was assessed by direct visualization, assessing the presence of hydrosalpinx and hyperemia of the organs of the upper parts of the urogenital tract.

On day 30 after infection with C. trachomatis, pathological changes were evaluated visually. For this, the mice were killed, autopsy and removal of the reproductive organs (uterus, ovaries) was performed. Macro photographs of organs and a comparative analysis of pathological changes between the experimental and control groups of animals were made (Fig. 10A, B, C).

Autopsy of the ovaries and uterus in the group of animals immunized with a combination vaccine containing Ad-MBL-CT666 and rMBL-CT666 revealed no pathological changes, such as hydrosalpinx, and there was no hyperemia of the fallopian tubes and adhesions (Fig. 10A).

In non-immunized mice and treated with empty adenovirus infected with C. trachomatis, the pathology of the reproductive organs was pronounced, especially in the form of hydrosalpinx, characteristic of a chlamydial infection, the presence of serous hemorrhagic exudate in small quantities and severe hyperemia were also recorded uterine horns, ovaries (Fig. 10B, C).

3) Evaluation of the suppression of infection caused by C. trachomatis in the lower parts of the urogenital tract.

To assess the accumulation of infection in the lower parts of the urogenital tract, vaginal swabs from 3 to 21 days were selected from mice after infection with C. trachomatis. Chlamydial infection in the swabs was determined using the cultural method of research (Table 2, Figure 11A, B, C, D, D).

Table 2. Determination of the number of infected mice in the study groups.

The number of infected mice in each group for 21 days 3 days 6 day 9 days 15 days 21 days Ad-MBL-CT666 + rMBL-CT666 10/10 10/10 10/10 9/10 1/10 Ad null 10/10 10/10 10/10 10/10 10/10 C. trachomatis 10/10 10/10 10/10 10/10 10/10

A study of the dynamics of the development of infection in the lower parts of the urogenital tract showed that immunization with Ad-MBL-CT666 with rMBL-CT666 boosting led to a significant suppression of chlamydial infection by day 15, and 20 days after infection (Figure 11), infection was detected in only one immunized mice, while in the control group the infection was detected in 10 ⁴ FU / ml in 10 out of 10 mice.

Thus, the possibility of using an immunogenic composition containing a strain of recombinant pseudo-adenovirus particles based on the human serotype 5 adenovirus genome carrying the chimeric gene MBL-CT666 of Chlamydia trachomatis as the prime component of the anti- Chlamydia vaccine to induce a protective immune response against urogenital chlamydia was shown.

All these examples confirm that the task of this invention, namely, the preparation of the active substance of an immunogenic composition against human urogenital chlamydia, a strain of a recombinant pseudo-adenovirus particle, which can be used to create an immunogenic composition without the use of adjuvants, is effective for a single administration as a prime component of the antichlamydia vaccine to humans, due to the fact that the antigen is produced directly in the cells of the human body and has a wide spectrum of action against various serotypes of C. Trachomatis, performed.

Industrial applicability

The proposed strain of the recombinant pseudo-adenovirus particle expressing the chlamydia trachomatis MBL-CT666 chimeric gene can be used as an immunogenic component for the manufacture of vaccines for the prevention of urogenital chlamydial infection caused by Chlamydia trachomatis .

Claims (10)

1. The strain of the recombinant pseudo-adenovirus particle, obtained on the basis of DNA of human adenovirus 5 serotype with a deletion in the region E1 and E3 of the adenovirus genome, having in the region of E1 deletion of the adenovirus genome expressing a construct with the nucleotide sequence of SEQ ID NO: 1 of the chlamydia trachomatis MBL-CT666 chimeric gene, which, after administration to a subject, expresses the chimeric gene MBL-CT666 of Chlamydia trachomatis SEQ ID NO: 1 in the cells of the body and produces the chimeric protein MBL-CT666 of Chlamydia trachomatis as the amino acid sequence of SEQ ID NO: 2, which induces protection against human urogenital chlamydia. 2. A method for producing a strain of a recombinant pseudo adenovirus particle expressing the chlamydia trachomatis MBL-CT666 chimeric gene according to claim 1, wherein the strain is obtained by homologous recombination in E. coli cells of strain BJ5183 between the pShuttle-CMV plasmid (# 240007, pShuttle- CMV vector, Agilent, US) carrying a cassette with the chlamydia trachomatis MBL-CT666 chimeric gene cloned from the pAL2-T plasmid and human adenovirus 5 serotype DNA with a deletion in the E1 and E3 regions of the adenovirus genome, and recombinant pseudo-adenovirus nanoparticles are assembled in cells line HEK293, Human embryonic kidney 293, after transfection with recombinant pAd-MBL-CT666 DNA, the expression cassette contains the CMV promoter of human cytomegalovirus, the target gene is the chlamydia trachomatis MBL-CT666 chimeric gene, pA is a polyadenylation signal and is located in deletion of adenoviral E1 region of the genome, the chimeric gene for detection of MBL-CT666 Chlamydia trachom atis use a polymerase chain reaction with specific primers: on adenovirus hexon: ADH01 ACTACAAYATTGGCTACCAGG; ADH02 CAAAACATAAAGAAGKGTGGGC, for the chimeric gene MBL-CT666 of Chlamydia trachomatis: CT666-For CAAGGACTGAGAGGCTTGCA; CT666-Rev TCTCGGTGTTCACAGCTGTC. 3. An immunogenic composition containing a strain of a recombinant pseudo-adenovirus particle expressing the chlamydia trachomatis MBL-CT666 chimeric gene according to claim 1, in an amount of at least 2 × 10 ⁸ PFU / ml, and a pharmaceutically acceptable buffer solution of up to 0.5-1.0 ml, while the dose volume is 0.5-1.0 ml in a bottle. 4. The use of an immunogenic composition containing a strain of a recombinant pseudo-adenovirus particle expressing the chlamydia trachomatis MBL-CT666 chimeric gene according to claim 3, as a prime component of the chlamydia vaccine to protect against human urogenital chlamydia.

Images