RU2720519C1 - Gene therapy dna-vector based on gene therapy dna-vector vtvaf17, carrying target gene selected from group of ifnb1, ifna14, ifna2, il12a, il12b genes to increase level of expression of these target genes, method for preparation and use thereof, strain escherichia coli scs110-af/vtvaf17-ifnb1, or escherichia coli scs110-af/vtvaf17-ifna14, or escherichia coli scs110-af/vtvaf17-ifna2, or escherichia coli scs110-af/vtvaf17-il12a, or escherichia coli scs110-af/vtvaf17-il12b, carrying gene-therapeutic dna-vector, method for production thereof, method for industrial production of gene therapy dna vector - Google Patents

Abstract

FIELD: biotechnology; medicine; agriculture.SUBSTANCE: invention refers to genetic engineering and can be used in biotechnology, medicine and agriculture to develop gene therapy preparations. A gene therapy DNA vector based on the VTvaf17 gene therapy DNA vector, having a target gene selected from a group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B to increase the level of expression of this target gene in the human and animal body, wherein the gene therapy DNA vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B has the nucleotide sequence SEQ ID No. 1, or SEQ ID No. 2, or SEQ ID No. 3, or SEQ ID No. 4, or SEQ ID No. 5, respectively. Each of the created gene therapy DNA vectors: VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B due to the limited size of the vector part of VTvaf17, not exceeding 3200 base pairs, has the ability to efficiently penetrate into cells and to express the target gene cloned in it, selected from the group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B respectively.EFFECT: gene-therapeutic DNA-vector contains no nucleotide sequences of viral origin and antibiotic-resistant genes are absent, providing the possibility of its safe application for genetic therapy of human and animals.16 cl, 17 dwg, 20 ex

Description

Gene therapeutic DNA vector based on VTvaf17 gene therapeutic DNA vector, carrying the target gene selected from the group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B to increase the expression level of these target genes, method for its preparation and use, strain Escherichia coli SCS110-AF / VTvaf17-IFNB1 or Escherichia coli SCS110-AF / VTvaf17-IFNA14 or Escherichia coli SCS110-AF / VTvaf17-IFNA2 or Escherichia coli SCS110-AF / VTvaf17-IL12A or Escherichia coli SCS110-AF / VTvaf17-gene-12, DNA12 a method for its preparation, a method for the industrial production of a gene therapy DNA vector.

Technical field

The invention relates to genetic engineering and can be used in biotechnology, medicine, and agriculture to create gene therapy drugs.

State of the art

Gene therapy is a modern medical approach aimed at treating inherited and acquired diseases by introducing new genetic material into the patient’s cells in order to compensate or suppress the function of the mutant gene and / or correct a genetic defect. The end product of gene expression may be an RNA or protein molecule. However, the implementation of most of the physiological processes in the body is associated with the functional activity of protein molecules, while RNA molecules are either an intermediate in the synthesis of proteins or carry out regulatory functions. Thus, the goal of gene therapy is, in most cases, the introduction into the body of genes that provide for the transcription and subsequent translation of protein molecules encoded by these genes. As used herein, gene expression means the production of a protein molecule whose amino acid sequence is encoded by this gene.

The IFNB1, IFNA14, IL12A, IL12B, IFNA2 genes, which are part of the gene group, play a key role in a number of processes in humans and animals. The connection of low / insufficient concentrations of these proteins with various adverse human conditions is shown, which, in some cases, is confirmed by disturbances in the normal expression of genes encoding these proteins. Thus, the gene therapeutic increase in the expression of a gene selected from the group of genes IFNB1, IFNA14, IL12A, IL12B, IFNA2 has the potential to correct various conditions in humans and animals.

Type I interferons are important for protection against viral infections and are one of the main components of innate immunity. In addition, type I interferons are involved in cell differentiation and antitumor protection. After secretion in response to the pathogen, type I interferons bind a homologous receptor complex and induce the transcription of a number of genes, such as coding pro-inflammatory cytokines and chemokines. Mice with no or reduced expression of this gene exhibit several phenotypes, including defects in B-cell maturation and increased susceptibility to viral infection.

In addition to antiviral activity, type I interferons (IFN-α / β) also mediate many immunoregulatory effects. Immunomodulation functions suggest that type I IFNs may provide a link between innate and adaptive immune responses. IFN-α / β is known to be involved in the induction of expression of MHC class I and activation of the cytotoxic effects of NK cells and regulate the expression of other cytokines.

In general, the mechanism of action of type I interferons may look as follows: in the case of a controlled viral infection or other “weak” and indirect inducers, the effect of type I interferons is limited by local effects. Under the condition of IL-12 activation, along with IFN-α / β, IFN-γ production by CD4 T cells is stimulated and, upon exposure of antigens as part of MHC I, also by CD8 T cells. In the context of the spread of viral infection and high levels of IFN-α / β induction, the activation of NK cell cytotoxicity and predominant polarization towards CD8-T cell reactions also occur.

The IFNB1 gene encodes a cytokine interferon 1 beta. The protein encoded by this gene belongs to the class I interferon class. In a number of experimental studies, the antiviral properties of IFNB1 are proposed to be used to control the replication of retroviruses, such as HIV. In vivo experiments showed that transfection of mononuclear cells of HIV patients with a retroviral vector expressing the IFNB1 gene led to a suppression of HIV replication compared to control cells, transplantation of such cells to experimental mice suppressed HIV replication to an undetectable standard test level at 40% animals (Vieillard V et al., 1999). Similar positive results were obtained in experiments on primates (Gay W et al., 2004).

Regarding the anticancer activity of IFNB1, it has been demonstrated that transfection of human glioma cells with a plasmid vector expressing the IFNB1 gene effectively suppressed in vitro cell replication (Mizuno M et al., 1990). Moreover, transfection of melanoma cells with a viral vector expressing the IFNB1 gene resulted in a significant increase in the efficacy of bleomycin and, as a result, in the death of up to 98% of tumor cells (Fondello C et al., 2018). Genetically modified cells expressing the IFNB1 gene also had antitumor activity in in vivo experiments on laboratory animals, including the mouse model of metastatic choriocarcinoma (Kim GS et al., 2018).

Multiple sclerosis (MS) among autoimmune diseases is the most studied pathology in terms of the role of IFNB1. IFNB1 is used as an active ingredient in many effective drugs used for the treatment of MS (Rebif, Betaseron, Avonex, etc.). The gene therapy approach using a plasmid vector expressing the recombinant modified IFNB1 gene is also considered a promising approach to the treatment of MS (Hamana A et al., 2018).

It has also been shown that expression of IFNB1 in neurons plays a role in the pathogenesis of Parkinson's disease. Moreover, the introduction of a lentiviral vector expressing this gene to mice with an experimental model of Parkinson's disease prevented the development of the disease (Ejlerskov P et al., 2015).

An initial phase of clinical trials of intra-articular administration of an adeno-associated viral vector expressing the IFNB1 gene in patients with rheumatoid arthritis (NCT02727764) is currently underway.

The IFNA14, IFNA2 genes encode IFN-α cytokines of subtypes 14 and 2 also related to type I interferons. All subtypes of IFN-α bind to the same type I interferon receptor (IFNAR). However, the binding affinity of different subtypes varies, which leads to the induction of various signaling pathways and various biological effects. Differences in the efficacy of different subtypes have been described in HSV, MCMV, and influenza virus infections in mice. In the case of HIV-1 infection, it was shown that IFN-α2 can play the role of the most pathogenetically significant subtype, however, only six IFN-α subtypes were evaluated in this work using a laboratory-adapted strain of HIV-1 (Sperber SJ et al., 1992 ) Harper et al. it has been shown that there is an inverse relationship between expression of IFN-α subtypes and effectiveness in reducing HIV-1 replication in vitro. It was found that the most common (influenced by HIV infection) subtypes, IFN-α2 and -α1 / 13 were less effective compared to IFN-α6, -α14 and -α8 (Harper et al., 2015). Subsequent work using plasmid vectors expressing various IFN-I subtypes showed that although all IFN-I subtypes inhibit HIV-1 replication, the effect was longer in mice that received plasmids expressing IFNB1, IFNA14 genes (Abraham S et al., 2016).

Thus, there are conflicting data on the comparative effectiveness of various type I interferons for modulating immunological processes. However, it is obvious that each of the subtypes can be used as the basis for the treatment of autoimmune, viral, and other conditions associated with an imbalance in the immune system.

The IL12A, IL12B genes encode the subunits of the cytokine IL-12 - p35 and p40, respectively. IL-12 is a pro-inflammatory cytokine produced by dendritic cells, macrophages and B cells in response to infectious agents. Induction of IL-12 stimulates the production of IFN-g by T cells and leads to potentiation of antigen presentation, which facilitates the differentiation of TH1 cells. IL-12 can also induce IFN-g production by NK cells. The nature of the course and outcome of many infections depends on the ability of the pathogen to induce the synthesis of IL-12. For example, infection with Candida albicans induces the synthesis of IL-12, and it contributes to effective cellular defense against the pathogen. The human immunodeficiency virus (HIV) inhibits the synthesis of IL-I2, which is associated with many defects in cell defense in AIDS. Leishmania, capable of inhibiting the synthesis of IL-12, causes a chronic infection. Selective inhibition of IL-12 synthesis, even while maintaining the production of other pro-inflammatory cytokines (IL-1, TNF-a), allows pathogens to persist for a long time in the host's body (Okwor I, Uzonna JE., 2016). A gene therapy approach using plasmid vectors expressing IL-12 has a protective effect in infections with leishmania and trypanosomes (Sakai T et al., 2000). The ability of IL-12 to polarize the immune response towards Th1 made it possible to use it as an immunomodulating agent in vaccination, and a gene therapy approach was used in a number of studies (Tapia E et al., 2003).

Mutations in the IL12A, IL12B genes are associated with autoimmune diseases such as multiple sclerosis, systemic lupus erythematosus, primary biliary cirrhosis, Behcet's disease, celiac disease, Sjogren's syndrome and others. The ability of IL-12 to stimulate dendritic cells and boost antitumor immunity has been investigated in numerous studies, in particular, using the gene therapy approach, the antitumor effect has been shown (Razi Soofiyani S et al., 2016). In the work of Denies et al. a plasmid vector expressing the IL-12 gene was successfully used in combination with antitumor vaccination, while acting as a gene therapeutic adjuvant with an immunomodulating effect (Denies S et al., 2014).

Moreover, since the p40 subunit is common to several cytokines from the IL-12 family, modulation of the expression of the IL12B gene, including using the gene therapy approach, opens up potential possibilities for influencing conditions associated with insufficient expression of cytokines such as IL-23. IL-27 (Waldner MJ, Neurath MF, 2009).

Thus, the prior art indicates that the genes IFNB1, IFNA14, IFNA2, IL12A, IL12B have the potential to correct a number of deviations, including, but not limited to, infectious, autoimmune diseases, cancer, hereditary and acquired pathological conditions, as well as the need modulation of the immune response. This is due to the integration of the IFNB1, IFNA14, IFNA2, IL12A, IL12B genes within the framework of this patent into a group of genes. Genetic constructs that provide expression of proteins encoded by genes from the group of IFNB1, IFNA14, IFNA2, IL12A, IL12B can be used to develop drugs for the prevention and treatment of various diseases and pathological conditions.

Moreover, the data presented indicate that insufficient expression of proteins encoded by the IFNB1, IFNA14, IFNA2, IL12A, IL12B genes in the gene group is associated not only with pathological conditions, but also with a predisposition to their development. Also, the data presented indicate that insufficient expression of these proteins may not manifest explicitly in the form of pathology, which can be unambiguously described in the framework of existing standards of clinical practice (for example, using the ICD code), but at the same time cause conditions that are unfavorable for humans and animals and are associated with a deterioration in the quality of life.

Analysis of approaches to increase the expression of target genes implies the possibility of using various gene therapy vectors.

Gene therapy vectors are divided into viral, cellular and DNA vectors (Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal Products EMA / CAT / 80183/2014). Recently, in gene therapy, more and more attention has been paid to the development of non-viral systems for the delivery of genetic material, among which plasmid vectors are leading. Plasmid vectors lack the disadvantages inherent in cell and viral vectors. In the target cell, they exist in an episomal form, do not integrate into the genome, their production is cheap enough, the absence of an immune response and adverse reactions to the introduction of a plasmid vector make them a convenient tool for gene therapy and genetic prevention (DNA vaccines) (Li L, Petrovsky N . // Expert Rev Vaccines. 2016; 15 (3): 313-29).

However, the limitations for the use of plasmid vectors for gene therapy are: 1) the presence of antibiotic resistance genes for production in bacterial strains, 2) the presence of various regulatory elements represented by sequences of viral genomes 3) the size of the therapeutic plasmid vector, which determines the efficiency of vector penetration into target cell.

It is known that the European Medicines Agency considers it necessary to avoid introducing antibiotic resistance markers into the plasmid vectors for gene therapy being developed (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA / CAT / GTWP / 44236/2009 Committee for advanced therapies). This recommendation is associated primarily with the potential danger of the penetration of a DNA vector or horizontal transfer of antibiotic resistance genes into bacterial cells present in the body as part of normal or opportunistic microflora. In addition, the presence of antibiotic resistance genes significantly increases the size of the DNA vector, which leads to a decrease in the efficiency of its penetration into eukaryotic cells.

It should be noted that antibiotic resistance genes also make a fundamental contribution to the method of obtaining DNA vectors. In the case of antibiotic resistance genes, strains for producing DNA vectors are usually cultured in a medium containing a selective antibiotic, which creates the risk of trace amounts of antibiotic in insufficiently purified preparations of DNA vectors. Thus, the production of DNA vectors for gene therapy, in which there are no antibiotic resistance genes, is associated with the production of strains with such a distinctive feature as the ability to stably amplify target DNA vectors in a medium without antibiotics.

In addition, the European Medical Agency recommends avoiding the presence of regulatory elements in therapeutic plasmid vectors to increase the expression of target genes (promoters, enhancers, post-translational regulatory elements), which are nucleotide sequences of the genomes of various viruses (Draft Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products, http://www.ema.europa.eu/docs/en_GB/document_library/Scientific_guideline/2015/05/WC500187020.pdf). These sequences, although they may increase the level of expression of the target transgene, however, pose a risk of recombination with the wild-type virus genetic material and integration into the genome of a eukaryotic cell. Moreover, the appropriateness of overexpression of a particular gene for therapy purposes remains an unresolved issue.

Also, an essential point is the size of the therapeutic vector. It is known that modern plasmid vectors are often overloaded with non-functional sites that seriously increase the size of the vector (Mairhofer J, Grabherr R. // Mol Biotechnol. 2008.39 (2): 97-104). For example, the ampicillin resistance gene in pBR322 series vectors, as a rule, consists of at least 1000 bp, which is more than 20% of the size of the vector itself. In this case, an inverse relationship is observed between the size of the vector and its ability to penetrate into eukaryotic cells - DNA vectors with a small size penetrate into human and animal cells more efficiently. So, for example, in a series of experiments on transfection of HELA cells with DNA vectors ranging in size from 383 to 4548 bp it was shown that the difference in penetration efficiency can reach two orders of magnitude (differ 100 times) (Hornstein BD et al. // PLoS ONE. 2016; 11 (12): e0167537.).

Thus, when choosing a DNA vector for safety and maximum efficiency, preference should be given to those constructs that do not contain antibiotic resistance genes, sequences of viral origin and the size of which allow efficient penetration into eukaryotic cells. The strain to obtain such a DNA vector in quantities sufficient for the purpose of gene therapy should provide the possibility of stable amplification of the DNA vector using nutrient media that do not contain antibiotics.

An example of the use of recombinant DNA vectors for gene therapy is a method for producing a recombinant vector for genetic immunization according to the patent US 9550998 B2. The vector is a supercoiled plasmid DNA vector and is intended for the expression of cloned genes in animal and human cells. The vector consists of the origin of replication, regulatory elements, including the promoter and enhancer of human cytomegalovirus, regulatory elements from the human T-lymphotropic virus.

The accumulation of the vector is carried out in a special strain of E. coli without the use of antibiotics due to antisense complementation of the sacB gene introduced into the strain by means of a bacteriophage. The disadvantage of this invention is the presence of regulatory elements in the composition of the DNA vector, which are sequences of viral genomes.

The prototypes of the present invention in terms of the use of gene therapy approaches to increase the level of expression of genes from the group IFNB1, IFNA14, IFNA2, IL12A, IL12B are the following applications.

US4808523A describes a plasmid vector carrying a gene encoding IFNB1. This vector allows you to increase the expression of IFNB1 in mammalian cells. The disadvantage of this invention is the method of use limited to the production of IFNB1 protein in vitro and is different from the gene therapeutic use of this vector. Another disadvantage of this invention is the presence of viral origin sequences in the vector.

US20040203118A1 describes polynucleotides encoding various variants of IFNA14, as well as a therapeutic agent, which is a vector expressing various variants of IFNA14. The disadvantage of this invention is the uncertainty of the purposes of using this invention and the uncertain safety requirements of the vectors used.

CN101304758A describes a nucleotide sequence encoding IFNA2, as well as a vector expressing this sequence for the treatment of various diseases associated with impaired expression of this gene. The disadvantage of this invention is the uncertainty of the safety requirements of the vector used.

US5723127A describes a method for using IL12 protein for therapeutic immunomodulation, in particular as an adjuvant. The disadvantage of this invention is the use of IL12 protein instead of a gene therapy vector expressing a gene encoding an IL12 protein.

Disclosure of invention

The objective of the invention is the construction of gene therapy DNA vectors to increase the expression level of the group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B in humans and animals, combining the following properties:

I) The effectiveness of gene therapy DNA vector to increase the level of expression of target genes in eukaryotic cells.

II) The possibility of safe use for human and animal genetic therapy due to the absence of regulatory elements in the composition of the gene therapy DNA vector, which are the nucleotide sequences of the viral genomes.

III) The possibility of safe use for human and animal genetic therapy due to the absence of antibiotic resistance genes in the composition of the gene therapy DNA vector.

IV) Technological production and the possibility of producing a gene therapy DNA vector on an industrial scale.

Paragraphs II and III are provided in this technical solution in accordance with the recommendations of state regulators for drugs for gene therapy, in particular, the European Medicines Agency regarding the rejection of the introduction of antibiotic resistance markers into the developed plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011, EMA / CAT / GTWP / 44236/2009 Committee for advanced therapies) and regarding the refusal to introduce into the developed plasmid vectors for gene therapy eleme nt viral genomes (Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products / 23 March 2015, EMA / CAT / 80183/2014, Committee for Advanced Therapies).

The objective of the invention is also the construction of strains carrying these gene therapy DNA vectors, for the production and production on an industrial scale of gene therapy DNA vectors.

The problem is solved due to the fact that a gene therapeutic DNA vector based on the gene therapeutic DNA vector VTvaf17 was created, carrying the target gene selected from the group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B to increase the level of expression of this target gene in humans and animals wherein the gene therapy DNA vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B has the nucleotide sequence of SEQ ID No. 1 or SEQ ID No. 2 or SEQ ID No. 3 or SEQ ID No. 4 or SEQ ID No. 5, respectively. Moreover, each of the created gene therapeutic DNA vectors: VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B due to the limited size of the vector part of VTvaf17, not exceeding 3200 bp, has the ability to efficiently penetrate into cells and express the target gene cloned into it, selected from the group of IFNB1, IFNA14, IFNA2, IL12A, IL12B genes, respectively. The gene therapy DNA vector does not contain nucleotide sequences of viral origin and there are no antibiotic resistance genes, providing the possibility of its safe use for genetic therapy in humans and animals.

A method has also been created for producing a gene therapy DNA vector based on the VTvaf17 gene therapy DNA vector carrying a target gene selected from a group of genes: IFNB1 gene, IFNA14 gene, IFNA2 gene, IL12A gene, IL12B gene, which consists in the fact that each of the gene therapy DNAs vectors: VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B are obtained as follows: the coding portion of the target gene from the group IFNB1, or IFNA14, or IFNA2, or IL12A, or IL12B is cloned into the VTvaf17 DNA vector and the gene therapy VTvaf17-IFNB1 DNA vector, SEQ ID NO. 1, or VTvaf17-IFNA14, SEQ ID NO 2, or VTvaf17-IFNA2, SEQ ID No. 3, or VTvaf17-IL12A, SEQ ID No. 4, or VTvaf17-IL12B, SEQ ID No. 5, respectively.

 The method of using the created gene therapeutic DNA vector based on the VTvaf17 gene therapeutic DNA vector carrying the target gene selected from the group of genes: IFNB1 gene, IFNA14 gene, IFNA2 gene, IL12A gene, IL12B gene to increase the expression level of these target genes, consists in introducing the selected gene therapy DNA vectors or several selected gene therapy DNA vectors into cells, organs and tissues of a human or animal, and / or the introduction of autologous human or animal cells into organs and tissues of a human or animal, transfection linked to a selected gene therapy DNA vector or several selected gene therapy DNA vectors, or a combination of the indicated methods.

A method of obtaining a strain of Escherichia coli SCS110-AF / VTvaf17-IFNB1, or a strain of Escherichia coli SCS110-AF / VTvaf17-IFNA14, or a strain of Escherichia coli SCS110-AF / VTvaf17-IFNA2, or a strain of Escherichia coli SCS110-AF / VTvaf17 Escherichia coli SCS110-AF / VTvaf17-IL12B consists in the electroporation of competent cells of the strain Escherichia coli SCS110-AF with a gene therapy DNA vector and subsequent selection of stable clones of the strain using a selective medium.

Declared a strain of Escherichia coli SCS110-AF / VTvaf17-IFNB1, or a strain of Escherichia coli SCS110-AF / VTvaf17-IFNA14, or a strain of Escherichia coli SCS110-AF / VTvaf17-IFNA2, or a strain of Escherichia coli SCS110-AF / VTherm coli SCS110-AF / VTvaf17-IL12B, carrying a gene therapy DNA vector for its production with the possibility of culturing the strain without the use of antibiotics.

A method for the industrial production of a gene therapeutic DNA vector is to scale the bacterial culture of the strain to the amounts necessary to build up the bacterial biomass in an industrial fermenter, after which the biomass is used to isolate the fraction containing the desired DNA product - gene therapy DNA vector VTvaf17-IFNB1 or VTvaf17 IFNA14 or VTvaf17-IFNA2 or VTvaf17-IL12A are multi-stage filtered and purified by chromatographic methods.

Brief Description of the Drawings

1

The scheme of the gene therapy VTvaf17 DNA vector containing the target gene selected from the group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B, which is a double-stranded DNA molecule capable of autonomous replication in Escherichia coli cells, is shown.

Figure 1 shows the diagrams corresponding to:

A - gene therapeutic DNA vector VTvaf17-IFNB1,

B - gene therapy DNA vector VTvaf17-IFNA14,

C - gene therapy DNA vector VTvaf17-IFNA2,

D - gene therapy DNA vector VTvaf17-IL12A,

E - gene therapy DNA vector VTvaf17-IL12B.

The following structural elements of the vector are marked on the diagrams:

EF1a is the promoter region of the EF1A human elongation factor gene with its own enhancer contained in the first intron of the gene. Serves to ensure a high level of transcription of the recombinant gene in most human tissues;

The target gene reading frame corresponding to the coding part of the IFNB1 gene (Fig. 1A), or IFNA14 (Fig. 1B), or IFNA2 (Fig. 1C), or IL12A (Fig. 1D) or IL12B (Fig. 1E), respectively;

hGH-TA - transcription terminator and polyadenylation site of the human growth factor gene;

ori - the origin of replication, which serves for autonomous replication with a single nucleotide replacement to increase the copy number of the plasmid in the cells of most strains of Escherichia coli;

RNA-out is a regulatory element of the RNA-out of the transposon Tn 10, which provides the possibility of positive selection without the use of antibiotics when using strain Eshcerichia coli SCS 110.

Unique restriction sites are noted.

2

shows graphs of the accumulation of cDNA amplicons of the target gene, namely, the IFNB1 gene, in a BEAS-2B human normal bronchial epithelial cell culture (ATCC® CRL-9609 ™) prior to transfection and 48 hours after transfection of these cells with the gene therapy DNA vector VTvaf17-IFNB1 in order to assess the ability to penetrate into eukaryotic cells and functional activity, that is, the expression of the target gene at the mRNA level.

Figure 2 shows the curves of accumulation of amplicons during the reaction, corresponding to:

1 - cDNA of the IFNB1 gene in a BEAS-2B cell culture before transfection with VTvaf17-IFNB1 DNA vector;

2 - cDNA of the IFNB1 gene in BEAS-2B cell culture after transfection with VTvaf17-IFNB1 DNA vector;

3 - B2M gene cDNA in a BEAS-2B cell culture prior to transfection with VTvaf17-IFNB1 DNA vector;

4 - cDNA of the B2M gene in a BEAS-2B cell culture after transfection with VTvaf17-IFNB1 DNA vector.

The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene.

Figure 3

graphs of the accumulation of cDNA amplicons of the target gene, namely the IFNA14 gene, are shown in the culture of human peripheral blood mononuclear cells (PBMC) before transfection and 48 hours after transfection of these cells with VTvaf17-IFNA14 DNA vector in order to assess the ability to penetrate into eukaryotic cells and functional activity, that is, expression of the target gene at the mRNA level.

Figure 3 shows the curves of accumulation of amplicons during the reaction, corresponding to:

1 - cDNA of the IFNA14 gene in PBMC culture prior to transfection with VTvaf17-IFNA14 DNA vector;

2 - cDNA of the IFNA14 gene in PBMC culture after transfection with VTvaf17-IFNA14 DNA vector;

3 - cDNA of B2M gene in PBMC culture prior to transfection with VTvaf17-IFNA14 DNA vector;

4 - cDNA of the B2M gene in PBMC culture after transfection with VTvaf17-IFNA14 DNA vector.

The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene.

4

graphs of accumulation of cDNA amplicons of the target gene, namely, the IFNA2 gene in human gum fibroblast culture cells of the HGF-1 line (ATCC® CRL-2014 ™) before transfection and 48 hours after transfection of these cells with VTvaf17-IFNA2 DNA vector for evaluation, are shown ability to penetrate into eukaryotic cells and functional activity, that is, expression of the target gene at the mRNA level.

Figure 4 shows the curves of accumulation of amplicons during the reaction, corresponding to:

1 - cDNA of the IFNA2 gene in human gum fibroblast cells of the HGF-1 line before transfection with VTvaf17-IFNA2 DNA vector;

2 - cDNA of the IFNA2 gene in human gum fibroblast cells of the HGF-1 line after transfection with VTvaf17-IFNA2 DNA vector;

3 - cDNA of the B2M gene in human gum fibroblast cells of the HGF-1 line before transfection with VTvaf17-IFNA2 DNA vector:

4 - cDNA of the B2M gene in human gum fibroblast cells of the HGF-1 line after transfection with VTvaf17-IFNA2 DNA vector.

The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene.

5

shows the graphs of the accumulation of cDNA amplicons of the target gene, namely the IL12A gene, in a BEAS-2B human normal bronchial epithelial cell culture (ATCC® CRL-9609 ™) before transfection and 48 hours after transfection of these cells with VTvaf17-IL12A DNA vector to assessing the ability to penetrate eukaryotic cells and functional activity, that is, expression of the target gene at the mRNA level.

Figure 5 shows the curves of accumulation of amplicons during the reaction, corresponding to:

1 - cDNA of the IL12A gene in a BEAS-2B cell culture prior to transfection with VTvaf17-IL12A DNA vector;

2 - cDNA of the IL12A gene in a BEAS-2B cell culture after transfection with VTvaf17-IL12A DNA vector;

3 - cDNA of the B2M gene in a BEAS-2B cell culture before transfection with VTvaf17-IL12A DNA vector;

4 - cDNA of the B2M gene in a BEAS-2B cell culture after transfection with VTvaf17-IL12A DNA vector.

The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene.

6

shows the graphs of the accumulation of cDNA amplicons of the target gene, namely the IL12B gene, in a BEAS-2B cell culture (ATCC® CRL-9609 ™) before transfection and 48 hours after transfection of these cells with VTvaf17-IL12B DNA vector to assess the ability to penetrate into eukaryotic cells and functional activity, that is, expression of the target gene at the mRNA level.

In Fig.6 marked curves of the accumulation of amplicons during the reaction, corresponding to:

1 - cDNA of the IL12B gene in BEAS-2B cell culture before transfection with VTvaf17-IL12B DNA vector;

2 - cDNA of the IL12B gene in a BEAS-2B cell culture after transfection with VTvaf17-IL12B DNA vector;

3 - cDNA of the B2M gene in BEAS-2B cell culture before transfection with VTvaf17-IL12B DNA vector;

4 - cDNA of the B2M gene in a BEAS-2B cell culture after transfection with VTvaf17-IL12B DNA vector.

The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene.

7

shows a concentration chart of IFNB1 protein in the cell lysate of a BEAS-2B human normal bronchial epithelial cell culture (ATCC® CRL-9609 ™) after transfection of these cells with VTvaf17-IFNB1 DNA vector to evaluate functional activity, i.e., expression at the protein level, by change the amount of IFNB1 protein in the cell lysate.

7, the following elements are marked:

culture A - culture BEAS-2B, transfected with an aqueous solution of dendrimers without plasmid DNA (control);

culture B - culture of BEAS-2B transfected with VTvaf17 DNA vector;

culture C is a culture of BEAS-2B transfected with VTvaf17-IFNB1 DNA vector.

In FIG. 8

shows the concentration chart of IFNA14 protein in a cell lysate of human peripheral blood mononuclear cell culture (PBMC), after transfection of these cells with VTvaf17-IFNA14 DNA vector to evaluate functional activity, i.e., expression of the target gene at the protein level, and the possibility of increasing the level of protein expression with using gene therapy DNA vector based on gene therapy DNA vector VTvaf17, carrying the target gene IFNA14.

On Fig marked the following elements:

Culture A — PBMC culture transfected with an aqueous solution of dendrimers without plasmid DNA (control);

Culture B — PBMC culture transfected with VTvaf17 DNA vector;

Culture C — Culture of PBMCs Transfected with VTvaf17-IFNA14 DNA Vector.

Fig.9

shows a concentration chart of IFNA2 protein in a lysate of a human gum fibroblast cell culture line HGF-1 (ATCC® CRL-2014 ™) after transfection of these cells with VTvaf17-IFNA2 DNA vector to evaluate functional activity, i.e., expression of the target gene at the protein level, and the possibility of increasing the level of protein expression using gene therapy DNA vector based on gene therapy DNA vector VTvaf17, carrying the target gene IFNA2.

In Fig.9 marked the following elements:

culture A — cell culture of human gum fibroblasts of the HGF-1 line transfected with an aqueous solution of dendrimers without plasmid DNA (control);

culture B — human gum fibroblast cell culture of the HGF-1 line transfected with VTvaf17 DNA vector;

culture C - cell culture of human gum fibroblasts of the HGF-1 line transfected with VTvaf17-IFNA2 DNA vector.

In FIG. 10

shows a concentration chart of IL12A protein in a human chondrocyte cell culture lysate of Human Chondrocytes (HC) (Cell Applications, Inc. Cat. 402K-05a) after transfection of these cells with VTvaf17-IL12A DNA vector to evaluate functional activity, i.e., target gene expression at protein, and the possibility of increasing the level of protein expression using gene therapy DNA vector based on the gene therapy DNA vector VTvaf17, carrying the target gene IL12A.

10, the following elements are marked:

culture A - cell culture of human chondrocytes Human Chondrocytes (HC), transfected with an aqueous solution of dendrimers without plasmid DNA (control);

culture B - cell culture of human chondrocytes Human Chondrocytes (HC), transfected with DNA vector VTvaf17;

culture C - cell culture of human chondrocytes Human Chondrocytes (HC), transfected with DNA vector VTvaf17-IL12A.

In FIG. eleven

shows a concentration chart of IL12B protein in a BEAS-2B human normal bronchial epithelial cell culture lysate (ATCC® CRL-9609 ™) after transfection of these cells with VTvaf17-IL12B DNA vector to evaluate functional activity, i.e., expression of the target gene at the protein level, and the possibility of increasing the level of protein expression using gene therapy DNA vector based on the gene therapy DNA vector VTvaf17 carrying the target gene IL12B.

10, the following elements are marked:

culture A — a culture of BEAS-2B cells transfected with an aqueous solution of dendrimers without plasmid DNA (control);

culture B — a culture of BEAS-2B cells transfected with VTvaf17 DNA vector;

culture C - a culture of BEAS-2B cells transfected with VTvaf17-IL12B DNA vector.

In FIG. 12

shows the concentration diagram of the IL12A protein in biopsy samples of the skin of three patients after introducing the VTvaf17-IL12A gene therapy DNA vector into the skin of these patients in order to evaluate the functional activity, that is, the expression of the target gene at the protein level, and the possibility of increasing the level of protein expression using the gene therapy DNA vector based on the gene therapy DNA vector VTvaf17 carrying the target gene IL12A.

On Fig marked the following elements:

P1I - biopsy of the patient’s skin P1 in the area of introduction of gene therapy DNA vector VTvaf17-IL12A;

P1II - biopsy of the skin of the patient P1 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

P1III - biopsy of the skin of the patient P1 from the intact area;

P2I - biopsy of the skin of patient P2 in the area of the introduction of gene therapy DNA vector VTvaf17-IL12A;

P2II - biopsy of the skin of patient P2 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

P2III - biopsy of the skin of the patient P2 from the intact area;

P3I - biopsy of the skin of the patient P3 in the area of introduction of gene therapy DNA vector VTvaf17-IL12A;

P3II - biopsy of the skin of the patient P3 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

P3III - biopsy of the skin of the patient P3 from the intact area.

In FIG. thirteen

shows a concentration chart of IFNA2 protein in biopsy specimens of the gastrocnemius muscle of three patients after introducing the VTvaf17-IFNA2 gene therapeutic DNA vector into the calf muscle of these patients in order to evaluate the functional activity, i.e., expression of the target gene at the protein level, and the possibility of increasing the level of protein expression using gene therapy A DNA vector based on the gene therapy VTvaf17 DNA vector carrying the target IFNA2 gene.

On Fig marked the following elements:

P1I - a biopsy of the gastrocnemius muscle of the patient P1 in the area of the introduction of gene therapy DNA vector VTvaf17-IFNA2;

P1II - biopsy of the gastrocnemius muscle of the patient P1 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

P1III - biopsy of the intact portion of the calf muscle of the patient P1;

P2I - biopsy of the gastrocnemius muscle of patient P2 in the area of the introduction of gene therapy DNA vector VTvaf17-IFNA2;

P2II - biopsy of the gastrocnemius muscle of patient P2 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

P2III - biopsy of the intact portion of the calf muscle of patient P2;

P3I - biopsy of the gastrocnemius muscle of the patient P3 in the area of the introduction of gene therapy DNA vector VTvaf17-IFNA2;

P3II - biopsy of the gastrocnemius muscle of the patient P3 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

P3III - biopsy of the intact portion of the calf muscle of the patient P3.

14

shows a concentration chart of IFNA14 protein in biopsy samples of the skin of three patients after introducing the VTvaf17-IFNA14 gene therapeutic DNA vector into the skin of these patients to evaluate functional activity, i.e., expression of the target gene at the protein level, and the possibility of increasing the level of protein expression using gene therapy DNA vector based on the gene therapy DNA vector VTvaf17 carrying the target gene IFNA14.

On Fig marked the following elements:

P1I - biopsy of the skin of the patient P1 in the area of introduction of gene therapy DNA vector VTvaf17-IFNA14;

P1II - biopsy of the skin of the patient P1 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

P1III - biopsy of the skin of the patient P1 from the intact area;

P2I - biopsy of the skin of patient P2 in the area of the introduction of gene therapy DNA vector VTvaf17-IFNA14;

P2II - biopsy of the skin of patient P2 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

P2III - biopsy of the skin of the patient P2 from the intact area;

P3I - biopsy of the skin of the patient P3 in the area of introduction of gene therapy DNA vector VTvaf17-IFNA14;

P3II - biopsy of the skin of the patient P3 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

P3III - biopsy of the skin of the patient P3 from the intact area.

In FIG. fifteen

shows the concentration chart of IFNA14 protein in human skin biopsies after introducing into the skin a culture of autologous fibroblasts transfected with VTvaf17-IFNA14 gene therapy DNA vector to demonstrate the method of administration by introducing autologous cells transfected with VTvaf17-IFNA14 gene therapy DNA vector.

On Fig marked the following elements:

P1C is a biopsy sample of the patient’s skin P1 in the injection zone of a patient’s autologous fibroblast culture transfected with VTvaf17-IFNA14 gene therapy DNA vector;

P1B - biopsy of the patient’s skin P1 in the injection zone of autologous fibroblasts of the patient transfected with the gene therapy VTvaf17 DNA vector;

P1A - biopsy of the skin of the patient P1 from the intact area.

In FIG. sixteen

shows a diagram of protein concentrations: human IFNB1 protein, human IFNA14 protein, human IFNA2 protein, human IL12A protein, human IL12B protein in the muscle tissue of three Wistar rats after injection of a mixture of gene therapy vectors: gene therapy DNA vector VTvaf17-IFNB1, gene therapy DNA vector VTvaf17-IFNA14, gene therapy DNA vector VTvaf17-IFNA2, gene therapy DNA vector VTvaf17-IL12A, gene therapy DNA vector VTvaf17-IL12B to demonstrate how to use a mixture of gene therapy DNA vectors.

In Fig.16 marked the following elements:

K1I is a fragment of muscle tissue of rat K1 in the injection zone of a mixture of gene therapy DNA vectors: VTvaf17-IFNB1, VTvaf17-IFNA14, VTvaf17-IFNA2, VTvaf17-IL12A and VTvaf17-IL12B;

K1II - a fragment of muscle tissue of rat K1 in the area of introduction of gene therapy DNA vector VTvaf17 (placebo);

K1III - a fragment of muscle tissue of the control intact section of rat K1;

K2I is a fragment of muscle tissue of rat K2 in the injection zone of a mixture of gene therapy DNA vectors: VTvaf17-IFNB1, VTvaf17-IFNA14, VTvaf17-IFNA2, VTvaf17-IL12A and VTvaf17-IL12B;

K2II - a fragment of muscle tissue of rat K2 in the area of the introduction of gene therapy DNA vector VTvaf17 (placebo);

K2III - a fragment of muscle tissue of the control intact section of rat K2;

K3I is a fragment of muscle tissue of rat K3 in the injection zone of a mixture of gene therapy DNA vectors: VTvaf17-IFNB1, VTvaf17-IFNA14, VTvaf17-IFNA2, VTvaf17-IL12A and VTvaf17-IL12B;

K3II - a fragment of muscle tissue of rat K3 in the area of introduction of gene therapy DNA vector VTvaf17 (placebo);

K3III - a fragment of muscle tissue of the control intact section of rat K3.

In FIG. 17

graphs of accumulation of cDNA amplicons of the target IFNA2 gene in bovine peripheral blood mononuclear cells (PBMC) are shown before and 48 hours after transfection of these cells with VTvaf17-IFNA2 DNA vector in order to demonstrate the method of application by introducing gene therapy DNA vector to animals.

On Fig marked curves of accumulation of amplicons during the reaction, corresponding to:

1 - IFNA2 gene cDNA in bovine PBMC cells prior to transfection with VTvaf17-IFNA2 gene therapy DNA vector;

2 - IFNA2 gene cDNA in bovine PBMC cells after transfection with VTvaf17-IFNA2 gene therapy DNA vector;

3 - ACT gene cDNA in bovine PBMC cells prior to transfection with VTvaf17-IFNA2 gene therapy DNA vector;

4 - ACT gene cDNA in bovine PBMC cells after transfection with VTvaf17-IFNA2 gene therapy DNA vector;

The bovine / cow actin gene (AST) shown in the GenBank database under number AH001130.2 was used as the reference gene.

The implementation of the invention

Based on VTvaf17 DNA Vector 3165 bp Gene therapy DNA vectors containing target human genes designed to increase the level of expression of these target genes in human and animal tissues have been created. Moreover, the method for producing each gene therapy DNA vector carrying the target genes is to clone the protein coding sequence of the target gene selected from the group of genes into the polylinker of the gene therapy DNA vector VTvaf17: IFNB1 gene (encodes IFNB1 protein), IFNA14 gene (encodes IFNA14 protein), IFNA2 gene (encodes IFNA2 protein), IL12A gene (encodes IL12A protein), IL12B gene (encodes IL12B protein) of a person. It is known that the ability of DNA vectors to penetrate eukaryotic cells is mainly due to the size of the vector. In this case, the DNA vectors with the smallest size have a higher penetrating ability. Thus, it is preferable that the vector contains no elements that do not carry a functional load, but which increase the size of the DNA vector. These features of DNA vectors were taken into account when preparing a gene therapy DNA vector based on the VTvaf17 gene therapy DNA vector that carries the target gene selected from the group of IFNB1, IFNA14, IFNA2, IL12A, IL12B genes by the absence of large non-functional sequences and antibiotic resistance genes in the vector, which made it possible, in addition to technological advantages and safety benefits, to significantly reduce the size of the resulting gene therapy VTvaf17 DNA vector carrying the target gene selected from groups of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B. Thus, the ability to penetrate into eukaryotic cells of the resulting gene therapy DNA vector is due to its small size.

Each of the gene therapy DNA vectors: DNA vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B was prepared as follows: the coding portion of the target gene IFNB1, or IFNA14, or IFNA2, or IL12A or IL12B was cloned into VTvaf17 gene therapy DNA vector and VTvaf17-IFNB1 gene therapy DNA vector, SEQ ID NO. 1, or VTvaf17-IFNA14, SEQ ID NO. 2 or VTvaf17-IFNA2, SEQ ID No 3, or VTvaf17-IL12A, was obtained SEQ ID No. 4, or VTvaf17-IL12B, SEQ ID No. 5, respectively. The coding portion of the 565 bp IFNB1 gene, or 571 bp IFNA14 gene, or 568 bp IFNA2 gene, or 766 bp IL12A gene, or 988 bp IL12B gene. obtained by isolating total RNA from a biological sample of healthy human tissue. The reverse transcription reaction was used to obtain the first cDNA strand of the IFNB1, IFNA14, IFNA2, IL12A, IL12B genes. Amplification was carried out using oligonucleotides created for this by chemical synthesis. The amplification product was digested with specific restriction endonucleases taking into account the optimal procedure for further cloning, and cloning into the VTvaf17 gene therapy DNA vector was performed at the restriction sites BamHI, EcoRI, HindIII, KpnI, SalI located in the polylinker of the VTvaf17 vector. The choice of restriction sites was carried out so that the cloned fragment fell into the reading frame of the expression cassette of the VTvaf17 vector, while the protein coding sequence did not contain restriction sites for the selected endonucleases. Moreover, it will be understood by those skilled in the art that the methodological implementation of the preparation of the gene therapeutic DNA vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B may vary within the framework of the selection of known methods for molecular cloning of genes , however, these methods fall within the scope of the present invention. For example, different oligonucleotide sequences can be used to amplify the IFNB1, or IFNA14, or IFNA2, or IL12A, or IL12B gene, various restriction endonucleases, or laboratory techniques such as ligase-free gene cloning.

The gene therapy DNA vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B has the nucleotide sequence of SEQ ID No. 1 or SEQ ID No. 2 or SEQ ID No. 3 or SEQ ID No. 4 or SEQ ID No. 5, respectively. Moreover, specialists in the art know the property of degeneracy of the genetic code, from which it follows that the scope of the present invention also includes variants of nucleotide sequences that differ in insertion, deletion or replacement of nucleotides that do not lead to a change in the polypeptide sequence encoded by the target gene, and / or do not lead to a loss of functional activity of the regulatory elements of the VTvaf17 vector. Moreover, specialists in the art know the phenomenon of genetic polymorphism, from which it follows that the scope of the present invention also includes variants of nucleotide sequences of genes from the group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B which at the same time encode various amino acid sequences of IFNB1 proteins, IFNA14, IFNA2, IL12A, IL12B are not different from those given in their functional activity under physiological conditions.

The ability to penetrate into eukaryotic cells and functional activity, that is, the ability to express the target gene obtained from the gene therapy of the DNA therapeutic vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B, is confirmed by introducing into eukaryotic cells the resulting vector and subsequent analysis of the expression of a specific mRNA and / or protein product of the target gene. The presence of specific mRNA in cells into which the gene therapy DNA vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B was introduced indicates both the ability of the obtained vector to penetrate eukaryotic cells and about its ability to express the mRNA of the target gene. Moreover, as is known to specialists in this field of technology, the presence of a mRNA gene is a prerequisite, but not proof of translation of the protein encoded by the target gene. Therefore, to confirm the properties of the gene therapy DNA vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B to express the target gene at the protein level in eukaryotic cells into which the gene therapy DNA vector has been introduced, analyze the concentration of proteins encoded by the target genes using immunological methods. The presence of IFNB1, or IFNA14, or IFNA2, or IL12A, or IL12B confirms the efficiency of expression of target genes in eukaryotic cells and the possibility of increasing the protein concentration using gene therapy DNA vector based on VTvaf17 gene therapy DNA vector carrying the target gene selected from the group IFNB1, IFNA14, IFNA2, IL12A, IL12B genes. Thus, to confirm the expression efficiency of the created gene therapy DNA vector VTvaf17-IFNB1 carrying the target gene, namely, the IFNB1 gene therapy DNA vector VTvaf17-IFNA14 carrying the target gene, namely the IFNA14 gene, the gene therapy DNA vector VTvaf17-IFNA2 using the target gene, namely, the IFNA2 gene, VTvaf17-IL12A gene therapy DNA vector, which is the target gene, namely, the IL12A gene, VTvaf17-IL12B gene therapy DNA vector, carrying the target gene, namely the IL12B gene, the following methods were used :

A) real-time PCR - a change in the accumulation of cDNA amplicons of target genes in the lysate of human and animal cells, after transfection of various human and animal cell lines with gene therapy DNA vectors;

B) Enzyme-linked immunosorbent assay - a change in the quantitative level of target proteins in the lysate of human cells, after transfection of various human cell lines with gene therapy DNA vectors;

C) Enzyme-linked immunosorbent assay - a change in the quantitative level of target proteins in the supernatant of biopsy samples of human and animal tissues, after the introduction of gene therapy DNA vectors into these tissues;

D) Enzyme-linked immunosorbent assay - a change in the quantitative level of target proteins in the supernatant of biopsy samples of human tissues, after the introduction of these cells autologous cells of this person, transfected with gene therapy DNA vectors.

To confirm the feasibility of the method of using the created gene therapy DNA vector VTvaf17-IFNB1 carrying the target gene, namely the IFNB1 gene therapy DNA vector VTvaf17-IFNA14 carrying the target gene, namely the IFNA14 gene, gene therapy DNA vector VTvaf17-IFNA2, carrying the target gene, namely, the IFNA2 gene, the gene therapy DNA vector VTvaf17-IL12A, carrying the target gene, namely the gene IL12A, the gene therapy DNA vector VTvaf17-IL12B, carrying the target gene, namely the IL12B gene, performed:

A) transfection with gene therapy DNA vectors of various cell lines of humans and animals;

B) the introduction of gene therapy DNA vectors into various tissues of humans and animals;

C) introducing into the animal tissue a mixture of gene therapy DNA vectors;

D) the introduction into the human tissue of autologous cells transfected with gene therapy DNA vectors.

The indicated methods of application are characterized by the absence of potential risks for the genetic therapy of humans and animals due to the absence of regulatory elements representing the nucleotide sequences of the viral genomes in the gene therapy DNA vector and due to the absence of antibiotic resistance genes in the DNA therapy vector, which is confirmed by the absence sites homologous to viral genomes and antibiotic resistance genes in the nucleotide sequences of gene therapy of the VTvaf17-IFNB1 DNA therapeutic vector, or VTvaf17-IFNA14 gene therapeutic DNA vector, or VTvaf17-IFNA2 gene therapeutic DNA vector, or VTvaf17-IL12A gene therapeutic DNA vector or VTvaf17-IL12B gene therapeutic DNA vector (SEQ ID No. 1 or SEQ ID No. 2 or SEQ ID No. 3 or SEQ ID No. 4 or SEQ ID No. 5, respectively).

As is known to those skilled in the art, antibiotic resistance genes as part of gene therapy DNA vectors are used to prepare these vectors in preparative amounts by increasing bacterial biomass in a nutrient medium containing a selective antibiotic. In the framework of the present invention, in order to ensure the safe use of the gene therapy VTvaf17 DNA vector carrying the target gene IFNB1 or IFNA14 or IFNA2 or IL12A or IL12B, the use of selective growth media containing an antibiotic is not possible. As a technological solution for obtaining the gene therapy VTvaf17 DNA vector carrying the target gene selected from the group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B to scale up to the industrial scale of obtaining gene therapy vectors, a method for producing strains for producing the indicated gene therapy vectors based on bacteria is proposed Escherichia coli SCS110-AF. A method of obtaining a strain of Escherichia coli SCS110-AF / VTvaf17-IFNB1 or a strain of Escherichia coli SCS110-AF / VTvaf17-IFNA14, or a strain of Escherichia coli SCS110-AF / VTvaf17-IFNA2, or a strain of Escherichia coli SCS110-AF / VTavia17 IL coli SCS110-AF / VTvaf17-IL12B consists in obtaining competent cells of the Escherichia coli strain SCS110-AF with the introduction of the gene therapy DNA vector VTvaf17-IFNB1, or DNA vector VTvaf17-IFNA14, or DNA vector VTvaf17-IFNA2, or DNA vector VTvaf17-IL12A, or DNA vector VTvaf17-IL12B, respectively, using the methods of transformation (electroporation), well-known specialists in this field of technology. The resulting Escherichia coli strain SCS110-AF / VTvaf17-IFNB1, or the Escherichia coli strain SCS110-AF / VTvaf17-IFNA14, or the Escherichia coli strain SCS110-AF / VTvaf17-IFNA2, or the Escherichia coli strain SCS110-AF / VTvaf17 Escherichia coli SCS110-AF / VTvaf17-IL12B is used to generate the gene therapy DNA vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B, respectively, with the possibility of using media without antibiotic content.

To confirm the receipt of the strain Escherichia coli SCS110-AF / VTvaf17-IFNB1, or the strain Escherichia coli SCS110-AF / VTvaf17-IFNA14, or the strain Escherichia coli SCS110-AF / VTvaf17-IFNA2, or the strain Escherichia coli SCS110-AF / VTAvaf17 or Escherichia coli strain SCS110-AF / VTvaf17-IL12B was transformed, selected and subsequently expanded with plasmid DNA.

To confirm the technological feasibility of obtaining and the possibility of scaling up the industrial production of the gene therapy VTvaf17-IFNB1 DNA vector that carries the target gene, namely the IFNB1 gene, the VTvaf17-IFNA14 gene therapy DNA vector that carries the target gene, namely the IFNA14 gene, the gene therapy DNA vector VTvaf17-IFNA2 carrying the target gene, namely, the IFNA2 gene, the gene therapy DNA vector VTvaf17-IL12A, carrying the target gene, namely the gene IL12A, the gene therapy DNA vector VTvaf17-IL12B, carrying the target gene, namely the IL12B gene, performed fermentation in prom the scale of the Escherichia coli strain SCS110-AF / VTvaf17-IFNB1 or the Escherichia coli strain SCS110-AF / VTvaf17-IFNA14 or the Escherichia coli strain SCS110-AF / VTvaf17-IFNA2 or the Escherichia coli strain SCS110-AF / Escherichia coli SCS110-AF / VTheraf17 coli SCS110-AF / VTvaf17-IL12B, each of which contains the gene therapy VTvaf17 DNA vector carrying the target gene, namely IFNB1, or IFNA14, or IFNA2, or IL12A, or IL12B.

A method of scaling the production of bacterial mass to an industrial scale for the isolation of the gene therapy VTvaf17 DNA vector carrying the target gene selected from the group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B is that the seed culture of the strain Escherichia coli SCS110-AF / VTvaf17-IFNB1 or a strain of Escherichia coli SCS110-AF / VTvaf17-IFNA14, or a strain of Escherichia coli SCS110-AF / VTvaf17-IFNA2, or a strain of Escherichia coli SCS110-AF / VTvaf17-IL12A, or a strain of Escherichia coli SCS110-AF / VTBaf17 IL the volume of the nutrient medium without antibiotic content providing the appropriate dynamics of biomass accumulation, upon reaching To obtain a sufficient amount of biomass in the logarithmic growth phase, the bacterial culture is transferred to an industrial fermenter, then grown until a stationary growth phase is reached, then a fraction containing the desired DNA product - gene therapy DNA vector VTvaf17-IFNB1, or gene therapy DNA vector VTvaf17- is isolated IFNA14, or gene therapy DNA vector VTvaf17-IFNA2, or gene therapy DNA vector VTvaf17-IL12A or gene therapy DNA vector VTvaf17-IL12B are multi-stage filtered and purified by chromatographic methods. At the same time, it will be understood by those skilled in the art that the conditions for the cultivation of the strains, the composition of the culture media (excluding antibiotic content), the equipment used, and DNA purification methods can vary within standard operating procedures depending on a single production line, but there are known approaches to scaling , industrial production and purification of DNA vectors using Escherichia coli strain SCS110-AF / VTvaf17-IFNB1, or Escherichia coli strain SCS110-AF / VTvaf17-IFNA14, or Escherichia coli strain SCS110-AF / VTvaf17-IFNA2, or Esch strain erichia coli SCS110-AF / VTvaf17-IL12A, or Escherichia coli strain SCS110-AF / VTvaf17-IL12B or are within the scope of the present invention.

The disclosed disclosure is supported by examples of implementation of the present invention.

The invention is illustrated by the following examples.

Example 1.

Obtaining gene therapy DNA vector VTvaf17-IFNB1, carrying the target gene, namely, the gene IFNB1.

The gene therapy DNA vector VTvaf17-IFNB1 was constructed by cloning the coding portion of the 565 bp IFNB1 gene. in the DNA vector VTvaf17 size 3165 bp restriction sites BamHI and EcoRI. The coding part of the IFNB1 gene size of 565 bp obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction using a commercial Mint-2 kit (Eurogen, Russia) and PCR amplification using oligonucleotides:

IFNB1_F AGGATCCACCATGACCAACAAGTGTCTCCTC

IFNB1_R ATAGAATTCAGTTTCGGAGGTAACCTGTAAG

and the commercial Phusion® High-Fidelity DNA Polymerase kit (New England Biolabs, USA).

The gene therapy DNA vector VTvaf17 was constructed by combining six DNA fragments obtained from various sources:

(a) the origin of replication was obtained by PCR amplification of a portion of the commercial plasmid pBR322 with the introduction of a point mutation;

(b) the EF1a promoter region was obtained by PCR amplification of a portion of human genomic DNA;

(c) hGH-TA transcription terminator was obtained by PCR amplification of a portion of human genomic DNA;

(d) the regulatory region of the Tn10 RNA-out transposon was obtained by synthesis from oligonucleotides;

(e) the kanamycin resistance gene was obtained by PCR amplification of a portion of the commercial human pET-28 plasmid;

(e) polylinker was obtained by annealing two synthetic oligonucleotides.

PCR amplification was performed using a commercial Phusion® High-Fidelity DNA Polymerase kit (New England Biolabs, USA) in accordance with the manufacturer's instructions. Fragments have overlapping regions for the possibility of combining them with subsequent PCR amplification. Fragments (a) and (b) were combined using Ori-F and EF1-R oligonucleotides, as well as fragments (c), (d) and (e) using hGH-F and Kan-R oligonucleotides. Next, the obtained sites were combined by restriction followed by ligation at the BamHI and NcoI sites. The result was a plasmid, not yet containing polylinker. For its introduction, the plasmid was digested at the BamHI and EcoRI sites and ligated with fragment (e). Thus, a 3165 bp vector was obtained carrying the kanamycin resistance gene, which is flanked by SpeI restriction sites. Next, this site was digested at SpeI restriction sites, after which the remaining fragment was ligated onto itself. Thus, a gene therapy VTvaf17 DNA vector of 3165 bp was obtained, which is recombinant, with the possibility of selection without antibiotics.

The digestion of the amplification product of the coding part of the IFNB1 gene and VTvaf17 DNA vector was performed by restriction endonucleases BamHI and EcoRI (New England Biolabs, USA).

The result was the DNA vector VTvaf17-IFNB1 size of 3706 bp with the nucleotide sequence of SEQ ID No. 1 and the General structure depicted in figa.

Example 2.

Obtaining the gene therapeutic DNA vector VTvaf17-IFNA14 carrying the target gene, namely, the IFNA14 gene.

The gene therapy DNA vector VTvaf17-IFNA14 was constructed by cloning the coding portion of the IFNA14 gene of 571 bp in size. in the DNA vector VTvaf17 size 3165 bp restriction sites BamHI and EcoRI. The coding part of the IFNA14 gene size 571 bp obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction using a commercial Mint-2 kit (Eurogen, Russia) and PCR amplification using oligonucleotides:

IFNA14_F AGGATCCACCATGGCATTGCCCTTTGCTTTAATG

IFNA14_R TATGAATTCAATCCTTCCTCCTTAATCTTTTTTGC

and the commercial Phusion® High-Fidelity DNA Polymerase kit (New England Biolabs, USA), the amplification product and VTvaf17 DNA vector were digested with BamHI and EcoRI restriction endonucleases (New England Biolabs, USA).

The result was the DNA vector VTvaf17-IFNA14 size 3712 bp with the nucleotide sequence of SEQ ID No. 2 and the General structure depicted in figv.

In this case, the gene therapy DNA vector VTvaf17 was designed according to Example 1.

Example 3

Obtaining DNA vector VTvaf17-IFNA2, carrying the target gene, namely, the human IFNA2 gene.

The gene therapy DNA vector VTvaf17-IFNA2 was constructed by cloning the coding portion of the 568 bp IFNA2 gene. in the DNA vector VTvaf17 size 3165 bp restriction sites BamHI and EcoRI. The coding portion of the 568 bp IFNA2 gene obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction using a commercial Mint-2 kit (Eurogen, Russia) and PCR amplification using oligonucleotides:

IFNA2_F AGGATCCACCATGGCCTTGACCTTTGCTTTAC

IFNA2_R TATGAATTCATTCCTTACTTCTTAAACTTTCTTG

and the commercial Phusion® High-Fidelity DNA Polymerase kit (New England Biolabs, USA), the amplification product and VTvaf17 DNA vector were digested with BamHI and EcoRI restriction endonucleases (New England Biolabs, USA).

The result was a DNA vector VTvaf17-IFNA2 size of 3709 bp with the nucleotide sequence of SEQ ID No. 3 and the General structure depicted in figs.

In this case, the gene therapy DNA vector VTvaf17 was designed according to Example 1.

Example 4.

Obtaining gene therapy DNA vector VTvaf17-IL12A, carrying the target gene, namely, the gene IL12A.

The gene therapy DNA vector VTvaf17-IL12A was constructed by cloning the coding portion of the 766 bp IL12A gene. in the DNA vector VTvaf17 size 3165 bp restriction sites SalI, KpnI. The coding part of the gene IL12A size 766 bp obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction using a commercial Mint-2 kit (Eurogen) and PCR amplification using oligonucleotides:

IL12A_F ATCGTCGACCACCATGTGGCCCCCTGGGTCA

IL12A_R TTCGGTACCTTAGGAAGCATTCAGATAGCTCATC

and the commercial Phusion® High-Fidelity DNA Polymerase kit (New England Biolabs, USA), the amplification product and VTvaf17 DNA vector were digested with restriction endonucleases SalI, KpnI (New England Biolabs, USA).

As a result, the DNA vector VTvaf17-IL12A of 3925 bp was obtained. with the nucleotide sequence of SEQ ID No. 4 and the General structure depicted in fig.1D.

In this case, the gene therapy DNA vector VTvaf17 was designed according to Example 1.

Example 5

Obtaining gene therapy DNA vector VTvaf17-IL12B carrying the target gene, namely, the gene IL12B.

The gene therapeutic DNA vector VTvaf17-IL12B was constructed by cloning the coding portion of the 988 bp IL12B gene. in the DNA vector VTvaf17 size 3165 bp restriction sites BamHI, HindIII. The coding portion of the IL12B gene is 988 bp in size. obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction using a commercial Mint-2 kit (Eurogen) and PCR amplification using oligonucleotides:

IL12B_F AGGATCCACCATGTGTCACCAGCAGTTGGTC,

IL12B_R TGTAAGCTTAACTGCAGGGCACAGATGC

and the commercial Phusion® High-Fidelity DNA Polymerase kit (New England Biolabs, USA), the amplification product and VTvaf17 DNA vector were digested with restriction endonucleases BamHI, HindIII (New England Biolabs, USA).

The result was a DNA vector VTvaf17-IL12B size 4141 bp with the nucleotide sequence of SEQ ID No. 5 and the General structure depicted in figa.

In this case, the gene therapy DNA vector VTvaf17 was designed according to Example 1.

Example 6

Confirmation of the ability of the gene therapeutic DNA vector VTvaf17-IFNB1 carrying the target gene, namely, the IFNB1 gene, to penetrate eukaryotic cells and confirmation of its functional activity at the level of mRNA expression of the target gene. This example also demonstrates the feasibility of using a gene therapy DNA vector carrying the target gene.

Changes in the mRNA accumulation of the target IFNB1 gene were evaluated in a culture of normal human bronchial epithelium BEAS-2B (ATCC® CRL-9609 ™) 48 hours after their transfection with the gene therapy DNA vector VTvaf17-IFNB1 carrying the human IFNB1 gene. The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PRC reaction.

To assess changes in mRNA accumulation of the target IFNB1 gene, a BEAS-2B human cell culture was used. The BEAS-2B cell culture was grown under standard conditions (37 ° C, 5% CO2) using a BEGM culture medium preparation kit (Lonza / Clonetics Corporation, No. CC-3170). In the process of cultivation, a growth medium changed every 48 hours.

To obtain 90% confluency, 24 hours before transfection, cells were plated in a 24-well plate at a rate of 5 × 10⁴cells / well. Transfection with VTvaf17-IFNB1 gene therapy DNA vector expressing the human IFNB1 gene was performed using Lipofectamine 3000 (ThermoFisher Scientific, USA) according to the manufacturer's recommendations. In tube No. 1, 1 μl of VTvaf17-IFNB1 DNA vector solution (concentration 500 ng / μl) and 1 μl of P3000 reagent were added to 25 μl of Opti-MEM medium (Gibco, USA). Gently mixed with gentle shaking. In tube No. 2, 1 μl of Lipofectamin 3000 solution was added to 25 μl of Opti-MEM medium (Gibco, USA). Gently mixed with gentle shaking. The contents of tube No. 1 were added to the contents of tube No. 2, incubated for 5 min at room temperature. The resulting solution was added dropwise to the cells in a volume of 40 μl.

The BEAS-2B cells transfected with the VTvaf17 gene therapy DNA vector containing the target gene insert (IFNB1 cDNA before and after transfection with the VTvaf17 gene therapy DNA containing the target gene insert was not transfected in the figures were used as a control). The control vector VTvaf17 for transfections were performed as described above.

Total RNA from BEAS-2B cells was isolated using Trizol Reagent (Invitrogen, USA) according to the manufacturer's recommendations. 1 ml of Trizol Reagent was added to the cell well and homogenized, followed by heating for 5 min at 65 ° C. Next, the sample was centrifuged at 14000g for 10 min and again heated for 10 min at 65 ° C. Then 200 μl of chloroform was added, smoothly mixed and centrifuged at 14000g for 10 minutes. Then the aqueous phase was selected, 1/10 volume of 3M sodium acetate, pH 5.2 and an equal volume of isopropyl alcohol were added to it. The sample was incubated at -20 ⁰ С for 10 min, followed by centrifugation at 14000g for 10 min. The precipitate was washed with 1 ml of 70% ethanol, dried in air and dissolved in 10 μl of RNase-free water. Determination of the level of mRNA expression of the IFNB1 gene after transfection was carried out by assessing the dynamics of accumulation of cDNA amplicons by real-time PCR. To obtain and amplify cDNA specific for the human IFNB1 gene, the oligonucleotides IFNB1_SF and IFNB1_SR were used:

IFNB1_SF TGGCAATTGAATGGGAGAGCT

IFNB1_FR GTCTCATTCCAGCCAGTGCT

The length of the amplification product is 182 bp

The reverse transcription reaction and PCR amplification was performed using the SYBR GreenQuantitect RT – PCR Kit (Qiagen, USA) for real-time PCR. The reaction was carried out in a volume of 20 μl, containing: 25 μl QuantiTect SYBR Green RT-PCR MasterMix, 2.5 mm magnesium chloride, 0.5 μm of each primer, 5 μl of RNA. The reaction was carried out on a CFX96 thermocycler (Bio-Rad, USA) under the following conditions: 1 reverse transcription cycle at 42 ° C for 30 minutes, denaturation 98 ° C for 15 minutes, then 40 cycles including denaturation 94 ° C for 15 sec, annealing primers 60 ° C for 30 sec and elongation of 72 ° C for 30 sec. The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene. As a positive control, amplicons obtained by PCR on matrices representing plasmids at known concentrations containing cDNA sequences of the IFNB1 and B2M genes were used. As a negative control, deionized water was used. The number of dynamics of accumulation of cDNA amplicons of the IFNB1 and B2M genes was evaluated in real time using the Bio-RadCFXManager 2.1 amplifier software (Bio-Rad, USA). The graphs obtained as a result of the analysis are presented in FIG. 2.

From figure 2 it follows that as a result of transfection of a culture of human bronchial epithelial cells BEAS-2B gene therapy DNA vector VTvaf17-IFNB1, the level of specific mRNA of the human IFNB1 gene grew many times, which confirms the ability of the vector to penetrate eukaryotic cells and express the IFNB1 gene at the mRNA level. The presented results also confirm the feasibility of the method of using the gene therapy VTvaf17-IFNB1 DNA vector to increase the level of expression of the IFNB1 gene in eukaryotic cells.

Example 7

Confirmation of the ability of the gene therapeutic DNA vector VTvaf17-IFNA14 carrying the target gene, namely, the IFNA14 gene, to penetrate eukaryotic cells and confirmation of its functional activity at the level of mRNA expression of the target gene. This example also demonstrates the feasibility of using a gene therapy DNA vector carrying the target gene.

Changes in the mRNA accumulation of the target IFNA14 gene were evaluated in a culture of human peripheral blood mononuclear cells 48 hours after their transfection with the VTvaf17-IFNA14 gene therapy DNA vector carrying the human IFNA14 gene. The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PRC reaction.

The primary cell culture of a human peripheral blood mononuclear cell culture was isolated from 10 ml of healthy volunteer venous blood by centrifugation in 1.09 ficoll solution (Paneko, P051) and cultured in RPMI Media 1640 (GIBCO®, 11875-085) supplemented with 10% horse Horse Serum serum (ATCC® 30-2040 ™) under standard conditions (37 ° C, 5% CO2). To obtain 90% confluency, 24 hours before transfection, cells were plated in a 24-well plate at a rate of 5 × 10 ⁴ cells / well. Lipofectamine 3000 reagent (ThermoFisher Scientific, USA) was used for transfection. Transfection with VTvaf17-IFNA14 gene therapy DNA vector expressing the human IFNA14 gene was performed as described in Example 5. The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene. As a control, a human osteosarcoma cell culture MG-63 was used, transfected with VTvaf17 gene therapy DNA vector that did not carry the target gene (IFNA14 cDNA before and after transfection with VTvaf17 gene therapy DNA vector that did not contain the target gene insert in the figures is not shown. RNA isolation, the reverse transcription reaction and real-time PCR was performed as described in example 5, with the exception of oligonucleotides with different sequences from example 5. To amplify the cDNA specific for the human IFNA14 gene, used oligonucleotides IFNA14_SF and IFNA14_SR:

IFNA14_SF GGCAACCAGTTCCAGAAAGC

IFNA14_SR CACACAGGCTTCCAGGTCAT

Amplification Product Length - 168 bp

As a positive control, amplicons obtained by PCR on matrices representing plasmids at known concentrations containing cDNA sequences of the IFNA14 and B2M genes were used. As a negative control, deionized water was used. The number of PCR products - cDNA gene IFNA14 and B2M obtained as a result of amplification were evaluated in real time using the software of the Bio-RadCFXManager 2.1 amplifier (Bio-Rad, USA). The graphs obtained as a result of the analysis are presented in FIG. 3.

From figure 3 it follows that as a result of transfection of a culture of mononuclear cells of human peripheral blood gene therapy DNA vector VTvaf17-IFNA14, the level of specific mRNA of the human IFNA14 gene increased many times, which confirms the ability of the vector to penetrate eukaryotic cells and express the IFNA14 gene at the mRNA level. The presented results also confirm the feasibility of the method of using the gene therapy VTvaf17-IFNA14 DNA vector to increase the level of expression of the IFNA14 gene in eukaryotic cells.

Example 8

Confirmation of the ability of the gene therapeutic DNA vector VTvaf17-IFNA2 carrying the target gene, namely, the IFNA2 gene, to penetrate eukaryotic cells and confirmation of its functional activity at the level of mRNA expression of the target gene. This example also demonstrates the feasibility of using a gene therapy DNA vector carrying the target gene.

Changes in the mRNA accumulation of the target IFNA2 gene in a human gum fibroblast cell culture of the HGF-1 line (ATCC® CRL-2014 ™) were evaluated 48 hours after their transfection with the VTvaf17-IFNA2 gene therapeutic vector carrying the human IFNA2 gene. The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PRC reaction.

HGF-1 human gum fibroblast cell culture (ATCC® CRL-2014 ™) was grown in Dulbecco's Modified Eagle's Medium (DMEM) (ATCC® 30-2002 ™) supplemented with 10% cattle serum (ATCC® 30-2020 ™ ) under standard conditions (37 ° C, 5% CO2). To obtain 90% confluency, 24 hours before transfection, cells were plated in a 24-well plate at a rate of 5 × 10 ⁴ cells / well. Lipofectamine 3000 reagent (ThermoFisher Scientific, USA) was used for transfection. Transfection with VTvaf17-IFNA2 gene therapy DNA vector expressing the human IFNA2 gene was carried out as described in Example 5. The B2M gene (Beta-2 microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene. As a control, we used a culture of HGF-1 human gum fibroblast cells transfected with the VTvaf17 gene therapy DNA vector that did not carry the target gene (cDNA of the IFNA2 gene before and after transfection with the VTvaf17 gene therapy DNA vector that did not contain the target gene insert in the figures is not shown. Isolation RNA, the reverse transcription reaction, and real-time PCR were performed as described in Example 5, except for oligonucleotides with sequences differing from Example 5. To amplify cDNA specific for the IFNA2 gene sheep, used oligonucleotides IFNA2_SF and IFNA2_SR:

IFNA2_SF AGCTGAATGACCTGGAAGCC

IFNA2_SR CTGCTCTGACAACCTCCCAG

Amplification Product Length - 165 bp

As a positive control, amplicons obtained by PCR on matrices representing plasmids at known concentrations containing cDNA sequences of IFNA2 and B2M genes were used. As a negative control, deionized water was used. Number of PCR products - cDNA of IFNA2 genes and B2M obtained as a result of amplification were evaluated in real time using the software of the Bio-RadCFXManager 2.1 amplifier (Bio-Rad, USA). The graphs obtained as a result of the analysis are presented in FIG. 4.

From figure 4 it follows that as a result of transfection of a culture of human gum fibroblast cells of the HGF-1 line with the gene therapeutic DNA vector VTvaf17-IFNA2, the specific mRNA of the human IFNA2 gene grew many times, which confirms the ability of the vector to penetrate eukaryotic cells and express the IFNA2 gene at the mRNA level. The presented results also confirm the feasibility of the method of using the gene therapy VTvaf17-IFNA2 DNA vector to increase the level of expression of the IFNA2 gene in eukaryotic cells.

Example 9

Confirmation of the ability of the gene therapeutic DNA vector VTvaf17-IL12A carrying the target gene, namely, the IL12A gene, to penetrate eukaryotic cells and confirmation of its functional activity at the level of mRNA expression of the target gene. This example also demonstrates the feasibility of using a gene therapy DNA vector carrying the target gene.

Changes in the mRNA accumulation of the target IL12A gene were evaluated in a BEAS-2B human normal bronchial epithelial cell culture (ATCC® CRL-9609 ™) 48 hours after their transfection with the VTvaf17-IL12A gene therapeutic DNA gene carrying the human IL12A gene. The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PRC reaction.

A BEAS-2B human cell culture was grown using the BEGM culture medium preparation kit (Lonza / Clonetics Corporation, No. CC-3170) under standard conditions (37 ° C, 5% CO2). To obtain 90% confluency, 24 hours before transfection, cells were plated in a 24-well plate at a rate of 5 × 10 ⁴ cells / well. Lipofectamine 3000 reagent (ThermoFisher Scientific, USA) was used for transfection. Transfection with the gene therapy VTvaf17-IL12A DNA vector expressing the human IL12A gene was carried out as described in Example 5. As a control, a BEAS-2B line of human chondrocyte cells transfected with the VTvaf17 gene therapy DNA vector transfected without the target gene was used (IL12A gene cDNA up to and after transfection with VTvaf17 gene therapy DNA vector that does not contain the target gene insert, the figures are not shown in Fig. RNA isolation, reverse transcription reaction and real-time PCR was performed as described in example 5, except for ol gonucleotides with sequences differing from Example 5. To amplify the cDNA specific for the human IL12A gene, the oligonucleotides IL12A_SF and IL12A_SR were used:

IL12A_SF GCTCCAGAAGGCCAGACAAA

IL12A_SR GCCAGGCAACTCCCATTAGT

The length of the amplification product is 183 bp

As a positive control, amplicons obtained by PCR on matrices representing plasmids at known concentrations containing cDNA sequences of the IL12A and B2M genes were used. The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene. As a negative control, deionized water was used. The number of PCR products - cDNA of IL12A genes and B2M obtained as a result of amplification were evaluated in real time using the software of the Bio-RadCFXManager 2.1 amplifier (Bio-Rad, USA). The graphs obtained as a result of the analysis are presented in FIG. 5.

From figure 5 it follows that as a result of transfection of a culture of human cells of the BEAS-2B line with the gene therapeutic DNA vector VTvaf17-IL12A, the level of specific mRNA of the human IL12A gene grew many times, which confirms the ability of the vector to penetrate eukaryotic cells and express the IL12A gene at the mRNA level. The presented results also confirm the feasibility of the method of using VTvaf17-IL12A gene therapy DNA vector to increase the level of IL12A gene expression in eukaryotic cells.

Example 10

Confirmation of the ability of the gene therapeutic DNA vector VTvaf17-IL12B carrying the target gene, namely, the IL12B gene, to penetrate eukaryotic cells and confirmation of its functional activity at the level of mRNA expression of the target gene. This example also demonstrates the feasibility of using a gene therapy DNA vector carrying the target gene.

Changes in the mRNA accumulation of the target IL12B gene were evaluated in a BEAS-2B human normal bronchial epithelial cell culture (ATCC® CRL-9609 ™) 48 hours after their transfection with the VTvaf17-IL12B gene therapy DNA gene carrying the human IL12B gene. The amount of mRNA was determined by the dynamics of accumulation of cDNA amplicons in the real-time PRC reaction.

A BEAS-2B human cell culture was grown using the BEGM culture medium preparation kit (Lonza / Clonetics Corporation, No. CC-3170) under standard conditions (37 ° C, 5% CO2). To obtain 90% confluency, 24 hours before transfection, cells were plated in a 24-well plate at a rate of 5 × 10 ⁴ cells / well. Lipofectamine 3000 reagent (ThermoFisher Scientific, USA) was used for transfection. Transfection with the gene therapy VTvaf17-IL12B DNA vector expressing the human IL12B gene was performed as described in Example 5. As a control, a BEAS-2B line of human chondrocyte cells transfected with the VTvaf17 gene therapy DNA vector transfected without the target gene was used (IL12B gene cDNA up to and after transfection with VTvaf17 gene therapy DNA vector that does not contain the target gene insert, the figures are not shown in Fig. RNA isolation, reverse transcription reaction and real-time PCR was performed as described in example 5, except for ol gonucleotides with sequences differing from Example 5. To amplify the cDNA specific for the human IL12B gene, the oligonucleotides IL12B_SF and IL12B_SR were used:

IL12B_SF CATCAAACCTGACCCACCCA

IL12B_SR GCTGAGGTCTTGTCCGTGAA

Amplification Product Length - 192 bp

As a positive control, amplicons obtained by PCR on matrices representing plasmids at known concentrations containing cDNA sequences of the IL12B and B2M genes were used. The B2M gene (Beta-2-microglobulin) shown in the GenBank database under the number NM 004048.2 was used as the reference gene. As a negative control, deionized water was used. The number of PCR products - cDNA of IL12B genes and B2M obtained as a result of amplification were evaluated in real time using the software of the Bio-RadCFXManager 2.1 amplifier (Bio-Rad, USA). The graphs obtained as a result of the analysis are presented in FIG. 5.

From figure 5 it follows that as a result of transfection of a BEAS-2B human cell culture with gene therapy VTvaf17-IL12B DNA vector, the level of specific mRNA of the human IL12B gene grew many times, which confirms the ability of the vector to penetrate eukaryotic cells and express the IL12B gene at the mRNA level. The presented results also confirm the feasibility of the method of using VTvaf17-IL12B gene therapy DNA vector to increase the level of IL12B gene expression in eukaryotic cells.

Example 11

Confirmation of the effectiveness and feasibility of the method of using the gene therapeutic DNA vector VTvaf17-IFNB1 carrying the IFNB1 gene to increase expression of the IFNB1 protein in mammalian cells.

The change in the amount of IFNB1 protein in the lysate of BEAS-2B human normal bronchial epithelial cell culture (ATCC® CRL-9609 ™) after transfection of these cells with VTvaf17-IFNB1 DNA vector carrying the human IFNB1 gene was evaluated.

The cell culture of human normal bronchial epithelial cells BEAS-2B was grown as described in example 6.

To obtain 90% confluency, 24 hours before transfection, cells were plated in a 24-well plate at a rate of 5 × 10 ⁴ cells / well. The 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection. As a control, we used an aqueous solution of dendrimers without DNA vector (A), VTvaf17 DNA vector that did not contain IFNB1 gene cDNA (B), and VTvaf17-IFNB1 DNA vector carrying human IFNB1 gene (C) as transfected agents. The preparation of the DNA / dendrimer complex was carried out according to the manufacturer's method (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) with some changes. To transfect cells in one well of a 24-well plate, culture medium was added to 1 μg of the DNA vector dissolved in TE buffer to a final volume of 60 μl, then 5 μl of SuperFect Transfection Reagent was added and carefully mixed by 5-fold pipetting. The complex was incubated at room temperature for 10-15 minutes. Next, culture medium was taken from the wells, the wells were washed with 1 ml of PBS buffer. To the resulting complex was added 350 μl of medium containing 10 μg / ml gentamicin, carefully mixed and added to the cells. Cells were incubated with the complex for 2-3 hours at 37 ° C in an atmosphere containing 5% CO2.

Then the medium was carefully removed, the cell monolayer was washed with 1 ml of PBS buffer. Then, a medium containing 10 μg / ml gentamicin was added and incubated for 24-48 hours at 37 ° С in an atmosphere of 5% СО2.

After transfection, 0.1 ml of 1N HCl was added to 0.5 ml of the culture liquid, mixed thoroughly and incubated for 10 minutes at room temperature. The mixture was then neutralized by adding 0.1 ml of 1.2 M NaOH / 0.5 M HEPES (pH 7-7.6) and mixed thoroughly. The supernatant was taken and used to quantify the target protein. IFNB1 protein was quantified by enzyme-linked immunosorbent assay (ELISA) using the Human IFN-b kit (Interferon Beta) ELISA Kit (ElabBioscience E-EL-H0085) according to the manufacturer's method with optical density detection using a ChemWell automated biochemical and enzyme immunoassay (Awareness Technology Inc., USA).

The numerical value of the concentration was determined using a calibration curve constructed from standard samples with a known concentration of IFNB1 protein, which is part of the kit. The sensitivity of the method was at least 18.75 pg / ml, the measurement range was from 31.25 pg / ml to 2000 pg / ml. Statistical processing of the obtained results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). The graphs obtained as a result of the analysis are presented in FIG. 7.

From figure 7, it follows that transfection of BEAS-2B cells with VTvaf17-IFNB1 gene therapeutic DNA vector leads to an increase in the amount of IFNB1 protein compared to control samples, which confirms the ability of the vector to penetrate eukaryotic cells and express the IFNB1 gene at the protein level. The presented results also confirm the feasibility of the method of using the gene therapy VTvaf17-IFNB1 DNA vector to increase the level of expression of IFNB1 in eukaryotic cells.

Example 12

Confirmation of the effectiveness and feasibility of the method of using the gene therapeutic DNA vector VTvaf17-IFNA14 carrying the IFNA14 gene to increase expression of the IFNA14 protein in mammalian cells.

The change in the amount of protein in mononuclear cells of human peripheral blood was evaluated after transfection of these cells with the DNA vector VTvaf17-IFNA14 carrying the human IFNA14 gene. Cells were isolated and grown as described in example 7.

The 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection. As a control, we used an aqueous solution of dendrimers without DNA vector (A), VTvaf17 DNA vector that did not contain IFNA14 gene cDNA (B), and VTvaf17-IFNA14 DNA vector carrying the human IFNA14 gene (C) as transfected agents. The preparation of the DNA dendrimer complex and transfection of MG-63 cells was carried out as described in example 11.

After transfection, 0.1 ml of 1N HCl was added to 0.5 ml of the culture liquid, mixed thoroughly and incubated for 10 minutes at room temperature. The mixture was then neutralized by adding 0.1 ml of 1.2 M NaOH / 0.5 M HEPES (pH 7-7.6) and mixed thoroughly. The supernatant was taken and used to quantify the target protein. IFNA14 protein was quantified by enzyme-linked immunosorbent assay (ELISA) using the Human IFNA14 / Interferon Alpha 14 ELISA Kit (Sandwich ELISA) (LifeSpan BioSciences LS-F13512-1) according to the manufacturer's method with optical density detection using an automatic biochemical and enzyme immunoassay ChemWell (Awareness Technology Inc., USA).

The numerical value of the concentration was determined using a calibration curve constructed from standard samples with a known concentration of IFNA14 protein, which is part of the kit. The sensitivity of the method was at least 15.6 pg / ml, the measurement range was from 15.6 pg / ml to 1000 pg / ml. Statistical processing of the obtained results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). The graphs obtained as a result of the analysis are presented in FIG. 8.

From figure 8 it follows that the transfection of the culture of human peripheral blood mononuclear cells with the gene therapy VTvaf17-IFNA14 DNA vector leads to an increase in the amount of IFNA14 protein compared to control samples, which confirms the ability of the vector to penetrate eukaryotic cells and express the IFNA14 gene at the protein level. The presented results also confirm the feasibility of the method of using the gene therapy VTvaf17-IFNA14 DNA vector to increase the level of expression of IFNA14 in eukaryotic cells.

Example 13

Confirmation of the effectiveness and feasibility of the method of using the gene therapeutic DNA vector VTvaf17-IFNA2 carrying the IFNA2 gene to increase expression of the IFNA2 protein in mammalian cells.

The change in the amount of IFNA2 protein in a lysate of human gum fibroblast cell line HGF-1 (ATCC® CRL-2014 ™) culture was evaluated after transfection of these cells with VTvaf17-IFNA2 DNA vector carrying the human IFNA2 gene. Cells were cultured as described in example 8.

The 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection. As a control, an aqueous solution of dendrimers without DNA vector (A), VTvaf17 DNA vector without the cDNA of the IFNA2 gene (B) were used, and VTvaf17-IFNA2 DNA vector carrying the human IFNA2 gene (C) was used as transfected agents. The preparation of the DNA dendrimer complex and the transfection of human gum fibroblast cells of the HGF-1 line were performed as described in Example 11.

After transfection, 0.1 ml of 1N HCl was added to 0.5 ml of the culture liquid, mixed thoroughly and incubated for 10 minutes at room temperature. The mixture was then neutralized by adding 0.1 ml of 1.2 M NaOH / 0.5 M HEPES (pH 7-7.6) and mixed thoroughly. The supernatant was taken and used to quantify the target protein. IFNA2 protein was quantified by enzyme-linked immunosorbent assay (ELISA) using the Human Interferon Alpha 2 ELISA Kit (Abcam, ab233622) according to the manufacturer's method with optical density detection using a ChemWell automated biochemical and enzyme immunoassay (Awareness Technology Inc., USA).

The numerical value of the concentration was determined using a calibration curve constructed from standard samples with a known concentration of IFNA2 protein, which is part of the kit. The sensitivity of the method was not less than 56.04 pg / ml, the measurement range was from 187.5 pg / ml to 12000 pg / ml. Statistical processing of the obtained results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). The graphs obtained as a result of the analysis are presented in FIG. 9.

From figure 9 it follows that the transfection of the culture of human gum fibroblast cells of the HGF-1 line with the gene therapy DNA vector VTvaf17-IFNA2 leads to an increase in the amount of IFNA2 protein compared to control samples, which confirms the ability of the vector to penetrate eukaryotic cells and express the IFNA2 gene at the protein level . The presented results also confirm the feasibility of the method of using the gene therapy VTvaf17-IFNA2 DNA vector to increase the level of expression of IFNA2 in eukaryotic cells.

Example 14

Confirmation of the effectiveness and feasibility of the method of using the gene therapeutic DNA vector VTvaf17-IL12A carrying the IL12A gene to increase the expression of IL12A protein in mammalian cells.

The change in the amount of IL12A protein in the lysate of BEAS-2B human normal bronchial epithelial cell culture (ATCC® CRL-9609 ™) was evaluated after transfection of these cells with VTvaf17-IL12A DNA vector carrying the human IL12A gene. Cells were cultured as described in example 9.

The 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection. An aqueous solution of dendrimers without a DNA vector (A), a VTvaf17 DNA vector that does not contain IL12A gene cDNA (B) were used as a control; VTvaf17-IL12A DNA vector carrying a human IL12A gene (C) was used as transfected agents. Preparation of the DNA dendrimer complex and transfection of BEAS-2B cells was performed as described in Example 11.

After transfection, 0.1 ml of 1N HCl was added to 0.5 ml of the culture liquid, mixed thoroughly and incubated for 10 minutes at room temperature. The mixture was then neutralized by adding 0.1 ml of 1.2 M NaOH / 0.5 M HEPES (pH 7-7.6) and mixed thoroughly. The supernatant was taken and used to quantify the target protein.

Quantification of IL12A protein was carried out by enzyme-linked immunosorbent assay (ELISA) using the Human IL12A / p35 ELISA Kit (Sandwich ELISA) (LifeSpan BioSciences LS-F24142-1) according to the manufacturer’s method with optical density detection using a ChemWell automated biochemical and enzyme immunoassay ( Awareness Technology Inc., USA).

The numerical value of the concentration was determined using a calibration curve constructed from standard samples with a known concentration of IL12A protein, which is part of the kit. The sensitivity of the method was at least 4.688 pg / ml, the measurement range was from 7.813 pg / ml to 500 pg / ml. Statistical processing of the obtained results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). The graphs obtained as a result of the analysis are presented in FIG. 10.

Figure 10 shows that transfection of a BEAS-2B cell culture with VTvaf17-IL12A gene therapeutic DNA vector leads to an increase in the amount of IL12A protein compared to control samples, which confirms the ability of the vector to penetrate eukaryotic cells and express the IL12A gene at the protein level. The presented results also confirm the feasibility of the method of using the gene therapy VTvaf17-IL12A DNA vector to increase the level of IL12A expression in eukaryotic cells.

Example 15

Confirmation of the effectiveness and feasibility of the method of using the gene therapeutic DNA vector VTvaf17-IL12B, carrying the IL12B gene, to increase the expression of IL12B protein in mammalian cells.

The change in the amount of IL12B protein in the lysate of human normal bronchial epithelial cell culture BEAS-2B (ATCC® CRL-9609 ™) was evaluated after transfection of these cells with the DNA vector VTvaf17-IL12B carrying the human IL12B gene. Cells were cultured as described in example 9.

The 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection. As a control, we used an aqueous solution of dendrimers without DNA vector (A), VTvaf17 DNA vector that did not contain IL12B gene cDNA (B), and VTvaf17-IL12B DNA vector carrying human IL12B gene (C) as transfected agents. Preparation of the DNA dendrimer complex and transfection of BEAS-2B cells was performed as described in Example 11.

After transfection, 0.1 ml of 1N HCl was added to 0.5 ml of the culture liquid, mixed thoroughly and incubated for 10 minutes at room temperature. The mixture was then neutralized by adding 0.1 ml of 1.2 M NaOH / 0.5 M HEPES (pH 7-7.6) and mixed thoroughly. The supernatant was taken and used to quantify the target protein.

Quantification of IL12B protein was performed by enzyme-linked immunosorbent assay (ELISA) using the Human IL12B / IL12 p40 ELISA Kit (Sandwich ELISA) (LifeSpan BioSciences LS-F24549-1) according to the manufacturer's method with optical density detection using a ChemWell automated biochemical and enzyme immunoassay (Awareness Technology Inc., USA).

The numerical value of the concentration was determined using a calibration curve constructed from standard samples with a known concentration of IL12B protein, which is part of the kit. The sensitivity of the method was at least 2 pg / ml, the measurement range was from 31.2 pg / ml to 2000 pg / ml. Statistical processing of the obtained results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). The graphs obtained as a result of the analysis are presented in FIG. eleven.

From figure 11 it follows that the transfection of the culture of cells of the normal epithelium of human bronchi BEAS-2B gene therapy DNA vector VTvaf17-IL12B leads to an increase in the amount of IL12B protein compared to control samples, which confirms the ability of the vector to penetrate eukaryotic cells and express IL12B gene at the protein level . The presented results also confirm the feasibility of the method of using the gene therapeutic DNA vector VTvaf17-IL12B to increase the expression level of IL12B in eukaryotic cells.

Example 16

Confirmation of the effectiveness and feasibility of the method of using the gene therapeutic DNA vector VTvaf17-IL12A carrying the IL12A gene to increase the expression of IL12A protein in human tissues.

To confirm the effectiveness of the VTvaf17-IL12A gene therapy DNA vector carrying the target gene, namely, the IL12A gene and the feasibility of the method of its application, changes in the amount of IL12A protein in human skin were introduced when the VTvaf17-IL12A gene therapy DNA vector containing the IL12A human gene was introduced into human skin .

To analyze the changes in the amount of IL12A protein, three patients were injected with the VTvaf17-IL12A gene vector carrying the IL12A gene into the skin of the forearm and a placebo representing the VTvaf17 gene therapy DNA vector without the IL12A gene cDNA was introduced simultaneously.

Patient 1, male 66 years old, (P1); patient 2, woman 65 years old, P2); patient 3, male, 52 years old, (P3). Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. VTvaf17-IL12A gene therapy DNA vector that contains IL12A gene cDNA and VTvaf17 gene therapy DNA vector used as a placebo that does not contain IL12A gene cDNA, each of which was dissolved in sterile Nuclease-Free purification water. To obtain the genetic construct, DNA-cGMP grade in-vivo-jetPEI complexes were prepared in accordance with the manufacturer's recommendations.

The gene therapy DNA vector VTvaf17 (placebo) and the gene therapy DNA vector VTvaf17-IL12A carrying the IL12A gene were introduced in an amount of 1 mg for each genetic construct using a 30G tunnel method to a depth of 3 mm. The volume of the injected solution of the gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector VTvaf17-IL12A carrying the IL12A gene is 0.3 ml for each genetic construct. The foci of introduction of each genetic construct were located on the forearm at a distance of 8-10 cm from each other.

Biopsy samples were taken on the 2nd day after the introduction of genetic constructs of gene therapy DNA vectors. A biopsy was performed from the patient’s skin in the injection area of the gene therapy DNA vector VTvaf17-IL12A carrying the gene IL12A (I), gene therapy DNA vector VTvaf17 (placebo) (II), as well as from intact skin areas (III) using a device for taking Biopsies of Epitheasy 3.5 (Medax SRL, Italy). The skin of the patients in the biopsy area was previously washed with sterile saline and anesthetized with lidocaine. The size of the biopsy sample was about 10 cubic meters. mm, mass - about 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride, and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was taken and used to quantify the target protein by enzyme-linked immunosorbent assay (ELISA). Quantification of the IL12A protein was carried out by enzyme-linked immunosorbent assay as described in example 14.

The numerical value of the concentration was determined using a calibration curve constructed from standard samples with a known concentration of IL12A protein, which is part of the kit. Statistical processing of the obtained results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). according to the manufacturer’s method with optical density detection using an automated ChemWell biochemical and enzyme immunoassay analyzer (Awareness Technology Inc., USA). The graphs obtained as a result of the analysis are presented in FIG. 12.

From figure 12 it follows that in the skin of all three patients in the area of the introduction of gene therapy DNA vector VTvaf17-IL12A carrying the target gene IL12A person, there was an increase in the amount of protein IL12A compared with the amount of protein IL12A in the field of introduction of gene therapy DNA vector VTvaf17 (placebo), not containing the human IL12A gene, which indicates the effectiveness of the gene therapy VTvaf17-IL12A DNA vector and confirms the feasibility of the method of its use, in particular with the intradermal introduction of the gene therapy DNA vector into tissue h man.

Example 17

Confirmation of the effectiveness and feasibility of the method of using the gene therapeutic DNA vector VTvaf17-IFNA2 carrying the IFNA2 gene to increase the expression of IFNA2 protein in human tissues.

To confirm the effectiveness of the VTvaf17-IFNA2 gene therapy DNA vector carrying the IFNA2 target gene and the feasibility of its use, the change in the amount of IFNA2 protein in human muscle tissue was evaluated with the introduction of the VTvaf17-IFNA2 gene therapy DNA vector carrying the target gene, namely, the human IFNA2 gene.

To analyze the changes in the amount of IFNA2 protein, three patients were injected with VTvaf17-IFNA2 gene vector carrying the IFNA2 gene with a transport molecule into the calf muscle tissue and a placebo representing the VTvaf17 gene therapy DNA vector without the IFNA2 gene cDNA with the transport molecule was introduced .

Patient 1, female 48 years old, (P1); patient 2, male 32 years old (P2); patient 3, male 54 years old, (P3). Polyethyleneimine Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system; sample preparation was carried out in accordance with the manufacturer's recommendations.

The gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector VTvaf17-IFNA2 carrying the IFNA2 gene were introduced in an amount of 1 mg for each genetic construct using a 30G tunnel method to a depth of about 10 mm. The volume of the injected solution of the gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector VTvaf17-IFNA2 carrying the IFNA2 gene is 0.3 ml for each genetic construct. Foci of introduction of each genetic construct were located medially at a distance of 8-10 cm from each other.

Biopsy samples were taken on the 2nd day after the introduction of genetic constructs of gene therapy DNA vectors. A biopsy was performed from areas of muscle tissue of patients in the injection area of the gene therapy DNA vector VTvaf17-IFNA2 carrying the gene IFNA2 (I), gene therapy DNA vector VTvaf17 (placebo) (II), as well as from the intact portion of the calf muscle (III) using the device for a biopsy of MAGNUM (BARD, USA). The skin of the patients in the biopsy area was previously washed with sterile saline and anesthetized with lidocaine. The size of the biopsy sample was about 20 cubic meters. mm, mass - about 22 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride, and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was taken and used to quantify the target protein.

The quantification of IFNA2 protein was carried out by enzyme-linked immunosorbent assay as described in example 13.

The numerical value of the concentration was determined using a calibration curve constructed from standard samples with a known concentration of IFNA2 protein, which is part of the kit. Statistical processing of the obtained results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). The graphs obtained as a result of the analysis are presented in FIG. thirteen.

From figure 13 it follows that in the gastrocnemius muscle of all three patients in the area of the introduction of gene therapy DNA of the vector VTvaf17-IFNA2 carrying the target gene, namely, the human IFNA2 gene, there was an increase in the amount of IFNA2 protein in comparison with the amount of IFNA2 protein in the area of introduction of gene therapy DNA vector VTvaf17 (placebo), which does not contain the human IFNA2 gene, which indicates the effectiveness of the gene therapeutic DNA vector VTvaf17-IFNA2 and confirms the feasibility of the method of its use, in particular with intramuscular injection of gene therapy whom DNA vector in human tissue.

Example 18

Confirmation of the effectiveness and feasibility of the method of application of the gene therapeutic DNA vector VTvaf17-IFNA14, carrying the IFNA14 gene, to increase the expression of IFNA14 protein in human tissues.

To confirm the effectiveness of the VTvaf17-IFNA14 gene therapeutic DNA vector carrying the target gene, namely, the IFNA14 gene and the feasibility of its use, changes in the amount of IFNA14 protein in human skin were evaluated when VTvaf17-IFNA14 gene therapeutic DNA vector containing the IFNA14 human gene was introduced into the human skin .

In order to analyze changes in the amount of IFNA14 protein, three patients were injected with VTvaf17-IFNA14 gene therapy vector carrying the IFNA14 gene into the skin of the forearm and a placebo representing VTvaf17 gene therapy DNA vector without the IFNA14 gene cDNA was introduced simultaneously.

Patient 1, female 55 years old (P1); patient 2, male 47 years old (P2); patient 3, male, 60 years old (P3). Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. The gene therapy DNA vector VTvaf17-IFNA14, which contains the cDNA of the IFNA14 gene, and the gene therapy DNA vector VTvaf17, used as a placebo, which does not contain the cDNA of the IFNA14 gene, each of which was dissolved in sterile water with a Nuclease-Free purification. To obtain the genetic construct, DNA-cGMP grade in-vivo-jetPEI complexes were prepared in accordance with the manufacturer's recommendations.

The gene therapy DNA vector VTvaf17 (placebo) and the gene therapy DNA vector VTvaf17-IFNA14 carrying the IFNA14 gene were introduced in an amount of 1 mg for each genetic construct using a 30G tunnel method to a depth of 3 mm. The volume of the injected solution of the gene therapy DNA vector VTvaf17 (placebo) and gene therapy DNA vector VTvaf17-IFNA14 carrying the IFNA14 gene is 0.3 ml for each genetic construct. The foci of introduction of each genetic construct were located on the forearm at a distance of 8-10 cm from each other.

Biopsy samples were taken on the 2nd day after the introduction of genetic constructs of gene therapy DNA vectors. A biopsy was performed from the patient’s skin in the injection area of the gene therapy DNA vector VTvaf17-IFNA14, carrying the gene IFNA14 (I), gene therapy DNA vector VTvaf17 (placebo) (II), as well as from intact areas of the skin (III) using a device for taking Biopsies of Epitheasy 3.5 (Medax SRL, Italy). The skin of the patients in the biopsy area was previously washed with sterile saline and anesthetized with lidocaine. The size of the biopsy sample was about 10 cubic meters. mm, mass - about 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride, and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was taken and used to quantify the target protein by enzyme-linked immunosorbent assay as described in example 12.

The numerical value of the concentration was determined using a calibration curve constructed from standard samples with a known concentration of IFNA14 protein, which is part of the kit. Statistical processing of the obtained results was carried out using software for statistical processing and visualization of data R, version 3.0.2 (https://www.r-project.org/). The graphs obtained as a result of the analysis are presented in FIG. 14.

From figure 14 it follows that in the skin of all three patients in the area of introducing the gene therapy DNA of the vector VTvaf17-IFNA14 carrying the target human IFNA14 gene, there was an increase in the amount of IFNA14 protein compared to the amount of IFNA14 protein in the area of introducing the gene therapy DNA vector VTvaf17 (placebo), not containing the human IFNA14 gene, which indicates the effectiveness of the gene therapy VTvaf17-IFNA14 DNA vector and confirms the feasibility of the method of its use, in particular with the intradermal introduction of the gene therapy DNA vector into the tissue eloveka.

Example 19

Confirmation of the effectiveness of the VTvaf17-IFNA14 gene therapeutic DNA vector carrying the IFNA14 gene and the feasibility of its use for increasing the expression of IFNA14 protein in human tissues by introducing autologous fibroblasts transfected with the VTvaf17-IFNA14 gene therapeutic DNA vector.

To confirm the effectiveness of the VTvaf17-IFNA14 gene therapeutic DNA vector carrying the IFNA14 gene and the feasibility of its application, changes in the amount of IFNA14 protein in human skin were introduced when a patient's autologous fibroblast culture transfected with VTvaf17-IFNA14 gene therapy DNA vector was introduced into the patient’s skin.

A corresponding culture of autologous fibroblasts transfected with the gene therapy VTvaf17-IFNA14 DNA vector carrying the IFNA14 gene was injected into the skin of the forearm, and a placebo representing a culture of autologous fibroblasts of the patient transfected with the VTvaf17 gene therapy DNA vector without the IFNA gene was introduced.

The primary culture of human fibroblasts was isolated from biopsy samples of the patient’s skin. Using a skin biopsy device Epitheasy 3.5 (Medax SRL, Italy), a skin biopsy sample was taken from an area protected from UV radiation, namely, behind the auricle or from the side inner surface in the area of the elbow joint, about 10 square meters. mm, weight - about 11 mg. The patient’s skin was pre-washed with sterile saline and anesthetized with lidocaine solution. The primary cell culture was cultured at 37 ° C in an atmosphere containing 5% CO2 in DMEM medium with 10% fetal calf serum and ampicillin 100 U / ml. Reseeding of culture and change of culture medium was carried out every 2 days. The total duration of culture growth did not exceed 25-30 days. An aliquot containing 5 × 10 ⁴ cells was selected from the cell culture. The patient’s fibroblast culture was transfected with VTvaf17-IFNA14 gene therapy DNA vector carrying the IFNA14 gene or placebo - VTvaf17 vector without the IFNA14 target gene.

Transfection was carried out using the cationic polymer polyethylenimine JETPEI (Polyplus Transfection, France), according to the instructions of the manufacturer. Cells were cultured for 72 hours and then administered to the patient. The patient was introduced a culture of autologous fibroblasts of this patient transfected with the VTvaf17-IFNA14 gene therapy DNA vector and a placebo representing a culture of the patient's autologous fibroblasts transfected with the VTvaf17 gene therapy DNA vector was carried out by the tunnel method into the forearm with a 30G needle with a length of 13 mm to a depth of about 3 mm . The concentration of modified autologous fibroblasts in the injected suspension was approximately 5 million cells per 1 ml of suspension, the number of introduced cells did not exceed 15 million. The foci of the introduction of autologous fibroblast culture were located at a distance of 8-10 cm from each other.

Biopsy samples were taken on the 4th day after the introduction of a culture of autologous fibroblasts transfected with the gene therapy VTvaf17-IFNA14 DNA vector carrying the target gene, namely, the IFNA14 gene and placebo. A biopsy was performed from areas of the patient’s skin in the area where the autologous fibroblast culture transfected with gene therapy VTvaf17-IFNA14 DNA vector carrying the target gene was introduced, namely, IFNA14 (C) gene, autologous fibroblast culture transfected with VTvaf17 gene therapy DNA vector that did not carry the target IFNA14 gene (placebo) (B), as well as from areas of intact skin (A), using an Epitheasy 3.5 biopsy device (Medax SRL, Italy). The skin in the patient biopsy area was previously washed with sterile saline and anesthetized with lidocaine solution. The size of the biopsy sample was about 10 cubic meters. mm, mass - about 11 mg. The sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride, and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was taken and used to quantify the target protein as described in Example 12.

The graphs obtained as a result of the analysis are presented in FIG. fifteen.

From figure 15 it follows that in the patient’s skin in the field of introducing a culture of autologous fibroblasts transfected with gene therapy VTvaf17-IFNA14 DNA vector carrying the IFNA14 gene, there was an increase in the amount of IFNA14 protein compared to the amount of IFNA14 protein in the field of introducing a culture of autologous fibroblasts transfected with gene therapy DNA vector VTvaf17, not carrying the IFNA14 gene (placebo), which indicates the effectiveness of the gene therapy DNA vector VTvaf17-IFNA14 and confirms the feasibility of its use for increased IFNA14 I expression levels in human tissues, in particular when administered autologous fibroblasts transfected with the gene therapy vector DNA VTvaf17-IFNA14.

Example 20

Confirmation of the effectiveness and feasibility of the method of combined use of the gene therapy VTvaf17-IFNB1 DNA vector carrying the IFNB1 gene, the VTvaf17-IFNA14 gene therapy DNA vector, the IFNA14 gene, VTvaf17-IFNA2 gene therapy DNA vector, the IFNA2 gene, VTVaf17 gene therapy DNA vector 12 carrying the IL12A gene, VTvaf17-IL12B gene therapy DNA vector carrying the IL12B gene to increase expression of IFNB1, IFNA14, IFNA2, IL12A and IL12B proteins in mammalian tissues.

The change in the amount of IFNB1, IFNA14, IFNA2, IL12A, and IL12B proteins in the muscle tissue zone was assessed with the combined introduction of a mixture of gene therapy vectors into this zone. The study was performed on 3 laboratory animals — male Wistar rats of 8 months of age weighing 240–290 g. Transfection reagent cGMP grade in-vivo-jetPEI (Polyplus Transfection, France) was used as a transport system. An equimolar mixture of gene therapy DNA vectors was dissolved in sterile Nuclease-Free purification water. To obtain the genetic construct, DNA-cGMP grade in-vivo-jetPEI complexes were prepared in accordance with the manufacturer's recommendations.

The volume of intramuscularly injected solution was 0.1 ml with a total amount of DNA of 100 μg. The solution was administered using an insulin syringe. Rats were decapitated 2 days after the procedure.

Samples were taken 2 days after the introduction of gene therapy DNA vectors. Biopsy material was taken from areas of the right thigh muscle in the injection zone of a mixture of five gene therapy DNA vectors carrying the genes IFNB1, IFNA14, IFNA2, IL12A, IL12B (zone I), from the sections of the left muscle of the thigh in the injection zone of the gene therapy DNA vector VTvaf17 (placebo ) (zone II), as well as from areas of muscle tissue that have not undergone any manipulation (zone III). Each sample was placed in a buffer solution containing 50 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM EDTA and 1 mM phenylmethylsulfonyl fluoride, and homogenized to obtain a uniform suspension. The resulting suspension was centrifuged for 10 min at 14000g. The supernatant was taken and used to quantify the target proteins as described in Example 11 (quantification of IFNB1 protein), Example 12 (quantification of IFNA14 protein), Example 13 (quantification of IFNA2 protein), Example 14 (quantification of IL12A protein), Example 15 (quantification of IL12B protein). The graphs obtained as a result of the analysis are presented in FIG. sixteen.

From figures 16 it follows that in zone I, into which a mixture of gene therapy vectors was introduced: gene therapy DNA vector VTvaf17-IFNB1, carrying the target gene IFNB1, gene therapy DNA vector VTvaf17-IFNA14, carrying the target gene IFNA14, gene therapy DNA vector VTvaf17-IFNA2 carrying the IFNA2 target gene, VTvaf17-IL12A gene therapy DNA vector, IL12A target gene, VTvaf17-IL12B gene therapy DNA vector, carrying the IL12B target gene, an increase in the number of IFNB1, IFNA14, IFNA2, IL12A and IL12B proteins compared to zone II (placebo zone) and zone III (intact I am a zone). The results obtained indicate the effectiveness of the combined use of gene therapy DNA vectors and confirms the feasibility of the method of application to increase the expression level of target proteins in mammalian tissues.

Example 21

Confirmation of the efficacy of the gene therapy DNA vector VTvaf17-IFNA2 carrying the IFNA2 gene and the feasibility of the method of its use to increase the expression level of IFNA2 protein in mammalian cells.

To confirm the effectiveness of the VTvaf17-IFNA2 gene therapeutic DNA vector carrying the IFNA2 gene, the mRNA accumulation of the target IFNA2 gene was monitored in peripheral blood mononuclear cells of the bovine 48 hours after their transfection with the VTvaf17-IFNA2 gene therapeutic DNA vector carrying the human IFNA2 gene.

Mononuclear cells of peripheral blood of a bull were isolated from 50 ml of venous blood by centrifugation in a gradient of ficoll solution 1.077 (Paneko, P052p) and cultured in RPMI Media 1640 medium (GIBCO®, 11875-085) with the addition of 10% Horse Serum (ATCC® 30 -2040 ™) under standard conditions. Transfection with the gene therapy VTvaf17-IFNA2 DNA vector carrying the human IFNA2 gene and VTvaf17 DNA vector not carrying the human IFNA2 gene (control), RNA isolation, reverse transcription reaction, PCR amplification and data analysis were performed as described in Example 8. As a reference the gene used the bull / cow actin gene (AST) listed in the GenBank database under the number AH001130.2. As a positive control, amplicons obtained by PCR on matrices representing plasmids at known concentrations containing the sequences of IFNA2 and AST genes were used. As a negative control, deionized water was used. Number of PCR products - cDNA of IFNA2 genes and the amplification ACTs were evaluated in real time using the Bio-RadCFXManager 2.1 Amplifier software. (Bio-Rad, USA).

The graphs obtained as a result of the analysis are presented in FIG. 17.

From figure 17 it follows that as a result of transfection of mononuclear cells of peripheral blood of a bull gene therapy DNA vector VTvaf17-IFNA2, the level of specific mRNA of the human IFNA2 gene grew many times, which confirms the ability of the vector to penetrate eukaryotic cells and express the IFNA2 gene at the mRNA level. The presented results confirm the feasibility of the method of using VTvaf17-IFNA2 gene therapy DNA vector to increase the level of expression of the IFNA2 gene in mammalian cells.

Example 22

The strain Escherichia coli SCS110-AF / VTvaf17-IFNB1 or the strain Escherichia coli SCS110-AF / VTvaf17-IFNA14 or the strain Escherichia coli SCS110-AF / VTvaf17-IFNA2 or the strain Escherichia coli SCS110-AF / VTvaf17-IF1AI12 or / VTvaf17-IL12B, carrying the gene therapy DNA vector, and a method for its preparation.

Construction of a strain for the industrial production of a gene therapy DNA vector based on the gene therapy DNA vector VTvaf17 carrying the target gene selected from the group of genes: IFNB1, IFNA14, IFNA2, IL12A, IL12B, namely the Escherichia coli strain SCS110-AF / VTvaf17-IFNB1, or Escherichia coli strain SCS110-AF / VTvaf17-IFNA14, or Escherichia coli strain SCS110-AF / VTvaf17-IFNA2, or Escherichia coli strain SCS110-AF / VTvaf17-IL12A or Escherichia coli strain SCS110-AF / VTvaf17-DNA12 -Vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A or VTvaf17-IL12B, respectively, for its operation with the possibility of selection b Without the use of antibiotics, electrochemical cells of the Escherichia coli strain SCS110-AF are prepared by electroporation of these cells with the gene therapy DNA vector VTvaf17-IFNB1 or DNA vector VTvaf17-IFNA14 or DNA vector VTvaf17-IFNA2 or DNA vector VTvaf17-IL12A or VTvaf17-IL12B DNA vector, after which the cells are plated on Petri dishes with agarized selective medium containing yeast extract, peptone, 6% sucrose, and 10 μg / ml chloramphenicol. In this case, the strain Escherichia coli SCS110-AF for producing the gene therapy DNA vector VTvaf17 or gene therapy DNA vectors based on it with the possibility of positive selection without the use of antibiotics was obtained by constructing a linear DNA fragment containing the regulatory element RNA-in transposon Tn10 for selection without using antibiotics 64 bp in size, sacB levansaccharose gene, the product of which provides selection on a sucrose-containing medium of 1422 bp in size, catR chloramphenicol resistance gene necessary for selection of cells Ones of the strain in which homologous recombination of 763 bp and two homologous sequences providing a homologous recombination process in the region of the recA gene with its simultaneous inactivation of 329 bp. and 233 bp, after which Escherichia coli cells were transformed by electroporation and clones that survived on a medium containing 10 μg / ml chloramphenicol were selected.

Example 23

A method for scaling the production of a gene therapy DNA vector based on the VTvaf17 gene therapy DNA vector carrying the target gene selected from the group of genes: IFNB1, IFNA14, IFNA2, IL12A, IL12B to an industrial scale.

To confirm the manufacturability and feasibility of industrial production of the gene therapy DNA gene vector VTvaf17-IFNB1 (SEQ ID No. 1), or VTvaf17-IFNA14 (SEQ ID No. 2), or VTvaf17-IFNA2 (SEQ ID No. 3), or VTvaf17-IL12A (SEQ ID No. 4), or VTvaf17-IL12B (SEQ ID No. 5) carried out large-scale fermentation of the Escherichia coli strain SCS110-AF / VTvaf17-IFNB1, or the Escherichia coli strain SCS110-AF / VTvaf17-IFNA14, or the Escherichia coli strain SCS110-AF / VTvaf17-IFNA2, or Escherichia coli strain SCS110-AF / VTvaf17-IL12A, or Escherichia coli strain SCS110-AF / VTvaf17-IL12B, each of which contains VTvaf17 gene therapy DNA vector carrying the target gene, namely IFNB1 or IFNA14, or IFNA2, or IL12A, or IL12B. Each strain of Escherichia coli SCS110-AF / VTvaf17-IFNB1, or Escherichia coli SCS110-AF / VTvaf17-IFNA14, or Escherichia coli SCS110-AF / VTvaf17-IFNA2, or Escherichia coli SCS110-AF / VTvaf17-IL12A or Escher1 / VTvaf17-IL12B was obtained on the basis of the Escherichia coli strain SCS110-AF (Cell and Gene Therapy LLC, United Kingdom) according to Example 22 by electroporation of competent cells of this strain with the gene therapy DNA vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B, carrying the target gene, namely, IFNB1, or IFNA14, or IFNA2, or IL12A or IL12B, followed by plating the transformed cells on Petri dishes with agar selective medium containing aschey yeast extract, peptone, 6% sucrose and selection of individual clones.

Fermentation of the obtained strain of Escherichia coli SCS110-AF / VTvaf17-IFNB1 carrying the gene therapy DNA vector VTvaf17-IFNB1 was carried out in a 10 L fermenter, followed by isolation of the gene therapy DNA vector VTvaf17-IFNB1.

For fermentation of the Escherichia coli strain SCS110-AF / VTvaf17-IFNB1, a 10 l medium was prepared containing 100 g tryptone, 50 g yeast extract (Becton Dickinson, USA), brought up to 8800 ml with water and autoclaved at 121 ° C for 20 min, then added 1200 ml of 50% (w / v) sucrose. Next, a seed culture of Escherichia coli strain SCS110-AF / VTvaf17-IFNB1 was seeded in a flask in a volume of 100 ml. Incubated in a shaker incubator for 16 hours at 30 ° C. The seed culture was transferred to the Techfors S fermenter (Infors HT, Switzerland), grown to reach the stationary phase. The control was carried out by measuring the optical density of the culture at a wavelength of 600 nm. Cells were besieged by centrifugation for 30 min at 5000-10000 g. The supernatant was removed, the cell mass was resuspended in 10% by volume of phosphate-buffered saline. Re-centrifuged for 30 min at 5000-10000g. The supernatant was removed, a solution of 20 mM TrisCl, 1 mM EDTA, 200 g / l sucrose, pH 8.0 in a volume of 1000 ml was added to the cell mass, mixed thoroughly until a homogeneous suspension was formed. Egg lysozyme solution was added to a final concentration of 100 μg / ml. Incubated for 20 min on ice with gentle stirring. Next, 2500 ml of a solution of 0.2 M NaOH, 10 g / l sodium dodecyl sulfate was added, incubated for 10 min on ice with gentle stirring, then 3500 ml of a solution of 3M sodium acetate, 2M acetic acid, pH 5-5.5 were added, incubated 10 min on ice with gentle stirring. The resulting sample was centrifuged for 20-30 minutes at 15,000 g or more. The solution was gently decanted, the residue was disposed of by filtration through a coarse filter (filter paper). Added RNase A (Sigma, USA) to a final concentration of 20 ng / ml, incubated overnight for 16 hours at room temperature. The solution was centrifuged for 20-30 min at 15000g, then filtered through a 0.45 μm membrane filter (Millipore, USA). Then, ultrafiltration through a membrane with a cut-off size of 100 kDa (Millipore, United States) was performed and diluted to the initial volume with 25 mM TrisCl buffer, pH 7.0. The operation was repeated three to four times. The solution was applied to a column with 250 ml of DEAE sepharose HP sorbent (GE, USA), balanced with a solution of 25 mM TrisCl, pH 7.0. After applying the sample, the column was washed with three volumes of the same solution, and then the gene therapy VTvaf17-IFNB1 DNA vector was eluted with a linear gradient from a solution of 25 mM TrisCl, pH 7.0 to a solution of 25 mM TrisCl, pH 7.0, 1 M NaCl in a volume of five column volumes. The elution was controlled by the optical density of the effluent at 260 nm. Chromatographic fractions containing the gene therapy DNA vector VTvaf17-IFNB1 were combined and gel filtration was performed on a Superdex 200 sorbent (GE, USA). The column was balanced with phosphate-buffered saline. Elution was controlled by the optical density of the effluent at 260 nm, and the fractions were analyzed by agarose gel electrophoresis. Fractions containing the gene therapy DNA vector VTvaf17-IFNB1 were combined and stored at -20 ° C. To assess the reproducibility of the process, the indicated technological operations were repeated five times. All technological operations for Escherichia coli SCS110-AF / VTvaf17-IFNA14 strains, or Escherichia coli SCS110-AF / VTvaf17-IFNA2, or Escherichia coli SCS110-AF / VTvaf17-IL12A or Escherichia coli SCS110-AF / VTvaf17-IL12B were carried out in a similar manner.

The reproducibility of the process and quantitative characteristics of the yield of the final product confirm the manufacturability and feasibility of industrial production of the gene therapy DNA gene vector VTvaf17-IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B.

Thus, the created gene therapy DNA vector with the target gene can be used to introduce into the cells of animals and humans, characterized by reduced or insufficient expression of the protein encoded by this gene, thus providing a therapeutic effect.

The task of this invention is solved, namely: the construction of gene therapy DNA vectors to increase the expression level of the IFNB1, IFNA14, IFNA2, IL12A, IL12B genes, combining the following properties:

I) The effectiveness of increasing the expression of target genes in eukaryotic cells due to the resulting gene therapy vectors with a minimum size;

II) The possibility of safe use for human and animal genetic therapy due to the absence of regulatory elements in the composition of the gene therapy DNA vector, which are nucleotide sequences of viral genomes and antibiotic resistance genes;

III) Technological production and the possibility of operating time in strains on an industrial scale;

IV) The problem of constructing strains carrying these gene therapy DNA vectors for the production of these gene therapy DNA vectors has also been solved.

This is confirmed by examples:

for item I - example 1, 2, 3, 4, 5; 6; 7; 8; 9; 10; eleven; 12; thirteen; 14; fifteen; sixteen; 17; 18, 19, 20, 21

for item II - example 1, 2, 3, 4, 5

for paragraph III and paragraph IV - example 22, 23.

Industrial Applicability:

All the above examples confirm the industrial applicability of the proposed gene therapeutic DNA vector based on the VTvaf17 gene therapeutic DNA vector carrying the target gene selected from the group of genes: IFNB1 gene, IFNA14 gene, IFNA2 gene, IL12A gene, IL12B gene to increase the expression level of these target genes , Escherichia coli strain SCS110-AF / VTvaf17-IFNB1 or Escherichia coli SCS110-AF / VTvaf17-IFNA14 or Escherichia coli SCS110-AF / VTvaf17-IFNA2 or Escherichia coli SCS110-AF / VTvaf17-IL12A or Escherichia coli AF1 IL12B carrying a gene therapy DNA vector, a method for producing a gene therapy DNA vector, using Soba production on an industrial scale gene therapy DNA vector.

List of abbreviations

VTvaf17 is a gene therapy vector that does not contain viral genome sequences and antibiotic resistance markers (vector therapeutic virus-antibiotic-free),

DNA - deoxyribonucleic acid,

cDNA is a complementary deoxyribonucleic acid,

RNA - ribonucleic acid,

mRNA - matrix ribonucleic acid,

bp - nucleotide pairs,

PCR - polymerase chain reaction,

ml - milliliter, μl - microliter,

cube mm - cubic millimeter,

l - liter

mcg - micrograms

mg - milligram

g - gram

μM - micromol,

mm - millimole

min - minute

sec - second

rpm - revolutions per minute,

nm - nanometer

cm - centimeter

MW - milliwatts

father f-relative fluorescence unit,

PBC - phosphate-buffered saline,

PBMC - peripheral blood mononuclear cells.

BIBLIOGRAPHY

1. Abraham S, Choi JG, Ortega NM, Zhang J, Shankar P, Swamy NM. Gene therapy with plasmids encoding IFN-β or IFN-α14 confers long-term resistance to HIV-1 in humanized mice. Oncotarget. 2016 Nov 29; 7 (48): 78412-78420.

2. Denies S, Cicchelero L, Van Audenhove I, Sanders NN. Combination of interleukin-12 gene therapy, metronomic cyclophosphamide and DNA cancer vaccination directs all arms of the immune system towards tumor eradication. J Control Release. 2014 Aug 10; 187: 175-82.

3. Draft Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products, http://www.ema.europa.eu/docs/en_GB/document_library/Scientific_guideline/2015/05/WC500187020.pdf

4. Ejlerskov P, Hultberg JG, Wang J, Carlsson R, Ambjørn M, Kuss M, Liu Y, Porcu G, Kolkova K, Friis Rundsten C, Ruscher K, Pakkenberg B, Goldmann T, Loreth D, Prinz M, Rubinsztein DC , Issazadeh-Navikas S. Lack of Neuronal IFN-β-IFNAR Causes Lewy Body- and Parkinson's Disease-like Dementia. Cell. 2015 Oct 8; 163 (2): 324-39.

5. Fondello C, Agnetti L, Glikin GC, Finocchiaro LME. Mechanisms Enhancing the Cytotoxic Effects of Bleomycin plus Suicide or Interferon-β Gene Lipofection in Metastatic Human Melanoma Cells. Anticancer Agents Med Chem. 2018 Jun 3.

6. Gay W, Lauret E, Boson B, Larghero J, Matheux F, Peyramaure S, Rousseau V, Dormont D, De Maeyer E, Le Grand R. Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251. Retrovirology. 2004 Sep 25; 1: 29.

7. Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal Products EMA / CAT / 80183/2014

8. Hamana A, Takahashi Y, Tanioka A, Nishikawa M, Takakura Y. Safe and effective interferon-beta gene therapy for the treatment of multiple sclerosis by regulating biological activity through the design of interferon-beta-galectin-9 fusion proteins. Int J Pharm. 2018 Jan 30; 536 (1): 310-317.

9. Harper MS, Guo K, Gibbert K, Lee EJ, Dillon SM, Barrett BS, McCarter MD, Hasenkrug KJ, Dittmer U, Wilson CC, Santiago ML. Interferon-alpha Subtypes in an Ex Vivo Model of Acute HIV-1 Infection: Expression, Potency and Effector Mechanisms. Plos pathog. 2015

10. Hornstein BD, Roman D, Arévalo-Soliz LM, Engevik MA, Zechiedrich L. Effects of Circular DNA Length on Transfection Efficiency by Electroporation into HeLa Cells. Ceña V, ed. PLOS ONE. 2016; 11 (12): e0167537. doi: 10.1371 / journal.pone.0167537.

11. Kim GS, Heo JR, Kim SU, Choi KC. Cancer-Specific Inhibitory Effects of Genetically Engineered Stem Cells Expressing Cytosine Deaminase and Interferon-β Against Choriocarcinoma in Xenografted Metastatic Mouse Models. Transl Oncol. 2018 Feb; 11 (1): 74-85.

12. Li L, Petrovsky N. Molecular mechanisms for enhanced DNA vaccine immunogenicity. Expert Rev Vaccines. 2016; 15 (3): 313-29

13. Mairhofer J, Grabherr R. Rational vector design for efficient non-viral gene delivery: challenges facing the use of plasmid DNA. Mol Biotechnol. 2008.39 (2): 97-104

14. Mizuno M., Yoshida J., Sugita K., Yagi K., Growthinhibition of glioma cells of different cell lines byhuman interferon-βproduced in the cells transfectedwith its gene by means of liposomes, J. Clin Biochem. Nutr., 9: 73-77, 1990

15. Okwor I, Uzonna JE. Pathways leading to interleukin-12 production and protective immunity in cutaneous leishmaniasis. Cell Immunol. 2016 Nov; 309: 32-36.

16. Razi Soofiyani S, Kazemi T, Lotfipour F, Mohammad Hosseini A, Shanehbandi D, Hallaj-Nezhadi S, Baradaran B. Gene therapy with IL-12 induced enhanced anti-tumor activity in fibrosarcoma mouse model. Artif Cells Nanomed Biotechnol. 2016 Dec; 44 (8): 1988-1993. Epub 2016 Jan 13.

17. Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011 EMA / CAT / GTWP / 44236/2009 Committee for advanced therapies

18. Sakai T, Hisaeda H, Nakano Y, et al. Gene gun-mediated delivery of an interleukin-12 expression plasmid protects against infections with the intracellular protozoan parasites Leishmania major and Trypanosoma cruzi in mice. Immunology 2000; 99: 615-24.

19. Sperber SJ, Gocke DJ, Haberzettl C, Kuk R, Schwartz B, Pestka S. Anti-HIV-1 activity of recombinant and hybrid species of interferon-alpha. J Interferon Res. 1992; 12: 363-8.

20. Tapia E, Pérez-Jiménez E, López-Fuertes L, Gonzalo R, Gherardi MM, Esteban M. The combination of DNA vectors expressing IL12 + IL-18 elicits high protective immune response against cutaneous leishmaniasis after priming with DNA-p36 / LACK and the cytokines, followed by a booster with a vaccinia virus recombinant expressing p36 / LACK. Microbes Infect 2003; 5: 73-84.

21. Vieillard V, Jouveshomme S, Leflour N, Jean-Pierre E, Debre P, De Maeyer E, Autran B. Transfer of human CD4 (+) T lymphocytes producing beta interferon in Hu-PBL-SCID mice controls human immunodeficiency virus infection . J Virol. 1999 Dec; 73 (12): 10281-8.

22. Waldner MJ, Neurath MF. Gene therapy using IL 12 family members in infection, auto immunity, and cancer. Curr Gene Ther. 2009 Aug; 9 (4): 239-47.

23. Molecular Biology, 2011, Volume 45, No. 1, p. 44-55

--->

LIST OF SEQUENCES

<110> Cell and Gene Therapy Ltd (CELL and GENE THERAPY Ltd), Breakthrough Innovative Technologies Limited Liability Company,

<120> Gene therapeutic DNA vector based on VTvaf17 gene therapeutic DNA vector, carrying the target gene selected from the group of genes IFNB1, IFNA14, IFNA2, IL12A, IL12B to increase the expression level of these target genes, method for its preparation and use, strain Escherichia coli SCS110 -AF / VTvaf17-IFNB1 or Escherichia coli SCS110-AF / VTvaf17-IFNA14 or Escherichia coli SCS110-AF / VTvaf17-IFNA2 or Escherichia coli SCS110-AF / VTvaf17-IL12A or Escherichia coli SCS110-AF / VTvaf17 DNA -vector, method for its preparation, industrial-scale production of a gene therapy DNA vector.

<160> 5

<170> BiSSAP 1.3.6

<210> 1

<211> 3706

<212> DNA

<213> Homo Sapiens

<400> 1

cgtgaggctc cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt 60

tggggggagg ggtcggcaat tgaaccggtg cctagagaaa gtggcgcggg gtaaactggg 120

aaagtgatgt cgtgtactgg ctccgccttt ttcccgaggg tgggggagaa ccgtatataa 180

gtgcagtagt cgccgtgaac gttctttttc gcaacgggtt tgccgccaga acacaggtaa 240

gtgccgtgtg tggttcccgc gggcctggcc tctttacggg ttatggccct tgcgtgcctt 300

gaattacttc cacgcccctg gctgcagtac gtgattcttg atcccgagct tcgggttgga 360

agtgggtggg agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt 420

gaggcctggc ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt 480

ctcgctgctt tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt 540

tttttctgggg aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt 600

tttggggccg cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg 660

ggcctgcgag cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct 720

ctggtgcctg gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg 780

tcggcaccag ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca 840

aaatggagga cgcggcgctc gggagagcgg gcgggtgagt cacccgcaca aaggaaaagg 900

gcctttccgt cctcagccgt cgcttcatgt gactccacgg agtaccgggc gccgtccagg 960

cacctcgatt agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt 1020

tatgcgatgg agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac 1080

ttgatgtaat tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag 1140

cctcagacag tggttcaaag tttttttctt ccatttcagg tgtcgtgaaa actaccccta 1200

aaagccagga tccaccatga ccaacaagtg tctcctccaa attgctctcc tgttgtgctt 1260

ctccactaca gctctttcca tgagctacaa cttgcttgga ttcctacaaa gaagcagcaa 1320

ttttcagtgt cagaagctcc tgtggcaatt gaatgggagg cttgaatact gcctcaagga 1380

caggatgaac tttgacatcc ctgaggagat taagcagctg cagcagttcc agaaggagga 1440

cgccgcattg accatctatg agatgctcca gaacatcttt gctattttca gacaagattc 1500

atctagcact ggctggaatg agactattgt tgagaacctc ctggctaatg tctatcatca 1560

gataaaccat ctgaagacag tcctggaaga aaaactggag aaagaagatt tcaccagggg 1620

aaaactcatg agcagtctgc acctgaaaag atattatggg aggattctgc attacctgaa 1680

ggccaaggag tacagtcact gtgcctggac catagtcaga gtggaaatcc taaggaactt 1740

ttacttcatt aacagactta caggttacct ccgaaactga attccctgtg acccctcccc 1800

agtgcctctc ctggccctgg aagttgccac tccagtgccc accagccttg tcctaataaa 1860

attaagttgc atcattttgt ctgactaggt gtccttctat aatattatgg ggtggagggg 1920

ggtggtatgg agcaaggggc aagttgggaa gacaacctgt agggcctgcg gggtctattg 1980

ggaaccaagc tggagtgcag tggcacaatc ttggctcact gcaatctccg cctcctgggt 2040

tcaagcgatt ctcctgcctc agcctcccga gttgttggga ttccaggcat gcatgaccag 2100

gctcagctaa tttttgtttt tttggtagag acggggtttc accatattgg ccaggctggt 2160

ctccaactcc taatctcagg tgatctaccc accttggcct cccaaattgc tgggattaca 2220

ggcgtgaacc actgctccct tccctgtcct tacgcgtaga attggtaaag agagtcgtgt 2280

aaaatatcga gttcgcacat cttgttgtct gattattgat ttttggcgaa accatttgat 2340

catatgacaa gatgtgtatc taccttaact taatgatttt gataaaaatc attaactagt 2400

ccatggctgc ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc 2460

ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc gtcagggcgc 2520

gtcagcgggt gttggcgggt gtcggggcgc agccatgacc cagtcacgta gcgatagcgg 2580

agtgtatact ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg 2640

cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct 2700

tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 2760

tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 2820

gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 2880

aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 2940

ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 3000

gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 3060

ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 3120

ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 3180

cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 3240

attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 3300

ggctacacta gaagaacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 3360

aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt 3420

gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 3480

tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga 3540

ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc 3600

taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct 3660

atctcagcga tctgtctatt tcgttcatcc atagttgcct gactcc 3706

<210> 2

<211> 3712

<212> DNA

<213> Homo Sapiens

<400> 2

cgtgaggctc cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt 60

tggggggagg ggtcggcaat tgaaccggtg cctagagaaa gtggcgcggg gtaaactggg 120

aaagtgatgt cgtgtactgg ctccgccttt ttcccgaggg tgggggagaa ccgtatataa 180

gtgcagtagt cgccgtgaac gttctttttc gcaacgggtt tgccgccaga acacaggtaa 240

gtgccgtgtg tggttcccgc gggcctggcc tctttacggg ttatggccct tgcgtgcctt 300

gaattacttc cacgcccctg gctgcagtac gtgattcttg atcccgagct tcgggttgga 360

agtgggtggg agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt 420

gaggcctggc ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt 480

ctcgctgctt tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt 540

tttttctgggg aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt 600

tttggggccg cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg 660

ggcctgcgag cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct 720

ctggtgcctg gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg 780

tcggcaccag ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca 840

aaatggagga cgcggcgctc gggagagcgg gcgggtgagt cacccgcaca aaggaaaagg 900

gcctttccgt cctcagccgt cgcttcatgt gactccacgg agtaccgggc gccgtccagg 960

cacctcgatt agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt 1020

tatgcgatgg agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac 1080

ttgatgtaat tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag 1140

cctcagacag tggttcaaag tttttttctt ccatttcagg tgtcgtgaaa actaccccta 1200

aaagccagga tccaccatgg cattgccctt tgctttaatg atggccctgg tggtgctcag 1260

ctgcaagtca agctgctctc tgggctgtaa tctgtctcaa acccacagcc tgaataacag 1320

gaggactttg atgctcatgg cacaaatgag gagaatctct cctttctcct gcctgaagga 1380

cagacatgac tttgaatttc cccaggagga atttgatggc aaccagttcc agaaagctca 1440

agccatctct gtcctccatg agatgatgca gcagaccttc aatctcttca gcacaaagaa 1500

ctcatctgct gcttgggatg agaccctcct agaaaaattc tacattgaac ttttccagca 1560

aatgaatgac ctggaagcct gtgtgataca ggaggttggg gtggaagaga ctcccctgat 1620

gaatgaggac tccatcctgg ctgtgaagaa atacttccaa agaatcactc tttatctgat 1680

ggagaagaaa tacagccctt gtgcctggga ggttgtcaga gcagaaatca tgagatccct 1740

cctctttttca acaaacttgc aaaaaagatt aaggaggaag gattgaattc cctgtgaccc 1800

ctccccagtg cctctcctgg ccctggaagt tgccactcca gtgcccacca gccttgtcct 1860

aataaaatta agttgcatca ttttgtctga ctaggtgtcc ttctataata ttatggggtg 1920

gaggggggtg gtatggagca aggggcaagt tgggaagaca acctgtaggg cctgcggggt 1980

ctattgggaa ccaagctgga gtgcagtggc acaatcttgg ctcactgcaa tctccgcctc 2040

ctgggttcaa gcgattctcc tgcctcagcc tcccgagttg ttgggattcc aggcatgcat 2100

gaccaggctc agctaatttt tgtttttttt gtagagacgg ggtttcacca tattggccag 2160

gctggtctcc aactcctaat ctcaggtgat ctacccacct tggcctccca aattgctggg 2220

attacaggcg tgaaccactg ctcccttccc tgtccttacg cgtagaattg gtaaagagag 2280

tcgtgtaaaa tatcgagttc gcacatcttt ttgtctgatt attgattttt ggcgaaacca 2340

tttgatcata tgacaagatg tgtatctacc ttaacttaat gattttgata aaaatcatta 2400

actagtccat ggctgcctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca 2460

gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca 2520

gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc atgacccagt cacgtagcga 2580

tagcggagtg tatactggct taactatgcg gcatcagagc agattgtact gagagtgcac 2640

catatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct 2700

tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 2760

gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 2820

atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 2880

ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 2940

cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 3000

tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 3060

gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 3120

aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 3180

tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 3240

aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 3300

aactacggct acactagaag aacagtattt ggtatctgcg ctctgctgaa gccagttacc 3360

ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt 3420

ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg 3480

atcttttctct cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 3540

atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa 3600

tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag 3660

gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact cc 3712

<210> 3

<211> 3709

<212> DNA

<213> Homo Sapiens

<400> 3

cgtgaggctc cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt 60

tggggggagg ggtcggcaat tgaaccggtg cctagagaaa gtggcgcggg gtaaactggg 120

aaagtgatgt cgtgtactgg ctccgccttt ttcccgaggg tgggggagaa ccgtatataa 180

gtgcagtagt cgccgtgaac gttctttttc gcaacgggtt tgccgccaga acacaggtaa 240

gtgccgtgtg tggttcccgc gggcctggcc tctttacggg ttatggccct tgcgtgcctt 300

gaattacttc cacgcccctg gctgcagtac gtgattcttg atcccgagct tcgggttgga 360

agtgggtggg agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt 420

gaggcctggc ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt 480

ctcgctgctt tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt 540

tttttctgggg aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt 600

tttggggccg cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg 660

ggcctgcgag cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct 720

ctggtgcctg gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg 780

tcggcaccag ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca 840

aaatggagga cgcggcgctc gggagagcgg gcgggtgagt cacccgcaca aaggaaaagg 900

gcctttccgt cctcagccgt cgcttcatgt gactccacgg agtaccgggc gccgtccagg 960

cacctcgatt agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt 1020

tatgcgatgg agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac 1080

ttgatgtaat tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag 1140

cctcagacag tggttcaaag tttttttctt ccatttcagg tgtcgtgaaa actaccccta 1200

aaagccagga tccaccatgg ccttgacctt tgctttactg gtggccctcc tggtgctcag 1260

ctgcaagtca agctgctctg tgggctgtga tctgcctcaa acccacagcc tgggtagcag 1320

gaggaccttg atgctcctgg cacagatgag gagaatctct cttttctcct gcttgaagga 1380

cagacatgac tttggatttc cccaggagga gtttggcaac cagttccaaa aggctgaaac 1440

catccctgtc ctccatgaga tgatccagca gatcttcaat ctcttcagca caaaggactc 1500

atctgctgct tgggatgaga ccctcctaga caaattctac actgaactct accagcagct 1560

gaatgacctg gaagcctgtg tgatacaggg ggtgggggtg acagagactc ccctgatgaa 1620

ggaggactcc attctggctg tgaggaaata cttccaaaga atcactctct atctgaaaga 1680

gaagaaatac agcccttgtg cctgggaggt tgtcagagca gaaatcatga gatctttttc 1740

tttgtcaaca aacttgcaag aaagtttaag aagtaaggaa tgaattccct gtgacccctc 1800

cccagtgcct ctcctggccc tggaagttgc cactccagtg cccaccagcc ttgtcctaat 1860

aaaattaagt tgcatcattt tgtctgacta ggtgtccttc tataatatta tggggtggag 1920

gggggtggta tggagcaagg ggcaagttgg gaagacaacc tgtagggcct gcggggtcta 1980

ttgggaacca agctggagtg cagtggcaca atcttggctc actgcaatct ccgcctcctg 2040

ggttcaagcg attctcctgc ctcagcctcc cgagttgttg ggattccagg catgcatgac 2100

caggctcagc taatttttgt ttttttggta gagacggggt ttcaccatat tggccaggct 2160

ggtctccaac tcctaatctc aggtgatcta cccaccttgg cctcccaaat tgctgggatt 2220

acaggcgtga accactgctc ccttccctgt ccttacgcgt agaattggta aagagagtcg 2280

tgtaaaatat cgagttcgca catcttgttg tctgattatt gatttttggc gaaaccattt 2340

gatcatatga caagatgtgt atctacctta acttaatgat tttgataaaa atcattaact 2400

agtccatggc tgcctcgcgc gtttcggtga tgacggtgaa aacctctgac acatgcagct 2460

cccggagacg gtcacagctt gtctgtaagc ggatgccggg agcagacaag cccgtcaggg 2520

cgcgtcagcg ggtgttggcg ggtgtcgggg cgcagccatg acccagtcac gtagcgatag 2580

cggagtgtat actggcttaa ctatgcggca tcagagcaga ttgtactgag agtgcaccat 2640

atgcggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc 2700

gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct 2760

cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg 2820

tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc 2880

cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga 2940

aacccgacag gactataaag ataccaggcg tttccccctct gaagctccct cgtgcgctct 3000

cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg 3060

gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag 3120

ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat 3180

cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac 3240

aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac 3300

tacggctaca ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc 3360

ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt 3420

tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc 3480

ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg 3540

agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca 3600

atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca 3660

cctatctcag cgatctgtct atttcgttca tccatagttg cctgactcc 3709

<210> 4

<211> 3925

<212> DNA

<213> Homo Sapiens

<400> 4

cgtgaggctc cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt 60

tggggggagg ggtcggcaat tgaaccggtg cctagagaaa gtggcgcggg gtaaactggg 120

aaagtgatgt cgtgtactgg ctccgccttt ttcccgaggg tgggggagaa ccgtatataa 180

gtgcagtagt cgccgtgaac gttctttttc gcaacgggtt tgccgccaga acacaggtaa 240

gtgccgtgtg tggttcccgc gggcctggcc tctttacggg ttatggccct tgcgtgcctt 300

gaattacttc cacgcccctg gctgcagtac gtgattcttg atcccgagct tcgggttgga 360

agtgggtggg agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt 420

gaggcctggc ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt 480

ctcgctgctt tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt 540

tttttctgggg aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt 600

tttggggccg cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg 660

ggcctgcgag cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct 720

ctggtgcctg gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg 780

tcggcaccag ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca 840

aaatggagga cgcggcgctc gggagagcgg gcgggtgagt cacccgcaca aaggaaaagg 900

gcctttccgt cctcagccgt cgcttcatgt gactccacgg agtaccgggc gccgtccagg 960

cacctcgatt agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt 1020

tatgcgatgg agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac 1080

ttgatgtaat tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag 1140

cctcagacag tggttcaaag tttttttctt ccatttcagg tgtcgtgaaa actaccccta 1200

aaagccagga tccgatatcg tcgaccacca tgtggccccc tgggtcagcc tcccagccac 1260

cgccctcacc tgccgcggcc acaggtctgc atccagcggc tcgccctgtg tccctgcagt 1320

gccggctcag catgtgtcca gcgcgcagcc tcctccttgt ggctaccctg gtcctcctgg 1380

accacctcag tttggccaga aacctccccg tggccactcc agacccagga atgttcccat 1440

gccttcacca ctcccaaaac ctgctgaggg ccgtcagcaa catgctccag aaggccagac 1500

aaactctaga attttaccct tgcacttctg aagagattga tcatgaagat atcacaaaag 1560

ataaaaccag cacagtggag gcctgtttac cattggaatt aaccaagaat gagagttgcc 1620

taaattccag agagacctct ttcataacta atgggagttg cctggcctcc agaaagacct 1680

cttttatgat ggccctgtgc cttagtagta tttatgaaga cttgaagatg taccaggtgg 1740

agttcaagac catgaatgca aagcttctga tggatcctaa gaggcagatc tttctagatc 1800

aaaacatgct ggcagttatt gatgagctga tgcaggccct gaatttcaac agtgagactg 1860

tgccacaaaa atcctccctt gaagaaccgg atttttataa aactaaaatc aagctctgca 1920

tacttcttca tgctttcaga attcgggcag tgactattga tagagtgatg agctatctga 1980

atgcttccta aggtaccgaa ttccctgtga cccctcccca gtgcctctcc tggccctgga 2040

agttgccact ccagtgccca ccagccttgt cctaataaaa ttaagttgca tcattttgtc 2100

tgactaggtg tccttctata atattatggg gtggaggggg gtggtatgga gcaaggggca 2160

agttgggaag acaacctgta gggcctgcgg ggtctattgg gaaccaagct ggagtgcagt 2220

ggcacaatct tggctcactg caatctccgc ctcctgggtt caagcgattc tcctgcctca 2280

gcctcccgag ttgttgggat tccaggcatg catgaccagg ctcagctaat ttttgttttt 2340

ttggtagaga cggggtttca ccatattggc caggctggtc tccaactcct aatctcaggt 2400

gatctaccca ccttggcctc ccaaattgct gggattacag gcgtgaacca ctgctccctt 2460

ccctgtcctt acgcgtagaa ttggtaaaga gagtcgtgta aaatatcgag ttcgcacatc 2520

ttgttgtctg attattgatt tttggcgaaa ccatttgatc atatgacaag atgtgtatct 2580

accttaactt aatgattttg ataaaaatca ttaactagtc catggctgcc tcgcgcgttt 2640

cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct 2700

gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg 2760

tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg gcttaactat 2820

gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat accgcacaga 2880

tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac tgactcgctg 2940

cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta 3000

tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc 3060

aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag 3120

catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac 3180

caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc 3240

ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt 3300

aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 3360

gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga 3420

cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta 3480

ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aagaacagta 3540

tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga 3600

tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 3660

cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 3720

tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc 3780

tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact 3840

tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 3900

cgttcatcca tagttgcctg actcc 3925

<210> 5

<211> 4684

<212> DNA

<213> Homo Sapiens

<400> 5

cgtgaggctc cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt 60

tggggggagg ggtcggcaat tgaaccggtg cctagagaaa gtggcgcggg gtaaactggg 120

aaagtgatgt cgtgtactgg ctccgccttt ttcccgaggg tgggggagaa ccgtatataa 180

gtgcagtagt cgccgtgaac gttctttttc gcaacgggtt tgccgccaga acacaggtaa 240

gtgccgtgtg tggttcccgc gggcctggcc tctttacggg ttatggccct tgcgtgcctt 300

gaattacttc cacgcccctg gctgcagtac gtgattcttg atcccgagct tcgggttgga 360

agtgggtggg agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt 420

gaggcctggc ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt 480

ctcgctgctt tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt 540

tttttctgggg aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt 600

tttggggccg cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg 660

ggcctgcgag cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct 720

ctggtgcctg gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg 780

tcggcaccag ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca 840

aaatggagga cgcggcgctc gggagagcgg gcgggtgagt cacccgcaca aaggaaaagg 900

gcctttccgt cctcagccgt cgcttcatgt gactccacgg agtaccgggc gccgtccagg 960

cacctcgatt agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt 1020

tatgcgatgg agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac 1080

ttgatgtaat tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag 1140

cctcagacag tggttcaaag tttttttctt ccatttcagg tgtcgtgaaa actaccccta 1200

aaagccagga tccaccatgt gtcaccagca gttggtcatc tcttggtttt ccctggtttt 1260

tctggcatct cccctcgtgg ccatatggga actgaagaaa gatgtttatg tcgtagaatt 1320

ggattggtat ccggatgccc ctggagaaat ggtggtcctc acctgtgaca cccctgaaga 1380

agatggtatc acctggacct tggaccagag cagtgaggtc ttaggctctg gcaaaaccct 1440

gaccatccaa gtcaaagagt ttggagatgc tggccagtac acctgtcaca aaggaggcga 1500

ggttctaagc cattcgctcc tgctgcttca caaaaaggaa gatggaattt ggtccactga 1560

tattttaaag gaccagaaag aacccaaaaa taagaccttt ctaagatgcg aggccaagaa 1620

ttattctgga cgtttcacct gctggtggct gacgacaatc agtactgatt tgacattcag 1680

tgtcaaaagc agcagaggct cttctgaccc ccaaggggtg acgtgcggag ctgctacact 1740

ctctgcagag agagtcagag gggacaacaa ggagtatgag tactcagtgg agtgccagga 1800

ggacagtgcc tgcccagctg ctgaggagag tctgcccatt gaggtcatgg tggatgccgt 1860

tcacaagctc aagtatgaaa actacaccag cagcttcttc atcagggaca tcatcaaacc 1920

tgacccaccc aagaacttgc agctgaagcc attaaagaat tctcggcagg tggaggtcag 1980

ctgggagtac cctgacacct ggagtactcc acattcctac ttctccctga cattctgcgt 2040

tcaggtccag ggcaagagca agagagaaaa gaaagataga gtcttcacgg acaagacctc 2100

agccacggtc atctgccgca aaaatgccag cattagcgtg cgggcccagg accgctacta 2160

tagctcatct tggagcgaat gggcatctgt gccctgcagt taagcttggt accgaattcc 2220

ctgtgacccc tccccagtgc ctctcctggc cctggaagtt gccactccag tgcccaccag 2280

ccttgtccta ataaaattaa gttgcatcat tttgtctgac taggtgtcct tctataatat 2340

tatggggtgg aggggggtgg tatggagcaa ggggcaagtt gggaagacaa cctgtagggc 2400

ctgcggggtc tattgggaac caagctggag tgcagtggca caatcttggc tcactgcaat 2460

ctccgcctcc tgggttcaag cgattctcct gcctcagcct cccgagttgt tgggattcca 2520

ggcatgcatg accaggctca gctaattttt gtttttttgg tagagacggg gtttcaccat 2580

attggccagg ctggtctcca actcctaatc tcaggtgatc tacccacctt ggcctcccaa 2640

attgctggga ttacaggcgt gaaccactgc tcccttccct gtccttacgc gtagaattgg 2700

taaagagagt cgtgtaaaat atcgagttcg cacatcttgt tgtctgatta ttgatttttg 2760

gcgaaaccat ttgatcatat gacaagatgt gtatctacct taacttaatg attttgataa 2820

aaatcattaa ctagtccatg gctgcctcgc gcgtttcggt gatgacggtg aaaacctctg 2880

acacatgcag ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca 2940

agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc 3000

acgtagcgat agcggagtgt atactggctt aactatgcgg catcagagca gattgtactg 3060

agagtgcacc atatgcggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc 3120

aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga 3180

gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca 3240

ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg 3300

ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt 3360

cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc 3420

ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct 3480

tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc 3540

gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta 3600

tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca 3660

gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag 3720

tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag 3780

ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt 3840

agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa 3900

gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg 3960

attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga 4020

agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta 4080

atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc 4140

c 4141

<---

LIST OF SEQUENCES OF OLIGONUCLEOTIDES

IFNB1_F AGGATCCACCATGACCAACAAGTGTCTCCTC

IFNB1_R ATAGAATTCAGTTTCGGAGGTAACCTGTAAG

IFNB1_SF TGGCAATTGAATGGGAGAGCT

IFNB1_SR GTCTCATTCCAGCCAGTGCT

IFNA14_F AGGATCCACCATGGCATTGCCCTTTGCTTTAATG

IFNA14_R TATGAATTCAATCCTTCCTCCTTAATCTTTTTTGC

IFNA14_SF GGCAACCAGTTCCAGAAAGC

IFNA14_SR CACACAGGCTTCCAGGTCAT

IFNA2_F AGGATCCACCATGGCCTTGACCTTTGCTTTAC

IFNA2_R TATGAATTCATTCCTTACTTCTTAAACTTTCTTG

IFNA2_SF AGCTGAATGACCTGGAAGCC

IFNA2_SR CTGCTCTGACAACCTCCCAG

IL12A_F ATCGTCGACCACCATGTGGCCCCCTGGGTCA

IL12A_R TTCGGTACCTTAGGAAGCATTCAGATAGCTCATC

IL12A_SF GCTCCAGAAGGCCAGACAAA

IL12A_SR GCCAGGCAACTCCCATTAGT

IL12B_F AGGATCCACCATGTGTCACCAGCAGTTGGTC

IL12B_R TGTAAGCTTAACTGCAGGGCACAGATGC

IL12B_SF CATCAAACCTGACCCACCCA

IL12B_SR GCTGAGGTCTTGTCCGTGAA

Claims (36)

1. Gene therapy DNA vector based on VTvaf17 gene therapy DNA vector for the treatment of diseases characterized by impaired innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including in case of antitumor vaccination as gene therapeutic adjuvant, wherein the gene therapeutic DNA vector contains the coding portion of the target gene IFNB1, cloned into the gene therapeutic DNA vector VTvaf17, to obtain m gene therapy DNA vector VTvaf17-IFNB1, with the nucleotide sequence SEQ ID №1. 2. Gene therapeutic DNA vector based on VTvaf17 gene therapeutic DNA vector for the treatment of diseases characterized by impaired innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including in case of antitumor vaccination as gene therapy adjuvant, wherein the gene therapy DNA vector contains the coding portion of the target gene IFNA14, cloned into the gene therapy DNA vector VTvaf17, to obtain I am taking the gene therapy DNA vector VTvaf17-IFNA14, with the nucleotide sequence of SEQ ID NO: 2. 3. Gene therapy DNA vector based on VTvaf17 gene therapy DNA vector for the treatment of diseases characterized by impaired innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with an imbalance of the immune system, for immunomodulation, including in case of antitumor vaccination as a gene therapy an adjuvant, wherein the gene therapy DNA vector contains the coding portion of the target IFNA2 gene, cloned into VTvaf17 gene therapy DNA vector, to obtain m gene therapeutic DNA vector VTvaf17-IFNA2, with the nucleotide sequence of SEQ ID No. 3. 4. Gene therapeutic DNA vector based on VTvaf17 gene therapeutic DNA vector for the treatment of diseases characterized by impaired innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including in case of antitumor vaccination as gene therapy adjuvant, wherein the gene therapy DNA vector contains the coding portion of the target IL12A gene, cloned into the gene therapy DNA vector VTvaf17, to obtain m gene therapy DNA vector VTvaf17-IL12A, with the nucleotide sequence SEQ ID №4. 5. Gene therapeutic DNA vector based on VTvaf17 gene therapeutic DNA vector for the treatment of diseases characterized by impaired innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with an imbalance of the immune system, for immunomodulation, including with antitumor vaccination as gene therapy adjuvant, wherein the gene therapy DNA vector contains the coding portion of the target IL12B gene cloned into the VTvaf17 gene therapy DNA vector to obtain m gene therapy DNA vector VTvaf17-IL12B, with the nucleotide sequence SEQ ID №5. 6. Gene therapy DNA vector based on the gene therapy DNA vector VTvaf17, carrying the target gene IFNB1, IFNA14, IFNA2, IL12A, IL12B according to claims 1-4 or 5, characterized in that each of the created gene therapy DNA vectors: VTvaf17-IFNB1 , or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B according to claims 1 to 4 or 5, due to the limited size of the vector part of VTvaf17, not exceeding 3200 bp, has the ability to effectively penetrate human and animal cells and express the IFNB1 or IFNA14 or IFNA2 or IL12A or IL12B cloned into it target gene. 7. Gene therapy DNA vector based on the gene therapy DNA vector VTvaf17, carrying the target gene IFNB1, IFNA14, IFNA2, IL12A, IL12B according to claims 1-4 or 5, characterized in that each of the created gene therapy DNA vectors: VTvaf17 IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B according to claims 1-4 or 5, nucleotide sequences that are not antibiotic resistance genes, viral genes, and regulatory elements are used as structural elements viral genomes, providing the possibility of its safe use for genetic therapy of humans and animals. 8. A method of obtaining a gene therapy DNA vector based on the gene therapy DNA vector VTvaf17, carrying the target gene IFNB1, IFNA14, IFNA2, IL12A, IL12B according to claims 1 to 4 or 5, wherein each of the gene therapy DNA vectors: VTvaf17 IFNB1, or VTvaf17-IFNA14, or VTvaf17-IFNA2, or VTvaf17-IL12A, or VTvaf17-IL12B is prepared as follows: the coding portion of the target gene IFNB1, or IFNA14, or IFNA2, or IL12A, or IL12B is cloned into the gene therapy DNA vector VTvaf17 and get the gene therapy DNA vector VTvaf17-IFNB1, SEQ ID No. 1, or VTvaf17-IFNA14, SEQ ID No. 2, or VTvaf17-IFNA2, SEQ ID No. 3, or VTvaf17-IL12A, SEQ ID No. 4, or VT vaf17-IL12B, SEQ ID No. 5, respectively, wherein the coding portion of the target gene IFNB1, or IFNA14, or IFNA2, or IL12A, or IL12B is obtained by isolating total RNA from a biological sample of human tissue, followed by a reverse transcription reaction and PCR amplification with using the created oligonucleotides and cleavage of the amplification product with the corresponding restriction endonucleases, moreover, cloning into the gene therapy DNA vector VTvaf17 is carried out at the Sail and Kpnl restriction sites, or at the BamHI and EcoRI restriction sites, and DYT without antibiotics, in this case, upon receipt of the gene therapy DNA vector VTvaf17-IFNB1, SEQ ID No. 1 for carrying out the reverse transcription reaction and PCR amplification, oligonucleotides are used as the oligonucleotides created for this IFNB1_F AGGATCCACCATGACCAACAAGTGTCTCCTC IFNB1_R ATAGAATTCAGTTTCGGAGGTAACCTGTAAG, and the splitting of the amplification product and cloning of the coding part of the IFNB1 gene into the gene therapy DNA vector VTvaf17 is carried out using restriction endonucleases BamHI and EcoRI, moreover, upon receipt of the gene therapy DNA vector VTvaf17-IFNA14, SEQ ID No. 2 for carrying out the reverse transcription reaction and PCR amplification, oligonucleotides are used as the oligonucleotides created for this IFNA14_F AGGATSSASSATATGGСATTGSSCTTTGSTTTAAATG IFNA14_R TATGAATTCAATCCTTCCTCCTTAATCTTTTTTTGC, and the splitting of the amplification product and cloning of the coding portion of the IFNA14 gene into the gene therapy VTvaf17 DNA vector is performed using restriction endonucleases BamHI and EcoRI, moreover, when receiving the gene therapy DNA vector VTvaf17-IFNA2, SEQ ID No. 3 for carrying out the reverse transcription reaction and PCR amplification, oligonucleotides are used as the oligonucleotides created for this IFNA2_F AGGATSSASSATATGGCCTTGACCTTTGCTTTAC IFNA2_R TATGAATTCATTCCTTACTTCTTAAACTTTCTTG, and the splitting of the amplification product and cloning of the coding part of the IFNA2 gene into the gene therapy DNA vector VTvaf17 is carried out using restriction endonucleases BamHI and EcoRI, moreover, upon receipt of the gene therapy DNA vector VTvaf17-IL12A, SEQ ID No. 4 for the reverse transcription reaction and PCR amplification, oligonucleotides are used as the oligonucleotides created for this IL12A_F ATCGTCGACCACCATGTGGCCCCCTGGGTCA IL12A_R TTCGGTACCTTAGGAAGCATTCAGATAGCTCATC, and the splitting of the amplification product and cloning of the coding part of the IL12A gene into the gene therapy DNA vector VTvaf17 is carried out using restriction endonucleases Sail and Kpnl, moreover, when receiving the gene therapy DNA vector VTvaf17-IL12B, SEQ ID No. 5 for carrying out the reverse transcription reaction and PCR amplification, oligonucleotides are used as the oligonucleotides created for this IL12B_F AGGATCCACCATGTGTCACCAGCAGTTGGTC IL12B_R TGTAAGCTTAACTGCAGGGCACAGATGC, and the splitting of the amplification product and cloning of the coding part of the IL12B gene into the gene therapy DNA vector VTvaf17 is carried out using restriction endonucleases BamHI and Hindi 11. 9. A method of using a gene therapy DNA vector based on the VTvaf17 gene therapy DNA vector carrying the target gene IFNB1, IFNA14, IFNA2, IL12A, IL12B according to claims 1-4 and / or 5, for the treatment of diseases characterized by impaired innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including antitumor vaccination as a gene therapy adjuvant, consisting in transfection of the chosen gene therapy DNA vecto Ohm, carrying the target gene based on the gene therapy DNA vectors VTvaf17, or several selected gene therapy DNA vectors carrying the target genes based on the gene therapy DNA vectors VTvaf17, from the created gene therapy DNA vectors carrying the target genes based on the gene therapy DNA vector VTvaf17, cells of organs and tissues of a patient or animal, and / or the introduction into the organs and tissues of a patient or animal of autologous cells of this patient or animal transfected with a selected gene therapy DNA vector m carrying the target gene based on the gene therapy DNA vectors VTvaf17 or several selected gene therapy DNA vectors carrying the target genes based on the gene therapy DNA vectors VTvaf17 from the created gene therapy DNA vectors carrying the target genes based on the gene therapy DNA vector VTvaf17 and / or in the introduction into the organs and tissues of a patient or animal of a selected gene therapy DNA vector carrying the target gene based on VTvaf17 gene therapy DNA vector or several selected gene therapy DNA vectors carrying the target genes based on the gene therapy VTvaf17 DNA vector, from created gene therapy DNA vectors carrying the target genes based on the gene therapy VTvaf17 DNA vector, or in a combination of the indicated methods. 10. A method of producing a strain for the production of a gene therapeutic DNA vector according to claims 1-4 or 5 for the treatment of diseases characterized by impaired innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with an imbalance of the immune system, for immunomodulation, including including antitumor vaccination as a gene therapeutic adjuvant, which consists in obtaining electrocompetent cells of the strain of Escherichia coli SCSI 10-AF followed by electroporation of these genoter cells VTvaf17-IFNB1 eutectic DNA vector, or VTvaf17-IFNA14 DNA vector, or VTvaf17-IFNA2 DNA vector, or VTvaf17-IL12A DNA vector, or VTvaf17-IL12B DNA vector, after which the cells are plated on Petri dishes with agar selective medium containing yeast extract, peptone, 6% sucrose, as well as 10 μg / ml chloramphenicol, resulting in an Escherichia coli strain SCSI 10-AF / VTvaf17-IFNB1 or an Escherichia coli strain SCS110-AF / VTvaf17-IFNA14, or an Escherichia coli strain SCS110-AF / VTvaf17-IFNA2, or Escherichia coli strain SCS110-AF / VTvaf17-IL12A, or Escherichia coli strain SCS110-AF / VTvaf17-IL12B. 11. The strain Escherichia coli SCS110-AFA / Tvaf17-IFNB1, obtained by the method according to claim 10, carrying the gene therapy DNA vector VTvaf17-IFNB1, for its production with the possibility of selection without the use of antibiotics to obtain a gene therapy DNA vector for the treatment of diseases characterized by violation innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including with antitumor vaccination as a gene therapy adjuvant. 12. The strain Escherichia coli SCS110-AF / VTvaf17-IFNA14, obtained by the method according to claim 10, carrying the gene therapy DNA vector VTvaf17-IFNA14, for its production with the possibility of selection without the use of antibiotics to obtain gene therapy DNA vector for the treatment of diseases characterized by violation innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including with antitumor vaccination as a gene therapy adjuvant. 13. The strain Escherichia coli SCSI10-AF / VTvaf17-IFNA2, obtained by the method according to claim 10, carrying the gene therapy DNA vector VTvaf17-IFNA2, for its production with the possibility of selection without the use of antibiotics to obtain gene therapy DNA vector for the treatment of diseases characterized by violation innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including with antitumor vaccination as a gene therapy adjuvant. 14. The strain Escherichia coli SCS110-AF / VTvaf17-IL12A, obtained by the method according to claim 10, carrying the gene therapy DNA vector VTvaf17-IL12A, for its production with the possibility of selection without the use of antibiotics to obtain a gene therapy DNA vector for the treatment of diseases characterized by violation innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including with antitumor vaccination as a gene therapy adjuvant. 15. The strain Escherichia coli SCSI 10-AF / VTvaf17-IL12B, obtained by the method according to p. 10, carrying the gene therapy DNA vector VTvaf17-IL12B, for its production with the possibility of selection without the use of antibiotics to obtain gene therapy DNA vector for the treatment of diseases characterized violation of innate and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including with antitumor vaccination as a gene therapy adjuvant. 16. A method for the industrial production of a gene therapy DNA vector based on VTvaf17 gene therapy DNA vector carrying the target gene IFNB1 or IFNA14 or IFNA2 or IL12A or IL12B, according to claims 1-4 or 5, for the treatment of diseases characterized by a violation of congenital and adaptive immunity, for the treatment of autoimmune, oncological, viral diseases associated with imbalance of the immune system, for immunomodulation, including with antitumor vaccination as a gene therapy adjuvant, consisting in the fact that VTvaf17-IFNB1 singing DNA vector, or VTvaf17-IFNA14 gene therapy DNA vector, or VTvaf17-IFNA2 gene therapy DNA vector, or VTvaf17-IL12A gene therapy DNA vector, or VTvaf17-IL12B gene therapy DNA vector, obtained by sowing in a flask with a prepared medium a seed culture selected from Escherichia coli strain SCS110-AFA / Tvaf 17-IFNB1, or Escherichia coli strain SCSI 10-AF / VTvaf17-IFNA14, or Escherichia coli strain SCSI 10-AF / VTvaf17-IFNA2, or Escherichia strain coli SCSI 10-AF / VTvaf17-IL12A, or Escherichia coli strain SCSI 10-AF / VTvaf17-IL12B, then incubate the seed medium in a shaker-incubator and transfer ny in its industrial fermenter and then grown until stationary phase is then separated fraction containing the target DNA product multistage filtered and purified by chromatographic methods.

Images