RU2691308C1

RU2691308C1 - BACTERIAL STRAIN ESCHERICHIA coli/pTdcR-turboYFP, HAVING SENSITIVITY TO TERAHERTZ RADIATION

Info

Publication number: RU2691308C1
Application number: RU2018130231A
Authority: RU
Inventors: Данил Сергеевич Сердюков; Татьяна Николаевна Горячковская; Алексей Сергеевич Розанов; Ирина Анатольевна Мещерякова; Сергей Евгеньевич Пельтек
Priority date: 2018-08-20
Filing date: 2018-08-20
Publication date: 2019-06-11

Abstract

FIELD: biotechnology.SUBSTANCE: invention refers to biotechnology and genetic engineering. E. coli/pTdcR-TurboYFP strain is obtained by transforming the E. coli JM109 strain with plasmid pTdcR-TurboYFP prepared on the basis of the Turbo YFP-B plasmid and containing a gene coding the fluorescent protein TurboYFP under the control of the promoter promoter gene of the L-threonine dehydratase operon.EFFECT: invention enables to obtain a recombinant strain of bacteria Escherichia coli/pTdcR-TurboYFP with high genetic stability, having sensitivity to THz radiation.1 cl, 5 dwg, 3 ex

Description

Изобретение относится к области биотехнологии и генной инженерии и может быть использовано для тестирования присутствия в окружающей среде терагерцового (ТГц) излучения, применяемого в научных исследованиях, а также в приборах медицинского и других назначений.The invention relates to the field of biotechnology and genetic engineering and can be used to test the presence in the environment of terahertz (THz) radiation used in scientific research, as well as in devices for medical and other purposes.

С вхождением в эпоху интенсивного научно-технического прогресса начинает повсеместно использоваться неионизирующее электромагнитное излучение, в частности, ТГц излучение, которое по частотному диапазону располагается между высокочастотным микроволновым и длинноволновым инфракрасным диапазонами в интервале частот от 0,3 до 10 ТГц, т.е. 0,3×10¹²-10×10¹² Гц (длина волны 1 мм - 30 мкм).With entry into the era of intensive scientific and technological progress, non-ionizing electromagnetic radiation, in particular, THz radiation, which is located between the high-frequency microwave and long-wave infrared bands in the frequency range from 0.3 to 10 THz, i.e. 0.3 × 10 ¹² -10 × 10 ¹² Hz (wavelength 1 mm - 30 microns).

Известны способы тестирования ТГц излучения, основанные на физических принципах: межподзонные переходы и связанные с ними явления в квантовых ямах, сверхрешетках и точках; туннелирование с участием фотонов в резонансных туннельных диодах. Данный вид излучения тестируется также путем регистрации фотонов с помощью одноэлектронных транзисторов и поверхностных волн в транзисторах с высокой подвижностью электронов и др. [1].Known methods of testing THz radiation, based on physical principles: intersubband transitions and related phenomena in quantum wells, superlattices and points; photon tunneling in resonant tunnel diodes. This type of radiation is also tested by registering photons with single-electron transistors and surface waves in transistors with high electron mobility, etc. [1].

Основным недостатком физических способов тестирования ТГц излучения является отсутствие эффективных ТГц приемников, а также сложность их использования и необходимость высокой квалификации оператора.The main disadvantage of physical methods for testing THz radiation is the lack of effective THz receivers, as well as the complexity of their use and the need for highly skilled operator.

Современная экологическая обстановка диктует необходимость тестирования чистоты воды, воздуха и пищевых продуктов, что требует создания новых высокоэффективных и чувствительных методов, которые бы в отсутствие знаний о природе токсического для организма человека вещества, выявляли его присутствие в различных средах. Разработка бактериальных биосенсоров предоставила такую возможность [2]. В основе биосенсора лежит способность клетки отвечать на токсическое воздействие активацией своих защитных систем. Каскады генов активируются в клетке в присутствии агентов, повреждающих структуру и функции клетки [3, 4]. Промоторы таких генов и являются чувствительным звеном геносенсорной конструкции. Они связаны с репортерным геном, появление продукта которого свидетельствует об активации системы. В качестве репортерных генов используют гены, кодирующие флюоресцентные или люминесцентные белки, которые легко детектируются [5].Modern environmental conditions dictate the need for testing the purity of water, air and food products, which requires the creation of new highly effective and sensitive methods that, in the absence of knowledge about the nature of a substance toxic to the human body, would reveal its presence in various environments. The development of bacterial biosensors provided such an opportunity [2]. The basis of the biosensor is the ability of the cell to respond to toxic effects by the activation of its protective systems. Gene cascades are activated in the cell in the presence of agents that damage the structure and function of the cell [3, 4]. The promoters of such genes are the sensitive part of the genosensory construct. They are associated with a reporter gene, the appearance of the product of which indicates the activation of the system. Genes encoding fluorescent or luminescent proteins that are easily detected are used as reporter genes [5].

К настоящему времени разработан ряд достаточно эффективных геносенсорных конструкций на основе промоторов генов, являющихся ключевыми регуляторами стрессовых ответов или основными эффекторами ответа на стресс. Известны геносенсорные конструкции, способные выявлять различные токсические агенты, например, агенты, индуцирующие окислительный стресс у бактериальных клеток [6, 7], агенты, повреждающие ДНК [8], белки или мембраны [9], а также сенсоры, регистрирующие присутствие тяжелых металлов [10, 11].To date, a number of fairly effective genosensory constructions have been developed based on gene promoters, which are key regulators of stress responses or major effectors of the response to stress. Genosensory constructions are known that can detect various toxic agents, for example, agents that induce oxidative stress in bacterial cells [6, 7], agents that damage DNA [8], proteins or membranes [9], and sensors that record the presence of heavy metals [ 10, 11].

Известен штамм Escherichia coli (Е. coli), содержащий рекомбинантные плазмиды с бактериальными luxCDABE-генами под контролем индуцибельных стрессовых промоторов PrpoE и PgrpE и неиндуцибельного Plac промотора, и разработанный на их основе набор проб бактериальных клеток Е. coli для тестирования детергентов гидрофобной природы в окружающей среде [12].A known strain of Escherichia coli (E. coli), containing recombinant plasmids with bacterial luxCDABE genes under the control of PrpoE and PgrpE inducible stress promoters and non-inducible Plac promoter, and a set of E. coli bacterial cell samples for testing of detergents of hydrophobic nature in the surrounding environment [12].

Известен штамм Е. coli, содержащий рекомбинантные плазмиды с бактериальными luxCDABE-генами под контролем индуцибельных стрессовых промоторов PkatG, PsoxS, PrecA, PgrpE, и разработанный на их основе набор проб бактериальных клеток Е. coli для тестирования гептила в окружающей среде [13].A known E. coli strain containing recombinant plasmids with bacterial luxCDABE genes under the control of inducible stress promoters PkatG, PsoxS, PrecA, PgrpE, and a set of samples of bacterial E. coli cells for testing heptyl in the environment developed on their basis [13].

Известен штамм Е. coli, содержащий генетическую конструкцию pDps-GFP, продуцирующий флюоресцентный белок green fluorescent protein (GFP) в присутствии фенола и перекиси водорода [14].A known E. coli strain containing the genetic construct pDps-GFP, producing the fluorescent protein green fluorescent protein (GFP) in the presence of phenol and hydrogen peroxide [14].

Известен штамм Е. coli, содержащий генетическую конструкцию pKatG-GFP, продуцирующий флуоресцентный белок GFP в присутствии веществ, индуцирующих окислительный стресс у бактериальных клеток [15].A known E. coli strain containing the genetic construct pKatG-GFP, producing GFP fluorescent protein in the presence of substances that induce oxidative stress in bacterial cells [15].

Недостатком вышеназванных штаммов-геносенсоров является их непригодность для тестирования ТГц излучения.The disadvantage of the above genosensors strains is their unsuitability for testing THz radiation.

Наиболее ближайшим к заявляемому штамму - прототипом, является штамм Е. coli/pGlnA-GFP, содержащий геносенсорную конструкцию pGlnA-GFP, включающую ген, кодирующий флуоресцентный белок GFP, находящийся под регуляторным контролем промотора гена glnA Е. coli, обеспечивающего продукцию флуоресцентного белка GFP в присутствии ТГц излучения [17].The closest to the claimed strain is the prototype, is the E. coli / pGlnA-GFP strain containing the pGlnA-GFP genosensor construct, including the gene encoding the fluorescent GFP protein, which is under the regulatory control of the glnA gene promoter, providing the production of the fluorescent GFP protein in the presence of THz radiation [17].

Задачей изобретения является получение рекомбинантного штамма, обеспечивающего продукцию флуоресцентного белка turbo yellow fluorescent protein (TurboYFP) в присутствии ТГц излучения.The objective of the invention is to obtain a recombinant strain that provides production of fluorescent protein turbo yellow fluorescent protein (TurboYFP) in the presence of THz radiation.

Технический результат: получение рекомбинантного штамма бактерий Е. coli/pTdcR-TurboYFP с повышенной генетической стабильностью, обладающего чувствительностью к ТГц излучению, позволяющего использовать его в качестве геносенсора для тестирования присутствия ТГц излучения.EFFECT: obtaining a recombinant E. coli / pTdcR-TurboYFP bacterial strain with enhanced genetic stability, sensitivity to THz radiation, allowing it to be used as a genosensor for testing the presence of THz radiation.

Полученный рекомбинантный штамм Е. coli/pTdcR-TurboYFP способен продуцировать флуоресцентный белок TurboYFP, обладающий усиленной в сравнении с GFP флуоресценцией. Штамм также имеет преимущество в более высокой генетической стабильности за счет мутаций по хромосомным генам endA, recA и hsdR.The resulting recombinant E. coli / pTdcR-TurboYFP strain is capable of producing the fluorescent protein TurboYFP, which has enhanced fluorescence compared to GFP. The strain also has the advantage of a higher genetic stability due to mutations in the chromosomal genes endA, recA and hsdR.

Штамм Е. coli/pTdcR-TurboYFP может быть использован для исследования влияния ТГц излучения на регуляторные элементы клеток E. coli и выявления последовательности изменений в экспрессии различных генов при ТГц облучении.The strain E. coli / pTdcR-TurboYFP can be used to study the effect of THz radiation on the regulatory elements of E. coli cells and to identify the sequence of changes in the expression of various genes under THz irradiation.

Сущность предлагаемого изобретения заключается в следующем.The essence of the invention is as follows.

Генно-инженерными методами получают плазмиду pTdcR-TurboYFP, несущую ген, кодирующий флуоресцентный белок TurboYFP под контролем промотора гена активатора оперона L-треониндегидратазы.The plasmid pTdcR-TurboYFP carrying the gene encoding the fluorescent protein TurboYFP under the control of the promoter of the gene of the operon activator L-threonine dehydratase is obtained by genetic engineering methods.

Исходным генетическим материалом для конструирования рекомбинантной плазмиды pTdcR-TurboYFP являются:The source of genetic material for the construction of recombinant plasmid pTdcR-TurboYFP are:

- плазмида pTurboYFP-B (Evrogen),- plasmid pTurboYFP-B (Evrogen),

- фрагмент промотора гена активатора оперона L-треониндегидратазы -69…+157 относительно сайта начала транскрипции,- a fragment of the promoter of the activator gene of the operon L-threonine dehydratase -69 ... + 157 relative to the site of the start of transcription,

Полученная плазмида pTdcR-TurboYFP (фиг. 1) характеризуется следующими признаками:The obtained plasmid pTdcR-TurboYFP (Fig. 1) is characterized by the following features:

- имеет размер 4243 п.о.;- has a size of 4243 bp;

- содержит искусственный ген, кодирующий флуоресцентный белок TurboYFP, под контролем промотора гена tdcR;- contains an artificial gene encoding a fluorescent protein TurboYFP, under the control of the promoter of the tdcR gene;

- состоит из следующих элементов:- consists of the following elements:

ampR - ген, кодирующий белковую последовательность, обеспечивающую устойчивость клетки к ампициллину;ampR - a gene encoding a protein sequence that ensures cell resistance to ampicillin;

ampR promoter - промотор, регулирующий работу гена ampR;ampR promoter - the promoter that regulates the operation of the ampR gene;

cmr - ген, кодирующий белковую последовательность, обеспечивающую устойчивость клетки к хлорамфениколу;cmr - gene encoding a protein sequence that ensures cell resistance to chloramphenicol;

lambda t0 terminator - терминатор транскрипции t0 фага лямбда;lambda t0 terminator - transcription terminator t0 of phage lambda;

rrnB T1 terminator - терминатор транскрипции Т1 гена rrnB Е. coli;rrnB T1 terminator - transcription terminator T1 of the rrnB gene E. coli;

ori - начало репликации плазмидной конструкции;ori - the beginning of the replication of the plasmid construct;

TurboYFP - ген, кодирующий последовательность белка TurboYFP и находящийся под контролем промотера гена tdcR Е. coli;TurboYFP - the gene encoding the sequence of the TurboYFP protein and under the control of the promoter of the E. coli tdcR gene;

tdcR promoter - промотер гена tdcR Е. coli.tdcR promoter - promoter of tdcR gene E. coli.

Функциональная карта плазмиды pTdcR-TurboYFP представлена на фиг. 1.A functional map of the plasmid pTdcR-TurboYFP is shown in FIG. one.

Нуклеотидная последовательность промоторной области гена tdcR Е. coli приведена на фиг. 2.The nucleotide sequence of the promoter region of the E. coli tdcR gene is shown in FIG. 2

Предлагаемый штамм получают трансформацией клеток бактерии Е. coli JM109 плазмидой pTdcR-TurboYFP методом электропорации на электропораторе Gene Pulser Xcell (Bio-Rad) [16]. Отбор трансформантов осуществляют на среде Lysogeny broth (LB) с ампициллином (100 мг/л).The proposed strain is obtained by transformation of E. coli JM109 bacteria cells with the pTdcR-TurboYFP plasmid by electroporation using the Gene Pulser Xcell (Bio-Rad) electroporator [16]. The selection of transformants carried out on the medium Lysogeny broth (LB) with ampicillin (100 mg / l).

Штамм Е. coli/pTdcR-TurboYFP имеет следующие характеристики.The strain E. coli / pTdcR-TurboYFP has the following characteristics.

Грамотрицательные палочки. При росте на LB-агаре колонии гладкие, круглые, блестящие, сероватые, мутные, край ровный. При росте в жидких средах LB образуют интенсивную муть. Клетки прямые, палочковидной формы, подвижные.Gram-negative sticks. With the growth on LB-agar, the colonies are smooth, round, shiny, grayish, turbid, the edge is smooth. With growth in liquid media, LB forms an intense haze. The cells are straight, rod-shaped, mobile.

Физиолого-биохимические признаки.Physiological and biochemical signs.

Штамм является факультативным аэробом. Оптимальная температура роста 37°С. Хорошо растет в пределах рН среды от 7,0 до 8,0. Штамм характеризуется способностью использовать в качестве субстратов пептон, дрожжевой экстракт.Strain is an optional aerobic. The optimum growth temperature is 37 ° C. It grows well in the range of pH from 7.0 to 8.0. The strain is characterized by the ability to use peptone, yeast extract as substrates.

Генетические признаки, устойчивость к антибиотикам.Genetic traits, antibiotic resistance.

Штамм устойчив к ампициллину благодаря наличию в клетке плазмиды pTdcR-TurboYFP, несущей ген устойчивости к ампициллину под регуляцией соответствующего промотора. Штамм устойчив к налидиксовой кислоте благодаря наличию в бактериальной хромосоме гена устойчивости к налидиксовой кислоте под регуляцией соответствующего промотора. Штамм обладает повышенной генетической стабильностью благодаря мутациям по хромосомным генам endA, recA и hsdR.The strain is resistant to ampicillin due to the presence in the cell of the plasmid pTdcR-TurboYFP, carrying the gene for resistance to ampicillin under the regulation of the corresponding promoter. The strain is resistant to nalidixic acid due to the presence in the bacterial chromosome of the gene for resistance to nalidixic acid under the regulation of the corresponding promoter. The strain has an increased genetic stability due to mutations in the chromosomal genes endA, recA and hsdR.

Условия хранения штамма.The storage conditions of the strain.

Штамм Е. coli/pTdcR-TurboYFP хранят в среде LB с глицерином (t=-70°C) не менее года или на агаризованной среде LB со 100 мкг/мл ампициллина на чашках Петри (t=+8°С), или в стеклянных пробирках со скошенным агаром (t=+4°С). Во втором и третьем случаях пересевы на свежие среды делают один раз в месяц.The strain E. coli / pTdcR-TurboYFP is stored in LB medium with glycerin (t = -70 ° C) for at least a year or on agar LB medium with 100 μg / ml ampicillin on Petri dishes (t = + 8 ° С) or glass test tubes with beveled agar (t = + 4 ° С). In the second and third cases, transfers to fresh media are done once a month.

Изобретение иллюстрируется следующими примерами.The invention is illustrated by the following examples.

Пример 1. Конструирование плазмиды pTdcR-TurboYFP.Example 1. Construction of plasmid pTdcR-TurboYFP.

Геносенсорную конструкцию на основе промотора гена tdcR получали путем амплификации ПЦР-фрагмента базовой плазмиды pTurboYFP-B, в котором исключен участок ДНК с промотором Т5, и встройки на его место нужной промоторной последовательности гена tdcR.The genosensor construct based on the tdcR gene promoter was obtained by amplifying the PCR fragment of the basic plasmid pTurboYFP-B, in which the DNA region with the T5 promoter was excluded, and inserting the desired tdcR promoter sequence in its place.

Для этого была проведена амплификация плазмиды pTurboYFP-B с использованием праймеров:For this, amplification of the plasmid pTurboYFP-B was performed using primers:

прямой - 5' atgagcagcggcgcc;straight line - 5 'atgagcagcggcgcc;

обратный - 5' tttctcgaggtgaagacgaaagg.the reverse is 5 'tttctcgaggtgaagacgaaagg.

Полученный ПЦР-фрагмент базовой плазмиды pTurboYFP-B с расчетной длиной 4017 п.о. анализировали с помощью электрофореза в 1% агарозном геле. На фиг. 3 представлена электрофореграмма данного ПЦР-фрагмента.The obtained PCR fragment of the base plasmid pTurboYFP-B with a calculated length of 4017 p. analyzed by electrophoresis in 1% agarose gel. FIG. 3 shows the electrophoregram of this PCR fragment.

После проведения ПЦР реакционную смесь очищали от исходной плазмиды pTurboYFP-B путем обработки рестриктазой MalI.After PCR, the reaction mixture was purified from the original plasmid pTurboYFP-B by treatment with the restriction enzyme MalI.

Для получения ДНК-фрагмента, содержащего промоторную последовательность гена tdcR использовали праймеры:To obtain a DNA fragment containing the promoter sequence of the tdcR gene, primers were used:

прямой - 5' cctttcgtcttcacctcgagaaatcaatactttccagagtatcgttattacaat;straight line - 5 'cctttcgtcttcacctcgagaaatcaatactttccagagtatcgttattacaat;

обратный - 5' ggcgccgctgctcattaaatttaactcaaattttgcctggtaattatcc.reverse - 5 'ggcgccgctgctcattaaatttaactcaaattttgcctggtaattatcc.

В качестве матрицы использовали хромосомную ДНК Е. coli JM109. Полученный ПЦР-фрагмент, содержащий промоторную последовательность гена tdcR, с расчетной длиной 264 п.о. анализировали с помощью электрофореза в 1% агарозном геле. На фиг. 4 представлен ПЦР-фрагмент, содержащий промоторную последовательность гена tdcR и необходимый для создания геносенсорной конструкции pTdcR-TurboYFP.As a matrix, E. coli JM109 chromosomal DNA was used. The obtained PCR fragment containing the promoter sequence of the tdcR gene, with a calculated length of 264 p. analyzed by electrophoresis in 1% agarose gel. FIG. 4 shows a PCR fragment containing the promoter sequence of the tdcR gene and necessary to create the pTdcR-TurboYFP genosensor construct.

Неочищенные ПЦР-фрагменты сшивали по Гибсону с помощью готовой смеси Gibson Assembly Master Mix (New England Biolabs).Untreated PCR fragments were sutured according to Gibson using the ready mix Gibson Assembly Master Mix (New England Biolabs).

Правильность конструирования геносенсорной конструкции pTdcR-TurboYFP подтверждали секвенированием области встройки промоторной области гена tdcR.The correct design of the pTdcR-TurboYFP genosensor construct was confirmed by sequencing the insertion region of the tdcR promoter region.

Пример 2. Выращивание штамма Е. coli/pTdcR-TurboYFP.Example 2. The cultivation of the strain E. coli / pTdcR-TurboYFP.

Клетки Е. coli JM109 трансформировали путем электропорации плазмидой pTdcR-TurboYFP. Ночные культуры клеток геносенсоров подращивали на свежей среде LB со 100 мкг/мл ампициллина до оптической плотности OD=0,6 (логарифмическая фаза роста).E. coli JM109 cells were transformed by electroporation with the pTdcR-TurboYFP plasmid. Night cell cultures of the genosensors were grown on fresh LB medium from 100 μg / ml ampicillin to an optical density OD = 0.6 (logarithmic growth phase).

Пример 3. Исследование чувствительности штамма Е. coli/pTdcR-TurboYFP к присутствию ТГц излучения.Example 3. The study of the sensitivity of the strain E. coli / pTdcR-TurboYFP to the presence of THz radiation.

Для индукции синтеза в клетках флуоресцентного белка TurboYFP использовали свежетрансформированную культуру клеток штамма Е. coli/pTdcR-TurboYFP (геносенсор), выращенную на свежей среде LB с антибиотиком до логарифмической фазы роста, как описано выше. По 50 мкл культуры геносенсора помещали в лунки 96-луночного планшета и проводили облучение клеток, которое сопровождалось их нагреванием до 37°С. Для генерации ТГц излучения использовали Новосибирский Лазер на свободных электронах (ЛСЭ) в ЦКП синхротронного и ТГц излучения (ИЯФ СО РАН). В качестве отрицательного контроля служили культуры клеток, которые инкубировали в лунках 96-луночного планшета при 37°С в термостате. После облучения опытных культур, до анализа флуоресценции, опытные и контрольные культуры находились в термостате при температуре 37°С.For induction of synthesis in cells of the fluorescent protein TurboYFP, a freshly transformed cell culture of E. coli / pTdcR-TurboYFP strain (genosensor) grown on fresh LB medium with antibiotic to the logarithmic growth phase was used as described above. 50 μl of the genosensor culture were placed in the wells of a 96-well plate and cells were irradiated, which was accompanied by their heating to 37 ° C. For the generation of THz radiation, the Novosibirsk Free Electron Laser (FEL) was used in the synchrotron and THz PCR (BINP SB RAS). Cell cultures that were incubated in wells of a 96-well plate at 37 ° C in a thermostat served as negative controls. After irradiation of the experimental cultures, prior to the analysis of fluorescence, the experimental and control cultures were kept in a thermostat at a temperature of 37 ° C.

Чувствительность клеток к ТГц излучению оценивали по увеличению флуоресценции, измеряемой через 30-40 мин после облучения на планшетном анализаторе VICTOR X3 2030 (Perkin Elmer) со следующими параметрами: время облучения возбуждающим светом 0,1 сек, длина волны возбуждения 485 нм, длина волны эмиссии 535 нм. Измерение флуоресценции проводили каждые 20 или 30 минут. Клетки культивировали на термошейкере PST-60HL (Biosan) при температуре 37°С и 800 об/мин.The sensitivity of cells to THz radiation was assessed by the increase in fluorescence measured 30–40 minutes after irradiation on a VICTOR X3 2030 tablet analyzer (Perkin Elmer) with the following parameters: excitation light exposure time of 0.1 sec, excitation wavelength 485 nm, emission wavelength 535 nm. Fluorescence measurements were performed every 20 or 30 minutes. Cells were cultured on a PST-60HL thermoshaker (Biosan) at a temperature of 37 ° C and 800 rpm.

На фиг. 5 представлены результаты измерения интенсивности флюоресценции белка TurboYFP в клетках-геносенсорах Е. coli/pTdcR-TurboYFP после воздействия в течение 30 минут ТГц излучением с длиной волны 130 мкм и плотностью мощности 1,4 Вт/см².FIG. 5 shows the results of measuring the fluorescence intensity of the TurboYFP protein in E. coli / pTdcR-TurboYFP genosensors cells after exposure for 30 minutes to THz radiation with a wavelength of 130 μm and a power density of 1.4 W / cm ² .

Из фиг. 5 видно, что однократно облученный в течение 30 минут ТГц излучением с длиной волны 130 мкм и плотностью мощности 1,4 Вт/см² геносенсор Е. coli/pTdcR-TurboYFP начинает синтезировать флеоресцентный белок TurboYFP примерно через 60 мин после начала измерения и продолжает синтез в течение не менее последующих 180 мин.From FIG. 5 shows that the THz radiation with a wavelength of 130 μm and a power density of 1.4 W / cm ^2, once genetically irradiated for 30 minutes, E. coli / pTdcR-TurboYFP begins to synthesize the TurboYFP fluorescent protein approximately 60 minutes after the start of measurement and continues for at least the next 180 minutes

Увеличение флуоресценции клеток полученного штамма свидетельствует об активации геносенсорной конструкции и, следовательно, о присутствии в среде ТГц излучения.An increase in the fluorescence of cells of the resulting strain indicates the activation of the genosensory construct and, therefore, the presence of THz radiation in the medium.

Использование изобретения позволит быстро в стационарных или полевых условиях определять наличие ТГц излучения в дозах, которые могут иметь биологические эффекты, а также может быть использовано в исследованиях биологических эффектов ТГц излучения.The use of the invention makes it possible to quickly determine in stationary or field conditions the presence of THz radiation at doses that may have biological effects, and can also be used in studies of the biological effects of THz radiation.

Источники информацииInformation sources

1. Вакс В.Л., Домрачева Е.Г., Ластовкин А.А., Приползин С.И., Собакинская Е.А., Черняева М.Б., Анфертьев В.А. Приемники излучения терагерцового частотного диапазона // Вестник нижегородского университета им. Н.И. Лобачевского. 2013. №6(1). С. 81-86.1. Vaks V.L., Domracheva E.G., Lastovkin A.A., Pripolzin S.I., Sobakinskaya E.A., Chernyaeva M.B., Anfertiev V.A. Receivers of the terahertz frequency range // Bulletin of the Nizhny Novgorod University. N.I. Lobachevsky. 2013. № 6 (1). Pp. 81-86.

2.

S.F. Microbial biosensors // Biosens Bioelectron. 2001. V. 16. P. 337-353.2

SF Microbial biosensors // Biosens Bioelectron. 2001. V. 16. P. 337-353.

3. Zheng M., Wang X., Templeton L.J. Smulski D.R., LaRossa R.A., Storz G. DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide // J. Bacteriol. 2001. V. 183(15). P. 4562-4570.3. Zheng M., Wang X., Templeton L.J. Smulski D.R., LaRossa R.A., Storz G. DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide // J. Bacteriol. 2001. V. 183 (15). P. 4562-4570.

4. Khil P.P., Camerini-Otero R.D. Over 1000 genes are involved in the DNA damage response of Escherichia coli // Mol. Microbiol. 2002. V. 44(1). P. 89-105.4. Khil P.P., Camerini-Otero R.D. Over 1000 genes are involved in the Escherichia coli damage response // Mol. Microbiol. 2002. V. 44 (1). P. 89-105.

5. Hakkila K., Maksimow M., Karp M., Virta M. Reporter genes lucFF, luxCDABE, gfp, and dsred have different characteristics in whole-cell bacterial sensors // Anal. Biochem. 2002. V. 301(2). P. 235-242.5. Hakkila K., Maksimow M., Karp M., Virta M. Reporter genes lucFF, luxCDABE, gfp, and dsred bacterial sensors // Anal. Biochem. 2002. V. 301 (2). P. 235-242.

6. Lu C., Albano C.R., Bentley W.E., Rao G. Quantitative and kinetic study of oxidative stress regulons using green fluorescent protein // Biotechnol. Bioeng. 2005. V. 89(5). P. 574-587.6. Lu C., Albano C. R., Bentley W.E., Rao G. Quantitative and kinetic study of oxidative stress regulons using green fluorescent protein // Biotechnol. Bioeng. 2005. V. 89 (5). P. 574-587.

7. Kirn B.C., Gu M.B. A bioluminescent sensor for high throughput toxicity classification // Biosens Bioelectron. 2003. V. 18(8). P. 1015-1021.7. Kirn B.C., Gu M..B. A bioluminescent sensor for high throughput toxicity classification // Biosens Bioelectron. 2003. V. 18 (8). P. 1015-1021.

8. Justus Т., Thomas S.M. Construction of a umuC'-luxAB plasmid for the detection of mutagenic DNA repair via luminescence // Mutat. Res. 1998. V. 398. P. 131-141.8. Justus T., Thomas S.M. Construction of a umuC'-luxAB DNA repair via luminescence // Mutat. Res. 1998. V. 398. P. 131-141.

9. Behor O., Smulski D.R., Van Dyk Т.К., LaRossa R.A., Belkin S. Recombinant microorganisms as environmental biosensors: pollutants detection by Escherichia coli bearing fabA'::lux fusions // J. Biotechnol. 2002. V. 94(1). P. 125-132.9. Behor O., Smulski D.R., Van Dyk T.K., LaRossa R.A., Belkin S. Recombinant microorganisms as environmental biosensors by Escherichia coli bearing fabA ':: lux fusions // J. Biotechnol. 2002. V. 94 (1). P. 125-132.

10. Tauriainen S., Virta M., Chang W., Karp M. Measurement of firefly luciferase reporter gene activity from cells and lysates using Escherichia coli arsenite and mercury sensors // Anal. Biochem. 1999. V. 272(2). P. 191-198.10. Tauriainen, S., Virta, M., Chang, W., Karp, M., ly. Biochem. 1999. V. 272 (2). P. 191-198.

11. Ivask A., Virta M., Kahru A. Construction and use of specific luminescent recombinant bacterial sensors for the assessment of bioavailable fraction of cadmium, zinc, mercury and chromium in the soil // Soil. Biol. Biochem. 2002. V. 34(10). P. 1439-1447.11. Ivask, A., Virta, M., Kahru, A. Bacterial sensors for the assessment of bioavailable fraction of cadmium, zinc, mercury and chromium in the soil // Soil. Biol. Biochem. 2002. V. 34 (10). P. 1439-1447.

12. Патент RU 2355760 C1, оп. 20.05.2009.12. Patent RU 2355760 C1, op. 20.05.2009.

13. Патент RU 2297450 C1, оп. 11.07.2005.13. Patent RU 2297450 C1, op. July 11, 2005.

14. Патент RU 2348687 C1, оп. 10.03.2009.14. Patent RU 2348687 C1, op. 03/10/2009.

15. Khlebodarova T.M., Tikunova N.V., Kachko A., Stepanenko I.L., Podkolodny N.L., Kolchanov N.A. Application of bioinformatics resources for genosensor design // J. Bioinform. Comput. Biol. 2007. Vol. 5(2B). P. 931-938.15. Khlebodarova T.M., Tikunova N.V., Kachko A., Stepanenko I.L., Podkolodny N.L., Kolchanov N.A. Application of bioinformatics resources for genosensor design // J. Bioinform. Comput. Biol. 2007. Vol. 5 (2B). P. 931-938.

16. Dower W.J., Miller J.F. Ragsdale C.W. High efficiency transformation of E. coli by high voltage electroporation // Nucleic Acids Res. 1988. Vol. 16(13). P. 6127-6145.16. Dower W.J., Miller J.F. Ragsdale C.W. High-quality transformation of coli to high-voltage electroporation // Nucleic Acids Res. 1988. Vol. 16 (13). P. 6127-6145.

17. Mescheryakova I.A., Demidova E.V., Goryachkovskaya T.N., Demidov E.A., Bryanskaya A.V., Sergeeva S.V., Kiselev S.L., Lagarkova M.A., Kulipanov G.N., Semenov A.I., Vinokurov N.A., Kolchanov N.A., Popik V.M., Peltek S.E. Nonthermal impact terahertz radiation on the living systems // Abstracts of the 10th International Conference on Bioinformatics of Genome Regulation and Structure/Systems Biology, Russia, Novosibirsk, 29 August - 2 September 2016. P. 188.17. Mescheryakova, I.A., Demidova, E.V., Goryachkovskaya, T.N., Demidov, E.A., Bryanskaya, A.V., Sergeeva, S.V., Kiselev, S.L., Lagarkova, M.A., Kulipanov, G.N., Semenov A.I., Vinokurov, N.A., Kolchanov, N.A. Nonthermal impact terahertz radiation on the living systems // Abstracts of the 10th International Conference on Biomedical and Energy Systems, Russia, Novosibirsk, August 29 - September 2, 2016. P. 188.

Claims

The strain of bacteria E. coli / pTdcR-TurboYFP, which has a sensitivity to THz radiation, obtained by transforming E. coli JM109 strain with the plasmid pTdcR-TurboYFP, constructed on the basis of the plasmid pTurboYFP-B and containing the gene coding for the TurboYFP fluorescent protein under promoter control. L-threonine dehydratase.