RU2678227C1 - Minimally invasive method for diagnostics of lung cancer on basis of changing copy number of mtdna hv2 locus - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology. Determination of the copy number of the genetic locus HV2 relative to the reference GAPDH gene is carried out by PCR-RV in the presence of the EVA-Green dye. Use highly specific primers: to HV2 F – GGGAGCTCTCCATGCATTTGGTA, R – AAATAATAGGATGAGGCAGGAATC; to GAPDH F – GCTGAACGGGAAGCTCACT, R – GCAGGTTTTTCTAGACGGCAG on the matrix of the isolated vDNA. Calculate the relative copy number of the gene (rC) according to the formula rC = -2, where Ct is the median of the fluorescence signals, ΔC= C(HV2) – C(GAPDH), and compare the obtained rC values with the predictive copy number interval. With values rC> 16,169 ± 3,423 diagnose the absence of malignant tumors of the lung, with values rC< 1,756 ± 496 a patient is diagnosed with lung cancer, and with values rCbetween the specified intervals consider the result to be undefined. Method has high sensitivity and specificity, its use is carried out with blood plasma; registration of the results produced once at the end of the study, which takes less than 5 hours.EFFECT: method allows to make the procedure of primary diagnosis of lung cancer more simple, accurate and comfortable for the patient, as well as to increase the level of early detection of the disease.1 cl, 2 ex, 1 tbl

Description

The invention relates to medicine, namely to molecular biology, oncology, and can be used for minimally invasive diagnosis of lung cancer.

More than 1 million 800 thousand new cases of lung cancer and more than 1 million 500 thousand deaths from this pathology are registered annually in the world (see World Cancer Report 2014. Chapter 1.1. World Health Organization. 2014. ISBN 9283204298).

Such a high mortality rate is partly due to the fact that currently the problem of early diagnosis of lung cancer remains unresolved, and the molecular markers studied do not show significant specificity.

The prognostic value of many of them is controversial and mainly reflects differences in research methodology, patient groups and interpretations.

Signatures of the expression of certain genes (e.g., DUSP6, MMD, STAT1, ERBB3, and LCK) have predictive value, although these data are extremely heterogeneous (see Kutilin D.S., Enin Ya.S., Petrusenko N.A., Vodolazhsky D.I. Changing the copy number of genetic loci during malignancy of lung tissue // Modern problems of science and education. - 2016. - No. 6; URL: https://www.science-education.ru/ru/article/view?id=25994).

The transformation of normal cells into cancer cells is associated with the accumulation of changes in the genome that ensure that transformed cells acquire an unlimited potential for proliferation; resistance to apoptosis signals; ability to support angiogenesis; ability to invasion and metastasis.

The molecular changes responsible for acquiring the above properties can be used as tumor markers (see Zhu CQ, Shih W., Ling CH, Tsao MS Immunohistochemical markers of prognosis in non-small cell lung cancer: a review and proposal for a multiphase approach to marker evaluation // J. Clin. Pathol. - 2006. - V. 59 (8). - P. 790-800; see Vladimirova L.Yu., Kit O.I., Sholokhova E.A. Role of histological and molecular analysis in choosing a method for the treatment of non-small cell lung cancer of the late stages // Farmateka. 2012. No. 8 (241). S. 9-22.).

Such molecular tumor markers include specific changes in the number of gene copies (see Kit O.I., Vodolazhsky D.I., Kutilin D.S., Gudueva E.N. Change in the copy number of genetic loci in gastric cancer // Molecular Biology. - 2015. - T. 49, No. 4. - S. 658-666.).

Change in the number of copies of a gene (copy number variation, CNV) is one of the main mechanisms for changing the degree of expression of potential oncogenes and tumor suppressor genes of cancer cells. CNV is a type of genetic polymorphism resulting from unbalanced chromosome rearrangements leading to deletions and duplications of DNA fragments larger than 50 (base pairs) (see Zarrei M., MacDonald JR, Merico D., Scherer SW A copy number variation map of the human genome // Nature Reviews Genetics. - 2015. - V. 16 (3). - P. 172-83).

The result of such unbalanced chromosomal rearrangements can also be a decrease or increase in the number of copies of a particular gene and, consequently, reduced or increased expression of the gene product - protein or non-coding RNA (see Chen Z., Xu WR, Qian N., Zhu W., Bu XF , Wang S., Yan YM, Mao F., Gu HB, Cao HL, Xu XJ Oct4, a novel marker for human gastric cancer // J. Surg. Oncol. - 2009 .-- V. 99 (7) .-- P . 414-9.).

Schneider-Stock R

Kasper H.U., Pross М., Hackelsberger A., Lippert Н., Roessner A. Mdm2 gene amplification in gastric cancer correlation with expression of Mdm2 protein and p53 alterations. A Mod Pathol. - 2000 - V. 13 (6) - P. 621-626; см. Кутилин Д.С., Енин Я.С., Петрусенко H.A., Водолажский Д.И. Изменение копийности генетических локусов при малигнизации тканей легкого // Современные проблемы науки и образования. - 2016. - №6.; URL: https://www.science-education.ru/ru/article/view?id=25994).CNVs are the next level in the full understanding of the molecular context of the development of the tumor process. Thus, the role of CNV as a factor in the malignancy of the tissues of the stomach and lung was studied (see

Schneider-stock r

Kasper HU, Pross M., Hackelsberger A., Lippert N., Roessner A. Mdm2 gene amplification in gastric cancer correlation with expression of Mdm2 protein and p53 alterations. A Mod Pathol. - 2000 - V. 13 (6) - P. 621-626; see Kutilin D.S., Yenin Y.S., Petrusenko HA, Vodolazhsky D.I. Changing the copy number of genetic loci during malignancy of lung tissue // Modern problems of science and education. - 2016. - No. 6 .; URL: https://www.science-education.ru/ru/article/view?id=25994).

A study was made of the relative copy number of the genetic loci responsible for the regulation of apoptosis (CVC, BCL2, C-FLAR, P53, MDM2), proliferation (SOX2, OCT4, NANOG, PIK3 and MK167), oxidative phosphorylation (HV2) and the response to hypoxia (HIF1A1 ) in samples containing tumor and normal lung tissue cells and genetic loci were identified that have high potential as molecular markers for predicting lung cancer (HV2, HIF1A1, P53, MDM2). However, this potential is limited by the high level of invasiveness in obtaining biomaterial.

A possible solution to this problem lies in the transition to the study of the copy number of genes in extracellular DNA of blood plasma.

Extracellular DNA in the body should include: cellular and mitochondrial DNA from somatic and tumor cells undergoing apoptosis and necrosis; DNA from erythroblasts, the nuclei of which are enucleated during the process of differentiation into red blood cells, DNA from lymphocytes during their apoptotic death after stimulation, DNA of embryos in the mother’s blood, bacterial and viral DNA.

In many types of tumors, elevated levels of extracellular DNA (vDNA) in peripheral blood are determined. Moreover, the progress of the disease is often associated with a gradual increase in the level of vDNA. Moreover, quite often the level of vDNA increases with tumor metastasis, compared with values in the absence of the latter (see Kozlov V.A. Free extracellular DNA in normal and pathological conditions. Medical immunology. 2013, V. 15, No. 5, p. 399-412).

The change in the number of copies of mitochondrial DNA determined by the copy number of the HV2 locus (hypervariable region from 33 to 160 nucleotides of the mtDNA D-loop) reflects the state of oxidative phosphorylation of malignant cells (see Scatena R. Mitochondria and cancer: a growing role in apoptosis, cancer cell metabolism and dedifferentiation. // Adv Exp Med Biol. - 2012 .-- V. 942. - P. 287-308).

In a large-scale study, which included groups of patients with gastric cancer at various stages and conditionally healthy donors, a reliable correlation of mtDNA copy number and disease progression was shown (see Liao LM et al. Mitochondrial DNA Copy Number and Risk of Gastric Cancer: a Report from the Shanghai Women's Health Study // Cancer Epidemiol Biomarkers Prev; 2011, 20 (9); 1944-9).

The results of another study showed that in 95% of patients with pulmonary adenocarcinoma in the cDNA, a significant decrease in the number of HV2 copies was found in comparison with cDNA of conditionally healthy donors (see Kutilin D.S., Ayrapetova T.G., Anistratov P.A., Pyltsin S.P., Leiman I.A., Chubaryan A.V., Turkin I.N., Vodolazhsky D.I., Nikolaeva N.V., Lysenko I.B. Change in the relative copy number of genetic loci in extracellular DNA in patients with lung adenocarcinoma. University proceedings. North-Caucasian region. Natural sciences. 2017. No. 3. P. 74-83).

Therefore, as a marker for predicting lung cancer, the relative copy number of mtDNA HV2 is acceptable.

From patent sources the following inventions are known that are closest to ours.

1. "The method of combined endoscopic diagnosis of X-ray negative synchronous central lung cancers" (see patent RU 2628649 C1, published: 08.21.2017, Bull. No. 24) The method consists in a combined endoscopic diagnosis of X-ray negative synchronous central lung cancers using narrow-spectrum video bronchoscopy - blue-green part of the spectrum and in autofluorescence mode

If pathological sites, including minimal foci of the mucous membrane of the bronchial tree, are detected by autofluorescence, sites with a pronounced lilac glow against the green glow of the normal surrounding mucous membrane are taken for malignant transformation.

2. "Method for the diagnosis of lung cancer" (see patent RU 2633693 C1, published: 10.16.2017, Bull. No. 29) The method is intended for minimally invasive diagnosis of lung cancer by detecting aberrantly methylated marker genes in the composition of extracellular DNA (vDNA) in blood plasma .

Methyl-specific PCR was performed using specially selected primers and probes for the FDPS control gene and the aberrant methylated marker genes RARbeta2, RASSF1A and TCF21. Next, a comparative analysis of the results of PCR is carried out taking into account the obtained SL for detectable genes. If the value Ct≤35.1 for the FDPS gene and Ct≤41 for the RARbeta2 and / or RASSF1A and / or Ct≤42.5 genes for the TCF gene 21, then a conclusion is made about the presence of lung cancer in the patient.

3. "A method for the differential diagnosis of malignant neoplasms and somatic non-malignant diseases" (see patent RU 2232391 C2, published: July 10, 2004, Bull. No. 19).

The method consists in the differential diagnosis of malignant neoplasms of the lungs, malignant neoplasms of the stomach, malignant neoplasms of the hematopoietic system, malignant neoplasms of the colon, malignant neoplasms of the male urogenital system, malignant neoplasms of the female genitourinary system, malignant neoplasms of the mammary gland, malignant neoplasms of the mammary gland, malignant neoplasms non-malignant venous diseases according to infrared absorption spectra of blood serum.

4. "Aptamer specific for tumor tissues of the human lung" (see patent RU 2528870 C2, published: 09/20/2014, Bull. No. 26) The method is aimed at detecting lung cancer using aptamers, and can be used in diagnosis.

Aptamers are obtained as a result of selection, including the alternation of rounds of positive selection of aptamers to the crushed tumor tissues of the lung of a person taken after surgery from cancer patients, and negative selection to healthy tissues of the lung and whole blood of healthy people, with the identification of the aptamer pool with the highest affinity, its cloning, sequencing, checking for specificity of binding to lung tumor cells.

The obtained aptamers are highly sensitive to the products of tumor decay and circulating cancer cells in the peripheral blood of patients with lung cancer, which improves the efficiency of the diagnosis of human lung cancer.

However, the methods described above are fundamentally different from ours, have less sensitivity or specificity than what we offer. Moreover, these methods are more difficult for clinical implementation, or have less accuracy due to the interpretation of the data.

An analysis of patent sources (www.fips.ru) also showed the absence of valid patents and applications for a “Minimally invasive method for the diagnosis of lung cancer based on changes in the copy number of the mtDNA HV2 locus”.

The technical result of the claimed invention is the creation of a new, simple, not expensive and accurate method with unique highly specific sequences of synthetic oligonucleotides (primers) for the diagnosis of lung cancer.

The technical result is achieved by determining the copy number of the HV2 genetic locus relative to the GAPDH reference gene by PCR-RV in the presence of EVA-Green dye and highly specific primers: for HV2 F - GGGAGCTCTCCATGCATTTGGTA, R - AAATAATAGGATGAGGCAGGAATC; for GAPDH F - GCTGAACGGGAAGCTCACT, R - GCAGGTTTTTCTAGACGGCAG isolated extracellular DNA on the matrix, calculated relative copy number of the gene (rC) of formula rC = 2 ^-ΔCt, where Ct - median fluorescence _{signals, ΔC t = C t (HV2} ) - C t (GAPDH) , and the obtained rC values are compared with the prognostic copy interval, and for rC _HV2 values> 16169 ± 3423, the absence of lung malignant tumors is diagnosed, for rC _HV2 values <1756 ± 496, the patient is diagnosed with lung cancer, and for rC _HV2 values between the indicated intervals, the obtained The result is uncertain.

The essence of the method is that blood samples (10 ml of blood and 3 ml of 10 mm phosphate buffer, pH 7.5, with 0.15 M NaCl and 50 mm EDTA) are separated into plasma and the cell fraction by centrifugation for 20 minutes at 400 g at 15 ° C. VDNA is isolated from blood plasma by the phenol-chloroform method and amplification is carried out with highly specific primers for the HV2 locus and the GAPDH gene, primary data are analyzed and relative copy number (rC) is calculated by the formula 2 ^-ΔCt where ΔCt = Ct (HV2) - Ct (GAPDH). Then, the obtained rC values are compared with prognostic copy numbers, and for values in the rC interval _HV2 > 16169 ± 3423 the patient is diagnosed with the absence of malignant neoplasms of the lung (sensitivity 96%, specificity 95%), and with values in the interval rC _HV2 <1756 ± 496 the patient is diagnosed with lung cancer (sensitivity 96%, specificity 92%). For rC _HV2 values between the indicated intervals, the result is considered to be undefined.

The claimed analysis is based on determining the number of copies of mtDNA relative to the GAPDH reference gene in the blood plasma vDNA of patients at risk of developing lung cancer, and then comparing the obtained values with the copy interval rC _HV2 characteristic of lung cancer or its absence.

The claimed method includes the following techniques:

- isolation of extracellular DNA from blood plasma using the phenol-chloroform extraction method;

- determination of the relative copy number of the HV2 genetic locus by PCR-RV in the presence of EVA-Green dye and specific primers on the selected vDNA matrix;

- analysis of primary data using the software of the amplifier;

- the calculation of the relative copy number of the gene (rC) based on the ratio of signals produced by amplitudes of the studied and reference sequences,

- comparing the rC sample with prognostic values of the rC _standard copy number determined for patients with lung cancer and conditionally healthy donors (without cancer).

To implement the method, specific oligonucleotide direct and reverse primers for the HV2 and GAPDH loci have been developed. The design of specific oligonucleotide primers (Table 1) was carried out using NCBI GenBank reference sequences.

The claimed method is as follows:

At the first stage, blood samples (10 ml of blood and 3 ml of 10 mm phosphate buffer, pH 7.5, with 0.15 M NaCl and 50 mm EDTA) are separated into plasma and cell fraction by centrifugation for 20 minutes at 400 g at 15 ° FROM.

DNA is isolated from the blood plasma by the phenol-chloroform method in our modification. An equal volume of lysis buffer (2% SDS and 1% mercaptoethanol) and 20 μl of proteinase K are added to the blood plasma, incubated in an incubator at 58 ° C for 1 hour.

An equal volume of alkaline phenol and chloroform (1: 1 ratio) was added to the obtained lysate, centrifuged for 20 minutes at 3000 rpm.

After phase separation, the aqueous phase is taken into a separate sterile tube. An equal volume of 96% isopropyl alcohol and a solution of 5 M NaCl are added to the aqueous phase to a concentration of 100 mM, the tube is placed in a refrigerator at -20 ° C for 60 minutes.

Then it is centrifuged for 15 minutes at 12700 rpm, at -10 ° С, the supernatant is decanted, and the precipitate is washed with 80% ethanol, ethanol residues are removed by centrifugation, the precipitate is dried in a solid-state thermostat and dissolved in 10 mM TE buffer.

The concentration of the obtained DNA preparations is measured on a fluorimeter. For PCR-PB, the DNA concentration in each sample is normalized to 0.5 ng / μl.

Amplification is carried out in 20 μl of a PCR mixture containing 3 ng of vDNA, 0.20 mm dNTPs, 2.5 mm MgCl ₂ , 1x PCR buffer, 1x EvaGreen dye, and 0.1 EA / μl DNA-reaction mixture Thermus aquaticus polymerase, and 600 nM forward and reverse primers for the reference or target genes.

Quantitative PCR-RV amplification is carried out on a thermal cycler according to the following program: t = 95 ° C for 4 min. 40 cycles: t = 95 ° C for 10 s, t = 58 ° C (read signal) for 30 s, t = 72 ° C for 30 s.

The relative copy number of the HV2 locus is calculated as follows: С _{t is} calculated for the target locus HV2 and reference GAPDH, then ΔC _t = C _t (HV2) - C _t (GAPDH) is calculated; the copy number of the genetic locus relative to the reference gene (rC) is calculated by the formula 2 ^-ΔCt .

The obtained rC values are compared with the interval of the prognostic copy coefficient:

- at rC _HV2 values> 16169 ± 3423, the absence of malignant lung tumors is diagnosed (sensitivity 96%, specificity 95%),

- at rC _HV2 values <1756 ± 496, the patient is diagnosed with lung cancer (sensitivity 96%, specificity 92%),

- at rC _HV2 between the indicated intervals, the result is considered to be undefined.

The proposed method was carried out examination of 50 patients who were diagnosed with lung cancer, and 30 conditionally healthy donors (without cancer). To prove the prognostic value of the proposed method, the following examples are given.

1. A group of 30 conditionally healthy donors aged 27 to 57 years were examined by the claimed method for the copy number of the HV2 locus relative to GAPDH. The work was carried out in compliance with the principles of voluntariness and confidentiality in accordance with the “Fundamentals of the legislation of the Russian Federation on the protection of the health of citizens” (Decree of the President of the Russian Federation of 12.24.1993 No. 2288) and with the permission of the ethics committee of the Federal State Budget Scientific Research Institute of Health of the Russian Federation. All conditionally healthy volunteer donors were bled using a vakuteyner with an anticoagulant. VDIK was isolated from the plasma obtained after centrifugation, and the analysis was performed by the claimed method.

The rC _HV2 values were in the range from 12746 to 19592 (in 29 donors), which corresponds to the rC _HV2 value characteristic of the absence of lung malignancies. In 1 donor (at the age of 50), the result was uncertain (intermediate interval) rC _HV2 = 3917.19. All donors were examined (initial inspection of NPV: 16-18 per min; no shortness of breath, chest on palpation: painless, vesicular breathing, no wheezing, SKT of OGK without pathology).

2. A group of 50 people who initially applied for lung cancer were examined by the claimed method for the copy number of the HV2 locus relative to GAPDH. The average age of the subjects was 60.1 ± 7.3 years, at the time of the study, 48 patients had a verified diagnosis of lung cancer at stages T1N0M0 to T3N2M1, and 2 patients were diagnosed with lung cancer at stages T4N2M1 and T4N3M1. Blood samples were taken from all patients (before surgery) using a vacutainer and plasma was obtained by centrifugation, vDNA was isolated from the obtained plasma (as described in the method).

The rC _HV2 values ranged from 1260 to 2252 (in 48 patients), which corresponds to the rC _HV2 characteristic of lung cancer. In 1 of two patients (T4N3M1), the result was uncertain (less than the prognostic minimum characteristic of lung cancer) rC _HV2 = 686.24, in 2 of two patients (T4N2M1), the result was also uncertain (less than the prognostic minimum for lung cancer) rC _HV2 = 180.21.

The inventive method includes the primers developed by us and is economically viable for the diagnosis of lung cancer, carried out in a standard laboratory of molecular biology (PCR), without the use of special expensive equipment; possesses high sensitivity and specificity, analysis is possible with blood plasma, takes no more than 5 hours.

Claims (1)

A minimally invasive method for diagnosing lung cancer based on changes in the copy number of the HV2 mtDNA locus, including the extraction of extracellular DNA from blood plasma, characterized in that the copy number of the HV2 genetic locus relative to the GAPDH reference gene is determined by PCR-RV in the presence of EVA-Green dye and highly specific primers: HV2 F - GGGA GCTCTCCATGCATTTGGTA, R - AAATAATAGGATGAGGCAGGAATC; for GAPDH F - GCTGAACGGGAAGCTCACT, R - GCAGGTTTTTCTAGA CGGCAG isolated extracellular DNA on the matrix, calculated relative copy number of the gene (rC) of formula rC = 2 ^-ΔCt, where Ct - median fluorescence _{signals, ΔC t = C t (HV2} ) -C t (GAPDH ), and the obtained rC values are compared with the prognostic copy interval, and for rC _HV2 values> 16169 ± 3423, the absence of lung malignant tumors is diagnosed, for rC _HV2 values <1756 ± 496, the patient is diagnosed with lung cancer, and for rC _HV2 values between these intervals, the result is uncertain.