RU2575056C2 - Hsp47 expression modulation - Google Patents

Abstract

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry, particularly to nucleic acid molecules for target gene expression modulation. What is declared is a two-stranded nucleic acid molecule for heat shock protein 47 (hsp47) gene expression inhibition. There are also presented a composition containing the above nucleic acid molecule, and a method of treating a patient suffering a hsp47-associated disease.

EFFECT: invention may be used for treating hsp47-associated conditions and disorders, such as hepatic fibrosis, pulmonary fibrosis, abdominal fibrosis and renal fibrosis.

25 cl, 27 dwg, 31 tbl, 10 ex

Description

RELATED APPLICATION FOR A PATENT

[0001] This application claims priority according to provisional applications for US patent US 61 / 372,072, filed August 9, 2010, US 61 / 307,412, filed February 23, 2010 and US 61 / 285,149, filed December 9, 2009, each of which has the name "Modulation of the expression of HSP47", and which are incorporated into this description in full by reference and for all purposes.

LIST OF SEQUENCES

[0002] This application includes a list of sequences, which is designated 220-PCT1_ST25_07-Dec-10.txt, while a copy of this list in the ASCII standard, created December 7, 2010, size 533 kb, is incorporated into this description in full by reference.

FIELD OF TECHNOLOGY

[0003] Compositions and methods for modulating expression of hsp47 are provided.

BACKGROUND

[0004] In the work of Sato, Y., et al. the introduction of liposomes combined with vitamin A is described for the delivery of small interfering RNAs (siRNAs) against gp46, a rat homologue of heat shock protein of 47 humans, a rat animal model of liver cirrhosis. Sato, Y., et al., Nature Biotechnology, vol. 26 (4), p. 431-442 (2008).

[0005] Chen, J-J., Et al. described the transfection of samples of human keloid scars HSP47-shRNA (small RNAs forming hairpins) to study the proliferation of fibroblasts of keloid scars. Chen, J-J., Et al., British Journal of Dermatology, vol. 156, p. 1188-1195 (2007).

[0006] PCT Patent Publication No. WO 2006/068232 describes a drug carrier specific for astrocytes that includes a retinoic acid derivative and / or an analogue of vitamin A.

BRIEF DESCRIPTION OF THE PRESENT INVENTION

[0007] In the present description provides compositions, methods and kits for modulating the expression of target genes. In various aspects and embodiments of the present invention, the compositions, methods and kits provided herein modulate the expression of heat shock protein 47 (hsp47), which is also known as SERPINH1. These compositions, methods and kits may include the use of nucleic acid molecules (e.g., small interfering nucleic acids (siNAs), short interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs), micro-RNAs (miRNAs) or short hairpin-forming RNAs, ( shRNA)) that bind a nucleotide sequence (e.g., an mRNA sequence) encoding hsp47, e.g., an encoding human hsp47 mRNA sequence, an example of which is SEQ ID NO: 1. In some preferred embodiments of the composition, methods and kits of the present disclosure inhibit hsp47 expression. For example, molecules, siNAs (e.g., dsHK molecules of RISC length or dsHK molecules of Dicer length) are provided that reduce or inhibit the expression of hsp47. Compositions, methods and kits are also provided for the treatment and / or prevention of diseases, conditions or disorders caused by hsp47, such as liver fibrosis, cirrhosis, pneumofibrosis, including pulmonary fibrosis (including ILF), kidney fibrosis as a result of any disease (e.g. , CKD, including ESRD), peritoneal fibrosis, chronic liver damage, fibrillogenesis, fibrotic diseases of other organs, abnormal scars (keloid scars) as a result of any possible types of skin lesions: accidental and iatrogenic (surgery); scleroderma; cardiofibrosis, an unsuccessful filtering operation for glaucoma, as well as intestinal adhesions.

[0008] In one aspect, nucleic acid molecules (eg, siNA molecules) are provided in which (a) the nucleic acid molecule comprises a sense strand and an antisense strand; (b) each strand of the nucleic acid molecule is independently 15-49 nucleotides in length; (c) a sequence of 15-49 nucleotides of the antisense strand is complementary to the mRNA sequence encoding a human hsp47 (e.g., SEQ ID NO: 1); and (d) the sequence of 15-49 nucleotides of the sense strand is complementary to the sequence of the antisense chain and contains the sequence of 15-49 nucleotides of the mRNA encoding human hsp47 (e.g., SEQ ID NO: 1).

[0009] In some embodiments, an antisense strand sequence that is complementary to a mRNA sequence encoding a human hsp47 includes a sequence complementary to a sequence between nucleotides 600-800; or 801-899; or 900-1000; or 1001-1300 SEQ ID NO: 1; or between nucleotides 650-730; or 900-975 SEQ ID NO: 1. In some embodiments, the antisense strand includes a sequence that is complementary to the mRNA sequence encoding human hsp47, corresponding to nucleotides 674-693 of SEQ ID NO: 1 or a part thereof; or nucleotides 698-716 of SEQ ID NO: 1 or a part thereof; or nucleotides 698-722 of SEQ ID NO: 1 or a part thereof; or nucleotides 701-720 of SEQ ID NO: 1 or a part thereof; or nucleotides 920-939 of SEQ ID NO: 1 or a part thereof; or nucleotides 963-982 of SEQ ID NO: 1 or a part thereof; or nucleotides 947-972 of SEQ ID NO: 1 or a part thereof; or nucleotides 948-966 of SEQ ID NO: 1 or a part thereof; or nucleotides 945-969 of SEQ ID NO: 1 or a part thereof; or nucleotides 945-963 of SEQ ID NO: 1 or part thereof.

[0010] In some embodiments, the antisense strand of a nucleic acid molecule (eg, siNA molecule) as described herein includes a sequence corresponding to SEQ ID NO: 4 or a part thereof; or SEQ ID NO: 6 or parts thereof; or SEQ ID NO: 8 or parts thereof; or SEQ ID NO: 10 or parts thereof; or SEQ ID NO: 12 or parts thereof; or SEQ ID NO: 14 or parts thereof; or SEQ ID NO: 16 or parts thereof; or SEQ ID NO: 18 or parts thereof; or SEQ ID NO: 20 or parts thereof; or SEQ ID NO: 22 or parts thereof; or SEQ ID NO: 24 or parts thereof; or SEQ ID NO: 26 or parts thereof; or SEQ ID NO: 28 or parts thereof; or SEQ ID NO: 30 or parts thereof; or SEQ ID NO: 32 or parts thereof; or SEQ ID NO: 34 or parts thereof; or SEQ ID NO: 36 or parts thereof; or SEQ ID NO: 38 or parts thereof; or SEQ ID NO: 40 or parts thereof; or SEQ ID NO: 42 or parts thereof; or SEQ ID NO: 44 or parts thereof; or SEQ ID NO: 46 or parts thereof; or SEQ ID NO: 48 or parts thereof; or SEQ ID NO: 50 or parts thereof; or SEQ ID NO: 52 or parts thereof; or SEQ ID NO: 54 or parts thereof; or SEQ ID NO: 56 or parts thereof; or SEQ ID NO: 58 or parts thereof. In some embodiments, the sense strand of a nucleic acid molecule (eg, siNA molecule) as described herein includes a sequence corresponding to SEQ ID NO: 3 or parts thereof; or SEQ ID NO: 5 or parts thereof; or SEQ ID NO: 7 or parts thereof; or SEQ ID NO: 9 or parts thereof; or SEQ ID NO: 11 or parts thereof; or SEQ ID NO: 13 or parts thereof; or SEQ ID NO: 15 or parts thereof; or SEQ ID NO: 17 or parts thereof; or SEQ ID NO: 19 or parts thereof; or SEQ ID NO: 21 or parts thereof; or SEQ ID NO: 23 or parts thereof; or SEQ ID NO: 25 or parts thereof; or SEQ ID NO: 27 or parts thereof; or SEQ ID NO: 29 or parts thereof; or SEQ ID NO: 31 or parts thereof; or SEQ ID NO: 33 or parts thereof; or SEQ ID NO: 35 or parts thereof; or SEQ ID NO: 37 or a part thereof; or SEQ ID NO: 39 or parts thereof; or SEQ ID NO: 41 or parts thereof; or SEQ ID NO: 43 or parts thereof; or SEQ ID NO: 45 or parts thereof; or SEQ ID NO: 47 or parts thereof; or SEQ ID NO: 49 or parts thereof; or SEQ ID NO: 51 or parts thereof; or SEQ ID NO: 53 or parts thereof; or SEQ ID NO: 55 or parts thereof; or SEQ ID NO: 57 or parts thereof.

[0011] In some preferred embodiments, the antisense strand of a nucleic acid molecule (eg, siNA molecule) as described herein includes a sequence corresponding to any of the antisense sequences shown in Table A-19. In some preferred embodiments, the antisense strand and the sense strand are selected from pairs of sequences shown in Table A-19. In some embodiments, the antisense and sense strands are selected from the pairs of sequences represented in SERPINH1_4, SERPINH1_12, SERPINH1_18, SERPINH1_30, SERPINH1_58 and SERPINH1_88. In some embodiments, the antisense strand and sense strand are selected from pairs of sequences shown in SERPINH1_4 (SEQ ID NOS: 195 and 220), SERPINH1_12 (SEQ ID NOS: 196 and 221), SERPINH1_30 (SEQ ID NOS: 199 and 224), and SERPINH1_58 (SEQ ID NOS: 208 and 233).

[0012] In some embodiments, the antisense and sense strands of a nucleic acid molecule (eg, siNA molecules) as described herein include pairs of sequences shown in SERPINH1_4 (SEQ ID NOS: 195 and 220). In some embodiments, the nucleic acid molecule (eg, siNA molecule) as described herein includes the antisense and sense strands of the pairs of sequences shown in SERPINH1_12 (SEQ ID NOS: 196 and 221). In certain embodiments, the antisense and sense strands of a nucleic acid molecule (eg, siNA molecules) as described herein include pairs of sequences set forth in SERPINH1_30 (SEQ ID NOS: 199 and 224). In some embodiments of a nucleic acid molecule (eg, siNA molecule) as described herein, it includes the antisense and sense strands of the pairs of sequences shown in SERPINH1_58 (SEQ ID NOS: 208 and 233).

[0013] In some embodiments, the antisense strand of a nucleic acid molecule (eg, siNA molecule) as described herein includes a sequence corresponding to any of the antisense sequences shown in any of Tables B or C.

[0014] According to some preferred embodiments, the antisense strand of a nucleic acid molecule (eg, siNA molecule) as described herein includes a sequence corresponding to any antisense sequence shown in Table A-18. In some preferred embodiments, the antisense and sense strands are selected from the pairs of sequences shown in Table A-18. In some embodiments, the nucleic acid molecule (e.g., siNA molecule) as described herein includes antisense and sense strands selected from the pairs of sequences shown in SERPINH1_2 (SEQ ID NOS: 60 and 127), SERPINH1_6 (SEQ ID NOS: 63 and 130) , SERPINH1_11 (SEQ ID NOS: 68 and 135), SERPINH1_13 (SEQ ID NOS: 69 and 136), SERPINH1_45 (SEQ ID NOS: 97 and 164), SERPINH1_45a (SEQ ID NOS: 98 and 165), SERPINH1_51 (SEQ ID NOS : 101 and 168), SERPINH1_52 (SEQ ID NOS: 102 and 169) or SERPINH1_86 (SEQ ID NOS: 123 and 190). In some preferred embodiments, the antisense and sense strands are selected from pairs of sequences shown in SERPINH1_2 (SEQ ID NOS: 60 and 127), SERPINH1_6 (SEQ ID NOS: 63 and 130), SERPINH1_45a (SEQ ID NOS: 98 and 165) and SERPINH1_51 (SEQ ID NOS: 101 and 168).

[0015] In some preferred embodiments, the nucleic acid molecule (eg, siNA molecule) as described herein includes antisense and sense strands selected from the pairs of sequences shown in SERPINH1_2 (SEQ ID NOS: 60 and 127). In some embodiments, the antisense and sense strands include pairs of sequences shown in SERPINH1_6 (SEQ ID NOS: 63 and 130). In some embodiments, a nucleic acid molecule (eg, siNA molecule) as described herein includes antisense and sense strands selected from pairs of sequences represented by SERPINH1_11 (SEQ ID NOS: 68 and 135). In some embodiments, the antisense and sense strands are the sequence pairs set forth in SERPINH1_13 (SEQ ID NOS: 69 and 136). In some embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_45 (SEQ ID NOS: 97 and 164). In certain embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_45a (SEQ ID NOS: 98 and 165). In some embodiments, the antisense and sense strands are pairs of sequences presented in SERPINH1_51 (SEQ ID NOS: 101 and 168).

[0016] In some embodiments, the antisense strand of a nucleic acid molecule (eg, siNA molecule) as described herein includes a sequence corresponding to any of the antisense sequences shown in any of Tables D or E.

[0017] According to various embodiments of nucleic acid molecules (eg, siNA molecules) as described herein, an antisense strand may have 15-49 nucleotides in length (eg, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 or 49 nucleotides in length); or 17-35 nucleotides in length; or 17-30 nucleotides in length; or 15-25 nucleotides in length; or 18-25 nucleotides in length; or 18-23 nucleotides in length; or 19-21 nucleotides in length; or 25-30 nucleotides in length; or 26-28 nucleotides in length. In some embodiments of nucleic acid molecules (eg, siNA molecules) as described herein, an antisense strand may be 19 nucleotides in length. Similarly, the sense strand of nucleic acid molecules (e.g., siNA molecules) as described herein can be 15-49 nucleotides long (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length) ; or 17-35 nucleotides in length; or 17-30 nucleotides in length; or 15-25 nucleotides in length; or 18-25 nucleotides in length; or 18-23 nucleotides in length; or 19-21 nucleotides in length; or 25-30 nucleotides in length; or 26-28 nucleotides in length. In some embodiments of nucleic acid molecules (eg, siNA molecules) as described herein, a sense strand can be 19 nucleotides in length. In some embodiments of nucleic acid molecules (eg, siNA molecules) as described herein, the antisense strand and the sense strand can be 19 nucleotides in length. The double-stranded region of nucleic acid molecules (e.g., siNA molecules) as described herein may be 15-49 nucleotides in length (e.g., approximately 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length), 15-35 nucleotides in length; or 15-30 nucleotides in length or approximately 15-25 nucleotides in length; or 17-25 nucleotides in length; or 17-23 nucleotides in length; or 17-21 nucleotides in length; or 25-30 nucleotides in length; or 25-28 nucleotides in length. In various embodiments of nucleic acid molecules (e.g., siNA molecules) as described herein, a double-stranded region may be 19 nucleotides in length.

[0018] In some embodiments, the sense and antisense nucleic acid strands (for example, siNA nucleic acid molecules) as described herein are separate polynucleotide chains. In some embodiments, the individual antisense and sense strands form a double-stranded structure via hydrogen bonds, for example, by linking Watson-Crick base pairs. In some embodiments, the sense and antisense chains are separate chains that are covalently linked to each other. In other embodiments, the sense and antisense strands are part of the same polynucleotide chain, having both a sense and an antisense site; in some preferred embodiments, said polynucleotide chain has a hairpin structure.

[0019] In some embodiments, the nucleic acid molecule (eg, siNA molecule) is a double-stranded nucleic acid molecule (dsHK) that has symmetrical protruding (“sticky”) ends and has a blunt end at both ends. In other embodiments, the nucleic acid molecule (eg, siNA molecule) is a dsHK molecule that has symmetrical protruding ends and has a protruding end on both sides of the dsHK molecule; preferably said molecule has protruding ends with a length of 1, 2, 3, 4, 5, 6, 7 or 8 nucleotides; preferably, the molecule has protruding ends of 2 nucleotides. In some embodiments, the protruding ends are 5 'protruding ends; in other embodiments, the protruding ends are 3 'protruding ends. In some embodiments, the nucleotides at the protruding ends are modified using modifications as described herein. In some embodiments, the nucleotides at the protruding ends are 2'-deoxynucleotides.

[0020] In some preferred embodiments, the nucleic acid molecule (eg, siNA molecule) is a dsHK molecule that is asymmetrical at the protruding ends and has a blunt end at one end of the molecule and a protruding end at the other end of the molecule. In some embodiments, the protruding end has a length of 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides; preferably, the protruding end is 2 nucleotides. In some preferred embodiments, the asymmetric dsHK molecule has a 3'-protruding end (e.g., a 3'-protruding end of 2 nucleotides) on one side of the double-stranded region formed on the sense strand and a blunt end on the other end of the molecule. In some preferred embodiments, the asymmetric dsHK molecule has a 5'-protruding end (e.g., a protruding 5'-end of 2 nucleotides) on one side of the duplex formed on the sense strand and a blunt end on the other side of the molecule. According to other preferred embodiments, the asymmetric dsHK molecule has a protruding 3'-end (for example, a protruding 3'-end with a length of 2 nucleotides) on one side of the double-stranded region formed on the antisense chain, and a blunt end on the other side of the molecule. In some preferred embodiments, the asymmetric dsHK molecule has a protruding 5'-end (e.g., a protruding 5'-end with a length of 2 nucleotides) on one side of the double-stranded region formed on the antisense chain, and a blunt end on the other side of the molecule. In some preferred embodiments, the protruding ends are 2'-deoxynucleotides.

[0021] In some embodiments, the nucleic acid molecule (eg, siNA molecule) has a hairpin structure (having sense and antisense strands on one polynucleotide) with a loop structure at one end and a blunt end at the second end. In some embodiments, the nucleic acid molecule has a hairpin structure with a loop structure at one end and a protruding second end (for example, a protruding end with a length of 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides); in some embodiments, the protruding end is a protruding 3'-end; in some embodiments, the protruding end is a protruding 5'-end; in some embodiments, the protruding end is on the sense chain; in some embodiments, the protruding end is on an antisense chain.

[0022] According to some preferred embodiments, the nucleic acid molecule is selected from the nucleic acid molecules shown in Table 1.

[0023] Nucleic acid molecules (eg, siNA molecule) as described herein may include one or more modifications or modified nucleotides, for example, as described herein. For example, a nucleic acid molecule (eg, siNA molecule) as described herein may include a modified nucleotide having a modified sugar residue; a modified nucleotide having a modified nucleic base, or a modified nucleotide having a modified phosphate group. Similarly, a nucleic acid molecule (e.g., siNA molecule) as described herein may include a modified phosphodiester backbone and / or may include a modified terminal phosphate group.

[0024] Nucleic acid molecules (for example, siNA molecules) according to the present description can have one or more nucleotides that include a modified sugar group, for example, according to the present description. In some preferred embodiments, the modified sugar group is selected from the group consisting of 2'-O-methyl, 2'-methoxyethoxy, 2'-deoxy, 2'-fluoro, 2'-allyl, 2'-O- [2- ( methylamino) -2-hydroxyethyl], 4'-thio, 4 '- (CH ₂ ) ₂ -O-2'-bridge, 2'-closed nucleic acid and 2'-O- (N-methylcarbamate).

[0025] Nucleic acid molecules (eg, siNA molecules) according to the present description may have one or more modified nucleic bases, for example, according to the present description, which may preferably be nucleic bases selected from the group consisting of xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azo uracil, cytosine and imine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, amino, thiol, thioalkyl, hydroxyl and other substituted at position 8 adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and acyclic nucleotides.

[0026] Nucleic acid molecules (for example, siNA molecules) according to the present description may have one or more modifications of the phosphodiester backbone, for example, according to the present description. According to some preferred embodiments, the phosphodiester bond is modified by replacing the phosphodiester bond with a phosphothioate, 3 '- (or -5') deoxy-3 '- (or-5') thio-phosphothioate, phosphodithioate, phosphoselenate, 3 '- (or -5 ') deoxy phosphate, borane phosphate, 3' - (or -5 ') deoxy-3' - (or 5 '-) amino phosphoamidate, hydrogen phosphonate, boranophosphate ester, phosphoamidate, alkyl or aryl phosphonate and phosphotriether or phosphorous bonds.

[0027] In various embodiments, the proposed nucleic acid molecules (eg, siNA molecules) may include one or more modifications in the sense strand, but not in the antisense strand. In some embodiments, nucleic acid molecules (eg, siNA molecules) are provided that include one or more modifications in the antisense strand, but not in the sense strand. In some embodiments, the proposed nucleic acid molecules (eg, siNA molecules) include one or more modifications in both the sense strand and the antisense strand.

[0028] According to some embodiments, in which the proposed nucleic acid molecules (eg, siNA molecules) have modifications, the sense strand includes a sequence of alternating modified and unmodified nucleotides, and / or the antisense strand includes a sequence of alternating modified and unmodified nucleotides; according to some preferred types of such embodiments, said modification is a 2'-O-methyl (2 'methoxy or 2'OMe) sugar group. The sequence of alternating modified and unmodified nucleotides may begin with a modified nucleotide at the 5'-end or 3'-end of one of the chains; eg. The sequence of alternating modified and unmodified nucleotides may begin with a modified nucleotide at the 5'-end or 3'-end of the sense strand, and / or The sequence of alternating modified and unmodified nucleotides may begin with a modified nucleotide at the 5'-end or 3'-end of the antisense . If both the antisense and sense strands include a sequence of alternating modified nucleotides, the sequence of modified nucleotides may be configured such that the modified nucleotides in the sense strand are arranged opposite the modified nucleotides in the antisense strand, or a phase shift in the sequence may occur such that the modified nucleotides of the sense strand are opposite the unmodified nucleotides of the antisense chain and vice versa.

[0029] Nucleic acid molecules (eg, siHK molecules) as described herein may include 1-3 (ie 1, 2 or 3) deoxynucleotides at the 3′-end of the sense and / or antisense strand.

[0030] Nucleic acid molecules (eg, siHK molecules) as described herein may include a phosphate group at the 5 ′ end of the sense and / or antisense chain.

According to one aspect, double-stranded nucleic acid molecules having structure (A1) are provided:

(A1) 5 ′ (N) x-Z 3 ′ (antisense chain)

3 ′ Z ′ - (N ') y-z ′ ′ 5 ′ (sense chain)

where each of N and N ′ represents a nucleotide that may be unmodified or modified, or represents an unconventional functional group;

where each of (N) x and (N ′) y represents an oligonucleotide in which each subsequent N or N ′ is connected to the next N or N ′ covalent bond;

where each of the Ζ and Z ′ independence may be present or absent, but if present independently contains 1-5 successive nucleotides or other functional groups or a combination thereof, covalently attached to the 3′-end of the chain in which it is present;

where z ′ ′ may be present or absent, but if present, is a blocking group covalently attached to the 5′-end of (N ′) y;

where each of x and y independently represents an integer from 18 to 40; where the sequence (N ′) y is complementary to the sequence (N) x; and (N) x includes an antisense sequence to SEQ ID ΝΟ: 1. In some embodiments, (N) x includes the antisense oligonucleotide shown in Table A-19. In other embodiments, (N) x is selected from the antisense nucleotide shown in Tables D or C.

[0031] In some embodiments, the covalent bond connecting each adjacent N or N ′ is a phosphodiester bond.

[0032] According to some embodiments, x = y, and each of x and y is 19, 20, 21, 22, or 23. According to various embodiments, x = y = 19.

[0033] In certain embodiments of nucleic acid molecules (eg, siNAs) as described herein, a double stranded nucleic acid molecule is siRNA, siNA, or miRNA.

[0034] In some embodiments, the antisense and sense strands are selected from pairs of sequences shown in SERPINH1_4 (SEQ ID NOS: 195 and 220), SERPINH1_2 (SEQ ID NOS: 196 and 221), SERPINH1_30 (SEQ ID NOS: 199 and 224 ) and SERPINH1_58 (SEQ ID NOS: 208 and 233).

[0035] In some embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_4 (SEQ ID NOS: 195 and 220). In some embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_12 (SEQ ID NOS: 196 and 221). In some embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_30 (SEQ ID NOS: 199 and 224). In some embodiments, the antisense and sense strands are pairs of sequences presented in SERPINH1_58 (SEQ ID NOS: 208 and 233).

[0036] In some embodiments, the double-stranded nucleic acid molecules comprise a DNA group or a target mismatch at position 1 of the antisense strand (5'-end). Such a structure is described below. In one embodiment, modified nucleic acid molecules are provided having the structure (A2) set forth below:

(A2) 5 'N ¹ - (N) xZ 3' (antisense chain)

3 'Z'-N ² - (N') yz "5 '(semantic chain)

where each of N ² , N and N 'represents an unmodified or modified ribonucleotide or non-traditional group;

where each of (N) x and (N ') y represents an oligonucleotide in which each subsequent N or N' is connected to an adjacent N or N 'covalent bond;

where each of x and y independently represents an integer from 17 to 39;

where the sequence (N ') y has the complementarity of the sequence (N) x, and (N) x has the complementarity of the continuous sequence in the target RNA;

where N ^{1 is} covalently linked to (N) x and does not correspond to the target RNA or is a DNA group complementary to the target RNA;

where N ¹ represents a group selected from the group consisting of natural or modified uridine, deoxyribouridine, ribotimidine, deoxyribotimidine, adenosine or deoxyadenosine;

where z "may be present or absent, but if present, is a blocking group covalently attached to the 5'-end of N ² - (N ') y; and

where each of Z and Z 'is independently present or absent from each other, but if present independently represents 1-5 consecutive nucleotides, consecutive non-nucleotide groups, or a combination thereof, covalently linked to the 3'-end of the chain in which it is present.

[0037] In some embodiments, the sequence (N ') y is fully complementary to the sequence (N) x. In various embodiments, the sequence N ² - (N ') y is complementary to the sequence N ¹ - (N) x. In some embodiments, (N) x contains an antisense sequence that is fully complementary to approximately 17-39 consecutive nucleotides in the target RNA. In other embodiments, (N) x contains an antisense sequence that is substantially complementary to approximately 17-39 consecutive nucleotides in the target RNA.

[0038] In some embodiments, N ¹ and N ² form a Watson-Crick base pair. In some embodiments, N ¹ and N ² form a base pair other than Watson-Crick. In some embodiments, a base pair is formed between the ribonucleotide and the deoxyribonucleotide.

[0039] In some embodiments, x = y = 18, x = y = 19, or x = y = 20. According to preferred embodiments, x = y = 18. If x = 18 in N ¹ - (N) x, N ¹ denotes position 1, and positions 2-19 are included in (N) ₁₈ . If y = 18 in N ² - (N ') y, N ^2. denotes position 19, and positions 1-18 are included in (N') ₁₈ .

[0040] In some embodiments, N ^{1 is} covalently linked to (N) x and does not match the target RNA. In various embodiments, N ^{1 is} covalently linked to (N) x and is a DNA group complementary to the target RNA.

[0041] In some embodiments, the uridine at position 1 of the antisense chain is substituted with N ¹ selected from adenosine, deoxyadenosine, deoxyuridine (dU), ribotimidine, or deoxythymidine. In various embodiments, N ^{1 is} selected from adenosine, deoxyadenosine, or deoxyuridine.

[0042] In some embodiments, the guanosine at position 1 of the antisense chain is substituted with N ¹ selected from adenosine, deoxyadenosine, uridine, deoxyuridine, ribotimidine, or deoxythymidine. In various embodiments, N ^{1 is} selected from adenosine, deoxyadenosine, uridine, or deoxyuridine.

[0043] In some embodiments, the cytidine at position 1 of the antisense chain is substituted with N ¹ selected from adenosine, deoxyadenosine, uridine, deoxyuridine, ribotimidine, or deoxythymidine. In various embodiments, N ^{1 is} selected from adenosine, deoxyadenosine, uridine, or deoxyuridine.

[0044] In some embodiments, the adenosine at position 1 of the antisense chain is substituted with N1 selected from deoxyadenosine, deoxyuridine, ribotimidine, or deoxythymidine. In various embodiments, N ^{1 is} selected from deoxyadenosine or deoxyuridine.

[0045] In certain embodiments, N ¹ and N ² form a base pair between uridine or deoxyuridine and adenosine or deoxyadenosine. In other embodiments, N ¹ and N ² form a base pair between deoxyuridine and adenosine.

[0046] In some embodiments, the double-stranded nucleic acid molecule is siRNA, siNA, or miRNA. Double-stranded nucleic acid molecules as used herein are also referred to as duplexes.

[0047] In some embodiments, (N) x includes the antisense oligonucleotide shown in Table A-18. In some embodiments, x = y = 18, and N1- (N) x includes the antisense oligonucleotide shown in Table A-18. In some embodiments, x = y = 19 or x = y = 20. In some preferred embodiments, x = y = 18. In some embodiments, x = y = 18, and the sequences N1- (N) x and N2- (N ') y are selected from the pairs of oligonucleotides shown in Table A-18. In some embodiments, x = y = 18, and the sequences N1- (N) x and N2- (N ') y are selected from pairs of oligonucleotides shown in Tables D and E. According to some embodiments, the antisense strand and sense strand are selected from pairs the sequences represented in SERPINH1_2 (SEQ ID NOS: 60 and 127), SERPINH1_6 (SEQ ID NOS: 63 and 130), SERPINH1_1 (SEQ ID NOS: 68 and 135), SERPINH1_3 (SEQ ID NOS: 69 and 136), SERPINH1_45 ( SEQ ID NOS: 97 and 164), SERPINH1_45a (SEQ ID NOS: 98 and 165), SERPINH1_51 (SEQ ID NOS: 101 and 168), SERPINH1_51a (SEQ ID NOS: 105 and 172), SERPINH1_52 (SEQ ID NOS: 102 and 169) or SERPINH1_86 (SEQ ID NOS: 123 and 190). In certain preferred embodiments, the antisense strand and the sense strand are selected from pairs of sequences shown in SERPINH1_2 (SEQ ID NOS: 60 and 127), SERPINH1_6 (SEQ ID NOS: 63 and 130), SERPINH1_45a (SEQ ID NOS: 98 and 165), SERPINH1_51 (SEQ ID NOS: 101 and 168) and SERPINH1_51a (SEQ ID NOS: 105 and 172).

[0048] According to some preferred embodiments, the antisense strand and the sense strand are selected from the pairs of sequences shown in SERPINH1_2 (SEQ ID NOS: 60 and 127). In some embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_6 (SEQ ID NOS: 63 and 130). In some embodiments, the antisense and sense strands are pairs of sequences presented in SERPINH1_11 (SEQ ID NOS: 68 and 135). In some embodiments, the antisense and sense strands are pairs of sequences presented in SERPINH1_13 (SEQ ID NOS: 69 and 136). In some embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_45 (SEQ ID NOS: 97 and 164). In some embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_45a (SEQ ID NOS: 98 and 165). In some embodiments, the antisense and sense strands are pairs of sequences presented in SERPINH1_51 (SEQ ID NOS: 101 and 168). In some embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_51a (SEQ ID NOS: 105 and 172). In some embodiments, the antisense and sense strands are pairs of sequences shown in SERPINH1_52 (SEQ ID NOS: 102 and 169). In some embodiments, the antisense and sense strands are pairs of sequences presented in SERPINH1_86 (SEQ ID NOS: 123 and 190). In some preferred embodiments, the antisense strand and the sense strand are selected from pairs of sequences shown in SERPINH1_2 (SEQ ID NOS: 60 and 127), SERPINH1_6 (SEQ ID NOS: 63 and 130), SERPINH1_45a (SEQ ID NOS: 98 and 165), SERPINH1_51 (SEQ ID NOS: 101 and 168) and SERPINH1_51a (SEQ ID NOS: 105 and 172).

[0049] In some embodiments, N1 and N2 form a Watson-Crick base pair. In other embodiments, N1 and N2 form a base pair other than Watson-Crick. In some embodiments, N1 is a modified ribadenosine or a modified ribouridine.

[0050] In some embodiments, N1 and N2 form a Watson-Crick base pair. In other embodiments, N1 and N2 form a base pair other than Watson-Crick. In some embodiments, N1 is selected from the group consisting of riboadenosine, modified ribadenosine, deoxyriboadenosine, modified deoxyriboadenosine. In other embodiments, N1 is selected from the group consisting of ribouridine, deoxyriburidine, modified ribouridine, and modified deoxyriburidine.

[0051] In some embodiments, position 1 in the antisense strand (5′-end) contains deoxyribouridine (dU) or adenosine. In certain embodiments, N1 is selected from the group consisting of riboadenosine, modified ribadenosine, deoxyriboadenosine, modified deoxyriboadenosine, and N2 is selected from the group consisting of ribouridine, deoxyribouridine, modified riburidine, and modified deoxyribouridine. In some embodiments, N1 is selected from the group consisting of riboadenosine and modified ribadenosine, and N2 is selected from the group consisting of ribouridine and modified ribouridine.

[0052] In some embodiments, N1 is selected from the group consisting of ribouridine, deoxyribouridine, modified ribouridine, and modified deoxyribouridine, and N2 is selected from the group consisting of riboadenosine, modified riboadenosine, deoxyriboadenosine, modified deoxyriboadenosine. In some embodiments, N1 is selected from the group consisting of ribouridine and deoxyribouridine, and N2 is selected from the group consisting of ribadenosine and modified ribadenosine. In some embodiments, N1 is ribouridine and N2 is ribadenosine. In some embodiments, N1 is deoxyribouridine and N2 is riboadenosine.

[0053] According to some embodiments of Structure (A2), N1 comprises a modified ribouracil with 2'OMe sugar or a modified riboadenosine with 2'OMe sugar. In some embodiments of structure (A), N2 comprises a modified ribonucleotide or deoxyribonucleotide with 2'OMe sugar.

[0054] In some embodiments of Structure (A2), N1 comprises a modified ribouracil with 2'OMe sugar or a modified ribocytosine with 2'OMe sugar. In some embodiments of structure (A), N2 comprises a modified ribonucleotide with 2'OMe sugar.

[0055] In some embodiments, N and N ′ is an unmodified nucleotide. In some embodiments, at least one of N or N ′ includes a chemically modified nucleotide or non-traditional group. In some embodiments, the unconventional group is selected from a mirror nucleotide, a ribose residue without a base, and a deoxyribose residue without a base. In some embodiments, the unconventional group is a mirror nucleotide, preferably an L-DNA group. In some embodiments, at least one of N or N ′ comprises a modified ribonucleotide with 2′OMe sugar.

[0056] In some embodiments, the sequence (N ′) y is fully complementary to the sequence (N) x. In other embodiments, the sequence (N ′) y is substantially complementary to the sequence (N) x.

[0057] In some embodiments, (N) x includes an antisense sequence that is fully complementary to approximately 17-39 consecutive nucleotides in the target mRNA. In other embodiments, (N) x includes an antisense sequence that is substantially complementary to approximately 17-39 consecutive nucleotides in the target mRNA.

[0058] According to some embodiments of Structure A1 and Structure A2, the compound has blunt ends, for example, while Z and Z ′ are absent. According to another embodiment, at least one of Ζ or Z ′ is present. Ζ and Z ′ independently include one or more covalently linked modified and / or unmodified nucleotides, including deoxyribonucleotides and ribonucleotides or an unconventional group, for example, an inverted deoxyribose group or ribose without a base; non-nucleotide C3, C4 or C5 group, amino-6 group, mirror nucleotide etc. In some embodiments, Ζ and Z ′ independently of one another comprise a C3 group or an amino-C6 group. In some embodiments, Z ′ is absent, and Ζ is present and includes a non-nucleotide C3 group. In some embodiments, Ζ is absent, and Z ′ is present and includes a non-nucleotide C3 group.

[0059] According to some embodiments of Structure A1 and Structure A2, each N consists of an unmodified ribonucleotide. In some embodiments of Structure A1 and Structure A2, each N ′ consists of an unmodified nucleotide. In preferred embodiments, at least one of N and N ′ is an unmodified ribonucleotide or an unconventional group.

[0060] In other embodiments, the compound of Structure A1 or Structure A2 comprises at least one ribonucleotide modified in a sugar residue. In some embodiments, the compound comprises a modification at the 2 ′ position of the sugar residue. In some embodiments, the modification at position 2 ′ includes the presence of an amino, fluoro, alkoxy, or alkyl group. In some embodiments, modification 2 ′ includes an alkoxy group. In preferred embodiments, the alkoxy group is a methoxy group (also known as 2′-O-methyl; 2′OMe; 2′-OCH3). In some embodiments, the nucleic acid compound comprises alternating ribonucleotides modified with 2′OMe at the sugar residue on an antisense and / or sense strand. In other embodiments, the compound includes modified ribonucleotides with 2′OMe sugar in the antisense chain, only (Ν) x or Ν1- (Ν) x. In some embodiments, the middle antisense strand ribonucleotide, for example, the ribonucleotide at position 10 in the 19-dimensional strand, is unmodified. In various embodiments, the nucleic acid compound comprises at least 5 alternating ribonucleotides modified and unmodified with 2′OMe sugar. According to additional embodiments, the compound of Structure A1 or Structure A2 comprises modified ribonucleotides in alternating positions, with each ribonucleotide at the 5 ′ and 3′-ends (Ν) x or Ν1- (Ν) x modified at their sugar residues and each ribonucleotide at 5 The ′ ′ and 3′-ends of (N ′) y or N2- (N ′) y are not modified in their sugar moieties.

[0061] In some embodiments, a double-stranded molecule includes one or more of the following modifications

a) N in at least one of positions 5, 6, 7, 8 or 9 from the 5′-end of the antisense strand is selected from 2′5 ′ nucleotide or mirror nucleotide;

b) N ′ in at least one of positions 9 or 10 from the 5′-end of the sense strand is selected from 2′5 ′ nucleotide and pseudouridine; and

c) N ′ at 4, 5 or 6 consecutive positions at the 3′-end of (N ′) y contains a 2′5 ′ nucleotide.

[0062] In some embodiments, a double-stranded molecule includes a combination of the following modifications:

a) the antisense strand includes a 2′5 ′ nucleotide or mirror nucleotide in at least one of positions 5, 6, 7, 8 or 9 from the 5′-end; and

b) the sense strand includes at least one of 2′5 ′ nucleotides and pseudouridine at positions 9 or 10 from the 5′-end.

[0063] In some embodiments, a double-stranded molecule includes a combination of the following modifications:

a) the antisense strand includes a 2′5 ′ nucleotide or mirror nucleotide in at least one of positions 5, 6, 7, 8 or 9 from the 5′-end; and

b) the sense strand includes 4, 5 or 6 consecutive 2′5 ′ nucleotides in the penultimate position at the 3′-end or 3′-terminal position.

[0064] In some embodiments, the sense chain [(Ν) x or N1- (N) x] includes 1, 2, 3, 4, 5, 6, 7, 8, or 9 modified ribonucleotides with 2′OMe sugar. In some embodiments, the antisense strand includes modified 2′OMe sugar ribonucleotides at positions 2, 4, 6, 8, 11, 13, 15, 17, and 19. In other embodiments, the antisense strand includes modified 2′OMe sugar ribonucleotides at positions 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19. According to other embodiments, the antisense strand includes modified ribonucleotides with 2′OMe sugar at positions 3, 5, 7, 9, 11, 13 , 15, 17, and 19. According to some embodiments, the antisense chain includes one or more modifs. pyrimidine-skilled with 2'OMe-sugar. In some embodiments, all pyrimidine nucleotides in the antisense strand are modified at 2′OMe sugar residues. In some embodiments, the sense strand includes modified pyrimidines with 2′OMe sugar.

[0065] According to some embodiments of Structure A1 and Structure A2, neither the sense strand nor the antisense strand are phosphorylated at the 3′- and 5′-ends. In other embodiments, both the sense strand and the antisense strand are phosphorylated at the 3′-ends.

[0066] According to some embodiments of Structure A1 and Structure A2 (N ′), y includes at least one non-traditional group selected from a mirror nucleotide, 2′5 ′ nucleotide and TNA. In some embodiments, the unconventional group is a mirror nucleotide. In various embodiments, the mirror nucleotide is selected from L-ribonucleotide (L-PHK) and L-deoxyribonucleotide (L-DNA). In preferred embodiments, the mirror nucleotide is L-DNA. According to some embodiments, the sense chain contains an unconventional group at position 9 or 10 (from the 5'-end). According to preferred embodiments, the sense chain includes an unconventional group at position 9 (from the 5'-end). According to some embodiments, the sense strand is 19 nucleotides in length and contains 4, 5 or 6 consecutive functional non-standard groups at positions 15 (from the 5'-end). In some embodiments, the sense strand includes 4 consecutive 2'5 'ribonucleotides at positions 15, 16, 17, and 18. In some embodiments, the sense strand includes 5 consecutive 2'5' ribonucleotides at positions 15, 16, 17, 18, and 19. In various embodiments, the sense strand also contains Z '. In some embodiments, Z ′ includes a C3OH group or a C3Pi group.

[0067] In some embodiments of Structure A1 (N '), y includes at least one L-DNA group. In some embodiments, x = y = 19, and (N ') y consists of unmodified ribonucleotides at positions 1-17 and 19 and one L-DNA in the penultimate position at the 3'-end (position 18). In other embodiments, x = y = 19, and (N ') y consists of unmodified ribonucleotides at positions 1-16 and 19 and two consecutive L-DNAs in the penultimate position at the 3'-end (positions 17 and 18). In various embodiments, the unconventional group is a nucleotide linked to an adjacent nucleotide via a 2′-5 ′ internucleotide phosphate bond. In various embodiments (N ′), y includes 2, 3, 4, 5, or 6 consecutive ribonucleotides at the 3 ′ end connected by 2′-5 ′ internucleotide bonds. According to one embodiment, four consecutive nucleotides at the 3'-end (N ') y are connected via three 2'-5' phosphodiester bonds, wherein one or more 2'-5 'nucleotides that form 2'-5' phosphodiester bonds, also includes the modification of 3'-O-methyl sugar (3'OMe). Preferably, the 3'-terminal nucleotide (N ') y contains a modification of 2'OMe sugar. In some embodiments, x = y = 19, and (N ′) y includes two or more consecutive nucleotides at positions 15, 16, 17, 18, and 19, and includes a nucleotide connected to the adjacent nucleotide 2′-5 ′ internucleotide linkage ( 2'-5 'nucleotide). In various embodiments, a nucleotide forming a 2′-5 ′ internucleotide linkage includes a 3′-deoxyribose nucleotide or a 3 ′ methoxy nucleotide (3 ′ H or 3′OMe instead of 3 ′ OH). In some embodiments, x = y = 19, and (N ′) y includes 2′-5 ′ nucleotides at positions 15, 16, and 17, such that adjacent nucleotides are linked by a 2′-5 ′ internucleotide link between positions 15-16 , 16-17 and 17-18; or at positions 15, 16, 17, 18 and 19, so that adjacent nucleotides are connected by a 2'-5 'internucleotide link between positions 15-16, 16-17, 17-18 and 18-19, and 3'OH is available at the 3'-terminal nucleotide or at positions 16, 17 and 18 so that the adjacent nucleotides are connected by a 2'-5 'internucleotide link between positions 16-17, 17-18 and 18-19. In some embodiments, x = y = 19, and (N ′) y includes 2′-5 ′ nucleotides at positions 16 and 17 or at positions 17 and 18 or positions 15 and 17, so that adjacent nucleotides are connected 2 ′ -5 'internucleotide linkage between positions 16-17 and 17-18 or between positions 17-18 and 18-19 or between positions 15-16 and 17-18, respectively. In other embodiments, the pyrimidine nucleotides (rU, rC) in (N ′) y are replaced by nucleotides linked to the adjacent nucleotide 2′-5 ′ internucleotide linkage. In some embodiments, the antisense and sense strands are selected from pairs of sequences shown on SERPINH1_4, SERPINH1_12, SERPINH1_18, SERPINH1_30, SERPINH1_58 or SERPINH1_88, and x = y-19, and (N ') y contains five consecutive nucleotides at 3'-end connected by four 2'-5 'bonds, in particular, bonds between the positions of nucleotides 15-16, 16-17, 17-18 and 18-19.

[0068] In some embodiments, the bonds include phosphodiester bonds. In some embodiments, the antisense and sense strands are selected from pairs of sequences represented on SERPINH1_4, SERPINH1_12, SERPINH1_8, SERPINH1_30, SERPINH1_58 or SERPINH1_88, and x = y = 19, and (N ') y contains five consecutive nucleotides at the 3'-end connected by four 2'-5 'bonds, and further also includes Z' and z 'independently selected from the inverted group without a base, and C3 alkyl [C3; 1,3-propanediol mono (dihydrogen phosphate)] blocking group. The C3 alkyl blocking group is covalently linked to the 3 'or 5'-terminal nucleotide. In some embodiments, the 3'-terminal C3 blocking group also contains 3'-phosphate. In some embodiments, the 3'-terminal C3 blocking group also contains a 3'-terminal hydroxy group.

[0069] According to some embodiments, the antisense and sense strands are selected from pairs of sequences represented on SERPINH1_4, SERPINH1_12, SERPINH1_18, SERPINH1_30, SERPINH1_58 or SERPINH1_88, and x = y = 19, and (N ') y includes L-DNA at position 18 ; and (N ') y further also includes Z' and z 'independently selected from the inverted group without a base, and C3 alkyl [C3; 1,3-propanediol mono (dihydrogen phosphate)] blocking group.

[0070] In some embodiments, (N ') y includes a 3'-terminal phosphate. In some embodiments, (N ') y includes a 3'-terminal hydroxyl.

[0071] In some embodiments, the antisense and sense strands are selected from pairs of sequences represented on SERPINH1_4, SERPINH1_12, SERPINH1_18, SERPINH1_30, SERPINH1_58 or SERPINH1_88, and x = y = 19, and (N) x includes modified ribonucleotides 2 in positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 or in positions 2, 4, 6, 8, 11, 13, 15, 17, 19. According to some embodiments, the antisense and sense chain selected from the pairs of sequences represented on SERPINH1_4, SERPINH1_12, SERPINH1_18, SERPINH1_30, SERPINH1_58 and SERPINH1_88, and x = y = 19, and (N) x includes modified pyrimidines with 2'OM sugar th. In some embodiments, all pyrimidines in (N) x include a 2'OMe sugar modification.

[0072] In some embodiments the antisense and sense circuit selected from the pairs of the sequences shown in SERPINH1_2, SERPINH1_6, SERPINH1_11, SERPINH1_13, SERPINH1_45, SERPINH1_45a, SERPINH1_51, SERPIN51a, SERPINH1_52 or SERPINH1_86, and x = y = 18 and N2 represents a group ribadenosine.

[0073] According to some embodiments, the antisense and sense strands are selected from pairs of sequences represented on SERPINH1_2, SERPINH1_6, SERPINH1_11, SERPINH1_13, SERPINH1_45, SERPINH1_45a, SERPINH1_51, SERPINH1 and 52, SERPINH1, 52, N1 and 52 = 1, 52, and 18 = 1 and 52 ') y includes five consecutive nucleotides at the 3'-end connected by four 2'-5'-bonds, in particular, bonds between nucleotides at positions 15-16, 16-17, 17-18 and 18-19. In some embodiments, the bonds include phosphodiester bonds.

[0074] According to some embodiments, the antisense and sense strands are selected from pairs of sequences represented on SERPINH1_2, SERPINH1_6, SERPINH1_11, SERPINH1_13, SERPINH1_45, SERPINH1_45a, SERPINH1_51, SERPINH1_1, or 18PIN, SERPINH1_1H1, yPIN = 18, SERPINH1_51, YP = 18, SERPINH1_51, yPIN = yPP, SERPINH1_51, YP = 18PP ′) Y includes five consecutive nucleotides at the 3′-end connected by four 2′-5′-bonds, and further also includes Z ′ and z ′ independently selected from the inverted group without a base, and C3 alkyl [C3; 1,3-propanediol mono (dihydrogen phosphate)] blocking group.

[0075] In some embodiments the antisense and sense circuit selected from the sequences of the pairs presented at SERPINH1_2, SERPINH1_6, SERPINH1_11, SERPINH1_13, SERPINH1_45, SERPINH1_45a, SERPINH1_51, SERPINH1_51a, SERPINH1_52 or SERPINH1_86, and x = y = 18 and N ² - ( N ′) y includes L-DNA at position 18; and (N ′) y further also includes Z ′ and z ′ independently selected from the inverted group lacking a base and C3 alkyl [C3; 1,3-propanediol mono (dihydrogen phosphate)] blocking group.

[0076] In some embodiments, N ² - (N ′) y contains 3′-terminal phosphate. In some embodiments, N2- (N ′) y contains a 3′-terminal hydroxyl.

[0077] According to some embodiments, the antisense and sense strands are selected from pairs of sequences represented on SERPINH1_2, SERPINH1_6, SERPINH1_11, SERPINH1_13, SERPINH1_45, SERPINH1_45a, SERPINH1_51, SERPINH1_1, and 18PI = 18, SERPINH1_1H = 18, SERPINH1_51_1, SERPINH1_51, = SERPINH1_51, YP = 18, SERPINH1_51, YP = 18P, SERPINH1_51, YP, SERPINH1_51, SERPINH1_51, YP = 18P, N) x includes modified ribonucleotides with 2′OMe sugar at positions 1, 3, 5, 7, 9, 11, 13, 15.17, 19 or at positions 1, 3, 5, 9, 11,13,15,17 , 19, or at positions 3, 5, 9,11,13,15, 17, or at positions 2, 4, 6, 8, 11, 13, 15, 17, 19. According to some embodiments, the antisense and sense chains are selected from pairs of sequences represented on SERPINH1_2, SERPIN H1_6, SERPINH1_11, SERPINH1_13, SERPINH1_45, SERPINH1_45a, SERPINH1_51, SERPINH1_51a, SERPINH1_52 or SERPINH1_86, and x = y = 18, and N ¹ - (N) x includes the modified ribonucleotides at position 11, position 11, 11′2, 2 ′, and 19 (from the 5′-end). According to some embodiments, the antisense and sense strands are selected from pairs of sequences represented on SERPINH1_2, SERPINH1_6, SERPINH1_11, SERPINH1_13, SERPINH1_45, SERPINH1_45a, SERPINH1_51, SERPINH1_51a, SERPINH1 and x1, y = 18, and = 18, _1, and = 52 It includes modified ribonucleotides with 2′OMe sugar at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 or at positions 3, 5, 7, 9, 11, 13, 15, 17, 19. In some embodiments, the antisense and sense strands are selected from pairs of sequences represented on SERPINH1_2, SERPINH1_6, SERPINH1_11, SERPINH1_13, SERPINH1_45, SERPINH1_45a, SERPINH1_51, SERPINH1_51a, SERPINH1_1 x = y = 18, and N1- (N) x includes modified ribonucleotides with 2′OMe sugar at positions 2, 4, 6, 8, 11.13, 15.17, 19.

[0078] According to some embodiments, the antisense and sense strands are selected from pairs of sequences represented on SERPINH1_2, SERPINH1_6, SERPINH1_11, SERPINH1_13, SERPINH1_45, SERPINH1_45a, SERPINH1_51, SERPINH1_1, and 18PI = 18, SERPINH1_1H1, YP = 18, SERPINH1_51_1, YP = 18, SERPINH1_51_1, YP = 18, SERPINH1_51, YP = 18PP ) x includes modified pyrimidines with 2′OMe sugar. In some embodiments, all pyrimidines in (N) x include a 2′OMe sugar modification. In some embodiments, the antisense strand also includes L-DNA or a 2′-5 ′ nucleotide at position 5, 6, or 7 (5 ′> 3 ′). In other embodiments, the antisense strand also includes a ribonucleotide that forms a 2′5 ′ internucleotide linkage between ribonucleotides at positions 5-6 or 6-7 (5 ′> 3 ′)

[0079] According to further embodiments, Ν1- (Ν) x also includes Ζ, wherein Ζ includes a non-nucleotide protruding end. In some embodiments, the non-nucleotide protruding end is C3-C3 [1,3-propanediol mono (dihydrogen phosphate)] 2.

[0080] In some embodiments of Structure A2, (N ′) y comprises at least one L-DNA group. In some embodiments, x = y = 18, and (N ′) y consists of unmodified nucleotides at positions 1-16 and 18 and one L-DNA in the penultimate position at the 3′-end (position 17). In other embodiments, x = y = 18, and (N ′) y consists of unmodified nucleotides at positions 1-15 and 18 and two consecutive L-DNAs in the penultimate position at the 3′-end (positions 16 and 17). In various embodiments, the unconventional group is a nucleotide coupled to an adjacent nucleotide via a 2′-5 ′ internucleotide phosphorus bond. In various embodiments, (N ′) y includes 2, 3, 4, 5, or 6 consecutive ribonucleotides at the 3 ′ end connected by 2′-5 ′ internucleotide bonds. According to one embodiment, four consecutive nucleotides at the 3′-end of (N ′) y are connected via three 2′-5 ′ phosphodiester bonds, with one or more 2′-5 ′ nucleotides that form 2′-5 ′ phosphodiester bonds also include the modification of sugar 3'-O-methyl (3'OMe). Preferably, the 3'-terminal nucleotide (N ') y comprises a modification of the 2'OMe of sugar. In some embodiments, x = y = 18, and in (N ′) y, two or more consecutive nucleotides at positions 14, 15, 16, 17, and 18 comprise a nucleotide linked to an adjacent nucleotide via a 2′-5 ′ internucleotide linkage. In various embodiments, the nucleotide forming the 2'-5 'internucleotide linkage includes 3' deoxyribose or 3 'methoxynucleotide. In some embodiments, x = y = 18, and (N ') y includes a nucleotide connected to the adjacent nucleotide via a 2'-5' internucleotide link between positions 15-16, 16-17 and 17-18, or between positions 16- 17 and 17-18. In some embodiments, x = y = 18, and (N ′) y includes a nucleotide coupled to an adjacent nucleotide via a 2′-5 ′ internucleotide link between positions 14-15, 15-16, 16-17, and 17-18 or between positions 15-16, 16-17 and 17-18 or between positions 16-17 and 17-18 or between positions 17-18 or between positions 15-16 and 17-18. In other embodiments, the pyrimidine nucleotides (rU, rC) in (N ′) y are replaced by nucleotides linked to the adjacent nucleotides 2′-5 ′ by an internucleotide linkage.

[0081] In some embodiments, the antisense and sense strands are selected from pairs of oligonucleotides shown in Table A-18 and designated as SERPINH1_2 (SEQ ID NOS: 60 and 127), SERPINH1_6 (SEQ ID NOS: 63 and 130), SERPINH1_45a (SEQ ID NOS: 98 and 165), SERPINH1_51 (SEQ ID NOS: 101 and 168) and SERPINH1_51a (SEQ ID NOS: 105 and 172).

[0082] In some embodiments, the double-stranded nucleic acid molecule includes an antisense strand shown in SEQ ID NO: 127 and a sense strand shown in SEQ ID NO: 60; designated in the present description as SERPINH1_2. In some embodiments, a double stranded nucleic acid molecule has the structure

5' UAUAGCACCCAUGUGUCUC-Z 3 ' (antisense chain of SEQ ID NO: 127) |||||||||||||||||||| 3 'Z'- AUAUCGUGGGUACACAGAG-z " 5' (sense chain of SEQ ID NO: 60)

in which each "|" denotes the base pairing between ribonucleotides;

in which A, C, G, U independently from each other represent a modified or unmodified ribonucleotide, or an unconventional group;

in which Z and Z 'may be independently present or absent, but if present independently, are 1-5 consecutive nucleotides or non-nucleotide groups, or a combination thereof, covalently linked to the 3'-end of the chain in which they are located; and

in which z "may be present or absent, but if present, is a blocking group covalently linked to the 5'-end of N2- (N ') y.

[0083] In some embodiments, a double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 127) comprises one or more modified pyrimidines and / or purines with 2'OMe sugar, 2'-5 'ribonucleotide at position 5, 6 , 7 or 8, and a nucleotide or non-nucleotide 3 ′ protruding end. In some embodiments, the sense strand (SEQ ID NO: 60) includes 4 or 5 consecutive 2'5 'nucleotides at the 3'-terminal or penultimate position, a nucleotide or non-nucleotide group covalently linked to the 3'-end, and blocking a group covalently attached to the 5'-end. In other embodiments, the sense strand (SEQ ID NO: 60) includes one or more 2'OMe pyrimidines, a nucleotide or non-nucleotide group covalently linked to the 3'-end, and a blocking group covalently linked to the 5'-end.

[0084] In some embodiments, a double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 127) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11 , 15, 17 and 19, a 2'-5 'ribonucleotide at position 7, and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense chain (SEQ ID NO: 60) is selected from the sense chain, which includes

a) 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19, C3OH protruding 3'-end not consisting of nucleotides; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; or

b) 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19, a 3'-terminal phosphate, and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; or

c) modified 2'OMe ribonucleotides with sugar at positions (5 '> 3') 5, 7, 13, and 16; 2'5 'ribonucleotide at position 18; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; or

d) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 7, 13, 16 and 18; 2'5 'ribonucleotide at position 9; C3OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; or

e) 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: a C3-Pi group covalently linked to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0085] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 127) comprises modified nucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 15, 17 , 19, 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 60) includes 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: C3 protruding 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0086] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 127) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 15, 17 19, a 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH protruding 3'-end; and the sense strand (SEQ ID NO: 60) includes 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: 3'-terminal phosphate; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0087] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 127) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 15, 17 , 19, 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 60) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 5, 7, 13 and 16; 2'-5 'ribonucleotide at position 18; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0088] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 127) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 15, 17 , 19, 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 60) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 7, 13, 16 and 18; 2'-5 'ribonucleotide at position 9; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0089] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 127) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 15, 17 , 19, 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 60) includes 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: a C3-Pi group covalently linked to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0090] In some embodiments, a double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 127) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11 , 13, 15, 17, 19 and C3-C3 protruding 3'-end; and the sense strand (SEQ ID NO: 60) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 7, 9, 13, 16 and 18; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0091] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 60) includes 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: 3'-terminal phosphate, and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end, and the antisense chain (SEQ ID NO: 127) includes an antisense chain selected from:

a) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and the C3Pi-C3OH group covalently linked to the 3'-end ; or

b) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 6, 8, 10, 12, 14, 17, 18 and the C3Pi-C3OH group covalently linked to the 3'-end.

[0092] In some embodiments, a double-stranded nucleic acid molecule is provided that includes an antisense strand as set forth in SEQ ID NO: 130 and a sense strand as set forth in SEQ ID NO: 63; denoted in the present description as SERPINH1_6. In some embodiments, said duplex comprises a structure

5' UACUCGUCUCGCAUCUUGU-Z 3 ' (antisense SEQ ID NO: 130) |||||||||||||||||||| 3 'Z'- AUGAGCAGAGCGUAGAACA-z " 5' (semantic SEQ ID NO: 63)

on which "|" refers to the base pairing between ribonucleotides;

in which A, C, G, U independently represent an unmodified or modified ribonucleotide or an unconventional group;

on which Z and Z 'may independently or absent be present, but if present, independently represent 1-5 consecutive nucleotides or non-nucleotide groups or a combination thereof, covalently linked to the 3'-end of the chain in which they are located; and

on which z "may or may not be present, but if present, is a blocking group covalently attached to the 5'-end of N2- (N ') y.

[0093] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 63) comprises one or more modified pyrimidine with 2'OMe sugar; a nucleotide or non-nucleotide protruding 3 ′ end; and a blocking group covalently linked to the 5'-end. In some embodiments, the antisense chain (SEQ ID NO: 130) includes one or more modified pyrimidines with 2'OMe sugar, a nucleotide or non-nucleotide group covalently linked to the 3'-end, and a blocking group covalently linked to 5'- end.

[0094] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 63) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 14, and 18; A C3OH or C3Pi group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense chain (SEQ ID NO: 130) is selected from the antisense chain, which includes:

a) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 13, 15 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end; or

b) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 7, 9, 12, 13 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end; or

c) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 13, 15 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end; or

d) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 13, 15 and 17; dU at position 1; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end.

[0095] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 63) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 14, and 18; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense strand (SEQ ID NO: 130) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 13, 15, and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end.

[0096] In some embodiments, an oligonucleotide duplex molecule is provided in which the sense strand (SEQ ID NO: 63) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 14 and 18 and possibly at position 2 ; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense strand (SEQ ID NO: 130) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 7, 9, 12, 13, and 17; 2'-5 'ribonucleotide at position 7; and C3: a Pi-C3OH group covalently linked to the 3'-end.

[0097] In certain embodiments, an oligonucleotide duplex molecule is provided in which the sense strand (SEQ ID NO: 63) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 14 and 18; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense chain (SEQ ID NO: 130) is selected from the antisense chain, which includes:

a) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 13, 15 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3Pi or C3Pi-C3OH group covalently attached to the 3'-end; or

b) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 7, 9, 12, 13 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3Pi or C3Pi-C3OH group covalently attached to the 3'-end.

[0098] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 63) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 14 and 18; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense strand (SEQ ID NO: 130) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 13. 15 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end.

[0099] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 63) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 14 and 18; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense strand (SEQ ID NO: 130) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5,7, 9, 12,13 and 17; 2'-5 'ribonucleotide at position 7; and C3Pi-C3OH protruding 3'-end.

[0100] In some embodiments, the duplex includes an antisense strand set forth in SEQ ID NO: 165 and a sense strand set forth in SEQ ID NO: 98; denoted in the present description as SERPINH1_45a. In some embodiments, said duplex comprises a structure

5' AGGAAGUUGAUCUUGGAGU-Z 3 ' (antisense SEQ ID NO: 165) |||||||||||||||||||| 3 'Z'- UCCUUCAACUAGAACCUCA-z " 5' (semantic SEQ ID NO: 98)

on which "|" refers to the base pairing between ribonucleotides;

in which A, C, G, U independently represent an unmodified or modified ribonucleotide or an unconventional group;

on which Z and Z 'may be independently present or absent, but if independently present, represents 1-5 consecutive nucleotide or non-nucleotide groups of their combination, covalently linked to the 3'-end of the chain in which they are located ; and

on which z "may or may not be present, but if present, is a blocking group covalently attached to the 5'-end of N2- (N ') y.

[0101] In some embodiments, the sense strand (SEQ ID NO: 98) includes 2'-5 'ribonucleotides at positions (5'> 3 ') of 15, 16, 17 and 18, or 15, 16, 17, 18 and 19: a nucleotide or a non-nucleotide group covalently linked to the 3'-end, and a blocking group covalently linked to the 5'-end. In some embodiments, the antisense strand (SEQ ID NO: 165) comprises modified pyrimidine or purines with 2'OMe sugar, a 2'-5 'nucleotide at positions 5, 6, 7, and 8 (5'> 3 '); and a nucleotide or non-nucleotide group covalently linked to the 3'-end.

[0102] In some embodiments, the sense strand (SEQ ID NO: 98) includes 2'-5 'ribonucleotides at positions (5'> 3 ') 15, 16, 17, 18 and 19: C3Pi or C3-OH 3'- a terminal non-nucleotide group and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense chain (SEQ ID NO: 165) includes an antisense chain selected from one of:

a) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 4, 6, 8, 11, 13, 15, 17 and 19; A 2'-5 'ribonucleotide at position 7 and a C3Pi-C3Pi or C3Pi-C3OH protruding 3'-end; or

b) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 4, 6, 8, 11,13,15,17 and 19 and C3Pi-C3Pi or C3Pi-C3OH protruding 3'-end;

c) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 13, 15, 17 and 19; A 2'-5 'ribonucleotide at position 7 and a C3Pi-C3Pi or C3Pi-C3OH protruding 3'-end; or

d) modified ribonucleotides with 2'ome sugar at positions (5 '> 3') 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 and C3Pi-C3Pi or C3Pi-C3OH protruding 3'-end .

[0103] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 98) includes 2'-5 'ribonucleotides at positions (5'> 3 ') 15, 16, 17, 18 and 19: C3-OH 3 the '-terminal group and the inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense strand (SEQ ID NO: 165) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 4, 6, 8, 11, 13, 15, 17 and 19; 2'-5 'ribonucleotide at position 7 and C3P1-COH protruding 3'-end.

[0104] In some embodiments, the double-stranded nucleic acid molecule includes an antisense strand shown in SEQ ID NO: 168 and a sense strand shown in SEQ ID NO: 101; designated in the present description as SERPINH1_51. In some embodiments, said double helix comprises a structure

5' UCACCCAUGUGUCUCAGGA-Z 3 ' (antisense SEQ ID NO: 168) 3 'Z'- AGUGGGUACACAGAGUCCU-z " 5' (semantic SEQ ID NO: 101)

on which "|" refers to the base pairing between ribonucleotides;

in which A, C, G, U independently represent an unmodified or modified ribonucleotide or an unconventional group;

on which Z and Z 'may be independently present or absent, but if present, represent independently 1-5 consecutive nucleotides or non-nucleotide groups or a combination thereof, covalently linked to the 3'-end of the chain in which they are located ; and

on which z "may or may not be present, but if present, is a blocking group covalently attached to the 5'-end of N2- (N ') y.

[0105] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 101) includes modified pyrimidines with 2'OMe sugar, possibly a 2'-5 'ribonucleotide at position 9 or 10; a nucleotide or a non-nucleotide group covalently linked to the 3'-end, and possibly a blocking group covalently linked to the 5'-end. In some embodiments, the antisense strand (SEQ ID NO: 168) comprises modified pyrimidine and / or purines with 2'OMe sugar, a 2'-5 'nucleotide at position 5, 6, 7, or 8 (5'> 3 '); and a nucleotide or non-nucleotide group covalently linked to the 3'-end.

[0106] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 101) includes modified pyrimidines with 2'OMe sugar at positions (5 '> 3') 4, 11, 13, and 17, possibly , A 2'-5 'ribonucleotide at position 9 or 10, a C3Pi or C3OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense chain (SEQ ID NO: 168) is selected from the antisense chain, which includes:

a) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 8 and 15, 2'5 'ribonucleotide at position 6 or 7; a protruding end of a C3Pi-C3OH covalently bonded to the 3'-end; or

b) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 4, 8, 13 and 15, 2'5 'ribonucleotides at position 6 or 7; a protruding end of a C3Pi-C3OH covalently bonded to the 3'-end; or

c) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1,4, 8, 11 and 15, 2'5 'ribonucleotides at position 6; a protruding end of a C3Pi-C3OH covalently bonded to the 3'-end; or

d) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 8, 12, 13 and 15; 2'5 'ribonucleotide at position 6; C3Pi-C3OH group covalently attached to the 3'-end.

[0107] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 101) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 11, 13 and 17, possibly 2'- A 5 'ribonucleotide at position 9, a C3-OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense strand (SEQ ID NO: 168) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') of 1, 8 and 15, 2'5 'of the ribonucleotide at position 6; C3Pi-C3OH group covalently attached to the 3'-end.

[0108] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 101) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 11, 13 and 17, possibly 2'- A 5 'ribonucleotide at position 9, a C3-OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense strand (SEQ ID NO: 168) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') of 1, 4, 8, 13 and 15, 2'5 'of the ribonucleotide at position 6; C3Pi-C3OH group covalently attached to the 3'-end.

[0109] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 101) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 11, 13 and 17, 2'-5 ' a ribonucleotide at position 9, a C3OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense strand (SEQ ID NO: 168) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') of 1, 4, 8, 11 and 15, 2'5 'of the ribonucleotide at position 6; C3Pi-C3OH group covalently attached to the 3'-end.

[0110] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 101) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 11, 13 and 17, 2'-5 ' a ribonucleotide at position 9, a C3OH non-nucleotide group covalently linked to the 3′-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5′-end; and the antisense strand (SEQ ID NO: 168) includes modified ribonucleotides with 2′OMe sugar at positions (5 ′> 3 ′) 1, 3, 8, 12, 13 and 15; 2′5 ′ ribonucleotide at position 6; C3Pi-C3OH group covalently linked to the 3′-end.

[0111] In some embodiments, the double-stranded nucleic acid molecule comprises an antisense strand shown in SEQ ID NO: 172 and a sense strand shown in SEQ ID NO: 105; designated in the present description as SERPINH1_51a. In some embodiments, said duplex comprises a structure

on which "|" refers to the base pairing between ribonucleotides;

in which A, C, G, U independently represent an unmodified or modified ribonucleotide or an unconventional group;

on which Ζ and Z ′ may be independently present or absent, but, if present independently, represent 1-5 consecutive nucleotides or non-nucleotide groups, or a combination thereof, covalently linked to the 3′-end of the chain in which they are located; and

on which z ′ ′ may be present or absent, but if present, is a blocking group covalently linked to the 5′-end of N2- (N ′) y.

[0112] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 105) comprises modified pyrimidines with 2′OMe sugar, possibly a 2′-5 ′ ribonucleotide at position 9 or 10; a nucleotide or a non-nucleotide group covalently linked to the 3′-end, and possibly a blocking group covalently linked to the 5′-end. In some embodiments, the antisense strand (SEQ ID NO: 172) includes modified pyrimidine and / or purines with 2′OMe sugar, a 2′-5 ′ nucleotide at position 5, 6, 7, or 8 (5 ′> 3 ′); and

a nucleotide or non-nucleotide group covalently linked to the 3'-end.

[0113] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 105) includes modified pyrimidines with 2'OMe sugar at positions (5 '> 3') 4, 11, 13, and 17, possibly , A 2'-5 'ribonucleotide at position 9 or 10, a C3Pi or C3OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense chain (SEQ ID NO: 172) is selected from an antisense chain that includes

a) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 8 and 15, 2'5 'ribonucleotide at position 6 or 7; A C3Pi-C3OH group covalently attached to the 3'-end; or

b) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 8, 13 and 15, 2'5 'ribonucleotides at position 6 or 7; A C3Pi-C3OH group covalently attached to the 3'-end; or

c) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 8, 11 and 15, 2'5 'ribonucleotides at position 6; A C3Pi-C3OH group covalently attached to the 3'-end; or

d) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 8, 12, 13 and 15; 2'5 'ribonucleotide at position 6; C3Pi-C3OH group covalently attached to the 3'-end.

[0114] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 105) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 11, 13 and 17, possibly 2'- A 5 'ribonucleotide at position 9, a C3-OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense chain (SEQ ID NO: 172) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 8 and 15, 2'5 'ribonucleotide at position 6; C3Pi-C3OH group covalently attached to the 3'-end.

[0115] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 105) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 11, 13 and 17, possibly 2'- 5'ribonucleotide at position 9, a C3-OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense strand (SEQ ID NO: 172) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 8, 13 and 15, 2'5 'ribonucleotide at position 6; and a C3P1-C3OH group covalently attached to the 3'-end.

[0116] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 105) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 11, 13 and 17, 2'-5 ' a ribonucleotide at position 9, a C3-OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense chain (SEQ ID NO: 172) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 8, 11 and 15, 2'5 'ribonucleotide at position 6; C3Pi-C3OH group covalently attached to the 3'-end.

[0117] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 105) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 11, 13 and 17, 2'-5 ' a ribonucleotide at position 9, a C3OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense strand (SEQ ID NO: 172) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 8, 12, 13 and 15; 2'5 'ribonucleotide position 6; C3Pi-C3OH group covalently attached to the 3'-end.

[0118] In some embodiments, the antisense and sense strands are selected from the pairs of oligonucleotides shown in Table A-19 and designated as SERPINH1_4 (SEQ ID NOS: 195 and 220) and SERPINH1_12 (SEQ ID NOS: 196H221).

[0119] In some embodiments, the double-stranded nucleic acid molecule comprises an antisense strand shown in SEQ ID NO: 220 and a sense strand shown in SEQ ID NO: 194; designated in the present description as SERPINH1_4. In some embodiments, a double stranded nucleic acid molecule has the structure

5' AAUAGCACCCAUGUGUCUC-Z 3 ' (antisense SEQ ID NO: 220) |||||||||||||||||||| 3 'Z'- UUAUCGUGGGUACACAGAG-z " 5' (semantic SEQ ID NO: 195)

on which "|" refers to the base pairing between ribonucleotides;

in which A, C, G, U independently represent an unmodified or modified ribonucleotide or an unconventional group;

on which Z and Z 'may be independently present or absent, but if present, are independently 1-5 consecutive nucleotides or non-nucleotide groups or a combination thereof, covalently linked to the 3'-end of the chain in which they are located; and

on which z "may or may not be present, but if present, is a blocking group covalently attached to the 5'-end of N2- (N ') y.

[0120] In some embodiments, a double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 220) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 15 , 17 and 19, a 2'-5 'ribonucleotide at position 7, and a C3P1-C3OH group covalently linked to the 3'-end; and the sense chain (SEQ ID NO: 195) is selected from the sense chain, which includes:

a) 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19, a C3OH group covalently linked to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; or

b) 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19, the 3'-terminal phosphate; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; or

c) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 5, 7, 13 and 16; 2'5 'ribonucleotide at position 18; C3OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; or

d) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 7, 13, 16 and 18; 2'5 'ribonucleotide at position 9; C3OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; or

d) 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: a C3Pi group covalently linked to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0121] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 220) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 15, 17, 19 , A 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 195) includes 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: a C3 group covalently linked to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0122] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 220) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 15, 17, 19 , A 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 195) includes 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: 3'-terminal phosphate; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0123] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 220) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 15, 17, 19 , A 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 195) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 5, 7, 13 and 16; 2'-5 'ribonucleotide at position 18; C3OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0124] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 220) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 15, 17, 19 , A 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 195) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 7, 13, 16 and 18; 2'-5 'ribonucleotide at position 9; C3OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0125] A double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 220) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 15, 17, 19 , A 2'-5 'ribonucleotide at position 7 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 195) includes 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: a C3Pi group covalently linked to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0126] In some embodiments, a double-stranded nucleic acid molecule is provided in which the antisense strand (SEQ ID NO: 220) comprises modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11 , 13, 15, 17, 19 and a C3Pi-C3OH group covalently linked to the 3'-end; and the sense strand (SEQ ID NO: 195) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 7, 9, 13, 16 and 18; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end.

[0127] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 195) includes 2'-5 'ribonucleotides at positions 15, 16, 17, 18 and 19: a 3'-terminal phosphate and inverted a non-base deoxyribonucleotide group covalently attached to the 5'-end, and the antisense chain (SEQ ID NO: 220) includes an antisense chain selected from one of the following:

a) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 7, 9, 11, 13, 15, 17, 19 and the C3Pi-C3OH group covalently linked to the 3'-end; or

b) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 6, 8, 10, 12, 14, 17, 18 and the C3Pi-C3OH group covalently linked to the 3'-end.

[0128] In some embodiments, a double-stranded nucleic acid molecule is provided that includes an antisense strand shown in SEQ ID NO: 130 and a sense strand presented in SEQ ID NO: 63; designated in the present description as SERPINH1_12. In some embodiments, said double helix comprises a structure

5' AACUCGUCUCGCAUCUUGU-Z 3 ' (antisense SEQ ID NO: 221) |||||||||||||||||||| 3 'Z'- UUGAGCAGAGCGUAGAACA-z " 5' (semantic SEQ ID NO: 196)

in which "|" refers to the base pairing between ribonucleotides;

in which A, C, G, U independently from each other represent an unmodified or modified ribonucleotide or non-traditional group;

in which Z and Z 'may be independently present or absent, but if independently present, are 1-5 consecutive nucleotides or non-nucleotide groups or a combination thereof, covalently linked to the 3'-end of the chain in which they are located; and

in which z "may be present or absent, but if present, is a blocking group covalently attached to the 5'-end of N2- (N ') y.

[0129] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 196) includes one or more modified pyrimidines with 2'OMe sugar; a nucleotide or non-nucleotide protruding 3 ′ end; and a blocking group covalently linked to the 5'-end. In some embodiments, the antisense chain (SEQ ID NO: 221) includes one or more modified pyrimidines with 2'OMe sugar, a nucleotide or a non-nucleotide group covalently linked to the 3'-end, and a blocking group covalently linked to 5'- end.

[0130] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 196) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 14, and 18; C3OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense chain (SEQ ID NO: 221) is selected from an antisense chain that includes

a) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 13, 15 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end; or

b) modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 7, 9, 12, 13 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end.

[0131] In some embodiments, a double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 196) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 14, and 18; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense strand (SEQ ID NO: 221) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 9, 11, 13, 15 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end.

[0132] In some embodiments, an oligonucleotide duplex molecule is provided in which the sense strand (SEQ ID NO: 196) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 14 and 18 and possibly at position 2 ; A C3-OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense strand (SEQ ID NO: 221) includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 3, 5, 7, 9, 12, 13 and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3'-end.

[0133] In certain embodiments, an oligonucleotide duplex molecule is provided in which the sense strand (SEQ ID NO: 196) includes modified ribonucleotides with 2′OMe sugar at positions (5 ′> 3 ′) 14 and 18; A C3-OH group covalently linked to the 3′-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5′-end; and the antisense chain (SEQ ID NO: 221) is selected from an antisense chain that includes:

a) modified ribonucleotides with 2′OMe sugar at positions (5 ′> 3 ′) 3, 5, 9, 11, 13, 15 and 17; 2′-5 ′ ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3′-end; or

b) modified ribonucleotides with 2′OMe sugar at positions (5 ′> 3 ′) 3, 5, 7, 9, 12, 13 and 17; 2′-5 ′ ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3′-end.

[0134] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 196) includes modified ribonucleotides with 2′OMe sugar at positions (5 ′> 3 ′) 14 and 18; A C3-OH group covalently linked to the 3′-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5′-end; and the antisense chain (SEQ ID NO: 221) includes modified ribonucleotides with 2′OMe sugar at positions (5 ′> 3 ′) 1, 3, 5, 9, 11, 13, 15, and 17; 2′-5 ′ ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3′-end.

[0135] A double-stranded nucleic acid molecule is provided in which the sense strand (SEQ ID NO: 196) comprises modified ribonucleotides with 2′OMe sugar at positions (5 ′> 3 ′) 14 and 18; A C3-OH group covalently linked to the 3′-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5′-end; and the antisense strand (SEQ ID NO: 221) includes modified ribonucleotides with 2′OMe sugar at positions (5 ′> 3 ′) 1, 3, 5,7, 9, 12, 13 and 17; 2′-5 ′ ribonucleotide at position 7; and a C3Pi-C3OH group covalently linked to the 3′-end.

[0136] According to other embodiments of Structures A1 and A2 (N ′), y comprises 1-8 modified nucleotides, wherein the modified ribonucleotide is a DNA nucleotide. In some embodiments, (N ′) y includes 1, 2, 3, 4, 5, 6, 7, or up to 8 DNA groups.

[0137] In some embodiments, Z or Z ′ is present and independently includes two non-nucleotide groups.

[0138] According to further embodiments, Z and Z 'are present and each of them independently includes two non-nucleotide groups.

[0139] In some embodiments, each of Z and Z ′ includes a baseless group, for example, a baseless deoxyribose group (denoted as “dAb”) or a baseless ribose group (denoted as “rAb”). In some embodiments, each of Z and / or Z ′ includes two covalently linked groups lacking a base and is, for example, dAb-dAb or rAb-rAb or dAb-rAb or rAb-dAb, where each covalento group is attached to an adjacent group, preferably with a phosphorus bond. In some embodiments, the phosphorus bond includes a phosphothioate, phosphonoacetate, or phosphodiester bond. In preferred embodiments, the phosphorus bond comprises a phosphodiester bond.

[0140] In some embodiments, each of Z and / or Z 'independently of each other includes an alkyl group, optionally a propane group [(CH2) 3] (C3) or a derivative thereof, including propanol (C3-OH) and phosphorus derivatives propanediol ("C3-3'Pi"). In some embodiments, each of Z and / or Z ′ includes two alkyl groups covalently linked to the 3 ′ end of the antisense chain or sense chain via a phosphodiester or phosphothioate bond, and covalently linked to each other via a phosphodiester or phosphothioate bond, and in some examples are C3Pi-C3Pi or C3Pi-C3OH. The 3'-end of the antisense chain and / or the 3'-end of the sense chain is covalento linked to the C3 group via phosphorus bond, and the C3 group is covalently conjugated to the C3-OH group via phosphorus bond. In some embodiments, phosphorus bonds include a phosphodiester, phosphonoacetate, or phosphodiester bond. In preferred embodiments, the phosphorus bond comprises a phosphodiester bond.

[0141] According to various embodiments, Structures A1 or Structures A2, Z and Z 'are absent. In other embodiments, each of Z and / or Z ′ is present. In some embodiments, each of Z and / or Z ′ independently of each other includes a C2, C3, C4, C5 or C6 alkyl group, optionally a C3 [propane, - (CH2) ₃ -] group or derivative thereof, including propanol ( C3-OH / C3OH), propanediol, and the phosphodiester derivative of propanediol ("C3Pi"). In preferred embodiments, each of Z and / or Z ′ comprises two hydrocarbon groups and in some examples is C3P1-C3OH or C3Pi-C3Pi. Each C3 is covalently bonded to an adjacent C3 via a covalent bond, preferably a phosphorus bond. In some embodiments, phosphorus bonds include a phosphodiester, phosphonoacetate, or phosphodiester bond.

[0142] In certain embodiments, x = y = 19, and Z comprises a protruding end with at least one C3 alkyl. In some embodiments, the protruding end of C3-C3 is covalently bonded to the 3'-end of (N) x or (N ') y via a covalent bond, preferably a phosphodiester bond. In some embodiments, the bond between the first C3 and the second C3 is a phosphodiester bond. In some embodiments, the non-nucleotide protruding 3 ′ end is a C3Pi-C3Pi. In some embodiments, the non-nucleotide protruding 3 ′ end is C3Pi-C3Ps. In some embodiments, the non-nucleotide protruding 3'-end is C3Pi-C3OH (OH is hydroxyl). In some embodiments, the non-nucleotide protruding 3 ′ end is a C3Pi-C3OH.

[0143] According to various embodiments, the alkyl group contains an alkyl derivative, including C3 alkyl, C4 alkyl, C5 alkyl or C6 alkyl group containing a terminal hydroxy, amino or phosphate group. In some embodiments, the alkyl group is a derivative of a C3 alkyl or C3 alkyl group. In some embodiments, the C3 alkyl group contains propanol, propyl phosphate, propyl phosphothioate, or a combination thereof. The C3 alkyl group is connected to the 3'-end (N ') y and / or 3'-end (N) x via a phosphodiester bond. In some embodiments, the alkyl group contains propanol, propyl phosphate or propyl phosphothioate. In some embodiments, each of Z and Z ′ is independently selected from propanol, propyl phosphate, propyl phosphothioate, combinations thereof, or multiple thereof, in particular 2 or 3 covalently attached propanol, propyl phosphate, propyl phosphothioate, or combinations thereof. In some embodiments, each of Z and Z ′ is independently selected from propyl phosphate, propyl phosphothioate, propyl phosphopropanol; propyl phospho-propyl phosphothioate; propylphospho-propyl phosphate; (propyl phosphate) ₃ , (propyl phosphate) _2- propanol, (propyl phosphate) _2- propyl phosphothioate. Any group conjugated to propane or propanol may be included in Z or Z ′.

[0144] Examples of structures of examples of 3'-terminal non-nucleotide groups are given below:

[0145] In some embodiments, each of Z and Z ′ is independently selected from propanol, propyl phosphate, propyl phosphothioate, combinations thereof, or multiples thereof.

[0146] In some embodiments, each of Z and Z ′ is independently selected from propyl phosphate, propyl phosphothioate, propyl phosphopropanol; propyl phospho-propyl phosphothioate; propylphospho-propyl phosphate; (propyl phosphate) 3, (propyl phosphate) 2-propanol, (propyl phosphate) 2-propyl phosphothioate. Any group conjugated to propane or propanol may be included in Z or Z ′.

[0147] In further embodiments, each of Z and / or Z 'includes a combination of a baseless group and an unmodified deoxyribonucleotide or ribonucleotide, or a combination of a carbohydrate group and an unmodified deoxyribonucleotide or ribonucleotide, or a combination of a baseless group (deoxyribo or ribo) and a carbohydrate group. According to such embodiments, each of Z and / or Z ′ includes C3-rAb or C3-dAb, each group being covalently linked to the adjacent group via a phosphor bond, preferably a phosphodiester, phosphotioate or phosphothioacetate bond.

[0148] In some embodiments, the nucleic acid molecules of the present disclosure include a sense oligonucleotide sequence selected from any of the oligonucleotides numbered 2-67 or 68-92 shown below in Tables A-18 and A-19, respectively.

[0149] According to some preferred embodiments, the compounds provided herein include Compound_1, Compound_2, Compound_3, Compound_4, Compound_5, Compound_6, Compound_7, Compound_8 and Compound_9 as described herein.

[0150] In certain embodiments (such as, for example, Compound_1, Compound_5 and Compound_6 as described herein), 19 dimensional double stranded nucleic acid molecules are provided in which the antisense strand is SEQ ID NO: 127 and the sense strand is SEQ ID NO : 60. In certain embodiments, 19 dimensional double-stranded nucleic acid molecules are provided in which the antisense strand is SEQ ID NO: 127 and includes modified ribonucleotides with 2'OMe sugar, 2'-5 'ribonucleotide in at least one of positions 1, 5 , 6 or 7, and a 3'-terminal non-nucleotide group covalently linked to the 3'-end; and the sense strand is SEQ ID NO: 60 and includes at least one 2'5 'ribonucleotide or modified ribonucleotide with 2'OMe sugar, a non-nucleotide group covalently linked to the 3'-end, and a blocking group covalently linked to 5'-end. In some embodiments, a 19-dimensional double-stranded nucleic acid molecule is provided in which the antisense strand is SEQ ID NO: 127 and includes modified ribonucleotides with 2'OMe sugar at positions 3, 5, 9, 11, 13, 15, 17, and 19 (5 '> 3'), a 2'-5 'ribonucleotide at position 7, and the 3'-terminal C3OH non-nucleotide group covalently linked to the 3'-end; and the sense strand is SEQ ID NO: 60 and includes 5 consecutive 2'5 'ribonucleotides at the 3'-terminal positions 15, 16, 17, 18 and 19 (5'> 3 '), a C3Pi non-nucleotide group covalently linked with a 3'-end, and an inverted group without a base covalently attached to the 5'-end.

[0151] In one embodiment, Compound_1 is provided, which is a 19 dimensional double stranded nucleic acid molecule in which the antisense strand is SEQ ID NO: 127 and includes modified ribonucleotides with 2'OMe sugar at positions 3, 5, 9, 11, 13, 15, 17 and 19 (5 '> 3'), a 2'-5 'ribonucleotide at position 7, and a C3Pi-C3OH non-nucleotide group covalently linked to the 3'-end; and the sense strand is SEQ ID NO: 60 and includes 5 consecutive 2'5 'ribonucleotides at the 3'-terminal positions 15, 16, 17, 18 and 19 (5'> 3 '), a C3Pi non-nucleotide group covalently linked with a 3'-end, and an inveted group without a base covalently linked to the 5'-end; and which also includes a modified ribonucleotide with 2'OMe sugar at position 1 of the antisense chain.

[0152] In one embodiment, Compound_6 is provided, which is a 19 dimensional double stranded nucleic acid molecule in which the antisense strand is SEQ ID NO: 127 and includes modified ribonucleotides with 2'OMe sugar at positions 3, 5, 9, 11 , 13, 15, 17 and 19 (5 '> 3'), a 2'-5 'ribonucleotide at position 7, and a C3Pi-C3OH non-nucleotide group covalently linked to the 3'-end; and the sense strand is SEQ ID NO: 60 and includes 5 consecutive 2'5 'ribonucleotides at the 3'-terminal positions 15, 16, 17, 18 and 19 (5'> 3 '), a C3Pi non-nucleotide group covalently linked with a 3'-end, and an inverted group without a base covalently linked to the 5'-end; and which also includes a 2'5 'ribonucleotide at position 1 of the antisense strand.

[0153] In one embodiment, Compound_5 is provided, which is a 19 dimensional double stranded nucleic acid molecule in which the antisense strand is SEQ ID NO: 127 and includes modified ribonucleotides with 2'OMe sugar at positions 1, 3, 5, 9, 11, 13, 15, 17 and 19 (5 '> 3'), a 2'-5 'ribonucleotide at position 7, and a C3P1-C3OH non-nucleotide group covalently linked to the 3'-end; and the sense strand is SEQ ID NO: 60 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 7, 13, 16 and 18, 2'5 'ribonucleotide at position 9, C3OH is not a nucleotide group covalently bonded to the 3'-end, and an inverted group without a base covalently bonded to the 5'-end.

[0154] In certain embodiments (such as, for example, Compound_2 and Compound_7 as described herein), 19 dimensional double stranded nucleic acid molecules are provided in which the sense strand is SEQ ID NO: 63 and the antisense strand is SEQ ID NO: 130 . In some embodiments, 19-dimensional double-stranded nucleic acid molecules are provided in which the sense strand is SEQ ID NO: 63 and includes modified pyrimidine ribonucleotides with 2'OMe sugar; a non-nucleotide group covalently linked to the 3'-end; and a blocking group covalently attached to the 5'-end; and the antisense strand is SEQ ID NO: 130 and includes modified ribonucleotides with 2'OMe sugar; 2'-5 'ribonucleotide at position 7; and a non-nucleotide group covalently linked to the 3'-end. In certain embodiments, 19-dimensional double-stranded nucleic acid molecules are provided in which the sense strand is SEQ ID NO: 63 and includes modified ribonucleotides with 2'OMe sugar, a non-nucleotide group covalently linked to the 3'-end, and a blocking group covalently attached to the 5'-end; and the antisense strand is SEQ ID NO: 130 and includes modified ribonucleotides with 2'OMe sugar; 2'-5 'ribonucleotide in at least one of positions 5, 6 or 7; and a non-nucleotide group covalently linked to the 3'-end.

[0155] In one embodiment, Compound_2 is provided, which is a 19 dimensional double stranded nucleic acid molecule in which the sense strand is SEQ ID NO: 63 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 14 and 18; C3OH group covalently attached to the 3'-end; and a deoxyribonucleotide group inverted without a base covalently attached to the 5'-end; and the antisense chain is SEQ ID NO: 130 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 12, 13, and 17; 2'-5 'ribonucleotide in at least one of positions 5, 6 or 7; and a C3Pi-C3OH non-nucleotide group covalently linked to the 3'-end.

[0156] In one embodiment, Compound_7 is provided, which is a 19 dimensional double stranded nucleic acid molecule in which the sense strand is SEQ ID NO: 63 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 14 and 18; C3OH group covalently attached to the 3'-end; and an inverted deoxyribonucleotide group without a base covalently attached to the 5'-end; and the antisense chain is SEQ ID NO: 130 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 1, 3, 5, 9, 11, 13, and 17; 2'-5 'ribonucleotide at position 7; and a C3Pi-C3OH non-nucleotide group covalently linked to the 3'-end.

[0157] In some embodiments (such as, for example, Compound_3 as described herein), 19 dimensional double stranded nucleic acid molecules are provided in which the sense strand is SEQ ID NO: 98 and the antisense strand is SEQ ID NO: 165. In some embodiments, 19-dimensional double-stranded nucleic acid molecules are provided in which the sense strand is SEQ ID NO: 98 and includes 2'-5 'ribonucleotides at positions at the 3'-end: a non-nucleotide group covalently linked to 3'- an end and a blocking group covalently linked to the 5'-end; and the antisense strand is SEQ ID NO: 165 and includes modified ribonucleotides with 2'OMe sugar; 2'-5 'ribonucleotide in at least one of positions 5, 6 or 7 and a non-nucleotide group covalently linked to the 3'-end. According to one embodiment, Compound_3 is provided, which is a 19 dimensional double stranded nucleic acid molecule in which the sense strand is SEQ ID NO: 98 and includes 2'-5 'ribonucleotides at positions (5'> 3 ') 15, 16, 17, 18 and 19: a C3-OH 3 ′ group covalently linked to the 3′-end and an inverted deoxyribonucleotide group without a base covalently linked to the 5′-end; and the antisense chain is SEQ ID NO: 165 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '>3') 2, 4, 6, 8, 11, 13, 15, 17 and 19; 2'-5 ¹ ribonucleotide at position 7 and C3Pi-C3OH covalently linked to the 3'-end.

[0158] In some embodiments (such as, for example, Compound_4, Compound_8 and Compound_9 as described herein), 19 dimensional double stranded nucleic acid molecules are provided in which the sense strand is SEQ ID NO: 101 and the antisense strand is SEQ ID NO : 168. In certain embodiments, 19-dimensional double-stranded nucleic acid molecules are provided in which the sense strand is SEQ ID NO: 101 and includes modified pyrimidine ribonucleotides with 2'OMe sugar and optionally 2'-5 'ribonucleotide in one of positions 9 or 10, a non-nucleotide group covalently linked to the 3'-end and a blocking group covalently linked to the 5'-end; and the antisense strand is SEQ ID NO: 168 and includes modified ribonucleotides with 2'OMe sugar, 2'5 'ribonucleotide in at least one of positions 5, 6 or 7; and a non-nucleotide group covalently linked to the 3'-end.

[0159] In one embodiment, Compound_4 is provided, which is a 19 dimensional double stranded nucleic acid molecule in which the sense strand is SEQ ID NO: 101 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4 , 11, 13, and 17, 2'-5 'ribonucleotide at position 9, C3OH is a non-nucleotide group covalently linked to the 3'-end, and a base inverted deoxyribonucleotide group covalently linked to the 5'-end; and the antisense strand is SEQ ID NO: 168 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') of 1, 4, 8, 11 and 15, 2'5 'of the ribonucleotide at position 6; a C3Pi-C3OH group forming a protruding end covalently attached to the 3'-end.

[0160] In one embodiment, Compound_8 is provided, which is a 19 dimensional double stranded nucleic acid molecule in which the sense strand is SEQ ID NO: 101 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 4, 11, 13 and 17, a C3OH non-nucleotide group covalently linked to the 3'-end and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense chain is SEQ ID NO: 168 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') of 1, 4, 8, 13 and 15, 2'5 'of the ribonucleotide at position 6; and a C3Pi-C3OH group forming a protruding end covalently bonded to the 3'-end.

[0161] In one embodiment, Compound_9 is provided, which is a 19 dimensional double stranded nucleic acid molecule in which the sense strand is SEQ ID NO: 101 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') 2, 4, 11, 13 and 17, a C3OH non-nucleotide group covalently linked to the 3'-end, and an inverted deoxyribonucleotide group without a base covalently linked to the 5'-end; and the antisense strand is SEQ ID NO: 168 and includes modified ribonucleotides with 2'OMe sugar at positions (5 '> 3') of 1, 4, 8, 11 and 15, 2'5 'of the ribonucleotide at position 6; a non-nucleotide group C3Pi-C3OH covalently attached to the 3'-end.

[0162] According to another aspect, methods are provided for reducing the expression of hsp47 in a cell by introducing into the cell a nucleic acid molecule as described herein in an amount sufficient to reduce the expression of hsp47. In one embodiment, the cell is a stellate liver cell. According to another embodiment, the cell is a stellate cell of kidney or lung tissue. In some embodiments, the methods are carried out in vitro; in other embodiments, the method is carried out in vivo.

[0163] According to another aspect, methods are provided for treating a patient suffering from a disease caused by hsp47. The methods include administering to the patient a nucleic acid molecule, for example, as described herein, in an amount sufficient to reduce the expression of hsp47. In some embodiments, the disease caused by hsp47 is a disease selected from the group consisting of liver fibrosis, cirrhosis, pulmonary fibrosis, including pulmonary fibrosis (including ILP), any condition that causes kidney fibrosis (for example, CKD, including ESRD) , peritoneal fibrosis, chronic liver damage, fibrillogenesis, fibrotic diseases in other organs, abnormal scarring (keloid scars) associated with all possible types of skin injury: in an accident and iatrogen E (surgery); scleroderma, cardiomyrosis, unsuccessful outcome of filtering surgery for glaucoma and intestinal adhesions. In some embodiments, the compound can be used to treat organ diseases, for example, indications, including those presented in Table 2 below:

table 2 Organ 3 diseases Leather Pathological scars, for example, keloid and hypertrophic scars Surgical scars Keloid scars after injuries or nephrogenic fibrosing dermopathy Peritoneum Peritoneal sclerosis Commissures Peritoneal sclerosis caused by chronic peritoneal dialysis on an outpatient basis (CAPD) Liver Cirrhosis, including cirrhosis due to hepatitis C, primary biliary cirrhosis Liver fibrosis, for example, prevention of liver fibrosis in carriers of hepatitis C schistosomiasis cholangitis Liver cirrhosis caused by Hepatitis C after liver transplantation or non-alcoholic steatohepatitis (NASH) Pancreas Inter (peri) lobular fibrosis (for example, in the case of alcoholic chronic pancreatitis), periductal fibrosis (for example, in the case of hereditary pancreatitis), periductal and interlobular fibrosis (for example, in the case of autoimmune pancreatitis), diffuse inter- and intralobular fibrosis (for example, for obstructive chronic pancreatitis) Kidney Chronic kidney disease (CKD) of any etiology. Treatment of early stage of CKD (elevated levels of CK) in patients with diabetes (“prevents” further renal impairment) Renal fibrosis caused by glomerulosclerosis in lupus Diabetic Nephropathy Heart Congestive heart failure Endomyocardial fibrosis, cardiofibrosis fibrosis associated with myocardial infarction

Lungs Asthma, idiopathic pulmonary fibrosis (IFL); Interstitial Pulmonary Fibrosis (ILF) Radiation pneumonitis causing pulmonary fibrosis (e.g. due to radiation therapy for cancer) Bone marrow Myeloproliferative diseases: myelofibrosis (MF), Osler’s disease (PV), idiopathic thrombocythemia (IT) idiopathic myelofibrosis caused by drugs myelofibrosis. Eyes Anterior segment: clouding of the cornea, for example, as a result of hereditary dystrophy, herpetic keratitis or pterygium; Glaucoma Back segment: fibrosis and tractional retinal detachment. progressive diabetic retinopathy (DR); fibrovascular scarring and gliosis in the retina; Under the retina, fibrosis, for example, after subretinal hemorrhage, associated with neovascular AMD Retroorbital fibrosis, after cataract surgery, proliferative vitreoretinopathy. Pemphigus eye Intestines Intestinal fibrosis, Crohn's disease Vocal cords Scarring of the vocal cords, fibrosis of the mucous membrane of the vocal cords, fibrosis of the larynx Vascular system Atherosclerosis, restenosis of arteries after angioplasty Multisystem Scleroderma, systemic sclerosis; multiple fibrosclerosis; sclerodermatosis graft-versus-host disease in bone marrow transplant recipients, and nephrogenic systemic fibrosis (under the influence of contrast agents based on gadolinium (OVSA), 30% MRI) Malignant formations of various origin Metastatic and invasive cancer as a result of suppression of the function of activated tumor myofibroblasts

[0164] In some embodiments, preferred indications include hepatitis C cirrhosis after liver transplantation; cirrhosis due to non-alcoholic steatohepatitis (NASH); idiopathic pulmonary fibrosis; radiation pneumonitis causing pulmonary fibrosis; diabetic nephropathy; peritoneal sclerosis caused by chronic peritoneal dialysis on an outpatient basis (CAPD), and pemphigus.

[0165] Fibrotic liver diseases include alcoholic cirrhosis, cirrhosis caused by hepatitis B, cirrhosis caused by hepatitis C, cirrhosis caused by hepatitis C (Hep C) after orthopic liver transplantation (OLTX), NASH / NLBP, primary biliary cirrhosis (PBC) primary sclerosing cholangitis (PSC), bile duct atresia, alpha 1-antitrypsin deficiency (A1AD), copper accumulation diseases (Wilson's disease), fructosemia, galactosemia, glycogen accumulation diseases (in particular, types III, IV, VI, IX and X ), iron overload syndromes (hemochromatosis), naru eniya lipid metabolism (e.g., Gaucher's disease), peroxisomal disease (e.g., Zellweger syndrome), tyrosinemia, congenital hepatic fibrosis, bacterial infection (e.g., brucellosis), parasitic (echinococcosis), Budd-Chiari's disease (veno-occlusive disease of the liver).

[0166] Lung diseases include idiopathic pulmonary fibrosis, silicosis, pneumoconiosis, neonatal bronchopulmonary lysplasia after acute respiratory failure syndrome, lung damage due to bleomycin / chemical agents, bronchiolitis obliterans (OB) after lung transplantation, chronic obstructive pulmonary disease (COPD), cystic fibrosis, asthma.

[0167] Heart diseases include cardiomyopathy, atherosclerosis (Bergenra disease, etc.), endomyocardial fibrosis, atrial fibrillation, scarring after myocardial infarction (MI)

[0168] Other diseases of the thoracic region include radiation-induced tissue reaction capsules around structured breast implants and submucosal oral fibrosis.

[0169] Kidney diseases include autosomal dominant polycystic kidney disease (ADPP), diabetic nephropathy (diabetic glomerulosclerosis), FSHC (collapse versus other histologic options), IgA nephropathy (Berger's disease), lupus nephritis, osteochondritis tuberculodergobertobergnegerdegresserdeuberdegresserdeuberdegenera syndrome, osteochondritis obergoduberdegresserdegressergobertobergeneger syndrome, osteochondritis obergoduberdegressergloberdeuberger's syndrome, osteochondrodergobertobergressergobertobergnegerdegresserdeubergerdegeneraggerodergobertobergner syndrome, IgG nephritis, osteochondritis tuberculosis, : nephropathy caused by drugs (protective) penicillins, sergalosporins, analgesics, membrane-proliferative glomerulonephritis (MPHN), Shenlein-Genoch disease, congenital nephropathies: juvenile nephronophysis, hereditary onychoarthrosis and Alport syndrome.

[0170] Bone marrow diseases include lymphangioliomyomatosis (LAM), a chronic graft-versus-host reaction, polycythemia, idiopathic thrombocythemia, myelofibrosis.

[0171] Eye diseases include retinopathy, retrolental fibroplasia (RLF), pemphigus, lacrimal glandular fibrosis, retinal surgery, clouding of the cornea, herpetic keratitis, pterygium, glaucoma, age-related macular degeneration (VDM), retinopathy caused by diabetes mellitus (SD).

[0172] Gynecological diseases include endometriosis with hormone replacement therapy to prevent scarring, fibrosis / salpingitis after PPI.

[0173] Systemic diseases include Dupuytren’s syndrome, palmar aponeurosis, Peyronie’s disease, Ledrochosis disease, keloid scars, multiple fibrosclerosis, nephrogenic systemic fibrosis, nephrogenic myelofibrosis (anemia).

[0174] Fibrotic diseases caused by injuries include scarring and contracting of the skin and soft tissues as a result of burns (including chemical), radiation-induced scarring in the skin and organs after application of radiation in cancer therapy, keloid scars (skin).

[0175] Indications after surgery include peritoneal fibrosis due to peritoneal dialysis of the peritoneum, corneal implant, cochlear implant, other implants, silicone breast implants, chronic sinusitis; commissures, pseudo-optimal hyperplasia of dialysis transplants.

[0176] Other conditions include chronic pancreatitis.

[0177] In some embodiments, a method of treating a patient suffering from liver fibrosis is provided, comprising administering to the patient an effective amount of a nucleic acid molecule as described herein, thereby treating liver fibrosis. In some embodiments, the patient suffers from cirrhosis of the liver due to hepatitis. In some embodiments, the patient suffers from cirrhosis due to NASH.

[0178] In some embodiments, the use of a nucleic acid molecule as described herein for the manufacture of a medicament for the treatment of liver fibrosis is provided. In some embodiments, liver fibrosis is caused by hepatitis. In some embodiments, liver fibrosis is caused by NASH.

[0179] In some embodiments, a method for remodeling scar tissue is provided, comprising administering to a patient in need thereof an effective amount of a nucleic acid molecule as described herein, thereby affecting remodeling of scar tissue. In some embodiments, scar tissue is located in the liver. In some embodiments, the patient suffers from cirrhosis of the liver due to hepatitis. In some embodiments, the patient suffers from cirrhosis due to NASH.

[0180] In some embodiments, a method is provided for influencing a regression of fibrosis, comprising administering to a patient in need thereof an effective amount of a nucleic acid molecule as described herein, thereby affecting the regression of fibrosis.

[0181] In some embodiments, a method for reducing scar tissue in a patient is provided, comprising the step of administering to the patient an effective amount of a nucleic acid molecule as described herein to reduce scar tissue. In some embodiments, a method is provided for reducing scar tissue in a patient, comprising the step of topically applying an effective amount of a nucleic acid molecule to the scar tissue as described herein to reduce scar tissue.

[0182] According to some embodiments, a method for improving the appearance of scar tissue is provided, comprising the step of topically applying an effective amount of a nucleic acid molecule to the scar tissue as described herein to improve the appearance of scar tissue.

[0183] In some embodiments, a method is provided for treating a patient suffering from pulmonary fibrosis, comprising administering to the patient an effective amount of a nucleic acid molecule as described herein, thereby treating pulmonary fibrosis. In some embodiments, the patient suffers from interstitial pulmonary fibrosis (ILF). In some embodiments, the patient suffers from radiation pneumonitis causing pulmonary fibrosis. In some embodiments, the patient suffers from pulmonary fibrosis caused by drugs.

[0184] In some embodiments, the use of a nucleic acid molecule as described herein for the manufacture of a medicament for the treatment of pulmonary fibrosis is provided. In some embodiments, pulmonary fibrosis is an ILF. In some embodiments, pulmonary fibrosis is pulmonary fibrosis caused by drugs or radiation.

[0185] In one aspect, pharmaceutical compositions are provided that include a nucleic acid molecule (eg, an siNA molecule) as described herein in a pharmaceutically acceptable carrier. In some embodiments, the dosage form includes or comprises a delivery system suitable for delivering nucleic acid molecules (eg, siNA molecules) to a patient; examples of delivery systems are described in more detail below.

[0186] According to a related aspect, compositions or kits are provided that include a nucleic acid molecule (eg, siNA molecule) packaged for use by a patient. The package may have a label or include a place tag or package insert that indicates the contents of the package and gives specific information on how the patient should or can use the nucleic acid molecule (e.g., siNA molecule), for example, the label may contain dose and / or information indications for use. In some embodiments, the content of the label includes a message in a form prescribed by a government agency, for example. Food and Drug Administration. In some embodiments, the label may indicate which nucleic acid molecule (eg, siNA molecule) is suitable for use in treating a patient suffering from a disease associated with hsp47; for example, the label may indicate which nucleic acid molecule (eg, siNA molecule) is suitable for use in the treatment of fibrosis; or, for example, the label may indicate which nucleic acid molecule (e.g., siNA molecule) is suitable for use in treating a disease selected from the group consisting of fibrosis, liver fibrosis, cirrhosis, pulmonary fibrosis, kidney fibrosis, peritoneal fibrosis, chronic liver damage and fibrillogenesis.

[0187] As used herein, the terms “heat shock protein 47” or “hsp47” or “HSP47” are used interchangeably to mean any heat shock protein 47, peptide or polypeptide having any action of the hsp47 protein. Heat shock protein 47 is a serine protease inhibitor (serpin), also denoted by the term, for example, serpin peptidase inhibitor, clade H, 1 member (SERPINH1), SERPINH2, collagen binding protein 1 (CBP1), CBP2, gp46; arsenic-transactivated protein 3 (AsTP3); HSP47; proliferation 14 inducing gene (PIG14); PPROM rheumatoid arthritis antigen A-47 (RA-A47); colligin-1 and colligin-2. In some preferred embodiments, “hsp47” means human hsp47. The heat shock protein 47 (or more specifically, human hsp47) may have an amino acid sequence that matches or substantially matches SEQ ID NO. 2 (Figure 7).

[0188] As used herein, the term "nucleotide sequence encoding hsp47" refers to a nucleotide sequence that encodes a human hsp47 protein or part thereof. The term "hsp47 encoding nucleotide sequence" also includes hsp47 coding sequences, such as hsp47 isoforms, mutant hsp47 genes, variants obtained by splicing hsp47 genes, and hsp47 gene polymorphisms. The nucleic acid sequence encoding hsp47 includes mRNA sequences encoding hsp47, which are also referred to as the term "hsp47 mRNA". An example of a human hsp47 mRNA sequence is SEQ ID. NO one.

[0189] As used herein, the terms “nucleic acid molecule” or “nucleic acid” are used interchangeably to mean an oligonucleotide, nucleotide or polynucleotide. Variants of a “nucleic acid molecule” are described in more detail herein. A nucleic acid molecule includes both modified nucleic acid molecules and unmodified nucleic acid molecules as described herein. A nucleic acid molecule may include deoxyribonucleotides, ribonucleotides, modified nucleotides or nucleotide analogs in any combination.

[0190] In the present description, the term "nucleotide" means a chemical group containing sugar (or its analogue or modified sugar), a nucleic base (or its analogue or modified base), a phosphate group (or its analogue or modified phosphate group). A nucleotide includes both modified nucleotides and unmodified nucleotides as described herein. As used herein, nucleotides may include deoxyribonucleotides (e.g., unmodified deoxyribonucleotides), ribonucleotides (e.g., unmodified ribonucleotides) and analogs of modified nucleotides, including, but not limited to, closed nucleic acid, peptide nucleic acids, L-nucleotides (also referred to as mirror nucleotides) , ethylene bridge nucleic acids (ENA), arabinosides, PACE, nucleotides with 6-carbon sugar, and nucleotide analogs (including nucleotides lacking a base ni), which are often considered non-nucleotides. In some embodiments, the nucleotides can be modified at the sugar moiety, nucleic base and / or phosphate group using any modifications known in the art, for example, modifications as described herein. The terms "polynucleotide" or "oligonucleotide" in the present description denote a chain of linked nucleotides; polynucleotides and oligonucleotides may also have modifications in nucleotide sugar, nucleic bases and phosphate backbones, examples of which are well known in the art and / or are described herein.

[0191] As used herein, the terms “small interfering nucleic acid” or “siNA” or “small interfering nucleic acid molecule” mean any nucleic acid molecule capable of altering gene expression or replication of a virus. Preferably, siNA inhibits or reduces gene expression or viral replication. siNA includes, but is not limited to, nucleic acid molecules that can mediate sequence specific RNAs, for example, small interfering RNAs (siRNAs), double-stranded RNAs (dsRNA), micro-RNAs (miRNA), small hairpin RNAs (shRNA), small interfering oligonucleotide, small interfering nucleic acid, small interfering modified oligonucleotide, chemically modified siRNA, RNA post-transcriptional gene silencing (ptgsPHK) and others. As used herein, the term “small interfering nucleic acid”, “siNA” or “small interfering nucleic acid molecule” has the meaning that is described in more detail herein.

[0192] In the present description, the term "complementarity" means that a nucleic acid can form a hydrogen bond (s) with another nucleic acid sequence through traditional Watson-Crick bonds or other unconventional bonds. For nucleic acid molecules according to the present description, the free binding energy of the nucleic acid molecule with its complementary sequence is sufficient for the corresponding nucleic acid function to become, for example, RNAi activity. The determination of free binding energies for nucleic acid molecules is well known in the art (see, for example, Turner et al., 1987, CSH Symp. Quant. Biol. LII pp. 123-133; Frier et al., 1986, Proc. Nat. Acad. Sci. USA 83: 9373-9377; Turner et al., 1987, J. Am. Chem. Soc. 109: 3783-3785). The percentage of complementarity indicates the proportion of contiguous residues in the nucleic acid molecule that can form hydrogen bonds (for example, Watson-Crick base pairing) with a second nucleic acid sequence (for example, if 5, 6, 7, 8, 9, or 10 nucleotides of 10 nucleotides the first oligonucleotide mate with the bases of the second nucleic acid sequence having 10 nucleotides, which means 50%, 60%, 70%, 80%, 90% and 100% complementarity, respectively). “Complete complementarity” means that all adjacent residues of a nucleic acid sequence form hydrogen bonds with the same number of adjacent residues in a second nucleic acid sequence. In one embodiment, the nucleic acid molecule of the present disclosure includes from about 15 to about 35 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 , 29, 30, 31, 32, 33, 34 or 35) nucleotides that are complementary to one or more target nucleic acid molecules or parts thereof.

[0193] In the present description, the term "sense region" refers to the nucleotide sequence of a siNA molecule complementary to (partially or completely) the antisense region of a siNA molecule. The sense strand of a siNA molecule may include a nucleic acid sequence having homology with a target nucleic acid sequence. As used herein, “sense strand” means a nucleic acid molecule that includes a sense region and may also include additional nucleotides.

[0194] In the present description, the term "antisense region" refers to the nucleotide sequence of a siNA molecule complementary to (partially or completely) the target nucleic acid sequence. The antisense strand of a siNA molecule may in some cases include a nucleic acid sequence complementary to the sense region of a siNA molecule. As used herein, the term “antisense strand” means a nucleic acid molecule that includes an antisense region and may also include additional nucleotides.

[0195] In the present description, the term "RNA" means a molecule that includes at least one ribonucleotide residue.

[0196] As used herein, the term “duplex region” refers to a region in two complementary or substantially complementary oligonucleotides that form base pairs with each other, both by Watson-Crick base pairing, and in another manner in which duplex is formed between oligonucleotide chains that are complementary or substantially complementary. For example, an oligonucleotide having 21 nucleotides can form base pairs with another oligonucleotide of 21 nucleotides, with only 19 bases of each chain being complementary or substantially complementary, thus the “duplex region” consists of 19 base pairs. The remaining base pairs may, for example, exist in the form of 5 'and 3'-protruding ends. Also within the duplex area, 100% complementarity is not required; significant complementarity is allowed within the duplex area. Significant complementarity will indicate such complementarity between chains in which they can hybridize under biological conditions. Techniques for empirically determining the ability to hybridize two strands under biological conditions are well known in the art. Alternatively, chains can be synthesized and added and combined under biological conditions in order to determine whether they hybridize with each other.

[0197] As used herein, the term “non-pairing analog of a nucleotide” means a nucleoideid analog that includes a non-pairing group, including but not limited to: 6-desamino adenosine (nebularin), 4-Me-indole, 3-nitropyrrole, 5 nitroindole, Ds, Pa, N3-Me ribo U, N3-Me ribo T, N3-Me dC, N3-Me-dT, N1-Me-dG, N1-Me-dA, N3-ethyl-dC, N3- Me dC. In some embodiments, the non-pairing nucleotide analog is a ribonucleotide. In other embodiments, it is a deoxyribonucleotide.

[0198] In the present description, the term "terminal functional group" includes, but is not limited to, a group of halogen, alcohol, amine, carboxy, ester, amide, aldehyde, ketone, ether.

[0199] A “nucleotide without a base” or “an analog of a nucleotide without a base”, as used herein and in the art, may mean a pseudo-nucleotide or non-traditional group. Unlike a nucleotide, which is a monomeric unit of a nucleic acid, usually consisting of a sugar residue of ribose or deoxyribose, phosphate and a base (adenine, guanine, thymine or cytosine in DNA; adenine, guanine, uracil or cytosine in RNA), a nucleotide without base or pseudo-nucleotide missing base, and therefore it is not a nucleotide, in the sense in which the term is usually understood in the art. Unbased deoxyribose groups include, for example, baseless deoxyribose-3'-phosphate; 1,2-dideoxy-D-ribofuranose-3-phosphate; 1,4-anhydro-2-deoxy-D-ribitol-3-phosphate. Inverted deoxyribose groups without base include inverted deoxyribose without base; 3 ', 5' inverted deoxy-5'-phosphate without base.

[0200] The term "blocking group" (z ") in the present description includes a group that can be covalently linked to the 5'-end (N ') y, and includes a ribose group without a base, a deoxyribose group without a base, modifications of a ribose group without base and deoxyribose groups without base, including, 2'O alkyl modifications; inverted ribose groups without base and deoxyribose without base, and their modifications; C6-imino-Pi; mirror nucleotide, including L-DNA and L-PHK; 5'OMe nucleotide; and nucleotide analogs, including 4 ', 5'-methylene nucleotide; 1- (β-D-erythrofuranosi k) nucleotide; 4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate; 6-aminohexyl phosphate; 12-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexite nucleotide; alpha-nucleotide; threo-pentofuranosyl nucleotide; acyclic 3 ', 4'-nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5'-5'-inverted group without base; 1,4-butanediol phosphate; 5'-amino; and methylphosphonate and 5'-mercapto groups, whether or not bridged.

[0201] Known blocking groups can be ribose or deoxyribose without base; inverted ribose or deoxyribose groups without base; C6 amino Pi; mirror nucleotide, including L-DNA and L-PHK. Nucleic acid molecules as described herein can be synthesized using one or more inverted nucleotides, for example, inverted thymidine or inverted adenine (for example, see Takei, et al., 2002. JBC 277 (26): 23800-06).

[0202] The term "unconventional group" as used herein refers to non-nucleotide groups, including a baseless group, an inverted baseless group, a hydrocarbon group (alkyl) and derivatives thereof, and also includes a deoxyribonucleotide, a modified deoxyribonucleotide, a mirror nucleotide (L-DNA or L -PHK), a non-pairing nucleotide analog, and a nucleotide coupled to an adjacent nucleotide via a 2'-5 'internucleotide phosphate bond; bridged nucleic acids, LHK and nucleic acids connected by a bridge of ethylene, nucleotides with modified bonds (for example, PACE) and nucleotides with modified bases, as well as additional groups, referred to in the present description as non-traditional groups.

[0203] As used herein, the term “suppress”, “reduce” or “decrease” in relation to gene expression means that gene expression or level of RNA molecules or corresponding RNA molecules encoding one or more proteins or protein subunits (eg, mRNA) or the activity of one or more proteins or protein units is reduced below the level that is observed in the absence of an inhibitory factor (such as a nucleic acid molecule, for example, siNA, for example, having structural features according to the present description); for example, expression can be reduced by 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less than what is observed in the absence of an inhibitor.

BRIEF DESCRIPTION OF THE FIGURES

[0204] Figure 1 is a bar graph showing the effect of GFP siNAs on various reporter cell lines. Cell lines were obtained by injecting the human cDNA-GFP HSP47 cDNA-GFP or rat cPNA-GFP GP46 into HEK293, the human fibrosarcoma cell line HT1080, the human HSC line hTERT, or the NRK cell line. Anti-GFP negative control siNA or siNA was introduced into the cells and GFP fluorescence was measured. The results showed that anti-GFP siNA reduces fluorescence to varying degrees in different cell lines. The 293_HSP47-GFP and 293_GP46-GFP cell lines were selected for siHsp47 screening because of the ease with which they can be transfected and the sensitivity to decreased fluorescence.

[0205] Figure 2 is a set of bar graphs showing cytotoxicity and reduction efficacy of various siHsp47 in 293_HSP47-GFP and 293_GP46-GFP cell lines. The results showed that siHsp47-C, siHsp47-2 and siHsp47-2d effectively lower both human HSP47 and rat GP46 (human hsp47 homolog) without significant cytotoxicity. siGp46A against GP46 does not reduce human HSP47. Also behind the scenes, siHsp47s were superior to siGp46A in reducing rat GP46.

[0206] Figure 3 is a bar graph showing the effect of reducing various siHsp47s on hsp47 mRNA as measured by TaqMan® quantitative PCR using the hTERT human HSC cell line. The Y axis represents the residual hsp47 mRNA level. HSP47-C was the most effective among all hsp47 siNAs studied.

[0207] Figure 4 is a bar graph showing the effect of different hsp47 siNAs on the expression of collagen I in hTERT cells. Collagen I mRNA was determined by real-time quantitative PCR using a TaqMan® probe. The Y axis represents the residual mRNA level of collagen I expression. The result showed that the collagen I mRNA level is significantly reduced in cells treated with some candidates (siHsp47-2, siHsp47-2d and their combination with siHsp47-1).

[0208] Figure 5 shows a decrease in liver fibrosis area in animals treated with siHSP47.

[0209] Figure 6 shows an example of a human hsp47 mRNA cDNA nucleic acid sequence (SEQ ID NO: 1; based on the cDNA described under GenBank Accession Number: NM_001235).

[0210] Figure 7 shows an example of the amino acid sequence of a human hsp47 (SEQ ID NO: 2).

[0211] In Figure 8, is a nucleic acid sequence encoding a protein, human hsp47 cDNA (SEQ ID NO: 59), which corresponds to nucleotides 230-1486 of SEQ ID NO: 1.

[0212] Figures 9A-9I show the plasma stability of Compounds_1, Compounds_2, Compounds_3, Compounds_4, Compounds_5, Compounds_6, Compounds_7, Compounds_8 and Compounds_9, respectively, by staining with ethidium bromide.

[0213] Figures 10A-10I show directional / non-directional activity of Compound_1, Compound_2, Compound_3, Compound_4, Compound_5, Compound_6, Compound_7, Compound_8 and Compound_9, respectively. AS_CM shows the activity of the antisense strand of the compound against a plasmid containing a full match insert; AS_SM shows the activity of the antisense strand of the compound against a plasmid containing an insert of a seed sequence; S_CM shows the activity of the sense strand of the compound with respect to the plasmid containing the full match insert. All analyzes were performed on human cells, except for the data presented in Figure 10F, which was performed on rat REF52 cells.

DETAILED DESCRIPTION OF THE INVENTION

RNA interference and siNA nucleic acid molecules

[0214] The term RNA interference refers to a sequence-specific post-translational gene silencing process in animals regulated by short interfering RNAs (siRNAs) (Zamore et al., 2000, Cell, 101, 25-33; Fire et al., 1998, Nature, 391, 806; Hamilton et al., 1999, Science, 286, 950-951; Lin et al., 1999, Nature, 402, 128-129; Sharp, 1999, Genes & Dev., 13: 139-141 and Strauss , 1999, Science, 286, 886). The corresponding process in plants (Heifetz et al., PCT International Publication No. WO 99/61631) is often referred to as post-transcriptional gene silencing (PTGS) or RNA silencing. The process of post-transcriptional gene silencing is believed to be an evolutionarily conservative cell defense mechanism used to prevent the expression of foreign genes (Fire et al., 1999, Trends Genet., 15, 358). Such protection against the expression of foreign genes could appear in response to the formation of double-stranded RNAs (dsPHKs) resulting from a viral infection or from the random insertion of transposons into the host genome, through a cellular response that specifically destroys the homologous single-stranded RNA or RNA of the virus genome. The presence of dsRNA in the cell triggers an RNAi response through a mechanism that is not yet fully described. Apparently, this mechanism is different from other known mechanisms in which ribonucleases that are sensitive to double-stranded RNAs, such as the interferon response that results from activation mediated by dsRNA, PKR protein kinases and 2 ′, 5′-oligoadenylate cyclase, leading to non-specific mRNA cleavage by ribonuclease L (see, for example, US Patent Nos. 6,107,094; 5,898,031; publications Clemens et al., 1997, J. Interferon & Cytokine Res., 17, 503-524; Adah et al., 2001, Curr. Med Chem., 8, 1189).

[0215] The presence of long dsRNAs in cells stimulates the activity of the ribonuclease III enzyme designated Dicer (Bass, 2000, Cell, 101, 235; Zamore et al., 2000, Cell, 101, 25-33; Hammond et al., 2000, Nature, 404, 293). Dicer is involved in processing dsPHK into short pieces of dsRNA known as small interfering RNAs (siRNAs) (Zamore et al., 2000, Cell, 101, 25-33; Bass, 2000, Cell, 101, 235; Berstein et al., 2001 , Nature, 409, 363). Small interfering RNAs resulting from Dicer activity typically have approximately 21 to 23 nucleotides in length and include approximately 19 duplex pairs of nucleotides (Zamore et al., 2000, Cell, 101, 25-33; Elbashir et al., 2001, Genes Dev., 15, 188). Dicer is also involved in the excision of small transient RNAs with a length of 21 and 22 nucleotides (stPHK) from a RNA precursor of a conserved structure that are involved in translation control (Hutvagner et al., 2001, Science, 293, 834). The RNAi response also includes an endonuclease complex, which is commonly referred to as the RNA-induced silencing complex (RISC), which mediates the cleavage of single-stranded RNA having a sequence complementary to the siRNA duplex antisense strand. The cleavage of the target RNA occurs in the middle of the site complementary to the antisense strand of the siRNA duplex (Elbashir et al., 2001, Genes Dev., 15, 188).

[0216] RNAi were investigated in various systems. Fire et al., 1998, Nature, 391, 806 first observed RNAi in C. elegans. Bahramian and Zarbl, 1999, Molecular and Cellular Biology, 19, 274-283 and Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe dsRNA-mediated RNAi in mammals. Hammond et al., 2000, Nature, 404, 293, describes RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., 2001, Nature, 411,494 and Tuschi et al., PCT International Publication No. WO 01/75164, described RNAs induced by the administration of duplexes of synthetic RNAs from 21 nucleotides in mammalian cell cultures, including human embryonic liver cells and cells HeLa. Recent work using lysates of Drosophila embryos (Elbashir et al., 2001, EMBO J., 20, 6877 and Tuschi et al., International PCT publication No. WO 01/75164) has opened up several requirements for the structure, length, chemical composition and sequence of siRNAs which are necessary to mediate the effective activity of RNAi.

[0217] Nucleic acid molecules (eg, having structural features as described herein) can inhibit or negatively regulate gene expression or virus replication by mediating RNA interference or gene silencing in a sequence-specific manner (see, for example, Zamore et al., 2000, Cell, 101, 25-33; Bass, 2001, Nature, 411, 428-429; Elbashir et al., 2001, Nature, 411, 494-498; and Kreutzer et al., PCT International No. WO 00/44895; Zernicka-Goetz et al., PCT International Publication No. WO 01/36646; Fire, PCT International Publication No. WO 99/32619; Plaetinck et al., PCT International Publication No. WO 00/01846; Mello and Fire, PCT International Publication No. WO 01/29058; Deschamps-Depaillette, PCT International Publication No. WO 99/07409; and Li et al ., PCT International Publication No. WO 00/44914; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237; Hutvagner and Zamore, 2002, Science, 297, 2056-60; McManus et al., 2002, RNA, 8, 842-850; Reinhart et al., 2002, Gene & Dev., 16, 1616-1626; and Reinhart & Bartel, 2002, Science, 297, 1831).

[0218] A siHK nucleic acid molecule can be formed by two separate polynucleotide chains, with one chain being a sense strand and the second being an antisense strand, while the antisense and sense strand are complementary to each other (ie, each strand includes a nucleotide sequence that complementary to the second nucleotide sequence); such that the antisense strand and the sense strand form a duplex or double-stranded structure of any length and structure as described herein for nucleic acid molecules, for example, the double-stranded portion (duplex) is from about 15 to about 49 (for example, about 17, 18 , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 , 44, 45, 46, 47, 48 or 49 base pairs); an antisense strand includes a nucleotide sequence that is complementary to the nucleotide sequence of a target nucleic acid molecule (i.e., hsp47 mRNA) or a portion thereof, and a sense strand includes a nucleotide sequence corresponding to a target nucleic acid sequence or a portion thereof (e.g., from about 17 to 49 or more nucleotides of nucleic acid molecules in the present description are complementary to the target nucleic acid or part thereof).

[0219] According to certain aspects and embodiments, the nucleic acid molecule (eg, siNA molecule) provided herein may be a “RISC length” molecule or may be a Dicer substrate, as described in more detail below.

[0220] A siNA nucleic acid molecule may comprise separate sense and antisense sequences or regions, wherein sense and antisense regions are covalently linked by nucleotide or non-nucleotide linker molecules known in the art, or otherwise not covalently linked by ionic bonds, hydrogen bonds, Wad der Waals bonds, hydrophobic bonds and / or stacking interactions. Nucleic acid molecules may include a nucleotide sequence that is complementary to the nucleotide sequence of the target gene. Nucleic acid molecules can interact with the nucleotide sequence of the target gene in such a way that it inhibits the expression of the target gene.

[0221] In another case, the siNA nucleic acid molecule consists of a single polynucleotide, wherein the sense and antisense portions of the nucleic acid molecule complementary to each other are connected via linkers based on nucleic acid or not based on nucleic acid, i.e. the antisense strand and the sense strand are part of a single polynucleotide having an antisense stretch and a sense strand that are stacked to form a duplex stretch (for example, to form a hairpin structure, as is well known in the art). Such siNA nucleic acid molecules can be a polynucleotide with an asymmetric duplex, hairpin or asymmetric secondary hairpin structure having sense and antisense regions complementary to each other, wherein the antisense region includes a nucleotide sequence that is complementary to the nucleotide sequence in a single target nucleic acid molecule or parts, and the semantic region has a nucleotide sequence corresponding to the nucleic acid sequence isloty - target (e.g., hsp47 mRNA sequence). Such siNA nucleic acid molecules can be a ring single-stranded polynucleotide having two or more loop structures and a stem containing complementary sense and antisense regions, wherein the antisense region includes a nucleotide sequence that is complementary to the nucleotide sequence in the target nucleic acid molecule or its part, and the semantic region has a nucleotide sequence corresponding to the nucleic acid sequence of the target or part thereof, etc. and this ring polynucleotide can be processed in vivo or in vitro to form an active nucleic acid molecule capable of mediating RNAi.

[0222] The following nomenclature is often used in the art to describe the length and protruding ends of siNA molecules, and it is used in the present description and Examples. Names given to duplexes indicate the length of the oligomers and the presence or absence of protruding ends. For example, the “21 + 2” duplex contains two nucleic acid chains, both of which are 21 nucleotides in length, also denoted by the term 21-dimensional siRNA duplex or 21-dimensional nucleic acid, and has a 3 ′ protruding end of 2 nucleotides. "21-2" refers to a 21-dimensional duplex of nucleic acids with a 5'-protruding end of 2 nucleotides. “21-02” is a 21-dimensional nucleic acid duplex without protruding ends (“blunt” ends). “21 + 2UU” is a 21-dimensional duplex with a 3'-protruding end of 2 nucleotides, and both 2 terminal nucleotides at the 3'-ends are U residues (which may lead to mismatch of the target sequence). The above nomenclature can be applied to siNA molecules with different lengths of chains, duplexes and protruding ends (for example, 19-0, 21 + 2, 27 + 2, etc.). According to another but similar nomenclature, “25/27” means an asymmetric duplex having a sense base of 25 bases and an antisense chain of 27 bases with a 3'-protruding end of 2 nucleotides. “27/25” means an asymmetric duplex having a sense chain of 27 bases and an antisense chain of 25 bases.

Chemical modifications

[0223] According to certain aspects and embodiments of the nucleic acid molecule (eg, siNA molecule) according to the present description include one or more modifications (or chemical modifications). In some embodiments, such modifications include any changes in a nucleic acid or polynucleotide molecule that will make the molecule different from a standard ribonucleotide or RNA molecule (that is, that includes standard groups of adenosine, cytosine, uracil or guanosine); which may be referred to by the term “unmodified” ribonucleotide or unmodified ribonucleic acid. Conventional DNA bases and polynucleotides having 2'-deoxysaccharide represented by adenosine, cytosine, thymine or guanosine groups can be referred to as "unmodified deoxyribonucleotide" or "unmodified deoxyribonucleic acid"; accordingly, the term "unmodified nucleotide" or "unmodified nucleic acid" in the present description means "unmodified ribonucleotide" or "unmodified ribonucleic acid", unless otherwise indicated. Such modifications can occur in a nucleotide sugar, nucleic base, nucleotide phosphate group and / or polynucleotide phosphate backbone.

[0224] According to some embodiments, the modifications of the present description can be used to increase the activity of an RNAi molecule and / or to increase in vivo stability of molecules, in particular stability in serum, and / or to increase the bioavailability of molecules. Examples of modifications include, but are not limited to, internucleotide or internucleoside bonds; deoxynucleotides or dideoxyribonucleotides in any position and chain of the nucleic acid molecule; a nucleic acid (e.g. ribonucleic acid) with a 2'-position modification, preferably selected from amino, fluoro, methoxy, alkoxy and alkyl; 2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoronucleotides, universal base nucleotides, acyclic nucleotides, 5-C methyl nucleotides, biotin group and terminal glyceryl and / or inverted deoxy residues without a base, spatially hindered molecules such as fluorescent molecules and the like. Other nucleotide modifiers may include 3-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxyinosine (ddI), 2', 3'-dideoxy-3'-thiacytidine (3TC ), 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T) and monophosphate nucleotides 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxy-3'-thiacytidine (3TC ) and 2 ', 3'-didehydro-2', 3'-dide-hydroxythymidine (d4T). Other details of the various modifications are described in more detail below.

[0225] Modified nucleotides include nucleotides having a northern conformation (for example, the Northern pseudo-rotation cycle, see, for example, Saenger, Principles of Nucleic Acid Structure, Springer-Verlag ed., 1984). Examples of nucleotides having a northern conformation include, but are not limited to, nucleotides of a closed nucleic acid (LNA) (for example, nucleotides 2'-O, 4'-C-methylene- (D-ribofuranosyl)); 2'-methoxyethoxy nucleotides (MOE); 2'-methylthioethyl, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-chloro nucleotides, 2'-azido nucleotides and 2'-O-methyl nucleotides. Closed nucleic acids or LNAs are described, for example, in Elman et al., 2005; Kurreck et al., 2002; Crinelli et al., 2002; Braasch and Corey, 2001; Bondensgaard et al., 2000; Wahlestedt et al., 2000; International Patent Publications No. WO 00/47599, WO 99/14226, WO 98/39352 and WO 2004/083430. In one embodiment, the LNA is integrated at the 5'-end of the sense strand.

[0226] Chemical modifications also include unclosed nucleic acids or UNA, which are acyclic non-nucleotide analogs that lack a C2'-C3 'link (although UNA are not real nucleotides, it is emphasized that they are included in the scope of the definition of " modified "nucleotides or modified nucleic acids as described herein). In certain embodiments, the protruding ends of the nucleic acid molecule can be modified so that they contain UNA at the positions of the protruding ends (i.e., the protruding end of 2 nucleotides). In other embodiments, UNAs are included at the 3 ′ or 5 ′ ends. UNA can be located anywhere in the nucleic acid chain, i.e. at position 7. Nucleic acid molecules may contain one or more UNA. Examples of UNA are described in Nucleic Acids Symposium Series No. 52 p. 133-134 (2008). In some embodiments, a nucleic acid molecule (eg, siNA molecule) as described herein includes one or more UNA or one UNA. In some embodiments, a nucleic acid molecule (eg, a siNA molecule) as described herein that has a protruding 3 ′ end includes one or more UNAs in the protruding 3 ′ end. In certain embodiments, a nucleic acid molecule (eg, a siNA molecule) as used herein includes a UNA (eg, one UNA) in an antisense strand; for example, at position 6 or position 7 of the antisense chain. Chemical modifications also include non-pairing nucleotide analogs, for example, as described herein. Chemical modifications also include unconventional groups as described herein.

[0227] Also, chemical modifications include terminal modifications in the 5 ′ and / or 3 ′ portion of the oligonucleotides and are referred to as blocking groups. Such terminal modifications are selected from a nucleotide, a modified nucleotide, lipid, peptide and sugar.

[0228] Also, chemical modifications include six-membered “analogs of six-membered ring nucleotides”. Examples of six-membered ring nucleotide analogs are described in Allart, et al (Nucleosides & Nucleotides, 1998, 17: 1523-1526 ,; and Perez-Perez, et al., 1996, Bioorg. And Medicinal Chem Letters 6: 1457-1460). Oligonucleotides, including analogues of six-membered ring nucleotides, including nucleotide monomers with hexitol and altriol, are described in the publication of international patent application WO 2006/047842.

[0229] Also, chemical modifications include “mirror” nucleotides that have reverse chirality compared to a conventional naturally occurring nucleotide; those. the mirror nucleotide may be a "L-nucleotide" analog of a natural D-nucleotide (see. US Patent No. 6,602,858). Mirrored nullotides may also include at least one modification of a sugar or base and / or carcass, for example, as described herein, such as a phosphotioate or phosphonate group. US Pat. No. 6,602,858 describes nucleic acid catalysts comprising substituting at least one L nucleotide. Mirror nucleotides include, for example, L-DNA (L-deoxyriboadenosine-3'-phosphate (mirror dA); L-deoxyribo-cytidine-3'-phosphate (mirror dC); L-deoxyribo-guanosine-3'-phosphate (mirror dG); L -deoxyribotimidine-3'-phosphate (mirror dT)) and L-PHK (L-riboadenosine-3'-phosphate (mirror rA); L-ribocytidine-3'-phosphate (mirror rC); L-riboguanosine-3'- phosphate (mirror rG); L-ribouracil-3'-phosphate (mirror dU).

[0230] In some embodiments, the modified ribonucleotides include modified deoxyribonucleotides, for example, 5'OME DNA (5-methyl-deoxyriboguanosine-3'-phosphate), which can be used as a nucleotide at the 5'-terminal position (position number 1); PACE (deoxyriboadenosine 3 'phosphonoacetate, deoxyribo cytidine 3' phosphonoacetate, deoxyriboguanosine 3 'phosphonoacetate, deoxyribotimidine 3' phosphonoacetate).

[0231] Modifications may be present in one or more chains of a nucleic acid molecule as described herein, for example, in a sense strand, in an antisense strand, or in both strands. In some embodiments, the antisense strand may include modifications, and the sense strand may include only unmodified RNA.

Nucleic Bases

[0232] Nucleic acid bases of the present disclosure may include unmodified ribonucleotides (purines and pyrimidines) such as adenine, guanine, cytosine, uracil. Nucleic bases in one or both chains can be modified with natural and synthetic nucleic bases, such as thymine, xanthine, hypoxanthine, inosine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, any nucleotides with a "universal base"; 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, amino, thiol , thioalkyl, hydroxyl and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, deazapurines, heterocyclic substituted analogues of purines and pyrimidines, for example, aminoethoxy phenoxazine, derivatives of purines (e.g. pyrimides 1-alkyl-, 1-alkenyl-, heteroaromatic- and 1-alkynyl derivatives) and their tautomers, 8-oxo-N6-methyladenine, 7-diazaxanthin, 5-methylcytosine, 5-methyluracil, 5- (1-propynyl) uracil, 5- (1-propynyl) cytosine and 4,4-ethanocytosine). Other examples of suitable bases include non-purinyl and non-pyrimidyl bases, for example 2-aminopyridine and triazines.

Sugar groups

[0233] Sugar groups in nucleic acids as described herein may include a 2'-hydroxyl-pentofuranosyl sugar group without modifications. Alternatively, sugar groups can be modified, for example, a 2'-deoxy-pentofuranosyl sugar group, D-ribose, hexose, modifications at the 2 'position of the pentofuranosyl sugar group, such as 2'-O-alkyl (including 2'-O- methyl and 2 * -O-ethyl), i.e. 2'-alkoxy, 2'-amino, 2'-O-allyl, 2'-8-alkyl, 2'-halogen (including 2'-fluoro, chloro and bromo), 2'-methoxyethoxy, 2'-O- methoxyethyl, 2'-O-2-methoxyethyl, 2'-allyloxy (-OCH2CH = CH2), 2'-propargyl, 2'-propyl, ethynyl, ethenyl, propenyl, CF, cyano, imidazole, carboxylate, thioate, C1- C10 lower alkyl, substituted lower alkyl, alkylaryl or aralkyl, OCF3, OCN, O-, S- or N-alkyl; O-, S or N-alkenyl; SOCH3; S02CH3; ONO2; NO2, N3; heterocycloalkyl; heterocycloalkylaryl; aminoalkylamino; polyalkylamino or substituted silyl, as among others, for example, as described in European Patents EP 0586520 B1 or EP 0618925 B1.

[0234] Alkyl groups include saturated aliphatic groups, including unbranched alkyl groups (eg methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc.), branched alkyl groups (isopropyl, tert -butyl, isobutyl, etc.), cycloalkyl groups (alicyclic) (niclopropyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl), alkyl-substituted cycloalkyl groups and cycloalkyl-substituted alkyl groups. In some embodiments, the unbranched or branched alkyl chain has 6 or fewer carbon atoms in its core (e.g., C1-C6 for unbranched chain, C3-C6 for branched chain) and more preferably 4 or less. Similarly, preferred cycloalkyls may have from 3-8 carbon atoms in the ring structure and more preferably have 5 or 6 carbon atoms in the ring structure. The term C1-C6 includes alkyl groups containing 1-6 carbon atoms. An alkyl group can be substituted with an alkyl group, for example, an alkyl group having a hydrogen substituent on one or more carbon atoms of the carbon backbone. Such substituents can include, for example, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxy, phosphate, phosphonate, phosphinate, cyano, amino (including alkylamino, dialkylalkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbomyl and ureido), amidino, imino, sulfurhydryl, alk ltio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic group.

[0235] The alkoxy group includes substituted and unsubstituted alkyl, alkenyl and alkynyl groups covalently bonded to the oxygen atom. Examples of alkoxy groups include methoxy, ethoxy, isopropyloxy, propoxy, butoxy, and pentoxy groups. Examples of substituted alkoxy groups include halogenated alkoxy groups. Alkoxy groups may be substituted with groups such as alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonylcarbonyl, dialkylalkylcarbonyl, dialkyl, alkyl , cyano, amino (including alkyl amino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbomoyl and ureido), amidino, imino, sulfhydry , Alkylthio, arylthio, thiocarboxylate, sulfate, alkylsulfinyl, sulfonate, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic group. Examples of halogen-substituted alkoxy groups include, but are not limited to, fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloromethoxy, dichloromethoxy, trichloromethoxy, etc.

[0236] In some embodiments, the pentafuranosyl ring may be substituted with acyclic derivatives in which there is no C2'-C3'-bond of the pentafuranosyl ring. For example, acyclic nucleotides can replace a 2-hydroxyethoxymethyl group with a 2'-deoxyribofuranosyl sugar, usually present in dNMP.

[0237] Halogens include fluorides, bromides, chlorides, iodides.

Wreck

[0238] the Nucleosides of the nucleic acid according to the present description can be connected to each other via a phosphodiester bond. The phosphodiester bond may be replaced by other bonds. For example, phosphothioate, thiophosphate-D-ribose, triester, thioate, a backbone connected by 2'-5 'bridges (can also be denoted as 5'-2' or 2'5 'nucleotide or 2'5' ribonucleotide), PACE, 3 '- (or-5') deoxy-3 '- (or-5') thio-phosphothioate, phosphodithioate, phosphoselenates, 3 '- (or -5') deoxyphosphinates, boranophosphates, 3 '- (or -5') deoxy -3 '- (or 5' -) aminophosphoamidates, hydrogen phosphonates, phosphonates, boranophosphate esters, phosphoamidates, alkyl or aryl phosphonates and phosphotriether modifications, such as alkyl phosphotriethers, phosphotriethers phosphor bonds, 5'-ethoxy ether, photoester, methylphosphonate and phosphorus-free bonds, for example, carbonate, carbamate, silyl, sulfur, sulfonate, sulfonamide, formacetal, thioformacetyl, oxime, methyleneimino, methylenemethylimino, methylenehydrozo, methylene dimethylhydrazo and methyleneoxymethylimino bonds.

[0239] The nucleic acid molecules of the present disclosure may include a peptide nucleic acid backbone (PNA). The PNA backbone includes repeating units of N- (2-aminoethyl) -glycine linked by peptide bonds. Various bases such as purine, pyrimidine, natural and synthetic bases are joined in the backbone via methylene carbonyl bonds.

Terminal (terminal) phosphates

[0240] Modifications can be made at terminal phosphate groups. Examples of various stabilizers that can be used, for example, to stabilize the 3′-end of nucleic acid sequences include, but are not limited to, (1) [3′-3 ′] inverted deoxyribose; (2) deoxyribonucleotide; (3) [5′-3 ′] - 3′-deoxyribonucleotide; (4) [5′-3 ′] - ribonucleotide; (5) [5′-3 ′] - 3′-O-methyl ribonucleotide; (6) 3′-glyceryl; (7) [3′-5 ′] - 3′-deoxyribonucleotide; (8) [3′-3 ′] - deoxyribonucleotide; (9) [5′-2 ′] is a deoxyribonucleotide and (10) [5′-3 ′] is a dideoxyribonucleotide. In addition to the unmodified backbone, stabilizers can be combined with one or more different backbone modifications as described herein.

[0241] Examples of chemically modified terminal phosphate groups include the following:

Conjugates

[0242] Modified nullotides and nucleic acid molecules (eg, siHK molecules) as described herein may include conjugates, for example, a conjugate covalently coupled to a chemically modified nucleic acid molecule. Examples of conjugates include, but are not limited to, conjugates and ligands as described in Vargeese et al., U.S. Ser. No. 10 / 427,160. the conjugate can be covalently linked to a nucleic acid molecule (e.g., siHK molecule) using a biodegradable linker. The conjugate molecule can be connected to the 3′-end of the sense strand and / or antisense strand of a chemically modified nucleic acid molecule. The conjugate molecule can be connected to the 5′-end of the sense strand and / or antisense strand of a chemically modified nucleic acid molecule. The conjugate molecule can be connected by either the 3′-end or the 5′-end of the sense strand and / or antisense strand of a chemically modified nucleic acid molecule or any combination thereof. In one embodiment, the conjugate molecule may include a molecule that facilitates the delivery of a chemically modified nucleic acid to a biological system, such as a cell. In another embodiment, the conjugate molecule attached to a chemically modified nucleic acid molecule is polyethylene glycol, human serum albumin or a cell receptor ligand that mediates cell uptake. Examples of specific conjugate molecules of the present invention that can be attached to a chemically modified nucleic acid molecule are described in Vargeese et al., U.S. Ser. No. 10 / 201.394.

Linkers

[0243] A nucleic acid molecule as described herein (eg, siNA) may comprise a nucleotide, non-nucleotide or mixed nucleotide / non-nucleotide linker that connects the sense region of the nucleic acid and the antisense region of the nucleic acid. The nucleotide linker may be a linker with a length of ≥2 nucleotides, for example, approximately 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. The nucleotide linker may be an aptamer of a nucleic acid. The term “aptamer” or “nucleic acid aptamer” as used herein refers to a nucleic acid molecule that specifically binds to a target molecule, wherein the nucleic acid molecule has a sequence that includes a sequence recognized by the target molecule in vivo. Alternatively, the aptamer may be a nucleic acid molecule that binds to a target molecule (e.g., hsp47 mRNA), while the target molecule does not bind to the nucleic acid in vivo. For example, an aptamer can be used to bind to a ligand-binding domain of a protein, while preventing the interaction of a natural ligand with a protein. This is a non-limiting example, and it will be apparent to those skilled in the art that other implementations can easily be obtained using techniques commonly known in the art. See, for example, Gold et al .; 1995, Annu. Rev. Biochem., 64, 763; Brody and Gold, 2000, J. Biotechnol., 74, 5; Sun, 2000, Curr. Opin. Mol. Ther., 2, 100; Kusser, 2000, J. Biotechnol., 74, 27; Hermann and Patel, 2000, Science, 287, 820; and Jayasena, 1999, Clinical Chemistry, 45, 1628.

[0244] A non-nucleotide linker may include a baseless molecule, a polyester, a polyamine, a polyamide, a peptide, a carbohydrate, a lipid, a polycarbohydrate or other polymeric compounds (for example, polyethylene glycol, for example, having from 2 to 100 ethylene glycol groups). Some examples include examples as described in Seela and Kaiser, Nucleic Acids Res. 1990, 18: 6353 and Nucleic Acids Res. 1987, 15: 3113; Cload and Schepartz, J. Am. Chem. Soc. 1991, 113: 6324; Richardson and Schepartz, J. Am. Chem. Soc. 1991, 113: 5109; Ma et al., Nucleic Acids Res. 1993, 21: 2585 and Biochemistry 1993, 32: 1751; Durand et al., Nucleic Acids Res. 1990, 18: 6353; McCurdy et al., Nucleosides & Nucleotides 1991, 10: 287; Jschke et al., Tetrahedron Lett. 1993, 34: 301; Ono et al., Biochemistry 1991, 30: 9914; Arnold et al., International Publication No. WO 89/02439; Usman et al., International Publication No. WO 95/06731; Dudycz et al., International Publication No. WO 95/11910 and Ferentz and Verdine, J. Am. Chem. Soc. 1991, 113: 4000.

5'-ends, 3'-ends and protruding ends

[0245] Nucleic acid molecules as described herein (eg, siNA molecules) may have blunt ends on both sides, have protruding (“sticky”) ends on both sides, or a combination of blunt and sticky ends. The protruding ends can be at either the 5'- or 3'-end of the sense or antisense chain.

[0246] The 5 ′ and / or 3 ′ ends of a double stranded nucleic acid molecule (eg, siNA) may have blunt ends or protruding ends. The 5'-end may be blunt, and the 3'-end may have a protruding end on the sense or antisense chain. In other embodiments, the 3'-end may be blunt, and the 5'-end may have a protruding end on the sense or antisense chain. According to another embodiment, both the 5'- and 3'-ends are blunt, or both the 5'- and 3'-ends have protruding ends.

[0247] The 5'- and / or 3'-end of one or both nucleic acid chains may include a free hydroxyl group. The 5'- and / or 3'-end of any chain of a nucleic acid molecule can be modified to include chemical modification. Such a modification can stabilize nucleic acid molecules, for example, the 3'-end may have increased stability due to the presence of a modification of the nucleic acid molecule. Examples of end modifications (e.g., terminal blocking groups) include, but are not limited to, absence of base (without base), deoxy without base, inverted (deoxy) without base, glyceryl, dinucleotide, acyclic nucleotide, amino, fluorine, chlorine, bromine, CN , CF, methoxy, imidazole, carboxylate, thioate, C1-C10 lower alkyl, substituted lower alkyl or arylalkyl, OCF3, OCN, Ο-, S- or Ν-alkyl; Ο-, S- or Ν-alkenyl; SOCH3; SO2CH3; ONO2; NO2, N3; heterocycloalkyl; heterocycloalkylaryl; aminoalkylamino; polyalkylamino or substituted silyl, including those described in European patents EP 586,520 and EP 618,925, and other modifications according to the present description.

[0248] Nucleic acid molecules include blunt-ended molecules, i.e. ends that do not include drooping nucleotides. A nucleic acid molecule may include one or more blunt ends. A blunt-ended nucleic acid molecule has a number of nucleotide pairs equal to the number of nucleotides in each strand of the nucleic acid molecule. A nucleic acid molecule can include one blunt end, for example, the 5′-end of the antisense strand and the 3′-end of the sense strand do not have hanging nucleotides. A nucleic acid molecule may include one blunt end, for example, while the 3′-end of the antisense strand and the 5′-end of the sense strand does not have hanging nucleotides. A nucleic acid molecule can include two blunt ends, for example, the 3′-end of the antisense chain and the 5′-end of the sense strand, as well as the 5′-end of the antisense strand and the 3′-end of the sense strand do not have hanging nucleotides. Other nucleotides in blunt-ended nucleic acid molecules may include, for example, mismatched bases, loops, loops or ambiguous base pairs to modulate the activity of a nucleic acid molecule to mediate RNA interference.

[0249] In some embodiments of a nucleic acid molecule (eg, siHK molecule) as described herein, at least one end of the molecule has a protruding end of at least one nucleotide length (eg, 1-8 hanging nucleotides). For example, one or both strands of a double-stranded nucleic acid molecule according to the present description may have a protruding end at the 5′-end and / or at the 3′-end. The protruding end can be on either one or both sense and antisense chains of a nucleic acid molecule. The length of the protruding end may be only one nucleotide or as many as 1-8 or more nucleotides (for example, 1, 2, 3, 4, 5, 6, 7 or 8 nucleotides); in some preferred embodiments, the protruding end is 2, 3, 4, 5, 6, 7, or 8 nucleotides; for example, the protruding end may be as small as 2 nucleotides. The nucleotide (s) forming the protruding end may be deoxyribonucleotide (s), ribonucleotide (s), natural and non-natural nucleic bases, or any nucleotide with a modified sugar, base or phosphate group, for example, as described herein. A double-stranded nucleic acid molecule can have both 5'- and 3'-protruding ends. The protruding ends at the 5'- and 3'-end may have different lengths. The protruding end may include at least one modification of the nucleic acid, which may be a deoxyribonucleotide. One or more deoxyribonucleotides may be located at the 5'-end. The 3'-end of the corresponding oppositely directed nucleic acid molecule chain may not have a protruding end, more preferably a non-protruding end of deoxyribonucleotides. One or more deoxyribonucleotides may be located at the 3'-end. The 5'-end of the corresponding oppositely directed dsRNA chain may not have a protruding end, more preferably a non-protruding end of deoxyribonucleotides. The protruding end at the 5'- or 3'-end of the chain may be 1-8 (e.g., approximately 1, 2, 3, 4, 5, 6, 7, or 8) unpaired nucleotides, preferably the protruding end is 2-3 unpaired nucleotides ; more preferably 2 unpaired nucleotides. Nucleic acid molecules may include double-stranded nucleic acid molecules with protruding ends of approximately 1-20 length (e.g., approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 1, 15 , 16, 17, 18, 19 or 20); preferably 1-8 (e.g., approximately 1, 2, 3, 4, 5, 6, 7, or 8) nucleotides, e.g., approximately 21 nucleotide duplexes with approximately 19 base pairs and 3'-protruding ends from one, two, or three nucleotides. The nucleic acid molecules of the present invention may include duplex nucleic acid molecules with blunt ends, with both ends being blunt or in one case one of the ends being blunt. The nucleic acid molecules as described herein may include one or more blunt ends, i.e. however, the blunt end has no hanging nucleotides. In one embodiment, the blunt-ended nucleic acid molecule has a number of nucleotide pairs equal to the number of nucleotides in each strand of the nucleic acid molecule. A nucleic acid molecule may include one blunt end, for example, while the 5'-end of the antisense strand and the 3'-end of the sense strand does not have hanging nucleotides. The nucleic acid molecule may include one blunt end, for example, while the 3'-end of the antisense strand and the 5'-end of the sense strand does not have hanging nucleotides. A nucleic acid molecule may include two blunt ends, for example, the 3'-end of the antisense strand and the 5'-end of the sense strand, as well as the 5'-end of the antisense strand and the 3'-end of the sense strand do not have hanging nucleotides. In some preferred embodiments, the nucleic acid compounds have blunt ends. Other blunt-ended siHK nucleotides may include, for example, mistakenly paired bases, loops, loops or ambiguous base pairs to modulate the activity of a nucleic acid molecule to mediate RNA interference.

[0250] In many embodiments, one or more or all of the nucleotides of the protruding end of the nucleic acid molecule (eg, siHK molecules) as described herein are modified as described herein; for example, one or more or all of the nucleotides may be 2′-deoxynucleotides.

The number, location and distribution of the location (figure) of modifications.

[0251] Nucleic acid molecules (eg, siHK molecules) as described herein may include modified nucleotides as a percentage of the total number of nucleotides in a nucleic acid molecule. Therefore, the nucleic acid molecule may include from about 5% to about 100% of the modified nucleotides (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the modified nucleotides). The exact fraction of modified nucleotides in a given nucleic acid molecule will depend on the total number of nucleotides in the nucleic acid. If the nucleic acid molecule is single-stranded, the proportion of modifications may depend on the total number of nucleotides in a single-stranded nucleic acid molecule. Similarly, if the nucleic acid molecule is double-stranded, the proportion of modifications depends on the total number of nucleotides in the sense strand, antisense strand, or both in the sense and antisense strands.

[0252] Nucleic acid molecules as described herein may include unmodified RNA as a percentage of the total number of nucleotides in a nucleic acid molecule. Therefore, the nucleic acid molecule may include from about 5% to about 100% of the modified nucleotides (e.g., about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the total number of nucleotides in the nucleic acid molecule).

[0253] A nucleic acid molecule (eg, a siHK molecule) may include a sense strand that includes from about 1 to about 5, more specifically about 1, 2, 3, 4, or 5 phosphothioate internucleotide bonds and / or one or more (eg, about 1, 2, 3, 4, 5 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro and / or one or more (e.g., about 1, 2, 3, 4, 5, or more) modified nucleotides with a universal base, and, possibly, a terminal blocking molecule at the 3′-end or 5′-end or both 3′- and 5 ′ Is the end of the sense chain; and wherein the antisense chain comprises from about 1 to about 5 or more, more precisely about 1, 2, 3, 4, 5 or more phosphothioate internucleotide bonds and / or one or more (for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro and / or one or more (e.g., approximately 1, 2, 3 , 4, 5, 6, 7, 8, 9, 10 or more) modified nucleotides with a universal base, and, possibly, a terminal blocking molecule at the 3′-end, 5′-end, or both 3′- and 5 ′ -end of the antisense chain. A nucleic acid molecule may include about 1.2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and / or antisense nucleic acid chain chemically modified 2′-deoxy, 2′-O-methyl and / or 2′-deoxy-2′-fluorine nucleotides with or without from about 1 to about 5 or more, for example, about 1, 2, 3, 4, 5 or more phosphothioate internucleotide bonds and / or 3 terminal blocking molecules ′ ′ End, 5′-end, or both 3′- and 5′-end located on the same or different chains.

[0254] A nucleic acid molecule may include from about 1 to about 5 or more (in particular about 1, 2, 3, 4, 5 or more) phosphotioate internucleotide bonds in each chain of the nucleic acid molecule.

[0255] A nucleic acid molecule may include 2′-5 ′ internucleotide bonds, for example, at the 3′-end, 5′-end or both the 3′- and 5′-end of one or both nucleic acid chains. Also at different different positions within one or both chains of the nucleic acid sequence, there may be 2′-5 ′ internucleotide bonds, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, including each internucleotide bond of the pyrimidine nucleotide in one or both chains of the siHK molecule may include a 2′-5 ′ internucleotide bond or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, including each internucleotide bond purine nucleotide in one or both chains of the siNA molecule, may include a 2'-5 'internucleotide bond.

[0256] A chemically modified short interfering nucleic acid (siNA) molecule may include an antisense region, wherein any (eg, one or more or all) pyrimidine nucleotides in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (eg all of the pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or, in another case, the many pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and any ( an example, one or more or all) purine nucleotides in the antisense region are 2'-deoxy purine nucleotides (for example, all purine nucleotides are 2'-deoxy purine nucleotides, or in another case, a lot of purine nucleotides are 2'-deoxy purine nucleotides).

[0257] A chemically modified short interfering nucleic acid (siNA) molecule may include an antisense region, wherein any (eg, one or more or all) pyrimidine nucleotides in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (eg all of the pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or, in another case, the many pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and any ( an example, one or more or all) purine nucleotides in the antisense region are 2'-O-methyl purine nucleotides (for example, all purine nucleotides are 2'-O-methyl purine nucleotides or, in another case, the plurality of purine nucleotides is 2'-O-methyl purine nucleotides).

[0258] A chemically modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against hsp47 within a cell or in an in vitro system may include a sense region, wherein one or more pyrimidine nucleotides in the sense region are 2 '-deoxy-2'-fluoro pyrimidine nucleotides (for example, all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides, or in another case, many pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one or more purine nucleotides in the sense are 2'-deoxy purine nucleotides (for example, all purine nucleotides are 2'-deoxy purine nucleotides, or otherwise many purine nucleotides are 2'-deoxy purine nucleotides), and an antisense region, while one or more antisense pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides (for example, all irimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides, or else the plurality of pyrimidine nucleotides is 2'-deoxy-2'-fluoro pyrimidine nucleotides), and one or more purine nucleotides in the antisense region are 2 '-O-methyl purine nucleotides (for example, in this case, purine nucleotides are 2'-O-methyl purine nucleotides, or in another case, the many purine nucleotides are 2'-O-methyl purine nucleotides). The sense region and / or antisense region may have a modification of the terminal protective group, for example, any modification that is optionally located at the 3'-end, 5'-end or 3'- and 5'-ends of the sense and / or antisense sequence. Also additionally, the sense region and / or antisense region may include a 3'-terminal protruding end of nucleotides from about 1 to 4 (for example, about 1, 2, 3 or 4) of 2'-deoxynucleotides. The protruding end nucleotides may also include one or more (e.g., approximately 1.2, 3.4 or more) phosphothioate, phosphonoacetate and / or thiophosphonoacetate internucleotide bonds. Purine nucleotides in the semantic region in another case can be 2'-O-methyl purine nucleotides (for example, all purine nucleotides are 2'-O-methyl purine nucleotides, or in another case, many purine nucleotides are 2'- O-methyl purine nucleotides) and one or more antisense purine nucleotides are 2'-O-methyl purine nucleotides (for example, all purine nucleotides are 2'-O-methyl purine nucleotides, or otherwise ozhestvo purine nucleotide is 2'-O-methyl purine nucleotides). One or more purine nucleotides of the sense region can in another case be purine ribonucleotides (for example, all purine nucleotides are purine ribonucleotides or, in another case, many purine nucleotides are purine ribonucleotides) and any purine nucleotides in the antisense region are 2 ' -O-methyl purine nucleotides (for example, all purine nucleotides are, for example, 2'-O-methyl purine nucleotides, or in many other cases of purine nucleotides is a 2'-O-methyl purine nucleotides). Alternatively, one or more purine nucleotides in the sense and / or antisense can be selected from the group consisting of 2'-deoxynucleotides, closed nucleic acid nucleotides (LNA), 2'-methoxyethyl nucleotides, 4'-thionucleotides and 2'-O methyl nucleotides (e.g., all purine nucleotides are selected from the group consisting of 2'-deoxynucleotides, closed nucleic acid nucleotides (LNA), 2'-methoxyethyl nucleotides, 4'-thionucleotides and 2'-O-methyl nucleotides, or otherwise many purine nucleotides selected from the group consisting of 2'-deoxynucleotides, closed nucleic acid nucleotides (LNA), 2'-methoxyethyl nucleotides, 4'-thionucleotides and 2'-O-methyl nucleotides).

[0259] In some embodiments, a nucleic acid molecule (eg, a siNA molecule) as described herein includes a modified nucleotide (eg, one modified nucleotide) in an antisense strand; for example, at position 6 or position 7 of the antisense chain.

[0260] Drawings of modifications and alternating modifications

[0261] Nucleic acid molecules (eg, siNA molecules) as described herein can have sequences of modified and unmodified nucleic acids. The sequence of nucleotide modifications in an extended nucleotide chain can be a modification enclosed within a single nucleotide or group of nucleotides that are covalently linked to each other using standard phosphodiester bonds or at least partially using phosphotioate bonds. Accordingly, a “sequence” (pattern) as described herein may, but need not necessarily, include repeating units. Examples of modification patterns that can be used with respect to nucleic acid molecules (eg, siNA molecules) as described herein include those described in Giese, US Pat. No. 7,452,987. For example, nucleic acid molecules (eg, siNA molecules) as described herein include molecules having modification patterns, such as similar or the same as those shown schematically in Figure 2 in Giese US Patent No. 7,452,987.

[0262] The modified nucleotide or group of modified nucleotides may be at the 5'-end or 3'-end of the sense or antisense strand, the flanking nucleotide or group of nucleotides is located on both sides of the modified nucleotide or group, while the flanking nucleotide or group may be unmodified or does not have the same modification as the previous nucleotide or group of nucleotides. A flanking nucleotide or group of nucleotides, however, may have a different modification. This sequence of the modified nucleotide or group of modified nucleotides, respectively, and the unmodified or otherwise modified nucleotide or group of unmodified or otherwise modified nucleotides may be repeated one or more times.

[0263] In some sequences, the 5'-terminal nucleotide of the chain is a modified nucleotide, while in other sequences the 5'-terminal nucleotide of the chain is an unmodified nucleotide. In some sequences, the 5'-end of the chain begins with a group of modified nucleotides, while in other sequences the 5'-end is an unmodified group of nucleotides. This modification pattern may be on the first chain and / or on the second chain of the nucleic acid molecule.

[0264] Modified nucleotides of one strand of a nucleic acid molecule may be complementary at position to modified or unmodified nucleotides or nucleotide groups of another strand.

[0265] There may be a phase shift between the modifications or sequences of modifications on one chain relative to the modification pattern of another chain, in which the sequence of modifications does not overlap. For example, a shift occurs in such a way that the modified nucleotide group of the sense strand corresponds to the unmodified nucleotide group of the antisense strand and vice versa.

[0266] A partial shift of the modification pattern may occur, in which the modified groups overlap. Groups of modified nucleotides in any given strand may optionally have the same length, but may also have different lengths. Similarly, groups of modified nucleotides of any given strand may have the same length or different lengths.

[0267] In some sequences, the second (penultimate) nucleotide at the end of the chain is an unmodified nucleotide or the beginning of a group of unmodified nucleotides. Preferably, this unmodified nucleotide or unmodified group of nucleotides is located at the 5′-end of the sense and / or antisense chain, and even more preferably at the end of the sense chain. An unmodified nucleotide or an unmodified group of nucleotides can be located at the 5′-end of the sense strand. According to a preferred embodiment, the modification pattern consists of separate alternating modified and unmodified nucleotides.

[0268] In some cases, double-stranded nucleic acid molecules include a 2′-O-methyl modified nucleotide and an unmodified nucleotide, preferably a nucleotide that is not a 2′-O-methyl modified, are inserted in both strands alternately, resulting in a sequence of alternating 2′-O-methyl modified nucleotides and nucleotides that may be unmodified or at least not include a 2′-O-methyl modification. In some embodiments, the same 2′-O-methyl modification sequence and no modification exists in the second chain; according to other embodiments, alternating 2′-O-methyl modified nucleotides are only in the sense strand and are not present in the antisense chain, and according to other embodiments, alternating 2′-O-methyl modified nucleotides are only in the sense strand and are not in the sense strand . In some embodiments, there is a phase shift between the two strands in which the 2′-O-methyl modified nucleotide on the first strand forms base pairs with unmodified (s) nucleotide (s) on the second strand and vice versa. This agreement, i.e. base pairing of the 2′-O-methyl modified and unmodified nucleotide (s) on both strands is particularly preferred according to some embodiments. In some embodiments, a sequence of alternating 2′-O-methyl modified nucleotides exists throughout the entire nucleic acid molecule or the entire duplex region. In other embodiments, a sequence of alternating 2′-O-methyl modified nucleotides exists only in part of the nucleic acid or the entire duplex region.

[0269] When drawing “phase shift” modifications, it may be preferable if the antisense strand starts with a 2′-O-methyl modified nucleotide at the 5′-end, whereby the second nucleotide is unmodified, the third, fifth, seventh, etc. to. nucleotides again, thus, are 2′-O-methyl modified, while the second, fourth, sixth, eighth, etc. nucleotides are unmodified nucleotides.

Examples of locations and drawings of modifications

[0270] While examples of modification patterns are presented in more detail below, all combinations of modification patterns are provided with all possible characteristics of nucleic acid molecules as described herein and known in the art (for example, characteristics include, but are not limited to, sense strand length , the length of the antisense chain, the length of the duplex portion, the length of the protruding single-stranded end, while one or both ends of the double-stranded nucleic acid molecule can be blunt and and “sticky” (protruding), the location of the modified nucleic acid, the number of modified nucleic acids, types of modifications, while the double nucleic acid molecule with protruding ends may have the same or different number of nucleotides in the protruding ends on each side, while in the nucleic acid molecule one or more of one type of modification is used, and the number of adjacent modified / unmodified nucleotides). With respect to all the detailed examples below, although it is shown that the duplex portion is 19 nucleotides, the nucleic acid molecules as described herein can have a duplex portion ranging from 1 to 49 nucleotides in length, while each strand of the duplex portion can independently have 17-49 nucleotides in length. Examples of modification drawings are given in the present description.

[0271] Nucleic acid molecules can have a blunt end (if n is 0) at both ends, which includes one or a continuous set of modified nucleic acids. The modified nucleic acid can be in any position along the entire sense or antisense chain. Nucleic acid molecules may include a group of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 or 49 adjacent modified nucleotides. Modified nucleic acids can be up to 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% , 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 100% of the nucleic acid chain. The modified nucleic acids in the examples immediately below can be found only in the sense strand, only in the antisense strand, or both in the sense and antisense strands.

[0272] General examples of the structure of a nucleic acid are shown below, where X = nucleotide of the sense strand in the duplex region; X _a = nucleotide of the protruding 5'-end in the sense strand; X _b = nucleotide of the protruding 3'-end in the sense strand; Y = nucleotide of the antisense strand in the duplex region; Y _a = nucleotide of the protruding 3'-end in the antisense strand; Y _b = nucleotide of the protruding 5'-end in the antisense strand; and M = modified nucleotide in the duplex region. A and b are independently 0-8 (for example, 0, 1, 2, 3, 4, 5, 6, 7, or 8). X, Y, a and b are independently modified or unmodified. The sense and antisense chains may independently contain each 17-49 nucleotides in length. The examples below have a duplex portion of 19 nucleotides; however, the nucleic acid molecules of the present disclosure may have a duplex portion of a length between the 17 and 49 nucleotides in length, and each strand independently from each other is from 17 to 49 nucleotides in length.

[0273] Other examples of the structure of a nucleic acid molecule are shown below, where X = unmodified sense strand nucleotides; x = unmodified nucleotide of the protruding end of the sense strand; Y = unmodified antisense strand nucleotides; y = unmodified nucleotide of the protruding end of the antisense chain; and M = modified nucleotide. The sense and antisense strands independently can have 17-49 nucleotides in length. The examples below have a duplex portion of 19 nucleotides; however, the nucleic acid molecules of the present description may have a duplex portion of a length between the 17 and 49 nucleotides, and each chain independently from each other has from 17 to 49 nucleotides in length.

[0274] Nucleic acid molecules can have blunt ends on both sides with alternating modified nucleic acids. Modified nucleic acids can be located in any position along the entire sense or antisense chain.

[0275] Nucleic acid molecules with a blunt 5'-end and a protruding 3'-end end with one modified nucleic acid.

[0276] Nucleic acid molecules with a protruding 5'-end and a blunt 3'-end end with one modified nucleic acid.

[0277] Nucleic acid molecules with protruding ends on both sides and all protruding ends are modified nucleic acids. In the structure immediately below, M represents the number of modified nucleic acids, where n is an integer from 0 to 8 (i.e. 0, 1, 2, 3, 4, 5, 6, 7, and 8).

[0278] Nucleic acid molecules with protruding ends at both ends and some nucleotides at the protruding ends are modified nucleotides. In the structures immediately below, M represents the number of modified nucleotides, x represents the number of unmodified nucleotides of the protruding end in the sense strand, y represents the number of unmodified nucleotides of the protruding end in the antisense strand, with each n independently representing an integer from 0 to 8 (t ie 0, 1, 2, 3, 4, 5, 6, 7, and 8), and each protruding end is a maximum of 20 nucleotides; preferably a maximum of 8 nucleotides (modified and / or unmodified).

[0279] Modified nucleotides at the 3'-end of the sense region.

[0280] The protruding end at the 5'-end of the semantic section.

[0281] The protruding end at the 3'-end of the antisense plot.

[0282] Modified nucleotide (s) within the semantic region

[0283] Examples of nucleic acid molecules are presented below together with an equivalent general structure according to the symbols used above:

[0284] siHSP47-C siRNA for human and rat hsp47, having a 19 nucleotide (ie 19 dimensional) duplex region and protruding ends of 2 modified nucleotides (ie, deoxynucleotides) at the 3 ′ ends of the sense and antisense strands.

[0285] siHSP47-Cd siRNA for human and rat hsp47 having a 25-dimensional duplex region, a protruding end of 2 nucleotides at the 3'-end of the antisense strand and 2 modified nucleotides at the 5'-terminal and penultimate positions of the sense strand.

[0286] siHSP47-1 siRNA to human and rat hsp47 cDNA 719-737 having a 19-dimensional duplex region and protruding ends of 2 modified nucleotides (ie, deoxynucleotides) at the 3'-ends of the sense and antisense strands.

[0287] siHSP47-1d siRNA to 719-737 human and rat hsp47 cDNA having a 25-mer with a blunt end at the 3'-end of the sense strand and a protruding end of 2 nucleotides at the 3'-end of the antisense strand and 2 modified nucleotides in 5 '-end and penultimate positions of the sense chain.

[0288] siHSP47-2 siRNA to 469-487 human hsp47 cDNA having a 19-dimensional duplex region and protruding ends of 2 modified nucleotides (ie, deoxynucleotides) at the 3'-ends of the sense and antisense strands.

[0289] siHSP47-2d siRNA to 469-493 human hsp47 cDNA having a 25-dimensional duplex region with a blunt end at the 3'-end of the sense strand and a protruding end of 2 nucleotides at the 3'-end of the antisense strand and 2 modified 5 '-end and penultimate positions of the sense chain.

[0290] rat siHSP47-2d siRNA to 466-490 rat Gp46 cDNA having a 25-dimensional duplex region with a blunt end at the 3'-end of the sense strand and a protruding end of 2 nucleotides at the 3'-end of the antisense strand and 2 modified nucleotides in 5'-terminal and penultimate positions of the sense chain.

[0291] siHSP47-3 siRNA to 980-998 human hsp47 cDNA having a 19-dimensional duplex region and protruding ends of 2 modified nucleotides (ie, deoxynucleotides) at the 3'-ends of the sense and antisense strands.

[0292] siHSP47-3d siRNA to 980-1004 human hsp47 cDNA having a 25-dimensional duplex region with a blunt end at the 3'-end of the sense strand and a protruding end of 2 nucleotides at the 3'-end of the antisense strand and 2 modified nucleotides of 5 '-end and penultimate positions of the sense chain.

[0293] siHSP47-4 siRNA to 735-753 human hsp47 cDNA having a 19-dimensional duplex region and protruding ends of 2 modified nucleotides (ie, deoxynucleotides) at the 3'-ends of the sense and antisense strands.

[0294] siHSP47-4d siRNA to 735-759 human hsp47 cDNA having a 25-dimensional duplex region with a blunt end at the 3'end of the sense strand and a protruding end of 2 nucleotides at the 3'end of the antisense strand and 2 modified 5 nucleotides '-end and penultimate positions of the sense chain.

[0295] siHSP47-5 siRNA to 621-639 human hsp47 cDNA having a 19-dimensional duplex region and protruding ends of 2 modified nucleotides (ie, deoxynucleotides) at the 3'-ends of the sense and anti-sense strands.

[0296] siHSP47-6 siRNA to 446-464 human hsp47 cDNA having a 19-dimensional duplex region and protruding ends of 2 modified nucleotides (ie, deoxynucleotides) at the 3'-ends of the sense and antisense strands

[0297] siHSP47-7 siRNA to 692-710 human hsp47 cDNA having a 19-dimensional duplex region and protruding ends of 2 modified nucleotides (ie, deoxynucleotides) at the 3'-ends of the sense and antisense strands.

Gaps and gaps in nucleic acid chains

[0298] Nucleic acid molecules (eg, siNA molecules) provided herein can have a chain, preferably a sense strand, that has gaps or gaps. In this regard, nucleic acid molecules can have three or more chains, for example, Meroduplex RNA (mdPHK), described in international patent application No. PCT / US07 / 081836. A nucleic acid molecule with a chain having gaps or gaps may have 1-49 nucleotides in length or have a RISC length (e.g., approximately 15-25 nucleotides) or a Dicer substrate (e.g., approximately 25-30 nucleotides), for example, according to the present description.

[0299] Nucleic acid molecules with three or more chains include, for example, “A” (antisense) chain, “S1” (second) chain and “S2” (third) chain, with “S1” and “S2” being complementary and form base pairs with non-overlapping portions of chain “A” (for example, mdPHK may have structure A: S1S2). Together, S1, S2 or more chains form what essentially resembles the sense strand for the antisense “A” strand. The double-stranded portion formed by hybridization of the chains “S1” and “A” differs from and does not overlap with the double-stranded portion formed by hybridization of the chains “S2” and “A”. A nucleic acid molecule (for example, a siNA molecule) can be a molecule with “spaces”, which means that the “gap” is from 0 nucleotides to 10 nucleotides (for example. O, 1, 2, 3, 4, 5, 6, 7 , 8, 9 or 10 nucleotides). Preferably, the sense strand has spaces. In some embodiments, the duplex A: S1 is separated from the duplex A: S2 by a gap arising from at least one unpaired nucleotide (up to about 10 unpaired nucleotides) in the “A” chain, which is located between the duplex A: S1 and duplex A: S2, and which differs from any one or more unpaired nucleotides at the 3'-end of one or more “A”, “S1” or “S2” chains. Duplex A: S1 can be separated from duplex A: B2 by a gap of 0 nucleotides (i.e., a gap in which only the phosphodiester bond between two nucleotides is absent or broken in the polynucleotide molecule) between duplex A: S1 and duplex A: S2, which can also be referred to as dsPHK with breaks (ndsPHK). For example, A: S1S2 may include dsRNA having at least two double-stranded sites that contain a total of about 14 base pairs to about 40 base pairs, and the double-stranded sites are separated by a space of from about 0 to about 10 nucleotides, optionally stupid ends, or A: S1S2 may include dsRNA having at least two double-stranded regions separated by a space of up to 10 nucleotides, wherein at least one of the double-stranded regions comprises from about 5 pairs of nucleotides to 13 base pairs vany.

Substrates Dicer

[0300] In some embodiments, the nucleic acid molecules (eg, siNA molecules) as described herein can be a Dicer substrate precursor molecule, for example, a double-stranded nucleic acid processed in vivo to produce active nucleic acid molecules, for example, according to as described in Rossi Publication, US Patent Application Serial No. 200550244858. Under certain conditions and situations, it turned out that these relatively longer types of dsRNA siNAs, for example, from about 25 to about 30 nucleotides, can give unexpectedly effective results in terms of activity and duration of action. Not wanting to be bound by a specific theory, it is believed that longer types of dsRNA serve as a substrate for the Dicer enzyme in the cell cytoplasm. In addition to cleaving the double-stranded nucleic acid into shorter segments, Dicer can facilitate the incorporation of single-stranded cleavage products obtained from cleaved dsRNA into the silencing complex caused by RNA (RISC complex), which is responsible for the destruction of the cytoplasmic RNA obtained from the target gene.

[0301] Dicer substrates may have some properties that enhance their processing of Dicer. Dicer substrates are long enough for Dicer to process them to produce an active nucleic acid molecule, and may also include one or more of the following properties: (i) dsRNA is asymmetric, for example, has a protruding 3′-end at the first chain (antisense chain), and (ii) dsRNA has a modified 3′-end on the second chain (sense chain) to direct the orientation of Dicer binding and processing of dsRNA into active siRNA. In some embodiments, the longest chain in a Dicer substrate may be 24-30 nucleotides.

[0302] Dicer substrates can be symmetric or asymmetric. The Dicer substrate may have a sense strand that comprises 22-28 nucleotides, and the antisense strand may include 24-30 nucleotides, thus, according to some embodiments, the resulting Dicer substrate may have a protruding end at the 3′-end of the antisense strand. The Dicer substrate may have a sense strand of 25 nucleotides in length, and an antisense strand of 27 nucleotides in length with a protruding end of 2 bases at the 3′-end. The protruding end may be 1-3 nucleotides, for example, 2 nucleotides. The sense strand may also have 5 ′ phosphate.

[0303] Also, an asymmetric Dicer substrate may contain two deoxynucleotides at the 3 ′ end of the sense strand instead of two ribonucleotides. Some examples of the lengths and structures of Dicer substrates are 21 + 0, 21 + 2, 21-2, 22 + 0, 22 + 1, 22-1, 23 + 0, 23 + 2, 23-2, 24 + 0, 24 +2, 24-2, 25 + 0, 25 + 2, 25-2, 26 + 0, 26 + 2, 26-2, 27 + 0, 27 + 2 and 27-2.

[0304] The sense strand of a Dicer substrate may be from about 22 to about 30 (for example, about 22, 23, 24, 25, 26, 27, 28, 29, or 30); from about 22 to about 28; from about 24 to about 30; from about 25 to about 30; from about 26 to about 30; from about 26 to about 29; or from about 27 to about 28 nucleotides in length. In some preferred embodiments, Dicer substrates comprise sense and antisense strands that are at least about 25 nucleotides long and no more than about 30 nucleotides in length; approximately 26 to 29 nucleotides or 27 nucleotides in length. The sense and antisense chains can have the same length (with blunt ends), different lengths (have protruding ends), or a combination thereof. The sense and antisense chains can be on the same polynucleotide or on different polynucleotides. The Dicer substrate may have a duplex region of approximately 19, 20, 21, 22, 23, 24, 25, or 27 nucleotides.

[0305] Like other siNA molecules as described herein, a Dicer antisense strand can have any sequence that hybridizes to an antisense strand under biological conditions, for example, in the cytoplasm of a eukaryotic cell.

[0306] Dicer substrates can have any modifications in the nucleic base, sugar or phosphate backbone known in the art and / or as described herein for other nucleic acid molecules (eg, siNA molecules). In some embodiments, Dicer substrates can have a sense strand modified for Dicer processing using acceptable modifiers located at the 3'-end of the sense strand, i.e. dsPHK is designed to guide Dicer binding and processing orientation. Suitable modifiers include nucleotides, for example, deoxyribonucleotides, dideoxyribonucleotides, acyclic nucleotides, and the like. and sterically hindered molecules such as fluorescent molecules and the like. Acyclic nucleotides replace the 2-hydroxyethoxymethyl group with 2'-deoxyribofuranosyl sugar, usually present in dNMP. Other nucleotide modifiers that can be used as siNA molecules of Dicer substrates include 3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxyinosine (ddI), 2', 3'-dideoxy-3'-thiacytidine (3TC), 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T) and monophosphate nucleotides 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxy-3'-thiacytidine (3TC) and 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T). In one embodiment, deoxynucleotides are used as modifiers. If nucleotide modifiers are used, they can replace ribonucleotides (for example, 1-3 nucleotide modifiers or 2 nucleotide modifiers are replaced by ribonucleotides at the 3'-end of the sense strand), while the length of the Dicer substrates does not change. If sterically hindered molecules are used, they can be attached to the ribonucleotide at the 3'-end of the antisense chain. Thus, according to some embodiments, the chain length does not change when modifiers are embedded. In some embodiments, the two DNA bases in dsRNA are substituted to direct the orientation of the Dicer processing of the antisense strand. According to another embodiment, the two terminal DNAs of the base are replaced by two ribonucleotides at the 3 ′ end of the sense strand forming the blunt end of the duplex at the 3 ′ end of the sense strand and the 5 ′ end of the antisense strand, and the protruding end of the two RNA nucleotides is located at 3 ′ -end of the antisense chain. This composition is asymmetric with DNA at the blunt end and RNA bases at the protruding (sticky) end.

[0307] In some embodiments, the modifiers are incorporated into the Dicer substrate such that the modification does not interfere with the nucleic acid molecule to serve as a substrate for the Dicer. In one embodiment, one or more modifications are made that enhance the processing of the Dicer Dicer substrate. One or more modifications can be made that result in more efficient RNAi. One or more modifications may be made that support the greater effect of RNAi. One or more modifications can be made that lead to more power on each Dicer substrate that needs to be delivered to the cell. Modifications can be integrated at the 3′-terminal portion, the 5′-terminal portion, both at the 3′-terminal and 5′-terminal portion, or at various positions in the sequence. Any number and combination of modifications can be incorporated into a Dicer substrate until the modification prevents the nucleic acid molecule from serving as a substrate for Dicer. If multiple modifications are present, they may be the same or different. Modifications of bases, sugar groups, phosphate backbone and combinations thereof are contemplated. Any 5′-end can be phosphorylated.

[0308] Examples of modifications of the phosphate backbone of a Dicer substrate include phosphonates, including methylphosphonate, phosphothioate and phosphotriether modifications, such as alkyl phosphotriethers and the like. Examples of modifications of the sugar groups of the Dicer substrate include 2′-alkylpyrimidine, for example 2′-O-methyl, 2′-fluoro, amino and deoxy modifications, and the like. (see, for example, Amarzguioui et al., 2003). Examples of base group modifications of the Dicer substrate include baseless sugars, 2′-O-alkyl modified pyrimidines, 4-thiouracil, 5-bromouracil, 5-iodouracil and 5- (3-aminoallyl) -uracil and the like. Closed nucleic acids, or LHKs, may also be included.

[0309] The sense strand can be modified for Dicer processing with acceptable modifiers located at the 3′-end of the sense strand, i.e. Dicer substrate is designed to guide the orientation of Dicer binding and processing. Suitable modifiers include nucleotides such as deoxyribonucleotides, dideoxyribonucleotides, acyclic nucleotides, and the like. and sterically hindered molecules, for example, fluorescent molecules and the like. Acyclic nucleotides replace the 2-hydroxyethoxymethyl group in 2'-deoxyribofuranose sugar, usually present in dNMP. Other nucleotide modifiers may include 3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxyinosine (ddI), 2', 3'-dideoxy-3'-thiacytidine ( 3TC), 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T) and monophosphate nucleotides 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxy-3'-thiacytidine ( 3TC) and 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T). In one embodiment, deoxynucleotides are used as modifiers. If nucleotide modifiers are used, 1-3 nucleotide modifiers or 2-nucleotide modifiers are replaced by ribonucleotides at the 3'-end of the sense strand. If sterically hindered molecules are used, they are attached to the ribonucleotide at the 3'-end of the antisense chain. Thus, the length of the chains does not change when embedding modifiers. According to another embodiment, the invention includes the substitution of two DNA bases in a Dicer substrate to orient the Dicer processing of the antisense strand. According to another embodiment of the present invention, two terminal DNA bases are replaced by two ribonucleotides at the 3 ′ end of the sense strand, forming the blunt end of the duplex at the 3 ′ end of the sense strand and the 5 ′ end of the antisense strand, and a protruding 2 nucleotide end RNA is located at the 3'-end of the antisense strand. This composition is asymmetric with DNA at the blunt end and RNA bases at the sticky end.

[0310] The antisense chain can be modified for Dicer processing using suitable modifiers located at the 3'-end of the antisense chain, i.e. dsRNA is designed to guide Dicer binding and processing orientation. Suitable modifiers include nucleotides such as deoxyribonucleotides, dideoxyribonucleotides, acyclic nucleotides, and the like. and sterically hindered molecules such as fluorescent molecules and the like. Acyclic nucleotides replace the 2-hydroxyethoxymethyl group with a 2'-deoxyribofuranose sugar, usually present in dNMP. Other nucleotide modifiers may include 3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxyinosine (ddI), 2', 3'-dideoxy-3'-thiacytidine ( 3TC), 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T) and monophosphate nucleotides 3'-azido-3'-deoxythymidine (AZT), 2 ', 3'-dideoxy-3'-thiacytidine ( 3TC) and 2 ', 3'-didehydro-2', 3'-dideoxythymidine (d4T). In one embodiment, deoxynucleotides are used as modifiers. If nucleotide modifiers are used, 1-3 nucleotide modifiers or 2-nucleotide modifiers are replaced by ribonucleotides at the 3'-end of the sense strand. If sterically hindered molecules are used, they are attached to the ribonucleotide at the 3'-end of the antisense chain. Thus, the chain length does not change when embedding modifiers. According to another embodiment, the invention includes the substitution of two DNA bases in dsRNA for orienting Dicer processing of the antisense strand. According to another embodiment of the present invention, two terminal DNAs of the base are located at the 3 ′ end of the antisense strand instead of two ribonucleotides, forming the blunt end of the duplex at the 5 ′ end of the sense strand and the 3 ′ end of the antisense strand, and the protruding end of the 2 RNA nucleotides is located 3'-end of the sense chain. This composition is asymmetric with DNA at the blunt end and RNA bases at the protruding (sticky) end.

[0311] Dicer substrates with sense and antisense chains can be connected using a third structure. The third structure does not block Dicer activity on the Dicer substrate and does not interfere with the targeted destruction of RNA transcribed from the target gene. The third structure may be a chemical linking group. Suitable chemical linking groups are known in the art and can be used. Alternatively, the third structure may be an oligonucleotide that binds two dsRNA oligonucleotides in such a way that a hairpin structure is formed upon hybridization of the two oligonucleotides constituting the Dicer substrate. The hairpin structure preferably does not block Dicer activity on the Dicer substrate or does not interfere with the targeted destruction of RNA transcribed from the target gene.

[0312] It is not required that the sense and antisense chains of the Dicer substrate are fully complementary. They need to be substantially complementary for hybridization under biological conditions and to provide a substrate for Dicer, which gives siRNA, a sufficiently complementary target sequence.

[0313] A Dicer substrate may have some properties that enhance its processing of Dicer. The Dicer substrate may be long enough such that it processes Dicer to produce an active nucleic acid molecule (e.g., siRNA), and may have one or more of the following properties: (i) the Dicer substrate is asymmetric, for example, has a protruding 3'-end the first strand (antisense strand) and (ii) the Dicer substrate has a modified 3'-end on the second strand (sense strand) to direct the orientation of Dicer binding and processing to produce active siRNA. The Dicer substrate may be asymmetric, so that the sense strand includes 22-28 nucleotides, and the antisense strand includes 24-30 nucleotides. Thus, the resulting Dicer substrate has a protruding 3'-end of the antisense chain. The protruding end consists of 1-3 nucleotides, for example, 2 nucleotides. The sense strand may also have 5'-phosphate.

[0314] The Dicer substrate may have a protruding 3 ′ end of the antisense strand, and the sense strand is modified for Dicer processing. The 5'-end of the sense strand may have phosphate. The sense and antisense chains can hybridize under biological conditions, for example, the conditions found in the cytoplasm of a cell. A section of one of the chains, in particular, an antisense chain, of a Dicer substrate can have a sequence of at least 19 nucleotides in length, while these nucleotides are in the 21-nucleotide region adjacent to the 3'-end of the antisense chain, and are quite complementary to the nucleotide sequence of RNA, synthesized from the target gene. A Dicer substrate may also have one or more of the following additional properties: (a) the antisense strand has a shift to the right of the corresponding 21-mer (i.e., the antisense strand includes nucleotides on the right side of the molecule when compared with the corresponding 21-mer), ( b) the chains may not be fully complementary, i.e. chains may contain simple base pair errors, and (c) base modifications, such as closed nucleic acid (s), can be included at the 5'-end of the sense strand.

[0315] The antisense strand of the Dicer substrate nucleic acid molecule can be modified to include 1-9 ribonucleotides at the 5'-end to obtain a length of 22-28 nucleotides. If the antisense strand has a length of 21 nucleotides, then 1-7 ribonucleotides or 2-5 ribonucleotides or 4 ribonucleotides can be added to the 3'-end. Added ribonucleotides may have any sequence. Although the added ribonucleotides may be complementary to the target gene sequence, complete complementarity between the target sequence and antisense strands is not required. That is, the resulting antisense strand is quite complementary to the target sequence. Then the sense strand can have 24-30 nucleotides. The sense strand is sufficiently complementary to the antisense strand for hybridization with the antisense strand under biological conditions. In one embodiment, an antisense strand can be synthesized to include a modified 3 ′ end to direct Dicer processing. The sense strand may have a protruding 3'-end. The antisense strand can be synthesized to include a modified 3'-end to direct processing and Dicer binding, and the sense strand has a protruding 3'-end.

Heat Shock Protein 47

[0316] Heat shock protein 47 (HSP47) is a molecular chaperone specific for collagen and is located in the endoplasmic reticulum. It interacts with collagen during folding, collocation, and transport from the endoplasmic reticulum (Nagata Trends Biochem Sci 1996; 21: 22-6; Razzaque et al. 2005; Contrib Nephrol 2005; 148: 57-69; Koide et al. 2006 J. Biol. Chem .; 281: 3432-38; Leivo et al. Dev. Biol. 1980; 76: 100-114; Masuda et al. J. Clin. Invest. 1994; 94: 2481-2488; Masuda et al. Cell Stress Chaperones 1998; 3: 256-264). HSP47 has been reported to have increased expression in fibrosis of various tissues (Koide et al. J Biol Chem 1999; 274: 34523-26) such as cirrhosis (Masuda et al. J Clin Invest 1994; 94: 2481-8) lungs (Razzaque et al. Virchows Arch 1998; 432: 455-60; Kakugawa et al. Eur Respir J 2004; 24: 57-65) and glomerulosclerosis (Moriyama et al. Kidney Int 1998; 54: 110-19). Examples of the human hsp47 cDNA target nucleic acid sequence are described under the GenBank accession number: NM_001235 and the corresponding mRNA sequence, for example, shown in SEQ ID NO: 1. One skilled in the art will appreciate that this sequence may change over time and include any changes necessary in the nucleic acid molecules in the present specification, respectively.

[0317] The specific association of HSP47 with a spectrum of different types of collagen makes HSP47 a potential target for the treatment of fibrosis. Suppression of hsp47 expression may prevent the secretion of extracellular collagen I. Sato et al. (Nat Biotechnol 2008; 26: 431-442) investigated this possibility by using RNA to suppress the expression of hsp47 and prevent the development of liver fibrosis in rats. Similarly, Chen et al. (Br J Dermatol 2007; 156: 1188-1195) and Wang et al. (Plast. Reconstr Surg 2003; 111: 1980-7) investigated the suppression of hsp47 expression using RNA interference technology.

[0318] Methods and compositions for suppressing hsp47

[0319] Compositions and methods are provided for suppressing HSP47 expression using small nucleic acid molecules, such as small interfering nucleic acid (siNA) molecules, interfering RNA (RNAi), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro- RNA (miPHK) and small hairpin RNAs (shRNA), capable of mediating or which mediate RNA interference, against hsp47 gene expression. The compositions and methods according to the present description is also useful in the treatment of various fibrosis, for example, liver fibrosis, pulmonary fibrosis and kidney fibrosis.

[0320] The nucleic acid molecule (s) and / or methods of the present invention are used to suppress the expression of a gene (s) that encode RNAs, indicated for example by Genbank accession number _001235.

[0321] Compositions, methods and kits as described herein can include one or more nucleic acid molecules (eg, siNAs) and methods that independently or in combination modulate (eg, inhibit) the expression of the hsp47 protein and / or genes encoding the hsp47 proteins, proteins and / or genes or disorders related to the maintenance and / or development of diseases, conditions or disorders associated with hsp47, such as liver fibrosis, cirrhosis, pulmonary fibrosis, renal fibrosis, peritoneal fibrosis, chronic liver damage and fibrillogenesis (e.g. us encoding sequence comprising GenBank NM_001235 sequence under accession number), or a member of a gene family hsp47, wherein the genes or gene family sequences share homology. A description of various aspects and embodiments is provided with reference to examples of the hsp47 gene. However, various aspects and embodiments are also directed to other related hsp47 genes, for example, homologous genes and transcript variants and polymorphisms (e.g., single nucleotide polymorphism (SNP)) associated with specific hsp47 genes. For this reason, various aspects and embodiments are also directed to other genes that are involved in signal transduction or expression pathways of hsp47 mediated genes that are involved, for example, in the conservation or development of diseases, signs or conditions as described herein. You can analyze these additional genes for target sites using the methods described in this publication for the hsp47 gene. Thus, the modulation of other genes and the effects of such modulation of other genes can be produced, determined and measured according to the present description.

[0322] In one embodiment, the compositions and methods of the present disclosure include a double stranded short interfering nucleic acid (siNA) molecule that suppresses the expression of the hsp47 gene (eg, human hsp47, an example of which is SEQ ID NO: 1), the nucleic acid molecule includes from about 15 to about 49 base pairs.

[0323] In one embodiment, the nucleic acid of the present disclosure can be used to suppress expression of the hsp47 gene or the hsp47 gene family, wherein the sequence of the gene or gene family has sequence homology. Such homologous sequences can be identified by methods known in the art, for example, using sequence alignment. Nucleic acid molecules can be designed to target such homologous sequences, for example, using perfectly complementary sequences or by embedding non-canonical base pairs, for example, erroneous base pairs and / or ambiguous base pairs, which may produce additional target sequences. If erroneous pairings are identified, noncanonical base pairs (e.g., erroneous pairings and / or ambiguously paired bases) can be used to produce nucleic acid molecules that target more than one gene sequence. For example, but not limited to, non-canonical base pairs, such as UU and SS base pairs, are used to produce nucleic acid molecules that are capable of targeting sequences to distinguish between hsp47 targets that have sequence homology. Therefore, one of the advantages of using siNAs as described herein is that a single-stranded nucleic acid can be designed to include a nucleic acid sequence that is complementary to a nucleotide sequence that is conserved among homologous genes. With this approach, a single nucleic acid can be used to suppress the expression of more than one gene instead of using more than one nucleic acid molecule to act on different genes.

[0324] Nucleic acid molecules can be used to target conserved sequences corresponding to a gene family or gene families, such as the hsp47 gene family. Therefore, nucleic acid molecules targeting various hsp47 targets can provide an enhanced therapeutic effect. In addition, nucleic acid can be used to describe gene function pathways for various applications. For example, nucleic acid molecules can be used to suppress the activity of a target gene (s) in paths to determine the function of an uncharacterized gene (s) in an analysis of gene function (s), an analysis of mRNA function, or translation analysis. Nucleic acid molecules can be used to determine the possible pathways of the target gene involved in various diseases and conditions for drug development. Nucleic acid molecules can be used to understand the expression pathways of genes involved, for example, in fibrosis, such as liver, kidney, or pulmonary fibrosis, and / or inflammatory and proliferative signs, diseases, disorders, and / or conditions.

[0325] According to one embodiment, the compositions and methods of the present disclosure include a nucleic acid molecule having RNAi activity against hsp47 RNA, the nucleic acid molecule comprising a sequence complementary to any RNA having the hsp47 coding sequence, such as sequences having the sequences shown in Table I. According to another embodiment, the nucleic acid molecule may have an RNAi activity against hsp47 RNA, wherein the nucleic acid molecule includes a sequence complementary to an RNA having a variant of the hsp47 coding sequence, for example, other mutant hsp47 genes not shown in Table I, but for which it is known in the art that they are associated with the maintenance and / or development of fibrosis. Chemical modifications shown in Table I, or others as described herein, may be applied to any nucleic acid construct as described herein. In another embodiment, the nucleic acid molecule of the present disclosure includes a nucleotide sequence that can interact with the hsp47 gene nucleotide sequence, and thereby mediate silencing of the hsp47 gene expression, for example, the nucleic acid molecule mediates the regulation of hsp47 gene expression through cellular processes that modulate chromatin structure or hsp47 gene methylation patterns and prevent hsp47 gene transcription.

[0326] The nucleic acid molecules of the present disclosure may have RNAi activity against hsp47 RNA, the nucleic acid molecule comprising a sequence complementary to any RNA having a sequence encoding hsp47, for example, a sequence labeled with GenBank accession number NM_001235. Nucleic acid molecules may possess RNAi activity against hsp47 RNA, wherein the nucleic acid molecule includes a sequence complementary to RNA having a variant of the coding sequence of hsp47, for example, other mutant hsp47 genes that are known in the art to support and / or the development of fibrosis. Nucleic acid molecules as described herein include a nucleotide sequence that can interact with the hsp47 gene nucleotide sequence, and thus mediate the silencing of the hsp47 gene expression, for example, if the nucleic acid molecule mediates the regulation of hsp47 gene expression through cellular processes that modulate the structure of chromatin or hsp47 gene methylation patterns and prevent hsp47 gene transcription.

Treatment methods

[0327] The specific association of HSP47 with a spectrum of different types of collagen makes hsp47 a potential target for the treatment of fibrosis. Suppression of hsp47 expression may prevent the secretion of extracellular collagen I. Sato et al. (Nat Biotechnol 2008; 26: 431-442) investigated this possibility by using siRNAs to inhibit hsp47 expression and prevent the development of liver fibrosis in rats. Similarly, Chen et al. (Br J Dermatol 2007; 156: 1188-1195) and Wang et al. (Plast. Reconstr Surg 2003; 111: 1980-7) investigated the suppression of hsp47 expression using RNA interference technology.

[0328] In one embodiment, nucleic acid molecules can be used to reduce or inhibit the expression of hsp47 and / or hsp47 proteins derived from hsp47 and / or hsp47 haplotype polymorphisms that are associated with a disease or condition (eg, fibrosis). An analysis of the levels of hsp47 and / or the hsp47, hsp47 and / or hsp47 protein or the RNA level can be used to identify patients with such polymorphisms or patients who are at risk of developing signs, conditions or diseases as described herein. These patients are treatable, for example, treatment with nucleic acid molecules as described herein and any other composition useful for treating diseases associated with hsp47 and / or expression of the hsp47 gene. Therefore, analysis of levels of hsp47 and / or hsp47 or RNA protein can be used to determine the type and course of treatment for treating a patient. Monitoring levels of hsp47 and / or hsp47 or RNA protein can be used to predict clinical outcome and to determine the effectiveness of compounds and compositions that modulate the level and / or activity of specific hsp47 and / or hsp47 proteins associated with a sign, condition, or disease.

[0329] Methods and compositions are provided for suppressing hsp47 expression by using small nucleic acid molecules as described herein, such as short interfering nucleic acids (siNAs), interfering RNAs (RNAi), short interfering RNAs (siRNAs), double-stranded RNAs (dsRNA) , micro RNAs (miPHKs) and short hairpin RNAs (shRNAs) capable of mediating or which mediate RNA interference against hsp47 gene expression. The composition and methods according to the present description are also useful in the treatment of various forms of fibrosis, such as liver fibrosis, pulmonary fibrosis and renal fibrosis.

[0330] The nucleic acid molecules as described herein individually or in combination or in combination with other drugs can be used to prevent or treat diseases, signs, conditions and / or disorders associated with hsp47, such as liver fibrosis, cirrhosis, fibrosis lung, kidney fibrosis, peritoneal fibrosis, chronic liver damage and fibrillogenesis.

[0331] The nucleic acid molecules of the present description are capable of inhibiting the expression of hsp47 in a sequence-specific manner. Nucleic acid molecules can include a sense strand and an antisense strand that include adjacent nucleotides that are at least partially complementary (antisense) to the hsp47 mRNA.

[0332] In some embodiments, hsp47-specific dsRNA can be used in combination with other dsRNA specific to other molecular chaperones that are involved in folding of newly synthesized proteins, such as calnexin, calreticulin, BiP (Bergeron et al. Trends Biochem. Sci. 1994; 19: 124-128; Herbert et al. 1995; Cold Spring Harb. Symp. Quant. Biol. 60: 405-415)

[0333] Fibrosis can be treated by RNA interference using nucleic acid molecules as described herein. Examples of fibrosis include liver fibrosis, peritoneal fibrosis, pulmonary fibrosis, renal fibrosis. Nucleic acid molecules as described herein can inhibit the expression of hsp47 in a sequence-specific manner.

[0334] It is possible to monitor the treatment of fibrosis by determining the level of extracellular collagen using acceptable techniques known in the art, for example, using antibodies to collagen I. It is also possible to monitor the treatment of fibrosis by determining the level of hsp47 mRNA or the level of HSP47 protein in affected cells tissue. You can also monitor the treatment of fibrosis using a non-invasive scan of the affected organ or tissue, for example, computed tomography, magnetic resonance elastography.

[0335] A method for treating or preventing a patient or organism from a disease or condition associated with hsp47 may include contacting the patient or organism with a nucleic acid molecule as described herein under conditions suitable for modulating expression of the hsp47 gene in a patient or organism.

[0336] A method for treating or preventing fibrosis in a patient or organism may include contacting the patient or organism with the nucleic acid molecule under conditions suitable for modulating expression of the hsp47 gene in the patient or organism.

[0337] A method for treating or preventing one or more types of fibrosis selected from the group consisting of liver fibrosis, kidney fibrosis and pulmonary fibrosis in a patient or organism, may include contacting the patient or organism with a nucleic acid molecule under conditions suitable for modulating expression hsp47 gene in a patient or organism.

Fibrotic diseases

[0338] Fibrotic diseases are usually characterized by excessive deposition of fibrous material in the extracellular matrix, which contribute to abnormal changes in tissue architecture and disrupt the normal functioning of organs.

[0339] All tissues damaged by trauma respond by launching a wound healing program. Fibrosis, a type of disease characterized by excessive scarring, occurs if the normal self-organizing process of wound healing response is disrupted and causes excessive production and deposition of collagen. As a result, normal organ tissue is replaced by scar tissue, which ultimately leads to functional organ failure.

[0340] Fibrosis can be caused by various causes and in different organs. Liver cirrhosis, pulmonary fibrosis, sarcoidosis, keloid scars, and kidney fibrosis are all chronic diseases associated with progressive fibrosis, which results in a permanent loss of normal tissue function.

[0341] Acute fibrosis (usually with a sudden and severe onset and rapid onset) occurs as a general response to various forms of injuries, including injuries resulting from an accident (in particular injuries to the spinal cord and central nervous system), infections, surgery, ischemic diseases (e.g., scarring in the heart after a heart attack), burns, environmental pollution, alcohol and other types of toxins, acute respiratory distress syndrome, radiation therapy and chemotherapy.

[0342] Fibrosis, pathology caused by fibrosis, or pathology caused by abnormal cross-linking of cellular proteins can all be treated with siRNAs as described herein. Fibrotic diseases or diseases in which fibrosis is obvious (pathology caused by fibrosis) include both acute and chronic forms of organ fibrosis, including all of the following etiological options: pulmonary fibrosis, including interstitial lung disease and fibrotic lung disease, liver fibrosis, heart fibrosis, including myocardial fibrosis, renal fibrosis, including chronic renal failure, skin fibrosis, including scleroderma, keloid and hypertrophic scars; myelofibrosis (bone marrow fibrosis); all types of eye scars, including proliferative vitreoretinopathy (PVR) and surgical scars to treat cataracts or glaucoma; inflammatory bowel disease of various etiologies, macular degeneration, ophthalmopathy Graves ergotism caused by medicaments, keloid scarring, scleroderma, psoriasis, glioblastoma the syndrome Li-Fraumeni syndrome, sporadic glioblastoma, myeloid leukemia, acute myelogenous leukemia, myelodysplastic syndrome, mieloprodiferativny syndrome, Gynecologic Oncology , Kaposi's sarcoma, Hansen's disease and collagenous colitis.

[0343] According to various embodiments, the compounds (nucleic acid molecules) of the present description can be used to treat fibrotic diseases, for example, as described herein, as well as many other diseases and conditions other than fibrotic diseases, such as for example, as described herein. Other diseases that need to be treated include fibrotic diseases in other organs - renal fibrosis of any cause (CKD, including ESRD); pulmonary fibrosis (including ILF); myelofibrosis, abnormal scarring (keloid scars) caused by all kinds of skin injuries - accidental and iatrogenic (surgery); scleroderma, cardiofibrosis, unsuccessful filtering operation for glaucoma; intestinal adhesions.

Ophthalmic Surgery and Fibrotic Complications

[0344] Often, scar tissue contracture may occur as a result of eye surgery. Glaucoma surgery to create new drainage canals often fails due to scarring and tissue contracture, and the created drainage system may be blocked, which requires additional surgery. Existing anti-scar treatment regimens (mitomycin C or 5FU) are limited to concomitant complications (e.g. blindness), e.g. see Cordeiro MF, et al., Human anti-transforming growth factor-beta2 antibody: a new glaucoma anti-scarring agent Invest Ophthalmol Vis Sci. 1999 Sep; 40 (10): 2225-34. Also, contracture of scar tissue formed after a corneal injury or surgery on the cornea can occur, for example, laser or surgical treatment of myopia or refractive error, in which tissue contracture can lead to incorrect results. Scar tissue can be formed, for example, on / in the vitreous body or the retina and may eventually cause blindness in some patients with diabetes, and can be formed after an exfoliation operation called proliferative vitreoretinopathy (PVR). PVR is a common complication after retinal detachment and is associated with a hole or rupture of the retina. PVR refers to the growth of cell membranes in the vitreous cavity and on the anterior and posterior surfaces of the retina containing retinal pigment epithelium (RPE) cells. These membranes, which are essentially scar tissue, are stretched on the retina and can lead to a repeat retinal detachment, even after the initial successful retinal detachment procedure.

[0345] Scar tissue can form in the orbit or on the eye and muscles of the eyelids after surgery for strabismus, operations in the orbit or eyelids, or thyroid disease of the eye, and which results in the formation of scars on the conjunctiva, which can occur after surgery for glaucoma or rusovaya a disease, an inflammatory disease, for example, a pemphigoid, or an infectious disease, for example, trachoma. Also, an ophthalmic disease associated with contracture of tissues containing collagen is clouding and contracture of the lens capsule after cataract removal. The important role of MMP in ophthalmic diseases was recognized, including wound healing, dry eyes, non-healing ulceration of the cornea, recurrent erosion of the epithelium, neovascularization of the cornea, pterygium, conjunctival chalasia, glaucoma, PVR and ocular fibrosis.

Liver fibrosis

[0346] Liver fibrosis (AF) is usually an irreversible consequence of liver damage of several etiologies. In the Western World, the main etiological categories are: alcoholic liver disease (30-50%), viral hepatitis (30%), bile duct disease (5-10%), primary hemochromatosis (5%) and drug and cryptogenic cirrhosis of unknown etiology (10 -fifteen%). Liver fibrosis is also one of the symptoms of Wilson’s disease, α ₁ -antitripsin deficiency, and other rare diseases. With liver cirrhosis - the last stage of liver fibrosis - liver transplantation is often necessary, and cirrhosis is one of the ten most common causes of death in the Western World.

Renal fibrosis and related conditions

Chronic renal failure (CRF)

[0347] Chronic renal failure is a gradual and progressive loss of the ability of the kidneys to excrete waste, concentrate urine and retain electrolytes. CRF is slowly progressing. Most often, it occurs as a result of any disease that causes a gradual loss of kidney function, and fibrosis is the main pathology in which chronic kidney disease develops.

Diabetic Nephropathy

[0348] Diabetic nephropathy, which is characterized by glomerulosclerosis and tubulointerstitial fibrosis, is the single most predominant cause of end-stage renal failure in the modern world, and patients with diabetes comprise the largest group on dialysis. This method of treatment is expensive and far from optimal. Transplantation offers a better outcome, but suffers from a serious lack of donors.

Chronic kidney disease

[0349] Chronic kidney disease (CKD) is a global public health problem and is considered an ordinary condition that is associated with an increased risk of developing cardiovascular disease and chronic renal failure (CRF).

[0350] The National Kidney Fund (NKF) Kidney Disease Treatment Quality Initiative (K / DOQI) defines chronic kidney disease as kidney damage or reduced glomerular filtration rate (GFR) for three or more months. Other CKD markers are also known and used for diagnosis. In general, the destruction of the kidney body with irreversible sclerosis and loss of nephrons leads to a progressive deterioration of GFR. K / DOQI recently published the following classification of CKD stages:

Stage 1: kidney damage with normal or elevated GFR (> 90 ml / min / 1.73 m2)

Stage 2: a slight decrease in GFR (60-89 ml / min / 1.73 m ² )

Stage 3: moderate decrease in GFR (30-59 ml / min / 1.73 m ² )

Stage 4: a serious decrease in GFR (15-29 ml / min / 1.73 m ² )

Stage 5: renal failure (GFR <15 ml / min / 1.73 ml ² or dialysis)

[0351] At stages 1 and 2 of CKD, GFR alone does not confirm the diagnosis. You can rely on other markers of kidney damage, including abnormalities in blood or urine composition or abnormalities in radiological studies.

Pathophysiology of CKD

[0352] Approximately 1 million nephrons are found in each kidney, each of which contributes to the total GFR. Regardless of the etiology of kidney damage with progressive destruction of nephrons, the kidney can support GFR by hyperfiltration and compensatory hypertrophy of the remaining healthy nephrons. This nephron adaptability promotes long-term normal clearance of dissolved plasma substances, as a result of which substances such as urea and creatinine begin to show a significant increase in plasma levels only after the total GFR has decreased to 50% when the renal reserve is exhausted. Plasma creatinine will approximately double with a 50% reduction in GFR. Therefore, a two-fold increase in plasma creatinine compared with the initial value of 0.6 mg / dl to 1.2 mg / dl in a patient actually represents a loss of 50% of the mass of functioning nephrons.

[0353] Residual hyperfiltration and nephron hypertrophy are believed to be the main cause of progressive renal dysfunction, despite its usefulness due to the noted reasons. It is believed that this is due to increased capillary pressure in the glomeruli, which damages the capillaries and first leads to local and segmental glomerulosclerosis, and ultimately to global glomerulosclerosis. This hypothesis is based on studies of rats with 5/6 nephroectomy that developed lesions that were identical to those observed in people with CKD.

[0354] The two most common causes of chronic kidney disease are diabetes and hypertension. Other factors include acute nephrotoxin-induced strokes, including contrast agents or reduced perfusion; proteinuria; increased renal ammoniagenesis with interstitial trauma, hyperlipidemia, hyperphosphatemia with deposition of calcium phosphate, low levels of nitric oxide and smoking.

[0355] In the United States, the incidence and prevalence of CKD is increasing with poor outcomes and high cost to the healthcare system. Kidney disease is the ninth leading cause of death in the United States. The high mortality rate has led to the inclusion in the order of the US Secretary of Health for American Citizens, Healthy People 2010, a chapter on CKD. The objectives of this chapter are to formulate objectives and provide strategies to reduce the incidence, incidence, mortality, and health care costs of chronic kidney disease in the United States.

[0356] The incidence of end-stage chronic renal failure (ESRD) in the world has also been steadily increasing since 1989. The United States has the highest incidence of ESRD, followed by Japan. Japan has the highest prevalence per million population, followed by the United States.

[0357] The mortality caused by hemodialysis is astounding and indicates that the life expectancy of patients who begin hemodialysis is markedly reduced. At any age, patients with ESRD on dialysis have significantly increased mortality compared to patients without dialysis and people without kidney disease. At the age of 60, a healthy person can expect to live another 20 years, while the life expectancy of a 60-year-old hemodialysis patient is approaching 4 years (Aurora and Verelli, May 21, 2009. Chronic Renal Failure: Treatment & Medication. Emedicine. http://emedicine.medscape.com/article/238798-treatment).

Pulmonary fibrosis

[0358] Interstitial pulmonary fibrosis (IFL) is a scarring in the kidney caused by various inhaled agents, including mineral particles, organic dust and oxidizing gases, or for unknown reasons (idiopathic pulmonary fibrosis). The disease affects millions of people in the world, and there are no effective treatments. The main reason for the lack of beneficial treatment is that few molecular mechanisms have been investigated sufficiently to develop appropriate therapy targets (Lasky JA., Brody AR. (2000), “Interstitial fibrosis and growth factors.” Environ Health Perspect .; 108 Suppl 4: 751-62).

Fibrosis of the heart

[0359] Heart failure occupies a unique place among the main cardiovascular diseases, since only its prevalence increases, while there is a noticeable decrease in other diseases. This may be partially explained by the aging populations of the United States of America and Europe. The ability to save patients with myocardial damage is also a major factor, as these patients may develop a progression of left ventricular dysfunction due to destructive remodeling of the heart.

[0360] A normal myocardium consists of different cells, cardiomyocytes and non-cardiomyocytes, which include vascular endothelial and smooth muscle cells and fibroblasts.

[0361] Remodeling of the structure of the ventricular wall is a key determinant of the clinical outcome of heart disease. Such remodeling involves the production and degradation of extracellular matrix proteins, cell proliferation and migration, and apoptotic or necrotic cell death. Heart fibroblasts are fundamentally involved in these processes, producing growth factors and cytokines that act as autocrine and paracrine factors, as well as extracellular matrix proteins and proteinases. Recent studies have shown that interactions between heart fibroblasts and cardiomyocytes are absolutely necessary for the progression of heart remodeling, the combined effect of which is disruption of the heart and the onset of heart failure (Manabe I, et al., (2002), "Gene expression in fibroblasts and fibrosis: involvement in cardiac hypertrophy ", Circ Res. 13; 91 (12): 1103-13).

Burns and Scars

[0362] A separate problem that may occur, in particular with fibrotic disease, is tissue contracture, for example, scar contracture. Tissue contracture, including extracellular matrix components, in particular collagen-containing tissues, can occur in connection with many different pathological conditions and surgical or cosmetic procedures. The contracture of scars, for example, can cause physical problems, which can lead to the need for medical intervention, or it can cause problems of a purely cosmetic nature. Collagen is the main component of the scar and therefore is the most important structural component to consider. However, scars and other contracted tissues also include other structural components, in particular other extracellular matrix components, such as elastin, which can also contribute to tissue contracture.

[0363] A contracture of tissue containing collagen, which may also include other components of the extracellular matrix, is often found in burn healing. Burns can be chemical, thermal, or radiation burns, and can be on the eyes, on the surface of the skin, or on the skin and underlying tissues. Also, in some cases, burns can occur on internal tissues, for example, caused by exposure to radiation. Burning tissue contracture is often a problem and can lead to physical and / or cosmetic problems, such as loss of mobility and / or disfigurement.

[0364] Skin grafts can be used for various reasons, and they can undergo contracture after application. When healing burnt tissue, contracture can lead to physical and cosmetic problems. This is a particularly serious problem if many skin grafts are needed, for example, in case of severe burns.

[0365] Contracture is also a problem in creating artificial leather. To obtain artificial skin, it is necessary to have an epidermis consisting of epithelial cells (keratinocytes) and a dermis consisting of collagen populated by fibroblasts. It is important to have both types of cells, as they trigger signaling and stimulate each other using growth factors. The collagen component of artificial skin often shrinks to less than a tenth of its original area when populated with fibroblasts.

[0366] Scar contracture, contracture due to contraction of the fibrous tissue of the scar, is common. In some cases, the scar can turn into a deforming scar, a scar in which contraction causes severe deformity. The patient’s stomach can be actually divided into two separate chambers by hourglass contracture while reducing scar tissue formed during the healing of a stomach ulcer. Blockage of passages and ducts, cicatricial stenosis can occur with a reduction in scar tissue. Blood vessel contracture may be associated with primary obstruction or surgical trauma, for example, after surgery or angioplasty. Stenosis of other hollow organs, such as the ureters, may also occur. Problems can arise if any form of scarring occurs, either as a result of accidental injury, or after surgery. Diseases of the skin and tendons, which include contraction of tissues including collagen, include post-traumatic conditions caused by surgery or an accident, such as injuries to tendons of the hands or feet, conditions after transplantation, and pathological conditions such as scleroderma, Dupuytren's contracture, and bullous epidermolysis. Scarring and contracting of tissues in the eyes can occur under various conditions, for example, the effects of retinal detachment or diabetic eye damage (as mentioned above). Orbital contracture found in the skull of the eyeballs and related structures, including the extraocular muscles and eyelids, can occur if there is trauma or inflammatory damage. Tissues contract in the eye socket, causing a range of problems, including doubling in the eyes and unsightly appearance.

[0367] For more information on the different types of fibrosis, see publications: Molina V, et al., (2002), "Fibrotic diseases", Harefuah, 141 (11): 973-8, 1009; Yu L, et al., (2002), "Therapeutic strategies to halt renal fibrosis", Curr Opin Pharmacol. 2 (2): 177-81; Keane WF and Lyle PA. (2003), "Recent advances in management of type 2 diabetes and nephropathy: lessons from the RENAAL study." Am J Kidney Dis. 41 (3 Suppl 2): S22-5; Bohle A, et al., (1989), "The pathogenesis of chronic renal failure", Pathol Res Pract. 185 (4): 421-40; Kikkawa R, et al., (1997), "Mechanism of the progression of diabetic nephropathy to renal failure". Kidney Int Suppl. 62: S39-40; Bataller R, and Brenner DA. (2001), "Hepatic stellate cells as a target for the treatment of liver fibrosis", Semin Liver Dis. 21 (3): 437-51; Gross TJ and Hunninghake GW, (2001) "Idiopathic pulmonary fibrosis", N Engl J Med. 345 (7): 517-25; Frohlich ED. (2001) "Fibrosis and ischemia: the real risks in hypertensive heart disease". Am J Hypertens; 14 (6 Pt 2): 194S-199S; Friedman SL. (2003), "Liver fibrosis - from bench to bedside", J Hepatol. 38 Suppl 1: S38-53; Albanis E, et al., (2003), "Treatment of hepatic fibrosis: almost there", Curr Gastroenterol Rep. 5 (1): 48-56; (Weber KT. (2000), "Fibrosis and hypertensive heart disease", Curr Opin Cardiol. 15 (4): 264-72).

Nucleic acid molecule delivery and dosage forms

[0368] Nucleic acid molecules can be adapted for use in the prevention or treatment of fibrotic diseases (eg, fibrosis of the liver, kidneys, peritoneal or pulmonary), signs, conditions, and / or disorders that are associated or will respond to hsp47 levels in a cell or tissue by - Separately or in combination with other treatments. The nucleic acid molecule may include a carrier for delivery, including liposomes, for administration to a patient, carriers and diluent and their salts, and / or may be presented in pharmaceutically acceptable dosage forms.

[0369] The nucleic acid molecules as described herein can be delivered or administered directly with a vehicle or diluent, but not with any delivery vehicle that aids, facilitates or facilitates entry into the cell, including viral vectors, viral particles, liposome dosage forms, lipofectin or precipitating agents and the like.

[0370] Nucleic acid molecules can be delivered or administered to a patient by direct application of the nucleic acid molecules with a carrier or diluent or any other delivery vehicle that can act to facilitate, facilitate or facilitate entry into the cell, including viral sequences, viral particles, dosage forms liposomes, lipofectin or precipitating agents and the like. Polypeptides that facilitate the administration of a nucleic acid to a desired patient, such as those described in U.S. Patent Application Publication No. 20070155658 (e.g., a melamine derivative such as 2,4,6-triguanidino triazine and 2,4,6-triamidosarcosyl melamine, polyarginine polypeptide and polypeptide, including alternating glutamine and asparagine residues).

[0371] Methods for the delivery of nucleic acid molecules are described in Akhtar et al., Trends Cell Bio., 2: 139 (1992); Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, (1995), Maurer et al., Mol. Membr. Biol., 16: 129-140 (1999); Hofland and Huang, Handb. Exp. Pharmacol. 137: 165-192 (1999); and Lee et al., ACS Symp. Ser., 752: 184-192 (2000); U.S. Patent Nos. 6,395,713; 6,235,310; 5,225,182; 5,169,383; 5,167,616; 4,959217; 4,925,678; 4,487,603 and 4,486,194 and publications of Sullivan et al., PCT WO 94/02595; PCT WO 00/03683 and PCT WO 02/08754; and US Patent Application Publication No. 2003077829. These protocols can be used to deliver literally any nucleic acid molecule. Nucleic acid molecules can be introduced into cells using various methods known to those skilled in the art, including, but not limited to, encapsulation in liposomes, iontophoresis, or by incorporation into other carriers such as biodegradable polymers, hydrogels, cyclodextrins ( see, for example, Gonzalez et al., Bioconjugate Chem., 10: 1068-1074 (1999); Wang et al., PCT International Publication No. WO 03/47518 and WO 03/46185), poly (milk-co-glycol) acid (PLGA) and PLCA microspheres (see, for example, US Pat. No. 6,447,796 and Patent Application Publication nt US №2002130430), biodegradable nanocapsules, and bioadhesive microspheres, or proteinaceous vectors (O'Hara and Normand, International Publication PCT №WO 00/53722). Alternatively, the nucleic acid / carrier combination is delivered topically using direct injection or using an infusion pump. Direct injection of nucleic acid molecules according to the present invention, subcutaneous, intramuscular, transdermal, can be carried out using standard methods using a needle and syringe or using needleless techniques, for example, as described in Conry et al., Clin. Cancer Res., 5: 2330-2337 (1999) and Barry et al., PCT International Publication No. WO 99/31262. The molecules of the present invention can be used as pharmaceutical agents. Pharmaceutical agents prevent, modulate the occurrence, or treat (alleviate the symptom to some extent, preferably all symptoms) of the disease in a patient.

[0372] Nucleic acid molecules can be incorporated into complexes with cationic lipids, can be packaged in liposomes, or otherwise delivered to target cells or tissues. Nucleic acid or nucleic acid complexes can be introduced locally into the respective tissues ex vivo, or in vivo by direct dermal administration, transdermal administration or injection, or without incorporation into biopolymers. The nucleic acid molecules of the present invention may include the sequences shown in Tables I. Examples of such nucleic acid molecules essentially consist of the sequences shown in Table I.

[0373] Delivery systems include surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified or long-circulating liposomes or subtle liposomes). These dosage forms offer a way to increase the accumulation of drugs in target tissues. This class of drug carriers is resistant to opsonization and destruction by the system of phagocytic mononuclear cells (MPS or RES), thus contributing to a longer circulation time in the blood and an increased effect on the tissue of the encapsulated drug (Lasic et al. Chem. Rev. 1995, 95 , 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011).

[0374] Nucleic acid molecules can be formulated or complexed with polyethyleneimine (eg, linear or branched PEI) and / or polyethyleneimine derivatives, including, for example, polyethyleneimine-polyethylene glycol-N-acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine derivatives polyethylene glycol tri-N-acetylgalactosamine (PEI-PEG-triGAL) grafted with PEI, such as galactose PEI, cholesterol PEI, a derivative of PEI with antibodies and their derivatives with polyethylene glycol PEI (PEG-PEI) (see, for example, Ogris publications et al., 2001, AAPA PharmSci, 3, 1-11; Furgeson et al., 2003, Bioconjugate Chem., 14, 840- 847; Kunath et al., 2002, Pharmaceutical Research, 19, 810-817; Choi et al., 2001, Bull. Korean Chem. Soc., 22, 46-52; Bettinger et al., 1999, Bioconjugate Chem., 10, 558-561; Peterson et al., 2002, Bioconjugate Chem., 13, 845-854; Erbacher et al., 1999, Journal of Gene Medicine Preprint, 1, 1-18; Godbey et al., 1999., PNAS USA, 96, 5177-5181; Godbey et al., 1999, Journal of Controlled Release, 60, 149-160; Diebold et al., 1999, Journal of Biological Chemistry, 274, 19087-19094; Thomas and Klibanov, 2002, PNAS USA, 99, 14640-14645; Sagara, US Patent No. 6,586,524 and US Patent Application Publication No. 20030077829).

[0375] Nucleic acid molecules can be included in complexes with membrane disrupting agents, for example, those described in US Patent Application Publication No. 20010007666. The membrane damaging agent or agents and the nucleic acid molecule can also be included in complexes with a cationic lipid or auxiliary lipid molecule, such as lipids, for example, as described in US Pat. No. 6,235,310.

[0376] Nucleic acid molecules can be administered by injection into the lungs, for example, by inhalation of a dried aerosol dosage form or spray, administered by an inhalation device or a nebulizer providing rapid local uptake of nucleic acid molecules by the corresponding lung tissues. Solid dispersed compositions containing respirable dry particles of finely divided nucleic acid compositions can be prepared by grinding dried or lyophilized nucleic acid compositions and then passing the ground compositions, for example, through a sieve with a mesh size of 400 to break up or separate large agglomerates. The solid dispersed composition containing the nucleic acid compositions of the present invention may further comprise a dispersant that serves to facilitate aerosol formation, as well as other therapeutic compounds. A suitable dispersant is lactose, which can be mixed with the nucleic acid compound in any suitable ratio, for example, a ratio of 1 to 1 by weight.

[0377] Aerosols of liquid particles can include nucleic acid molecules as described herein and can be obtained by any suitable means, for example, using a nebulizer (see, for example, US patent No. 4,501,729). Nebulizers are commercially available devices that convert solutions or suspensions of the active ingredient into a therapeutic aerosol, for example, by accelerating compressed gas, usually air or oxygen, through narrow openings of a venturi or by ultrasonic mixing. Suitable dosage forms for use in nebulizers include the active ingredient in a liquid carrier in an amount of up to 40% w / w, preferably less than 20% w / w of the dosage form. Typically, the carrier is water or a dilute aqueous-alcoholic solution, preferably made isotonic with body fluids by the addition of, for example, sodium chloride or other acceptable salts. Possible additives include preservatives if the dosage form is non-sterile, for example, methyl hydroxybenzoate, antioxidants, flavors, essential oils, buffers and emulsifiers and other surfactants. Particulate aerosols, including the active composition and surfactant, can also be made using any solid aerosol generator. Aerosol generators for administering a solid drug to a patient produce particles that can be inhaled as described above and generate an aerosol volume containing a pre-measured dose of the therapeutic composition at a rate suitable for administration to humans. One example of a type of particulate aerosol generator is an injector. Acceptable dosage forms for administration by injection include finely divided powders that can be administered via an injector. In the injector, a powder, for example, a measured dose effective for treating as described herein, is enclosed in capsules or cartridges, usually made of gelatin or plastic, which are pierced or opened in situ, and the powder delivered by air released from the device by inhalation or using a hand pump. The powder used in the injector consists only of the active ingredient or a mixture of powders containing the active ingredient, an acceptable diluent of the powder, such as lactose, and possibly a surfactant. The active ingredient typically ranges from 0.1 to 100% w / w dosage form. A second type of example aerosol generator includes a metered dose inhaler. Dosage inhalers are pressurized aerosol dispensers, usually containing a suspension or solution of the active ingredient in a liquefied propellant. During use, these devices dispense the dosage form through a valve to deliver a measured volume to produce a finely divided spray containing the active ingredient. Suitable propellants include certain chlorofluorocarbon compounds, for example dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, and mixtures thereof. Additionally, the dosage form may contain one or more cosolvents, for example, ethanol, emulsifiers and other surfactants, such as butyric acid or sorbitan trioleate, antioxidants and acceptable flavorings. Other methods for delivery to the lungs are described, for example, in US patent application No. 20040037780 and US patent No. 6,592,904; 6,582,728; 6,565,885. PCT Patent Publication No. WO2008 / 132723 relates to aerosol delivery of oligonucleotides in general and siRNAs in particular to the respiratory system.

[0378] Nucleic acid molecules can be introduced into the central nervous system (CNS) or peripheral nervous system (PNS). Experiments have shown effective in vivo uptake of nucleic acids by neurons. See, for example, Sommer et al., 1998, Antisense Nuc. Acid Drug Dev., 8, 75; Epa et al., 2000, Antisense Nuc. Acid Drug Dev., 10, 469; Broaddus et al., 1998, J. Neurosurg., 88 (4), 734; Karle et al., 1997, Eur. J. Pharmocol., 340 (2/3), 153; Bannai et al., 1998, Brain Research, 784 (1.2), 304; Rajakumar et al., 1997, Synapse, 26 (3), 199; Wu-pong et al., 1999, BioPharm, 12 (1), 32; Bannai et al., 1998, Brain Res. Protoc., 3 (1), 83; and Simantov et al., 1996, Neuroscience, 74 (1), 39. Nucleic acid molecules are thus suitable for delivery and uptake by cells in the CNS and / or PNS.

[0379] The delivery of nucleic acid molecules to the central nervous system is provided by a large number of different strategies. Conventional CNS delivery approaches that may be used include, but are not limited to, intrathecal and intracerebroventricular administration, catheter and pump implantation, direct injection or perfusion to the site of injury or injury, injection into the cerebral artery system or administration through chemical or osmotic opening blood-brain barrier. Other approaches may include the use of various transport systems and carrier systems, for example, through the use of conjugates and biodegradable polymers. Moreover, gene therapy methods, for example, as described by Kaplitt et al., US Pat. No. 6,180,613 and Davidson, WO 04/013280, can be used to express nucleic acid molecules in the central nervous system.

[0380] Delivery systems may include, for example, aqueous and anhydrous gels, creams, various emulsions, microemulsions, liposomes, ointments, aqueous and anhydrous solutions, lotions, aerosols, hydrocarbon bases and powders, and may include fillers such as solvents, enhancers penetration (e.g., fatty acids, fatty acid esters, fatty alcohols and amino acids), and hydrophilic polymers (e.g., polycarbophil and polyvinylpyrrolidone). In one embodiment, the pharmaceutically acceptable carrier is a liposome or transdermal penetration enhancer. Examples of liposomes that can be used in the present invention include the following: (1) CellFectin, 1: 1.5 (M / M) liposome form of cationic lipid N, NI, NII, NIII-tetramethyl-N, NI, NII, NIII-tetrapalmit -y-spermine and dioleylphosphatidylethanolamine (DOPE) (GIBCO BRL); (2) Cytofectin GSV, 2: 1 (M / M) liposome form of cationic lipid and DOPE (Glen Research); (3) DOTAP (N- [1- (2,3-dioleyloxy) -N, N, N-tri-methyl-ammonium methyl sulfate) (Boehringer Manheim); and (4) Lipofectamine, 3: 1 (M / M) liposome form of the polycationic lipid DOSPA, neutral lipid DOPE (GIBCO BRL) and di-alkylated amino acid (D1LA2).

[0381] Delivery systems may include plasters, tablets, suppositories, suppositories, gels and creams, and may also contain excipients, such as solvents and enhancers (eg, propylene glycol, bile salts and amino acids), and other carriers (eg, polyethylene glycol, fatty acid esters and their derivatives, as well as hydrophilic polymers such as hydroxypropyl methylcellulose and hyaluronic acid).

[0382] Nucleic acid molecules can be included in compositions or complexes with polyethyleneimine (eg, linear or branched PEI) and / or derivatives of polyethyleneimine, including, for example, transplanted PEI, such as galactose derivatives PEI, cholesterol PEI, antibody derived PEI and polyethylene glycol PEI (PEG-PEI) (see, for example, Ogris et al., 2001, AAPA PharmSci, 3, 1-11; Furgeson et al., 2003, Bioconjugate Chem., 14, 840-847; Kunath et al., 2002 , Pharmaceutical Research, 19, 810-817; Choi et al., 2001, Bull. Korean Chem. Soc., 22, 46-52; Bettinger et al., 1999, Bioconjugate Chem., 10, 558-561; Peterson et al., 2002, Bioconjugate Chem., 13, 845-854; Erbacher et al., 1999, Journal of Gene Medicine Preprint, 1, 1-1 8; Godbey et al., 1999., PNAS USA, 96, 5177-5181; Godbey et al., 1999, Journal of Controlled Release, 60, 149-160; Diebold et al., 1999, Journal of Biological Chemistry, 274 , 19087-19094; Thomas and Klibanov, 2002, PNAS USA, 99.14640-14645; and Sagara, U.S. Patent No. 6,586,524.

[0383] Nucleic acid molecules may include a bioconjugate, for example, a nucleic acid conjugate as described by Vargeese et al., US 10/427,160; U.S. Patent No. 6,528,631; U.S. Patent No. 6,335,434; U.S. Patent No. 6,235,886; U.S. Patent No. 6,153,737; U.S. Patent No. 5,214,136; U.S. Patent No. 5,138,045.

[0384] Compositions, methods and kits according to the present description may include an expression vector that includes a nucleic acid sequence encoding at least one nucleic acid molecule according to the present invention, so that it promotes the expression of the nucleic acid molecule. Methods for introducing nucleic acid molecules or one or more vectors capable of expressing dsRNA chains in a cell’s environment will depend on the type of cell and its composition. A nucleic acid molecule or vector construct can be injected directly into the cell (i.e., intracellularly) or introduced extracellularly into the cavity, interstitial space, into the blood circulation of the body, administered orally, or can be administered by immersion of the body or cell in a solution containing dsRNA. The cell is preferably a mammalian cell, more preferably a human cell. The nucleic acid molecule of the expression vector may include a sense region and an antisense region. The antisense region may include a sequence complementary to the sequence of RNA or DNA encoding hsp47, and the sense region may include a sequence complementary to the antisense region. A nucleic acid molecule may include two separate chains having complementary sense and antisense regions. A nucleic acid molecule may include one strand having complementary sense and antisense regions.

[0385] Nucleic acid molecules that interact with target RNA molecules and suppress a gene encoding target RNA molecules (for example, target RNA molecules denoted by Genbank access numbers in the present description) can be expressed from transcription units inserted into DNA vectors or RNA. Recombinant vectors can be plasmid DNA and viral vectors. A nucleic acid molecule expressing viral vectors can be created based on, but not limited to, an adeno-associated virus, retrovirus, adenovirus, or alphavirus. Recombinant vectors capable of expressing nucleic acid molecules can be delivered as described herein and stored in target cells. Alternatively, viral vectors can be used that facilitate the transient expression of nucleic acid molecules. Such vectors can be re-entered if necessary. After expression, nucleic acid molecules bind to and suppress gene function or expression through RNA interference (RNAi). The delivery of the nucleic acid molecule expressing the vectors can be systemic, for example, by intravenous or intramuscular injection, by implanting into target cells explanted from the patient, followed by re-administration to the patient, or by other methods that allow the target cell to be introduced.

[0386] The expression vectors may include a nucleic acid sequence encoding at least one nucleic acid molecule according to the present description, in a manner that facilitates the expression of the nucleic acid molecule. For example, the vector may contain sequence (s) encoding both strands of the nucleic acid molecule, which include duplex. Also, the vector may contain a sequence (s) encoding a single nucleic acid molecule that is complementary to itself and thus forms a nucleic acid molecule. Non-limiting examples of such expression vectors are described in Paul et al., 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19, 500; and Novina et al., 2002, Nature Medicine, preliminary Internet publication doi: 10.1038 / nm725. Expression vectors can also be incorporated into a mammalian (eg, human) cell.

[0387] The expression vector may include a nucleic acid sequence encoding two or more nucleic acid molecules, which may be the same or different. Expression vectors may include a nucleic acid molecule sequence complementary to a nucleic acid molecule under access number Genbank NM_001235, for example, shown in Table I.

[0388] The expression vector may encode one or both strands of a nucleic acid duplex, or one strand complementary to itself, which hybridizes with itself to form a nucleic acid duplex. Nucleic acid sequences encoding nucleic acid molecules can be functionally linked in a way that facilitates expression of the nucleic acid molecule (see, for example, Paul et al., 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19,497; Lee et al., 2002, Nature Biotechnology, 19, 500; and Novina et al., 2002, Nature Medicine, preliminary Internet publication doi: 10.1038 / nm725).

[0389] The expression vector may include one or more of the following: a) a transcription initiation site (eg, an eukaryotic polymerase I, II or III initiation site); b) a transcription termination site (for example, an eukaryotic polymerase I, II, or III termination site); c) an intron; and d) a nucleic acid sequence encoding at least one nucleic acid molecule, said sequence being operably linked to an initiation site and a termination site in a manner that facilitates expression and / or delivery of the nucleic acid molecule. The vector may include an open reading frame (ORF) for the protein, functionally connected to the 5 ′ side or 3 ′ side of the sequence encoding the nucleic acid molecule; and / or intron (intermediate sequences).

[0390] Transcription of nucleic acid molecule sequences can be initiated from a promoter of eukaryotic RNA polymerase I (pol I), RNA polymerase (pol II), or RNA polymerase III (pol III). Transcripts of the pol II or pol III promoters are expressed in the cell at a high level; the levels of this pol II promoter in this type of cell depends on the nature of the regulatory sequences of the gene (enhancers, silencers, etc.) located nearby. Prokaryotic RNA polymerase promoters are also used if the prokaryotic RNA polymerase enzyme is expressed in appropriate cells (Elroy-Stein and Moss, 1990, Proc. Natl. Acad. Sci. USA, 87, 6743-7; Gao and Huang 1993, Nucleic Acids Res. , 21, 2867-72; Lieber et al., 1993, Methods Enzymol., 217, 47-66; Zhou et al., 1990, Mol. Cell. Biol., 10, 4529-37). Several researchers have shown that nucleic acid molecules expressed from such promoters can function in mammalian cells (e.g., Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Ojwang et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6; Chen et al., 1992, Nucleic Acids Res., 20, 4581-9; Yu et al., 1993, Proc. Natl. Acad. Sci. USA , 90, 6340-4; L'Huillier et al., 1992, EMBO J., 11, 4411-8; Lisziewicz et al., 1993, Proc. Natl. Acad. Sci. USA 90, 8000-4; Thompson et al., 1995, Nucleic Acids Res., 23, 2259; Sullenger & Cech, 1993, Science, 262, 1566). More specifically, transcription units, for example, derived from genes encoding U6 small nuclear (snPHK), transport RNA (tPHK) and adenoviral VA RNAs, are useful in obtaining high concentrations of the desired RNA molecules, such as siNAs, in cells (Thompson et al ., formerly; Couture and Stinchcomb, 1996, formerly; Noonberg et al., 1994, Nucleic Acid Res., 22, 2830; Noonberg et al., US Pat. No. 5,624,803; Good et al., 1997, Gene Ther. , 4, 45; Beigelman et al., PCT International Publication No. WO 96/18736. The above transcripts of nucleic acids can be inserted into various vectors for introduction into mammalian cells, including but not limited to limited to, plasmid DNA vectors, viral DNA vectors (such as adenovirus based vectors or adeno-associated virus) or viral RNA vectors (such as retroviral or alphavirus vectors) (see. Couture and Stinchcomb, 1996 above).

[0391] A nucleic acid molecule can be expressed in a cell from eukaryotic promoters (eg, Izant and Weintraub, 1985, Science, 229, 345; McGarry and Lindquist, 1986, Proc. Natl. Acad. Sci., USA 83, 399; Scanlon et al., 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Dropulic et al., 1992, J . Virol., 66, 1432-41; Weerasinghe et al., 1991, J. Virol., 65, 5531-4; Ojwang et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6 ; Chen et al., 1992, Nucleic Acids Res., 20, 4581-9; Sarver et al., 1990 Science, 247, 1222-1225; Thompson et al., 1995, Nucleic Acids Res., 23.2259; Good et al., 1997, Gene Therapy, 4, 45. Those skilled in the art will recognize that any nucleic acid can be expressed in eukaryotic cell with the corresponding DNA / RNA vector. The activity of such nucleic acids can be enhanced by their release from the primary transcript using an enzymatic nucleic acid (Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595 ; Ohkawa et al., 1992, Nucleic Acids Symp. Ser., 27, 15-6; Taira et al., 1991, Nucleic Acids Res., 19, 5125-30; Ventura et al., 1993, Nucleic Acids Res., 21.3249-55; Chowrira et al., 1994, J. Biol. Chem., 269, 25856.

[0392] A viral construct packaged in a viral particle will both efficiently incorporate the expression construct into the cell and transcribe the dsRNA construct encoded by the expression construct.

[0393] Oral administration methods include directly mixing RNA with the body’s food, as well as genetic engineering methods in which the species that are used as food are modified by engineering methods to express RNA, then fed to the body to be acted upon. Physical methods can be used to introduce a solution of a nucleic acid molecule into a cell. Physical methods for introducing nucleic acids include injecting a solution containing a nucleic acid molecule, bombarding particles coated with a nucleic acid molecule, holding a cell or organism in an RNA solution, or electroporation of cell membranes in the presence of a nucleic acid molecule.

[0394] Other methods known in the art for introducing nucleic acids into cells can be used, such as lipid-mediated carrier transfer, chemically mediated transport, for example calcium phosphate, and the like. Thus, nucleic acid molecules can be introduced together with components that perform one or more of the following actions: enhance the absorption of RNA by the cell, ensure hybridization of the duplex chains, stabilize hybridized chains, or otherwise enhance the suppression of the target gene.

[0395] Nucleic acid molecules or a vector construct can be introduced into the cell using acceptable dosage forms. One preferred dosage form is a lipid form, for example, liposomes coupled with Lipofectamine ™ 2000 (Invitrogen, CA, USA), Vitamin A (Sato et al. Nat Biotechnol 2008; 26: 431-442, PCT Patent Publication No. WO 2006 / 068232). Also, lipid dosage forms can be administered to animals, for example, by intravenous, intramuscular, or intraperitoneal injection, or orally or by inhalation, or by other methods known in the art. If the dosage form is suitable for administration to animals, for example, mammals and more specifically to humans, the dosage form is also pharmaceutically acceptable. Pharmaceutically acceptable dosage forms for the administration of oligonucleotides are known and can be used. In some cases, it may be preferable to prepare the dsRNA dosage forms in buffer or physiological saline and directly inject the dsRNA dosage form into the cells, for example, as in oocyte studies. Direct injection of dsRNA duplexes can also be performed. For acceptable methods of administering dsRNA, see published application for US Patent No. 2004/0203145, 20070265220, which is incorporated herein by reference.

[0396] Polymeric nanocapsules or microcapsules accelerate the transport and release of encapsulated or bound dsRNA into the cell. They include polymeric and monomeric materials, especially including polybutyl cyanoacrylate. A review of materials and manufacturing techniques has been published (see Kreuter, 1991). Polymeric materials that are formed from monomeric and / or oligomeric precursors in the polymerization / nanoparticle preparation step are known per se from the prior art, as well as the molecular weight and molecular weight distribution of the polymeric material that a person skilled in the art of manufacturing nanoparticles can choose according to with ordinary skills.

[0397] The nucleic acid molecules may be in the form of a microemulsion dosage form. A microemulsion is a system of water, oil, and an amphiphilic substance, which is a separate solution of an optically isotropic and thermodynamically stable liquid. Typically, microemulsions are prepared by first dispersing the oil in an aqueous solution of a surfactant and then adding a sufficient amount of the fourth component, usually an alcohol with an intermediate chain length, to form a clear system.

[0398] Surfactants that can be used in the preparation of microemulsions include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoxyethylene oleic acid esters, polyglycerol and fatty acid esters, tetraglycerol monolaurate (ML310) , tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocarpate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleol decateolate (SO750), DA707) individually or in combination with secondary surfactants. A secondary surfactant, usually a short-chain alcohol, such as ethanol, 1-propanol and 1-butanol, serves to increase the fluidity at the interphase boundary by penetrating the surfactant into the film and creating a disordered film due to the vacuum created between the surface molecules active substance.

[0399] Water-soluble crosslinked polymers

[0400] Dosage forms for delivery may include cross-linked water-soluble degrading polymers that include one or more degradable cross-linked lipid groups, one or more групп groups and / or one or more mPEG (PEG methyl ether derivatives (methoxypoly (ethylene glycol)) .

[0401] Degradable lipid groups preferably include compounds having the following structural motif:

[0402] In the formula above, ester bonds are biodegradable groups, R is a relatively hydrophobic "lipo" group, and the structural motif shown occurs when m is in the range of from about 1 to about 30. For example, in some embodiments, R is selected from the group consisting of C2-C50 alkyl, C2-C50 heteroalkyl, C2-C50 alkenyl, C2-C50 heteroalkenyl, C5-C50 aryl; C2-C50 heteroaryl; C2-C50 alkynyl, C2-C50 heteroalkynyl, C2-C50 carboxyalkenyl and C2-C50 carboxyheteroalkenyl. According to preferred embodiments, R is a saturated or unsaturated alkyl having 4-30 carbon atoms, more preferably 8-24 carbon atoms or sterol, preferably a cholesterol group. According to preferred embodiments, R is oleic, lauric, myristic, palmitic, margarine, stearic, arachidonic, behenic or lignoceric. In the most preferred embodiment, R is oleic.

[0403] N in the formula (A) may have a pair of electrons or a bond with a hydrogen atom. If N has a pair of electrons, the repeating unit may be cationic at low pH.

[0404] The decomposable cross-linked lipid group can react with polyethyleneimine (PEI), as shown in Scheme A below:

[0405] In Scheme (A), R has the same meanings as described above. ΡΕΙ may contain repeating units of formula (B) in which x is an integer in the range of from about 1 to about 100, and y is an integer in the range of from about 1 to about 100.

[0406] The reaction depicted in Scheme A can be carried out by mixing ΡΕΙ with diacrylate (I) in a mutual solvent such as ethanol, methanol or dichloromethane, with stirring, preferably at room temperature for several hours, then evaporating the solvent to isolate the obtained polymer . Not wanting to be bound by any particular theory, it is believed that the reaction between ΡΕΙ and diacrylate (I) includes the Michael reaction between one or more amines ΡΕΙ with diacrylate double bond (s) (see J. March, Advanced Organic Chemistry 3rd Ed., pp. 711-712 (1985)). The diacrylate shown in Scheme A can be prepared as described in US Application No. 11 / 216,986 (US Publication No. 2006/0258751).

[0407] The molecular weight of PEI is preferably in the range of from about 200 to 25,000 Daltons, more preferably 400-5,000 Daltons, even more preferably 600-2000 Daltons. PEI can be either branched or linear.

[0408] The molar ratio of PEI to diacrylate is preferably in the range of from about 1: 2 to about 1:20. The average molecular weight of the cationic lipopolymer can range from about 500 Daltons to about 1,000,000 Daltons, preferably from about 2,000 Daltons to about 200,000 Daltons. Molecular weight can be determined by gel chromatography using PEG standards or by agarose gel electrophoresis.

[0409] The cationic lipopolymer is preferably degradable, more preferably biodegradable, for example, degradable by a mechanism selected from the group consisting of hydrosil, enzymatic degradation, reduction, photo degradation and ultrasonic degradation. Not wanting to be bound by a certain theory, but it is believed that after the destruction of the cationic lipopolymer of formula (II) in the cell, enzymatic cleavage and / or hydrolysis of ester bonds occurs.

[0410] The synthesis can be carried out by reacting a degradable lipid group with a PEI group as described above. Then, mPEG (methylether derivative of PEG (methoxypoly (ethylene glycol)) is added to form a degrading crosslinked polymer. According to preferred embodiments, the reaction is carried out at room temperature. The reaction products can be isolated by any means known in the art, including chromatographic methods. According to a preferred embodiment sales of the product can be removed using precipitation, followed by centrifugation.

Dosage

[0411] Useful dosages for administration and the specific route of administration will vary depending on factors such as the type of cell, or for in vivo use, age, weight and the specific animal and body part to be treated, the specific nucleic acid and the method used delivery, the intended therapeutic or diagnostic use and form of the dosage form, for example, a suspension, emulsion, micelle or liposome, which will be obvious to experts in this field of technology. Typically, the dose is administered at lower levels and increased until the desired effect is achieved.

[0412] If lipids are used to deliver a nucleic acid, the amount of lipid compound that is administered can vary and usually depends on the amount of nucleic acid that is administered. For example, the weight ratio of the lipid compound to the nucleic acid is preferably about 1: 1 to about 30: 1, with a weight ratio of about 5: 1 to about 10: 1 being more preferred.

[0413] Acceptable dosage units for nucleic acid molecules can be in the range of 0.001-0.25 milligrams per kilogram of recipient body weight per day, or in the range of 0.01-20 micrograms per kilogram of body weight per day or in the range of 0.01-10 micrograms per kilogram of body weight per day or in the range of 0.10-5 micrograms per kilogram of body weight per day or in the range of 0.1-2.5 micrograms per kilogram of body weight per day.

[0414] Acceptable quantities of nucleic acid molecules can be entered and these quantities can be determined empirically using standard methods. Effective concentrations of certain types of nucleic acids in the cell medium can leave approximately 1 femtomolar, approximately 50 femtomolar, 100 femtomolar, 1 picomolar, 1.5 picomolar, 2.5 picomolar, 5 picomolar, 10 picomolar, 25 picomolar, 50 picomolar, 100 picomolar, 500 picomolar, 1 nanomolar, 2.5 nanomolar, 5 nanomolar, 10 nanomolar, 25 nanomolar, 50 nanomolar, 100 nanomolar, 500 nanomolar, 1 micromolar, 2.5 micromolar, 5 micromolar, 10 micromolar, 100 micromolar

[0415] The dosage may be from 0.01 μg to 1 g per kg of body weight (eg, 0.1 μg, 0.25 μg, 0.5 μg, 0.75 μg, 1 μg, 2.5 μg, 5 mcg, 10 mcg, 25 mcg, 50 mcg, 100 mcg, 250 mcg, 500 mcg, 1 mg, 2.5 mg, 5 mg, 10 mg, 25 mg, 50 mg, 100 mg, 250 mg or 500 mg per kg )

[0416] Dose levels of the order of from about 0.1 mg to about 140 mg per kg of body weight per day are useful for treating the conditions listed above (about 0.5 mg to about 7 g per patient per day). The amount of active ingredient that can be combined with a carrier to form a unit dosage form varies depending on the host being treated and the particular route of administration. Unit dosage forms usually contain from about 1 mg to about 500 mg of the active ingredient.

[0417] It will be understood that a particular dose level for any particular patient depends on many factors, including the activity of the particular compound used, age, body weight, general health, gender, nutrition, time of administration, route of administration and rate of excretion, drug combination and the severity of the particular disease being treated.

[0418] Pharmaceutical compositions that include a nucleic acid molecule according to the present description can be entered once daily, four times a day, three times a day, twice a day, daily or at any interval and for any time that is acceptable with medical points of view. However, the therapeutic agent can also be included in the dose in dosage units containing two, three, four, five, six or more parts of the dose administered at appropriate intervals throughout the day. In this case, the nucleic acid molecules contained in each part of the dose may be correspondingly smaller in order to provide a complete daily dosage unit. Also, a dosage unit may be formulated for a single dose over several days, for example, using a conventional sustained release dosage form that provides a sustained and consistent release of dsRNA over several days. Sustained release dosage forms are well known in the art. The dosage unit may contain an appropriate multiple of the daily dose. The composition can be formulated so that the sum of the multiple units of nucleic acid together contain a sufficient dose.

Pharmaceutical compositions, kits and containers

[0419] Also provided are compositions, kits, containers and dosage forms that include a nucleic acid molecule (eg, siNA molecule) as described herein to reduce the expression of hsp47 for introducing or distributing the nucleic acid molecule to a patient. The kit may include at least one container and at least one label. Suitable containers include, for example, bottles, ampoules, syringes, and test tubes. Containers may be formed from various materials, such as glass, metal or plastic. The container may comprise an amino acid sequence (s), a small molecule (s), a nucleic acid sequence (s), a population (population) of cells and / or an antibody (antibodies). According to one embodiment, the container comprises a polynucleotide for use to study a cell mRNA expression profile along with reagents used for this purpose. According to another embodiment, the container comprises an antibody, a binding fragment thereof or a specific binding protein for use to evaluate the expression of hsp47 protein in cells and tissues or for appropriate laboratory, prognostic, diagnostic, preventive and therapeutic purposes; indications and / or directions for such applications may be included on or with containers such as reagents and other compositions or instruments used for such purposes. The kit may also include associated indications and / or indications, reagents and other compositions or instruments used for such purposes may also be included.

[0420] In another case, the container may contain a composition that is effective for treating, diagnosing, predicting or preventing the condition, and may have a port for sterile access (for example, the container may be an intravenous solution packet or ampoule having a plug that can be punctured hypodermic needle for injection). The active agents in the composition may be a nucleic acid molecule capable of specifically binding to hsp47 and / or modulating the function of hsp47.

[0421] The kit may also include a second container that contains a pharmaceutically acceptable buffer, for example, phosphate buffered saline, Ringer's solution and / or dextrose solution. It may also include other materials desirable from a commercial or consumer point of view, including other buffers, diluents, filters, agitators, syringes and / or inserts with indications and / or instructions for use.

[0422] Single-dose ampoules or multi-dose containers in which nucleic acid molecules are packaged before use may include a hermetically sealed container containing an amount of polynucleotide or a solution containing a polynucleotide suitable for a pharmaceutically effective dose or several effective doses. The polynucleotide is packaged in a sterile dosage form and the hermetically sealed container is designed to maintain the sterility of the dosage form until use.

[0423] A container containing a polynucleotide comprising a sequence encoding a cellular immune response element or fragment thereof may include a package that has a label, and the label may carry a notice in the form prescribed by a government agency, for example. The Food and Drug Administration, which reflects the approval by the body under the federal law of the manufacture, use or distribution of polynucleotide material for human use.

[0424] Federal laws require that the use of pharmaceutical compositions for treating people be approved by the Federal Government Agency. In the United States, control is the responsibility of the Food and Drug Administration, which issues relevant regulations to guarantee such approval, described in detail in 21 U.S.C. § 301-392. Regulations for biological material, including products made from animal tissue, are provided by 42 U.S.C. § 262. A similar approval is necessary in most foreign countries. Regulations vary from country to country, but individual procedures are well known to those skilled in the art, and the compositions and methods of the present disclosure preferably correspond to them.

[0425] The dose for administration depends to a large extent on the condition and size of the patient to be treated, as well as on the frequency of treatment and route of administration. Schemes for continuing therapy, including dose and frequency, can be determined by the initial response and clinical assessment. A parenteral route of administration into the interstitial space of the tissue is preferred, but other parenteral routes of administration, for example, inhalation of an aerosol dosage form, may be required for specific administration, for example, to the mucous membranes of the nose, throat, bronchial tissue or lungs.

[0426] Therefore, the present disclosure provides a pharmaceutical product, which may include a polynucleotide comprising a sequence encoding an element of a cellular immune response or a fragment thereof, in a solution in a pharmaceutically acceptable injection vehicle and suitable for interstitial administration into tissue so that tissue cells express an element of the cellular immune response, the container contains the solution and notification along with the container in the form prescribed by the government agency, regulating m the manufacture, use or distribution of drugs, which reflects approval agency of manufacture, use or distribution of the polynucleotide solution for use in human.

Indications

[0427] The nucleic acid molecules of the present description can be used to treat diseases, conditions or disorders associated with hsp47, such as liver fibrosis, cirrhosis, pulmonary fibrosis, renal fibrosis, peritoneal fibrosis, chronic liver damage and fibrillogenesis, and any other disease or conditions that are associated with or responsive to hsp47 levels in a cell or tissue, individually or in combination with other treatments. For this reason, the compositions, kits, and methods of the present disclosure may include packaging a nucleic acid molecule as described herein that includes a decal or annotation. The etiquette may include indications for the use of nucleic acid molecules, for example, for the treatment or prevention of liver fibrosis, peritoneal fibrosis, kidney fibrosis and pulmonary fibrosis and any other disease or condition that are associated with or respond to hsp47 levels in a cell or tissue, individually or in combinations with other treatments. The label may include an indication for use to reduce the expression of hsp47. “Abstract” means instructions usually enclosed in commercial packaging of medicinal products that contain information about the indications, use, dosage, administration, contraindications, other therapeutic agents that can be combined with the packaged product, and / or warnings regarding the use of such therapeutic products and etc.

[0428] Those skilled in the art will appreciate that other methods for treating fibrosis, drugs and treatment methods known in the art can easily be combined with nucleic acid molecules as described herein (eg, siNA molecules), and thus This is also contemplated by the present invention.

[0429] The methods and compositions according to the present description will be described in more detail using the following non-limiting examples.

EXAMPLE 1

Selection of hsp47 nucleic acid sequences:

[0430] Nucleic acid molecules (eg, siNA≤25 nucleotides) against Hsp47 were obtained using several computer programs, including siRNA at the Whitehead Institute (Whitehead Institute for Biomedical Research), IDT siRNA Design (Integrated DNA Technologies), BLOCK-iT RNAi Designer (Invitrogen), siDESIGN Center (Dharmacon) and BIOPREDsi (Friedrich Miescher Institute for Biomedical Research, part of the Novartis Research Foundation, link http://www.biopredsi.org/start.html). The sequences of the uppermost siRNAs from these programs were compared and selected (see Table 1) by algorithms, as well as sequence homology between a human and a rat. Candidate sequences were confirmed using in vitro knockout assays.

[0431] When selecting sequences of nucleic acid molecules (for example, 21-dimensional siRNA), several parameters were taken into account. Examples of parameters include:

1) thermodynamic stability (RISC favors a chain with a less stable 5'-end)

2) the content of GC pairs 30-52%

3) a preferred arrangement of nucleotides:

(C / G) NNNNNNNN (A / U) 10NNNNNNNN (A / U), wherein N is any nucleotide

4) devoid of alleged immunostimulatory motives

5) 3'-protruding end of 2 nucleotides

6) the location of siRNAs within the transcript (preferably within the cDNA region)

7) sequence specificity (verified using BLAST)

8) differences in individual nucleotides when checking the SNP database

[0432] Developed siRNA sequences containing ≤25 nucleotides, based on the methods described. Received the corresponding siRNA substrate for Dicer (for example, ≥26 nucleotides), based on smaller sequences, and extended the target site siNA≤25 nucleotides by adding 4 bases to the 3'-end of the sense strand and 6 bases to the 5'-end of the antisense strand . The substrates for Dicer that were obtained usually had a sense base of 25 bases, an antisense chain of 27 bases with an asymmetric molecule having a blunt end and a protruding 3'-end. The sequences of the sense and antisense chains without modification of the base (base sequence) and with modifications (experimental sequence) are shown in Table 1.

EXAMPLE 2

[0433] For screening the activity of various siHK molecules against rat and human hsp47 genes, a variety of reporter cell lines were obtained by introducing human HSP47 cDNA labeled with green fluorescent protein (GFP) or rat GP46 cDNA construct with GFP in cell line 293, HT1080, HSC line human hTERT or NRK line. Then, anti-GFP siRNA was determined in the indicated cell lines. The residual fluorescence signal was measured and normalized with respect to random siRNA (Ambion) and then normalized by cell viability. The results showed that anti-GFP siRNA suppresses fluorescence to varying degrees in different cell lines (Fig. 1). The 293_HSP47-GFP and 293_GP46-GFP cell lines were selected by siHsp47 screening because of their ease of transfection and sensitivity to suppression of fluorescence.

SiRNA Transfection:

[0434] Cells were transfected with 1.5 pmol per well of anti-GFP siHK in 96-well cell culture plates using Lipofectamine RNAiMAX (Invitrogen) by reverse transfection. Cells were seeded at a density of 6,000 cells per well and mixed with siHK complexes. Fluorescence was read after 72 hours of incubation on a Synergy 2 Multi-Mode microplate reader (BioTek).

Cell viability analysis:

[0435] The viability of cells treated or not treated with siHK was determined after 72 hours of incubation using the CellTiter-Glo Luminescent Cell Viability Assay Kit in accordance with the instructions (Promega). Reading results were normalized relative to samples treated with random siHK molecules.

EXAMPLE 3

Evaluation of the effectiveness of the suppression of siHsp47 expression of hsp47 in reporter cell lines

[0436] Efficiency of suppressing siHK hsp47 in the 293 HSP47-GFP and 293_GP46-GFP cell lines was evaluated by detecting changes in the fluorescence signal of reporter GFP. The experiments were performed as described in Example 2. Fluorescence signals were normalized relative to fluorescence signals from cells treated with random siRNA (Ambion), which served as a control. The results showed that the studied hsp47 siNA molecules were effective in suppressing hsp47 mRNA in both cell lines. However, anti-GP46 mRNA siNA (according to 2008 publication Sato et al) was only effective against the 293_GP46-GFP cell line. The results are shown in Figure 2A-B.

[0437] The viability of 293_HSP47-GFP and 293_GP46-GFP cell lines treated with anti-hsp47 and gp46 siRNAs was determined using the methods described in Example 2. Cell viability was normalized with respect to cells treated with random siRNAs (Ambion). The results showed that treatment with siNA molecules did not have a significant effect on cell viability. However, the viability of 293_HSP47-GFP cell lines treated with different hsp47 siNAs differed depending on the siNA molecules used, while the viability of 293_GP46-GFP cell lines was similar. The viability of 293_HSP47-GFP cells was lower in cells treated with siHsp47-6 and Hsp47-7 than in other cells. The results are shown in Figure 2C-D.

EXAMPLE 4

Assessment of the inhibitory effect of siHsp47 on hsp47 mRNA by TaqMan® quantitative PCR

[0438] In Example 3, the effectiveness of the suppression of siHsp47s in reporter cell lines was evaluated by the change in the fluorescence signal. In order to justify the result of the mRNA level, siRNAs directed to endogenous hsp47 transfected human hTERT stem cells using Lipofectamine RNAiMAX (Invitrogen) using the reverse transfection method as described in Example 2.

[0439] The level of hsp47 mRNA was evaluated by the effectiveness of the suppression of various studied siHsp47 siNA molecules. Briefly, mRNA was isolated from hTERT cells 72 hours after transfection using an RNeasy mini-kit (Qiagen). The hsp47 mRNA level was determined by the method of quantitative PCR with reverse transcription using TaqMan® probes. Briefly, cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription (ABI) kit according to the manufacturer's instructions, and analyzed by TaqMan Gene Expression Assay (ABI, hsp47 analysis ID Hs01060395_gl). The hsp47 mRNA level was normalized relative to the level of GAPDH mRNA according to the manufacturer's instructions (ABI). The results showed that siHsp47-C was the most effective among all hsp47 siRNAs, siHsp47-2 and siHsp47-2d were in second place in terms of efficiency. Combinations of siHsp47-1 with siHsp47-2 or siHsp47-1 with siHsp47-2d were more effective than siHsp47-1 alone. The results are shown in Figure 3.

EXAMPLE 5

Confirmation of the effect of suppressing siHsp47 at the protein level

[0440] The suppressive effect of various Hsp47 siNA molecules (siHsp47) on the expression of hsp47 mRNA was confirmed at the protein level by measuring HSP47 in hTERT cells transfected with various siHsp47. Transfection of hTERT cells with various siHsp47 was carried out as described in Example 2. Transfected hTERT cells were lysed and cell lysates precipitated by centrifugation. Proteins in the purified cell lysate were separated by SDS polyacrylamide gel electrophoresis. The level of HSP47 protein in the cell lysate was determined using anti-HSP47 antibody (Assay Designs) as a primary antibody, goat anti-mouse IgG antibodies conjugated to HRP (Millipore) as a secondary antibody, followed by detection using a Supersignal West Pico Chemiluminescence kit (Pierce) . Antin antibody (Abeam) was used as a control of protein loading. The results showed a significant decrease in the level of Hsp47 protein in cells treated with siHsp47-C, siHsp47-2d, individually or by a combination of siHsp47-1 with siHsp47-2d.

EXAMPLE 6

Suppression of hsp47 collagen I siRNA expression

[0441] To determine the effect of siHsp47 on the level of collagen I expression, the level of collagen I mRNA was determined in hTERT cells treated with various anti-hsp47 siRNAs. Briefly, hTERT cells were transfected with various siHsp47 as described in Example 2. Cells were lysed after 72 hours and mRNA was isolated using the RNeasy mini-kit according to the instructions (Qiagen). The level of collagen I mRNA was determined by the method of quantitative PCR with reverse transcription using TaqMan® probes. Briefly, cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription (ABI) kit according to the instructions and was analyzed by TaqMan Gene Expression Assay (ABI, COL1A1 ID kit Hs01076780_g1). Collagen I mRNA was normalized to GAPDH mRNA according to manufacturer's instructions (ABI). The signals were normalized relative to the signal obtained from cells transfected with random siNAs. The results showed that the level of collagen I mRNA was significantly reduced in cells treated with some candidate siHsp47-2, siHsp47-2d and their combinations with siHsp47-1, as shown in Figure 4.

EXAMPLE 7

Immunofluorescence staining of hTERT cells treated with hsp47 siRNA

[0442] To visualize the expression of two markers of fibrosis — collagen I and smooth muscle alpha actin (SMA) —in hTERT cells transfected or not transfected with siHsp47, the cells were stained with rabbit anti-collagen I antibody (Abeam) and mouse anti-alpha SMA antibody ( Sigma). Goat antibodies Alexa Fluor 594 against mouse IgG and goat antibodies Alexa Fluor 488 against rabbit IgG (Invitrogen (Molecular Probes)) were used as secondary antibodies to visualize collagen I (green) and alpha-SMA (red). Hoescht was used to visualize the core (blue). The results showed a correlation between the suppression of siRNAs of certain target genes and the expression of collagen / SMA.

EXAMPLE 8

In vivo SJHSP47 study in animal models of liver fibrosis

[0443] siRNA for the treatment of cirrhosis of rat liver.

The sequence of the HSP47 siRNA duplex (siHSP47C) is presented below.

Semantic (5 '-> 3') ggacaggccucuacaacuaTT

Antisense (5 '-> 3') uaguuguagaggccuguccTT

[0444] A 10 mg / ml siRNA stock solution was prepared by dissolving in nuclease-free water (Ambion). For the treatment of rats with cirrhosis, a dosage form of siRNA with a liposome combined with vitamin A was prepared as described in Sato et al (Sato Y. et al. Nature Biotechnology 2008. Vol.26, p431) in order to act on activated stellate cells the liver that produce collagen. The composition of vitamin A (VA) -liposome-siRNA consisted of 0.33 μmol / ml VA, 0.33 μmol / ml liposome (Coatsome EL-01-D, NOF Corporation) and 0.5 μg / μl siRNA in 5% solution glucose.

[0445] A report on an animal model of cirrhosis is provided in Sato et al (Sato Y. et al. Nature Biotechnology 2008. Vol.26, p431). Liver cirrhosis in 4-week-old male SD mice was induced with 0.5% dimethylnitrosamine (DMN) (Wako Chemicals, Japan) in phosphate buffer (PBS). A dose of 2 ml / kg of body weight was administered intraperitoneally for 3 consecutive days per week at 0, 2, 4, 7, 9, 11, 14, 16, 18, 21, 23, 25, 28, 30, 32, 34, 36 , 38 and 40 days.

[0446] SiRNA Treatment: SiRNA treatment was performed starting from day 32 and for 5 intravenous injections. In more detail, rats were treated with siRNAs on days 32, 34, 36, 38 and 40. Then the rats were killed on 42 or 43 days. Three different doses of siRNAs were studied (1.5 mg siRNA per kg body weight, 2.25 mg siRNA per kg body weight, 3.0 mg siRNA per kg body weight). A detailed description of the study groups and the number of animals in each group are presented below:

1) Cirrhosis was caused by injection of DMN, then 5% glucose was administered instead of siRNA) (n = 10)

2) VA-Lip-siHSP47C 1.5 mg / kg (n = 10)

3) VA-Lip-siHSP47C 2.25 mg / kg (n = 10)

4) VA-Lip-siHSP47C 3.0 mg / kg (n = 10)

5) False treated animals (instead of DMN, PBS was administered. 5% glucose was administered instead of siRNA) (n = 6)

6) Control without treatment (intact) (n = 6)

VA-Lip denotes a complex of vitamin A - liposome.

[0447] Evaluation of therapeutic efficacy: On day 43, 2 out of 10 animals in the "sick rats" group and 1 out of 10 animals in the "VA-Lip-siHSP47C siRNA 1.5 mg / kg" group died due to the development of cirrhosis. The remaining animals survived. After the animals were sacrificed, liver tissue was fixed in 10% formalin. Then, the left lobe of each liver was embedded in paraffin for histological examination. Tissue sections were stained with Sirius red and hematoxylin and eosin (HE). Sirius red staining was used to visualize collagen deposits to determine the degree of cirrhosis. HE staining was used for contrast staining of nuclei and cytoplasm. Each glass was examined under a microscope (BZ-8000, Keyence Corp. Japan) and the percentage of area on a section stained with Sirius red was determined using image analysis software attached to the microscope. At least 4 glasses were prepared from each liver for image analysis, and the entire area of each glass (liver section) was photographed with a camera and analyzed. Statistical processing was performed using the Student t-test method.

[0448] Results: Figure 5 shows areas of fibrosis. The area of fibrosis in the group of “diseased rats” was greater than in the “falsely treated” or “untreated” groups. Thus, DMN treatment caused collagen deposition in the liver, which is usually observed with liver fibrosis. However, the fibrosis area was significantly reduced by siRNA treatment directed to the HSP47 gene, compared with the group of "diseased rats" (Figure 5). The results showed that siRNA according to the present description has therapeutic efficacy in this disease.

[0449] Additional siRNA compounds were tested in an animal model of liver fibrosis and showed that they reduce the area of fibrosis in the liver.

EXAMPLE 9

Obtaining sequences of active compounds of double-stranded RNA to HSP47 / SERPINH1 and obtaining siRNAs presented in Tables A-18, A-19 and B-E.

[0450] Using proprietary algorithms and known target gene sequences, sequences of many strong siRNAs were synthesized. These sequences, which were synthesized using this method, were complementary to the corresponding mRNA sequence.

[0451] Duplexes were obtained by hybridization of complementary single-stranded oligonucleotides. In a laminar box, approximately 500 μMol of single-stranded oligonucleotide stock solution was prepared by dilution in WFI (Water for Injection, Norbrook). Actual ssRNA concentrations were determined by diluting every 500 μM ssRNA in a ratio of 1: 200 using WFI and measuring OD using Nano Drop. This procedure was repeated 3 times and the average concentration was calculated. Then the mother liquor was diluted to a final concentration of 250 μmol. The complementary individual chains were hybridized by heating to 85 ° C and cooling to room temperature for at least 45 minutes. The full hybridization of duplexes was checked by applying 5 μl to a 20% polyacrylamide gel and staining. Samples were stored at -80 ° C.

[0452] Tables A-18, A-19, and BE show siRNAs for HSP47 / SERPINH1. For each gene, there is a separate list of 19-dimensional siRNA sequences that are priority based on the number of points in their own algorithm as the best sequences for targeting human gene expression.

[0453] The following abbreviations are used in Tables A-18, A-19 and B-E in the present description: “other species or Sp” means interspecific identity with other animals: D-dog, Rt-rat, Rb-rabbit, Rh- Rhesus macaque, P-pig, M-mouse; ORF: open reading frame. 19-mer and 18 + 1-mer denote oligomers of length 19 and 18 + 1 (U at position 1 of the antisense strand, A at position 19 of the sense strand) of ribonucleic acids, respectively.

In vitro studies targeting siRNA compounds to genes

Low-throughput screening (LTS) of siRNA oligos directed to the human and rat SERPINH1 gene.

[0454] Cell lines: Human RSZ prostate adenocarcinoma cells (ATCC, Cat # CRL-1435) were cultured in RPMI supplemented with 10% FBS and 2 mM L-Glutamine, and human cervical cancer cells HeLa (ATCC, Cat # CCL- 2) were cultured in the Needle medium in the modification of Dulbecco (DMEM) with the addition of 10% FBS, 2 mmol of L-glutamine. Cells were cultured at 37 ° C and 5% CO2.

[0455] About 2x10 ⁵ human PC-3 cells endogenously expressing the SERPINH1 gene were added to 1.5 ml of culture medium to achieve 30-50% confluency after 24 hours. Cells were transfected with Lipofectamine ™ 2000 reagent at a final concentration of 0.01-5 nMol per transfected cell. Cells were incubated at 37 ± 1 ° C, 5% CO ₂ for 48 hours. Cells transfected with siRNA were obtained and RNA was isolated using the EZ-PHK kit [Biological Industries (# 20-410-100)].

[0456] Reverse transcription was performed as follows: cDNA was synthesized and SERPINH1 mRNA levels were determined in real-time by PCR and normalized relative to cyclophilin A mRNA levels (CYNA, PPIA) for each sample. The siRNA activity was determined based on the ratio of the number of SERPINH1 mRNAs in the samples treated with siRNAs and in untransfected control samples.

[0457] The most active sequences were selected for further analyzes. As preferred compounds from Table A-18, siRNA compounds SERPINH1_2, SERPINH1_6, SERPINH1_13, SERPINH1_45 SERPINH1_45a, SERPINH1_51, SERPINH1_51a, SERPINH1_52 and SERPrNH1_86 were selected. As preferred compounds from Table A-19, siRNA compounds SERPINH1_4, SERPINH1_12, SERPINH1_18, SERPINH1_30, SERPINH1_58 and SERPINH1_88 were selected.

[0458] Other preferred compounds included SERPINH1_50, SERPINH1_67, SERPINH1_73, SERPINH1_74.

IC50 Values for Selected LTS SERPINH1 siRNA Oliges

[0459] About 2x10 ⁵ human PC-3 cells or 0.9x10 ⁵ rat REF52 cells endogenously expressing the SERPINH1 gene were inoculated in 1.5 ml of culture medium to achieve 30-50% confluency. Cells were transfected with SERPINH1 double-stranded RNA compounds (i.e. SERPINH1_2, 4, 6, 12, 13, 18, 45, 51, 58, 88) with Lipofectamine ™ 2000 reagent to achieve a final transfection concentration in the range of 0.0029-100 nMol. As a negative control, the cells were treated with Lipofectamme ™ 2000 reagent or synthetic siRNAs with a random sequence that was not specific for the target at final concentrations of 20-100 nMol. Cells transfected with siRNA labeled with Cy3 were used as a positive control of transfection efficiency.

[0460] Cells were incubated at 37 ± 1 ° C, 5% CO2 for 48 hours. Cells transfected with siRNA were obtained and RNA was isolated using the EZ-RNA kit [Biological Industries (# 20-410-100). Reverse transcription: cDNA synthesis was performed and human SERPINH1 mRNA levels were determined by real-time PCR and normalized to the cyclophilin A mRNA level (CYNA, PPIA) in each sample.

[0461] The IC50 values of the activity of the studied RNAi were determined by constructing a dose-response curve using activity results obtained with various final siRNA concentrations. The dose-response curve was constructed by plotting the relative amount of residual SERPINH1 mRNA on the diagram as a function of the logarithm of the concentration of the transfecting siRNA. The curve was calculated by plotting the best sigmoid curve from the measured data. The method of constructing a sigmoid curve is also known as building a curve using three points.

$$Y=Bot+\frac{\mathrm{one\; hundred}-Bot}{\mathrm{one}+{10}^{(LogIC\mathrm{fifty}-X)\times HillSlope}}$$

where Y is the residual response of SERPINH1 mRNA, X is the logarithm of the concentrations of transfected siRNAs, Bot is the Y value on the lower plateau, LogIC50 is the X value when Y is in the middle between the lower and upper plateaus, and HillSlope represents the slope of the curve.

[0462] The percentage of suppression of gene expression using specific siRNAs was determined using analysis of the target gene in cells expressing the endogenous gene by quantitative PCR. Other siRNA compounds from Tables A-18, A-19 and BE were studied in vitro, and it turned out that these siRNA compounds suppress gene expression. Activity is shown as the fraction of residual mRNA; accordingly, the lower the value, the higher the activity.

[0463] To check the stability of serum siRNA compounds, certain siRNA molecules were incubated in four different batches of human serum (100% concentration) at 37 ° C for 24 hours. Samples were collected after 0.5, 1, 3, 6, 8, 10, 16 and 24 hours. Migration parameters, as indicators, were determined at each moment of collection using polyacrylamide gel electrophoresis (PAGE).

[0464] Table 3 shows the IC50 (or activity, if IC50 is not calculated) in the human cell line for unmodified double stranded nucleic acid compounds (sense and antisense strands are unmodified, dTdT protruding ends at the 3'-end) selected from Tables A-18 and A-19.

Table 3 siRNA 1 position of the antisense chain Structure IC50 0.1 nMol 0.5 nMol 5 nMol SERPINH1_6_S709 U A2 0.019 SERPINH1_12_S709 BUT A1 0,065 SERPINH1_23_S709 U A2 0.377 SERPINH1_54_S709 BUT A1 0.522

SERPINH1_37_S709 U A2 0.11 SERPINH1_73_S709 A A1 0.189 SERPINH1_24_S709 U A2 0.271 SERPINH1_55_S709 A A1 0.268 SERPINH1_60_S709 U A2 0.163 SERPINH1_88_S709 A A1 0.135 SERPINH1_11_S709 U A2 0,079 SERPINH1_30_S709 A A1 0,093 SERPINH1_25_S709 U A2 0.229 SERPINH1_56_S709 A A1 0.469 SERPINH1_5_S709 U A2 0.178 SERPINH1_81_S709 G A1 1,404 SERPINH1_52_S709 U A2 0.06 SERPINH1_58_S709 A A1 0,304 SERPINH1_2_S709 U A2 0.008 SERPINH1_4_S709 A A1 0.006 SERPINH1_43_S709 U A2 1,403 SERPINH1_67_S709 A A1 2,39 SERPINH1_16_S709 U A2 134 95 16 SERPINH1_46_S709 A A1 112 84 28 SERPINH1_8_S709 U A2 103 90 39 SERPINH1_85_S709 FROM A1 166 109 59 SERPINH1_45_S709 U A2 0,029 SERPINH1_45a_S1354 A A2 0.051

The inhibitory activity of siRNAs:

[0465] About 2x10 ⁵ human PC-3 cells endogenously expressing the SERPINH1 gene were seeded in the well of 6 well plates and allowed to grow to 30-70% confluency for 24 hours. Cells were transfected with test siRNAs at various concentrations using Lipofectamine ™ 2000 reagent (Invitrogen). Cells were incubated at 37 ° C in an incubator at 5% CO2 for 48 hours or 72 hours. 48-72 hours after transfection, cells were harvested and RNA was isolated from the cells. Labeled Cy3 siRNA duplexes were used as a positive control of transfection efficiency. False transfected cells treated with Lipofectamine ™ 2000 reagent were designated as “control inactive samples” (“negative control”), and siRNA treated cells (HSP47-C) with known activity at a final concentration of 5 nMol were designated as “control active samples "(" Positive control "). Z 'and the orders of controls {order = average (negative) / medium (positive)} are means for describing the effectiveness of the analysis.

[0466] The relative suppression of the expression of the target gene of each studied siRNA was determined by quantitative PCR mRNA of the target from the cells. Reverse transcription was performed by synthesizing cDNA from cells and determining the mRNA levels of the target gene by real-time PCR. Measured mRNA levels in the cell were normalized relative to cyclophilin A mRNA levels (CYNA, PPIA) for each sample. The activity of siRNAs was determined by the ratio of the amount of mRNA of the target gene in the samples treated with siRNAs and in the control non-transfected samples. Z 'and the orders of controls {order = average (negative) / medium (positive)} are means for describing the effectiveness of the analysis.

[0467] The results of quantitative PCR were considered those that met the QC standards, ie the slope of the standard curve was in the range [-4, -3], R2> 0.99, without primer dimers. Results that did not meet QC requirements were excluded from the analysis.

[0468] The IC50 value of the activity of the studied RNAi was determined by constructing a dose-response curve using the activity results obtained at various final siRNA concentrations. The dose response curve was plotted by plotting the relative amount of residual SERPINH1 mRNA on the chart as a function of the logarithm of the concentration of the transfecting siRNA, as described above.

Checking the directivity and non-directionality of double-stranded RNA molecules:

[0469] The psiCHECK system evaluates the ability of a “lead chain” (GS) (antisense) and a satellite chain (PS) (sense chain) to induce directional (target) and non-directional effects by tracking changes in expression levels of their target sequences. Four constructs were prepared using psiCHECK ™ -2 (Promega) to evaluate the directed activity and possible undirected activity of each investigated GS and PS chain of the molecule. In each construct, one copy or three copies of the complete or seed sequence of the PS or GS molecule to be studied was cloned into a multiple cloning site located downstream of the stop codon of Renilla luciferase translation in the 3'-UTR region.

[0470] The resulting vectors were named:

[0471] 1-GS-CM (leading chain, full match) a vector containing one copy of the complete target sequence (nucleotide sequence, fully complementary to the whole sequence of 19 bases GS of the molecule under study);

[0472] 2-PS-CM (satellite chain, full match) a vector containing one copy of the complete target sequence (nucleotide sequence, fully complementary to the whole sequence of 19 bases PS of the molecule under study);

[0473] 3-GS-SM (lead chain, seed match), a vector containing one copy or three copies of the seed portion of the target sequence (a sequence complementary to nucleotides 1-8 GS of the molecule being studied);

[0474] 4-PS-SM (accompanying chain, seed match) a vector containing one copy of the seed portion of the target sequence (a sequence complementary to nucleotides 1-8 PS of the molecule under study).

Nomenclature:

[0475] Lead chain: a siRNA chain that crosses the RISC complex and directs cleavage / silencing of the complementary RNA sequence

[0476] Seeding sequence: Nucleotides 2-8 from the 5'-end of the control chain.

[0477] cm (full match): DNA fragment, fully complementary to the siRNA control chain. This DNA fragment was cloned into the 3'UTR of the reporter gene and it serves as a target for direct silencing of RNA.

[0478] sm (seed correspondence): 19-dimensional DNA fragment with ns 12-18 nullotides fully complementary to ns 2-8 siRNA control strands. This DNA fragment was cloned into the 3'UTR of the reporter gene, and it serves as a target for "undirected" silencing.

[0479] X1: one copy of cm or sm cloned into the 3'UTR of the reporter gene.

[0480] X3 Three copies of cm or sm, cloned into the 3'UTR of the reporter gene, separated from each other by 4 nucleotides.

Table 4 Non-limiting Examples of psiCHECK Cloning Targets Nomenclature Description Structure S2a_cm_X1 Clone Name SERPINH1_2, antisense is fully consistent = completely complementary to the antisense chain of SERPINH1_2, one copy. CTCGAG GAGACACATGGGTGCTATAG CGGCCGC SEQ_ID_NO: 2724 XhoI SERPINH1_2 sense chain NotI S2acmS_X1 Sense strand = strand of clone S2a_cm_X1 to be expressed in a vector, with protruding ends XhoI and NotI. 5'-TCGAGGAGACACATGGGTGCTATAGC SEQ_ID_NO: 2725 S2acmA_X1 Complementary (antisense) chain of clone S2a_cm_X1 with protruding ends XhoI and NotI. 5'-GGCCGCTATAGCACCCATGTGTCTCC SEQ_ID_NO: 2726 S2a_sm_X1 Clone Name SERPINH1_2, antisense seed match, single copy, nucleotides 12-18 are complementary to nucleotides 2-8 of the antisense strand SERPINH1_2. CTCGAG TCTCAAACGTTGTGCTATCG CGGCCGC SEQ_ID_NO: 2727 AS (3'-CTCTGTGTACCCACGATAT) SEQ_ID_NO: 2728 Priming S2s_cm_X1 Clone Name SERPINH1_2, full correspondence of the semantic = completely complementary to the semantic chain SERPINH1_2 = antisense chain, one copy. CTCGAG TATAGCACCCATGTGTCTC G CGGCCGC SEQ_ID_NO: 2729 XhoI SERPINH1_2 Antisense NotI S2s_sm_X1 Clone Name SERPINH1_2, semantic correspondence of the seed, one copy, is complementary to nucleotides 2-8 of the sense strand SERPINH1_2. CTCGAG GCGATACAAACTGTGTCTA G CGGCCGC SEO ID NO: 2730 S (3'- ATATCGTGGGTACACAGAG) SEQ_ID_NO: 2731 Seed

S2a_sm_X3 Clone Name SERPINH1_2, antisense seed match, three copies CTCGAG TCTCAAACGTTGTGCTATCttc cTCTCAAACGTTGTGCTATCttccTCTCA AACGTTGTGCTATC GCGGCCGC SEQ_ID_NO: 2732 (ttcc - spacer) S2s_sm_X3 Clone Name SERPINH1_2, semantic seed match, three copies CTCGAG GCGATACAAACTGTGTCTAtt ccGCGATACAAACTGTGTCTAttccGCG ATACAAACTGTGTCTA GCGGCCGC SEQ_ID_NO: 2733 (ttcc - spacer)

[0481] Target sequences were cloned using restriction sites compatible with XhoI and NotI enzymes. Hybridization mixtures were prepared in tightly closed 0.5 ml eppendorf tubes, heated in a water bath to 85 ° C, immersed in a boiling water bath, and finally gradually cooled to room temperature.

[0482] Ligation: Double-stranded oligonucleotides obtained using the hybridization procedure were ligated to linearized (using XhoI and NotI) psiCHECK ™ -2 and transfected with cells using standard methods. Positive colonies were determined and sequenced to confirm the sequence set. Table 5 shows the nucleotide sequences of inserted oligonucleotides.

Table 5 siRNA The full name of the clone SEQ ID NO: The sequence of the oligonucleotide (5 '> 3') SERPINH1_11 S11s_cm_X1 2734 GGCCGCCGGACAGGCCTCTACAACAC 2735 TCGAGTGTTGTAGAGGCCTGTCCGGC S11a_cm_X1 2736 GGCCGCTGTTGTAGAGGCCTGTCCGC 2737 TCGAGCGGACAGGCCTCTACAACAGC S11s_sm_X1 2738 GGCCGCAGGACAGGAAGAGCACCACC 2739 TCGAGGTGGTGCTCTTCCTGTCCTGC S11a_sm_X1 2740 GGCCGCGGTTGTAGCTTAAGGGAATC 2741 TCGAGATTCCCTTAAGCTACAACCGC S11s_sm_X3 2742 GGCCGCAGGACAGGAAGAGCACCACGGAAAGGACAG GAAGAGCACCACGGAAAGGACAGGAAGAGCACCACC

2743 TCGAGGTGGTGCTCTTCCTGTCCTTTCCGTGGTGCTCT TCCTGTCCTTTCCGTGGTGCTCTTCCTGTCCTGC S11a_sm_X3 2744 GGCCGCGGTTGTAGCTTAAGGGAATGGAAGGTTGTAG CTTAAGGGAATGGAAGGTTGTAGCTTAAGGGAATC 2745 TCGAGATTCCCTTAAGCTACAACCTTCCATTCCCTTAA GCTACAACCTTCCATTCCCTTAAGCTACAACCGC SERPINH1_30 S30s_cm_X1 2746 GGCCGCCGGACAGGCCTCTACAACTC 2747 TCGAGAGTTGTAGAGGCCTGTCCGGC S30a_cm_X1 2748 GGCCGCAGTTGTAGAGGCCTGTCCGC 2749 TCGAGCGGACAGGCCTCTACAACTGC SERPINH1_2 S2s_cm_X1 2750 GGCCGCGAGACACATGGGTGCTATAC 2751 TCGAGTATAGCACCCATGTGTCTCGC S2a_cm_X1 2752 GGCCGCTATAGCACCCATGTGTCTCC 2753 TCGAGGAGACACATGGGTGCTATAGC S2s_sm_X1 2754 GGCCGCTAGACACAGTTTGTATCGCC 2755 TCGAGGCGATACAAACTGTGTCTAGC S2a_sm_X1 2756 GGCCGCGATAGCACAACGTTTGAGAC 2757 TCGAGTCTCAAACGTTGTGCTATCGC S2s_sm_X3 2758 GGCCGCTAGACACAGTTTTGTATCGCGGAATAGACACA GTTTGTATCGCGGAATAGACACAGTTTGTATCGCC 2759 TCGAGGCGATACAAACTGTGTCTATTCCGCGATACAA ACTGTGTCTATTCCGCGATACAAACTGTGTCTAGC S2a_sm_X3 2760 GGCCGCGATAGCACAACGTTTGAGAGGAAGATAGCA CAACGTTTTGAGAGGAAGATAGCACAACGTTTTGAGAC 2761 TCGAGTCTCAAACGTTGTGCTATCTTCCTCTCAAACGT TGTGCTATCTTCCTCTCAAACGTTGTGCTATCGC SERPINH1_4 S4s_cm_X1 2762 GGCCGCGAGACACATGGGTGCTATTC 2763 TCGAGAATAGCACCCATGTGTCTCGC S4a_cm_X1 2764 GGCCGCAATAGCACCCATGTGTCTCC 2765 TCGAGGAGACACATGGGTGCTATTGC SERPINH1_6 S6s_cm_X1 2766 GGCCGCACAAGATGCGAGACGAGTAC 2767 TCGAGTACTCGTCTCGCATCTTGTGC S6a_cm_X1 2768 GGCCGCTACTCGTCTCGCATCTTGTC 2769 TCGAGACAAGATGCGAGACGAGTAGC S6s_sm_X1 2770 GGCCGCCCAAGATGATCTAATCTGCC 2771 TCGAGGCAGATTAGATCATCTTGGGC S6a_sm_X1 2772 GGCCGCGACTCGTCGATACTAGGTGC 2773 TCGAGCACCTAGTATCGACGAGTCGC S6s_sm_X3 2774 TCGAGGCAGATTAGATCATCTTGGTTCCGCAGATTAG ATCATCTTGGTTCCGCAGATTAGATCATCTTGGGC 2775 GGCCGCCCAAGATGATCTAATCTGCGGAACCAAGATG ATCTAATCTGCGGAACCAAGATGATCTAATCTGCC S6a_sm_X3 2776 GGCCGCGACTCGTCGATACTAGGTGGGAAGACTCGTC GATACTAGGTGGGAAGACTCGTCGATACTAGGTGC 2777 TCGAGCACCTAGTATCGACGAGTCTTCCCACCTAGTAT CGACGAGTCTTCCCACCTAGTATCGACGAGTCGC SERPIN S12s_cm_X1 2778 GGCCGCACAAGATGCGAGACGAGTTC

H1_12 2779 TCGAGAACTCGTCTCGCATCTTGTGC S12a_cm_X1 2780 GGCCGCAACTCGTCTCGCATCTTGTC 2781 TCGAGACAAGATGCGAGACGAGTTGC SERPINH1_45a (SERPINH1_45_S450) S450s_cmX1 2782 GGCCGCACTCCAAGATCAACTTCCTC 2783 TCGAGAGGAAGTTGATCTTGGAGTGC S450a_cmX1 2784 GGCCGCAGGAAGTTGATCTTGGAGTC 2785 TCGAGACTCCAAGATCAACTTCCTGC S450s_smX1 2786 GGCCGCCCTCCAAGCGACCATGAAGC 2787 TCGAGCTTCATGGTCGCTTGGAGAGGC S450a_smX1 2788 GGCCGCCGGAAGTTTCGATGTTCTGC 2789 TCGAGCAGAACATCGAAACTTCCGGC S450s_smX3 2790 GGCCGCCCTCCAAGCGACCATGAAGGGAACCTCCAAG CGACCATGAAGGGAACCTCCAAGCGACCATGAAGC 2791 TCGAGCTTCATGGTCGCTTGGAGGTTCCCTTCATGGTC GCTTGGAGGTTCCCTTCATGGTCGCTTGGAGGGC S450a_smX3 2792 GGCCGCCGGAAGTTTCGATGTTCTGGGAACGGAAGTT TCGATGTTCTGGGAACGGAAGTTTCGATGTTCTGC 2793 TCGAGCAGAACATCGAAACTTCCGTTCCCAGAACATC GAAACTTCCGTTCCCAGAACATCGAAACTTCCGGC SERPINH1_51 S51s_cm_X1 2794 GGCCGCTCCTGAGACACATGGGTGAC 2795 TCGAGTCACCCATGTGTCTCAGGAGC S51a_cm_X1 2796 GGCCGCTCACCCATGTGTCTCAGGAC 2797 TCGAGTCCTGAGACACATGGGTGAGC S51s_sm_X1 2798 GGCCGCGCCTGAGAACACGTGTGTCC 2799 TCGAGGACACACGTGTTCTCAGGCGC S51a_sm_X1 2800 GGCCGCGCACCCATTGTGATACTTCC 2801 TCGAGGAAGTATCACAATGGGTGCGC S51s_sm_X3 2802 GGCCGCGCCTGAGAACACGTGTGTCGGAAGCCTGAGA ACACGTGTGTCGGAAGCCTGAGAACACGTGTGTCC 2803 TCGAGGACACACGTGTTCTCAGGCTTCCGACACACACGT GTTCTCAGGCTTCCGACACACGTGTTCTCAGAGCGC S51a_sm_X3 2804 GGCCGCGCACCCATTGTGATACTTCGGAAGCACCCAT TGTGATACTTCGGAAGCACCCATTGTGATACTTCC 2805 TCGAGGAAGTATCACAATGGGTGCTTCCGAAGTATCA CAATGGGTGCTTCCGAAGTATCACAATGGGTGCGC SERPINH1_86 S86s_cm_X1 2806 GGCCGCACAGGCCTCTACAACTACAC 2807 TCGAGTGTAGTTGTAGAGGCCTGTGC S86a_cm_X1 2808 GGCCGCTGTAGTTGTAGAGGCCTGTC 2809 TCGAGACAGGCCTCTACAACTACAGC S86s_sm_X1 2810 GGCCGCACAGGCCTAGCACAAGCACC 2811 TCGAGGTGCTTGTGCTAGGCCTGTGC S86a_sm_X1 2812 GGCCGCGGTAGTTGGCTCTGAAGTGC 2813 TCGAGCACTTCAGAGCCAACTACCGC S86s_sm_X3 2814 GGCCGCACAGGCCTAGCACAAGCACGGAAACAGGCC TAGCACAAGCACGGAAACAGGCCTAGCACAAGCACC 2815 TCGAGGTGCTTGTGCTAGGCCTGTTTCCGTGCTTGTGC TAGGCCTGTTTCCGTGCTTGTGCTAGGCCTGTGC

S86a_sm_X3 2816 GGCCGCGGTAGTTGGCTCTGAAGTGGGAAGGTAGTTG GCTCTGAAGTGGGAAGGTAGTTGGCTCTGAAGTGC 2817 TCGAGCACTTCAGAGCCAACTACCTTCCCACTTCAGA GCCAACTACCTTCCCACTTCAGAGCCAACTACCGC SERPINH1_52 S52s_cm_X1 2818 GGCCGCGACAAGATGCGAGACGAGAC 2819 TCGAGTCTCGTCTCGCATCTTGTCGC S52a_cm_X1 2820 GGCCGCTCTCGTCTCGCATCTTGTCC 2821 TCGAGGACAAGATGCGAGACGAGAGC S52s_sm_X1 2822 GGCCGCTACAAGATTATCTCATCTCC 2823 TCGAGGAGATGAGATAATCTTGTAGC S52a_sm_X1 2824 GGCCGCGCTCGTCTATACTAGGTGAC 2825 TCGAGTCACCTAGTATAGACGAGCGC S52s_sm_X3 2826 GGCCGCTACAAGATTATCTCATCTCGGAATACAAGAT TATCTCATCTCGGAATACAAGATTATCTCATCTCC 2827 TCGAGGAGATGAGATAATCTTGTATTCCGAGATGAGA TAATCTTGTATTCCGAGATGAGATAATCTTGTAGC S52a_sm_X3 2828 GGCCGCGCTCGTCTATACTAGGTGAGGAAGCTCGTCT ATACTAGGTGAGGAAGCTCGTCTATACTAGGTGAC 2829 TCGAGTCACCTAGTATAGACGAGCTTCCTCACCTAGT ATAGACGAGCTTCCTCACCTAGTATAGACGAGCGC SERPINH1_58 S58s_cm_X1 2830 GGCCGCGACAAGATGCGAGACGAGTC 2831 TCGAGACTCGTCTCGCATCTTGTCGC S58a_cm_X1 2832 GGCCGCACTCGTCTCGCATCTTGTCC 2833 TCGAGGACAAGATGCGAGACGAGTGC SERPINH1_95 S95s_cm_X1 2834 GGCCGCACTCCAAGATCAACTTCCGC 2835 TCGAGCGGAAGTTGATCTTGGAGTGC S95a_cm_X1 2836 GGCCGCCGGAAGTTGATCTTGGAGTC 2837 TCGAGACTCCAAGATCAACTTCCGGC SERPINH1_96 S96s_cm_X1 2838 GGCCGCTCCTGAGACACATGGGTGCC 2839 TCGAGGCACCCATGTGTCTCAGGAGC S96a_cm_X1 2840 GGCCGCGCACCCATGTGTCTCAGGAC 2841 TCGAGTCCTGAGACACATGGGTGCGC SERPINH1_97 S97s_cm_X1 2842 GGCCGCACAGGCCTCTACAACTACTC 2843 TCGAGAGTAGTTGTAGAGGCCTGTGC S97a_cm_X1 2844 GGCCGCAGTAGTTGTAGAGGCCTGTC 2845 TCGAGACAGGCCTCTACAACTACTGC

[0483] The corresponding strands, as described above, were cloned into a 3'UTR reporter of Renilla luciferase mRNA into psiCHECK ™ -2 vector (Promega). XhoI and NotI were used as cloning sites using standard molecular biological methods. Each chain was synthesized chemically and hybridized by heating to 100 ° C and cooled to room temperature. Ligation was performed for 3 hours using standard molecular biological methods and E. coli DH5a cells were transformed. The obtained colonies were screened for K application No. 2012122470 for the presence of plasmid constructs by colony PCR using appropriate primers. Each plasmid (vector) was isolated from one positive colony and its sequence was confirmed.

[0484] About 1.3 x 10 ⁶ human HeLa cells were inoculated into a 10 cm diameter Petri dish. Then, the cells were incubated at 37 ± 1 ° C, 5% CO2 in an incubator for 24 hours. One day after inoculation, culture medium was changed to 8 ml of fresh culture medium, and each plate was transfected with one of the plasmids indicated above using Lipofectamine ™ 2000 reagent according to the manufacturer's protocol and incubated for 5 hours at 37 ± 1 ° C and 5% CO2 . After incubation, the cells were plated in a 96-well plate at a final concentration of 5x10 ³ cells per well in 80 μl of culture medium. After 16 hours, the cells were transfected with SERPINH1 siRNA molecules using Lipofectamme ™ 2000 reagent at various concentrations ranging from 0.001 nMol to 5 nMol in a final volume of 100 μl. False transfected cells treated with Lipofectamine ™ 2000 reagent with the corresponding psiCHECK ™ -2 plasmid were designated as “control inactive samples” (negative control), and cells treated with the known active siRNA (HSP47-C) at a final concentration of 5 nM were designated as “ control active samples ”(positive control). Z 'and the orders of controls {order = average (negative) / medium (positive)} are means for describing the effectiveness of the analysis.

[0485] The cells were then incubated for 48 hours at 37 ± 1 ° C and the Renilla and FireFly luciferase activities were determined in each transfected siRNA sample using the Dual-Luciferase® kit (Promega, Cat # E1960) according to the manufacturer's instructions. The activity of synthetic siRNAs in relation to this target sequence led to cleavage and subsequent destruction of hybrid mRNAs or to inhibition of translation of the encoded protein. Thus, measuring the decrease in Renilla luciferase activity provides a convenient way to monitor the effect of siRNAs, while Firefly luciferase allows normalization of Renilla luciferase expression. Renilla activity value was divided by Firefly luciferase activity value for each sample (normalization). Ultimately, Renilla luciferase activity was expressed as a fraction of the normalized activity value in the test sample compared to “control inactive samples”.

[0486] Results of levels of TNFα and IL-6 in peripheral blood mononuclear cells (PBMC) exposed to unmodified or modified siRNA / Lipofectamine ™ 2000. The results are presented in PG / ml calculated according to the standard curve. “Lipofec2000 control” refers to the level of cytokine secretion induced by the Lipofectamine ™ 2000 transfection reagent. None of the modified compounds had TNFa or IL6 cytokine levels higher than the control transfection reagent.

Donor II TNFa IL-6 The control 162 +/- 280 Lipofec2000 control 308 +/- 75 1303 +/- 440 dsPHK SEQ ID NOS: 101 and 168) unmodified 860 nMol 610 2915 287 nmol 6963 4021 96 nMol 641 2278 32 nMol 1095 4126 Connection_4 860 nMol 660 +/- 227 1166 +/- 280 287 nmol 484 +/- 84 1844 +/- 1072 96 nMol 571 +/- 170 2015 +/- 1667 32 nMol 865 +/- 90 2201 +/- 952

Donor I Donor II TNFa IL-6 TTFa IL-6 The control 115 +/- 64 162 +/- 280 Lipofec2000 control 427 +/- 87 1848 +/- 194 308 +/- 75 1303 +/- 440 dsRNA SEQ ID NOS: 60 and 127) unmodified 860 nMol 326 1014 873 4015 287 nmol 305 638 909 3046 96 nMol 546 1007 690 2451 32 nMol 707 1331 637 2159 Connection_1 860 nMol 491 1480 1017 4492 287 nmol 363 956 981 3126 96 nMol 294 840 952 2491 32 nMol 355 848 902 2779 Donor I TNFa IL-6 The control 115 +/- 64 Lipofec2000 control 427 +/- 87 1848 +/- 194 dsRNA SEQ ID NOS: 63 and 130) unmodified 860 nMol 228 553 287 nmol 395 569 9bp nMol 561 966 32 nMol 737 1021 Connection_2 860 nMol 598 1560 287 nmol 621 1440 96 nMol 570 1825 32 nMol 517 1510

Donor I Donor II TNFa IL-6 TNFa IL-6 The control 115 +/- 64 162 +/- 280 Lipofec2000 control 427 +/- 87 1848 +/- 194 308 +/- 75 1303 +/- 440 dsPHK SEQ ID NOS: 98 and 165) unmodified 860 nMol 137 225 521 4223 287 nmol 750 105 463 3755 96 nMol 504 180 627 2784 32 nMol 312 442 711 3084 Connection_3 860 nMol 540 2170 1474 3896 287 nmol 698 2428 1000 1864 96p nMol 582 1876 1089 1760 32 nMol 614 1341 724 1044 Results in PG / ml Donor I Donor II TNFa IL-6 TNFa IL-6 Control cells 115 +/- 64 162 +/- 280 CL075 (μg / ml) 2 13878 26464 0.67 8115 28471 17013 0.22 1575 10873 7589 22111 0.074 219 906 1389 7072

[0487] Induction data for genes responding to interferon (IFN), MX1 and IFIT1, unmodified and modified double-stranded nucleic acid compounds. The presented results are the residual genes for human IFIT1 and MX1 (order from control cells treated with Lipofectamine2000) according to studies on human PBMC. The data show that all modified compounds caused insignificant levels of IFN-controlled genes compared to unmodified compounds (_S709).

Donor II IFIT1 MX1 Lipo2000 control one one dsRNA SEQ ID NOS: 101 and 168) unmodified 32 nMol 5.5 3.3 96 nMol 7.5 4.3 297 nmol 3.9 3.8 860 nMol 0.8 0.8 Connection_4 32 nMol 1.2 +/- 0.5 1.7 +/- 0.35 96 nMol 1.1 +/- 0.3 1.5 +/- 0.06 297 nmol 0.7 +/- 0.3 0.9 +/- 0.7 860 nMol 0.6 +/- 0.1 0.9 +/- 0.5 Donor I Donor II IFIT1 MX1 IFIT1 MX1 Lipo2000 control one one one one dsRNA SEQ ID NOS: 60 and 127) nmodified 32 nMol 27.9 2.2 2.7 96 nMol 42.1 18.3 4.0 5.0 297 nmol 53.8 18.0 5.4 2.8 860 nMol 39.4 16.3 3.3 3.6 Connection_1 32 nMol 1.2 0.2 0.8 1.3 96 nMol 1.3 0.8 1.5 1.1 297 nmol 1.1 0.3 1.2 1.6 860 nMol 1.0 0.3 0.3 0.3 Donor I Donor II IFIT1 MX1 IFIT1 MX1 Lipo2000 control one 1.00 one one dsPHK SEQ ID NOS: 98 and 165) unmodified 32 nMol 29.7 18.5 4.3 4.1 96 nMol 39.1 19.2 5.5 297 nmol 25.1 9.3 4.8 5.2 860 nMol 3.8 3.7 Connection_3 32 nMol 1.4 0.4 1.0 1.4 96 nMol 1.7 1.3 1.3 1.1 297 nmol 1.9 1.4 1.1 1.4 860 nMol 5.2 2.5 1.1 1.4

Donor I IFIT1 MX1 Lipo2000 control one one dsRNA SEQ ID NOS: 63 and 130) unmodified 32 nMol 29.6 17.8 96 nMol 31.5 16.1 297 nmol 860 nMol 36.6 11.4 Connection_2 32 nMol 1.6 0.7 96 nMol 1.1 1.0 297 nmol 2.1 0.2 860 nMol 1.8 1.4 Donor I Donor II IFIT1 MX1 [FIT1 MX1 Control cells one one one one 0.125 eighteen 5.4 3.7 0.56 26 eleven 4.9 4.7 1.7 41 fourteen 4.5 5.1 5 24 7 0.9 0.8 0.075 four 2 1.8 1.8 0.12 27 10 4.5 3.6 0.67 21 4.6 4.2 2 26 12 4.1 3.7

[0488] The Tables below show the activity of Compound_1, Compound_2, Compound_3 and Compound_4 compared to unmodified (_S709) compounds in rat cells. The results are shown in the residual target (% of control cells treated with Lipofectamine ™ 2000) of the rat SERPINH1 gene in REF52 cells. The results of two separate experiments are shown. The suppression of the target gene in rat cells correlates with the study of compounds in animal models of human diseases.

Study_1 Research_2 Lipo2000 control one hundred one hundred dsRNA SEQ ID NOS: 60 and 127) unmodified 0.8 nMol 52 36 2 nMol 25 31 10 nMol 16 28 50 nMol 8 four Connection_1 0.8 nMol 53 fourteen 2 nMol 39 fourteen 10 nMol 19 24 50 nMol 7 four Study_1 Research_2 Lipo2000 control one hundred one hundred dsRNA SEQ ID NOS: 63 and 130) unmodified 0.8 nMol 45 fifteen 2 nMol 28 eighteen 10 nMol 13 12 50 nMol 12 8 Connection_2 0.8 nMol 76 78 2 nMol 61 68 10 nMol 37 28 50 nMol four Study_1 Research_2 Lipo2000 control one hundred one hundred dsPHK SEQ ID NOS: 98 and 165) unmodified 0.8 nMol 72 65 2 nMol 43 41 10 nMol 32 42 50 nMol 28 27 Connection_3 0.8 nMol 88 thirty 2 nMol 39 24 10 nMol 24 23 50 nMol 6 23

Research_3 Research_4 Lipo2000 control one hundred one hundred Connection_4 0.8 nMol 66 106 2 nMol 35 32 10 nMol 10 12 50 nMol 6 9

Serum Stability Analysis

[0489] Modified compounds were tested for the stability of the duplex of the present invention in human serum or human tissue extract, as described below:

[0490] siRNA molecules at a final concentration of 7 μM were incubated at 37 ° C in 100% human serum (Sigma Cat # H4522). (Stock solution of siRNA 100 μmol, diluted in human serum 1: 14.29 or extract of human tissue from various types of tissue). Five μl (5 μl) was added to 15 μl of the 1.5 x TBE loading buffer at various time points (e.g., 0, 30 minutes, 1 hour, 3 hours, 6 hours, 8 hours, 10 hours, 16 hours and 24 hours). Samples were immediately frozen in liquid nitrogen and stored at -20 ° C.

[0491] Each sample was added to a non-denaturing 20% acrylamide gel prepared by methods known in the art. Oligonucleotides were visualized with ethidium bromide in UV light.

Exonuclease Stability Assay

[0492] To study the stabilizing effect of 3 'non-nucleotide groups on the sense strand of a nucleic acid molecule, the antisense strand and hybridized siRNA duplex were incubated with cytosol extracts prepared from various types of cells.

Extract: Cytosol extract HCT116 (12 mg / ml).

Extraction buffer: fresh solution of 25 mM Hepes pH = 7.3 at 37 ° C; 8 mM MgCl; 150 mmol NaCl with 1 mmol DTT was added immediately before use.

[0493] Method: 3.5 ml of the studied siRNA (100 mmol) was mixed with 46.5 ml containing 120 mg of HCT116 cytosol extract. 46.5 ml consisted of 12 ml of HCT116 extract and 34.5 ml of extraction buffer supplemented with DTT and a cocktail of protease inhibitors / 100 (Calbiochem, setIII-539134). The final concentration of siRNA in the tube for incubation was 7 mmol. The sample was incubated at 37 ° C, and at the indicated time point, 5 ml was transferred to a new tube, mixed with 15 ml of 1XTVE-50% glycerol buffer and quickly frozen in liquid N2. The final siRNA concentration in the insertion buffer was 1.75 mMol (21 ng siRNA / ml). For analysis by native PAGE and EtBr staining, 50 ng was added to the lane. For Northern blotting, 1 ng of the studied siRNA was introduced into the lane.

Congenital immune response to SERPINH1 siRNA molecules:

[0494] Fresh human blood (at room temperature) was mixed 1: 1 with sterile 0.9% NaCl at room temperature (RT) and carefully layered (1: 2) onto Ficoll (Lymphoprep, Axis-Shield cat # 1114547). The sample was centrifuged at RT (22 ° C, 800g) in a swinging centrifuge for 30 minutes, washed with RPMI1640 medium and centrifuged (RT, 250 g) for 10 minutes. The number of cells was counted and plated at a final concentration of 1.5x10 ⁶ cells / ml of culture medium (RPMI1640 + 10% FBS + 2 mmol L-Glutamine + 1% Pen-Strep) and incubated for 1 hour at 37 ° C before siRNA treatment .

[0495] Then the cells were treated with the studied siRNAs at various concentrations using Lipofectamine ™ 2000 reagent (Invitrogen) according to the manufacturer's instructions and incubated at 37 ° C in an incubator at 5% CO2 for 24 hours.

[0496] As a positive control for IFN response, cells were treated with poly (I: C), a synthetic double-stranded RNA analog (dsRNA), which is a TLR3 ligand (InvivoGen Cat # tlrl-pic) at final concentrations of 0.25-5.0 μg / ml or thiazolinquinolone (CLO75), TLR 7/8 ligand (InvivoGen Cat # tlrl-c75) at final concentrations of 0.075-2 μg / ml. Cells treated with Lipofectamine ™ 2000 reagent were used as a negative control for the IFN response.

[0497] About 24 hours after incubation, cells were harvested and the supernatant was transferred to new tubes. Samples were immediately frozen in liquid nitrogen and the secretion of the cytokines IL-6 and TNF-α was checked using the IL-6 kit, DuoSet ELISA (R&D System DY2060) and TNF-α, DuoSet ELISA kit (R&D System DY210) according to the manufacturer's instructions. RNA was isolated from the cell pellet, and the mRNA levels of the IFIT1 genes (interferon-induced protein with tetratricopeptide repeats 1) and MX1 (resistance to myxoviruses (influenza virus) 1, interferon-inducible p78 protein) were determined by quantitative PCR. The measured amounts of mRNA were normalized relative to the amount of mRNA of the control peptidyl prolyl isomerase A gene (cyclophilin A; CycloA). The induction of IFN signaling pathways was evaluated by comparing the amount of mRNA from IFIT1 and MX1 genes from treated cells with their numbers in untreated cells. The results of quantitative PCR were those that passed QC standards, i.e. the slope of the standard curve was within [-4, -3], R2> 0.99, without primer dimers. Results that did not meet QC requirements were excluded from the analysis.

[0498] Table 6 shows compounds siSERPINH1. Data on the stability and activity of some compounds are presented in Table 6. The code structures of the sense and antisense chains are presented below in Table 7.

Table 6: Title Plasma stability (hours) % residue 5 nM % residue 25 nM Sense chain 5-> 3 code Antisense Chain 5-> 3 Code 001 002 003 004 006 SERPINH1_2_S1356 10 16 10 9 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; mG; rC; mA; rC, mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1357 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; mC; rA; mC; mC; mC; rA; mU; rG; mU; rG; mU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1358 16 52 41 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; mU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1359 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1360 10 47 31 8 twenty zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; r mU; rA; mU; rA; rG; mC; rA; mC; rC; mC; rA; mU; rG; mU

G; rC2p; rU2p; rA2p; rU2p; rA2p ; rG; rU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1361 8 31 34 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; rC2p; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1362 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; LdC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1363 17 10 fifteen 25 zc3p; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1364 zc3p; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; mC; rA; mC; mC; mC; rA; mU; rG; mU; rG; mU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1365 16 41 52 zc3p; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; mU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1366 zc3p; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1367 16 51 39 zc3p; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; mC; rA; mC; rC; mC; rA; mU; rG; mU; rG; rU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1368 zc3p; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; rC2p; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1369 zc3p; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; rG; LdC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1370 17 fifteen 61 twenty zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1371 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p $ mU; rA; mU; rA; rG; mC; rA; mC; mC; mC; rA; mU; rG; mU; rG; mU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1372 16 74 66 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p $ mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; mU; mC; mU; rC; zc3p; z c3p $

SERPINH1_2_S1373 8 48 65 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p $ mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1374 16 39 11 0 6 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p $ mU; rA; mU; rA; rG; mC; rA; mC; rC; mC; rA; mU; rG; mU; rG; rU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1375 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p $ mU; rA; mU; rA; rG; rC2p; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1376 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p $ mU; rA; mU; rA; rG; LdC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1377 3 25 5 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; mC; mU; rA; LdT; rA $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1378 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; mC; mU; rA; LdT; rA $ mU; rA; mU; rA; rG; mC; rA; mC; mC; mC; rA; mU; rG; mU; rG; mU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1379 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; mC; mU; rA; LdT; rA $ mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; mU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1380 8 23 33 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; mC; mU; rA; LdT; rA $ mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1381 16 25 56 12 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; mC; mU; rA; LdT; rA $ mU; rA; mU; rA; rG; mC; rA; mC; rC; mC; rA; mU; rG; mU; rG; rU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1382 8 22 31 eleven zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; mC; mU; rA; LdT; rA $ mU; rA; mU; rA; rG; rC2p; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1383 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; mC; mU; rA; LdT; rA $ mU; rA; mU; rA; rG; LdC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1384 16 7 twenty 7 four zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1385 16 55 37 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; m mU; rA; mU; rA; rG; mC; rA; mC; mC; mC; rA; mU; rG; m

U; rG; rC; mU; rA; mU; rA; zc3p $ U; rG; mU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1386 16 42 45 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; mU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1387 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; rG; mC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1388 16 21 39 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; rG; mC; rA; mC; rC; mC; rA; mU; rG; mU; rG; rU; mC; mU; rC; zc3p; zc3p $ SERPINH1_2_S1389 16 twenty 27 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; rG; rC2p; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1390 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; rG; LdC; rA; mC; mC; rC; rA; mU; rG; mU; rG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1687 zidB; rG; rA; rG; rA; rC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1694 24 zidB; rG; rA; rG; rA; rC; rA; mC; rA; rU2p; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1700 16 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; rU2p; rA; zc3p $ mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1705 10 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1707 10 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p $ mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1754 24 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1755 24 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p rU2p; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $

SERPINH1_2_S1756 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p rU2p; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1787 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p dU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_4_S1391 0 58 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rU2p rA; mA; rU; mA; rG; mC; rA; mC; rC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_4_S1782 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rU2p; zc3p rA; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_6_S1356 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1363 zc3p; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1370 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p; zc3p $ mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1414 zc3p; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; mU; mC; rG; mU; mC; mU; mC; rG; mC; rA; mU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1415 zc3p; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; mU; mC; rG; mU; mC; mU; rC; rG; mC; rA; mU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1416 zc3p; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; mU; mC; rG; mU; mC; mU; rC; rG; mC; rA; rU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1417 zc3p; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1418 zc3p; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; rU; mC; rG; LdT; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1419 zc3p; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; r mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; r

C; rG2p; rA2p; rG2p; rU2p; rA2p U; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1420 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; mU; mC; rG; mU; mC; mU; mC; rG; mC; rA; mU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1421 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; mU; mC; rG; mU; mC; mU; rC; rG; mC; rA; mU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1422 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; mU; mC; rG; mU; mC; mU; rC; rG; mC; rA; rU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1423 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1424 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; rU; mC; rG; LdT; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1425 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1426 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p; zc3p $ mU; rA; mC; mU; mC; rG; mU; mC; mU; mC; rG; mC; rA; mU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1427 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p; zc3p $ mU; rA; mC; mU; mC; rG; mU; mC; mU; rC; rG; mC; rA; mU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1428 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p; zc3p $ mU; rA; mC; mU; mC; rG; mU; mC; mU; rC; rG; mC; rA; rU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1429 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p; zc3p $ mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1430 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p; zc3p $ mU; rA; mC; rU; mC; rG; LdT; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1431 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC; rG2p; rA2p; rG2p; rU2p; rA2p; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $

SERPINH1_6_S1432 0 6 19 fifteen zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA $ mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1435 6 37 46 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA $ mU; rA; mC; mU; mC; rG; mU; mC; mU; rC; rG; mC; rA; rU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1436 3 10 17 5 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA $ mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1437 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA $ mU; rA; mC; rU; mC; rG; LdT; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1438 3 fifteen 17 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1439 24 12 23 eleven zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1442 24 29th zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; mU; mC; rG; mU; mC; mU; rC; rG; mC; rA; rU; mC; mU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1443 24 9 22 7 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1444 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; LdT; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1445 24 19 eighteen zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1739 24 eleven zidB; rA; mC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1741 24 12 zidB; rA; mC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1744 0 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; m mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; r

C; rG; rA; rG; mU; rA; zc3p $ U; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1746 0 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1785 zidB; rA; mC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ dU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_11_S1356 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p mU; rG; mU; rU; mG; rU; mA; rG; mA; rG; mG; rC; mC; rU; mG; rU; mC; rC; mG; zc3p; zc3p $ SERPINH1_11_S1363 zc3p; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p mU; rG; mU; rU; mG; rU; mA; rG; mA; rG; mG; rC; mC; rU; mG; rU; mC; rC; mG; zc3p; zc3p $ SERPINH1_11_S1370 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p; zc3p $ mU; rG; mU; rU; mG; rU; mA; rG; mA; rG; mG; rC; mC; rU; mG; rU; mC; rC; mG; zc3p; zc3p $ SERPINH1_11_S1446 zc3p; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p mU; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; mU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1449 zc3p; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p mU; rG; mU; mU; rG; rU2p; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1450 zc3p; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p mU; rG; mU; mU; rG; LdT; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1451 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p mU; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; mU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1454 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p mU; rG; mU; mU; rG; rU2p; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1455 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p mU; rG; mU; mU; rG; LdT; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1456 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p; zc3p $ mU; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; mU; mC; mC; rG; zc3p; zc3p $

SERPINH1_11_S1457 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p; zc3p $ mU; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; rC; mC; mU; rG; mU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1459 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p; zc3p $ mU; rG; mU; mU; rG; rU2p; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1460 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rA2p; zc3p $ mU; rG; mU; mU; rG; LdT; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1461 zidB; mC; rG; rG; rA; mC; rA; rG; rG; rC; mC; rU; rC; mU; rA; mC; rA; rA; LdC; rA $ mU; rG; mU; rU; mG; rU; mA; rG; mA; rG; mG; rC; mC; rU; mG; rU; mC; rC; mG; zc3p; zc3p $ SERPINH1_11_S1462 zidB; mC; rG; rG; rA; mC; rA; rG; rG; rC; mC; rU; rC; mU; rA; mC; rA; rA; LdC; rA $ mU; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; mU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1464 45 43 zidB; mC; rG; rG; rA; mC; rA; rG; rG; rC; mC; rU; rC; mU; rA; mC; rA; rA; LdC; rA $ mU; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1467 zidB; mC; rG; rG; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; mC; rA; zc3p $ mU; rG; mU; rU; mG; rU; mA; rG; mA; rG; mG; rC; mC; rU; mG; rU; mC; rC; mG; zc3p; zc3p $ SERPINH1_11_S1468 zidB; mC; rG; rG; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; mC; rA; zc3p $ mU; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; mU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1469 zidB; mC; rG; rG; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; mC; rA; zc3p $ mU; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; rC; mC; mU; rG; mU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1470 zidB; mC; rG; rG; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; mC; rA; zc3p $ mU; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1471 zidB; mC; rG; rG; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; mC; rA; zc3p $ mU; rG; mU; mU; rG; rU2p; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_11_S1472 zidB; mC; rG; rG; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; mC; rA; zc3p $ mU; rG; mU; mU; rG; LdT; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; mC; mC; rG; zc3p; zc3p $ SERPINH1_12_S1391 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; r rA; mA; rC; mU; rC; mG; rU; mC; rU; rC; mG; rC; mA; rU;

C; rG2p; rA2p; rG2p; rU2p; rU2p mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_12_S1780 zidB; rA; mC; rA; mA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rU; zc3p $ rA; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_30_S1391 zidB; rC; rG; rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC2p; rA2p; rA2p; rC2p; rU2p rA; mG; rU; mU; rG; mU; rA; mG; rA; rG; mG; rC; mC; rU; mG; rU; mC; rC; mG; zc3p; zc3p $ SERPINH1_45_S1354 174 40 rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU; rU; rC; rC; yrU; zdT; zdT $ yrA; rG; rG; rA; rA; rG; rU; rU; rG; rA; rU; rC; rU; rU; rG; rG; rA; rG; rU; zdT; zdT $ SERPINH1_45_S1500 16 96 54 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p ymA; rG; rG; rA; rA; rG; mU; mU; rG; rA; mU; mC; mU; mU; rG; rG; rA; rG; rU; zc3p; zc3p $ SERPINH1_45_S1501 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p ymA; rG; mG; rA; mA; rG; mU; mU; rG; rA; mU; rC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $ SERPINH1_45_S1502 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p ymA; rG; mG; rA; mA; rG; mU; mU; rG; rA; rU; mC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $ SERPINH1_45_S1505 16 22 17 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p yrA; mG; rG; mA; rA; mG; rU; mU; rG; rA; mU; rC; mU; rU; mG; rG; mA; rG; mU; zc3p; zc3p $ SERPINH1_45_S1506 zc3p; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p ymA; rG; rG; rA; rA; rG; mU; mU; rG; rA; mU; mC; mU; mU; rG; rG; rA; rG; rU; zc3p; zc3p $ SERPINH1_45_S1507 zc3p; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p ymA; rG; mG; rA; mA; rG; m U; mU; rG; rA; mU; rC; mU; mU; rG; mG; rA; mG; rU; zc3 p; zc3p $ SERPINH1_45_S1508 zc3p; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p ymA; rG; mG; rA; mA; rG; mU; mU; rG; rA; rU; mC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $ SERPINH1_45_S1509 16 zc3p; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p ymA; rG; rG; rA; rA; rG; rU2p; mU; rG; rA; mU; rC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $ SERPINH1_45_S1510 zc3p; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p ymA; rG; rG; rA; rA; rG; LdT; mU; rG; rA; mU; rC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $

SERPINH1_45_S1511 8 27 zc3p; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p yrA; mG; rG; mA; rA; mG; rU; mU; rG; rA; mU; rC; mU; rU; mG; rG; mA; rG; mU; zc3p; zc3p $ SERPINH1_45_S1512 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p; zc3p $ ymA; rG; rG; rA; rA; rG; mU; mU; rG; rA; mU; mC; mU; mU; rG; rG; rA; rG; rU; zc3p; zc3p $ SERPINH1_45_S1513 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p; zc3p $ ymA; rG; mG; rA; mA; rG; mU; mU; rG; rA; mU; rC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $ SERPINH1_45_S1514 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p; zc3p $ ymA; rG; mG; rA; mA; rG; mU; mU; rG; rA; rU; mC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $ SERPINH1_45_S1515 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p; zc3p $ ymA; rG; rG; rA; rA; rG; rU2p; mU; rG; rA; mU; rC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $ SERPINH1_45_S1516 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p; zc3p $ ymA; rG; rG; rA; rA; rG; LdT; mU; rG; rA; mU; rC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $ SERPINH1_45_S1517 24 22 31 7 eleven fourteen zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p; zc3p $ yrA; mG; rG; mA; rA; mG; rU; mU; rG; rA; mU; rC; mU; rU; mG; rG; mA; rG; mU; zc3p; zc3p $ SERPINH1_45_S1518 8 90 47 zidB; rA; rC; rU; mC; mC; rA; rA; rG; rA; rU; mC; rA; rA; mC; mU; rU; rC; LdC; yrU $ ymA; rG; rG; rA; rA; rG; mU; mU; rG; rA; mU; mC; mU; mU; rG; rG; rA; rG; rU; zc3p; zc3p $ SERPINH1_45_S1523 3 17 thirty 16 zidB; rA; rC; rU; mC; mC; rA; rA; rG; rA; rU; mC; rA; rA; mC; mU; rU; rC; LdC; yrU $ yrA; mG; rG; mA; rA; mG; rU; mU; rG; rA; mU; rC; mU; rU; mG; rG; mA; rG; mU; zc3p; zc3p $ SERPINH1_45_S1524 zidB; rA; rC; rU; rC; mC; rA; rA; rG; rA; rU; mC; rA; rA; rC; mU; rU; mC; mC; yrU; zc3p $ ymA; rG; rG; rA; rA; rG; mU; mU; rG; rA; mU; mC; mU; mU; rG; rG; rA; rG; rU; zc3p; zc3p $ SERPINH1_45_S1525 zidB; rA; rC; rU; rC; mC; rA; rA; rG; rA; rU; mC; rA; rA; rC; mU; rU; mC; mC; yrU; zc3p $ ymA; rG; mG; rA; mA; rG; mU; mU; rG; rA; mU; rC; mU; mU; rG; mG; rA; mG; rU; zc3p; zc3p $ SERPINH1_45_S1529 24 17 33 zidB; rA; rC; rU; rC; mC; rA; rA; rG; rA; rU; mC; rA; rA; rC; mU; rU; mC; mC; yrU; zc3p $ yrA; mG; rG; mA; rA; mG; rU; mU; rG; rA; mU; rC; mU; rU; mG; rG; mA; rG; mU; zc3p; zc3p $ SERPINH1_45_S1684 24 fourteen zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; r yrA; mG; rG; mA; rA; mG; rU2p; mU; rG; rA; mU; rC; m

C; rU2p; rU2p; rC2p; rC2p; yrU2p; zc3p $ U; rU; mG; rG; mA; rG; mU; zc3p; zc3p $ SERPINH1_45_S1685 8 fifteen zidB; rA; rC; rU; mC; mC; rA; rA; rG; rA; rU; mC; rA; rA; mC; mU; rU; rC; LdC; yrU $ yrA; mG; rG; mA; rA; mG; rU2p; mU; rG; rA; mU; rC; mU; rU; mG; rG; mA; rG; mU; zc3p; zc3p $ SERPINH1_45_S1781 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; yrU2p; zc3p $ rU; rG; rG; mA; rA; mG; rU2p; mU; rG; rA; mU; rC; mU; rU; mG; rG; mA; rG; mU; zc3p; zc3p $ SERPINH1_45_S1786 zidB; rA; rC; rU; rC; rC; rA; rA; rG; rA; rU; rC; rA; rA; rC; rU2p; rU2p; rC2p; rC2p; rA2p; zc3p $ dU; rG; rG; mA; rA; mG; rU2p; mU; rG; rA; mU; rC; mU; rU; mG; rG; mA; rG; mU; zc3p; zc3p $ SERPINH1_51_S1356 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; rA; mG; rG; mA; zc3p; zc3p $ SERPINH1_51_S1363 zc3p; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; rA; mG; rG; mA; zc3p; zc3p $ SERPINH1_51_S1370 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p; zc3p $ mU; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; rA; mG; rG; mA; zc3p; zc3p $ SERPINH1_51_S1473 zc3p; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; mC; rA; mC; mC; mC; rA; mU; rG; mU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1474 zc3p; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1475 zc3p; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1476 zc3p; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1477 zc3p; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; rA; mC; rC; LdC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1478 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; mC; rA; mC; mC; mC; rA; mU; rG; mU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $

SERPINH1_51_S1479 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1480 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1481 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1482 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p mU; rC; rA; mC; rC; LdC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1483 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p; zc3p $ mU; mC; rA; mC; mC; mC; rA; mU; rG; mU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1484 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p; zc3p $ mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1485 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p; zc3p $ mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1486 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1487 zidB; rU; rC; rC; rU; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG2p; rG2p; rU2p; rG2p; rA2p; zc3p $ mU; rC; rA; mC; rC; LdC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1488 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU; LdG; rA $ mU; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; rA; mG; rG; mA; zc3p; zc3p $ SERPINH1_51_S1489 8 25 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU; LdG; rA $ mU; mC; rA; mC; mC; mC; rA; mU; rG; mU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1490 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU; LdG; rA $ mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1491 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; m mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; rU

U; rG; rG; rG; rU; LdG; rA $ ; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1492 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU; LdG; rA $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1493 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU; LdG; rA $ mU; rC; rA; mC; rC; LdC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1494 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; rA; mG; rG; mA; zc3p; zc3p $ SERPINH1_51_S1495 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; mC; rA; mC; mC; mC; rA; mU; rG; mU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1496 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; mU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1497 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; mC; mC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1498 24 22 10 7 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1499 24 25 31 eighteen 28 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; LdC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1666 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC2p; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1667 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC2p; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; LdC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1668 16 fourteen zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC2p; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; rU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1669 24 eighteen zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC2p; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; mG; rU; rC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $

SERPINH1_51_S1670 16 13 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC2p; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; mA; rC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1673 24 22 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; rU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1674 16 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; mG; rU; rC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1675 16 35 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; mA; rC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1676 10 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU2p; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1677 10 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU2p; rG; rA; zc3p $ mU; rC; rA; mC; rC; LdC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1678 10 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU2p; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; rU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1679 10 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU2p; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; mG; rU; rC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1680 10 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; rU2p; rG; rA; zc3p $ mU; rC; mA; rC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1682 8 16 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; mG; rU; rC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1778 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC2p; rA; mC; rA; mU; rG; rG; rG; mU; rG; yrU; zc3p $ yrA; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; mG; rU; rC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1779 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; yrU; zc3p $ yrA; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; mG; rU; rC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1783 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC2p; rA; mC; rA; dU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; mG; rU; rC; rU;

mU; rG; rG; rG; mU; rG; rA; zc3p $ mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1784 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ dU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; mG; rU; rC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_52_S1356 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; rC; mG; rU; mC; rU; mC; rG; mC; rA; mU; rC; mU; rU; mG; rU; mC; zc3p; zc3p $ SERPINH1_52_S1363 zc3p; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; rC; mG; rU; mC; rU; mC; rG; mC; rA; mU; rC; mU; rU; mG; rU; mC; zc3p; zc3p $ SERPINH1_52_S1370 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p; zc3p $ mU; rC; mU; rC; mG; rU; mC; rU; mC; rG; mC; rA; mU; rC; mU; rU; mG; rU; mC; zc3p; zc3p $ SERPINH1_52_S1552 zc3p; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; TOU; mC; mU; mC; rG; mC; rA; mU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1553 zc3p; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU; mC; rU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1554 zc3p; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1555 zc3p; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU; rC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1556 zc3p; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; rU; LdC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1557 zc3p; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; rU; rC2p; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1558 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; mU; mC; mU; mC; rG; mC; rA; mU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1559 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU; mC; rU; mU; rG; mU; rC; zc3p; zc3p $

SERPINH1_52_S1560 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1561 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU; rC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1562 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; rU; LdC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1563 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p mU; rC; mU; mC; rG; rU; rC2p; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1564 16 94 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p; zc3p $ mU; rC; mU; mC; rG; mU; mC; mU; mC; rG; mC; rA; mU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1565 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p; zc3p $ mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU; mC; rU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1566 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p; zc3p $ mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1567 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p; zc3p $ mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU; rC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1568 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p; zc3p $ mU; rC; mU; mC; rG; rU; LdC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1569 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rA2p; zc3p $ mU; rC; mU; mC; rG; rU; rC2p; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1570 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; LdG; rA $ mU; rC; mU; rC; mG; rU; mC; rU; mC; rG; mC; rA; mU; rC; mU; rU; mG; rU; mC; zc3p; zc3p $ SERPINH1_52_S1571 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; LdG; rA $ mU; rC; mU; mC; rG; mU; mC; mU; mC; rG; mC; rA; mU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1572 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; r mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU;

G; rA; mC; rG; rA; LdG; rA $ mC; rU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1573 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; LdG; rA $ mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1574 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; LdG; rA $ mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU; rC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1575 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; LdG; rA $ mU; rC; mU; mC; rG; rU; LdC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1576 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; LdG; rA $ mU; rC; mU; mC; rG; rU; rC2p; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1577 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; rG; rA; zc3p $ mU; rC; mU; rC; mG; rU; mC; rU; mC; rG; mC; rA; mU; rC; mU; rU; mG; rU; mC; zc3p; zc3p $ SERPINH1_52_S1578 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; rG; rA; zc3p $ mU; rC; mU; mC; rG; mU; mC; mU; mC; rG; mC; rA; mU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1579 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; rG; rA; zc3p $ mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU; mC; rU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1580 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; rG; rA; zc3p $ mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1581 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; rG; rA; zc3p $ mU; rC; mU; mC; rG; mU; mC; rU; mC; rG; mC; rA; mU; rC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1582 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; rG; rA; zc3p $ mU; rC; mU; mC; rG; rU; LdC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_52_S1583 zidB; rG; rA; mC; rA; rA; rG; rA; mU; rG; mC; rG; rA; rG; rA; mC; rG; rA; rG; rA; zc3p $ mU; rC; mU; mC; rG; rU; rC2p; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_58_S1391 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rU2p rA; mC; rU; mC; rG; mU; rC; mU; rC; rG; mC; rA; mU; rC; mU; rU; mG; rU; mC; zc3p; zc3p $

SERPINH1_58_S1584 zidB; rG; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; rC2p; rG2p; rA2p; rG2p; rU2p rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; rA; rU; mC; mU; mU; rG; mU; rC; zc3p; zc3p $ SERPINH1_86_S1356 16 68 65 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; mG; rU; mU; rG; mU; rA; mG; rA; mG; rG; mC; rC; mU; rG; mU; zc3p; zc3p $ SERPINH1_86_S1363 zc3p; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; mG; rU; mU; rG; mU; rA; mG; rA; mG; rG; mC; rC; mU; rG; mU; zc3p; zc3p $ SERPINH1_86_S1370 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p; zc3p $ mU; rG; mU; rA; mG; rU; mU; rG; mU; rA; mG; rA; mG; rG; mC; rC; mU; rG; mU; zc3p; zc3p $ SERPINH1_86_S1530 zc3p; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1531 52 31 zc3p; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1532 zc3p; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; rG; rU; LdT; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1533 8 70 74 zc3p; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; rG; rU; rU2p; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1534 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1535 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1536 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; rG; rU; LdT; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1537 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p mU; rG; mU; rA; rG; rU; rU2p; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1538 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; m

; rC2p; rU2p; rA2p; rC2p; rA2p; zc3p $ C; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1539 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p; zc3p $ mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1540 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p; zc3p $ mU; rG; mU; rA; rG; rU; LdT; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1541 zidB; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC2p; rU2p; rA2p; rC2p; rA2p; zc3p $ mU; rG; mU; rA; rG; rU; rU2p; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1542 zidB; rA; mC; rA; rG; rG; mC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; LdC; rA $ mU; rG; mU; rA; mG; rU; mU; rG; mU; rA; mG; rA; mG; rG; mC; rC; mU; rG; mU; zc3p; zc3p $ SERPINH1_86_S1543 8 44 42 zidB; rA; mC; rA; rG; rG; mC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; LdC; rA $ mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1544 8 29th 36 zidB; rA; mC; rA; rG; rG; mC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; LdC; rA $ mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1545 zidB; rA; mC; rA; rG; rG; mC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; LdC; rA $ mU; rG; mU; rA; rG; rU; LdT; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1546 16 67 63 zidB; rA; mC; rA; rG; rG; mC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; LdC; rA $ mU; rG; mU; rA; rG; rU; rU2p; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1547 16 24 63 zidB; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; mC; rA; zc3p $ mU; rG; mU; rA; mG; rU; mU; rG; mU; rA; mG; rA; mG; rG; mC; rC; mU; rG; mU; zc3p; zc3p $ SERPINH1_86_S1548 16 39 67 zidB; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; mC; rA; zc3p $ mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1549 16 twenty 68 zidB; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; mC; rA; zc3p $ mU; rG; mU; rA; rG; mU; mU; rG; mU; rA; rG; rA; rG; rG; mC; rC; mU; rG; rU; zc3p; zc3p $ SERPINH1_86_S1550 16 96 92 zidB; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; mC; rA; zc3p $ mU; rG; mU; rA; rG; rU; LdT; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $

SERPINH1_86_S1551 16 70 51 zidB; rA; mC; rA; rG; rG; rC; rC; rU; rC; mU; rA; mC; rA; rA; rC; mU; rA; mC; rA; zc3p $ mU; rG; mU; rA; rG; rU; rU2p; rG; mU; rA; rG; rA; rG; rG; mC; mC; mU; rG; rU; zc3p; zc3p $ SERPINH1_2_S1686 zidB; rG; rA; rG; rA; rC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1688 zidB; rG; rA; rG; rA; rC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1689 zidB; rG; rA; rG; rA; rC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1690 zidB; rG; rA; rG; rA; rC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1691 zidB; rG; rA; rG; rA; rC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p; zc3p $ mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1692 zidB; rG; rA; rG; rA; rC; rA; mC; rA; rU2p; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1693 zidB; rG; rA; rG; rA; rC; rA; mC; rA; rU2p; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1695 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; rU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1696 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; rU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1697 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; rU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1698 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; rU2p; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $

SERPINH1_2_S1699 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; rU2p; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1701 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; LdT; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1702 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; LdT; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1703 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; LdT; rA; zc3p $ mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1704 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1706 zidB; rG; rA; rG; rA; rC; rA; rC; rA; rU; rG; rG; rG; rU; rG; rC2p; rU2p; rA2p; rU2p; rA2p; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1708 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; mC; mU; rA; LdT; rA $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1709 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; mC; mU; rA; LdT; rA $ mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_2_S1710 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; mA; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; rC; zc3p; zc3p $ SERPINH1_2_S1711 zidB; rG; rA; rG; rA; mC; rA; mC; rA; rU; rG; rG; rG; mU; rG; rC; mU; rA; mU; rA; zc3p $ mU; rA; mU; rA; mG; rC; rA2p; rC; mC; rC; mA; rU; mG; rU; mG; rU; mC; rU; mC; zc3p; zc3p $ SERPINH1_6_S1712 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1713 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1714 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; r mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; r

A; mC; rG; rA; rG; LdT; rA; zc3p $ U; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1715 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1716 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1717 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1718 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1719 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1720 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1721 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1722 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1723 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1724 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1725 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1726 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $

SERPINH1_6_S1727 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1728 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1729 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1730 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1731 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1732 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1733 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1734 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1735 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; rU2p; rA; zc3p; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1736 zidB; rA; mC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1737 zidB; rA; mC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1738 zidB; rA; mC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1740 zidB; rA; mC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; r

; mC; rG; rA; rG; mU; rA; zc3p $ U; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1742 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1743 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; mU; mC; rU; mC; rG; mC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1745 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1747 zidB; rA; rC; rA; rA; rG; rA; rU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1748 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1749 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1750 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; LdT; rA $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1751 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA: zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_6_S1752 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; mG; rC; mA; rU; mC; rU; mU; rG; mU; zc3p; zc3p $ SERPINH1_6_S1753 zidB; rA; mC; rA; rA; rG; rA; mU; rG; rC; rG; rA; rG; rA; mC; rG; rA; rG; mU; rA; zc3p $ mU; rA; mC; rU; mC; rG; rU2p; rC; mU; rC; rG; mC; mA; rU; rC; rU; mU; rG; rU; zc3p; zc3p $ SERPINH1_42_S1354 rG; rA; rC; rA; rG; rG; rC; rC; rU; rC; rU; rA; rC; rA; rA; rC; rU; rA; yrU; zdT; zdT $ yrA; rU; rA; rG; rU; rU; rG; rU; rA; rG; rA; rG; rG; rC; rC; rU; rG; rU; rC; zdT; zdT $ SERPINH1_51_S1671 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $

SERPINH1_51_S1672 zidB; rU; rC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; LdC; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1681 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; rA; mC; rC; rC2p; rA; mU; rG; rU; rG; rU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ SERPINH1_51_S1683 zidB; rU; mC; rC; mU; rG; rA; rG; rA; rC; rA; mC; rA; mU; rG; rG; rG; mU; rG; rA; zc3p $ mU; rC; mA; rC; rC; rC2p; rA; mU; rG; rU; rG; mU; mC; rU; mC; rA; rG; rG; rA; zc3p; zc3p $ Table 7: The abbreviation of modified nucleotides / nontraditional groups used in the Tables in the present description. The code Description rA Riboadenosine-3'-phosphate, 3'-adenylic acid rC Ribocytidin-3'-phosphate, 3'-cytidylic acid rG Riboguanosine-3'-phosphate, 3'-guanilic acid rU Ribouridine-3'-phosphate, 3'-uridylic acid mA 2-O-methyladenosine-3'-phosphate, 2-O-methyl-3'-adenylic acid mC 2-O-methylcytidine-3'-phosphate, 2-O-methyl-3'-cytidylic acid mG 2-O-methylguanosine-3'-phosphate, 2-O-methyl-3'-guanylic acid mU 2-O-methyluridine-3'-phosphate, 2-O-methyl-3'-uridyl acid dA Deoxyriboadenosine-3'-phosphate, 2'-deoxyribo-3'-adenylic acid dC Deoxyribo cytidine-3'-phosphate, 2'-deoxyribo-3'-cytidylic acid dG Deoxyriboguanosine-3'-phosphate, 2'-deoxyribo-3'-guanilic acid dT Deoxyribotimidine-3'-phosphate, 2'-deoxyribo-3'-thymidic acid rA2p Riboadenosine-2'-phosphate, 3'-thymidic acid rC2p Ribocytidin-2'-phosphate 2'-cytidic acid rG2p Riboguanosine-2'-phosphate 2'-guanilic acid rU2p Ribouridine-2'-phosphate 2'-uridic acid Lda L-Riboadenosine-3'-phosphate (specular reflection dA) Ldc L-Ribocytidin-3'-phosphate (specular reflection dC) Ldg L-Riboguanosine-3'-phosphate (specular reflection dG) Ldt L-Ribotimidin-3'-phosphate (specular reflection dT) dB No base deoxyribose-3'-phosphate, 1,2-dideoxy-O-ribofuranose-3-phosphate, 1,4-2-deoxy-O-ribitol-3'-phosphate zidB Inverted deoxyribose-5'-phosphate without base, at 5-5'-5'-aiAT, at 3-3'-3 'aiAT z Attachment for identifying a group covalently attached to the 3'-end or 5'-end psiU pseudouridine P 5'-phosphate S 5 'phosphotioate C3 C3 non-nucleotide S Missing 3'-linker (used together with the nucleotides indicated above at the 3'-end of the sequence)

[0499] siRNA oligonucleotides that are useful for creating double-stranded RNA molecules are described below in Tables A-18, A-19 B-E.

SERPINHL oligonucleotide sequences useful for preparing siRNA compounds

Table A-18: Title SEQ ID NO SEN Semantic (5 '> 3') SEQ ID NO AS Antisense (5 '> 3') Cross views Identical person gi 32454740 SERPINH1_2 60 GAGACACAUGGGUGCUAUA 127 UAUAGCACCCAUGUGUCUC H, Rt, Rh, M, D [1533-1551] (18/19) SERPINH1_3 61 GGGAAGAUGCAGAAGAAGA 128 UCUUCUUCUGCAUCUUCCC H, Rt, Rh, Rb [1112-1130] (18/19) SERPINH1_5 62 GAAGAAGGCUGUUGCCAUA 129 UAUGGCAACAGCCUUCUUC H, Rt [1123-1141] (18/19) SERPINH1_6 63 ACAAGAUGCGAGACGAGUA 130 UACUCGUCUCGCAUCUUGU H, Rt, Rh, [1464-1482] (18/19) SERPINH1_7 64 GGACAACCGUGGCUUCAUA 131 UAUGAAGCCACGGUUGUCC H, Rh, M [886-904] (18/19) SERPINH1_8 65 UGCAGUCCAUCAACGAGUA 132 UACUCGUUGAUGGACUGCA H, Rt, Rh, M [738-756] (18/19) SERPINH1_9 66 GCCUCAUCAUCCUCAUGCA 133 UGCAUGAGGAUGAUGAGGC H, Rt, Rh, M, D [1026-1044] (18/19) SERPINH1_10 67 CGCGCUGCAGUCCAUCAAA 134 UUUGAUGGACUGCAGCGCG H, Rt, Rh [733-751] (18/19) SERPINH1_11 68 CGGACAGGCCUCUACAACA 135 UGUUGUAGAGGCCUGUCCG H, Rt, Rh, p [944-962] (18/19) SERPINH1_13 69 UGACAAGAUGCGAGACGAA 136 UUCGUCUCGCAUCUUGUCA H, rh [1462-1480] (18/19) SERPINH1_14 70 CCAGCCUCAUCAUCCUCAA 137 UUGAGGAUGAUGAGGCUGG H, M, Rt, Rh, D- [1023-1041] (18/19) SERPINH1_15 71 GCUGCAGUCCAUCAACGAA 138 UUCGUUGAUGGACUGCAGC H, Rt, Rh [736-754] (18/19) SERPINH1_16 72 GCAGCGCGCUGCAGUCCAA 139 UUGGACUGCAGCGCGCUGC H, Rt, Rh [729-747] (18/19) SERPINH1_17 73 UGAGACACAUGGGUGCUAA 140 UUAGCACCCAUGUGUCUCA H, Rt, Rh [1532-1550]

M, D (18/19) SERPINH1_19 74 GGUGGAGGUGACCCAUGAA 141 UUCAUGGGUCACCUCCACC H, Rt, Rh, M [1159-1177] (18/19) SERPINH1_20 75 CUUUGACCAGGACAUCUAA 142 UUAGAUGUCCUGGUCAAAG H, Rt, Rh [1324-1342] (18/19) SERPINH1_21 76 GGAGGUGACCCAUGACCUA 143 UAGGUCAUGGGUCACCUCC H, Rt, Rh, M, D [1162-1180] (18/19) SERPINH1_22 77 CUCCUGAGACACAUGGGUA 144 UACCCAUGUGUCUCAGGAG H, D [1528-1546] (18/19) SERPINH1_23 78 AGAAGAAGGCUGUUGCCAA 145 UUGGCAACAGCCUUCUUCU H, Rt [1122-1140] (18/19) SERPINH1_24 79 AGCUCUCCAGCCUCAUCAA 146 UUGAUGAGGCUGGAGAGCU H, Rt, D, M, P, Rh [1017-1035] (18/19) SERPINH1_25 80 CUGCAGUCCAUCAACGAGA 147 UCUCGUUGAUGGACUGCAG H, Rt, Rh, M [737-755] (18/19) SERPINH1_26 81 CCGGACAGGCCUCUACAAA 148 UUUGUAGAGGCCUGUCCGG H, Rt, Rh, Rb, P [943-961] (18/19) SERPINH1_27 82 GCACCGGACAGGCCUCUAA 149 UUAGAGGCCUGUCCGGUGC H, Rt, Rh, Rb, P [940-958] (18/19) SERPINH1_28 83 GCAGAAGAAGGCUGUUGCA 150 UGCAACAGCCUUCUUCUGC H, Rt [1120-1138] (18/19) SERPINH1_31 84 AGAAGGCUGUUGCCAUCUA 151 UAGAUGGCAACAGCCUUCU H, Rt [1125-1143] (18/19) SERPINH1_32 85 AGCGCAGCGCGCUGCAGUA 152 UACUGCAGCGCGCUGCGCU H, Rt, Rh, [726-744] (18/19) SERPINH1_33 86 GACACAUGGGUGCUAUUGA 153 UCAAUAGCACCCAUGUGUC H, Rt, Rh, M [1535-1553] (18/19) | SERPINH1_34 87 GGGCCUGACUGAGGCCAUA 154 UAUGGCCUCAGUCAGGCCC H, Rt [1201-1219] (18/19) SERPINH1_35 88 AGACACAUGGGUGCUAUUA 155 UAAUAGCACCCAUGUGUCU H, Rt, Rh, M [1534-1552] (18/19) SERPINH1_36 89 CCAUGACCUGCAGAAACAA 156 UUGUUUCUGCAGGUCAUGG H, Rt, Rh, M [1171-1189] (18/19) SERPINH1_37 90 AGAUGCAGAAGAAGGCUGA 157 UCAGCCUUCUUCUGCAUCU H, Rt, Rh, M [1116-1134] (18/19) SERPINH1_38 91 CAAGCUCUCCAGCCUCAUA 158 UAUGAGGCUGGAGAGCUUG H, Rt, Rh, M, P, D [1015-1033] (18/19)

SERP1NH1_39 92 UGCAGAAGAAGGCUGUUGA 159 UCAACAGCCUUCUUCUGCA H, Rt [1119-1137] (18/19) SERPINH1_41 93 CAGCCUCAUCAUCCUCAUA 160 UAUGAGGAUGAUGAGGCUG H, Rt, Rh, M, D [1024-1042] (18/19) SERP1NH1_42 94 GACAGGCCUCUACAACUAA 161 UUAGUUGUAGAGGCCUGUC H, Rt, Rh, Rb, P [946-964] (18/19) SERPINH1_43 95 QAUGCAGAAGAAGGCUGUA 162 UACAGCCUUCUUCUGCAUC H, Rt, Rh, M [1117-1135] (18/19) SERPINH1_44 96 ACCCAUGACCUGCAGAAAA 163 UUUUCUGCAGGUCAUGGGU H, Rt, Rh, M [1169-1187] (18/19) SERPINH1_45 97 ACUCCAAGAUCAACUUCCA 164 UGGAAGUUGAUCUUGGAGU H, Rt, Rh, M, D [702-720] (18/19) SERPINH1_45a 98 ACUCCAAGAUCAACUUCCU 165 AGGAAGUUGAUCUUGGAGU H, Rt, Rh, M, D [702-720] (18/19) SERPINH1_48 99 AGGCCUCUACAACUACUAA 166 UUAGUAGUUGUAGAGGCCU H, Rt, Rh, Rb, P, D [949-967] (18/19) SERPINH1_49 one hundred CACUCCAAGAUCAACUUCA 167 UGAAGUUGAUCUUGGAGUG H, Rt, Rh, M, D [701-719] (18/19) SERPINH1_51 101 UCCUGAGACACAUGGGUGA 168 UCACCCAUGUGUCUCAGGA H, Rt, D, M [1529-1547] (18/19) SERPINH1_52 102 GACAAGAUGCGAGACGAGA 169 UCUCGUCUCGCAUCUUGUC H, Rt, Rh, [1463-1481] (18/19) SERPINH1_53 103 GGUGACCCAUGACCUGCAA 170 UUGCAGGUCAUGGGUCACC H, Rt, Rh, M [1165-1183] (18/19) SERPINH1_59 104 CCGAGGUGAAGAAACCUGA 171 UCAGGUUUCUUCACCUCGG H, Rt, Rh, [285-303] (18/19) SERPINH1_51a 105 UCCUGAGACACAUGGGUGU 172 ACACCCAUGUGUCUCAGGA H, Rt, D, M [1529-1547] (18/19) SERPINH1_61 106 GCACUCCAAGAUCAACUUA 173 UAAGUUGAUCUUGGAGUGC H, Rh, D [700-718] (18/19) SERPINH1_62 107 GUGGUGGAGGUGACCCAUA 174 UAUGGGUCACCUCCACCAC H, Rt, Rh, M, Rb [1157-1175] (18/19) SERPINH1_64 108 GCCGAGGUGAAGAAACCUA 175 UAGGUUUCUUCACCUCGGC H, Rt, Rh, [284-302] (18/19) SERPINH1_65 109 GCUCUCCAGCCUCAUCAUA 176 UAUGAUGAGGCUGGAGAGC H, Rt, D, M, P, Rh [1018-1036] (18/19) SERPINH1_66 110 GAUGCACCGGACAGGCCUA 177 UAGGCCUGUCCGGUGCAUC H, Rt, Rh, M, Rb, P [937-955] (18/19)

SERPINH1_68 111 CUCUCCAGCCUCAUCAUCA 178 UGAUGAUGAGGCUGGAGAG H, Rt, D, M, P, Rh [1019-1037] (18/19) SERPINH1_69 112 GCAGACCACCGACGGCAAA 179 UUUGCCGUCGGUGGUCUGC H, Rt, D [763-781] (18/19) SERPINH1_70 113 AGUCCAUCAACGAGUGGGA 180 UCCCACUCGUUGAUGGACU H, Rt, Rh, M [741-759] (18/19) SERPINH1_71 114 ACCGUGGCUUCAUGGUGAA 181 UUCACCAUGAAGCCACGGU H, Rt, Rh, [891-909] (18/19) SERPINH1_74 115 GAAGGCUGUUGCCAUCUCA 182 UGAGAUGGCAACAGCCUUC H, Rt, [1126-1144] (18/19) SERPINH1_75 116 GAAGAUGCAGAAGAAGGCA 183 UGCCUUCUUCUGCAUCUUC H, Rt, Rh, Rb [1114-1132] (18/19) SERPINH1_77 117 UGAUGAUGCACCGGACAGA 184 UCUGUCCGGUGCAUCAUCA H, Rh, [933-951] (18/19) SERPINH1_78 118 CCCUUUGACCAGGACAUCA 185 UGAUGUCCUGGUCAAAGGG H, Rt, Rh, [1322-1340] (18/19) SERPINH1_80 119 CAGUCCAUCAACGAGUGGA 186 UCCACUCGUUGAUGGACUG H, Rt, Rh, M [740-758] (18/19) SERPINH1_82 120 CAACCGUGGCUUCAUGGUA 187 UACCAUGAAGCCACGGUUG H, Rt, Rh, M [889-907] (18/19) SERPINH1_83 121 CGACAAGCGCAGCGCGCUA 188 UAGCGCGCUGCGCUUGUCG H [721-739] (18/19) SERPINH1_84 122 GCAGUCCAUCAACGAGUGA 189 UCACUCGUUGAUGGACUGC H, Rt, Rh, M [739-757] (18/19) SERPINH1_86 123 ACAGGCCUCUACAACUACA 190 UGUAGUUGUAGAGGCCUGU H, Rt, Rh, Rb, P, D [947-965] (18/19) SERPINH1_87 124 AAGAUGCAGAAGAAGGCUA 191 UAGCCUUCUUCUGCAUCUU H, Rt, Rh, M [1115-1133] (18/19) SERPINH1_89 125 CAGCGCGCUGCAGUCCAUA 192 UAUGGACUGCAGCGCGCUG H, Rt, Rh, [730-748] (18/19) SERPINH1_90 126 GCGCAGCGCGCUGCAGUCA 193 UGACUGCAGCGCGCUGCGC H, Rt, Rh, [727-745] (18/19)

Table A-18 SiRNA Selection siRNA SEQ ID SEN SEQ ID AS Activity 0.1 nM Activity 0.5 nM Activity 5 nM IC50 (nM) Length SERPINH1_2 60 127 65 48 7 .008 19 SERPINH1_6 63 130 164 39 5 .019 19 SERPINH1_11 68 135 119 54 6 .05 19 SERPINH1_13 69 136 91 24 four 19 SERPINH1_45 97 164 156 38 8 .07 19 SERPINH1_45a 98 165 19 SERPINH1_51 101 168 68 39 5 .05 19 SERPINH1_52 102 169 149 37 9 0.06 19 SERPINH1_86 123 190 121 61 0.27 19 siRNA SEQ ID SEN SEQ ID AS Activity 0.026 nM Activity 0.077 nM Activity 0.23 nM Activity 0.69 nM Activity 2.1 nM Activity 6.25 nM Activity 25 nM SERPINH1_45 97 164 102 81 55 41 28 22 16 SERPINH1_45a 98 165 107 98 84 69 36 24 16

Table A-19: Title SEQ ID NO SEN Semantic (5 '> 3') SEQ ID NO AS Antisense (5 '> 3') Kinds Length Identical person gi 32454740 SERPINH1_1 194 GGACAGGCCUCUACAACUA 219 UAGUUGUAGAGGCCUGUCC H, Rt, Rh, Rb, P 19 [945-963] (19/19) SERPINH1_4 195 GAGACACAUGGGUGCUAUU 220 AAUAGCACCCAUGUGUCUC H, Rt, Rh, M, D 19 [1533-1551] (19/19) SERPINH1_12 196 ACAAGAUGCGAGACGAGUU 221 AACUCGUCUCGCAUCUUGU H, Rt, Rh, 19 [1464-1482] (19/19) SERPINH1_18 197 CCUUUGACCAGGACAUCUA 222 UAGAUGUCCUGGUCAAAGG H, Rt, Rh, 19 [1323-1341] (19/19) SERPINH1_29 198 GACCCAUGACCUGCAGAAA 223 UUUCUGCAGGUCAUGGGUC H, Rt, Rh, M 19 [1168-1186] (19/19) SERPINH1_30 199 CGGACAGGCCUCUACAACU 224 AGUUGUAGAGGCCUGUCCG H, Rt, Rh, Rb, P 19 [944-962] (19/19) SERPINH1_40 200 ACCGGACAGGCCUCUACAA 225 UUGUAGAGGCCUGUCCGGU H, Rt, Rh, Rb, P, 19 [942-960] (19/19) SERPINH1_46 201 GCAGCGCGCUGCAGUCCAU 226 AUGGACUGCAGCGCGCUGC H, Rt, Rh, 19 [729-747] (19/19) SERPINH1_47 202 GCGCGCUGCAGUCCAUCAA 227 UUGAUGGACUGCAGCGCGC H, Rt, Rh, 19 [732-750] (19/19) SERPINH1_50 203 CUGAGACACAUGGGUGCUA 228 UAGCACCCAUGUGUCUCAG H, Rt, Rh, M, D 19 [1531-1549] (19/19) SERPINH1_54 204 AGAAGAAGGCUGUUGCCAU 229 AUGGCAACAGCCUUCUUCU H, Rt 19 [1122-1140] (19/19) SERPINH1_55 205 AGCUCUCCAGCCUCAUCAU 230 AUGAUGAGGCUGGAGAGCU H, Rt, D, M, P, Rh 19 [1017-1035] (19/19) SERPINH1_56 206 CUGCAGUCCAUCAACGAGU 231 ACUCGUUGAUGGACUGCAG H, Rt, Rh, M 19 [737-755] (19/19) SERPINH1_57 207 CGCUGCAGUCCAUCAACGA 232 UCGUUGAUGGACUGCAGCG H, Rt, Rh, 19 [735-753] (19/19) SERPINH1_58 208 GACAAGAUGCGAGACGAGU 233 ACUCGUCUCGCAUCUUGUC H, Rt, Rh, 19 [1463-1481] (19/19) SERPINH1_63 209 GGGCCUGACUGAGGCCAUU 234 AAUGGCCUCAGUCAGGCCC H, Rt 19 [1201-1219] (19/19) SERP1NH1_67 210 GAUGCAGAAGAAGGCUGUU 235 AACAGCCUUCUUCUGCAUC H, Rt, Rh, 19 [1117-1135]

M (19/19) SERPINH1_72 211 CACCGGACAGGCCUCUACA 236 UGUAGAGGCCUGUCCGGUG H, Rt, Rh, Rb, P 19 [941-959] (19/19) SERPINH1_73 212 AGAUGCAGAAGAAGGCUGU 237 ACAGCCUUCUUCUGCAUCU H, Rt, Rh M 19 [1116-1134] (19/19) SERP1NH1_76 213 AGCGCGCUGCAGUCCAUCA 238 UGAUGGACUGCAGCGCGCU H, Rt, Rh 19 [731-749] (19/19) SERPINH1_79 214 GGAAGAUGCAGAAGAAGGC 239 GCCUUCUUCUGCAUCUUCC H, Rt, Rh, Rb 19 [1113-1131] (19/19) SERPINH1_81 215 GAAGAAGGCUGUUGCCAUC 240 GAUGGCAACAGCCUUCUUC H, Rt 19 [1123-1141] (19/19) SERPINH1_85 216 UGCAGUCCAUCAACGAGUG 241 CACUCGUUGAUGGACUGCA H, Rt, Rh, M 19 [738-756] (19/19) SERPINH1_88 217 CCUGAGACACAUGGGUGCU 242 AGCACCCAUGUGUCUCAGG H, Rt, D, M 19 [1530-1548] (19/19) SERPINH1_91 218 CGCAGCGCGCUGCAGUCCA 243 UGGACUGCAGCGCGCUGCG H, Rt, Rh, 19 [728-746] (19/19)

EXAMPLE 10:

Animal models

Model fibrotic disease systems

[0500] Analysis of active siRNA according to the present invention could be performed on predictive animal models. Rat diabetic and aging kidney fibrosis models included Zucker obese and diabetes (ZDF) rats, old fa / fa Zucker obese rats, old Sprague-Dawley mice (SD), and Goto Kakizaki rats (GK); GK rats are an inbred strain obtained from Wistar rats selected for the spontaneous development of NIDDM (type II diabetes). Induced models of renal fibrosis included a model of permanent unilateral ureteral obstruction (UUO), which is a model of acute intestinal fibrosis found in healthy non-diabetic animals; renal fibrosis develops through several days after obstruction. Another induced model of renal fibrosis is 5/6 nephrectomy.

[0501] Two rat liver fibrosis models were Bile duct ligation (BDL) simulating surgery as controls and CC14 poisoning with animals kept on a diet of olive oil as controls, as described in the following publications: Lotersztajn S, et al Hepatic Fibrosis: Molecular Mechanisms and Drug Targets. Annu Rev Pharmacol Toxicol. 2004 Oct 07; Uchio K, et al., Down-regulation of connective tissue growth factor and type I collagen mRNA expression by connective tissue growth factor antisense oligonucleotide during experimental liver fibrosis. Wound Repair Regen. 2004 Jan-Feb; 12 (1): 60-6; Xu XQ, et al., Molecular classification of liver fibrosis in a rat model by proteomics and bioinformatics Proteomics. 2004 Oct; 4 (10): 3235-45.

[0502] Eye scarring models are well known in the art, for example, in Sherwood MB et al., J Glaucoma. 2004 Oct; 13 (5): 407-12. A new model of glaucoma filtering surgery in the rat; Miller MH et al., Ophthalmic Surg. 1989 May; 20 (5): 350-7. Wound healing in an animal model of glaucoma fistulizing surgery in the Rb; vanBockxmeer FM et al., Retina. 1985 Fall-Winter; 5 (4): 239-52. Models for assessing scar tissue inhibitors; Wiedemann Ρ et al., J Pharmacol Methods. 1984 Aug; 12 (1): 69-78. Proliferative vitreoretinopathy: the Rb cell injection model for screening of antiproliferative drugs.

[0503] Cataract models are described in the following publications: The role of Src family kinases in cortical cataract formation. Zhou J, Menko AS. Invest Ophthalmol Vis Sci. 2002 Jul; 43 (7): 2293-300; Bioavailability and anticataract effects of a topical ocular drug delivery system containing disulfiram and hydrochupropyl-beta-cyclodextrin on selenite-treated rats. Wang S, et al. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=15370367 Curr Eye Res. 2004 Jul; 29 (1): 51-8; and Long-term organ culture system to study the effects of UV-A irradiation on lens transglutaminase. Weinreb O, Dovrat Α .; Curr Eye Res. 2004 Jul; 29 (1): 51-8.

[0504] The compounds of Tables A-18 and Tables A-19 were tested on these fibrotic disease models, which were found to be effective in treating liver fibrosis and other fibrotic diseases.

Model glaucoma systems

[0505] A study of active siRNAs according to the present invention for the treatment or prophylaxis of glaucoma was performed in rat animal models of optic nerve damage, as described, for example, in the publications: Maeda, K. et al., "A Novel

Neuroprotectant against Retinal Ganglion Cell Damage in a Glaucoma Model and an Optic Nerve Crush Model in the rat. "Investigative Ophthalmology and visual Science (IOVS), March 2004, 45 (3) 851. In particular, the orbital part was exposed for a transverse section of the optic nerve. optic nerve (ON) of rats under anesthesia with access through the infraorbital part, the soft membranes of the brain were torn and all axons in ON were dissected with forceps for 10 seconds, 2 mm from the ethmoid plate.

[0506] Nucleic acid molecules as described herein were tested in this animal model, and the results showed that these siRNA compounds are useful in the treatment and / or prevention of glaucoma.

Rat Optic Nerve Injury Model (ONC): Intravitrial siRNA Delivery and Eye Drop Delivery

[0507] For the transverse section of the optic nerve, the ocular part of the optic nerve (ON) of the rats was exposed under anesthesia with access through the infraorbital part, the soft membranes of the brain were torn and all axons in ON were cut with tongs for 10 seconds, 2 mm from the ethmoid plate.

[0508] The siRNA compounds were delivered individually or in combination in a volume of 5 μl (10 μg / μl) as eye drops. Immediately after the destruction of the optical nerve (ONC), 20 μg / 10 μl of the studied siRNAs or 10 μl of PBS were injected into one or both eyes of adult Wistar rats and siRNAs absorbed into dissected and rapidly frozen whole retinas were determined after 5 hours and 1 day and 2, 4, 7, 14 and 21 days after injection. Similar experiments were performed to test the activity and effectiveness of siRNAs administered as eye drops.

Model ischemic reperfusion injury systems after lung transplantation in rats

[0509] An ischemia / reperfusion injury was obtained in a rat model as described in Mizobuchi et al., The Journal of Heart and Lung Transplantation, Vol 23 No. 7 (2004) and publications by Kazuhiro Yasufaku et al., Am. J. Respir. Cell Mol Biol, Vol 25, pp 26-34 (2001).

[0510] In particular, after performing isoflurane anesthesia, a size 14 teflon catheter was inserted into the trachea and the rat was mechanically ventilated using a rodent fan using 100% oxygen at a rate of 70 breaths per minute and a positive pressure at the end of exhalation of 2 cm H2O. The left pulmonary artery, veins, and the main trunk of the bronchus were ligated with a Castaneda clamp. During surgery, the lung was moistened with saline and the incision was closed to minimize evaporation losses. The duration of the period of ischemia was 60 minutes. At the end of the ischemia period, the clamp was removed and ventilation and reperfusion of the lung were ensured for the next 4, 24 hours and 5 days after stimulation of lung ischemia. At the end of this experiment, the lungs were carefully removed and frozen to isolate RNA or fixed in a cocktail of glutaraldehyde for subsequent histological examination.

An animal model of bleomycin as a model of idiopathic pulmonary fibrosis (IPF).

[0511] A study of the feasibility of delivering siRNA into the lungs and liver as part of a vitamin A-Coatsome dosage form administered by intravenous injection and intratracheal administration of the siRNA-vitamin A-Coatsome complex to healthy mice and mice that received bleomycin.

[0512] Purpose: To test two routes of administration for feasibility of delivering a dosage form of siRNA with vitamin A-Coatsome to normal lungs and fibrous lungs of mice. The main test hypothesis of this study is whether the systemic administration of the modified siRNA vitamin A-Coatsome dosage form provides beneficial absorption and cell-specific distribution in the fibrous and normal lungs of mice. At the same time, the intratracheal route of administration of the modified siRNA dosage form with vitamin A-Coatsome was investigated. Determination of siRNA and cell-specific distribution in the lungs and liver was performed by in situ hybridization (ISH)

[0513] BACKGROUND: A model of pulmonary fibrosis caused by bleomycin has been successfully developed and characterized over the past three decades (Moeller, et al. Int J Biochem Cell Biol, 40: 362-382, 2008; Chua et al., Am J Respir Cell Mol Biol 33: 9-13, 2005). Histological signs, such as intra-alveolar thickening, insertion into the wall of collagen and obliteration of the alveolar space, are present in BLM animals, as in patients with IPF. Early studies showed that C57 / B1 mice were systematically prone to BLM-induced lung fibrosis, while Balb / C mice were inherently stable. Different fibrosis patterns develop depending on the route of administration. Intratracheal administration of BLM leads to accentuated bronchiocentric fibrosis, while intravenous or intraperitoneal administration causes pleural scarring, as in the case of a human disease (Chua et al. Ibid). A murine model of conventional interstitial pneumonia (UIP) was used. This model exhibits a heterogeneous distribution of fibril accumulation (fibroproliferation), mainly located subpleurally, resulting in lesions similar to those observed in the lungs of patients with idiopathic pulmonary fibrosis (IPF) (Onuma, et al., Tohoku J Exp Med 194: 147-156 , 2001 and Yamaguchi and Ruoslahti, Nature 336: 244-246, 1988). UIPs are induced by intraperitoneal injection of bleomycin every other day for 7 days to continuously maintain subpleural fibro-proliferation in the lungs of mice (Swiderski et al. Am J Pathol 152: 821-828,1998 and Shimizukawa et al., Am J Physiol Lung Cell Mol Physiol 284: L526 -L532,2003).

[0514] As previously shown, siRNAs containing vitamin A-loaded liposomes interact with retin-binding protein (RBP) and provide efficient delivery to stellate liver cells via RBP receptor (Sato et al. Nat Biotechnol 26: 431-442, 2008) . This study was intended to test whether the siRNA complex with vitamin A-Coatsome would be effectively absorbed by activated myofibroblasts expressing RBP receptor in the lungs of mice treated with bleomycin. In addition, the method of local administration (intratracheal administration) was checked.

[0515] General study design

Mice - C57 B1 males

Initial N (BLM I.P.) - 40 (6 for the first pilot group, 34 for the study, taking into account the expected mortality of 25%)

Initial N (General) - 60

Test siRNAs: SERPINHI compounds as described herein.

[0516] Pulmonary fibrosis caused by bleomycin. Pulmonary fibrosis in female 12-week-old female mice C57BL / 6 was induced by intraperitoneal administration of bleomycin hydrosulfate: 0.75 mg / kg body weight, dissolved in 0.1 ml of physiological saline, every other day for 7 days, at 0, 2, 4 and 6 day.

[0517] Return visit and monitoring. Mice were weighed before starting administration of BLM and twice a week during the study.

[0518] Pilot assessment of the establishment of fibrosis. Mice (N = 30) were exposed to BLM in groups with an interval of one week between the first treated group (N = 5) and the rest of the animals. On day 14, two mice from the first group were sacrificed and lungs were taken for quick staining of HE and histopathological evaluation of fibrosis. If the diagnosis of pulmonary fibrosis was confirmed, the remaining rats were divided into groups and treated with siRNA on day 14 after the first injection of BLM. If on day 14 the animals did not develop sufficient pulmonary fibrosis, the remaining mice from the first treated group were sacrificed on day 21 followed by a quick histopathological evaluation of fibrosis. The remaining animals were treated with the complex of the studied siRNA starting from 21 days after administration of BLM.

[0519] Introduction of siRNA. On the 14th or 21st day after the first injection of BLM (TBD during the study, based on pilot estimates of the establishment of fibrosis), the animals were divided into groups according to body weight. Animals from groups 1 and 2 were injected intravenously (injection into the tail vein) with a siRNA / vitamin A / Coatsome complex with a siRNA concentration of 4.5 mg / kg body weight. Intact animals of the same age (groups 5 and 6) were treated in the same way. BLM-treated mice (group 9) were used as a control with a carrier of vitamin A-coatsome. After 24 hours, the injection was repeated to all animals as described above.

[0520] BLM animals from groups 3 and 4 and intact mice from groups 7 and 8 were anesthetized with isofuran and intrathecalized with 2.25 mg / kg siRNA in a dosage form with vitamin A-loaded liposomes. Group 10 mice BLM was administered only a carrier of vitamin A / Coatsome. Intrathecal administration was repeated after 24 hours.

[0521] Completion of the study. Animals from groups 1, 3, 5, 7, 9 were killed 2 hours after the second injection or administration of the siRNA complex. Animals from groups 2,4,6,8,10 were sacrificed 24 hours after the second injection or administration of the siRNA complex.

[0522] After killing, mice were transcardially injected with 10% neutral buffered formalin. The lungs were filled with 0.8-1.0 ml of 10% NBF and the trachea was ligated.

The lungs were excised and fixed for 24 hours in 10% NBF. Liver was obtained from each animal and fixed in 10% NBF for 24 hours.

[0523] Preparation of slices and evaluation. The resulting sections were prepared from the lungs and liver. First, the obtained sections were stained with hematoxylin and eosin to determine the morphology of the lungs and liver, then the sections were stained with Sirius Red (tricolor) to identify collagen. Then, the obtained sections were subjected to in situ hybridization (ISH) to detect siRNA.

[0524] the Compounds according to the present description was investigated in this animal model, and the results showed that these siRNA compounds are useful in the treatment and / or prevention of pulmonary fibrosis.

Table 1 List of siRNA sequences siRNA Target Area Base sequence [corresponding nucleotides of SEQ ID NO: 1] Experimental sequence [corresponding nucleotides of SEQ ID NO: 1] siHSP47-C hsp47 human / rat Semantic 5 'GGACAGGCCUCUACAACUAUU (SEQ ID NO: 3) [945-963] 5 'GGACAGGCCUCUACAACUAdTdT (SEQ ID NO: 5) [945-963] Anti-semantic 5 'UAGUUGUAGAGGCCUGUCCUU (SEQ ID NO: 4) [945-963] 5 'UAGUUGUAGAGGCCUGUCCdTdT (SEQ ID NO: 6) [945-963] siHSP47-Cd hsp47 human / rat Semantic 5 'GGACAGGCCUCUACAACUACUACGA (SEQ ID NO: 7) [945-969] 5 'GGACAGGCCUCUACAACUACUACdGdA (SEQ ID NO: 9) [945-969] Anti-semantic 5 'UCGUAGUAGUUGUAGAGGCCUGUCCUU (SEQ ID NO: 8) [945-969] 5 'UCGUAGUAGUUGUAGAGGCCUGUCCUU (SEQ ID NO: 10) [945-969] siHSP47-1 hsp47 human / rat Semantic 5 'CAGGCCUCUACAACUACUAUU (SEQ ID NO: 11) [948-966] 5 'CAGGCCUCUACAACUACUAdTdT (SEQ ID NO: 13) [948-966] Anti-semantic 5 'UAGUAGUUGUAGAGGCCUGUU (SEQ ID NO: 12) [948-966] 5 'UAGUAGUUGUAGAGGCCUGdTdT (SEQ ID NO: 14) [948-966]

siHSP47-1d hsp47 person Semantic 5 'CAGGCCUCUACAACUACUACGACGA (SEQ ID NO: 15) [948-972] 5 'CAGGCCUCUACAACUACUACGACdGdA (SEQ ID NO: 17) [948-972] Anti-semantic 5 'UCGUCGUAGUAGUUGUAGAGGCCUGUU (SEQ ID NO: 16) [948-972] 5 'UCGUCGUAGUAGUUGUAGAGGCCUGUU (SEQ ID NO: 18) [948-972] siHsp47-2 hsp47 person Semantic 5 'GAGCACUCCAAGAUCAACUUU (SEQ ID NO: 19) [698-717] 5 'GAGCACUCCAAGAUCAACUdTdT (SEQ ID NO: 21) [698-717] Anti-semantic 5 'AGUUGAUCUUGGAGUGCUCUU (SEQ ID NO: 20) [698-716] 5 'AGUUGAUCUUGGAGUGCUCdTdT (SEQ ID NO: 22) [698-716] siHsp47-2d hsp47 person Semantic 5 'GAGCACUCCAAGAUCAACUUCCGCG (SEQ ID NO: 23) [698-722] 5 'GAGCACUCCAAGAUCAACUUCCGdCdG (SEQ ID NO: 25) [698-722] Anti-semantic 5 'CGCGGAAGUUGAUCUUGGAGUGCUCUU (SEQ ID NO: 24) [698-722] 5 'CGCGGAAGUUGAUCUUGGAGUGCUCUU (SEQ ID NO: 26) [698-722] siHsp47-2d rat Gp46 rat Semantic 5 'GAACACUCCAAGAUCAACUUCCGAG (SEQ ID NO: 27) [587-611] 5 'GAACACUCCAAGAUCAACUUCCGdAdG (SEQ ID NO: 29) [587-611] Anti-semantic 5 'CUCGGAAGUUGAUCUUGGAGUGUUCUU (SEQ ID NO: 28) [587-611] 5 'CUCGGAAGUUGAUCUUGGAGUGUUCUU (SEQ ID NO: 30) [587-611] siHsp47-3 human hsp47 cDNA Semantic 5 'CUGAGGCCAUUGACAAGAAUU (SEQ ID NO: 31) [1209-1227] 5 'CUGAGGCCAUUGACAAGAAdTdT (SEQ ID NO: 33) [1209-1227]

Anti-Semantic 5 'UUCUUGUCAAUGGCCUCAGUU (SEQ ID NO: 32) [1209-1227] 5 'UUCUUGUCAAUGGCCUCAGdTdT (SEQ ID NO: 34) [1209-1227] siHsp47-3d hsp47 person Semantic 5 'CUGAGGCCAUUGACAAGAACAAGGC (SEQ ID NO: 35) [1209-1233] 5 'CUGAGGCCAUUGACAAGAACAAGdGdC (SEQ ID NO: 37) [1209-1233] Anti-Semantic 5 'GCCUUGUUCUUGUCAAUGGCCUCAGUU (SEQ ID NO: 36) [1209-1233] 5 'GCCUUGUUCUUGUCAAUGGCCUCAGUU (SEQ ID NO: 38) [1209-1233] siHsp47-4 hsp47 person Semantic 5 'CUACGACGACGAGAAGGAAUU (SEQ ID NO: 39) [964-982] 5 'CUACGACGACGAGAAGGAAdTdT (SEQ ID NO: 41) [964-982] Anti-Semantic 5 'UUCCUUCUCGUCGUCGUAGUU (SEQ ID NO: 40) [964-982] 5 'UUCCUUCUCGUCGUCGUAGdTdT (SEQ ID NO: 42) [964-982] siHsp47-4d hsp47 person Semantic 5 'CUACGACGACGAGAAGGAAAAGCUG (SEQ ID NO: 43) [964-988] 5 'CUACGACGACGAGAAGGAAAAGCdTdG (SEQ ID NO: 45) [964-988] Anti-Semantic 5 'CAGCUUUUUCCUUCUCGUCGUCGUAGUU (SEQ ID NO: 44) [964-988] 5 'CAGCUUUUCCUUCUCGUCGUCGUAGUU (SEQ ID NO: 46) [964-988] siHsp47-5 hsp47 person Semantic 5 'GCCACACUGGGAUGAGAAAUU (SEQ ID NO: 47) [850-870] 5 'GCCACACUGGGAUGAGAAAdTdT (SEQ ID NO: 49) [850-870] Anti-Semantic 5 'UUUCUCAUCCCAGUGUGGCUU (SEQ ID NO: 48) [850-868] 5 'UUUCUCAUCCCAGUGUGGCdTdT (SEQ ID NO: 50) [850-868]

siHsp47-6 hsp47 person Semantic 5 'GCAGCAAGCAGCACUACAAUU (SEQ ID NO: 51) [675-693] 5 'GCAGCAAGCAGCACUACAAdTdT (SEQ ID NO: 53) [675-693] Anti-semantic 5 'UUGUAGUGCUGCUUGCUGCUU (SEQ ID NO: 52) [675-693] 5 'UUGUAGUGCUGCUUGCUGCdTdT (SEQ ID NO: 54) [675-693] siHsp47-7 hsp47 person Semantic 5 'CCGUGGGUGUCAUGAUGAUUU (SEQ ID NO: 55) [921-939] 5 'CCGUGGGUGUCAUGAUGAUdTdT (SEQ ID NO: 57) [921-939] Anti-semantic 5 'AUCAUCAUGACACCCACGGUU (SEQ ID NO: 56) [921-939] 5 'AUCAUCAUGACACCCACGGdTdT (SEQ ID NO: 58) [921-939]

[0525] The contents of articles, patents and patent applications and all other documents and information in electronic form that are indicated or cited in this document are incorporated by reference in their entirety to the same extent as if it were separately indicated that Each publication should be incorporated by reference.

[0526] Applicants reserve the right to physically include in the publication all materials and information from any such articles, patents, patent applications, or other physical and electronic documents.

[0527] It will be apparent to one skilled in the art that various substitutions and modifications may be made to the invention as described herein without departing from the scope and spirit of the invention. Thus, such additional embodiments are within the scope of the present invention and claims. The present invention teaches those skilled in the art to verify the various combinations and / or substitutions of chemical modifications as described herein to obtain nucleic acid constructs with improved activity to mediate RNAi activity. Such improved activity may include improved stability, improved bioavailability and / or improved activation of RNAi mediating cellular responses. Thus, the specific variants of the present description are not limiting, and those skilled in the art will readily appreciate that certain combinations of changes in the present description can be investigated without undue experimentation to identify nucleic acid molecules with improved RNAi activity.

[0528] The inventions visually according to the present description can be practiced in the absence of any element or elements, limitations or limitations, not specifically according to the present description. Thus, for example, the indefinite article and the definite article and similar definitions in the context of the invention (especially in the context of the following claims) should be interpreted as the singular and plural, unless otherwise indicated or the contrary follows from the context. The terms “comprising,” “having,” “including,” and the like. should be understood in a broad sense and without limitation (for example, meaning "including, but not limited to"). The enumeration of the limits of values in the present description is intended only to serve as an abbreviated way of designating an individual value that falls within the limit, unless otherwise indicated, and each individual value is included in the description, as if it were separately listed. All methods according to the present description can be carried out in any order, unless otherwise indicated, or does not follow otherwise from the context. The use of any examples (eg, “such as”) as described herein is intended only to better illuminate the invention and does not limit the scope of the invention unless otherwise indicated. No expression in the description should be construed as an indication that any not claimed element is important for the practice of the invention. In addition, the terms and expressions used in the present description were used as a condition of description, and not limitation, and these terms and expressions are not aimed at excluding any equivalents of the functions shown and described or their parts, on the contrary, it is recognized that in the framework of the claimed various modifications are possible. Thus, it should be understood that, although the invention has been specifically disclosed in the preferred embodiments and additional functions, those skilled in the art may resort to modifications and changes of the inventions set forth in this publication, and it is believed that such changes and variations are within the scope of this invention .

[0529] The invention has been described in a broad sense and in a general document. Each narrow species and subgeneric group included in the general disclosure of information are also part of the invention. This includes a general description of the invention with a reservation or negative restriction that removes any item from the genus, regardless of whether the cut material is set forth in the present description. Other options are within the following formula. In addition, if the functions and aspects of the invention described in terms of Markush groups, those skilled in the art will understand that the invention is also described in terms of individual members or a subgroup of members of the Markush group.

Claims (25)

1. A double-stranded nucleic acid molecule for inhibiting the expression of the hsp47 gene, having the structure (A2) shown below:

in which each of N ² , N and N ′ represents an unmodified or modified ribonucleotide or non-traditional group;
in which each of (N) x and (N ′) y represents an oligonucleotide in which each subsequent N or N ′ is connected to a neighboring N or N ′ via a covalent bond;
in which each of x and y independently represents an integer from 17 to 39;
in which the sequence (N ′) y has the complementarity of the sequence (N) x, and the sequence (N) x has the complementarity of a continuous sequence in the mRNA encoding hsp47;
in which N ^{1 is} covalently linked to (N) x and is not complementary to mRNA encoding hsp47, or is a DNA group complementary to mRNA encoding hsp47;
wherein N ¹ is a group selected from the group consisting of natural or modified uridine, deoxyuridine, ribotimidine, deoxyribotimidine, adenosine or deoxyadenosine;
in which z ″ may be present or absent, but if present, is a protecting group covalently attached to the 5′-end of N ² - (N ′) y;
in which each of Z and Z ′ may independently be present or absent, but if present independently represents 1-5 consecutive nucleotides, consecutive non-nucleotide groups or a combination of nucleotides and non-nucleotide groups covalently attached to the 3′-end of the chain in which it is present, and
wherein said double-stranded nucleic acid molecule includes an oligonucleotide designated as SERPINH1_2 (SEQ ID NO: 60 and SEQ ID NO: 127), SERPINH1_45a (SEQ ID NO: 98 and SEQ ID NO: 165), or SERPINH1_51 (SEQ ID NO: 101 and SEQ ID NO: 168). 2. The double-stranded nucleic acid molecule according to claim 1, characterized in that x = y = 18. 3. The double-stranded nucleic acid molecule according to claim 1, characterized in that the sense strand and antisense strand are selected from the oligonucleotide represented by SERPINH1_2 (SEQ ID NO: 60 and SEQ ID NO: 127), SERPINH1_45a (SEQ ID NO: 98 and SEQ ID NO: 165) and SERPINH1_51 (SEQ ID NO: 101 and SEQ ID NO: 168). 4. The double-stranded nucleic acid molecule according to claim 3, represented by SERPINH1_2, which has the structure

in which each sign "|" denotes the base pairing between ribonucleotides;
in which each of A, C, G and U independently represents an unmodified or modified ribonucleotide or non-traditional group:
in which each of Z and Z ′ may independently be present or absent, but if present independently represents 1-5 consecutive nucleotide or non-nucleotide groups or a combination of nucleotides and non-nucleotide groups covalently attached to the 3′-end of the chain in which it is present; and
in which z ″ may be present or absent, but if present, is a protective group covalently attached to the 5′-end of the sense chain. 5. The double-stranded nucleic acid molecule according to claim 4, characterized in that each of A, C, G and U is an unmodified ribonucleotide, and z ″, Z and Z ′ are absent. 6. The double-stranded nucleic acid molecule according to claim 4, characterized in that Z and Z ′ are present. 7. The double-stranded nucleic acid molecule according to claim 6, characterized in that Z and Z ′ independently contain a protruding end of the nucleotides or non-nucleotides of the group. 8. The double-stranded nucleic acid molecule according to claim 7, characterized in that Z and Z ′ contain non-nucleotide groups. 9. The double-stranded nucleic acid molecule according to claim 8, characterized in that Z ′ contains C3Pi of the formula:

; and
wherein Z contains C3Pi-C3OH formulas:

. 10. The double-stranded nucleic acid molecule according to claim 4, characterized in that the antisense chain contains ribonucleotides with a modified 2′-O-methyl sugar residue. 11. The double-stranded nucleic acid molecule of claim 10, wherein the ribonucleotides with a modified 2′-O-methyl sugar residue are in positions (5 ′> 3 ′) 3, 5, 9, 11, 13, 15, 17 and 19. 12. The double-stranded nucleic acid molecule according to claim 11, characterized in that the antisense strand also contains a ribonucleotide with a modified 2′-O-methyl sugar residue in position (5 ′> 3 ′) 1. 13. The double-stranded nucleic acid molecule according to claim 12, characterized in that the antisense strand contains 2′5′ribonucleotide at position (5 ′> 3 ′) 7. 14. The double-stranded nucleic acid molecule according to claim 4 or 13, characterized in that the sense strand contains 4 or 5 consecutive 2′5 ′ ribonucleotides in 3′-terminal or penultimate positions. 15. The double-stranded nucleic acid molecule according to 14, characterized in that the sense strand contains 2′5 ′ ribonucleotides at positions (5 ′> 3 ′) 15, 16, 17 and 18. 16. The double-stranded nucleic acid molecule according to claim 4, characterized in that z ″ is present and contains a protective group covalently attached to the 5′-end of the sense strand. 17. The double-stranded nucleic acid molecule according to clause 16, characterized in that the protective group is selected from the group consisting of a ribose group without a base, an inverted ribose group without a base, an inverted deoxyribose group without a base, a deoxyribose group without a base and their modifications; C6-imino-Pi; inverted nucleotide; 5′OMe nucleotide; 4 ′, 5′-methylene nucleotide; 1- (β-D-erythrofuranosyl) nucleotide; 4′-thio nucleotide, carbocyclic nucleotide; 5′-amino-alkyl phosphate, 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate, aminohexyl 6-phosphate; 12-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; alpha nucleotide; threo-pentofuranosyl nucleotide; acyclic 3 ′, 4′-seco nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5′-5 ′ inverted group without base; 1,4-butanediol phosphate; 5′-amino; and a bridging or non-bridging methylphosphonate and 5′-mercapto group. 18. The double-stranded nucleic acid molecule according to 17, characterized in that the protective group contains an inverted deoxyribose group without a base. 19. The double-stranded nucleic acid molecule according to claim 1, characterized in that the antisense chain contains ribonucleotides with a modified 2′-O-methyl sugar residue, a 2′5 ′ ribonucleotide in at least one of the positions (5 ′> 3 ′) 1 , 5, 6 or 7, and a 3′-terminal non-nucleotide group, optionally a C3Pi-C3OH non-nucleotide group, covalently attached to the 3′-end; and the sense strand contains at least one 2′5 ′ ribonucleotide and / or ribonucleotide with a modified 2′-O-methyl sugar residue, a non-nucleotide group covalently attached to the 3′-end and a protective group covalently attached to 5′- the end. 20. The double-stranded nucleic acid molecule according to claim 2 or 4, characterized in that the antisense chain contains ribonucleotides with a modified 2′-O-methyl sugar residue at positions (5 ′> 3 ′) 1, 3, 5, 9, 11, 13, 15, 17 and 19, a 2′5 ′ ribonucleotide at position 7, and a C3Pi-C3OH non-nucleotide group covalently attached to the 3′-end; and the sense strand contains 5 consecutive 2′5 ′ ribonucleotides at 3′-terminal positions (5 ′> 3 ′) 15, 16, 17, 18 and 19, C3Pi is a non-nucleotide group covalently attached to the 3′-end and inverted a baseless group covalently attached to the 5′-end. 21. The double-stranded nucleic acid molecule according to claim 2 or 4, characterized in that the antisense chain contains ribonucleotides with a modified 2′-O-methyl sugar residue at positions (5 ′> 3 ′) 3, 5, 9, 11, 13, 15, 17 and 19, a 2′5 ′ ribonucleotide at positions 1 and 7, and a C3Pi-C30H non-nucleotide group covalently attached to the 3′-end; and the sense strand contains 5 consecutive 2′5 ′ ribonucleotides at 3′-terminal positions (5 ′> 3 ′) 15, 16, 17, 18 and 19, C3Pi is a non-nucleotide group covalently attached to the 3′-end and inverted a baseless group covalently attached to the 5′-end. 22. The double-stranded nucleic acid molecule according to claim 2 or 4, characterized in that the antisense chain contains ribonucleotides with a modified 2′-O-methyl sugar residue at positions (5 ′> 3 ′) 1, 3, 5, 9, 11, 13, 15, 17 and 19, 2′5 ′ ribonucleotide at position 7, C3Pi; C3OH is not a nucleotide group covalently attached to the 3′-end; and the sense strand contains ribonucleotides with a modified 2′-O-methyl sugar residue at positions (5 ′> 3 ′) 7, 13, 16 and 18, 2′5 ′ ribonucleotide at position 9, C3 is a non-nucleotide group covalently attached to 3′-end, and an inverted group, devoid of base, covalently attached to the 5′-end. 23. A composition comprising the double-stranded nucleic acid molecule according to any one of claims 1 to 22 and a pharmaceutically acceptable carrier for inhibiting the expression of the hsp47 gene. 24. A method of treating a patient suffering from an hsp47-related disease, comprising administering to said patient a double-stranded nucleic acid molecule according to any one of claims 1 to 22 in an amount sufficient to reduce expression of hsp47, wherein said double-stranded nucleic acid molecule is suitable for use for treating a patient. 25. The method according to paragraph 24, wherein the specified condition is fibrosis.

Images