RU2557977C1 - Method for prediction of risk of hyperplastic processes of endometrium - Google Patents
Method for prediction of risk of hyperplastic processes of endometrium Download PDFInfo
- Publication number
- RU2557977C1 RU2557977C1 RU2014119412/15A RU2014119412A RU2557977C1 RU 2557977 C1 RU2557977 C1 RU 2557977C1 RU 2014119412/15 A RU2014119412/15 A RU 2014119412/15A RU 2014119412 A RU2014119412 A RU 2014119412A RU 2557977 C1 RU2557977 C1 RU 2557977C1
- Authority
- RU
- Russia
- Prior art keywords
- tac
- tnfr1
- tnfα
- alleles
- processes
- Prior art date
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к области медицинской диагностики, а именно к гинекологии, и может быть использовано для прогнозирования риска развития гиперпластических процессов эндометрия (ГПЭ).The invention relates to the field of medical diagnostics, namely to gynecology, and can be used to predict the risk of developing endometrial hyperplastic processes (GGE).
Эндометрий - это слизистая оболочка, выстилающая полость матки. Когда эта оболочка начинает избыточно разрастаться при нарушении гормональных процессов в организме женщины, говорят о гиперплазии эндометрия. Встречаются три вида гиперпластических процессов эндометрия:The endometrium is the mucous membrane lining the uterine cavity. When this shell begins to grow excessively in violation of hormonal processes in the body of a woman, they speak of endometrial hyperplasia. There are three types of endometrial hyperplastic processes:
- железисто-кистозная гиперплазия эндометрия (разрастание железистой ткани и появление в ней кист);- glandular cystic endometrial hyperplasia (proliferation of glandular tissue and the appearance of cysts in it);
- железистые и железисто-кистозные полипы (полипы эндометрия - доброкачественные опухолевидные образования, растущие из стенки матки в ее просвет);- glandular and glandular-cystic polyps (endometrial polyps - benign tumor formations growing from the wall of the uterus into its lumen);
-атипическая гиперплазия - извращенное, нехарактерное разрастание ткани эндометрия (аденоматоз, аденоматозная гиперплазия) [Кипич Н.В. Значимость молекулярно-генетических и иммунных факторов в патогенезе и тактике ведения больных с гиперпластическими процессами эндометрия. //Автореф. дисс.к.м.н. - СПб., 2011. - 20 С.].-atypical hyperplasia - perverse, uncharacteristic growth of endometrial tissue (adenomatosis, adenomatous hyperplasia) [Kipich N.V. The importance of molecular genetic and immune factors in the pathogenesis and management of patients with endometrial hyperplastic processes. // Abstract. Ph.D. - SPb., 2011. - 20 S.].
Гиперпластические процессы эндометрия возможны в любом возрасте, встречаются почти у каждой четвертой женщины с бесплодием и имеют разную степень проявлений, но их частота значительно возрастает к периоду перименопаузы. Распространенность гиперплазии эндометрия составляет 10-30%, полипов эндометрия - 0,5-35,7% [Лысенко О.В. Гиперпластические процессы эндометрия в различные возрастные периоды исследование цитокинового статуса и содержания SFAS -лиганда//Акушерство и гинекология. - 2011. - №4.- С.12-15].Hyperplastic processes of the endometrium are possible at any age, occur in almost every fourth woman with infertility and have a different degree of manifestation, but their frequency increases significantly by the period of perimenopause. The prevalence of endometrial hyperplasia is 10-30%, endometrial polyps - 0.5-35.7% [O. Lysenko Hyperplastic processes of the endometrium at different age periods study of the cytokine status and content of SFAS ligand // Obstetrics and Gynecology. - 2011. - No. 4.- S.12-15].
Гиперпластические процессы эндометрия как возможная основа для формирования злокачественных опухолей в течение многих десятилетий представляют важную медико-социальную проблему. Частота озлокачествления гиперпластических процессов эндометрия колеблется в достаточно широких пределах (0,25-50%) и определяется морфологическими особенностями заболевания, длительностью его рецидивирования, а также возрастом пациенток. Простая гиперплазия эндометрия без атипии переходит в рак в 1% случаев, полиповидная форма без атипии - в 3 раза чаще.Hyperplastic processes of the endometrium as a possible basis for the formation of malignant tumors for many decades represent an important medical and social problem. The frequency of malignancy of endometrial hyperplastic processes varies widely (0.25-50%) and is determined by the morphological characteristics of the disease, the duration of its recurrence, and also the age of the patients. Simple endometrial hyperplasia without atypia passes into cancer in 1% of cases, the polypoid form without atypia is 3 times more likely.
Для клинической картины гиперплазии эндометрия характерны ановуляторные маточные кровотечения, возникающие, как правило, после задержки менструации. Кровотечение обычно бывает продолжительным, с умеренной кровопотерей или обильным, профузным. При гиперпластических процессах эндометрия (чаще при эндометриальных полипах) иногда появляются межменструальные кровянистые выделения [Максимов С.Я. Факторы риска возникновения злокачественных новообразований органов репродуктивной системы женщин//Вопросы онкологии.-2003. - Т.49, №3, - С.496 - 501].The clinical picture of endometrial hyperplasia is characterized by anovulatory uterine bleeding, which occurs, as a rule, after a delay in menstruation. Bleeding is usually prolonged, with moderate hemorrhage or profuse, profuse. With hyperplastic processes of the endometrium (more often with endometrial polyps), intermenstrual bleeding sometimes appears [Maksimov S.Ya. Risk factors for the occurrence of malignant neoplasms of the organs of the reproductive system of women // Questions of Oncology.-2003. - T. 49, No. 3, - S. 496 - 501].
Окончательное подтверждение диагноза ГПЭ возможно только после проведения гистероскопии с последующим гистологическим исследованием эндометрия. К сожалению, приходится констатировать, что ультразвуковая диагностика не всегда оказывается эффективной. В ряде случаев у пациенток с необъяснимым даже после проведения диагностической лапароскопии бесплодием ГПЭ, выявленная в процессе гистероскопического обследования, может оказаться единственной вероятной его причиной.The final confirmation of the diagnosis of HPE is possible only after hysteroscopy with subsequent histological examination of the endometrium. Unfortunately, we have to admit that ultrasound diagnostics are not always effective. In a number of cases, in patients with unexplained even after diagnostic laparoscopy infertility GGE detected during a hysteroscopic examination may be the only likely cause.
Патологическая трансформация эндометрия - сложный биологический процесс, затрагивающий все звенья нейрогуморальной регуляции организма женщины. Известно, что причиной развития ГПЭ могут быть дефекты овуляции, гиперэстрогения, дефицит прогестерона, нарушение процессов пролиферации и подавление апоптоза, а также изменение рецепторного фенотипа эндометрия. ГПЭ нередко возникает при эндометриозе, миоме и при хронических воспалительных процессах в эндометрии. В последние годы выявлена сложная система факторов, участвующих в клеточной регуляции, и расширены представления о межклеточном взаимодействии и внутриклеточных процессах в гормонозависимых тканях. Так, установлено, что в регуляции пролиферативной активности клеток эндометрия наряду с эстрогенами участвуют ряд биологически активных соединений (интерлейкины, факторы некроза опухоли, хемокины). В регуляции процессов тканевого гомеостаза и патогенезе пролиферативных заболеваний важная роль принадлежит не только усилению клеточной пролиферации, но и нарушению регуляции клеточной гибели (апоптоз). Резистентность клеток эндометрия к запрограммированной клеточной гибели (апоптозу) приводит к накоплению измененных и избыточно пролиферируюших клеток, что свойственно неопластическим изменениям эндометрия [Лысенко О.В. Гиперпластические процессы эндометрия в различные возрастные периоды, исследование цитокинового статуса и содержания SFAS-лиганда//Акушерство и гинекология. - 2011. - №4.- С.12-15].The pathological transformation of the endometrium is a complex biological process that affects all parts of the neurohumoral regulation of a woman's body. It is known that ovulation defects, hyperestrogenism, progesterone deficiency, disruption of proliferation processes and suppression of apoptosis, as well as a change in the endometrial receptor phenotype can be the cause of the development of HPE. HPE often occurs with endometriosis, myoma, and chronic inflammatory processes in the endometrium. In recent years, a complex system of factors involved in cell regulation has been identified, and ideas about intercellular interaction and intracellular processes in hormone-dependent tissues have been expanded. Thus, it was found that a number of biologically active compounds (interleukins, tumor necrosis factors, chemokines) participate in the regulation of the proliferative activity of endometrial cells along with estrogens. In the regulation of tissue homeostasis and the pathogenesis of proliferative diseases, an important role is played not only by increased cell proliferation, but also by impaired cell death regulation (apoptosis). The resistance of endometrial cells to programmed cell death (apoptosis) leads to the accumulation of altered and excessively proliferating cells, which is characteristic of neoplastic changes in the endometrium [Lysenko OV Hyperplastic processes of the endometrium at different age periods, the study of the cytokine status and content of the SFAS ligand // Obstetrics and Gynecology. - 2011. - No. 4.- S.12-15].
Известен способ по патенту РФ №2466390, опубликованный 10.11.2012 г. по заявке на изобретение №2011105301/15 от 15.02.2011 г. «Способ прогнозирования развития рака тела матки при патологических процессах эндометрия у женщин репродуктивного возраста» (Сидорова И.С. Унанян А.Л. (RU), Власов Р.С. (RU) и др.), где предложен способ прогнозирования развития рака тела матки, включающий определение клинических признаков, выскабливание матки, гистологическое исследование, определение метилирования генов-супрессоров MLH1, RASSF1, GSTP1, р16, RAR-b, CDX1 опухолевого роста методом метил-чувствительной полимеразной цепной реакции (МЧ-ПЦР), расчет коэффициента вероятности развития рака тела матки. При величине р больше 0,6 прогнозируют высокую вероятность развития рака тела матки, при р, равном 0,3-0,59, - умеренную вероятность развития рака, при р ниже 0,29 - низкую вероятность развития рака.The known method according to the patent of the Russian Federation No. 2466390, published on November 10, 2012, according to the application for invention No. 2011105301/15 of February 15, 2011. “A method for predicting the development of cancer of the uterine body in pathological processes of the endometrium in women of reproductive age” (I. Sidorova. Unanyan A.L. (RU), Vlasov R.S. (RU) and others), where a method is proposed for predicting the development of cancer of the uterine body, including the determination of clinical signs, curettage of the uterus, histological examination, determination of methylation of suppressor genes MLH1, RASSF1 , GSTP1, p16, RAR-b, CDX1 tumor growth method methyl-h comprehensible polymerase chain reaction (MCH-PCR), calculation of the coefficient of probability of developing cancer of the uterus. With a value of p greater than 0.6, a high probability of developing cancer of the uterine body is predicted, with p equal to 0.3-0.59, a moderate probability of developing cancer, with p below 0.29, a low probability of developing cancer.
Недостаток заключается в том, что он повышает точность прогнозирования развития рака тела матки при уже имеющихся патологических процессах эндометрия у женщин репродуктивного возраста, и не дает возможность спрогнозировать склонность пациенток к формированию изолированных гиперпластических процессов эндометрия.The disadvantage is that it increases the accuracy of predicting the development of cancer of the uterus in case of already existing pathological processes of the endometrium in women of reproductive age, and does not make it possible to predict the tendency of patients to form isolated endometrial hyperplastic processes.
Известен способ количественной морфологической оценки степени выраженности хронического эндометрита по патенту РФ №2475742, опубликованный 20.02.2013. Сущность способа состоит в том, что исследуют соскоб эндометрия. На гистологическом препарате оценивают в баллах наличие морфологических признаков хронического воспаления на преобладающей площади и на отдельных участках, в зависимости от их наличия и однородности. Сумма баллов, которая находится в диапазоне от 1 до 10 баллов, представляет собой количественную оценку степени выраженности хронического эндометрита. Сумма от 1 до 4-х баллов позволяет установить легкую степень выраженности хронического эндометрита. От 5 до 7 баллов - среднюю, от 8 до 10 - тяжелую. Недостатком является то, что способ может быть использован только путем исследования гистоморфологического исследования соскобов из полости матки.A known method of quantitative morphological assessment of the severity of chronic endometritis according to the patent of the Russian Federation No. 2475742, published on 02.20.2013. The essence of the method is that they examine the scraping of the endometrium. On a histological specimen, the presence of morphological signs of chronic inflammation in the predominant area and in individual areas is assessed in points, depending on their presence and uniformity. The total score, which is in the range from 1 to 10 points, is a quantitative assessment of the severity of chronic endometritis. The sum from 1 to 4 points allows you to establish a mild degree of severity of chronic endometritis. From 5 to 7 points - medium, from 8 to 10 - heavy. The disadvantage is that the method can only be used by examining a histomorphological study of scrapings from the uterine cavity.
Известен способ прогнозирования развития эндометриоза, приводящего к нарушению репродуктивной функции у девочек с альгоменореей по патенту РФ №2161311, опубликованный 27.12. 2000. Способ основан на исследовании ряда показателей иммунной системы и включает определение количества Т-лимфоцитов методом проточной цитометрии (с использованием цитометрической системы FACS Calibur фирмы Beckton Dickinson), определение концентрации иммуноглобулинов М (IgM) с помощью теста радиальной иммунодиффузии по Манчини, определение уровня циркулирующих иммунных комплексов (ЦИК) в сыворотке крови - методом выделения в полиэтиленгликоле с оценкой на спектрографе Multiscan фирмы Labsystems (длина волны 450 нм). Определение величины диагностического коэффициента F по формуле F=- K1 0,00793+K2 0,013 - K3 0,043+3,09, где K1 - показатель IgM, K2 - показатель ЦИК, K3 - показатель T-клеток (-CD3). Если F>0, то у пациента прогнозируют риск развития эндометриоза. Если F<0, то возникновение эндометриоза маловероятно. Предлагаемый способ дает вероятность правильного прогноза в 76% случаев.A known method for predicting the development of endometriosis, leading to impaired reproductive function in girls with algomenorrhea according to the patent of the Russian Federation No. 2161311, published 27.12. 2000. The method is based on the study of a number of indicators of the immune system and includes determining the number of T-lymphocytes by flow cytometry (using the FACS Calibur cytometric system from Beckton Dickinson), determining the concentration of immunoglobulins M (IgM) using the Mancini radial immunodiffusion test, determining the level of circulating immune complexes (CEC) in blood serum - by the method of isolation in polyethylene glycol as evaluated on a Multiscan spectrograph from Labsystems (wavelength 450 nm). The determination of the value of the diagnostic coefficient F by the formula F = - K 1 0.00793 + K 2 0.013 - K 3 0.043 + 3.09, where K 1 is the IgM indicator, K 2 is the CEC indicator, K 3 is the T-cell indicator (-CD3). If F> 0, then the patient predicts the risk of endometriosis. If F <0, then the occurrence of endometriosis is unlikely. The proposed method gives the probability of a correct forecast in 76% of cases.
Способ позволяет с учетом основных звеньев патогенеза эндометриоза прогнозировать развитие данного заболевания у девочек-подростков с альгоменореей и хроническими тазовыми болями, своевременно провести диагностику заболевания и рекомендовать патогенетически обоснованное лечение, что может повлиять на частоту тяжелых, запущенных форм эндометриоза и сопутствующего бесплодия.The method allows, taking into account the main links in the pathogenesis of endometriosis, to predict the development of this disease in adolescent girls with algomenorrhea and chronic pelvic pain, to diagnose the disease in a timely manner and recommend pathogenetically based treatment that can affect the frequency of severe, advanced forms of endometriosis and concomitant infertility.
Недостаток заключается в том, что он может быть использован только для прогноза развитие эндометриоза у девочек-подростков с альгоменореей и хроническими тазовыми болями, но не позволяет прогнозировать формирование изолированных гиперпластических процессов эндометрия.The disadvantage is that it can only be used to predict the development of endometriosis in adolescent girls with algomenorrhea and chronic pelvic pain, but it does not allow predicting the formation of isolated endometrial hyperplastic processes.
Задачей настоящего исследования является расширение арсенала способов диагностики, а именно создание способа прогнозирования формирования изолированных гиперпластических процессов эндометрия у женщин русской национальности, уроженках Центрального Черноземья России, по сочетаниям генетических полиморфизмов: -308 G TNFα, +36 A TNFR1, A I-TAC, -889 T IL-1A и/или +36 A TNFR1, A I-TAC, -889 T IL-1A и/или -308 G TNFα, +250 G Ltα, -889 T IL-1A.The objective of this study is to expand the arsenal of diagnostic methods, namely, to create a method for predicting the formation of isolated endometrial hyperplastic processes in women of Russian nationality, natives of the Central Black Earth Region of Russia, by combinations of genetic polymorphisms: -308 G TNFα, +36 A TNFR1, A I-TAC, - 889 T IL-1A and / or +36 A TNFR1, A I-TAC, -889 T IL-1A and / or -308 G TNFα, +250 G Ltα, -889 T IL-1A.
Технический результат использования изобретения - получение критериев оценки риска развития изолированных гиперпластических процессов эндометрия.The technical result of using the invention is to obtain criteria for assessing the risk of developing isolated endometrial hyperplastic processes.
В соответствии с поставленной задачей был разработан способ прогнозирования формирования изолированных гиперпластических процессов эндометрия, включающий забор крови, выделение ДНК из периферической венозной крови, типирование генетических полиморфизмов методом полимеразной цепной реакции, при этом осуществляют типирование генетических полиморфизмов гена фактора некроза опухоли α (-308 G/А TNFα), рецептора фактора некроза опухоли 1 (+36 A/G TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А/G I-TAC), интерлейкина 1А (-889 С/Т IL-1A), лимфотаксина α (+250 А/G Ltα) и анализ сочетаний полиморфизмов гена фактора некроза опухоли α (-308 G TNFα), рецептора фактора некроза опухоли 1 (+36 A TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А I-TAC), интерлейкинаIn accordance with the task, a method was developed for predicting the formation of isolated endometrial hyperplastic processes, including blood sampling, DNA extraction from peripheral venous blood, typing of genetic polymorphisms by the polymerase chain reaction, and genetic polymorphisms of the tumor necrosis factor gene α are typed (-308 G / A TNFα),
1А(-889 Т IL-1A), лимфотаксина α (+250 G Ltα), прогнозирование повышенного риска развития изолированных форм гиперпластических процессов эндометрия у больных в случае выявления сочетания аллелей -308 G TNFα 36 A TNFR1, A I-TAC, -889 T IL-1A и/или сочетания аллелей+36 A TNFR1, A I-TAC, -889 T IL-1A и/или сочетания аллелей -308 G TNFα,+250 G Ltα, -889 T IL-1A.1A (-889 T IL-1A), lymphotaxin α (+250 G Ltα), predicting an increased risk of developing isolated forms of endometrial hyperplastic processes in patients if a combination of the -308 G TNFα 36 A TNFR1, A I-TAC, -889 alleles is detected T IL-1A and / or combinations of alleles + 36 A TNFR1, A I-TAC, -889 T IL-1A and / or combinations of alleles -308 G TNFα, + 250 G Ltα, -889 T IL-1A.
Новизна и изобретательский уровень заключается в том, что из уровня техники не известна возможность прогноза развития изолированных гиперпластических процессов эндометрия по наличию сочетаний аллеля -308 G гена фактора некроза опухоли α (полиморфизм -308 G TNFα), аллеля+36 A рецептора фактора некроза опухоли (полиморфизм+36 A TNFR1), аллеля А интерферона индуцебельного хемоаттрактанта Т-клеток (полиморфизм А I-TAC), аллеля -889 Т интерлейкина 1А (полиморфизм -889 Т IL-1A), аллеля+250 G лимфотаксина α (полиморфизм+250 G Ltα).The novelty and inventive step is that the prior art does not know the possibility of predicting the development of isolated endometrial hyperplastic processes by the presence of combinations of the -308 G allele of the tumor necrosis factor α gene (polymorphism -308 G TNFα), the + 36 A tumor necrosis factor receptor allele ( polymorphism + 36 A TNFR1), allele A of the interferon inducible chemoattractant T-cells (polymorphism A I-TAC), allele -889 T of interleukin 1A (polymorphism -889 T IL-1A), allele + 250 G lymphotaxin α (polymorphism + 250 G Ltα).
Изобретения характеризуют следующие графические изображения:The invention is characterized by the following graphic images:
Фиг.1. Дискриминация аллелей по локусу G/A I-TAC (rs4512021) (где - гомозиготы GG, - гомозиготы AA, - гетерозиготы AG, - отрицательный контроль).Figure 1. Allele discrimination at the G / A I-TAC locus (rs4512021) (where - homozygotes GG, - homozygotes AA, - heterozygotes AG, - negative control).
Фиг.2. Электрофоретическое разделение продуктов рестрикции гена -889 C/T IL-1А, где 2,3,4 - гомозиготы -889 ТТ; 5,6,10 - гомозиготы -889 СС; 1,7-9,11-14 -гетерозиготы -889 СТ.Figure 2. Electrophoretic separation of the restriction products of the gene -889 C / T IL-1A, where 2,3,4 - homozygotes -889 TT; 5,6,10 - homozygotes -889 SS; 1.7-9.11-14-heterozygotes -889 ST.
Способ осуществляют следующим образом:The method is as follows:
ДНК выделяют из образцов периферической венозной крови больных с изолированными гиперпластическими процессами эндометрия методом фенольно-хлороформной экстракции в 2 этапа. На первом этапе к 4 мл крови добавляют 25 мл лизирующего буфера, содержащего 320 мМ сахарозы, 1% тритон Х-100, 5 мМ MgCl2, 10 мМ трис-HCl (pH=7,6). Полученную смесь перемешивают и центрифугируют при 4ºС, 4000 об/мин в течение 20 минут. После центрифугирования надосадочную жидкость сливают, к осадку добавляют 4 мл раствора, содержащего 25 мМ ЭДТА (рН=8,0) и 75 мМ NaCl, ресуспензируют. Затем прибавляют 0,4 мл 10% SDS, 35 мкл протеиназы К (10 мг/мл) и инкубируют образец при 37ºС в течение 16 часов.DNA is isolated from samples of peripheral venous blood of patients with isolated endometrial hyperplastic processes by phenol-chloroform extraction in 2 stages. At the first stage, 25 ml of lysis buffer containing 320 mM sucrose, 1% Triton X-100, 5 mM MgCl2, 10 mM Tris-HCl (pH = 7.6) is added to 4 ml of blood. The resulting mixture was stirred and centrifuged at 4 ° C, 4000 rpm for 20 minutes. After centrifugation, the supernatant is decanted, 4 ml of a solution containing 25 mM EDTA (pH = 8.0) and 75 mM NaCl are added to the precipitate, and they are resuspended. Then add 0.4 ml of 10% SDS, 35 μl of proteinase K (10 mg / ml) and incubate the sample at 37 ° C for 16 hours.
На втором этапе из полученного лизата последовательно проводят экстракцию ДНК равными объемами фенола, фенол-хлороформа (1:1) и хлороформа с центрифугированием при 4000 об/мин в течение 10 минут. После каждого центрифугирования производят отбор водной фазы. ДНК осаждают из раствора двумя объемами охлажденного 96% этанола. Сформированную ДНК растворяют в бидистиллированной, деионизованной воде и хранят при -200°С.At the second stage, DNA is sequentially extracted from the obtained lysate in equal volumes of phenol, phenol-chloroform (1: 1) and chloroform with centrifugation at 4000 rpm for 10 minutes. After each centrifugation, the aqueous phase is selected. DNA is precipitated from solution in two volumes of chilled 96% ethanol. The formed DNA is dissolved in bidistilled, deionized water and stored at -200 ° C.
Выделенную ДНК затем подвергают полимеразной цепной реакции с использованием стандартных олигонуклеотидных праймеров (таблица 1).The isolated DNA is then subjected to polymerase chain reaction using standard oligonucleotide primers (table 1).
Структура праймеров и зондов, используемых для генотипирования исследуемых ДНК-маркеровThe structure of primers and probes used for genotyping of the studied DNA markers
Таблица 1Table 1
TNFα
(rs 1800629) -308 G / A
TNFα
(rs 1800629)
54.0°С: 1.00m
95.0°C: 0.15m95.0 ° C: 4.00m
54.0 ° C: 1.00m
95.0 ° C: 0.15m
R: 5'-GGCCACTGACTGATTTGTGTGTAG-3'
5'-FAM-CCGTCCTCATGCC- RTQ1-3'
5'-ROX-CCGTCCCCATGCC - RTQ1-3'F: 5'-GAAATGGAGGCAATAGGTTTTTGAG-3 '
R: 5'-GGCCACTGACTGATTTGTGTGTAG-3 '
5'-FAM-CCGTCCTCATGCC- RTQ1-3 '
5'-ROX-CCGTCCCCATGCC - RTQ1-3 '
(rs 767455)+36 A / G TNFR1
(rs 767455)
59.0°С: 1.00m
95.0°C: 0.15m95.0 ° C: 4.00m
59.0 ° C: 1.00m
95.0 ° C: 0.15m
R: 5'-CCACCGTGCCTGACCTG-3'
5'- FAM: CTGCTGCCACTGGT-RTQ1-3'
5'- ROX: CTGCTGCCGCTGGT-BHQ2-3'F: 5'- AGCCCACTCTTCCCTTTGTC-3 '
R: 5'-CCACCGTGCCTGACCTG-3 '
5'- FAM: CTGCTGCCACTGGT-RTQ1-3 '
5'- ROX: CTGCTGCCGCTGGT-BHQ2-3 '
et al., 2008][Chae SJ
et al., 2008]
I-TAC
(rs 4512021)A / g
I-tac
(rs 4512021)
52.5°С: 1.00m
95.0°C: 0.15m95.0 ° C: 4.00m
52.5 ° C: 1.00m
95.0 ° C: 0.15m
R: 5' - GTGTCTTCCCAATGTGTGTTCCT - 3'
5' - FAM - ATGACTCTGGCTAGTC - RTQ1-3'
5' - ROX - AGCATGACTCCGGCTA-BHQ2-3'F: 5 '- CAAAGACCTAAGGGAACTAGGTGATAG - 3'
R: 5 '- GTGTCTTCCCAATGTGTGTTCCT - 3'
5 '- FAM - ATGACTCTGGCTAGTC - RTQ1-3'
5 '- ROX - AGCATGACTCCGGCTA-BHQ2-3'
IL-1A
(rs 1800587)-889 C / T
IL-1A
(rs 1800587)
94.0°С: 0.40m
60.0°C: 0.40m
72.0°С: 1.00m95.0 ° C: 4.00m
94.0 ° C: 0.40m
60.0 ° C: 0.40m
72.0 ° C: 1.00m
5'-ttacatatgagccttccatg-3'5'-aagcttgttctaccacctgaactaggc-3 '
5'-ttacatatgagccttccatg-3 '
et al., 2003][Trevilatto
et al., 2003]
Lt α
(rs 909253)+250 A / G
Lt α
(rs 909253)
56.3°С: 1.00m
95.0°C: 0.15m95.0 ° C: 5.00m
56.3 ° C: 1.00m
95.0 ° C: 0.15m
R: 5'-ACAGAGAGAGACAGG AAGGGAACA-3'
5'-FAM:CCATGGTTCCTCTC-RTQ1-3'
5'-ROX:CTGCCATGATTCC-RTQ1-3'F: 5'-CAG TCTCATTGTCTCTGTCACACATT-3 '
R: 5'-ACAGAGAGAGACAGG AAGGGAACA-3 '
5'-FAM: CCATGGTTCCTCTC-RTQ1-3 '
5'-ROX: CTGCCATGATTCC-RTQ1-3 '
Молекулярно-генетический анализ проводят методом полимеразной цепной реакции синтеза ДНК. ПЦР осуществляют на амплификаторах IQ5 (BioRad) и ТП4-ПЦР-01-«ТЕРЦИК».Molecular genetic analysis is carried out by polymerase chain reaction of DNA synthesis. PCR is carried out on amplifiers IQ5 (BioRad) and TP4-PCR-01- "TERTSIK".
На амплификаторе IQ5 (Bio-Rad) проводят анализ полиморфизмов генов -308 G/А TNFα,+36 A/G TNFR1, А/G I-TAC,+250 А/G Ltα методом полимеразной цепной реакции синтеза ДНК с использованием стандартных олигонуклеотидных праймеров и специфических зондов с последующим анализом полиморфизма методом дискриминации аллелей. Реакционная смесь объемом 25 мкл включает: 6,7 мМ трис-HCl (pH=8,8), 2,5 мМ MgCl2, 0,1 мкг геномной ДНК, по 10 пМ каждого праймера, по 5 пкмоль каждого зонда, по 200 мкМ dATP, dGTP, dCTP, dTTP и 1 единицу активной Taq-полимеразы. После денатурации выполняют 40 циклов амплификации по схеме: отжиг праймеров и денатурация.IQ5 (Bio-Rad) amplifiers analyze gene polymorphisms of -308 G / A TNFα, + 36 A / G TNFR1, A / G I-TAC, + 250 A / G Ltα by the method of polymerase chain reaction of DNA synthesis using standard oligonucleotide primers and specific probes, followed by analysis of polymorphism by allele discrimination. The reaction mixture with a volume of 25 μl includes: 6.7 mm Tris-HCl (pH = 8.8), 2.5 mm MgCl2, 0.1 μg of genomic DNA, 10 pM of each primer, 5 pmol of each probe, 200 μM dATP, dGTP, dCTP, dTTP and 1 unit of active Taq polymerase. After denaturation, 40 amplification cycles are performed according to the scheme: primer annealing and denaturation.
На амплификаторе ТП4-ПЦР-01-«ТЕРЦИК» проводят анализ полиморфизма гена -889 С/Т IL-1A методом полимеразной цепной реакции синтеза ДНК с использованием стандартных олигонуклеотидных праймеров по методике, указанной в работе [Hulkkonen, J.Inflammotory cytokines and cytokine gene polymorphisms in chronic lymphocytic leukaemia, in primary Sjögren's Syndrome and Haelthy Subjects: [acad. diss.] /J. Hulkkonen; University of Tampere, Medical School Tampere University Hospital. - Tampere, 2002. - 81 р.].The TP4-PCR-01- “TERTSIK” amplifier analyzes the polymorphism of the -889 C / T IL-1A gene by the polymerase chain reaction of DNA synthesis using standard oligonucleotide primers according to the method described in [Hulkkonen, J. Inflammotory cytokines and cytokine gene polymorphisms in chronic lymphocytic leukaemia, in primary Sjögren's Syndrome and Haelthy Subjects: [acad. diss.] / J. Hulkkonen; University of Tampere, Medical School Tampere University Hospital. - Tampere, 2002. - 81 p.].
Реакцию проводят в 12,5 мкл общего объема смеси, содержащей 33,5 мМ трис-HCl (pH=8,8), 1,25 мМ MgCl2, 0,5 мкг геномной ДНК, по 5 пМ каждого праймера, по 100 мкМ dATP, dGTP, dCTP, dTTP и 1 единицу активной Taq-полимеразы. После денатурации выполняют 32 цикла амплификации по схеме: денатурация, отжиг праймеров и элонгация. Затем пробы выдерживают 5 мин при 72°С и охлаждают. Продукты амплификации анализируют в 2%-ном агарозном геле, окрашенным бромистым этидием, в течение 30 минут при 160V. В качестве электрофорезного буфера используют 1хТАЕ (трис-ацетатный буфер). Затем пробы идентифицируют в проходящем УФ-свете.The reaction is carried out in 12.5 μl of the total volume of the mixture containing 33.5 mm Tris-HCl (pH = 8.8), 1.25 mm MgCl2, 0.5 μg of genomic DNA, 5 pM of each primer, 100 μM dATP , dGTP, dCTP, dTTP and 1 unit of active Taq polymerase. After denaturation, 32 amplification cycles are performed according to the scheme: denaturation, annealing of primers and elongation. Then the samples are kept for 5 min at 72 ° C and cooled. Amplification products are analyzed on a 2% agarose gel stained with ethidium bromide for 30 minutes at 160V. As electrophoresis buffer use 1xTAE (Tris-acetate buffer). Samples are then identified in transmitted UV light.
Генотипирование осуществляют методом дискриминации аллелей с использованием Tag Man зондов. При проведении ПЦР в амплификаторе с флюоресцентной детекцией (амплификатор IQ5) генотипирование осуществляют методом Tag Man зондов по данным величин ОЕФ (относительная единица флуоресценции) каждого зонда.Genotyping is carried out by allele discrimination using Tag Man probes. When performing PCR in a thermocycler with fluorescence detection (IQ5 amplifier), genotyping is carried out by the Tag Man method of probes according to the OEF values (relative fluorescence unit) of each probe.
Две полосы, вертикальная и горизонтальная, делят график на четыре секции: одна для каждого гомозиготного состояния, одна для гетерозиготного состояния и секция без реакции. Присвоение генотипов неизвестным образцам определяют вычерчиванием ОЕФ для одного флуорофора на оси x относительно ОЕФ для другого флуорофора на оси y на диаграмме дискриминации аллелей.Two bands, vertical and horizontal, divide the graph into four sections: one for each homozygous state, one for the heterozygous state and a section without reaction. Assigning genotypes to unknown samples is determined by plotting the OEF for one fluorophore on the x axis relative to the OEF for another fluorophore on the y axis in the allele discrimination diagram.
• Если значения ОЕФ неизвестного образца находятся выше горизонтальной полосы и правее вертикальной полосы, генотип гетерозиготен (GA).• If the OEF values of an unknown sample are above the horizontal strip and to the right of the vertical strip, the genotype is heterozygous (GA).
• Если значения ОЕФ неизвестного образца находятся выше горизонтальной полосы и левее вертикальной полосы, генотип гомозиготен по аллелю 2 (ОЕФ аллеля 2 отложены по оси y).• If the OEF values of the unknown sample are above the horizontal strip and to the left of the vertical strip, the genotype is homozygous for allele 2 (the OEF of
• Если значения ОЕФ неизвестного образца находятся ниже горизонтальной полосы и правее вертикальной, генотип гомозиготен по аллелю 1 (RFU аллеля 1 отложены по оси x).• If the OEF values of the unknown sample are below the horizontal strip and to the right of the vertical, the genotype is homozygous for allele 1 (RFU of
• Если значения ОЕФ неизвестного образца находятся ниже горизонтальной полосы и левее вертикальной, то определение генотипа невозможно, в данном случае неопределенный образец - отрицательный контроль.• If the OEF values of the unknown sample are below the horizontal strip and to the left of the vertical, then the determination of the genotype is not possible, in this case an undefined sample is a negative control.
Генотипирование ДНК-маркеров (локус -889 С/Т IL-1A) производят методом анализа полиморфизма длин рестрикционных фрагментов (ПДРФ) продуктов ПЦР-амплификации специфических участков генома с использованием соответствующих ферментов рестрикции производства фирмы «Сибэнзим» (Новосибирск).Genotyping of DNA markers (locus -889 C / T IL-1A) is performed by the analysis of restriction fragment length polymorphism (RFLP) of PCR amplification products of specific genome sections using appropriate restriction enzymes manufactured by Sibenzim (Novosibirsk).
После инкубации рестрикционной смеси в течение 16 часов при температуре 37°С проводят разделение фрагментов ДНК с помощью горизонтального электрофореза на электрофоретических ячейках производства фирмы «Хеликон» (Россия). В зависимости от размера разделяемых фрагментов ДНК используют агарозный гель 2-3% концентрации, приготовленный на основе ТВЕ-буфера, окрашенный раствором бромистого этидия (0,01%). Визуализацию фореграмм осуществляют в темном боксе с трансиллюминатором фирмы UVP (Швеция).After incubation of the restriction mixture for 16 hours at a temperature of 37 ° C, DNA fragments are separated by horizontal electrophoresis on electrophoretic cells manufactured by Helikon (Russia). Depending on the size of the separated DNA fragments, an agarose gel of 2-3% concentration is used, prepared on the basis of a TBE buffer, stained with ethidium bromide solution (0.01%). Visualization of phoreograms is carried out in a dark box with a transilluminator from UVP (Sweden).
Формирование базы данных и статистические расчеты осуществляют с использованием программы «STATISTICA 6.0» [Боровиков, В. Statistica: искусство анализа данных на компьютере /В. Боровиков. - 2-е изд. - СПб.: Питер, 2003. - 688 с.: ил. - (Для профессионалов)].The formation of the database and statistical calculations is carried out using the program "STATISTICA 6.0" [Borovikov, V. Statistica: the art of data analysis on a computer / V. Borovikov. - 2nd ed. - SPb .: Peter, 2003 .-- 688 p.: Ill. - (For professionals)].
Изучение роли комбинаций генетических вариантов полиморфных маркеров генов интерлейкинов в формирование изолированной миомы матки проведено с помощью программного обеспечения APSampler [http:sources.redhat.com/cygwin/], использующего метод Монте-Карло марковских цепей и байесовскую непараметрическую статистику [Favorov A. V. A Gibbs sampler for identification of symmetrically structured, spaced DNA motifs with improved estimation of the signal length /A. V. Favorov, M. S. Gelfand, A. V. Gerasimova [et al.] //Вioinformatics. - 2005. - Vol.21, №10. - Р. 2240-2245].The role of combinations of genetic variants of polymorphic markers of interleukin genes in the formation of isolated uterine fibroids was studied using the APSampler software [http: sources.redhat.com/cygwin/], using the Monte Carlo method of Markov chains and Bayesian nonparametric statistics [Favorov AV A Gibbs sampler for identification of symmetrically structured, spaced DNA motifs with improved estimation of the signal length / A. V. Favorov, M. S. Gelfand, A. V. Gerasimova [et al.] // Bioinformatics. - 2005. - Vol.21, No. 10. - R. 2240-2245].
Оценку уровня статистической значимости полученных результатов проводят с использованием поправки Бонферрони (рcor), т.е. поправки, минимизирующей вероятность получения ложноположительных результатов [Реброва О.Ю. Статистический анализ медицинских данных. https://sites.google.com/site/oyurebrova/book" \t "_blank /О.Ю. Реброва//М., МедиаСфера. - 2006 г. - 312 с.].The level of statistical significance of the obtained results is estimated using the Bonferroni correction (p cor ), i.e. amendments minimizing the probability of obtaining false positive results [Rebrova O.Yu. Statistical analysis of medical data. https://sites.google.com/site/oyurebrova/book "\ t" _blank /O.Yu. Rebrova // M., Media Sphere. - 2006 - 312 p.].
Возможность использования предложенного способа для оценки риска развития изолированных гиперпластических процессов эндометрия подтверждает анализ результатов наблюдений 713 больных с различными пролиферативными процессами репродуктивной системы, включающими миому матки, эндометриоз, гиперпластические процессы эндометрия и группы популяционного контроля из 500 человек. Среди 713 обследуемых у 150 женщин наблюдались гиперпластические процессы эндометрия. Пациенты включались в соответствующую группу больных только после установления диагноза заболевания, подтвержденного с помощью клинических, лабораторно-инструментальных методов обследования и подтвержденного результата гистологического исследования.The possibility of using the proposed method for assessing the risk of developing isolated endometrial hyperplastic processes is confirmed by an analysis of the observation results of 713 patients with various proliferative processes of the reproductive system, including uterine fibroids, endometriosis, endometrial hyperplastic processes and population control groups of 500 people. Among 713 examined, 150 women had endometrial hyperplastic processes. Patients were included in the appropriate group of patients only after a diagnosis of the disease was confirmed, confirmed by clinical, laboratory and instrumental methods of examination and the confirmed result of histological examination.
В исследуемые группы включались индивидуумы русской национальности, являющиеся уроженцами Центрального Черноземья России и не имеющие родства между собой.The studied groups included individuals of Russian nationality, who are natives of the Central Black Earth Region of Russia and have no kinship with each other.
Установлено, что сочетание молекулярно-генетических маркеров -308 G TNFα,+36 A TNFR1, A I-TAC, -889 T IL-1A встречается у 41,86% пациенток, что в 2 раза чаще, чем в контрольной группе (20,92%, р=0,000005, pcor=0,01, OR=2,72 95%CI 1,76 - 4,18). Также у больных с изолированными гиперпластическими процессами эндометрия встречается комбинация генетических вариантов +36 A TNFR1, A I-TAC, -889 T IL-1A (42,64%) в 1,9 раза чаще по сравнению с контролем (22,25%, р=0,0000008, pcor=0,02, OR=2,59, 95%CI 1,70 - 3,95). Сочетание трех генетических маркеров -308 G TNFα,+250 G Ltα, -889 T IL-1A (14,81%) в данной группе существенно чаще (в 4,5 раза) встречается, чем в контрольной группе (3,28%, р=0,000001, pcor=0,02, OR=5,12, 95%CI 2,47 - 10,61).It was found that the combination of molecular genetic markers -308 G TNFα, + 36 A TNFR1, A I-TAC, -889 T IL-1A occurs in 41.86% of patients, which is 2 times more often than in the control group (20, 92%, p = 0.000005, p cor = 0.01, OR = 2.72 95% CI 1.76 - 4.18). Also, in patients with isolated endometrial hyperplastic processes, a combination of genetic variants +36 A TNFR1, A I-TAC, -889 T IL-1A (42.64%) is 1.9 times more often compared with the control (22.25%, p = 0.0000008, p cor = 0.02, OR = 2.59, 95% CI 1.70 - 3.95). The combination of three genetic markers -308 G TNFα, + 250 G Ltα, -889 T IL-1A (14.81%) is significantly more (4.5 times) in this group than in the control group (3.28%, p = 0.000001, p cor = 0.02, OR = 5.12, 95% CI 2.47 - 10.61).
Конкретный пример.Specific example.
Пациентке Х. русской национальности, уроженке Центрального Черноземья России, был проведен забор периферической венозной крови, выделение ДНК из периферической венозной крови; методом полимеразной цепной реакции типирование генетических полиморфизмов гена фактора некроза опухоли α (-308 G/А TNFα), рецептора фактора некроза опухоли 1 (+36 A/G TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А/G I-TAC), интерлейкина 1А (-889 С/Т IL-1A), лимфотаксина α (+250 А/G Ltα) и анализ сочетаний полиморфизмов гена фактора некроза опухоли α (-308 G TNFα), рецептора фактора некроза опухоли 1 (+36 A TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А I-TAC), интерлейкина 1А (-889 Т IL-1A), лимфотаксина α (+250 G Ltα). Результаты представлены на фигурах 1 и 2.A patient Kh. Of Russian nationality, a native of the Central Black Earth Region of Russia, underwent peripheral venous blood sampling, DNA extraction from peripheral venous blood; polymerase chain reaction typing of genetic polymorphisms of the gene for tumor necrosis factor α gene (-308 G / A TNFα),
Выявлено, что в связи с наличием сочетания аллелей -308 G TNFα, +36 A TNFR1, A I-TAC, -889 T IL-1A и сочетания аллелей+36 A TNFR1, A I-TAC, -889 T IL-1A, женщину можно отнести в группу риска вероятности возникновения изолированных гиперпластических процессов эндометрия с целью предотвращения развития клинических проявлений, а также с целью их ранней диагностики для снижения частоты оперативного вмешательства и улучшения качества жизни женщины.It was revealed that due to the presence of the combination of the -308 G TNFα alleles, +36 A TNFR1, A I-TAC, -889 T IL-1A and the combination of the + 36 A alleles TNFR1, A I-TAC, -889 T IL-1A, a woman can be attributed to the risk group for the likelihood of isolated endometrial hyperplastic processes in order to prevent the development of clinical manifestations, as well as for the purpose of their early diagnosis to reduce the frequency of surgical intervention and improve a woman's quality of life.
Таким образом, полученные данные свидетельствуют о том, что сочетания аллелей -308 G TNFα,+36 A TNFR1, A I-TAC, -889 T IL-1A, аллелей+36 A TNFR1, A I-TAC, -889 T IL-1A, а так же аллелей -308 G TNFα,+250 G Ltα, -889 T IL-1A являются факторами риска развития гиперпластических процессов эндометрия (OR=2,72, OR=2,59 и OR=5,12, соответственно) у женщин русской национальности, уроженках Центрального Черноземья России.Thus, the data obtained indicate that the combination of the alleles -308 G TNFα, + 36 A TNFR1, A I-TAC, -889 T IL-1A, alleles + 36 A TNFR1, A I-TAC, -889 T IL- 1A, as well as the alleles -308 G TNFα, + 250 G Ltα, -889 T IL-1A are risk factors for the development of endometrial hyperplastic processes (OR = 2.72, OR = 2.59 and OR = 5.12, respectively) among women of Russian nationality, natives of the Central Black Earth Region of Russia.
Применение данного способа позволит сформировать среди женщин русской национальности, уроженках Центрального Черноземья России, группу пациенток с повышенным риском развития гиперпластических процессов эндометрия для обязательного динамического ультразвукового исследования с целью контроля за состоянием эндометрия, проведением гистоморфологического исследования содержимого полости матки, с последующим выбором мер профилактики, наблюдением и медикаментозным лечением у врача-специалиста. При раннем выявлении и правильном дифференцированном подходе к ведению больных с гиперпластическими процессами эндометрия предоставится возможность предотвратить озлакочествление гиперпластических процессов эндометрия.The application of this method will allow to form among women of Russian nationality, natives of the Central Black Earth Region of Russia, a group of patients with an increased risk of developing endometrial hyperplastic processes for mandatory dynamic ultrasound examination to monitor the endometrium, conduct a histomorphological study of the contents of the uterine cavity, followed by selection of preventive measures, observation and medication with a specialist doctor. With early detection and the correct differentiated approach to the management of patients with endometrial hyperplastic processes, it will be possible to prevent the malignancy of endometrial hyperplastic processes.
Claims (1)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2014119412/15A RU2557977C1 (en) | 2014-05-14 | 2014-05-14 | Method for prediction of risk of hyperplastic processes of endometrium |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2014119412/15A RU2557977C1 (en) | 2014-05-14 | 2014-05-14 | Method for prediction of risk of hyperplastic processes of endometrium |
Publications (1)
Publication Number | Publication Date |
---|---|
RU2557977C1 true RU2557977C1 (en) | 2015-07-27 |
Family
ID=53762616
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2014119412/15A RU2557977C1 (en) | 2014-05-14 | 2014-05-14 | Method for prediction of risk of hyperplastic processes of endometrium |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2557977C1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2650988C1 (en) * | 2017-06-27 | 2018-04-18 | Федеральное государственное автономное образовательное учреждение высшего образования "Белгородский государственный национальный исследовательский университет" (НИУ "БелГУ") | Method for predicting risk of endometrial hyperplastic processes based on genetic data |
RU2679637C1 (en) * | 2018-03-07 | 2019-02-12 | Федеральное государственное автономное образовательное учреждение высшего образования "Белгородский государственный национальный исследовательский университет" (НИУ "БелГУ") | Method for forecasting the risk of development of combination of genital endometriosis and hyperplastic endometry processes based on molecular-genetic data |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2453850C2 (en) * | 2010-06-17 | 2012-06-20 | Российская Федерация, От Имени Которой Выступает Министерство Образования И Науки Российской Федерации | Method for prediction of character of uterine involvement in myomatous nodes |
RU2466390C2 (en) * | 2011-02-15 | 2012-11-10 | Государственное образовательное учреждение высшего профессионального образования Первый Московский государственный медицинский университет им. И.М. Сеченова Министерства здравоохранения и социального развития Российской Федерации (ГОУ ВПО Первый МГМУ им. И.М. Сеченова Минздравсоцразвития России) | Method for prediction of developing endometrial cancer in pathological endometrial processes in females of reproductive age |
RU2475742C1 (en) * | 2011-10-18 | 2013-02-20 | Государственное образовательное учреждение высшего профессионального образования "Рязанский государственный медицинский университет им. акад. И.П. Павлова Министерства здравоохранения и социального развития Российской Федерации" | Method of quantitative morphological estimation of degree of chronic endometritis expression |
RU2480763C1 (en) * | 2012-03-07 | 2013-04-27 | Федеральное государственное автономное образовательное учреждение высшего профессионального образования "Белгородский государственный национальный исследовательский университет" | Method for prediction of risk of developing benign mammry dysplasia in females with genital endometriosis |
-
2014
- 2014-05-14 RU RU2014119412/15A patent/RU2557977C1/en not_active IP Right Cessation
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2453850C2 (en) * | 2010-06-17 | 2012-06-20 | Российская Федерация, От Имени Которой Выступает Министерство Образования И Науки Российской Федерации | Method for prediction of character of uterine involvement in myomatous nodes |
RU2466390C2 (en) * | 2011-02-15 | 2012-11-10 | Государственное образовательное учреждение высшего профессионального образования Первый Московский государственный медицинский университет им. И.М. Сеченова Министерства здравоохранения и социального развития Российской Федерации (ГОУ ВПО Первый МГМУ им. И.М. Сеченова Минздравсоцразвития России) | Method for prediction of developing endometrial cancer in pathological endometrial processes in females of reproductive age |
RU2475742C1 (en) * | 2011-10-18 | 2013-02-20 | Государственное образовательное учреждение высшего профессионального образования "Рязанский государственный медицинский университет им. акад. И.П. Павлова Министерства здравоохранения и социального развития Российской Федерации" | Method of quantitative morphological estimation of degree of chronic endometritis expression |
RU2480763C1 (en) * | 2012-03-07 | 2013-04-27 | Федеральное государственное автономное образовательное учреждение высшего профессионального образования "Белгородский государственный национальный исследовательский университет" | Method for prediction of risk of developing benign mammry dysplasia in females with genital endometriosis |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2650988C1 (en) * | 2017-06-27 | 2018-04-18 | Федеральное государственное автономное образовательное учреждение высшего образования "Белгородский государственный национальный исследовательский университет" (НИУ "БелГУ") | Method for predicting risk of endometrial hyperplastic processes based on genetic data |
RU2679637C1 (en) * | 2018-03-07 | 2019-02-12 | Федеральное государственное автономное образовательное учреждение высшего образования "Белгородский государственный национальный исследовательский университет" (НИУ "БелГУ") | Method for forecasting the risk of development of combination of genital endometriosis and hyperplastic endometry processes based on molecular-genetic data |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Shen et al. | Epigenetic analysis leads to identification of HNF1B as a subtype-specific susceptibility gene for ovarian cancer | |
KR102464372B1 (en) | Methods of diagnosing inflammatory bowel disease through rnaset2 | |
Lenaerts et al. | Genomewide copy number alteration screening of circulating plasma DNA: potential for the detection of incipient tumors | |
Kontic et al. | Aberrant Promoter Methylation of CDH13 and MGMT Genes is Associated With Clinicopathologic Characteristics of Primary Non–Small-Cell Lung Carcinoma | |
Wang et al. | Aberrant methylation of the 3q25 tumor suppressor gene PTX3 in human esophageal squamous cell carcinoma | |
De Sanctis et al. | Matrix metalloproteinase-3 mRNA: a promising peripheral blood marker for diagnosis of endometriosis | |
Muxiddinovna | GENETIC POLYMORPHISMS IN INTERLEUKIN-1Β (RS1143634) AND INTERLEUKIN-8 (RS4073) ARE ASSOCIATED WITH SURVIVAL AFTER RESECTION OF INTRAHEPATIC CHOLANGIOCARCINOMA | |
Kardum et al. | Methylation-associated silencing of SFRP1 gene in high-grade serous ovarian carcinomas | |
Tekcham et al. | Epigenetic downregulation of PTEN in gallbladder cancer | |
Sakai et al. | Identification of a novel uterine leiomyoma GWAS locus in a Japanese population | |
JP2011160711A (en) | Method for using frequency of methylation of specific gene as biomarker for gynecologic cancer | |
Najmutdinova et al. | STUDY OF THE ROLE OF POLYMORPHIC VARIANTS OF THE Arg72Pro LOCUS OF THE TP53 GENE IN THE DEVELOPMENT OF CERVICAL INTRAEPITHELIAL NEOPLASIA IN THE FEMALE POPULATION OF TASHKENT | |
Wu et al. | Long non-coding RNA HOX transcript antisense RNA (HOTAIR) suppresses the angiogenesis of human placentation by inhibiting vascular endothelial growth factor A expression | |
Rodríguez et al. | Alleles with short CAG and GGN repeats in the androgen receptor gene are associated with benign endometrial cancer | |
Rawnaq et al. | Monitoring of loss of heterozygosity in serum microsatellite DNA among patients with gastrointestinal stromal tumors indicates tumor recurrence | |
RU2557977C1 (en) | Method for prediction of risk of hyperplastic processes of endometrium | |
Huang et al. | Methylation of immune-regulatory cytokine genes and pancreatic cancer outcomes | |
RU2557954C1 (en) | Method of predicting development of risk of combined proliferative reproductive system diseases in women | |
RU2558854C1 (en) | Method for prediction of risk of endometriosis | |
Braný et al. | Different methylation levels in the KLF4, ATF3 and DLEC1 genes in the myometrium and in corpus uteri mesenchymal tumours as assessed by MS-HRM | |
RU2550933C1 (en) | Method for predicting risk of hysteromyoma | |
RU2480763C1 (en) | Method for prediction of risk of developing benign mammry dysplasia in females with genital endometriosis | |
RU2453850C2 (en) | Method for prediction of character of uterine involvement in myomatous nodes | |
Schoorlemmer et al. | Altered DNA methylation in human placenta after (suspected) preterm labor | |
EA010571B1 (en) | Method for diagnosis of non-small cell carcinoma of lung and a kit therefor |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20160515 |