RU2553349C1 - Oligodeoxyribonucleotide inhibitor of human dna-methyltransferase 1 - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: oligodeoxyribonucleotide inhibitor of human DNA-methyltransferase 1 (Dnmt1) is provided, characterized in that it has a self-complementary structure, which forms a double-stranded pin, has an unpaired CA pair in the recognition site of the enzyme of human DNA-methyltransferase 1 and comprises in its composition 5-methylcytosine (5mC) and thiophosphates instead of phosphates.

EFFECT: invention provides selective inhibition of the Dnmt1 enzyme activity in reactions in vitro and in vivo.

3 dwg, 3 ex

Description

The invention relates to molecular biology and can be used in medicine. The invention is intended to selectively inhibit the activity of the human DNA methyltransferase 1 enzyme (Dnmt1) both in vitro and in human cells with overexpression of Dnmt1, for example, in certain types of cancer cells.

Currently known specific Dnmt1 inhibitors can be divided into two groups: nucleoside and non-nucleoside inhibitors [Delpu Y, Cordelier P, Cho WC, Torrisani J. DNNA methylation andcancerdiagnosis // Int J MolSci. 2013 Jul 18; 14 (7): 15029-58]. The first group includes modified analogues of cytidine, which are inserted into the newly synthesized DNA and / or RNA chain and covalently bind to the enzyme Dnmt1, which leads to a decrease in the number of active molecules. Typical representatives of this group are 5-aza-cytidine (Vidaza®), 5-aza-2′-deoxycytidine (Dacogen®) and 1- (β-D-ribofuranosyl) -2 (1H) -pyrimidinone (Zebularin). These three nucleoside inhibitors have been shown to be effective in treating acute myeloid leukemia and myelodysplastic syndrome, but they are extremely toxic and have a strong mutagenic effect [Robak T. Newnucleoside-analogsforpatientswithhematological malignancies. ExpertOpin. Investig. Drugs 2011; 20: 343-359]. In addition, the mechanism of their effect on the DNA methylation system can activate promethastatic genes [Chik F., Szyf M. Effectsofspecific DNMT genedepletiononcancercelltransformation-andbreastcancercellcellusvas; towardselective DNMT inhibitors. Carcinogenesis. 2011; 32: 224-232] and the question of their metabolism in healthy cells remains unresolved.

The group of non-nucleoside inhibitors is more extensive. It includes, for example, flavonoids, hydralazine, procaine derivatives, antisense oligonucleotides and synthetic oligonucleotides - analogues of natural substrates Dnmt1, which have greater affinity than natural substrates or irreversibly bind to the enzyme [Knox JD, Araujo FD, Bigey P., Slack AD, Price GB, Zannis-Hadjopoulos M., Szyf M. 2000. Inhibition of DNA methyltransferase inhibits DNA replication. J. Biol. Chem. 275, 17986-17990. Stewart D.J., Donehower R.C., Eisenhauer E.A., Wainman N., Shah A.K., Bonfils C., MacLeod A.R., Besterman J.M., Reid G.K. 2003. A phase I pharmacokinetic and pharmacodynamic study of the DNA methyltransferase 1 inhibitor MG98 administered twice weekly. Ann. Oncol. 14, 766-774. Flynn J., Fang J.Y., Mikovits J.A., Reich N.O. 2003. A potent cell-active allosteric inhibitor of murine DNA cytosine C5 methyltransferase.J. Biol. Chem. 278, 8238-8243]. The listed inhibitors differ in the mechanisms of action, but one common feature is the lack of an insertion stage in DNA, and therefore, significantly reduced toxic and mutagenic effects, which makes them, along with good inhibitory properties, promising for the treatment of oncopathologies.

Known inhibitor analogue "Modulators of DNA cytosine-5 methyltransferase and methods for use thereof" (US patent for the invention No. 7138384 (B1), IPC A61K 38/00, publ. 21.11.2006), having a double-stranded structure containing in its composition methylcytosines. The lengths and sequences of these known patented structures and in the proposed application for the invention have significant differences.

The use of this inhibitor to suppress the activity of DNA methyltransferase 1 is possible, however, the effectiveness of this process is significantly lower than when using the inhibitor we offer. These drawbacks are due to the fact that there is only one modification of the enzyme recognition site, and there is no protection of the saccharophosphate backbone from the action of cell nucleases.

Another inhibitor analogue is known, "OLIGONUCLEOTIDE INHIBITORS OF DNA METHYLTRANSFERASES AND THEIR USE IN TREATING DISEASES" (International Application No. WO2014011573 (A2), IPC A61K 38/55, published January 16, 2014), which is a self-complementary oligonucleotide having a recognition site of CpG methyltransferase, as well as methylcytosine at the recognition site and protecting the saccharophosphate backbone from the action of cell nucleases.

However, in the international application, cytidine analogues are used in the oligonucleotide structure: azacitidine and zebularin, and the lengths and sequences of these structures differ significantly from those proposed by the authors of this application. The use of these inhibitors to suppress the activity of DNA methyltransferase 1 is possible, however, the effectiveness of this process is significantly lower than when using the inhibitor proposed in this application.

The closest analogue to the claimed object of the invention is a selective inhibitor of GC-boxmet [Flynn J., Fang J.Y., Mikovits J.A., Reich N.O. 2003. A potent cell-active allosteric inhibitor of murine DNA cytosine C5 methyltransferase. J. Biol. Chem. 278, 8238-8243] (prototype). It represents the oligodeoxyribonucleotide structure of 5′-CTGGATCCTTGCCC (5mC) GCCCCTTGAATTCCC-3 'and showed good inhibitory potential on murine Dnmt1 and bacterial DNA methyl transferase SssI. The disadvantages of the prototype include:

1. A single-stranded structure is less affinity than double-stranded DNA.

2. High bioavailability for exo- and endonucleases of restriction.

3. Relatively low inhibitory activity against human Dnmt1.

The technical result of the invention is to obtain a higher inhibitory activity of an oligodeoxyribonucleotide inhibitor by increasing affinity for human Dnmt1 and modifying it to confer resistance to endo- and exonucleases in living cells.

The specified technical result is achieved by obtaining an oligodeoxyribonucleotide inhibitor of DNA methyltransferase 1 person, characterized in that it has a self-complementary structure (5 ′ → 3 ′):

5′GAATGGATCCGCTCTAACTGCCCCCAGTTAGAG (5mC) AGATCCATTC3 ′, which forms a double-stranded hairpin, has an unpaired CA pair in the recognition site of the human DNA methyltransferase 1 enzyme 5′-CG-3 / 3′-A (5mC) -5 ′ and contains thiophosphates instead of phosphates, where 5mC-5-methylcytosine (to increase affinity for the enzyme and protect against nuclease activity in a living cell).

The defining hallmarks of the invention in comparison with the prototype are:

1. The formation of a self-complementary double-chain stud.

2. The presence of unpaired C: A pair in the recognition site of the enzyme Dnmt1 5′-CG-3 / 3′-A (5mC) -5 ′

3. Replacing all phosphates with thiophosphates.

The above distinguishing features make it possible to increase the inhibitory activity of an oligodeoxyribonucleotide inhibitor by increasing affinity for human Dnmt1 and modifying it to confer resistance to endo- and exonucleases in living cells.

The invention is illustrated by the following graphic materials. In FIG. 1 shows the nucleotide sequence of an oligodeoxyribonucleotide DNA methyltransferase 1 inhibitor forming a double stranded hairpin. In FIG. 2 shows the dependence of the activity of the enzyme Dnmt1 (A) on the concentration of the inventive inhibitor (I). In FIG. Figure 3 shows the dependence of the number of living HeLa cells (Fig. 3, a), CaSki (Fig. 3, b) and L-68 (Fig. 3, c) on the concentration of the inventive inhibitor.

Example 1. Synthesis of oligodeoxyribonucleotide inhibitor. The oligonucleotide inhibitor was synthesized by the standard amidophosphine method on an automatic synthesizer using phosphoramidites from Glen Research (USA) [Beaucage S.L., Caruthers M.N. Deoxynucleoside phosphoramidites - A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett., 22, 1859-1862, (1981)]. Then, the oxidation of phosphates to phosphothioates was carried out using a Beaucage reagent (Glen Research, USA) as a sulfonating agent [Iyer RP, Egan W., Regan J. B., Beaucage SL 3H-1, 2-Benzodithiole-3-one 1 , 1-dioxide as an improved sulfurizing reagent in the solid-phase synthesis of oligodeoxyribonucleoside phosphorothioates // J. Am. Chem. Soc. 1990. 112. No. 3. 1253-1254]. Final purification was carried out using HPLC. The oligonucleotide concentration was determined spectrophotometrically, the molar extinction coefficient was calculated based on the nucleotide sequence. A hairpin DNA structure was obtained by annealing the oligonucleotide at an increase in temperature to 85 ° C and its gradual decrease to + 25 ° C. A hairpin is formed due to the peculiarities of the sequence of the oligonucleotide, the different ends of which have a large affinity for each other. The obtained oligodeoxyribonucleotide DNA methyltransferase inhibitor has a nucleotide sequence (see Appendix) forming a double-stranded hairpin.

Example 2. Inhibition of Dnmtl invitro. DNA methylation reactions were carried out at 37 ° C. The reaction mixture contained 50 mMTris-HCl, pH 7.8, 1 mMEDTA, 1 mM DTT, 5% glycerol and 0.1 mg / ml BSA. The concentrations of human Dnmt1 enzyme, AdoMet, substrate DNA ((inosine-containing polymer poly (dI-dC) • poly (dI-dC) 1755 bp (GE Healthcare, UK)) and the oligonucleotide inhibitor were 0.05 ea. / μl (~ 10 ^-9 M), 10 μM, 1 μM (in terms of sites) and 1 μM, respectively, Reactions were started by adding a solution of Dnmt1 to a mixture of radioactively labeled with tritium [ ³ H-CH ₃ ] AdoMet (“GE Healthcare”, Great Britain) and substrate DNA (with or without an inhibitor) to a final volume of 20 μl. Mixed solutions were preheated to 37 ° C. The reaction time was 3 hours. Aliquot 18 μl of the reaction mixtures were applied onto DE-81 anion exchange filter discs (Whatman, UK) .The filters were washed three times with a solution of 0.02 M NH ₄ HCO ₃ , twice with water and once with 75% ethanol, after which the filters were dried and their ³ H radioactivity was counted in a toluene scintillator on a Mark III counter (SearleAnalytic, USA).

A preliminary assessment of the substrate and inhibitory properties was carried out based on a comparison of the methylation degrees of Dnmt1 DNA methyltransferase of the poly (dI-dC) • poly (dI-dC) (D) substrate, the synthetic oligonucleotide inhibitor (B), and their mixture with the substrate (C). The percentage inhibition of the methylation reaction of poly (dIdC) • poly (dIdC) in the mixtures was calculated as follows: 100% × (1 - (C - B) / D). The dependences of the activity of Dnmt1 (A) on the concentration of inhibitor (I) shown in FIG. 2, was analyzed using the program for nonlinear regression analysis Origin 8.0 (“OriginLab”), calculating 50% inhibitory concentration (IC ₅₀ ) according to the standard expression: A = A _max / (1 + ([I] / IC ₅₀ ) ⁿ ), where n is the Hill coefficient.

The experiment showed that the inhibitor itself is not susceptible to methylation and causes 82% inhibition of the reaction under these conditions. The calculated IC ₅₀ value was 144 ± 7 nM.

Example 3. Inhibition of Dnmt1 in vivo. The following standard procedure was used to evaluate the cytotoxic activity of the oligodeoxyribonucleotide inhibitor. A monolayer of cell culture L-68, HeLa and CaSki was grown in the wells of flat-bottomed 96-well plates. After replacing the medium with fresh serum-free cattle and antibiotics, serial dilutions of the studied inhibitor or control oligonucleotide without inhibitory effect, mixed with a transfection agent (Lipofectamine 2000 (Invitrogen, USA)) in the selected proportion were added to the culture medium. After incubation for 4 hours, the medium was changed to growth with serum and cultured for 24 hours. After this, the medium was removed, and the monolayer was stained with vital dye neutral red, which is included only in viable cells and does not stain the dead. After removing the dye and washing the wells, lysis buffer was added. The amount of dye adsorbed by the living cells of the monolayer was measured spectrophotometrically by the absorption intensity at a wavelength of 540 nm. Wells of the plate were used as controls, into which a control oligonucleotide was added, as well as wells without an inhibitor, but with Lipofectamine added. Analysis was performed using an Emax plate spectrophotometer (MolecularDevices, USA). The 50% toxic concentration (TC ₅₀ ) of the preparations was calculated using the Origin 8.0 program (“OriginLab”) according to the formula the same as for IC ₅₀ . Statistical processing of the results was carried out by conventional methods.

In FIG. Figure 3 shows the dependence of the number of living HeLa cells (Fig. 3a), CaSki (Fig. 3b) and L-68 (Fig. 3c) on the concentration of the inhibitor. The obtained TC ₅₀ values were 236 ± 10 nM for HeLa cells, 118 ± 3 nM for CaSki cells and> 10,000 nM for L-68 cells. The half toxic concentration for the controls was 4 and> 50 μM for Lipofectamin and the control oligonucleotide, respectively.

Claims (1)

The oligodeoxyribonucleotide inhibitor of DNA methyltransferase 1 person, characterized in that it has a self-complementary structure (5 ′ → 3 ′):
5′GAATGGATCCGCTCTAACTGCCCCCAGTTAGAG (5mC) AGATCCATTC3 ′, which forms a double-stranded hairpin, has an unpaired CA pair in the recognition site of the human DNA methyltransferase 1 enzyme 5′-CG-3 / 3′-A (5mC) -5 ′ and contains thiophosphates instead of phosphates, where 5mC is 5-methylcytosine.

Images