RU2539768C2 - INTEGRATIVE GENETIC CONSTRUCTION pWpr-le - Google Patents

Abstract

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of biotechnology, in particular to integrative genetic construction pWpr-le. Claimed invention can be used for introduction of gene of human/swine growth hormone releasing factor into chromosome of cell of Bacillus subtilis and related species of genus Bacillus and its further expression in said cells. Integrative genetic construction pWpr-le is characterised by nucleotide sequence, given in Fig. 2.

EFFECT: claimed invention makes it possible to obtain vector system for expression of gene of GHRH_le peptide in bacteria, possessing high stability in obtaining bacterial preparation of probiotic purpose in industrial conditions.

4 dwg, 3 ex

Description

FIELD OF THE INVENTION

The invention relates to the field of biotechnology, in particular to the creation of an integrative genetic construct for expression of a human / pig growth hormone growth factor (GHRH_le) gene in bacteria.

State of the art

A known method of creating recombinant producers of human interferon alfa based on Bacillus licheniformis (see patent RU No. 98112850/13 class C12N 1/20, AK61/35/74, C12N 1/20, C12R 1:10 2001.08.20). The method is based on the use of an autonomously replicating plasmid vector pBMB 105, carrying the target gene and the kanamycin phosphotransferase gene, which provides resistance to kanamycin. The method enables the production of the target protein while maintaining a bacillary culture under sterile conditions in the presence of kanamycin. However, due to the low replicative stability, the plasmid is rapidly lost during cultivation of the strain in the absence of antibiotic selection. The plasmid vector can be easily transferred to cells of a wide range of gram-positive microorganisms, including representatives of the resident microflora of the intestines of humans and animals. Thus, due to the low stability and biological hazard, the strain is unsuitable for the production of probiotic veterinary preparations.

The present invention consists in the creation of a new vector system for expression of the GHRH_le peptide gene in bacteria, which is highly stable in the preparation of a probiotic bacterial preparation under industrial conditions and its oral delivery to animals.

Disclosure of invention

The essence of the invention is a method for creating an integrative genetic construct for expression of the gene of the peptide GHRH_le in bacteria. To integrate the GHRH_le peptide gene into the Wpr chromosomal locus of bacteria of the genus Bacillus, a construct consisting of the following components was created (Fig. 1).

1. The promoter of the Wpr A gene (1000 bp)

The wprA gene encodes a subtilisin-like proteinase tightly bound to the cell wall (CWBP). The use of the nucleotide sequence corresponding to the promoter sequence of this gene implies the integration of the target construct (pWpr-le) into the genome of B. subtilis AJ73. Moreover, the shutdown of the WprA gene as a result of recombination does not lead to disruption of cell activity, and the activity of the wprA gene promoter ensures the synthesis of the target protein (GHRH_le) into the cytoplasm.

2. Mini-gene (15 bp) of the pentapeptide (E-peptide), the expression of which gives bacillus cells resistance to erythromycin. The use of the E-peptide mini-gene as a transcriptional reporter can significantly facilitate the search for the most productive clones by growing cultures at gradually increasing concentrations of erythromycin and selecting the most resistant to antibiotic.

3. The sequence encoding GHRH_le (100 bp)

Thus, the present invention relates to a method for producing an integrative genetic construct for expression of a GHRH_le peptide gene in bacteria.

The method includes:

- obtaining a plasmid construct pWpr-le carrying a trifunctional fusion gene;

- introduction of the construct into the genome of B. subtilis AJ73 by the method of chemical transformation according to Spitsaizen.

Short description of graphic images

Figure 1. Plasmid construction pWpr-le: concept. Figure 2. The sequence of the trifunctional fusion gene encoding GHRH_le in the pWpr-le construct.

Figure 3. Electrophoresis of genomic DNA isolated from clones (isolates) of bacilli designed to detect the integrated pWpr-le construct by PCR.

Figure 4. Electrophoretic analysis of PCR products to identify the pWpr_le construct, including the one integrated into the bacillus genome, using primers SLN-H1 and SLN-H2.

The implementation of the invention

Research Methodology:

1) obtaining the pWpr-le construct,

2) the introduction into the genome of B. subtilis AJ73 of the resulting construct,

3) isolation of genomic DNA from B. subtilis AJ73 and detection of the transgene by PCR.

1) Obtaining the pWpr-le construct

The construction was carried out according to the following scheme:

1. PCR cloning of the coding region of the mature form of GHRH_le using primers PCR was performed using primers to the GHRH_le peptide gene:

SLN_H1: GGGGATCCTATGCAGATGCCATCTTCAC

SLN_H2: GGGTCGACTATCCCTGCTGCCTGCTCATGA

The size of the PCR product is 105 bp. As a matrix, human genomic DNA is used.

2. Processing of the PCR product 1 with restriction endonucleases BamHI and SalI, cloning into the pQE30 vector (Qiagen), split at the BamHI and SalI sites.

3. Obtaining the DNA duplex of the artificial E-peptide minigene by mixing the primers Em2 and Em1.1 in an equimolar ratio, followed by completion with Pfu polymerase or Mu-MLV reverse transcriptase (Promega).

4. Processing of the DNA duplex with an NdeI restriction endonuclease, followed by cloning into the pET23a, pET23b or pET23c vector treated with the restriction endonucleases NdeI and Ecl136.II.

5. PCR amplification on a B. subtilis AJ73 genomic DNA matrix of a fragment containing the wprA gene promoter with Wpr41 and Wpr42 primers (product size 935 bp).

6. Processing of the PCR product 3 with restriction endonucleases BglII and XbaI, ligation with plasmid DNA of construct 2 based on pET23 vector carrying the erythromycin resistance E-peptide mini-gene.

7. Transfer of the DNA fragment containing the wprA gene promoter and the erythromycin resistance E-mini-gene from construct 6 to construct 2. To do this, the DNA of both constructs is processed with XhoI and EcoRI restriction endonucleases, and preparative purification of construct 6 is carried out with a length of 999 p .n. elution from agarose gel, ligation of the purified fragment with cleaved and purified phenolic extraction of plasmid DNA of construction 2.

The structure of the structure (figure 1 and figure 2) can distinguish the following elements:

- expression vector pQE30 (Qiagen);

- promoter of the WprA gene;

- E-peptide mini-gene, which provides the resistance of bacilli to erythromycin;

- a gene encoding a mature gene of the peptide GHRH_le;

- fragment polylinker vector pET32 (Novagen).

2) Introduction to the genome of B. subtilis AJ73 of the resulting construct. The pWpr-le construct was introduced into the cells of the strain B. subtilis AJ73 (VKPM B-5036) by the method of chemical transformation according to Spitsaisen [11].

The bacterial culture was grown for 14-18 hours in Lennox broth (yeast extract (Difco) 5 g / l, bactopeptone (Difco) 10 g / l, NaCl 5 g / l) at 37 ° C. The culture was diluted 20 times with SpI medium and grown for 4-5 hours. Then it was diluted with warm (37 ° C) SpII medium 10 times and MgCl _{2 was} added to 2.5 mM. The culture was incubated with aeration at 37 ° C for another 2 hours. Then DNA was added (1-2 μg / ml in the case of plasmid DNA), the cells were incubated for 1.5-2 hours at 37 ° C and plated on dry plates with LB agar and erythromycin.

Colony selection was carried out by the appearance of resistance to erythromycin at a concentration of 15 μg / ml.

Subsequently, the recombinant strains were stored on Petri dishes with LB agar (yeast extract (Difco) 5 g / l, bactopeptone (Difco) 10 g / l, NaCl 5 g / l, bactoagar (Ferak) 12 g / l) containing erythromycin (15 μg / ml) at + 4 ° C, reseeding once a month.

3) Isolation of genomic DNA from a cell culture of B. subtilis AJ73 and detection of the transgene by PCR.

To isolate genomic DNA, a cell culture of B. subtilis AJ73 cells was grown in 3 ml of Lennox medium for 16 hours at 37 ° C under intensive aeration. Cells were pelleted by centrifugation at 5000 rpm. Isolation of genomic DNA from the obtained B. subtilis AJ73 cells was performed using the “Reagent Kit for DNA Isolation on the S-Sorb” (“Synthol”) sorbent. The consumption of reagents during the isolation of genomic DNA from 3 ml of culture corresponded to those indicated in the instructions for the kit. The resulting genomic DNA was dissolved in 40-50 μl of elution solution No. 6 (figure 3).

To detect the transgene by PCR, the following primer pairs were used to obtain the PCR product, including the DNA sequence corresponding to the gene of the peptide GHRH _- le - SLN_H1 - SLN_H2:

SLN_H1: GGGGATCCTATGCAGATGCCATCTTCAC

SLN_H2: GGGTCGACTATCCCTGCTGCCTGCTCATGA,

The size of the PCR product is 105 bp.

PCR was performed using a four-channel thermal cycler TP4-PCR-01- "Tertsik" (LLC NPO DNA-Technology) in the matrix mode.

The primer annealing temperature (Ta) was + 60 ° С.

The volume of the PCR mixture was 20 μl; Taq DNA polymerase (Fermentas) was used.

Electrophoresis of PCR products was carried out on an agarose gel (3%), in TAE buffer (Tris (base) - 40 mM, EDTA - 1 mM, acetic acid - 31 mM) using the GeneRuler ™ 50 bp DNA Ladder molecular weight standard (MBI Fermentas, cat. No. SM 0373) (fragment sizes: 50-1000 bp) (Fig. 4).

The authenticity of the PCR product as a fragment of the GHRH_le peptide gene can be monitored by direct sequencing using SLN-H1 or SLN-H2 primers.

List of sources used

1. Bohlen P. Isolation and characterization of the porcine hypothalamic growth hormone releasing factor / Bohlen P., Esch F., Brazeau P., Ling N. and Guillemin R. // Biochem. Biophys. Res. Commun. - 1983 .-- V.116, N.2. - P.726-734.

2. Cravador A. Total DNA synthesis and cloning in Escherichia coli of a gene coding for the human growth hormone releasing factor / Cravador A., Jacobs P., Van Elsen A., Lacroix C., Colau B., Van Alphen P. , Herzog A. and Bollen A. // Biochimie - 1985 .-- V.67. - N.7-8. - P.829-834.

3. Draghia-Akli R. High-efficiency growth hormone releasing hormone plasmid vector administration into skeletal muscle mediated by electroporation in pigs. / Draghia - Akli R, Elllis KM, Hill L-A, Malone PB, Fiorotto ML // FASEB J. - 2003 .-- 17. - P.526-528.

4. Hirose I. Proteome analysis of Bacillus subtilis extracellular proteins: a two-dimensional protein electrophoretic study / Hirose I., Sano K., Shioda I., Kumano M., Nakamura K. and Yamane K. // Microbiology. - 2000. - 14. - P.65-75.

5. Lee S.J. Enhancement of secretion and extracellular stability of staphylokinase in Bacillus subtilis by wprA gene disruption / Lee S.J., Kim D.M., Bae K.H, Byun S.M. and Chung J.H. // Appl. Environ. Microbiol. - 2000. - 66. - P.476-480.

6. Stephenson K. Influence of a cell wall associated protease on production of alpha-amylase by Bacillus subtilis / Stephenson K., Harwood C.R. // Appl. Environ. Microbiol. - 1998. - 64. P.2875-2881.

7. Stephenson K. The influence of protein folding on the late stages of the secretion of α-amylases from Bacillus subtilis / Stephenson K., Carter N.M., Harwood C.R., Petit Glatron M.F. and Chambert R. // FEBS Lett. - 1998. - 430. - P.385-389.

8. Tjalsma H. et al. Proteomics of Protein Secretion by Bacillus subtilis: Separating the "Secrets" of the Secretome / Microbiology and molecular biology reviews. - 2004 .-- Vol.68. - No.2. - P.207-233.

9. Margot, P. The wprA gene of Bacillus subtilis 168, expressed during exponential growth, encodes a cell-wall-associated protease / Margot, P., and D. Karamata. // Microbiology. - 1996. - 142. - P.3437-3444.

10. Belyavskaya V.A., Sorokulova I.B., Romashova N.G., et al. The bacterial strain Bacillus licheniformis with antiviral and antibacterial activity. - RF patent.

11. Anagnostopoulos C. Requirements for transformation in Bacillus subtilis / Anagnostopoulos C., Spizizen J. // J. Bacteriol. - 1961. - V.81. - P.741-746.

Claims (1)

The integrative genetic construct pWpr-le, intended for introducing into the chromosome of Bacillus subtilis cells and related species of the genus Bacillus the gene for releasing human / pig growth hormone factor and its subsequent expression in these cells, characterized by the nucleotide sequence shown in Figure 2.

Images