RU2527069C2 - METHOD OF SPECIES AND STRAIN IDENTIFICATION OF BIFIDOBACTERIA OF PHYLOTYPE Bifidobacterium longum - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology and deals with species and strain identification of bifidobacteria of phylotype Bifidobacterium longum. Claimed method is based on combination and polymorphism of genes of toxin-antitoxin of RelBE superfamily and is characterised by the fact that for identification amplification with genome DNA is performed with application of set of species- and strain-specific oligonucleotides, PCR products are analysed in agarose gel, and size of obtained fragment is determined by means of DNA-marker. Analysed strains are related to certain species and/or strain in case of accumulation of fragments with application of certain oligonucleotides.

EFFECT: claimed invention can be used for identification of strains of bifidobacteria, identification of analysed strains in clinical samples or their molecular tracking in commercial preparations.

3 tbl

Description

FIELD OF THE INVENTION

The invention relates to biotechnology, in particular to the production of bacterial preparations and food products, as well as to medical microbiology, and can be used to identify strains of bifidobacteria.

State of the art

It is known that the clinical manifestations of intestinal dysbiosis, as a rule, are observed against the background of the absence or deficiency of bifidobacteria, which are normally the basis of the intestinal microflora of people of all ages. (Bondarenko V.M., Gracheva N.M., Matsulevich T.V. Intestinal dysbacteriosis in adults. M: KMK Scientifi with Press, 2003, 224 p .; Leahy SC, Higgins DG, Fitzgerald GF and van Sinderen D. Getting better with bifidobacteria. Journal of Applied Microbiology, 2005, 98, 1303-1315). That is why bifidobacteria are widely used in the composition of starter cultures for the preparation of various dairy products and in the form of bacterial preparations used for therapeutic and prophylactic purposes. In this regard, it is very important to develop accurate methods for identifying species and strains of bifidobacteria (Mazankova L.N., Lykova E.A. Probiotics: characterization of drugs and choice in pediatric practice // Children's Infections. 2004, No. 1, pp. 18-23 ; Bifidobacteria and their use in the clinic, medical industry and agriculture / Edited by Nikitin V.A. M., 1986, 119 pp. Bondarenko V. M., Vorobev A. A. Dysbiosis and drugs with probiotic function // Zhurn Microbiologist. - 2004. - No. 1. - P.84-92; Stanton C., Ross RP, Fitzgerald GF and Van Sinderen, D. (2005) Fermented functional foods based on probiotics and their biogenic meta bolites. Curr. Opin. Biotechnol. 16, 198-203).

Currently, the following methods are used to identify the species and genus of bifidobacteria:

1. A method based on the amplification of fragments of the 16S pPHK gene. (Youn SY, Seo JM, Ji GE. Evaluation of the PCR method for identification of Bifidobacterium species. Lett Appl Microbiol. 2008, Jan, 46 (1): 7-13; Krizova, J., Spanova, A. and Rittich, B. Evaluation of amplified ribosomal DNA restriction analysis (ARDRA) and species-specific PCR for identification of Bifidobacterium species. Syst Appl Microbiol. 2006, 29, 36-44; Kwon, HS, Yang, EH, Lee, SH, Yeon, SW , Kang, BH and Kim, TY Rapid identification of potentially probiotic Bifidobacterium species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA. FEMS Microbiol Lett. 2005, 250, 55-62; Mullie, C ., Odou, MF, Singer, E., Romond, MD and Izard, D. Multiplex PCR using 16S rRNA gene-targeted primers for the identification of Bifidobacteria from human origin. FEMS Microbiol Lett. 2003, 222, 129-136; Patent Japan, United States Patent 7,321,032, 2008; Patent P 200601788 ES, 2006; KR Patent 20050012505, 2 005).

The nucleotide sequences of the 16S rRNA genes have developed rhodo-, group- and species-specific primers, amplification with which in some cases can be carried out simultaneously in a common reaction mixture (the so-called multiplex PCR - multiplex PCR) (Matsuki T., Watanabe K., Fujimoto J. , Kado Y., Takada T., Matsumoto K., Tanaka R. Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal Bifidobacteria. Applied and environmental microbiology, Jan. 2004, p.167-173 ) However, the interspecific level of similarity in the 16S rRNA gene varies between 93-99%, and many species of bifidobacteria are phylogenetically close to each other.

2. The method of two-locus sequencing, in particular, using the β-subunit of F ₀ F ₁ -ATPase. (Ventura M., Canchaya S., van Sinderen D ,, Fitzgerald GF, Zink R. Bifidobacterium lactis DSM 10140: Identification of the atp (atpBEFHAGDC) Operon and Analysis of Its Genetic Structure, Characteristics, and Phytogeny. Applied and environmental microbiology, May 2004, p.3110-3121.).

3. A method using 7 conservative “housekeeping” genes clpC, dnaB, dnaG, dnaJ1, purF, rpoC and xfp, the combination of sequences of which allows revealing phylogenetic differences between the types of bifidobacteria. (Ventura, M., Canchaya, S., Del Casale, A., Dellaglio, F., Neviani, E., F.itzgerald, GF and van Sinderen, D. Analysis of bifidobacterial evolution using a multilocus approach. Int. J. Syst. Evol. Microbiol. 2006, 56, 2783-2792.).

However, the above methods do not allow strain-specific identification, since the nucleotide sequences of the genes used for species identification are completely identical for different strains of the same species.

For genotyping of strains of the species B. animalis subsp. lactis developed a method based on single nucleotide polymorphisms, inserts and divisions. (Briczinski E.R., Loquasto JR, Barrangou R., Dudley EG, Roberts AM, Roberts RF Strain-specific genotyping of Bifidobacterium animalis subsp. Lactis by using single-nucleotide polymorphisms, insertions, and deletions. Appl Environ Microbiol. 2009 Dec ; 75 (23): 7501-8. Epub 2009 Oct 2.).

Identification methods have not yet been developed for strains of other species of Bifidobacterium (including B. longum).

Disclosure of invention

The objective of the present invention is to provide an express method for molecular genetic typing of strains of bifidobacteria and, in particular, B. longum.

The claimed invention provides a method for identifying strains of the B. longum phylotype, based on the combination and polymorphism of the toxin-antitoxin genes of the relBE system. The action of the toxin-antitoxin systems in a number of studies qualifies as adaptation to stressful conditions (substrate starvation or other stresses), which allows the remaining bacteria to survive. (Prozorov A.A., Danilenko V.N. "Toxin-antitoxin" systems in bacteria: apoptosis tool or metabolism modulators? Microbiology. 2010. V.79. No. 2. P.147-159).

1. Bioinformatics analysis of the presence of mazEF and relBE toxin-antitoxin system genes in bifidobacteria

According to the data as of October 1, 2011, the database contains 11 genomes belonging to the group of B. longum (7 strains of the subspecies B. longum subsp. Longum and 4 strains of the subspecies B. longum subsp. Infantis), as well as the strain Bifidobacterium sp. 12_1_47BFAA, also related to the species B. longum.

The authors of the present invention conducted a computer search of the genes of MazEF and RelBE systems in the genomes of all sequenced strains of bifidobacteria using the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/) and UniProt (http: //www.uniprot.org/). A comparative analysis of the sequences of the detected genes was performed using the Blast (http://blast.ncbi.nlm.nih.gov/) and CLUSTAL W (http://www.ch.embnet.org/software/ClustalW.html) programs.

As a result of bioinformatics analysis, significant differences between B.longum phylotype strains by the presence of genes of these toxin-antitoxin systems were found (see Table 1). Modules of the mazEF system (overlapping genes) are present only in the genomes of 3 strains of B. longum - ATCC 15697, JDM301 and 157F. RelE toxin genes are present only in the genomes of 4 strains - ATCC 15697, JDM301,157F and 12_1_47BFAA.

RelB genes were found in all genomes of B. longum group strains. In the strain B. longum subsp. infantis ATCC 15697 contains the largest number (7) of relB antitoxin genes (we designate relB1-relB7 in the order in the genome). In the strain B. longum subsp. longum JDM301 contains 6 relB antitoxin genes (there are no genes homologous to the relB1 and relB5 genes, but there is a gene designated as relB8). In other B. longum strains, 1 to 3 relB antitoxin genes were detected. Thus, we found the polymorphism of relB antitoxin genes at the strain level.

The gene designated as relB3 is present in all B. longum genomes, has a high homology of 98 to 99% throughout the nucleotide sequence, except for the C-terminal region, and can be used for species identification of strains of the B. longum phylotype.

RelB1 - relB10 antitoxin genes have low homology between each other (15-30%), which can serve as a strain-specific sign, in addition, there are point differences and inserts in the nucleotide sequences of relB genes, which makes it possible to develop strain-specific oligonucleotides.

Genes of mazEF and relBE toxin-antitoxin systems were also found in the genomes of other species of the genus Bifidobacterium: in the genomes of 6 strains of the species B. animalis subsp. lactis is present in 1 module of the mazEF system (overlapping genes), 1 relE toxin gene and 2 relB antitoxin genes; in the genomes of 3 strains of the species B. bifidum - 1 module of the mazEF system and 3 relB antitoxin genes; in the genomes of 3 strains of the species B. breve - 2 modules of the mazEF system, 1 gene of toxin relE and 4 to 5 genes of antitoxin relB. The genome of the B. adolescentis ATCC 15703 strain contains 1 module of the mazEF system.

Thus, using the genes of the mazEF and relBE systems, species identification of all types of bifidobacteria can also be carried out.

2. Development of oligonucleotides for identification of B. longum

2.1. B. longum phylotype identification

Since the antitoxin gene, designated by us as relB3, is present in all B. longum genomes, oligonucleotides for species identification were constructed using CLUSTALW Programs (http://www.ch.embnet.org/software/ClustalW based on the nucleotide sequences of the conserved gene). html) and Adv.BLAST (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi).

Sequence 3 (see list of sequences) presents a comparative analysis of the nucleotide sequences of the antitoxin relB3 genes of B.longum strains and the localization of the ReBN and ReBC oligonucleotides for species identification. On all nucleotide sequences presented, the differences are highlighted in red, the inserts in yellow.

2.2. Strain-specific identification

With an increase in the number of available sequenced genomes of bifidobacteria, it became possible to identify DNA regions specific for each particular strain.

As mentioned above, the largest number (7) of relB antitoxin genes is present in the genome of the ATCC 15697 strain, and the relB1 gene is strain-specific, because absent in the genomes of the remaining strains. In this regard, to identify this strain, we constructed oligonucleotides based on the nucleotide sequence of the relB1 gene (sequence 1).

Also, the relB8 and relB10 genes are specific for the JDM301 and AACC 91563 strains, respectively (sequences 6, 8).

The relB2 gene is present in the genomes of the ATCC 15697, JDM301, and F8 strains; gene relB4 - in the genomes of strains ATCC 15697, JDM301, 157F and 12_1_47BFAA; relB5 gene - genomes of strains of ATCC 15697 and 157F; relB9 gene - genomes of ATCC 55813 and CCUG 52486 strains. A comparative analysis of the sequences of these genes for different strains revealed single nucleotide differences, which also allowed the construction of strain-specific oligonucleotides (sequences 2, 4, 5, 7).

The genomes of strains DJO10A, NCC2705, BBMN68, and JCM 1217 contain only the relB3 antitoxin gene, which is also present in the genomes of all B.longum strains (sequence 3).

According to the nucleotide sequence of the antitoxin relB3 gene, B. longum strains can be divided into 2 main groups:

Group relB3a. The following strains belong to it: ATCC 15697, ATCC 55813, DJO10A, 12_1_47BFAA, F8, NCC2705, JDM301,157F.

Group relB3b. In contrast to the relB3A group (numbering is given for strain ATCC 15697), the nucleotide sequence contains substitutions (A ₁₁₄ → G; C ₂₁₆ → T; A ₂₁₇ → G; C ₃₀₉ → T; A ₃₁₀ → G; A ₃₁₂ → G; G ₃₁₅ → A; T ₃₁₆ → G; A ₃₁₇ → C; C ₃₁₈ → T; G ₃₂₄ → A; A ₃₂₆ → G; A ₃₂₇ → G; T ₃₃₀ → G; G ₃₃₁ → A; A ₃₃₄ → G; T ₃₃₇ → C; A ₃₃₈ → G; C ₃₄₂ → T; A ₃₄₄ → G; C ₃₄₅ → A; T ₃₄₇ → G; A ₃₅₀ → G; G ₃₅₁ → C; A ₃₅₂ → G; G ₃₅₄ → A; C ₃₅₆ → T; G ₃₅₈ → T; A ₃₅₉ → G) and inserts (15 nucleotides in the region between 332 and 333 nucleotides; 4 nucleotides in the region between 342 and 343 nucleotides; 2 nucleotides in the region between 360 and 361 nucleotides).

It includes strains: CCUG 52486, BBMN68, JCM 1217 and CASS 91563.

The relB3a group can be divided into subgroups:

Subgroup relB3a. 1. The ATCC 15697 strain belongs to it.

Subgroup relB3a. 2. Differences from relB3A.1 - A ₁₁₄ → G; C ₂₁₆ → T; A ₂₁₇ → G; G ₂₂₈ → A; A ₃₃₄ → G.

The strains belong to it: ATCC 55813 (additionally contains the relB9 gene),

DJO10A (contains only the relB3 gene)

12_1_47BFAA (additionally contains the relB4 gene),

157F (additionally contains the relB4 and relB5 genes).

Subgroup relB3a. 3. Differences from relB3A.1 - A ₁₁₄ → G; C ₂₁₆ → T; A ₂₁₇ → G; G ₂₂₈ → A.

It includes strain NCC2705.

Subgroup relB3a. 4. Differences from relB3A.1 - G ₈₇ → A; A ₁₁₄ → G; C ₂₁₆ → T; A ₂₁₇ → G; A ₃₃₄ → G.

The strain JDM301 belongs to it.

Subgroup relB3a. 5. Differences from relB3A.1 - C ₂₁ → T; A ₁₁₄ → G; A ₁₆₈ → G; A ₁₇₉ → C; C ₂₁₆ → T; A ₂₁₇ → G; C ₃₅₆ → T. It includes strain F8.

The relB3b group can be divided into subgroups:

Subgroup relB3b. 1. Contains replacement A ₁₄₄ → C.

BBMN68 strain belongs to it.

Subgroup relB3b. 2. Contains replacements A ₁₄₄ → C; A ₁₆₈ → G.

It includes the strain CCUG 52486.

Subgroup relB3b. 3. Contains replacements A ₁₄₄ → C; G ₂₂₈ → A.

It includes the strain JCM 1217.

Subgroup relB3b. 4. Contains substitutions A ₁₆₈ → G; A ₁₇₉ → C.

It includes the strain CASS 91563.

All differences revealed by comparing the sequences of antitoxin relB genes allow identification of B. longum strains.

3. Development of oligonucleotides for the species identification of Bifidobacterium not belonging to the B. longum phylotype

Bioinformatics analysis of the presence of genes of the toxin-antitoxin of the MazEF and RelBE systems in other species of bifidobacteria is presented in table 3.

In the genomes of strains of the species B. bifidum there are 3 genes of antitoxin relB. A comparative analysis of the nucleotide sequences of relB genes of B. bifidum strains with the antitoxin genes of relB1-relB10 of B. longum strains showed that 2 genes have a high identity (from 98 to 99%) with the relB2 and relB10 genes, the third antitoxin gene has a low identity (15- 30%) and is designated by us as relB11. In this regard, we constructed the RelB11BbN and RelB11BbC oligonucleotides for the species identification of B. bifidum based on the nucleotide sequence of the relB11 gene (sequence 9).

Only 1 mazF toxin gene is present in the genome of B. adolescentis ATCC 15703 strain. A comparative analysis of its nucleotide sequence with mzzF genes showed a low identity with similar genes of strains of B. longum, B. animalis subsp. lactis, B. bifidum and B. breve. In this regard, in order to identify bifidobacteria belonging to the species B. adolescentis, we constructed the MazBaN and MazBaC oligonucleotides based on the mazF toxin gene sequence (sequence 10).

Similarly, oligonucleotides can be developed to identify other types of bifidobacteria - B. animalis subsp. lactis and B. breve.

In this way:

1) The method of identification of bifidobacteria of the present invention is based on the combination and polymorphism of the toxin-antitoxin gene systems RelBE and MazEF.

2) The proposed method involves amplification with genomic DNA using the proposed set of pairs of oligonucleotides for species and strain identification of bifidobacteria of the B. longum group.

3) The proposed method can be used for species identification of Bifidobacterium bifidum and Bifidobacterium adolescentis and other types of bifidobacteria.

The implementation of the invention

The bifidobacteria culture was grown on MPC agar medium with 0.05% cysteine for 48 hours at 37 ° C under anaerobic conditions in a HiAnaerobicTM anaerostat (HiMedia Company (India)), after which genomic DNA was isolated.

The bifidobacteria culture is centrifuged at 8000 rpm for 10 minutes. The precipitate was suspended in 0.6 ml of TEST buffer (10 mM Tris HCl pH 8.0; 5 mM EDTA pH 8.0; 1M NaCl; 1/200 volume of Triton-X100). Mix gently. Incubated at 37 ° C for 12 hours. Add 150 μl of a freshly prepared lysozyme solution (initial concentration of 100 mg / ml); add 10 μl of RNase solution (stock solution 10 mg / ml). Mix gently. Incubated at 37 ° C for 3 hours (suspension should become slightly viscous). Add 150 μl of a proteinase K solution (stock solution 20 mg / ml) and 150 μl of 10% sarcosyl. Mix gently. Incubated at 37 ° C for 24 hours until complete lysis. Add 100 μl of 25% sodium dodecyl sulfate, mix, incubate at 55 ° C for 2.5 hours (the suspension should lighten). 1 volume of phenol is added to the cell lysate. The contents of eppendorf are intensively but carefully mixed by inversion for 1 min. Centrifuged for 10 minutes at 12,000 rpm. The aqueous phase is selected in a new eppendorf, phenol treatment is repeated. The aqueous phase is taken up in pure eppendorf and 1 volume of chloroform with isoamyl alcohol is added. The contents of eppendorf are mixed by inversion for 1 min. Centrifuge for 5 minutes at 12,000 rpm. The aqueous phase is transferred to pure eppendorf, 1 ml of isopropanol is added, stirred by inversion (a precipitate appears in the form of strands). Centrifuged for 1 min at 10,000 rpm, the supernatant is removed. The precipitate was washed with 70% ethanol, dried and dissolved in 150 μl of water.

Amplification of DNA is carried out using the Amplification kit of Dialat Ltd company on the Tertsik instrument (DNA technology). The composition of the mixture for PCR (per 100 μl): 10 μl of 10 × PCR buffer, 10 μl of a mixture of 2.5 mM ΣdNTPs, 4 μl of 50 mM MgCl ₂ , 0.3 μg of genomic DNA and 0.8 μl of Taq polymerase enzyme. Oligonucleotide primers are added at a concentration of 20 pmol per 100 μl of the mixture.

PCR reaction parameters: 95 ° C for 5 min (cell lysis and denaturation of genomic DNA); then 30 cycles of amplification - 94 ° C - 1 min (denaturation), 56 ° C for 1 min (annealing of oligonucleotides), 72 ° C - 2 min (completion (extension) of the chain); final elongation of fragments at 72 ° C - 10 min, storage at 4 ° C.

The results of the study are taken into account by analyzing the amplification products of the test samples by electrophoresis in 1% agarose gel. After amplification is completed, 1/5 of the volume of a 6X DNA Loading Dye solution (Fermentas) is carefully added under oil to the test sample tubes after amplification, mixed, and 8 μl of the obtained sample is added to the wells of an agarose gel. Electrophoresis is performed in a SE-2 horizontal electrophoresis chamber (Helikon Company) with an Elf-4 power source (DNA technology) at a voltage of 120 V for 60 minutes. The results of electrophoresis are taken into account in ultraviolet light with a wavelength of 254 nm on a TCP-20 MS transilluminator (Vilber Lourmat, France). As a control of the size of the obtained fragment using DNA marker GeneRuler ™ 100+ bp ("Fermentas").

Examples of identification of the species and B. longum strains of the present invention

Example 1. Species identification of the B. longum phylotype

Species identification of bifidobacteria is carried out by amplification of DNA with the genomic DNA of bifidobacteria with the above parameters using the species-specific oligonucleotides RelBN ( ^{5 ′} TGCGAAACTGAAGAACGAGG ^{3 ′} ) and RelBC ( ^{5 ′} CGCGGAACTGCTTGTAGGT ^{3 ′} ).

When amplifying DNA of strains belonging to the B. longum phylotype, a fragment of 275 bp should be generated.

Example 2. Identification of strains of B. longum

For strain-specific identification, amplification with genomic DNA is performed using the oligonucleotides shown in Table 2. The PCR products are analyzed on a 1% agarose gel. The size of the obtained fragment is determined using the GeneRuler ™ DNA marker 100+ bp ("Fermentas").

The studied strain is identical to the strain of B. longum subsp. infantis ATCC 15697 in the case of producing fragments using oligonucleotides ReB1N-ReB1C (strain-specific), ReB2N-ReB2C and http: //ReB3.lN-ReB3.2C. When using the remaining oligonucleotides, there should be no PCR products.

The studied strain is identical to the strain of B. longum subsp. infantis ATCC 55813 in the presence of PCR products only when using the oligonucleotides ReB3.1N-ReB3.1C and ReB9.1N-ReB9.1C.

The studied strain is identical to the strain B.longum subsp. infantis CCUG 52486 in the case of PCR products only when using the oligonucleotides ReB3.1N-ReB3.1C, http: //ReB3.4N-ReB3.4C and ReB9.1N-ReB9.2C.

The studied strain is identical to the strain of B. longum DJO10A in the case of the presence of PCR products only when using oligonucleotides http://ReB3.lN-ReB3.lC.

The studied strain is identical to the strain of Bifidobacterium sp. (B.longum) 12_1_47BFAA in the case of PCR products only when using the oligonucleotides http://ReB3.lN-ReB3.lC and ReB4N-ReB4C.

The studied strain is identical to the strain of B. longum subsp. longum F8 in the presence of PCR products only when using the oligonucleotides ReB2N-ReB2C and ReB3.3N-ReBC.

The studied strain is identical to B. longum strain NCC2705 in the case of PCR products only when using oligonucleotides http: //ReB3.lN-ReB3.2C.

The studied strain is identical to the strain of B. longum subsp. longum JDM301 in the case of amplification of fragments only when using oligonucleotides ReB8N-ReB8C (strain-specific), ReB2N-ReB2C and http://ReB3.lN-ReB3.lC.

The studied strain is identical to the strain of B. longum subsp. longum BBMN68 in the case of PCR products only when using oligonucleotides http: //ReB3.lN-ReB3.lC and http: //ReB3.4N-ReB3.4C.

The studied strain is identical to the strain of B. longum subsp. infantis 157F in the case of PCR products only when using oligonucleotides http://ReB3.lN-ReB3.lC, ReB4N-ReB4C and ReB5N-ReB5C.

The studied strain is identical to the strain B.longum subsp. longum JCM1217 in the case of PCR products only when using oligonucleotides http: //ReB3.lN-ReB3.lC and http: //ReB3.5N-ReB3.4C.

The studied strain is identical to the strain of B. longum subsp. longum CASS 91563 in the case of PCR products only when using oligonucleotides ReB10N-ReB10C and ReB3.1N-ReB3.4C.

Example 3. Identification of the species Bifidobacterium bifidum and Bifidobacterium adolescentis

Identification of bifidobacteria relating to the form B.bifidum, is carried out by amplification with genomic DNA of bifidobacteria at the above-described parameters using RelB11BbN oligonucleotides ^{(5 'ATGGCGAGCATACCCAC 3')} and RelB11BbC ^{(5 'ATCTGCCATTCGACGTTTCCTT 3').}

During amplification with DNA of strains belonging to the species B. bifidum, a fragment of 178 bp should be generated.

The identification of B. adolescentis bifidobacteria is carried out by amplification with the bifidobacteria genomic DNA using the above parameters using the MazBaN oligonucleotides ( ^{5 ′} GTGAGATCTGGACTGTGCT ^{3 ′} ) and MazBaC ( ^{5 ′} CTGGCGCATGACATCATCT ^{3 ′} ).

When amplifying DNA of strains belonging to the species B. adolescentis, a fragment of 277 bp should be generated.

Example 4. Identification of strains of bifidobacteria from the Russian collection

Using the designed primers for mazEF and relBE toxin-antitoxin system genes, 35 strains of bifidobacteria were identified from the collection of the Laboratory of Microorganism Genetics of the Institute of General Genetics named after N.I. Vavilov RAS, isolated from the gastroenterological tract of practically healthy people in the Central region of Russia.

At the first stage, species identification was carried out. Of these, 23 strains were assigned to the B. longum phylotype, 6 strains to the B. adolescentis species, and 6 strains to the B. bifidum species.

At the second stage, B.longum strain identification was performed. Based on the composition of the genes of the relBE system among 23 strains of B. longum, no identical ones were found, i.e. this approach allows the identification of strain specificity.

Claims (1)

Method of species and strain identification of bifidobacteria of the Bifidobacterium longum phylotype, characterized in that it is based on the combination and polymorphism of genes of the toxin-antitoxin of the Re1BE superfamily and is characterized in that amplification with genomic DNA is carried out using a set of species- and strain-specific oligonucleotides, PCR analysis agarose gel, and the size of the obtained fragment is determined using a DNA marker, species identification is carried out using specific oligonucleotides, and s strains belong to the species B. longum in the case of use of the target fragment of 275 bp .; strain identification is carried out using the oligonucleotides shown in table 2, the studied strain is recognized as identical to the strain B. longum subsp. infantis ATCC 15697 in the case of the production of fragments using the oligonucleotides ReB1N-ReB1C, ReB2N-ReB2C and ReB3.1N-ReB3.2C; the test strain is recognized as identical to the strain B. longum subsp. infantis ATCC 55813 in the case of fragment production using the ReB3.1N-ReB3.1C and ReB9.1N-ReB9.1C oligonucleotides; the test strain is recognized as identical to B. longum subsp. infantis CCUG 52486 in the case of fragment production using the ReB3.1N-ReB3.1C, ReB3.4N-ReB3.4C and ReB9.1N-ReB9.2C oligonucleotides; the studied strain is recognized identical to strain B. longum DJO10A in the case of producing fragments using oligonucleotides ReB3.1N-ReB3.1C; the test strain is recognized as identical to the strain of Bifidobacterium sp. (B. longum) 12_1_47BFAA in the case of the production of fragments using the oligonucleotides ReB3.1N-ReB3.1C and ReB4N-ReB4C; the test strain is recognized as identical to B. longum subsp. longum F8 in the case of producing fragments using oligonucleotides ReB2N-ReB2C and ReB3.3N-ReBC; the studied strain is recognized identical to B. longum strain NCC2705 in the case of producing fragments using oligonucleotides ReB3.1N-ReB3.2C; the test strain is recognized as identical to B. longum subsp. longum JDM301 in the case of fragment production using the ReB8N-ReB8C, ReB2N-ReB2C and ReB3.1N-ReB3.1C oligonucleotides; the test strain is recognized as identical to B. longum subsp. longum BBMN68 in the case of the production of fragments using oligonucleotides ReB3.1N-ReB3.1C and ReB3.4N-ReB3.4C; the test strain is recognized as identical to B. longum subsp. infantis 157F in the case of producing fragments only when using the oligonucleotides ReB3.1N-ReB3.1C, ReB4N-ReB4C and ReB5N-ReB5C; the test strain is recognized as identical to B. longum subsp. longum JCM 1217 in the case of the production of fragments using the oligonucleotides ReB3.1N-ReB3.1C and ReB3.5N-ReB3.4C; the test strain is recognized as identical to B. longum subsp. longum CASS 91563 in the case of the production of fragments using oligonucleotides ReB10N-ReB10C and ReB3.1N-ReB3.4C.

Images