RU2522479C1 - APPLICATION YEAST STRAIN Komagataella pastoris AS RECIPIENT FOR CONSTRUCTION OF PRODUCERS OF TARGET PROTEIN - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: application of yeast strain Komagataella pastoris RNCIM Y-727 as the recipient to construction of producers of target protein is characterised, optionally comprising introduction of mutations into it, providing the use of auxotrophic selective markers.

EFFECT: solution can be applied in preparation of recombinant proteins without the use of methanol as inductor of gene expression.

8 dwg, 4 tbl, 10 ex

Description

The use of the yeast strain Komagataella pastoris as a recipient for the construction of producers of the target protein

The invention relates to biotechnology and the microbiological industry, in particular to the production of Komagataella pastoris strain of methylotrophic yeast, suitable for the construction of producer strains based on it, capable of synthesizing the target protein.

Currently, many substances used in the pharmaceutical industry are obtained by microbiological synthesis.

The expression system requires the following system: an approved single-celled or multicellular recipient organism suitable for transformation with a vector including a DNA sequence encoding a target protein and a transformation vector with all necessary elements (selective markers, promoters, terminators, etc.) .d.). Currently used expression systems can be divided into prokaryotic (bacterial) and eukaryotic, which are cells of yeast, mycelium fungi, insects and mammals.

Each of the systems has its own technological and economic advantages and disadvantages. The use of bacterial expression systems, for example, the expression system most often used in biotechnology using the recombinant bacterial strain of E. coli as the target protein producer, limits the spectrum of proteins produced due to the inability to reproduce all post-translational modifications characteristic of eukaryotes, such as glycosylation, phosphorylation the formation of disulfide bonds between cysteine residues, cis / trans isomerization of proline, etc. [one]. Also, when using E.coli bacteria as a producer of the target protein, they often face difficulties associated with refolding (due to improper folding in the cytoplasm of the cell and the formation of insoluble inclusion bodies), which makes it impossible to use E.coli for the biosynthesis of many proteins [1] . The non-glycosylated erythropoietin synthesized by E. coli cells (glycoprotein, a hemapoiesis stimulant), the stability and activity of which directly depends on glycosylation, has significantly lower stability compared to erythropoietin secreted by O- / N-glycosylated mammalian cells [2].

The use of mammalian cells for secretion of the target proteins, providing all the necessary post-translational modifications, leads to an increase in the cost of production due to the need to use complex and expensive equipment and culture media for their cultivation [3]. The use of yeast as a producer of target recombinant proteins is a compromise and, in some cases, the most optimal solution. Yeasts are representatives of eukaryotes and are capable of all of the above post-translational modifications characteristic of eukaryotic cells, including the secretion of proteins in the culture medium. Isolation and purification of the target recombinant product is significantly facilitated due to the fact that the amount of endogenous secreted yeast proteins is relatively small [3].

Interest in the production of recombinant proteins using expression systems based on methylotrophic yeast, in particular, of the genus Pichia, Komagataella, or Hansenula [6] is based on a number of advantages of these systems both from a scientific and a technological point of view.

The culture of methylotrophic yeast is grown in fermenters to higher densities compared to the traditionally used Saccharomyces cerevisiae yeast, which allows to obtain a higher level of production of the target protein [5]. Methylotrophic yeast has some of the most powerful promoters in nature. They are also distinguished by an alternative mechanism of protein glycosylation, which allows the synthesis of a low immunogenic target protein.

The most commonly used promoters for regulating the expression of heterologous genes are AOX1 (alcohol oxidase promoter), GAP (glyceraldehyde 3-phosphate dehydrogenase promoter), FLD (formaldehyde dehydrogenase promoter), FDH (dehydrogenase formate promoter), DHAS (dihydroxy 9 synacetone). The AOX1, FLD, and FDH promoters are known to be induced in response to the presence of methanol or oleate in the culture medium. When the culture grows on a glycerol- or glucose-containing medium, the listed promoters are repressed [11]. When the main carbon source is depleted, the AOX1 promoter is in a de-repressed state, while its activity is 1-2% of the activity in the induced state [12]. GAP is considered a constitutive promoter, i.e. induced by the growth of culture on many substrates, including glycerin, glucose.

A significant advantage of methylotrophic yeast is the level and quality of N-glycosylation of proteins. So, in P. pastoris cells, the size of the carbohydrate chains is on average 8-12 mannose residues, and the terminal residue is a low immunogenic α-1,2 mannose residue, whereas saccharomycetes usually secrete a much more heavily glycosylated protein containing up to 100-150 residues per one chain, with a terminal residue of which is a highly immunogenic α-1,3 mannose residue.

Using expression systems on various methylotrophic yeasts, many substances were obtained for the pharmaceutical industry: hepatitis B surface antigen (substance for vaccine), antistatin, epidermal growth factor, hirudin, α1-urokinase, endothelial growth factor, etc. [3]. The first approved product was registered with the FDA in December 2009.

As the closest analogue of the claimed invention, consider a strain of methylotrophic yeast Komagataella pfaffii NRRL Y-48124. Strain GS115 (phenotype his ^- ; Invitrogen, USA), which is its derivative, is widely used as an expression system in biotechnology [4]. An expression system based on this strain allows one to obtain target proteins with a high yield when using the methanol-induced alcohol oxidase promoter AOX1, the attractiveness of which lies not only in its activity, but also in its strict regulation [12]. Unlike some strong S. cerevisiae promoters, which have a basal expression level on repressive substrates, the AOX1 promoter is completely repressed upon growth on media containing repressive substrates such as glucose or glycerol or ethanol [12]. Strict regulation of the promoter is an important factor in the expression of target genes encoding cell toxic proteins.

Using strain GS115, such products as granulocyte-colony stimulating factor in an amount of up to 131 mg per 1 liter of culture fluid [6] and recombinant hepsidin in an amount of up to 100 mg per 1 liter of culture fluid [7] were obtained. The disadvantage of this strain is the ability to express the target protein gene under the control of the AOX1 promoter only in the presence of a methanol inducer, which is a toxic and flammable substance [21], [22].

Sanitary and hygienic requirements for the organization and conduct of work with methanol impose serious restrictions on the use of this substance in biotechnological production [16]. In this regard, it seems important to find a solution that, on the one hand, would allow the use of methylotrophic yeast for the production of the target protein; on the other hand, it would allow not using methanol as an inducer for gene expression of this protein.

The task of the invention is to expand the arsenal of methylotrophic yeast, suitable for the construction on their basis of producer strains capable of expressing the target protein.

The problem was solved by using the Komagataella pastoris VKPM Y-727 yeast strain as a recipient for constructing producer strains based on it, capable of expressing the target protein, both in the presence of the methanol inducer and in its absence.

Obtaining and taxonomic characteristics of the strain K. pastoris VKPM Y-727

A strain meeting the above requirements was found by screening in the All-Russian Collection of Industrial Microorganisms (VKPM). The belonging of the strain K. pastoris VKPM Y-727 to methylotrophic yeast of the genus Komagataella was confirmed by growth tests on the corresponding substrates - methanol, glycerin, oleate, etc. In addition to growth tests, a molecular genetic comparison was performed for the following markers: nucleotide sequence of domain D1 / D2 26S subunit of ribosomal RNA, nucleotide sequence of the alcohol oxidase gene promoter (AOX1). Comparison with the corresponding nucleotide sequences of the strain K. pfaffii (NRRL Y-48124) and its derivative GS115 (Invitrogen, USA) showed a 98% homology.

Morphological features:

When cultivated at a temperature of 28 ° C for 48 hours on an agarized YPD medium of the following composition (wt.%): Peptone - 2, yeast extract - 1, glucose - 2, agar - 2, water - the rest, the cells are oval, 3 -4 microns in diameter. Cells are budded. The budding is true, many-sided. True mycelium is not formed.

Colonies are as follows:

1) on an agarized YPD medium, colonies of light beige with a smooth edge, matte surface, lenticular profile and pasty consistency;

Growth in a liquid medium YPD composition (wt.%): Peptone - 2, yeast extract - 1, glucose - 2, water - the rest, at 28 ° C for 24 hours of cultivation, the liquid is cloudy, the precipitate is white, coagulation is not observed, parietal does not form films.

Physiological and biochemical signs: optional anaerobic. The growth temperature is 20-33 ° C (optimum is 28 ° C). The pH of the culture medium is 4.8-7.4 (optimum is 6.0).

Assimilation of carbon sources: utilizes glucose, glycerin, methanol, oleate, sorbitol, rhamnose. It does not utilize galactose, xylose, arabinose.

Assimilation of nitrogen sources: utilizes amino acids, ammonium sulfate, ammonium nitrate.

Storage: at a temperature of -70 ° C in a 30% aqueous solution of glycerol. Storage on an agarized YPD medium is possible for 3 months at + 4 ° C.

Regulatory elements

The following sequences of the genome of the strain K. pastoris are sequenced. VKPM Y-727:

Alcohol oxidase promoter AOX1 strain K.pastoris. VKPM Y-727 [SEQ ID N1] differs from the promoter of the strain, the closest analogue, by the following nucleotide substitutions: G-> A at position 5, C-> A at position 9, T-> A at position 11, A-> G at position 98, G-> A at position 131, deletion G at position 132-133, deletion C at position 170-171, C-> T at position 201, G-> A at position 206, deletion of SS at position 311-312, T-> A at position 354, A-> G at position 380, GA at position 482, C-> T at position 568, T-> A at position 582, A-> T at position 611.

The promoter glyceraldehyde phosphate dehydrogenase GAP strain K. pastoris. VKPM Y-727 [SEQ ID N2] differs from the promoter of the strain, the closest analogue, by the following nucleotide substitutions: G-> A at position 61, C-> T at position 86, A-> C at position 180, C-> T at position 201, T-> C at position 202, A at position 209, AG at position 211, T-> C at position 240, deletion of CT at position 243-244, A-> G at position 275, G-> A at position 413, T -> C at position 450.

The invention is illustrated by the following figures.

Figure 1 Electrophoregram of cell lysates of the strain K. pastoris VKPM Y-727 and K.pfaffii GS115

 The arrows indicate the signal to which the alcohol oxidase enzyme corresponds.

Lanes No. 1-7 correspond

1. Molecular marker, 70 kDa

2. YPD medium, strain K. pastoris. VKPM Y-727

3. YPD medium, strain K.pfaffii GS115

4. YPM medium, strain K. pastoris VKPM Y-727

5. YPM medium, strain K.pfaffii GS115

6. Medium YP, strain K. pastoris. VKPM Y-727

7. YP medium, strain K.pfaffii GS115

Figure 2 The level of activity of beta-galactosidase produced by cells of the strain K. pastoris. VKPM Y-727 and strain K.pfaffii GS115

The diagram shows measurements of beta-galactosidase activity during crop growth on three different media: YP (simulating depletion of a carbon source), YPM (containing methanol as an inductor and carbon source), YPD (containing glucose as a carbon source, which is a repressor of the AOX promoter) .

The vertical axis is the activity scale in Miller units [Rose, Botstein et al.].

The dark columns correspond to the enzyme activity in the cell lysate of the K.pastoris strain VKPM Y-727, the light columns correspond to the enzyme activity in the cell lysate of the K.pfaffii GS115 strain.

The bar plots show the standard deviation according to the results of measuring activity in two clones.

Figure 3 Map of plasmid 81-29. Linearized Transformation Fragment

HIS4-5 '- 5'-region of the HIS4 gene

HIS4-3 '- 3'-region of the HIS4 gene

URA3-pich - URA3 gene

ORI - bacterial replicon

AP ^R - beta-lactamase gene

MluI, BamHI - restriction sites of the corresponding restriction enzymes

Tu6-fragm - elements cloned from the Tu6 region of the Tu1 retrotransposon

Figure 4 Map of plasmid 85-011. Linearized Transformation Fragment

ARG4-5 '- 5'-region of the ARG4 gene

ARG4-3 '- 3'-region of the ARG4 gene

URA3-pich - URA3 gene

Prom - regulatory element of the URA3 gene

ORI - bacterial replicon

AP ^R - beta-lactamase gene

MluI, BamHI - restriction sites of the corresponding restriction enzymes

Figure 5 Map of plasmid 86-011. Linearized Transformation Fragment

ADE2-5 '- 5'-region of the ADE2 gene

ADE2-3 '- 3'-region of the ADE2 gene

URA3-pich - URA3 gene

Prom - regulatory element of the URA3 gene

ORI - bacterial replicon

AP ^R - beta-lactamase gene

MluI, BamHI - restriction sites of the corresponding restriction enzymes

Figa

Serum Albumin Production (HSA) normalized to culture fluid volume

The vertical axis shows the amount of HSA in mg per 1 liter of culture fluid.

The dark column corresponds to the amount of HSA in the culture fluid of K. pastoris strain VKPM Y-727. The light column corresponds to the amount of HSA in the culture fluid of the K.pfaffii GS115 strain. The bars display the standard deviation for the measurements of two clones.

FIG.6b

Serum Albumin Production (HSA) normalized to optical density unit

The vertical axis shows the amount of HSA in mg per unit optical density of the culture (OD = 1 at λ = 600 nm).

The dark column corresponds to the amount of HSA in the culture fluid of K. pastoris strain VKPM Y-727. The light column corresponds to the amount of HSA in the culture fluid of the K.pfaffii GS115 strain. The bars display the standard deviation for the measurements of two clones.

Figa

The activity of inulase produced by the compared strains under the control of the GAP promoter

The vertical axis shows the activity of inulase in units of activity per 1 ml of culture fluid per unit optical density of the culture (OD = 1 at λ = 600 nm).

The dark column corresponds to the activity of inulase in the culture fluid of the strain K.pastoris VKPM Y-727. The light column corresponds to the activity of inulase in the culture fluid of the strain K.pfaffii GS115. The bars display the standard deviation for the measurements of two clones.

Figb

The activity of inulase produced by the compared strains under the control of the AOX1 promoter

The vertical axis shows the activity of inulase in units of activity per 1 ml of culture fluid per unit optical density of the culture (OD = 1 at λ = 600 nm).

The dark column corresponds to the activity of inulase in the culture fluid of the strain K. pastoris VKPM Y-727. The light column corresponds to the activity of inulase in the culture fluid of the strain K.pfaffii GS115. The bars display the standard deviation for the measurements of two clones.

Fig. 8

Hepatitis B Surface Antigen Production (HBsAg)

The vertical axis shows the amount of HBsAg in μg per 100 units of optical density of the culture (at λ = 600 nm).

The dark column corresponds to the amount of HBsAg in the lysate of the cells of the strain K. pastoris VKPM Y-727. The light column corresponds to the amount of HBsAg in the lysate of cells of the strain K.pfaffii GS115. The bars display the standard deviation for the measurements of two clones.

Example 1. Confirmation of auto-induction of the promoter AOX1 strain K. pastoris VKPM Y-727

To confirm the induction of the AOX1 promoter in the K.pastoris VKPM Y-727 strain without using methanol, under the conditions of depletion of the carbon substrate, an experiment was conducted; As a control strain, K.pfaffii GS115 strain was used.

The analyzed strains were inoculated into test tubes with a medium of three types of YPD - with a repressing AOX1 promoter carbon source - glucose, YPM of the following composition (wt.%) (Peptone - 2, yeast extract - 1, methanol - 0.5, water - the rest) - s AOX1-inducing carbon source - methanol, YP (wt.%) (peptone - 2, yeast extract - 1, water - the rest) - without a carbon source. In the logarithmic growth phase, cell culture lysate samples from each tube were analyzed by electrophoresis under denaturing reducing conditions in a 12% polyacrylamide gel [Laemmli., 1970]. The result is presented on an electrophoregram (figure 1).

From the data presented on the electrophoregram, the signal intensity at the level of 70 kDa, which corresponds to the molecular weight of alcohol oxidase [13], can be used to judge the activity of the alcohol oxidase promoter under appropriate cell culture conditions. Figure 1 shows that the AOX1 gene is not expressed when growing on a medium with glucose (lanes No. 2, 3), and is expressed when growing on a medium with methanol in both strains (tracks No. 4, 5), and is also expressed in strain K .pastoris VKPM Y-727 upon growth on YP medium, i.e. in the absence of a carbon substrate. In the latter case, the expression level is 60-70% of the expression level on a medium with methanol (in the induced state), which confirms the activation of the AOX1 promoter in the K. pastoris VKPM Y-727 strain under growth conditions that mimic the depletion of the carbon substrate without using methanol .

Example 2. Comparison of the strength of promoters AOX1 from the strain K. pastoris VKPM Y-727 and from the control strain K.pfaffii GS115

Each of the AOX1 promoters from K. pastoris VKPM Y-727 and K.pfaffii GS115 strains was independently cloned into a plasmid containing the Lac-Z (beta-galactosidase) gene to evaluate the strength of the AOX1 promoter of each of the analyzed strains based on the activity produced by the constructed beta-galactosidase enzyme strains.

To this end, strains of K. pastoris Y-727 / pINT-G418-AOX1 _Y727- LacZ and K.pfaffii GS115 / pINT-G418-AOX1 _GS115- LacZ, beta-galactosidase producers, were constructed.

Construction of plasmids

Two plasmids were constructed: the plasmid pINT-G418-AOX1 _Y727- LacZ, intended for integration into the genome of the strain K. pastoris VKPM Y-727, and the plasmid pINT-G418-AOX1 _GS115- LacZ, designed for integration into the genome of the strain K.pfaffii GS115. Both plasmids contain the elements necessary for their amplification in E. coli cells: beta-lactamase gene (as a selective marker), bacterial replicon to ensure maintenance of a certain level of plasmid copy number. For the subsequent transformation of yeast cells and expression of the target Lac-Z gene (beta-galactosidase), the vectors contain the following elements: neo gene - aminoglycoside 3'-phosphotransferase, antibiotic resistance gene G418 and kanamycin [18], which is controlled by the ADH1 promoter - as a selective marker (the ADH1 promoter was obtained by PCR, the genomic DNA of the strain S. cerevisiae YBS618, primers prADH1-5'-aaagatctccatccttttgttgtttcc, prADH1-3'-cttgattgtatatgagata were used as a template); the Lac-Z gene [17], which is controlled by the AOX1 ₇₂₇ promoter (for strain Y727) or AOX _GS115 (strain GS115), cloned from the K. pastoris strain VKPM Y-727, or from the K.pfaffii GS115 strain, respectively, the AOX1 terminator . The promoter AOX1 ₇₂₇ and AOX _GS115 were obtained by PCR; the genomic DNA of the strain K. pastoris VKPM Y-727 or K.pfaffii GS115, respectively, was used as a template. Primers pr1_AOX1 (5'-ttcgtcgactaacatccaaagaggaaaggtt), pr2_AOX1 (5'-aaggtaccagatctagccatggtttggatccttcgaataattagttgttttttgatcttctcaa). The AOX1 terminator was obtained by PCR; the genomic DNA of the strain K. pastoris VKPM Y-727 or K.pfaffii GS115, respectively, prAOXter-5 'aatctcgaggattccagaatgccatttgcct, prAOXter3' gttgacgcgtgcacaacgg, were used as a template. The integrable part of the plasmid is flanked by regions for insertion into a specific locus of the genome — the endogenous promoter AOX1. To obtain linearized portions of plasmids intended for the transformation process, the original plasmids pINT-C418-AOX1 _Y727- LacZ and pINT-G418-AOX1 _GS115 -LacZ _were digested with MluI restriction endonuclease (Thermo Fisher Scientific Inc.).

Transformation and cultivation

As a result of the transformation process according to the standard protocol [16] and the selection of transformants, 2 strains of beta-galactosidase producer were obtained: K. pastoris Y-727 / pINT-G418-AOX1 _Y727- LacZ and control K.pfaffii GS115 / pINT-G418-AOX1 _GS115 -LacZ, in which the Lac-Z (beta-galactosidase) gene is under the control of AOX1 promoters cloned from the respective compared strains. Then 2 clones of each strain were selected. The inoculum of the analyzed clones was placed in test tubes with 5 ml of medium of three types of YPD with a repressing AOX1 carbon source - glucose, YPM - with an AOX1-inducing carbon source - methanol, YP - without a carbon source. The culture was grown in a rotary shaker-thermostat (250 rpm), at a temperature of 28 ° C. After 14 hours, the cells were separated by centrifugation in a benchtop centrifuge, at 3000 g, and destroyed using glass beads to obtain a cell lysate [Miller et al.].

Beta-Galactosidase Activity Assessment

Assessment of the level of activity of beta-galactosidase contained in the cell lysate of the analyzed strains was carried out by a known method [Rose, Botstein et al.]. From the data shown in table 1 and figure 2, it is seen that the activity of beta-galactosidase from the cell lysate of the culture of the strain K. pastoris Y-727 / pINT-G418-AOX1 _Y727- LacZ grown on YP medium (without carbon substrate and inductor methanol), accounts for about 70% of the activity of beta-galactosidase from a lysate of the same culture grown on YPM medium (containing methanol). This allows us to conclude that the AOX1 promoter in K. pastoris Y-727 cells is activated both in the presence and absence of a methanol inducer, in contrast to the expression system of the control strain, the closest analogue of K.pfaffii GS115. The level of synthesis of beta-galactosidase in both strains in the presence of methanol differs slightly in favor of the K.pastoris VKPM Y-727 strain.

Table 1 Beta-Galactosidase Activity (M.E.) Strain / Medium Yp Ypm Ypd K. pastoris Y-727 / pINT-G418-AOX1 _Y727- LacZ 1784.0 2668,0 0,0 1613.0 2124.0 0,0 Average 1698.5 2396.0 0,0 Wed sq. off 120.9 284.7 0,0 K.pfaffii GS115 / pINT-G418-AOX1 _GS115- LacZ 621.0 2205.0 0,0 988.0 2541.0 0,0 Average 804.5 2373.0 0,0 Wed sq. off 259.5 237.6 0,0

Example 3. Obtaining strain K. pastoris Y727ura3 ^mut

Construction of plasmids pURA3del

The vector contains the elements necessary for its amplification in E. coli cells: the beta-lactamase gene (as a selective marker), a bacterial replicon to ensure maintenance of a certain level of plasmid copy number. The URA3 gene was obtained by PCR using the genomic DNA of this strain as a template, and primers pr1_URA3 (5'-gataacgcgtttgacgaattgactaaagttct), pr2_URA3 (5'-gataacgcgtttgacgaattgactaaagttct). The gene obtained by PCR was cloned into a plasmid. Further, the reading frame of the URA3 gene was artificially violated in the obtained plasmid. After treatment of the plasmid with the restriction enzyme MluI, a fragment containing the flanks of the URA3 gene was obtained, so that when this fragment was integrated into the genome of the transformable strain, the native URA3 gene was inactivated, which led to the mutation of the strain by uracil synthesis.

Transformation and selection of transformants

The original K. pastoris strain VKPM Y-727 was transformed with the obtained fragment of plasmid pURA3del to obtain mutant clones for the URA3 gene encoding orotidine-5-phosphate decarboxylase, an enzyme involved in the de novo synthesis of pyrimidine bases. Mutant clones were selected on selective YPD plates containing 5-fluorotididic acid (5'-FOA) at a concentration of 500 μg / ml agar medium. As a result of selection, 5 clones were selected that possessed the ability to grow in the presence of a given concentration of 5-fluororotidic acid. The growth ability in the presence of this substrate is associated with a probable mutation in the URA3 gene, the product of which is orotidine-5-phosphate decarboxylase, is not active and does not cleave the substrate (5'-FOA) with the release of fluorine toxic to cells. The obtained mutants possessed the ura ^- phenotype. The selected clones were tested for growth ability on a minimal agarized YNB medium of the composition (wt.%) (0.17 yeast nitrogen base (Difco), 0.5 ammonium sulfate, 0.4 glucose, 2 agarose, the rest is water) with the addition of uracil at a concentration of 50 μg / ml of medium. According to all morphological characteristics, the obtained mutants did not differ from the clones of the original strain.

Example 4. Obtaining strain K. pastoris Y-727ura3 ^mut his4Δ

Construction of plasmids 81-29

Vector 81-29 contains the elements necessary for its amplification in E. coli cells: the beta-lactamase gene (as a selective marker), a bacterial replicon to ensure maintenance of a certain level of plasmid copy number. The HIS4 gene was amplified by PCR. As the matrix used genomic DNA from a strain of K. pastoris VKPM Y-727, primers: pr1_HIS4 (5'-ttcactcgtggatctataattgaacatgacatttcccttgctacct); pr2_HIS4 (5'-agatgccggttagatctatcgaat). The gene obtained by PCR was cloned into the original plasmid. The URA3 gene was obtained by PCR using the genomic DNA of this strain as a template, and primers pr1_URA3 (5'-gataacgcgtttgacgaattgactaaagttct), pr2_URA3 (5'-gataacgcgtttgacgaattgactaaagttct). The expression of the plasmid cloned URA3 gene is controlled by the endogenous URA3 promoter. The URA3 gene with the promoter is flanked by sequences from the region encoding the TuA protein of the Tu-1 retrotransposon cloned from S. cerevisiae yeast [19]. The resulting construct was inserted into the middle of the HIS4 gene (already cloned into the plasmid), so that it was surrounded by 5 'and 3' regions of the HIS4 gene. This design directs integration into the HIS4 locus, after processing the plasmid with restriction endonucleases MluI, BamHI (Thermo Fisher Scientific Inc.) see (Figure 2). Thus, during the transformation of the auxotrophic strain K. pastoris Y-727ura3 ^{mut with a} linearized fragment of vector 81-29, as a result of homologous recombination between the endogenous HIS4 locus and this fragment flanked by the 5 ′ and 3 ′ regions of the HIS4 gene, the linearized plasmid fragment is inserted with the replacement of the native HIS4 gene.

The result was a linearized fragment of vector 81-29 containing the URA3 gene flanked by sequences from the Tu1 retrotransposon, which in turn are flanked by the 5 'and 3' regions of the HIS4 gene cloned from the K. pastoris strain VKPM Y-727. The use of regions from the Tu1 retrotransposon ensures cleavage of the nucleotide sequence enclosed between them, which will be used after transformation.

Transformation of the strain K. pastoris Y-727ura3 ^mut

The obtained auxotrophic strain K. pastoris Y727ura3 ^mut (Example 3) was transformed with a linearized fragment of vector 81-29. As a result of homologous recombination during transformation, a deletion of the HIS4 gene occurs. The genomes of the obtained transformants contain a fragment of the vector 81-29 with the URA3 gene, instead of the substituted HIS4 gene. Transformants were selected on plates with minimal agarized YNB medium with histidine at a concentration of 50 μg / ml medium. Several selected transformants were inoculated in 5 ml of rich YPD medium. The culture grew for 24 hours, after which this culture was used as an inoculum for new seeding in YPD medium. After three passages, part of the cells was separated by centrifugation for plating on plates with agarized YPD medium containing 5-fluorotoric acid at a concentration of 500 μg / ml of medium to select those clones that had homologous recombination between Tu6 fragments that were integrated into the HIS4 locus, leading to gene delegation URA3, enclosed between fragments of Tu6 (Figure 3). As a result of recombination, a clone with the phenotype his ^- ura ^{- was} selected, incapable of growth on a medium without histidine and uracil. The ability of this clone to grow on minimal agarized YNB medium containing uracil at a concentration of 50 μg / ml of medium and histidine at a concentration of 50 μg / ml was confirmed.

One of these clones is designated as a strain of K. pastoris Y727ura3 ^mut his4Δ. The obtained histidine and uracil auxotrophic strain was used for transformation with vectors containing selective markers URA3 and HIS4, followed by selection of transformants on the corresponding selective media.

Example 5. Obtaining strain K. pastoris Y-727his4Δ

The obtained auxotrophic strain K. pastoris s Y-727ura3 ^mut his4Δ (Example 4) was transformed with a PCR product containing the URA3 gene. Primers Pr1_URA3 (5'-gataacgcgtttgacgaattgactaaagttct) and Pr2_URA3 (5'-atttacgcgtactccttgagtctggtcaaa) were used for PCR. Genomic DNA from the K. pastoris VKPM Y-727 strain was used as a template for PCR. Transformants were selected on YNB agar medium with histidine at a concentration of 50 μg / ml medium. As a result of transformation, clones with the his ^- phenotype were obtained. Selected transformants were tested for growth ability on minimal YNB medium supplemented with histidine at a concentration of 50 μg / ml medium.

The result is a strain of K. pastoris Y-727his4Δ. The obtained histidine auxotrophic strain was used for transformation with vectors containing the HIS4 selective marker, followed by selection of transformants on the appropriate selective medium.

Example 6. Obtaining strain K. pastoris Y-727arg4Δhis4Δ

Construction of plasmid 85-011

Vector 85-011 contains the elements necessary for its amplification in E. coli cells: the beta-lactamase gene (as a selective marker), a bacterial replicon to ensure maintenance of a certain level of plasmid copy number. This vector contains the URA3 gene, which is controlled by the native promoter, and flanked by the 5 'and 3' regions of the ARG4 gene, used to direct the integration of this fragment directly into the ARG4 locus. 5 'and 3' regions of the ARG4 gene were obtained by PCR. As the matrix used the genomic DNA of the strain K.pastoris VKPM Y-727, primers:

pr1_ARG4 (5'-tctaacgcgtgtcgactaggtgttttaccctgattaga),

pr2_ARG4 (5'-ggatcctatctccagagtccggagatgctagcactaagatagctggtaataagtttaga),

pr3_ARG4 (5'-tagtgctagcatctccggactcgagataggatccatccattgactcccgttttga),

pr4_ARG4 (5'-gataacgcgtagatctcaattgtatgtactataacagttt).

Transformation and selection of transformants

Strain K. pastoris Y727ura3 ^mut his4Δ (Example 4) was transformed with a linearized fragment of vector 85-011 (Figure 4). The fragment was obtained by processing the vector 85-011 with the restriction endonuclease MluI (Figure 4). As a result of homologous recombination during transformation, the fragment of vector 85-011 is inserted into the ARG4 locus with the replacement of the ARG4 gene (arginine succinate lyase), transformants have the ura ⁺ his ^- arg ^- phenotype. Transformants were selected on a minimal agarized YNB medium containing histidine at a concentration of 50 μg / ml and arginine at a concentration of 50 μg / ml of medium. Selected transformants possessed the phenotype arg ^- his ^- .

The obtained histidine and arginine auxotrophic strain K. pastoris Y-727arg4Δhis4Δ is suitable for producing producers by transformation with vectors containing the selective marker HIS4 or ARG4.

Example 7. Obtaining strain D. pastoris Y-727ade2Δhis4Δ

Construction of plasmid 86-011

Vector 86-011 contains the elements necessary for its amplification in E. coli cells: the beta-lactamase gene (as a selective marker), a bacterial replicon to ensure maintenance of a certain level of plasmid copy number. This vector contains the URA3 gene, which is under the control of the native promoter - flanked by 5 'and 3' regions of the ADE2 gene (phosphoribosylaminoimidazole carboxylase enzyme), used to direct the integration of this fragment directly into the ADE2 locus. 5 'and 3' regions of the ADE2 gene were obtained by PCR. We used as a template the genomic DNA of the strain Komagataella pastoris Y727, primers: pr1_ADE2 (5'-tactaacgcgtgtcgacgaaagtaggcaaattagtttgt), pr2_ADE2 (5'-ctcgagtatggatcctccggagatcccgggacatgtgagctttgaaaatatctaatcgt), pr3_ADE2 (5'-acatgtcccgggatctccggaggatccatactcgagtcatcggtgttcctgtcaag), pr4_ADE2 (5'-agtaacgcgtagatcttgaaatagaaatatgattagaaaaaa).

The strain K. pastoris Y-727ura3 ^mut his4Δ (Example 4) was transformed with a linearized fragment of vector 86-011 (Figure 5), which was obtained by processing vector 86-011 with the restriction endonuclease MluI (Figure 5). As a result of homologous recombination after transformation, a fragment of vector 86-011 is inserted into the ADE2 locus with the replacement of the ADE2 gene (phosphoribosylaminoimidazole carboxylase), and the obtained transformants have the ura ⁺ his ^- ade ^- phenotype. Transformants were selected on minimal agarized YNN medium containing histidine at a concentration of 50 μg / ml and adenine at a concentration of 50 μg / ml of medium. Selected transformants possessed the ade ^- his ^- phenotype. The obtained histidine and adenine auxotrophic strain was used for transformation with vectors containing a selective marker HIS4 or ADE2, followed by selection of transformants on an appropriate selective medium.

The obtained histodine and adenine auxotrophic strain K. pastoris Y-727arg4Δhis4Δ is suitable for producing producers by transformation with vectors containing the selective marker HIS4 or ADE2.

Example 8. Obtaining strain K. pastoris Y727his4Δ / pPH93-AOX1 _Y727 -HSA - producer of human serum albumin

Construction of plasmids

The expression integration vector rRH93-AOX1 _Y727- HSA contains the elements necessary for its amplification in E. coli cells: the beta-lactamase gene (as a selective marker), a bacterial replicon to ensure maintenance of a certain level of plasmid copy number. For transformation of yeast cells and expression of the target gene, the vector contains the following elements: HIS4 gene - histidinol dehydrogenase cloned from K. pastoris VKPM Y-727 as a selective marker, target protein gene - albumin (HSA) [SEQ ID N3], located under the control of the promoter AOX1 _Y727 [SEQ ID N1], cloned from K. pastoris VKPM Y-727, the terminator AOX1, cloned from K. pastoris VKPM Y-727. The integrable part of the plasmid is flanked by regions for insertion into a specific locus of the genome — the endogenous promoter AOX1. To obtain the linearized portion of the plasmid designed for transformation of the yeast K.pastoris VKPM Y-727, the original plasmid pRH93-AOX1 _Y727- HSA is treated with the restriction endonuclease MluI.

The expression integrative vector rRH93-AOX1 _GS115- HSA contains the same elements as pPH93-AOX1 _Y727 -HSA, with the exception of the HIS4 gene, histidinol dehydrogenase, cloned from K.pfaffii GS115 (the genomic DNA of the strain K.pfaffii was used as a template for PCR GS115, primers pr1_HIS4, pr2_HIS4), and the promoter AOX1 _GS115 , also cloned from K.pfaffii GS115. To obtain the linearized portion of the plasmid intended for transformation of K.pfaffii GS115 yeast, the original plasmid pPH93-AOX1 _GS115- HSA was treated with the restriction endonuclease MluI.

Transformation

Obtaining producers of secreted into the culture medium protein (human serum albumin, HSA) using strain K. pastoris VKPM Y-727 and as a control strain K.pfaffii GS115. As recipient strains, the strain K. pastoris Y-727his4Δ and the strain K.pfaffii GS115 are used. As a result of the transformation of these strains by linearized fragments of plasmids pRH93-AOX1 _Y727 -HSA and pPH93-AOX1 _GS115 -HSA, respectively, followed by selection of transformants on selective agarized YNB medium without amino acids and ammonium sulfate, strains producing recombinant serum albumin are obtained.

As a result, the following strains of serum albumin producers were obtained:

K. pastoris Y727his4Δ / pPH93-AOX1 _Y727 -HSA

K.pfaffii GS115 / pPH93-AOX1 _GS115 -HSA

Cultivation

For the experiment, 2 clones of each strain were selected. The inoculum of the analyzed clones was placed in test tubes with 5 ml of YPgM medium, the following composition (wt.%): Peptone - 2, yeast extract - 1, glycerin 0.5, methanol - 0.5, water - the rest. The culture was grown for 62 hours in a rotary shaker-thermostat (250 rpm), at a temperature of 28 ° C. Every 24 hours, methanol was induced by aseptically adding 50% methanol solution to the tubes to a final concentration of 0.5%. After 62 hours, the biomass was separated by centrifugation in a benchtop centrifuge, at 3000 g.

The concentration of albumin in the culture fluid was measured by enzyme-linked immunosorbent assay on a solid support. As the substrate used a standard plate for enzyme immunoassay with pre-sorbed human polyclonal antibodies to HSA. These antibodies, conjugate - human polyclonal anti-HSA antibodies labeled with horseradish peroxidase, calibration standard, as well as TMB chromogen (3.3 ', 5.5'-tetramethylbenzidine) were included in the Albumin, Human, BioAssay ELISA Kit (manufactured by United States Biological, USA). The analysis was carried out according to the protocol described in the instructions for the set.

The yield of the target protein was 41.12 (+/- 0.8) mg / l of culture fluid or 1.93 (+/- 0.2) mg per 1 optical unit) for strain K. pastoris Y-727his4Δ and 41.19 (+/- 1.4) mg / L of culture fluid or 1.38 (+/- 0.1) mg per 1 optical unit for the control strain K.pfaffii GS115.

The data presented in table 2 and Fig. 6 (a, b) indicate that, when normalizing to the volume of the culture fluid, the producer strain K. pastoris Y727his4Δ / pPH93-AOX1 _Y727- HSA is not inferior to the producer K.pfaffii GS115 / pRH93 -AOX1 _GS115 -HSA, and when normalized to optical units, it even surpasses it in productivity.

table 2 HSA Productivity mg / l mg / 1 p.u. Y727his4Δ 41.66 2.09 40.55 1.76 Average 41,105 1,925 Art. off 0.8 0.2 GS115 40,23 1.31 42.14 1.44 Average 41,185 1,375 Art. off 1.4 0.1

Example 9. Obtaining the producer of inulase

Inulase is an enzyme used in the food industry to produce fructose by cleaving β-glycosidic bonds of inulin (plant-derived polyfructose carbohydrate).

Construction of plasmids

It was constructed 4 expression integration vectors that differ in the method of regulation of gene expression of the target protein - inulase. The expression vector pINT-HIS4-GAP _Y727- INU contains the elements necessary for its amplification in E. coli cells: beta-lactamase gene (as a selective marker), bacterial replicon to ensure maintenance of a certain level of plasmid copy number. For transformation of yeast cells and expression of the target gene, the vector contains the following elements: the HIS4 gene - histidinol dehydrogenase, as a selectable marker, cloned from K. pastoris VKPM Y727, the target protein - inulase gene, cloned from Kluyveromyces marxianus [14], under control GAP _Y727 promoter, cloned from K. pastoris VKPM Y-727, AOX1 terminator. The GAP promoter was obtained by PCR; the genomic DNA of the K.pastoris VKPM strain Y-727, primers pr1_GAP (5'-aggaagcttttttgtagaaatgtcttggt), pr2_GAP (5'-ataggtacctgcagccatggtagatctttgattagttga) was used as a template.

To obtain the linearized portion of the plasmid intended for transformation, the original plasmid pINT-HIS4-GAP _Y727- INU is treated with a restriction endonuclease MluI. The integrable part of the plasmid is flanked by regions for insertion into a specific locus of the genome — the endogenous promoter AOX1. The expression vector pINT-HIS4-GAP _GS115 INU contains the same elements as the previous vector, with the exception of the selective marker, HIS4, which was cloned from K.pfaffii GS115 (obtained by PCR, from the matrix - genomic DNA of the strain K.pfaffii GS115 primers pr1_HIS4, pr2_HIS4), as well as the GAP _GS115 promoter, also cloned from K.pfaffii GS115. The GAP promoter was obtained by PCR; the genomic DNA of the strain K.pfaffii GS115, primers pr1_GAP (5'-aggaagcttttttgtagaaatgtcttggt), pr2_GAP (5'-ataggtacctgcagccatggtagatctttgatagttgttcaattgt) were used as a template. When processing with the restriction endonuclease MluI, the linearized fragment is also inserted at the AOX1 genome locus.

The expression vector pINT-HIS4-AOX1 _Y727- INU contains the elements necessary for its amplification in E. coli cells: the beta-lactamase gene (as a selective marker), a bacterial replicon to ensure maintenance of a certain level of plasmid copy number. For transformation of yeast cells and expression of the target gene, the vector contains the following elements: the HIS4 gene - histidinol dehydrogenase, as a selective marker, cloned from K. pastoris VKPM Y-727, the target protein gene - inulase, cloned from Kluyveromyces marxianus [14], located under the control of the promoter AOX1 _Y727 , cloned from K. pastoris VKPM Y-727, terminator AOX1. To obtain the linearized portion of the plasmid intended for transformation, the original plasmid pINT-HIS4-AOX1 _Y727- INU is treated with the restriction endonuclease MluI. The integrable part of the plasmid is flanked by regions for insertion into a specific locus of the genome — the endogenous promoter AOX1. The expression vector pINT-HIS4-AOX1 _GS115 INU contains the same elements as the previous vector, with the exception of the selective marker, HIS4, which was cloned from K.pfaffii GS115, as well as the GAP _GS115 promoter, also cloned from K.pfaffii GS115. When treated with the restriction endonuclease MluI, the linearized fragment is also inserted at the AOX1 locus.

Thus, 4 plasmids were obtained, two of which:

pINT-HIS4-GAP _Y727- INU and pINT-HIS4-AOX1 _Y727 -INU are designed to transform the strain K. pastoris Y-727his4Δ and differ from each other only by promoters (AOX1 and GAP) that control the expression of the target inulase gene in the strain K. pastoris Y-727his4Δ;

two other pINT-HIS4-GAP _GS115 INU; pINT-HIS4-AOX1 _GS115 INU - designed to transform the strain K.pfaffii GS115 and differ from each other only by the promoters (AOX1 and GAP) that control the expression of the target inulase gene in the strain K.pfaffii GS115.

Transformation

As recipient strains, the strain K. pastoris Y-727his4Δ and the strain K.pfaffii GS115 are used as a control. Moreover, the expression of the inulase gene is regulated by the AOX1 or GAP promoter in each of the analyzed producer strains.

As a result of the transformation of each of these strains to linearized fragments of the plasmid pINT-HIS4-AOX1 _Y727- INU or pINT-HIS4-AOX1 _GS115 INU, respectively, followed by selection of transformants on selective agarized YNB medium without amino acids with ammonium sulfate, the following inulase producing strains are obtained: K .pastoris VKPM Y-727 / pINT-HIS4-AOX1 _Y727 -INU and K.pfaffii GS115 / pINT-HIS4-AOX1 _GS115 INU. The expression of the inulase gene is under the control of the inducible promoter AOX1.

As a result of the transformation of each of these strains to linearized fragments of the plasmid pINT-HIS4-GAP _Y727- INU or pINT-HIS4-GAP _GS115 INU, respectively, followed by selection of transformants on selective agarized YNB medium without amino acids with ammonium sulfate, the following inulase producing strains are obtained: K .pastoris VKPM Y727 / pINT-HIS4-GAP _Y727 -INU and K.pfaffii GS115 / pINT-HIS4-GAP _GS115 INU. Inulase gene expression occurs under the control of the constitutive GAP promoter.

As a result, the following inulase producing strains were obtained:

Komagataella pastoris VKPM Y727 / pINT-HIS4-GAP _Y727 -INU

Komagataella pastoris VKPM Y727 / pINT-HIS4-AOX1 _Y727 -INU

Komagataella pfaffii GS115 / pINT-HIS4-GAP _GS115 INU

Komagataella pfaffii GS115 / pINT-HIS4-AOX1 _GS115 INU

Determination of inulase activity

For the experiment, 2 clones of each strain were selected. The inoculum of the analyzed clone K.pastoris Y727 / pINT-HIS4-GAP _Y727- INU or K.pfaffii GS115 / pINT-HIS4-GAP _GS115 INU was placed in test tubes with 5 ml of YPD medium, and the inoculum of the clone K.pastoris VKPM Y-727 / pINT-HIS4-AOX1 _Y727 -INU or K.pfaffii GS115 / pINT-HIS4-AOX1 _GS115 INU - in tubes with 5 ml of YPgM medium.

The culture was grown for 40 hours in a rotary shaker-thermostat (250 rpm), at a temperature of 28 ° C. In the case of growth on YPgM medium, methanol induction was carried out after 24 hours of growth, by aseptically adding 50% methanol solution to the tubes to a final concentration of 0.5%. After 40 hours, the biomass was separated by centrifugation in a benchtop centrifuge, at 3000 g.

The activity of secreted inulase was determined in the culture fluid using sucrose as a substrate. Inulase hydrolyzes the β-glycosidic bond, resulting in the formation of a reducing carbohydrate - glucose. The amount of glucose formed allows us to judge the activity of the inulase enzyme. The amount of glucose is measured by the optical density (at λ = 492 nm) of the reaction mixture, after addition of 3,5-dinitrosalicylic acid, which is reduced to 3-amino-5-nitrosalicylic acid, changing color [15]. Inulase activity is presented in units. 1 unit of activity is the amount of enzyme that releases 1 μmol of glucose in 1 min, normalized to 1 ml of culture fluid and then to 1 optical unit (OD ₅₉₅ ) of the culture.

From the data presented in Table 3 and Fig. 7 a, b, it is seen that the inulase activity in the case of expression under the control of the AOX1 promoter is more than 2 times higher in the K. pastoris VKPM strain Y-727 / pINT-HIS4- AOX1 _Y727 -INU, compared with the control strain K.pfaffii GS115 / pINT-HIS4-AOX1 _GS115 INU. Conversely, in the case of regulation of heterologous expression by the GAP promoter, the activity of the produced inulase is higher in the strain K.pfaffii GS115 / pINT-HIS4-GAP _GS115 INU, compared with K.pastoris Y727 / pINT-HIS4-GAP _Y727- INU.

Table 3 Inulase activity GAP promoter AOX1 promoter Y727his4Δ 0.44 0.35 0.48 0.43 Average 0.46 0.39 Art. off 0,0 0.1 GS115 1,11 0.18 0.97 0.16 Average 1,04 0.17 Art. off 0.1 0,0

Example 10. Obtaining a producer of intracellular protein of hepatitis B virus surface antigen

Construction of vectors pPH93-AOX1 _GS115 -HBsAg; pPH93-AOX1 _Y727 -HBsAg

The expression vector pPH93-AOX1 _GS115- HBsAg contains the elements necessary for its amplification in E. coli cells: the beta-lactamase gene (as a selective marker), a bacterial replicon to maintain a certain level of plasmid copy number. For transformation of yeast cells and expression of the target gene, the vector contains the following elements: HIS4 gene - histidinol dehydrogenase, cloned from strain GS115 with a promoter part, as a selective marker; gene of the target protein - hepatitis B virus surface antigen (HBsAg) [20], under the control of the AOX1 promoter, AOX1 terminator, cloned from strain GS115. The integrable part of the plasmid is flanked by regions for insertion into a specific locus of the genome — the endogenous promoter AOX1. To obtain the linearized portion of the plasmid intended for transformation, the original plasmid pRH93-AOX1 _GS115- HBsAg is treated with the restriction endonuclease MluI.

The expression vector pPH93-AOX1 _Y727- HBsAg contains the elements necessary for its amplification in E. coli cells: the beta-lactamase gene (as a selective marker), a bacterial replicon to ensure maintenance of a certain level of plasmid copy number. For transformation of yeast cells and expression of the target gene, the vector contains the following elements: URA3 gene - orotidine decarboxylase, cloned from the claimed strain with a promoter part, as a selective marker; the target protein gene is HBsAg, which is under the control of the AOX1 promoter, the AOX1 terminator, cloned from the claimed strain. The integrable part of the plasmid is flanked by regions for insertion into a specific locus of the genome — the endogenous promoter AOX1. As a result of the treatment with the restriction endonuclease MluI of the plasmid pRH93-AOX1 _GS115- HBsAg, a linearized portion of the plasmid intended for transformation of the recipient strain is obtained.

Transformation

The strain K.pastoris Y727ura3 ^mut his4Δ is used as the recipient strain and the control strain K.pfaffii GS115 is used.

As a result of transformation of strain K.pastoris Y727ura3 ^mut his4Δ linearized fragment of plasmid pPH93-AOX1 _Y727 -HBsAg, followed by selection of transformants on selective YNB agar medium with the content of histidine in a concentration of 50 ug / ml of the medium, the strain-producer strain K.pastoris Y727ura3 ^mut his4Δ / pPH93-AOX1 _Y727 -HBsAg synthesizing hepatitis B virus surface antigen

As a result of the transformation of the strain K.pfaffii GS115 by a linearized fragment of the plasmid pPH93-AOX1 _GS115- HBsAg, followed by selection of transformants on selective agarized YNB medium, a strain producing strain K.pfaffii GS115 / pPH93-AOX1 hepatitis B virus _{antigens was} obtained AT.

Determination of hepatitis B virus surface antigen production level

For the experiment, 2 clones of each strain were selected. The inoculum of the analyzed clones was placed in test tubes with 5 ml of YPgM medium. The culture was grown for 72 hours in a rotary shaker-thermostat (250 rpm), at a temperature of 28 ° C. Every 24 hours, methanol was induced by aseptically adding 50% methanol solution to the tubes to a final concentration of 0.5%. After 72 hours, the biomass was separated by centrifugation in a benchtop centrifuge, at 3000 g.

To determine the level of production used enzyme-linked immunosorbent assay on a solid substrate. As the substrate used a standard plate for enzyme immunoassay with pre-sorbed human polyclonal antibodies to HBsAg. This tablet, conjugate - mouse monoclonal antibodies to HBsAg labeled with horseradish peroxidase, as well as TMB chromogen (3.3 ', 5.5'-tetramethylbenzidine) were included in the standard HepaStrip kit (produced by Niarmedik Plus LLC) for determination of serum HBsAg.

The precipitated cells were disrupted in buffer (10 mM phosphate buffer, 500 mM NaCl, 10 mM EDTA, 2 mM PMSF, 1% Tween 20, pH 7.2) using glass beads (Sigma) on a FastPrep 24 disintegrator (MP). The amount of HBsAg in the resulting lysate was analyzed. As a standard for calibration, we used the industry standard HBsAg sample of hepatitis B virus (cat. No. B-331, LLC Scientific and Production Association Diagnostic Systems). The amount of HBsAg in the total clone lysate was determined by the absorption intensity of the reaction mixture at a wavelength of λ = 492 nm. Quantitatively, the data are normalized to 100 optical units and are shown in Fig. 8 and Table 4, from which it can be seen that the production of the hepatitis B virus surface antigen is the same for both compared strains within the measurement error.

Table 4 HSA Productivity mcg / 100 p.u. Y727his4Δ 87.2 91.1 Average 89.15 Art. off 2,8 GS115 93.5 84,4 Average 88.95 Art. off 6.4

Thus, the effective use of the strain of methylotrophic yeast K. pastoris VKPM Y-727 as a recipient strain for the construction of producers capable of synthesizing the target protein was confirmed. The strain has the following characteristics, corresponding to or superior to the characteristics of the strain - the closest analogue:

- suitable for the synthesis of various target proteins, in particular inulase, serum albumin, surface antigen of hepatitis B virus, beta-galactosidase, as confirmed by examples 2, 8, 9, 10; in this case, both inducible (AOX1) and constitutive (GAP) promoters can be used (examples 2, 8, 9, 10);

- unlike the closest analogue, it allows the synthesis of the target protein regulated by the AOX1 promoter both in the presence of a methanol inducer and in its absence with a yield of up to 70% of the level of synthesis of this protein in the presence of methanol (examples 1, 2);

- allows you to quite simply get auxotrophic mutants traditionally used in genetic engineering, as confirmed by examples 3, 4, 5, 6, 7.

List of scientific and technical information

1. Daly R, Milton TW Hearn (2005) Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and production. J. Mol. Recognit. 18: 119-138.

2. Narhi LO, Arakawa T, Strickland TW. (1991). The effect of carbohydrate on the structure and stability of erythropoietin. J. Biol. Chem. 266: 23022-23026.

3. Macauley-Patrick S, Fazenda ML (2005) Heterologous protein production using the Pichia pastoris expression system. Yeast 22: 249-270.

4. Balamurugan V, Reddy GR (2006) Pichia pastoris: A notable heterologous expression system for the production of foreign proteins - Vaccines. Indian Journal of Biotechnology (6): 175-186.

5. Gellissen G (2000) Heterologous protein production in methylotrophic yeasts. Appl. Microbiol. Biotechnol. 54 (6): 741-750.

6. Kurtzman CP (2009) Biotechnological strains of Komagataella (Pichia) pastoris are Komagataella phaffii as determined from multigene sequence analysis. J Ind Microbiol Biotechnol 36: 1435-1438.

7. Bhatacharya P, Pandey G (2007) Production and purification of recombinant human granulocyte macrophage colony stimulating factor (GM-CSF) from high cell density cultures of Pichia pastoris. Bioprocess and Biosystems Engineering 30 (5): 305-312.

8. Zhang H, Yuan QP (2007) Cloning and secretion expression of hepcidin in Pichia pastoris. Sheng Wu Gong Cheng Xue Bao 23 (3): 381-385.

9. Yurimoto H (2011) Yeast Methylotrophy: Metabolism, Gene Regulation and Peroxisome Homeostasis. Hindawi Publishing Corporation International Journal of Microbiology Article ID 101298.

10. Conde R, Cueva R (2004) A Search for Hyperglycosylation Signals in Yeast Glycoproteins. The journal of biological chemistry (42): 43789-43798.

11. Hartner A, Glieder A (2006) Regulation of methanol utilization pathway genes in yeasts. Microbial Cell Factories 2006, 5:39.

12. Tschopp JF, Brust PF, Cregg JM (1987) Expression of the lacZ gene from two methanol-regulated promoters in Pichia pastoris. Nucleic Acids Res. 15: 3859-3876.

13. Cregg JM, Barringer KJ (1985) Pichia pastoris as a Host System for Transformations. MOLECULAR AND CELLULAR BIOLOGY, Dec. 1985, p. 3376-3385.

14. Brevnova E.E., Kozlov D.G. Saccharomyces cerevisiae yeast strain - producer of fructose from inulin, 1998, Biotechnology, 1, 12-20.

15. Berezin IV, Rabinovich ML Study of Applicability of quantitative kinetic spectrophotometric method for glucose determination, 1997, Biokhimiya, 42: 1631-1637.

16. Shixuan Wu, Geoffrey J. Letchworth High efficiency transformation by electroporation of Pichia pastoris pretreated with lithium acetate and dithiothreitol, BioTechniques, 2004, 36: 152-154.

17. Rose M, Botstein D Construction and use of gene fusions lacZ (b-galactosidase) which are expressed in yeast. Meth. Enzymol. 101: 167-180.

18. Oka A Sugisaki H Takanami M Nucleotide sequence of the kanamycin resistance transposon Tn903 JOURNAL J. Mol. Biol. 147 (2), 217-226 (1981).

19. Marchenko A.N., Kozlov D.G., Svirshchevskaya E.V., Benevolensky S.V. Using the N-terminus of TuA protein to create hybrid virus-like particles. Biotechnology 2001, No. 2, 3-11.

20. Cheperegin S.E., Arman I.P., Granovsky N.N. "Optimization of hepatitis B virus surface antigen gene expression in yeast." Like genetics, microbiology, virology 1990, 5, pp. 17-20.

21. Resolution of the Chief State Sanitary Doctor of the Russian Federation of July 12, 2011 N 99 of Moscow "On approval of SP 2.3.3.2892-11" Sanitary requirements for the organization and conduct of work with methanol. "

22. State sanitary and epidemiological regulation of the Russian Federation 4.1. Control methods. Chemical factors determining the concentration of chemicals in the air. Gas chromatographic determination of methanol in air. Guidelines MUK 4.1.1046a-01 Issue 2, Ministry of Health of Russia, Moscow 2002.

Claims (1)

The use of the yeast strain Komagataella pastoris VKPM Y-727 as a recipient for the construction of producers of the target protein, optionally including the introduction of mutations into it, ensuring the use of auxotrophic selective markers.

Images