RU2521652C2 - RECOMBINANT DNA, CODING HYBRID VACCINE PROTEIN GHbc FOR REGULATION OF SEXUAL FUNCTION IN ANIMALS, CONSISTING OF NUCLEOCAPSIDE PROTEIN OF HUMAN HEPATITIS B VIRUS FUSED WITH GONADOLIBERIN - Google Patents

Abstract

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of biotechnology and genetic engineering and can be used in veterinary for creation of vaccines regulating the sexual function in animals. A gene of a hybrid protein GHbc is obtained by the PCR method and is inserted into a polylinker region of a plasmid vector pUC9.

EFFECT: claimed is recombinant DNA, coding the hybrid vaccine protein GHbc, consisting of a nucleocapsid protein of human hepatitis B virus, fused with gonadoliberin.

2 cl, 4 dwg, 4 ex

Description

FIELD OF THE INVENTION

The present invention relates to the field of biotechnology and genetic engineering and can be used in veterinary medicine to create vaccines that regulate the sexual function of animals. A recombinant DNA encoding a GHbc fusion vaccine protein is proposed consisting of a human hepatitis B virus nucleocapsid protein fused to gonadoliberin.

State of the art

Sexual differentiation and the process of sexual reproduction in vertebrates is regulated by a complex and interconnected system, which, in addition to sex steroid hormones, also includes peptide hormones such as gonadoliberin, luteinizing hormone, follicle-stimulating hormone, prolactin and adrenocorticotropic hormone. Peptide hormones are very important for ensuring reproductive function [1]. The first link in the complex chain of hormonal regulation of sexual function in mammals is gonadoliberin (GnRh), a decapeptide with the amino acid sequence pGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH2, with pGlu corresponding to pyroglutamic acid, a Gly-NH2 is glycine amide. In the hypothalamus, GnRh is synthesized in the form of a precursor peptide, which, after processing and cyclization of the N-terminal glutamine residue, forms pyro-glycine. The action of GnRh is manifested by stimulation of the synthesis and release of specific pituitary hormones (follicle-stimulating and luteinizing hormones), which in turn regulate the production of sex hormones - estrogens (estradiol) in females and androgens (testosterone) in males. As a result of blocking the activity of peptide hormones, it is possible to reduce the concentration of sex hormone steroids in the blood to virtually the “zero” mark - to the level that is observed in males after castration, and in females in menopause.

Research on the directed regulation of GnRh levels for medical and veterinary purposes is being actively conducted around the world. In most cases, efforts are aimed at creating a medicine to stop tumor growth in people with cancer of the breast, endometrium, prostate and ovaries. In this case, two strategies are used. The first of them is the use of synthetic analogues of natural gonadoliberin (Centerorelix, Diferelin), which are characterized by much higher biological activity. As a result of their prolonged action, the pituitary gland becomes resistant to the action of gonadoliberin, which leads to a significant decrease in the number of sex hormones-steroids in the blood. The advantage of this approach is that the blocking of the production of sex hormones is reversible. After discontinuation of the drug, the production of sex hormones is restored. The second approach involves the development of an immune response to gonadoliberin [2]. The latter is achieved by creating conjugates of exogenous GnRH with carrier proteins for subsequent immunization of humans and animals, which can be used to create bio-contraceptives that can elicit a strong and stable immune response against endogenous GnRH, thereby blocking the action of sex hormones [3]. It is important that such vaccination has a reversible effect, which is more gentle and humane in comparison with surgical methods.

In veterinary medicine, 100% effective immunization against GnRh can be used to sterilize both domestic [4] and wild animals [5], or to reduce aggressiveness in stallions [6], elephants [7], etc.

The most successful commercial vaccine, Improvac [8], is used to feed pigs for slaughter. The meat of sexually mature pigs (boars) has a characteristic smell, the so-called smack of a boar or the smell of a boar. In a mature pig, many specific steroids are formed in the testes - skatol and androstanol, which accumulate in the adipose tissue of the animal. Due to the characteristic smell of the boar, the meat of sexually mature male pigs is hardly suitable or even unsuitable for consumption and unsuitable for export. Since approximately 10% of the male slaughtered pigs are already mature before the time of slaughter, this potentially entails a large loss for agricultural production. To control and prevent these losses, almost all male piglets are neutered at a young age. In addition to the aspect of poor treatment of animals, castration also leads to infections, growth inhibition, and poor meat quality.

GnRh itself is non-immunogenic, and must be covalently conjugated to an immunogenic carrier for use in an immunocontraceptive. Diphtheria toxoid is used as an excipient in the composition of the Improvac vaccine. Known methods for producing GnRh conjugates using proteins such as snail hemocyanin, thyroglobulin [9], serum albumin [10] as carriers. Obtaining such immunogens is quite expensive, since there is a need to isolate \ synthesize separately two components, which are then cross-linked chemically. To achieve the necessary effectiveness and manifestation of biological effects, such vaccines should be used in significant doses and in the presence of significant amounts of adjuvants.

A fundamentally different approach is to create hybrid proteins that combine the sequence of gonadoliberin and a macromolecular carrier, which give the necessary immunogenicity to the target antigen. Successful examples of the creation of such hybrids using the most diverse proteins of viral and bacterial origin as carriers are known [11–13].

Disclosure of invention

The solution to the problem of obtaining immunogenic vaccine recombinant fusion protein includes the following necessary steps:

a) the choice of an adequate carrier protein that provides the necessary immunogenicity of foreign peptide fragments;

b) selection of the sequence of the target epitope;

c) the choice of a method of combining two sequences, suggesting the optimal combination from the point of view of preserving the antigenic and physicochemical properties of the carrier protein and the target antigen;

d) design of a hybrid protein gene optimized for expression in selected host cells.

The generated genes can then be expressed in various host cells, and the synthesized recombinant polypeptides are isolated and purified using known methods.

The goal of obtaining a nucleotide sequence encoding a GHbc hybrid vaccine protein for regulating sexual function in animals was achieved due to the fact that a recombinant DNA encoding a fusion protein consisting of a human hepatitis B virus nucleocapsid protein fused to gonadoliberin was obtained.

The choice of the hepatitis B virus nucleocapsid protein as a carrier protein for the presentation of the gonadoliberin sequence is explained by a number of reasons. First, HBcAg is a highly immunogenic polymer structure. Secondly, when expressed in various systems (yeast, bacterial, etc.), HBcAg is capable of self-assembly with the formation of stable virus-like particles (HPV), while the particles themselves are not infectious. Thirdly, the structure of HBcAg is tolerant to insertions of peptides at various positions. Fourth, various relatively simple techniques have been developed for the isolation and purification of such HPVs [14].

Insertions of foreign epitopes can be added to the N- and C-ends of the protein, as well as to the c / el region of the epitope [15]. HBcAg is a strong immunogen, stimulates both the humoral and cellular immune responses, acting both T-dependent and T-independent antigen [16].

As a result, recombinant HPV HBcAg are widely used as experimental vaccines against a number of diseases, in particular against malaria [17], hepatitis C [18], influenza A [19], and also as a component of alternative immunological test systems for diagnosis various diseases, in particular hepatitis E [20], hepatitis B itself [21].

The nucleotide sequence encoding the ayw subtype HbcAg is obtained from the plasmid pHBV320 [22].

To obtain the GHbc gene using the PCR method. Using a GHbcF / GHbcR primer, a DNA fragment encoding a fusion protein consisting of the N-terminal sequence of gonadoliberin fused to the amino acid sequence HbcAg from 4th to 183rd amino acid is obtained on a pHBV320 plasmid matrix.

Thus, the present invention includes one object, recombinant DNA, which encodes a hybrid vaccine protein GHbc for regulating sexual function in animals, consisting of a human hepatitis B virus nucleocapsid protein fused to gonadoliberin and characterized by the nucleotide sequence of SEQ ID NO: 1.

For the purposes of storage, modification and further use, this DNA was cloned into a standard pUC9 plasmid vector to form the plasmid pGHbc.

A brief description of the figures.

Figure 1 - Physical and genetic maps of the vector pUCGHbc. Designations:

GHbc is the hybrid protein gene, Apr is the beta-lactamase gene, which determines the resistance of cells containing the plasmid pGHbc to ampicillin, ORI is the site of the onset of replication.

Figure 2 - The results of the analysis in LTO-PAG sample obtained after isolation of the target protein GHBc from biomass.

From left to right: lane 1 - Molecular mass marker No. 431 (Fermentas, Lithuania); lane 2 - Supernatant after biomass disintegration; total cellular protein; bright band corresponds to GHBc; lane 3 — Fraction after purging GHBc; bright band corresponds to GHBc.

Figure 3 - Table of the values of antibody titers in experimental animals.

Figure 4 - The titer of antibodies against sex hormone in the blood serum of rats treated with vaccine protein. Serum dilution is plotted along the abscissa, and the degree of staining of samples with a chromogenic substrate (OD 450 nm) is plotted along the ordinate.

The implementation of the invention

When carrying out the invention, in addition to the methods described in detail in the following examples, methods well-known to those skilled in the art are described in the manuals on molecular biology and genetic engineering [23].

Example 1. Construction of the GHbc gene.

The gene for the GHbc fusion protein is obtained by PCR using pHBV320 as a plasmid DNA template, and synthetic oligonucleotides as primers:

GHbcF: 5′-CGGAATTCATGCAGCATTGGAGCTATGGCCTGCGTCCGGGCCCTTATAAAGAATTTGGA -3 ′ and

GHbcR: 5′-GCTAAGCTTCTAACATTGAGATTCCCG -3 ′.

The GHbcF primer contains (in the direction from 5 ′ to 3 ′) a sequence for the EcoRI restriction enzyme recognition site for subsequent cloning of the PCR fragment, a sequence of 33 nucleotides starting with an ATG initiator coding for 10 amino acids of gonadoliberin optimized for protein expression in cells E. coli, a sequence of 18 nucleotides homologous to the coding sequence of the HbcAg gene of the ayw subtype with the 4th 10th amino acid.

The GHbcR primer contains a sequence complementary to the 3 ′ terminal HbcAg coding sequence, including the TAG stop codon and a flanking sequence with the HindIII restriction enzyme recognition site for subsequent cloning of the PCR fragment.

PCR is performed using the Encyclo PCR Kit PCR reagent kit (Eurogen, Russia).

PCR conditions: 10 ng of the matrix - plasmid pHBV320, 5 μl of 10 μM GHbcF / GHbcR primer solutions, the volume of the mixture is 50 μl. PCR mode: 94 ° C, 5 ′ (denaturation), 94 ° C, 30 ′ ′, 50 ° C, 30 ′ ′, 72 ° C, 1 ′ (amplification). After amplification, 5 μl from PCR of the mixture was analyzed by electrophoresis in a 1.5% agarose gel and a homogeneous fragment of about 600 np was identified. The fragment is isolated from the gel using the BC012 DNA fragment extraction kit (Evrogen, Russia) in accordance with the manufacturer's instructions and is subjected to automatic sequencing using GHbcF and GHbcR primers on an ABIPrizm 3100 DNA Sequencer using the Applera ′ ′ fluorescent Big dye Cycle sequencing kit ′ ′.

Based on the sequence analysis, it was concluded that the resulting fragment really encodes the target GHbc fusion protein.

Example 2. Construction of the plasmid pGHbc.

To obtain a vector containing recombinant GHbc DNA, which could then be used as a source of the GHbc gene to create expression vectors, the PCR fragment obtained as described in Example 1 was cloned into a common plasmid vector pUC9.

100 ng of the obtained fragment is hydrolyzed with 5 units of restriction enzymes EcoRI and HindIII and ligated with EcoRI / HindIII vector pUC9 using T4 DNA ligase.

The competent ligase mixture was transformed into competent cells of the Escherichia coli strain XL1-Blue. Plasmid DNA was isolated from the obtained ampicillin-resistant transformants and the “positive” clones were selected by PCR screening with the M13Forward primer (universal primer) and GHbcR and the formation of a 700-bp PCR product was detected.

Several “positive” clones were checked by sequencing using M13Forward and M13Reverse primers and a clone was inserted with the insertion of a GHbc coding fragment (SEQID No. 1) that did not contain non-specific mutations.

The plasmid contained in the cells of the selected clone was designated as pGHbc (Figure 1).

Example 3. Obtaining a recombinant strain producer G-HBc.

The obtained recombinant plasmid pGHbc transform the E. coli strain BL21 (DE3) pLysS (“Novagene”, USA) [E. coli B, F ^- , ompT, hsdS _B (r _B ^- m _B ^- ), gal, dcm, (DE3), pLysS].

The producer strain and the GHBc gene were cultured in 50 ml of TBP-5052 medium [24] in a shaker incubator at 250 rpm at 37 ° C for 24 hours. The optical density in this case was 15.9 + 0.2 Oe with a length waves of 550 nm. Biomass was separated from the culture fluid by centrifugation at 12,000 g at + 4 ° C for 20 minutes. The filtrate of the culture fluid was removed by decantation.

Frozen 2.4 g cells were resuspended on ice in 20 ml of lysis buffer (50 mM Tris (Hcl) pH8.0, 0.5 M NaCl, 0.01 mM PMSF). Biomass disintegration was carried out on ice using a U3-disintegrator with 2-3 30-second pulses with a power of 40 W with a break of 5 minutes (based on 20 ml of cell mass suspension). Then, the disintegrated biomass was centrifuged at 12000 g for 20 min at + 4 ° С. A sample of the supernatant was taken for electrophoretic analysis in 14% SDS-PAGE (polyacrylamide gel in the presence of sodium dodecyl sulfate) (see Figure 2). The content of the recombinant GHBc protein in the soluble protein fraction was 80 mg in 20 ml of the supernatant after cell disintegration.

Example 4. Immunogenicity of the vaccine recombinant gonadoliberin fusion protein - HBc.

Wistar rats were kept in clean conditions in one box, but on different racks. Feeding was carried out with full-feed for small laboratory rodents (mice, rats, hamsters) SPF category.

Before starting the experiment, rats were randomized and divided into experimental and control groups. The experimental group consisted of 6 females and 6 males. The control group also consisted of 6 females and 6 males. Animals in the same cage or in close proximity to each other were of the same sex.

Animals on the 1st and 8th day of the experiment were given subcutaneous injections of GHBc and the buffer used to dissolve GHBc (control preparation) into the withers in the volume: on the 1st day of the experiment - 1 ml, on the 8th day - 1 5 ml (1 mg / kg animal weight).

On the 55th day of the experiment, we studied the effect of the drug on the behavioral reactions of rats during mating. For this, two males of the experimental group were transplanted to intact females in a 2: 1 ratio. Animals were kept together overnight. Observation of animals was carried out using a video camera.

It turned out that the males of the experimental group, unlike the males of the control group, did not exhibit the sexual behavior inherent in rats. The frequency of coatings by males of the control group of intact females averaged 1 time per 5 minutes during the observation period, when no similar acts were detected by males of the experimental group for the entire observation period. Vaginal smears taken from intact females confirmed that when the males of the control group were seated, there was a coating, and there was no coating when the males of the experimental group were seated. Normal, healthy offspring were obtained after covering intact females with males from the control group.

The titer of antibodies against GHBc in rat serum was determined on the 15th and 60th day of the experiment. For this, the serum obtained from experimental rats was bred sequentially 100, 500, 2500, 12500 times with PBS buffer containing BSA at a concentration of 1 mg / ml. Diluted sera were added to the wells of the immunological plate with GHBc pre-adsorbed in them. Serum antibodies bound to the antigen were detected using antiviral antibodies conjugated to horseradish peroxidase. Chromogenic substrate tetramethylbenzidine was added to the wells and after 10 minutes the reaction was stopped. Measurement of the degree of staining at a wavelength of 450 nm was carried out in duplicate using a tablet spectrophotometer. The data obtained for each rat in the group were averaged. Figure 3 presents the obtained titer values, Figure 4 shows the corresponding graph. Antibody protein titers are high; it should be noted that the antibody titers in females are higher than in males. It should also be noted a slight increase in the number of antibodies in the interval between the 15th and 60th days of the experiment, both in females and males. Thus, GHBc is highly immunogenic.

List of cited sources

1. Conn, P. M., Janovick, J. A., Stanislaus, D., Kuphal, D., Jennes, L. 1995. Molecular and cellular basis of gonadotropin releasing hormone action in the pituitary and the central nervous system. In: Litwack, G. (Ed.), Vitamins and Hormones, vol. 50. Academic Press, New York, pp. 151-214.

2. Ferro VA, Stimson WH. 1999. Anti-gonadotropin releasing hormone vaccines and their potential use in the treatment of hormone-responsive cancers. BioDrugs. 12 (1): 1-12.

3. Hardy CM, Braid AL. 2007. Vaccines for immunological control of fertility in animals. Rev Sci. Tech. 26 (2): 461-70

4. Delves PJ, Roitt IM. 2005 Vaccines for the control of reproduction-status in mammals, and aspects of comparative interest. Dev. Biol. (Basel). 121: 265-73.

5. Munson L 2006 Contraception in felids. Theriogenology. 66 (1): 126-34.

6. Stout TA 2005. Modulating reproductive activity in stallions: a review. Anim. Reprod. Sci. 89 (1-4): 93-103.

7. De Nys HM, Bertschinger HJ, Turkstra JA, Colenbrander B, Palme R, Human AM. 2010. Vaccination against GnRH may suppress aggressive behavior and musth in African elephant (Loxodonta africana) bulls-a pilot study. J S Afr. Vet. Assoc. 81 (1): 8-15.

8.http: //www.pfizerah.ru/preparats/pigs/other/improvak.ivp

9. Melun P.X, Vensing K.Y.G. PEPTIDE DERIVATIVES AND A COMPOSITION CAUSING AN IMMUNE RESPONSE TO LHRH. RF patent No. 2078770 dated 05/10/1997

10. Ladd, AE, Wang, C Yi, Zamb, TJ Immunogenic LHRH peptide constructs and synthetic universal immune stimulators for vaccines. US patent No. 5759551 dated 06/02/1998.

11. Fang F, Liu Y, Pu Y, Wang L, Wang S, Zhang X. 2010. Immunogenicity of recombinant maltose-binding protein (MBP) -gonadotropin releasing hormone I (GnRH-I). Syst. Biol. Reprod. Med. 56 (6): 478-86.

12. Wang XJ, Gu K, Xu JS, Li MH, Cao RY, Wu J, Li TM, Liu JJ. 2010. Immunization with a recombinant GnRH vaccine fused to heat shock protein 65 inhibits mammary tumor growth in vivo. Cancer Immunol. Immunother. 59 (12): 1859-66.

13. Wu X, Franka R, Svoboda P, Pohl J, Rupprecht CE. 2009. Development of combined vaccines for rabies and immunocontraception. Vaccine 27 (51): 7202-9.

14. Pumpens, P. and E. Grens. 1999. Hepatitis In core particles as a universal display model: a structure-function basis for development. FEBS Lett. 442: 1-6.

15. Bottcher, B., S.A. Wynne, and R.A. Crowther. 1997. Determination of the fold of the core protein of hepatitis B virus by electron cryomicroscopy. Nature 386: 88-91.

16. Milich, D.R., D.L. Peterson, F. Schodel, J.E. Jones, and J.L. Hughes. 1995. Preferential recognition of hepatitis B nucleocapsid antigens by Th1 or Th2 cells is epitope and major histocompatibility complex dependent. J. Virol. 69: 2776-2785.

17. Birkett, A., K. Lyons, A. Schmidt, D. Boyd, G.A. Oliveira, A. Siddique, R. Nussenzweig, J.M. Calvo-Calle, and E. Nardin. 2002. A modified hepatitis B virus core particle containing multiple epitopes of the Plasmodium falciparum circumsporozoite protein provides a highly immunogenic malaria vaccine in preclinical analyses in rodent and primate hosts. Infect. Immun. 70: 6860-6870.

18. Chen, J.Y. and F. Li. 2006. Development of hepatitis C virus vaccine using hepatitis B core antigen as immuno-carrier. World J. Gastroenterol. 12: 7774-7778.

19. Neirynck, S., Deroo, T., Saelens X., Vanlandschoot, P., Jou, W. M., Fiers W., 1999. A universal influenza A vaccine based on the extracellular domain of the M2 protein. Nat. Med. 5: 1157-63.

20. Touze, A., N. Enogat, Y. Buisson, and P. Coursaget. 1999. Baculovirus expression of chimeric hepatitis B virus core particles with hepatitis E virus epitopes and their use in a hepatitis E immunoassay. J. Clin. Microbiol. 37: 438-441.

21. Borisova G, Arya B, Dislers A, Borschukova O, Tsibinogin V, Skrastina D, Eldarov MA, Pumpens P, Skryabin KG, Grens E. 1993. Hybrid hepatitis B virus nucleocapsid bearing an immunodominant region from hepatitis B virus surface antigen. J. Virol. 67 (6): 3696-701.

22. Bichko, V., Pushko, P., Dreilina, D., Pumpen, P., Gren, E. 1985. Subtype aywvariant of hepatits B virus DNA primary structure analysis. FEBS Lett. 185: 208-212

23. Ausubel F.M., Brent, R., Kingston, R. E., Moore, D.D., Seidman J.G., Smith, J.A., and Struhl, K. (1997) Current Protocols in Molecular Biology, John Wiley and Sons, New York.

24. Studier F.W. (2005). Protein production by auto-induction in high density shaking cultures. Protein Expr. Purif. 41 (1): 207-234.

Claims (2)

1. Recombinant DNA encoding a vaccine fusion protein (GHbc) for regulating sexual function in animals, consisting of a human hepatitis B virus nucleocapsid protein fused to gonadoliberin, which is characterized by the nucleotide sequence of SEQ ID NO: 1. 2. A hybrid vaccine protein (GHbc) for the regulation of sexual function in animals, which is characterized by the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1.

Images