RU2521330C2 - Method for detecting bovine leukemia virus by nucleotide sequences of conserved regions of viral genome - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to the veterinary science and aims at detecting bovine leukemia virus (BLV) with the use of polymerase chain reaction. The reaction uses oligonucleotides having a sequence of not less than 15 sequential bases inside any of the base sequences of BLV locus genomes presented in SEQ ID NO from 1 to 11.

EFFECT: invention provides the universal method for detecting BLV irrespective of a BLV attribute to a specific population by using the conserved regions of the genome - gag and pol.

7 cl, 4 dwg, 4 tbl, 4 ex

Description

The invention relates to the field of biotechnology, molecular genetic diagnostics and veterinary medicine and may find application in veterinary medicine in the diagnosis of cattle for carriage of leukemia virus. In particular, the invention relates to a method for detecting cattle leukemia virus in animal tissues, as well as in the external environment using molecular biological methods, and to sets of oligonucleotides suitable for implementing this method.

State of the art

Bovine leukemia is a chronic retroviral proliferative disease caused by the Bovine Leukemia virus (BLV) virus of the cattle leukemia virus (BLV), which belongs to the Retroviridae family. The first disease report was made in 1871 (Leisering, 1871 by Rodriguez et al., 2011), and three years later Bollinger described cattle leukemia as a clearly defined nosological form (Bollinger, 1874 by Rodriguez et. Al., 2011). In most animals infected with VLCCR (about 70%), the disease is asymptomatic, approximately a third of the animals develop a mild form - persistent lymphocytosis (Rodriguez et al., 2011). Lethal lymphosarcoma occurs in less than 5-10% of infected animals, mainly adults (older than 4-5 years).

VLCCR is transmitted horizontally, especially when infected cells are transferred (Johnson R., 1985). Since the free virus is unstable, the most common means of transmission are cells infected with VLCCR (B lymphocytes, monocytes / macrophages) and present in blood or milk. Animals with persistent lymphocytosis (PL) are more likely to act as a source of infection, due to the high level of infected cells in the blood. In herds, the spread of the disease is often associated with iatrogenic factors: non-compliance with aseptic and antiseptic rules during veterinary and zootechnical procedures (such as removing horns, tattooing, rectal examinations, injections), which entails the movement of infected blood (Kobayashi et al., 2010 ; Kohara et al., 2006). Prolonged direct contact between infected and healthy animals should also be considered a risk factor. According to experimental data, the virus can be transmitted with the participation of blood-feeding insects (Perino L.J., 1990). It is possible to transfer VLSC from cows to calves through milk (Ferrer et al., 1981a; Ferrer et al., 1981b; Meas et al., 2002). In-utero transmission of VLCC occurs with a frequency of 4-18%, for cows with persistent lymphocytosis, the probability of transmission is higher (Lassauzet et al., 1991; Meas et al., 2002). A significant proportion of calves that received maternal antibodies to VLSC antigens remain uninfected (Burridge et al., 1982). In the semen of infected bulls, VLSCs were not detected (Dus Santos et al., 2007).

VLKRS is widespread on all continents, with the exception of Europe. Efforts to introduce a system of control measures and implement a program to eradicate VLCD in a number of European countries have been successful (Nuotio L., 2003; Knapen et al., 1993). The program for the elimination of VLCCS infection in dairy herds in Australia and New Zealand was launched in the mid-1990s; according to 2005 data, more than 98% of herds were virus free (NAHIS-AHA Enzootic Bovine Leukosis). According to National Animal Health Monitoring data for 2007, 83.9% of US farms have infected animals. Information is available on the situation in several provinces of Canada: 89% of herds and 20.8 - 37.4% of animals are infected with VLCC (VanLeeuwen J.A. F.L., 2005; VanLeeuwen J.A. T.A., 2006). 34-50% of infected animals in Chile, Venezuela, Colombia and Uruguay. In Argentina, the level of infection of animals and farms is 32.8% and 84%, respectively (Trono K.G., 2001). In Japan, 28.6% and 68.1% (Murakami K., 2011). According to the International Organization of Epizootics, VLKRS is found in China, Mongolia and Indonesia. In the countries of the Middle East, with the exception of Turkey and Iran, the prevalence of VLCCR is 20%.

The likelihood of human infection with VLCC was studied using a number of molecular methods (immunocytochemistry, PCR, RT-PCR). Analysis of a sample of healthy people in contact with cows (257 people) in 74% of cases showed the presence of specific antibodies to VLCC (Buehring et al., 2003). The risk of developing human leukemia as a result of VLCRS infection is assessed as unlikely, but not completely excluded (Calattini et al., 2006).

Over the past decades, a number of attempts have been made to create a vaccine against VLCC. None of the vaccines developed provides complete and lasting protection (Rodriguez S.M., 2011). The only approach used to control VLCC is to identify and subsequently eliminate or isolate animals infected with VLCC.

Diagnosis of leukemia can be carried out using serological, molecular genetic (PCR), hematological, clinical, pathomorphological methods and a bioassay method. Currently, in state programs to combat cattle leukemia, the basis for the diagnosis of VLSC is serological research methods - the immunodiffusion reaction (RID) and enzyme-linked immunosorbent assay (ELISA); hematological, clinical and pathomorphological methods serve to clarify the diagnosis.

The immune diffusion reaction (RID) is based on the detection of antibodies to the virus and, with high specificity, has a rather low sensitivity. Typical disadvantages of the method are the possibility of cross-sectional (nonspecific) reactions, the latent stage of the infectious process, the low critical mass of the pathogen, the physiological state of the animal, as well as the immunological suppression initiated by exposure to negative environmental factors, parasitoses, concomitant infections, and numerous vaccine loads. The sensitivity of the method is also affected by the specificity of the sera (Simard, 2000).

Enzyme-linked immunosorbent assay (ELISA), or enzyme-linked immunosorbent assay (ELISA), is based on the immunochemical antigen-antibody interaction and the use of antibodies or antigens labeled with enzymes as an indicator of this reaction. It has a higher sensitivity than RID. In addition, using ELISA can detect antibodies to VLCC in milk and urine (Carii, 1993; Carii, 1999). Despite the obvious advantages, the reliability of ELISA is still associated with immunological reactions, and therefore is not always adequate. Another disadvantage of ELISA is the inability to detect antibodies in the blood serum during the first 1.5-2 months after infection.

Young animals up to 6 months of age remain outside the planned studies due to the fact that the methods of RID and ELISA are practically not suitable for the diagnosis of leukemia in calves, which is associated with the peculiarities of the formation of their immunity. Practice has shown that, using serological methods, herd recovery is delayed for years, since it is impossible to identify all infected animals, especially in the early stages of the disease, and isolate them from healthy ones (Makarov, 2005).

Hematological examination is performed on animals in the blood serum of which specific antibodies to cattle leukemia virus were detected by RID or ELISA. This method identifies sick animals among virus carriers.

The most promising alternative to serological diagnostic methods is the approach using the polymerase chain reaction (PCR diagnostics), which allows to detect the presence of proviral DNA in the blood of cattle, thus revealing not only sick animals, but also animal carriers; the absence of age restrictions makes it possible to test calves from 15 days of age. The PCR method allows you to detect the virus in the material within 1-2 weeks after infection. This method has maximum sensitivity and high specificity (Sherman, 1992; Gonzalez, 1999), which depends on the optimal selection of primers (Marisolais, 1994; Limansky, 2002; Markiewicz, 2003). A known method for the PCR diagnosis of VLCC based on the amplification of a fragment of the Pol gene (RU 2445370 Cl).

The use of real-time PCR provides new opportunities for rapid quantitative detection of VLCCs (Kuckleburg, 2003). A similar approach allows one to detect proviral DNA in the host genome, even if it is presented in one copy (Jimba, 2010). PCR allows the identification of animals at the earliest stages of the disease with high reliability (Makarov, 2005).

At present, it has been shown that there are several genotypes of VLCCR associated with geographical isolates (Rodriguez, 2009). To date, 6 VLCCR genomes (accretion number in the NCBI database) have been sequenced: EF600696.1, NC_001414.1, K02120.1, AF257515.1, FJ914764.1, AF033818. The databases also contain more than 700 fragments of the virus genome from different geographical isolates, including from Russia. However, DNA typing of VLCCRs both in our country and abroad is carried out without taking into account the polymorphism of the virus genome, which gives a fraction of false negative results. Currently, the urgent task is to create a diagnostic method that allows you to detect BLV regardless of its type.

As a prototype of the invention, a method for diagnosing VLCRS by PCR, known from document WO / 2012/053666, was selected. In the known method for the PCR use the so-called "degenerate" or "degenerative" primers, which are actually a mixture of oligonucleotides of various structures, to one degree or another specific to viral DNA of various genotypes. The method allows to detect various viral variants by examining a sample of viral DNA during one PCR procedure, thereby facilitating screening studies, however, the degeneracy of the primers adversely affects the specificity and sensitivity of PCR.

Disclosure of invention

In the present invention, it is proposed to use strictly locus-specific primers and probes, each of which is an oligonucleotide complementary to the inner region of one of the specially selected nucleotide sequences of the VLCC genome, to carry out the diagnosis of VLCC during PCR with a prepared sample of viral nucleic acid (DNA or cDNA) loci belonging to the pol and gag genes, in which the inventors found short regions represented by SEQ ID NOs 1 through 11, the sequence of which is one ova from all known varieties of the virus. These sections of the nucleotide sequences are identical in all currently known varieties of VLCC (110 sequences in total). The present invention discloses the use of oligonucleotides complementary to the internal region of these conserved regions as primers and probes for PCR in the diagnosis of VLCC, which makes it possible to detect VLCC in a DNA sample, regardless of the type of virus. The list of nucleotide sequences that limit the structure of oligonucleotides suitable for creating primers and probes and their use in PCR diagnostics of VLCCs is given in Table 1. Their relative position in the VLCC genome is shown in Fig. 1.

Table 1. Gene pol SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4 SEQ ID NO: 5 SEQ ID NO: 6

SEQ ID NO: 7 Gag gene SEQ ID NO: 8 SEQ ID NO: 9 SEQ ID NO: 10 SEQ ID NO: 11

Additionally, to assess the quality of the reaction and the viral load (during quantitative real-time PCR), the 5′-region of the Ablim2 Bos taurus gene, which does not have homology to any of the conserved sequences, can be selected as a control (reference) sequence. Uniqueness in mammalian genomes was shown for this site (Klimov et al., 2005), i.e. it has no homology with other sequences of the genome of the species, and also differs from similar sequences of the genomes of other species.

The technical result obtained by the implementation of the present invention is the expansion of the possibilities for diagnosing VLCC due to the use of universal primers and probes in PCR that are complementary to the conserved regions of two loci of the virus genome - gag and pol. DNA diagnostics at two loci increases the specificity of the reaction and allows you to identify all known variants of the virus, excluding the possibility of obtaining false negative results. Another significant point is the use of the reference sequence of the cattle genome, which avoids false-positive results. Carrying out the reaction in multiplex format (all loci are tested in one test tube) can significantly reduce the cost of DNA diagnostics without loss of sensitivity. The present invention can be used to create various modifications of universal diagnostic PCR test systems designed to detect VLCC DNA. Based on the sequence listing of SEQ ID NO: 1-11 and the description of the conditions for selecting primers and probes without further studies, one skilled in the art will easily select primers and probes suitable for any currently known PCR modifications, for example, nested, or nested, PCR (nested-PCR), inverted PCR, reverse transcription PCR (RT-PCR, RT-PCR), asymmetric PCR (single-strande PCR), real-time PCR (real-time PCR), step-by-step PCR, RAPD , PCR using hot start (hot-start PCR).

In the description of the invention, the entire list of loci necessary for the selection of PCR primers and probes is disclosed, the procedure for selecting primers and probes is disclosed, experimental examples are presented that demonstrate the creation of various modifications of universal PCR test systems for detecting VLCRS virus, thus, the invention meets the condition " industrial applicability. "

The present invention for the first time discloses to a specialist a set of loci that can be used in a method for diagnosing VLCC, designed to identify any currently known varieties of VLCC, thus the invention meets the patentability criterion of "novelty."

A strictly limited list of sequences was selected on the basis of theoretical and experimental studies from a significant array of nucleotide sequences of various VLCC variants available in the GenBank database. The primary structure and the number of sequences that could be selected to create this list, as well as the very existence of this list, is not obvious to a specialist, thus, the invention meets the condition of patentability "inventive step".

Brief Description of the Drawings

Fig. 1. Illustrates the location of the sequences of SEQ ID NO: 1-11 with respect to the sequences of the gag and pol genes of VLCCR.

Fig. 2. Illustrates the electrophoretic separation of PCR products with BA1F / BA1R primers.

Fig. 3. Illustrates the electrophoretic separation of virus-negative and virus-positive PCR products.

Fig. 4. Illustrates the accumulation of real-time PCR products.

The implementation of the invention

Sampling, isolation and purification of viral nucleic acid is carried out using standard techniques known to the person skilled in the art.

When designing primers and probes based on a set of oligonucleotides complementary to a continuous sequence within any of the loci represented by SEQ ID NOs 1 through 11, the following conditions should be observed:

the content of bases G and C in the primer should be in the range of 40-60%;

primer length 15-25 nucleotides;

3 or more G or C bases are not allowed at the 3′-end of the primer, as this can lead to nonspecific annealing;

all primers should not form stable studs and duplexes on themselves or with each other (dimers and cross-dimers);

the melting temperature of the primers and the matrix should be similar and be in the range of 55-65 ° C.

Detection of PCR fragments is carried out in real time or by electrophoretic separation in PAG or agarose gel.

Examples of embodiment of the invention.

Example 1

Based on a set of oligonucleotides complementary to the continuous sequence inside any of the loci represented by SEQ ID NO: 1-11, two pairs of primers were selected for the amplification of VLCC for amplification of the sequences included in the gag and pol genes of the provirus genome. Another pair of primers was designed to amplify a unique fragment of the Bos taurus genome in the 5′-region of the Ablim2 gene. The characteristics of the selected primers are presented in table 2. The annealing temperature range of the selected primers was 55-57 ° C, which allows using the general program for amplification. Computer analysis showed that between the selected sequences there are no critical complementary regions (do not form dimers and cross-dimers), and the primers themselves do not form hairpins, i.e. they can be used for multiplex PCR. For all primers, the absence of additional planting sites in the Bos taurus genome and in the VLCCR genome was shown.

Table 2. Examples of primer sets selected according to the present invention. Primer Name Gene Length, nucleotide Sequence, 5′-3 ′ T _annealing , ° C Amplification Product Size (bp) BP2-F * pol 19 GCAGGCCGATATAACCCAT 55 229 BP2-R * 21 TGCTGGCAAAACCTGACAAAG 56 BG1-F gag twenty TATATTGCTTCCCCGGTCTC 55 292 BG1-R 25 GCTAATGAAATTTGTAACCGGTTGA 55

BA1-F Ablim2 eighteen CGTGTCACACACCTCTCC 57 one hundred BA1-R 19 CGCTCCTTTGCTTTTCTCC 55 * - F - forward (forward primer), R - reverse (reverse primer)

For the PCR formulation, the following conditions were calculated allowing the use of these primers in multiplex PCR: denaturation 95 ° С - 20 s, annealing 57 ° С - 15 s, chain elongation (synthesis) 72 ° С - 20 s.

Under these conditions, reactions were performed with each pair of primers separately and multiplex PCR with three pairs of primers. The reaction was carried out using a GenPakTM PCR Core kit (Isogen Laboratory LLC, Russia) (Figure 2).

In order to identify the further possibility of using the selected primer system in real-time PCR, a reaction was performed with the qPCRmix-HS kit (CJSC Evrogen, Russia), designed specifically for real-time PCR using probes.

When performing PCR using a mixture of qPCRmix-HS were obtained non-specific high molecular weight products. To increase the specificity of the reaction, it was decided to reduce the synthesis time to 15 seconds and increase the annealing temperature to 60 °.

Optimized programs are as follows:

Table 3. Optimized programs. set Conditions GenPak ™ PCR Core (Isogen Laboratory LLC, Russia) - initial denaturation (94 ° C - 3 min) - 35 cycles: denaturation (94 ° C, 20 s) annealing (58 ° С, 30 s) synthesis (72 ° C, 20 s) - final elongation (72 ° C, 5 min) qPCRmix-HS (Eurogen, Russia) - initial denaturation (94 ° C - 3 min) - 35 cycles: denaturation (94 ° C, 20 s) annealing (60 ° С, 30 s) synthesis (72 ° C, 15 s) - final elongation (72 ° C, 5 min)

Thus, the optimal conditions for PCR with primers based on oligonucleotides complementary to the conserved loci of pol and gag genes of the VLCCR genome were complemented with sequences SEQ ID NO 1-11. No non-specific reaction products were found. The possibility of conducting multiplex PCR is shown.

Example 2

Using the primers developed in Example 1, 1240 samples of DNA isolated from the blood of 13 animals (including from the blood of calves 2-4 months of age, about 500, and pregnant animals, about 100) were analyzed. Figure 3 shows an example of electrophoretic separation of the products of MPCR in a 2% agarose gel.

A total of 638 virus-positive animals and 602 virus-negative were identified. The share of virus carriers is 51.45%.

Example 3

Probes for real-time PCR (TaqMan type, for the Beacon format probes were taken for the basics of the same sequence) were selected for the developed primer pairs for internal conserved regions of amplified fragments:

P2 5′-GATACTTACTCTGGAGCTACTCATGCCTC-3 ′

G1 5′-ACCCAACAATCAGCTCAGCCCAACGC-3 ′

A1 5′-CCGCAGGGTCTACGGCAGCC-3 ′

Using the developed primers and probes, real-time multiplex PCR was performed using the DNA of an infected and healthy animal. Figure 4 shows the graphs of the accumulation of reaction products.

The figure shows that in reaction 1 with a DNA sample from an infected animal, the PCR curves with primers to the sequences of the gag and pol loci crossed the baseline, which is a positive response. In reaction 2 with a healthy animal, the curves did not cross the baseline. The blue curves characterizing the dynamics of the accumulation of the product of internal positive control crossed the baseline in both cases.

Example 4

In order to assess the possibility of using the loci represented by SEQ ID NOs: 4-7 and 11 for diagnosing VLCRC, reverse primers were selected for use in the reaction with a direct primer to the pol gene (BP2-F) and a direct primer to the gag gene (BG1 -F). The primer sequences are presented in table 4.

Table 4. Examples of primer sets selected according to the present invention. Primer Name Gene Length, nucleotide Sequence, 5′-3 ′ T _annealing , ° C Amplification Product Size (bp) * BP2-R3 pol 21 ACTTGTGGGGTTGTAGGGAAC 58 275 (274) BP2-R4 19 ATGGGAAGGTGGGGTTCGT 57 355 (354) BP2-R5 17 AGGGCTCGAGAAAGGGCCT 57 379 (378) BP2-R6 21 CTCCCATCTGGTCTTTAGAAT 51 431 (430) BG1-R2 gag 17 GGCATCTTGGGCCCTGG 57 498 (491, 494) * - size when used with direct primers for the pol (BP2-F) and gag (BG1-F) genes according to the sequences shown in Figure 1. The sizes obtained using the complete sequences of the virus genome are shown in parentheses.

The resulting primers were tested for complementarity and specificity of annealing using in silico PCR (using FastPCR 6.4 software). As the sequences of 6 VLCRC genomes (accretion number in the NCBI database): EF600696.1, NC_001414.1, K02120.1, AF257515.1, FJ914764.1, AF033818.

The results showed a high degree of homology of primer sequences to variants of VLCRC genomes. This confirms the possibility of using the loci of SEQ ID NO: 4-7 and 11 for PCR diagnostics of VLCCR.

LIST OF QUOTED LITERATURE (the contents of which are fully incorporated into this description by reference)

Makarov V.V., Grinishin, D.P. Epizootological prospects of cattle leukemia // Bulletin of the Russian Academy of Agricultural Sciences. 2005.V.2, S.70-72.

Buehring G.C., Philpott S.M., Choi K.Y. Humans have antibodies reactive with Bovine leukemia virus // AIDS Res Hum Retroviruses. 2003. V.19. No. 12. P.1105-1113.

Burridge M.J., Thurmond M.C., Miller J.M., Schmerr M.J., Van Der Maaten M.J. Fall in antibody titer to bovine leukemia virus in the periparturient period // Canadian Journal of Comparative Medicine. 1982. V. 46. Number 3. P.270-271.

Carli K.T., Sen A., Batmaz H., Kennerman E. Detection of IgG antibody to bovine leukaemia virus in urine and serum by two enzyme immunoassays // Lett. Appl. Microbiol. 1999. V.28. No. 6. P.416-418.

Carli K.T., Sen A., Batmaz H., Minbay A. Comparison of serum, milk and urine as samples in an enzyme immunoassay for bovine leukaemia virus infection // Res. Vet. Sci. 1993. V. 55. Number 3. P.394-395.

Delebecque F., Suspene R., Calattini S., Casartelli N, Saib A., Froment A., Wain-Hobson S., Gessain A., Vartanian JP, Schwartz O. Restriction of foamy viruses by APOBEC cytidine deaminases // J .Virol. 2006.V.80. No. 2. P.605-614.

Dus Santos M.J., Trono K., Lager I., Wigdorovitz A. Development of a PCR to diagnose BLV genome in frozen semen samples // Vet. Microbiol. 2007. V.119. P.10-18.

Ferrer J.F., Kenyon S.J., Gupta P. Milk of dairy cows frequently contains a leukemogenic virus // Science. 1981. V.213 No. 4511. P.1014-1016.

Ferrer J.F., Piper C.E. Role of colostrum and milk in the natural transmission of the bovine leukemia virus // Cancer Res. 1981. V.41. No. 12. P.4906-4909.

Gonzalez E.T., Norimine J., Valera A.R., Traveria G., Oliva G.A., Etcheverrigaray M.E. A rapid and sensitive diagnosis of bovine leukaemia virus infection using the nested shuttle polymerase chain reaction // Pesq. Vet. Bras. 1999. V.19. No. 2. P.63-67.

Jimba M., Takeshima S.N., Matoba K., Endoh D., Aida Y. BLV-CoCoMo-qPCR: Quantitation of bovine leukemia virus proviral load using the CoCoMo algorithm // Retrovirology. 2010. V.2. Number 7. P.91.

Johnson R., Gibson C. D., Kaneene J. B. Bovine leukemia virus: A herd-based control strategy // Preventive Veterinary Medicine. 1985. V.3. Number 4. P.339-349.

Klimov E., Rud'ko O., Rakhmanaliev E., Sulimova G. Genomic organization and tissue specific expression of ABLIM2 gene in human, mouse and rat // BBA - Gene Structure and Expression. 2005. V.1730 / 1. P.1-9.

Knapen K., Kerkhofs P., Mammerickx M. Eradication of enzootic bovine leukosis in Belgium: Results of the mass detection on the national cattle population in 1989, 1990 and 1991 // Ann. Med. Vet. 1993. V.137. P.197-201.

Kobayashi S., Tsutsui T., Yamamoto T., Hayama Y., Kameyama K., Konishi M., Murakami K. Risk factors associated with within-herd transmission of bovine leukemia virus on dairy farms in Japan // BMC Vet. Res., 2010, 6, 1.

Kohara J., Konnai S., Onuma M. .. Experimental transmission of Bovine leukemia virus in cattle via rectal palpation // Jpn. J. Vet. Res., 2006. V. 54. No. 1. P.25-30.

Kuckleburg C.J., Chase C.C., Nelson E.A., Marras S.A., Dammen M.A., Christopher-Hennings J. Detection of bovine leukemia virus in blood and milk by nested and real-time polymerase chain reactions // J. Vet. Diagn. Invest. 2003. V.15. No. 1. P.72-76.

Lassauzet M.L., Thurmond M.C., Johnson W.O., Holmberg C.A. (). Factors associated with in utero or periparturient transmission of bovine leukemia virus in calves on a California dairy // Can. J. Vet. Res. 1991. V. 55. Number 3. P.264-268.

Limansky A.P., Limanskya O. Comparison of primer sets for the detection of bovine leukemia virus by polymerase chain reaction // Bull. Vet. Inst. Pulawy. 2002. V. 46. P.27-36.

Markewicz L., Rulkax J., Kamiski S. Detection of BLV provirus in different cells by Nested-PCR // Bull. Vet. Inst. Pulawy. 2003. V.47. P.325-331.

Marsolais G., Dubuc R., Bergeron J., Morrey J.D., Kelly E.J., Jackson M.K. Importance of primer selection in the application of PCR technology to the diagnosis of bovine leukemia virus // J. Vet. Diagn. Invest. 1994. V.6. Number 3. P.297-301.

Meas S., Usui T., Ohashi K., Sugimoto C., Onuma M. Vertical transmission of bovine leukemia virus and bovine immunodeficiency virus in dairy cattle herds // Vet. Microbiol. 2002. V.84. Number 3. P.275-282.

Murakami K., Kobayashi S., Konishi M., Kameyama K., Yamamoto T., Tsutsui T. The recent prevalence of bovine leukemia virus (BLV) infection among Japanese cattle // Vet. Microbiol. 2011. V.148. No. 1. P.84-88.

Nuotio L.,. Rusanen H., Sihvonen L., Neuvonen E .. Eradication of enzootic bovine leukosis from Finland // Prev. Vet. Med. 2003. V. 59. No. 1-2. P.43-49.

Perino L.J., Wright R.E., Hoppe K.L., Fulton R.W. Bovine leukosis virus transmission with mouthparts from Tabanus abactor after interrupted feeding // Am. J. Vet. Res. 1990. V. 51. No. 8. P.1167-1169.

Rodriguez SM, Florins A., Gillet N., de Brogniez A., Sanchez-Alcaraz MT, Boxus M., Boulanger F., Gutiérrez G., Trono K., Alvarez I., Vagnoni L., Willems L. Preventive and Therapeutic Strategies for Bovine Leukemia Virus: Lessons for HTLV // Viruses. 2011. V.3. P.1210-1248.

Rodriguez S.M., Golemba M.D., Campos R.H., Trono K., Jones L.R. Bovine leukemia virus can be classified into seven genotypes: evidence for the existence of two novel clades // J. Gen. Virol. 2009. V.90. Pt.ll. P.2788-2797.

Sherman M.P., Ehrlich G. D., Ferrer J. F., Sninsky J. J., Zandomeni R., Dock N. L., Poiesz B. Amplification and analysis of specific DNA and RNA sequences of bovine leukemia virus from infected cows by polymerase chain reaction // J. Clin. Microbiol. 1992. V.30. No. 1. P.185-191.

Simard S., Richardson S., Dixon P., Belanger C., Maxwell P. Enzyme-linked immunosorbent assay for the diagnosis of bovine leukosis: comparison with the agar gel immunodiffusion test approved by the Canadian Food Inspection Agency // Can. J. Vet. Res. 2000. V.64. No. 2. P.101-106.

Trono K.G., Perez-Filgueira D.M., Duffy S., Borca M.V., Carrillo C. Seroprevalence of bovine leukemia virus in dairy cattle in Argentina: comparison of sensitivity and specificity of different detection methods // Vet. Microbiol. 2001. V.83. Number 3. P.235-248.

Van Leeuwen J.A., Forsythe L., Tiwari A., Chartier R. Seroprevalence of antibodies against bovine leukemia virus, bovine viral diarrhea virus, Mycobacterium avium subspecies paratuberculosis, and Neospora caninum in dairy cattle in Saskatchewan // Can. Vet. J. 2005. V. 46. No. 1. P.56-58.

Van Leeuwen J.A., Tiwari A., Plaizier J.C., Whiting T.L. Seroprevalences of antibodies against bovine leukemia virus, bovine viral diarrhea virus, Mycobacterium avium subspecies paratuberculosis, and Neospora caninum in beef and dairy cattle in Manitoba // Can. Vet. J. 2006. V. 47. No. 8. P.783-786.

Sequence listing

SEQ ID NO: 1 5′-GCAGGCCGATATAACCCATTATAAATACAAACAG-3 ′

SEQ ID NO: 2 5′-GTGTTTGTAGATACTTACTCTGGAGCTACTCATGCCTC-3 ′

SEQ ID NO: 3 5′-AACTGCTGGCAAAACCTGACAAAGGTTTT-3 ′

SEQ ID NO: 4 5′-GAACTTGTGGGGTTGTAGGGAAC-3 ′

SEQ ID NO: 5 5′-CATGGGAAGGTGGGGTTCGTCTA-3 ′

SEQ ID NO: 6 5′-TGAGTCCAGAGGGGCTCGAGAAAGGGCCTGAG-3 ′

SEQ ID NO: 7 5′-CTCCCATCTGGTCTTTAGAAT-3 ′

SEQ ID NO: 8 5′-CTTTGCCAATATATTGCTTCCCCGGTCGA-3 ′

SEQ ID NO: 9 5′-ACCCAACAATCAGCTCAGCCCAACGCCGG-3 ′

SEQ ID NO: 10 5′-TTAGGGACTCCGTCGGGAAGGTTGTCAGCTAATGAAATTTGTAACCGGTTGACAAA-3 ′

SEQ ID NO: 11 5′-GGCATCTTGGGCCCTGGGGTGTGGACGAG-3 ′

Claims (7)

1. A method for detecting cattle leukemia virus by polymerase chain reaction, characterized in that the reaction uses oligonucleotides having a sequence of at least 15 consecutive bases within any of the base sequences of the VLCC locus represented by SEQ ID NOs 1 through 11. 2. The method according to claim 1, where the oligonucleotides used in the reaction are specific to the gag gene. 3. The method according to claim 1, where the oligonucleotides used in the reaction are specific to the pol gene. 4. The method according to claim 1, where the reaction additionally uses oligonucleotides complementary to the 5′-region of the Ablim2 gene of the Bos taurus genome. 5. The method according to claims 1 to 4, where the amplification reaction of each target fragment is carried out separately. 6. The method according to claims 1 to 4, where the amplification reaction of each target fragment is carried out as part of a multiplex reaction. 7. The method according to claims 1 to 4, where the types of polymerase chain reaction are selected from the list: nested PCR, inverted PCR, reverse transcription PCR, asymmetric PCR, real-time PCR, stepwise PCR, RAPD, hot start PCR.

Images