RU2515913C1 - HYBRID PROTEIN HAVING PROLONGED ACTION, BASED ON RECOMBINANT HUMAN INTERFERON ALPHA-2 (VARIANTS), METHOD OF ITS PRODUCTION AND STRAIN OF Saccharomyces cerevisiae FOR IMPLEMENTING THIS METHOD (VERSIONS) - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: hybrid proteins GFN80 and GFN100 are formed based on recombinant human interferon alpha-2 fused on the N-terminus with the amino acid sequence of polypeptide S(G4S)16 or S(G4S)20, respectively. The strains of producer Saccharomyces cerevisiae RNCIM Y-3927 and Saccharomyces cerevisiae RNCIM Y-3928 are produced by recombinant method. The strains are used in the method of production of the hybrid protein GFN80 and GFN100, which comprises culturing under suitable conditions of yeast cells transformed by the expression vector, which contains the region of replication initiation of endogenous 2-micron plasmid of yeast Saccharomyces cerevisiae, and the promoter of yeast GAL1 controlling the expression of the gene comprising the DNA sequence SEQ ID NO:1 or SEQ ID NO:2, respectively, followed by isolation of the hybrid protein from the culture fluid.

EFFECT: invention enables to produce the hybrid recombinant human interferon alpha-2 with the prolonged action in the body of animals.

5 cl, 7 tbl, 15 ex

Description

The group of inventions relates to the field of biotechnology and relates to a protein with a prolonged action (longer life in animals compared to a natural protein), based on recombinant human interferon alpha-2 and its preparation by culturing Saccharomyces cerevisiae yeast.

Human interferons alpha-2 (IFN) belong to the class of cytokines, to the group of alpha interferons secreted by almost all types of virus-infected cells. Dosage forms of IFN are broad-spectrum drugs with immunomodulating, antiviral and antitumor activity. At present, IFN-based drugs are the most popular antiviral drugs that are part of the “gold drug standards” for the treatment of various viral diseases, including viral hepatitis B and viral hepatitis C (HCV) requiring lifelong therapy.

The pharmacokinetic characteristics of the recombinant unmodified (standard) IFN do not allow maintaining its plasma level, which partially explains the insufficiently high therapeutic effect [Reddy, 2004].

Known methods for modifying proteins, including IFN, increase their life time in the blood plasma of animals. Most of the known modifications are aimed at increasing the physical size (hydrodynamic volume) or charge (negative) of the molecules of drug proteins, which is carried out in order to slow down the process of their filtration from blood plasma through the pores of the renal tubules [Therapeutic Proteins, ed. R. Kontermann, 2012].

Chemical modification of IFN with the help of polyethylene glycols (PEG) made it possible to obtain PEG-IFN molecules, which are characterized by an increased lifetime in plasma and an improved pharmacokinetic profile [Zeuzem et al., 2000; Heathcote et al., 2000; Lindsay et al., 2001]. Large-scale clinical trials have shown that the effectiveness of combined preparations based on PEG-IFN is 1.5-2 times higher than the efficiency of standard interferon. At the same time, the level of HCV cure reaches 54-56% (Table 1), and at the same time the quality of life of patients improves [Fried et al., 2002; Manns et al., 2001; Hadziyannis 2004; Clark & Nelson, 2009].

However, the high cost of PEG-IFN significantly limits their mass application. Other adverse properties are the heterogeneity of chemically modified PEG-IFN molecules, the need to significantly (up to 10 times) increase the dosage of drugs based on them [Table 1 and Pasut, 2009], as well as the accumulation in the body of PEG derivatives that are not subject to biodegradation. In addition, about half of HCV patients remain immune to the course of treatment for PEG-IFN [Pasut, 2009].

The following methods for its biomodification were also used to obtain prolonged derivatives of IFN:

• genetic hybridization of IFN with long-lived human blood proteins, such as serum albumin [Bain et al., 2006; Subramanian et al., 2007; Nelson et al., 2009a, 2009b; Zeuzem 2009, 2009], or with a fragment of immunoglobulin [Jones et al., 2004], or with a fragment of an antibody that provides non-covalent binding to human serum albumin directly in the bloodstream [Walker et al., 2010]. However, the drug Albinterferon-alfa-2b (Human Genome Sciences Inc and Novartis AG), proposed for the treatment of chronic hepatitis C, has not received approval from regulatory agencies in the United States (FDA) and the EU (EMA) [http://seekingalpha.com/article/ 258673-human-genome-sciences-evenly-poised-after-fda-approval];

• genetic hybridization of IFN with artificial polypeptides that contain N-glycosylation sites and replicates of glycine, aspartic acid and glutamic acid residues predominate [US 20090298762];

• genetic hybridization of IFN with a polyanionic polypeptide from glutamic acid residues (84 and 173 residues) in E. coli cells [US 20020169125, AU 2002252429, WO 02077036]. The protein is not secreted and requires a long and time-consuming purification from both other intracellular proteins and cellular endotoxins;

• genetic hybridization of IFN with the C-terminal peptide (CTP) of the β-subunit of human chorionic gonadotropin containing 28 amino acid residues forming four O-glycosylation sites [US 20120015437]. One or more copies of CTP attached to the C-terminus of the molecules significantly prolongs the lifetime of therapeutic proteins in the blood plasma [US 2012035101, US 2012015437, US 2012004286, US 2011286967, US 2010317585, US 2010081614, US 5759818]. The use of CTP technology is limited by the need to obtain modified proteins exclusively in animal cells that ensure correct O-glycosylation;

• a genetic change in the natural sequence of IFN with the goal of constructing N-glycosylation sites. Modified in this way IFN produced in the culture of CHO cells contains four or five N-carbohydrate chains and has a 25-fold increased life time in the bloodstream [US 2012134960]. It is characterized by an increase in antitumor activity, but a decrease in specific antiviral activity in vitro. This method of obtaining prolongation, based on a change in the natural sequence of IFN, is fraught with a violation of the patient’s immune status, and its preparation is based on the use of expensive cell cultures.

The practical implementation of the above methods in most cases does not allow to optimize the process of obtaining a prolonged IFN by using more productive and / or cheaper expression systems, since it is limited by the choice of host cells suitable for biosynthesis of the modified protein.

Such restrictions are deprived of the method of prolongation using polypeptide technology, which involves the genetic hybridization (conjugation) of proteins with highly soluble, chemically and immunologically inert unstructured polypeptides (NPs), capable of mimicking the behavior of PEG molecules under physiological conditions. Such NPs in aqueous solutions under physiological salt, temperature, and buffer conditions are resistant to folding (formation of the tertiary structure), aggregation, nonspecific adsorption, and maintain a stable disordered type of “ball”, even when genetically conjugated with ordinary structured proteins. A constant change in the conformation of nanowires caused by thermal motion leads to a more or less constant averaged cotton-like structure, the molecular size of which depends only on the number of amino acid residues in the nanopowder, their intrinsic size (diameter), and conformational flexibility. In this regard, NPs can mediate a significant increase in the hydrodynamic volume of conjugated proteins, which causes a weakening of renal filtration and lengthens the lifetime of proteins in blood plasma [Binder & Skerra, 2012].

The use of NPs for protein prolongation has advantages over chemical modification using PEG, in particular:

• proteins modified by this technology can be expressed both intracellularly and secreted in various types of cells, including bacteria and yeast, which makes it possible to significantly reduce the cost and speed up their production and purification;

• modifying NPs have extremely low immunogenicity and, like PEG, are able to screen foreign proteins from recognition by the immune system;

• modifying NPs are biodegradable, which significantly reduces the risk of toxicity or accumulation in any organs (for example, in the kidneys or liver) or cells (for example, in macrophages);

• the genetically encoded sequence of NPs guarantees the immutability and accuracy of protein modification;

• since the internal sequences of NPs, as a rule, do not interact with each other or with the sequences of the protein with which NPs are conjugated, modified proteins retain specific activity at the level of unmodified analogues;

• selection of the size of the prolonged NP allows the construction of proteins with a medically reasonable level of prolongation.

In general terms, these characteristic features are characteristic of three known types of NPs that can prolong the action of proteins up to 100 times:

1) XTEN polypeptides containing a random alternation of 6 amino acid residues of alanine, glutamic acid, glycine, proline, serine and threonine [EP 2402754, US20110312881, WO 2011123830, WO 2011123813, US 20110151433, US20100323956, WO 201O0101502, 2748314, WO2007103515, US 7846445, US 7,855,279; Geething et al., 2010; Schellenberger et al; 2009];

2) PAS polypeptides containing proline, alanine and serine residues [WO 2011144756, NZ 580670, US 20100292130, EP 2173890, WO 2008155134, Skerra, 2010];

3) HAP (or OH8) -polypeptides that are glycine-rich sequences [Schlapschy et al., 2007; WO2007103515] containing residues of glycine (G) and serine (S).

The prolongation of the action of IFN through the use of NP PAS has been shown, the smallest size of which was about 200 amino acid residues [Skerra, 2010; EA 201000040].

The presence of prolonging activity against IFN has not been established for NAP polypeptides; moreover, an example is known that proves the absence of prolonging activity in NP NAP with a size of less than 200 amino acid residues in relation to a fragment of one of the antibodies [Schlapschy et al., 2007].

As the closest analogue of the claimed protein, let us consider a hybrid protein that has a prolonged action in animals and is a PAS-IFN hybrid protein, which includes, from the N-terminus (1), the Strep-tag II affinity tag, which facilitates the purification of the hybrid protein using affinity chromatography with streptavidin, (2) PAS NP, consisting of 200 residues of proline, alanine and serine, and (3) a sequence of interferon alpha-2b having a mass of 20.9 kDa, which differs from the calculated mass of native interferon al a-2b human - 19.3 kDa [EA 201 000 040].

The method of producing the nearest analogue protein is carried out in E.coli bacteria cells by microbiological synthesis with secretion into the periplasm and then carefully separating the periplasmic protein fraction from the cell cytoplasmic proteins, affinity purification of the target protein using streptavidin and its purification from cellular endotoxins. In this case, the yield of the analog protein after affinity purification did not exceed 0.1 mg / L / OD.

The obtained protein, the closest analogue, showed specific activity at the level of unmodified IFN and increased life time in rat organisms, similar to PEG-IFN variants.

The method for producing the proximate analogue protein by culturing E.coli bacteria, in contrast to the claimed one, does not allow to obtain the target protein secreted into the extracellular medium, and the level of production of the analogue protein is almost 30 times lower than the production level of the claimed protein according to the claimed method. Moreover, the yield of the protein closest to the analogue is even overestimated, since the method of affinity chromatography with streptavidin used for its purification requires additional purification of the target protein from bacterial endotoxins and, consequently, leads to additional losses.

It is known that one of the main assessments of the effectiveness of IFN drugs is the level of cure (SVR) of HCV patients, which correlates with the size of a single dose due to the specific activity of IFN and the “half-life” of IFN drugs from the body [Pasut, 2009]. An analysis of the data [Pasut, 2009] characterizing PEG-IFN preparations in comparison with the standard IFN (Table 1) suggests that a protein preparation that is characterized by a physiologically moderate 3-4-fold prolongation and a high level of standard IFN specific activity. The advantages of such a preparation can also be the mode of administration facilitated in comparison with the standard IFN, for example, 2 times instead of 3 times a week, while maintaining the cost at the level of the standard IFN.

Table 1 Comparative characteristics of injectable forms of IFN [according to Pasut, 2009] Characteristic Standard IFN PEG-IFN Pegasys Peglntron Specific (antiviral) activity,% one hundred 7 28 Half-life, h 4-16 61-110 27-39 SVR (with ribavirin),% 38-43 54-56 SVR (without ribavirin),% 16-20 36-39 23 HCV treatment regimen (doses per week) 3 one one The size of 1 averaged dose, million ME 3 2,5 6.7 Size 1 average dose, mcg fifteen 180 120 (1.5 mcg / kg)

The task of the claimed group of inventions is to expand the arsenal of proteins based on recombinant human interferon alpha-2 with a prolonged action, and to develop a method for their preparation.

The problem is solved by developing:

- a hybrid protein GFN80, which has a prolonged action and is a recombinant human interferon alpha-2, fused from the N-terminus with the amino acid sequence of the S (G4S) 16 polypeptide, where S is the serine residue, and G is the glycine residue;

- a hybrid protein GFN100, which has a prolonged action and is a recombinant human interferon alpha-2, fused from the N-terminus with the amino acid sequence of the S (G4S) 20 polypeptide, where S is the serine residue and G is the glycine residue;

- a method for producing a hybrid protein GFN80 or GFN100 by culturing under suitable conditions Saccharomyces cerevisiae yeast transformed with an expression vector that contains a replication initiation region of the endogenous 2 μm Saccharomyces cerevisiae yeast plasmid, as well as a yeast GAL1 promoter that controls expression of a gene including the SEQ ID DNA sequence NO: 1 or SEQ ID NO: 2, respectively, with subsequent isolation of the fusion protein from the culture fluid, as well as the construction of:

- strain Saccharomyces cerevisiae VKPM Y-3927 - producer of the hybrid protein GFN80 obtained by introducing the nucleotide sequence of SEQ ID NO: 1 in the plasmid p71-81 in the cells of the recipient, which is a plasmid-free derivative of the strain Saccharomyces cerevisiae VKPM Y-3550 [RU 2427645];

- strain Saccharomyces cerevisiae VKPM Y-3928 - producer of the hybrid protein GFN100 obtained by introducing the nucleotide sequence of SEQ ID NO: 2 as part of plasmid p71-82 in the cells of the recipient, which is a plasmid-free derivative of Saccharomyces cerevisiae strain VKPM Y-3550.

Stages of designing producer strains of the claimed hybrid proteins

Step 1. A DNA fragment is synthesized having open “sticky” ends identical to the “sticky” ends created by the restriction enzymes BglII and BamHI, and the coding polypeptide S (G4S) 4, where S is the residue of serine, and G is the residue of glycine. Directionally clone this synthetic DNA fragment in a suitable laboratory vector, digested at unique BglII and BamHI restriction enzyme recognition sites.

Stage 2. Using routine methods of genetic engineering, multimerization of the original synthetic DNA fragment cloned in stage 1 is carried out, and plasmids containing DNA fragments encoding S (G4S) 16 and S (G4S) 20 polypeptides are obtained, where S is the residue of serine, and G is the residue of glycine.

Step 3. Construct auxiliary plasmids and target expression plasmids p71-81 and p71-82, which correctly fuse the DNA sequences encoding the promoter region of the yeast GAL1 gene, the leader pre-pro region of the yeast α-factor and the amino acid sequence S (G4S) 16 or S (G4S) 20, respectively, and the structural gene of mature human interferon alpha-2b.

Step 4. Get the recipient strain of S. cerevisiae SCR8G1. For this purpose, cells of the museum strain of S. cerevisiae VKPM Y-3550 containing a recombinant plasmid are freed from the recombinant plasmid contained in them. Clones of the strain S. cerevisiae SCR8G1 are selected for lack of growth on an agar medium with glucose of 20 mg / ml, determined by the absence in the cells of the strain S. cerevisiae SCR8G1 of a recombinant plasmid carrying the functional allele of the PGK1 gene.

Step 5. Get the claimed strains of S. cerevisiae VKPM Y-3927 and S. cerevisiae VKPM Y-3928. For this purpose, the cells of the recipient strain S. cerevisiae SCR8G1 are transformed with recombinant plasmids p71-81 or p71-82, respectively, containing the functional allele of the PGK1 gene. Transformants are selected for their ability to grow at a temperature of 30 ° C on an agar medium with glucose of 20 mg / ml.

They confirm the ability of the obtained transformants to secrete target hybrid proteins and deposit them in the All-Russian Collection of Industrial Microorganisms (VKPM).

The result is the claimed strains:

- SCR-8G1 / p71-81 (lab name GFN80-Sc :, Saccharomyces cerevisiae VKPM Y-3927)

- SCR-8G1 / p71-82 (lab name GFN100-Sc :, Saccharomyces cerevisiae VKPM Y-3928)

Characterization of the claimed strains producing hybrid proteins

Description of producer strains

The inventive strains VKPM Y-3927 and VKPM Y-3928 contain the genes of the target hybrid proteins GFN80 or GFN100 as part of recombinant episomal plasmids p71-81 or p71-82, respectively, each of which provides the expression of the gene of the target hybrid protein under the control of the yeast promoter GAL1 and has following properties:

- the plasmid contains: the origin of replication of the endogenous 2-μm yeast plasmid, i.e. able to be maintained in yeast cells in an episomic multi-copy state; genes of orotidine 5-phosphate decarboxylase (URA3) and yeast 3-phosphoglycerate kinase (PGK1) capable of serving as selective markers, the sequence of the bacterial plasmid pUC19, as well as the expression cassette with the GFN80 or GFN100 fusion protein gene;

- the expression cassette contains the DNA sequence of the promoter region of the yeast gene GAL1, the DNA sequence of the structural gene MFα1 encoding the pre-prodrug peptide of the pheromone sex pheromone (α factor) yeast, the DNA sequence of the structural gene of the target hybrid protein GFN80 or GFN100 and the DNA sequence of the region termination of transcription of the CYC1 gene of yeast. The secretion of the target hybrid protein in the cells of the producer strain is directed by the N-terminal yeast α-factor leader sequence, which is removed from the target hybrid protein during intracellular transport. The combination of a strong promoter and a high dose of the gene in the multi-copy plasmid together provide a high level of secretion of the target hybrid proteins GFN80 or GFN100 in the cells of the claimed strains.

The inventive producer strains of S. cerevisiae VKPM Y-3927 and VKPM Y-3928 are diploid prototrophic strains. The diploid status of the cells of these strains provides increased stability of their characteristics. In the genome of the claimed strains there is a homozygous mutation in the 3-phosphoglycerate kinase gene, which provides the pgk1 / pgk1 genotype. This mutation limits the ability of the plasmid-free cells of the claimed strains to grow on any media containing any single carbon source that is digested by S. cerevisiae yeast. The presence of the functional allele of the 3-phosphoglycerate kinase gene (PGK1) in the episomal expression plasmid p71-81 or p71-82 provides for the selective growth of the plasmid-containing cells of the claimed strains under these conditions and for the selective maintenance of plasmids in growing cells.

The cells of the claimed strains contain a homozygous mutation in the GAL80 gene - genotype gal80 :: LEU2 / gal80 :: LEU2. The gal80 mutation is responsible for the inactivation of the protein repressing the GAL1 promoter, which leads to a change in regulation and allows galactose-independent activation of the GAL1 promoter that controls the expression of the target fusion proteins.

Cells of the claimed strains contain in the genome the Kex2 proteinase gene of S. cerevisiae yeast secreted into the extracellular medium under the control of the yeast GAL1 promoter, which contributes to an increase in the production of target hybrid proteins.

Cells of the claimed strains contain a homozygous mutation in the YPS1 gene in the genome - the genotype yps1 :: TRP1 / ypsfile: // l: / TRPl, which leads to the inactivation of Yps1 proteinase, which is responsible for the degradation of interferon and, presumably, interferon-containing hybrid target proteins [RU 2427645].

Due to the fact that the synthesis of the target hybrid proteins in the cells of the claimed strains is carried out under the control of the GAL1 promoter, which is repressed by glucose, the secretion of the target hybrid proteins into the culture medium is induced when the sugar concentration in the medium decreases to less than 2 mg / ml.

Genotypic characters of Saccharomyces cerevisiae VKPM Y-3927:

а / α leu2 / leu2 ura3 / ura3 trp1 / trp1 pgk1 :: URA3 / pgk1 :: URA3 gal80 :: LEU2 / gal80 :: LEU2 lys7 / LYS7 his3 / HIS3 his4 / HIS4 yps1 :: TRP1 / yps1v :: TRP1 ATH1 / ath1: :( ADH1-G418, TDH3-KEX2A) STA2 / STA2 suc0 / SUC2) / p71-81

The cells of the VKPM strain Y-3927 contain an episomal plasmid p71-81. Saccharomyces cerevisiae VKPM Y-3928:

а / α leu2 / leu2 ura3 / ura3 trp1 / trp1 pgk1 :: URA3 / pgk1 :: URA3 gal80 :: LEU2 / gal80 :: LEU2 lys7 / LYS7 his3 / HIS3 his4 / HIS4 yps1 :: TRP1 / yps1v :: TRP1 ATH1 / ath1: :( ADH1-G418, TDH3-KEX2A) STA2 / STA2 suc0 / SUC2) / p71-82

The cells of the VKPM strain Y-3928 contain an episomal plasmid p71-82.

Cultural and morphological features

When cultured at a temperature of 28 ° C for 48-96 hours on agarized nutrient media of the inventive strains form colonies. Moreover, the cells of the claimed strains have a round or oval shape, 3-7 microns in diameter, are budded. True budding, many-sided, they do not form a true mycelium.

Colonies are as follows:

1) on a YPD agar medium (composition in wt.%: Bactopeptone - 2, yeast extract - 1, bactoagar - 2, glucose - 2, water - the rest) - white colonies, opaque, with a smooth edge, matte surface, lenticular profile and creamy consistency;

2) on an agar medium with starch (composition in wt.%: Peptone - 2, yeast extract - 1, starch - 1, agar - 2, water - the rest) - white colonies with a patterned edge, matte surface, lenticular profile and grained consistency.

When growing in a liquid medium at a temperature of 28 ° C during the first 24 hours of cultivation, the liquid is cloudy, the precipitate is white, does not clump, and does not form wall films.

Physico-biochemical characteristics

The inventive strains are prototrophic, facultative anaerobes, mesophiles. Growth is possible in the temperature range of 10-37 ° C, the optimum temperature for growth is 29 ± 1 ° C, however, they are resistant to elevated temperature, capable of growth at 37 ° C. They are capable of growth at pH values of 3.8-7.4 (optimal pH range is 4.7-5.5).

Assimilation of carbon sources

The inventive strains ferment glucose, fructose, maltose, sucrose, dextrins, starch. Do not ferment lactose, galactose, inulin, xylose, arabinose. Strains are capable of growth in a starchy environment.

Assimilation of nitrogen sources

Peptone, yeast extract, amino acids, ammonium sulfate, ammonium nitrate are used as nitrogen sources.

Target Protein Synthesis

The inventive strains synthesize hybrid target proteins, which include the amino acid sequence of native human interferon alpha-2b. The full activation of the synthesis of target hybrid proteins occurs when the concentration of the fermentable carbon source in the cultivation medium decreases to an unfermentable level or when the strains grow in media containing exclusively unfermentable carbon sources. Under these conditions, strain cells secrete target fusion proteins into the culture medium.

Conditions and composition of media for long-term storage of strains

The cell suspension of the claimed strains is stored in a 15% glycerol solution at minus 70 ° C.

A method of obtaining a hybrid protein in General

For inoculation of the fermenter, a seed culture is obtained by culturing the producer strain of the target hybrid protein in an environment of the following composition, in wt.%: Peptone 1-3; yeast extract 0.5-3; glucose 1-3, water - the rest, the pH of the medium is natural for 16-40 hours at a temperature of 22-32 ° C on an orbital rocking chair 100-350 rpm

A fermenter (0.5-1000 L) containing a fermentation medium of the following composition, in wt.%: Peptone 1-3; yeast extract 0.5-3, glucose or sucrose 1-4, water - the rest, pH - natural. The amount of seed culture introduced into the fermenter is 3-15% of the volume of the fermentation medium.

Fermentation is carried out at 22-32 ° C, aeration of 0.5-1000 l / min and the mixing speed of the culture 100-1500 rpm 16-30 hours after the inoculation of the fermenter, the process is carried out without recharge or they are replenished with a 30-60% glucose or sucrose solution at a rate of 2-10 g / l / h and the pH-setting of the culture is established in the pH range 5.0-7.2. The total duration of fermentation is 38-68 hours

The production of the secreted target fusion protein under such conditions is at least 0.12 g / l.

Purification of the fusion protein from the yeast culture medium is carried out as described [RU 2427645].

The result is at least 0.05 g of the target hybrid protein from 1 liter of culture fluid.

Example 1. Construction of a recombinant plasmid pGS-4.

A DNA fragment is synthesized having open “sticky” ends identical to the “sticky” ends created by the restriction enzymes BglII and BamHI, and the coding polypeptide S (G ₄ S) ₄ , where S is the serine residue and G is the glycine residue.

SGGGGSGGGGSGGGGSGGGGS

5'-GATCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCCGGAGGTGGTGGTTCTGGTGGTGGTG

ACCACCACCACCAAGACCACCACCACCAAGGCCTCCACCACCAAGACCACCACCACCTAG-5 '

The recombinant plasmid pGS-4 is constructed on the basis of any suitable laboratory vector, for example, on the basis of a modified pUC19Bgl vector in which the EcoRI restriction enzyme recognition site is replaced by the BglI restriction enzyme recognition site. To this end, the synthetic DNA fragment is cloned into a selected vector, split at the BglII and BamHI sites so that the cloning sites are restored as part of the resulting plasmid.

The result is a recombinant plasmid pGS-4 containing a cloned synthetic DNA fragment.

Example 2. Construction of a recombinant plasmid pGS-16.

Stage 1. The recombinant plasmid pGS-4 is digested using restriction enzymes AatII and BamHI and the resulting restriction fragments are separated in a gel. A smaller DNA fragment is eluted from the gel and is called fragment-1.

Stage 2. The recombinant plasmid pGS-4 is digested using restriction enzymes AatII and BglII and the resulting restriction fragments are separated in a gel. The larger DNA fragment is eluted from the gel and is called fragment-2.

Fragments 1 and 2 obtained in stages 1 and 2, respectively, are ligated with each other and the resulting plasmid is called pGS-8.

Steps 1 and 2 are repeated except that the plasmid pGS-8 is used at each step. The result is the plasmid pGS-16. Plasmid pGS-16 contains a BglII / BamHI DNA fragment encoding the S (G4S) 16 polypeptide, where S is the serine residue and G the glycine residue.

Example 3. Construction of a recombinant plasmid pGS-20.

The AatII / BamHI DNA fragment-1 of the recombinant plasmid pGS-4 obtained as described in Step 1 of Example 2 is ligated with the AatII / BglII DNA fragment-2 of the plasmid pGS-16 DNA obtained as described in Step 2 of Example 2.

The result is the plasmid pGS-20. Plasmid pGS-20 contains a BglII / BamHI DNA fragment encoding the S (G4S) 20 polypeptide, where S is the serine residue and G the glycine residue.

Example 4. Construction of a recombinant plasmid pUC18x- (Ser) IFN.

To construct the recombinant plasmid pUC18x- (Ser) IFN, two DNA fragments are ligated: 1) a BamHI / XhoI fragment containing the vector part of the laboratory plasmid pUC18x containing the XhoI site instead of the EcoRI site in the modified polylinker; 2) BamHI / XhoI DNA fragment, which is obtained by PCR amplification of a DNA fragment of plasmid pUC18x-GAL1ppI-IFN2b [RU 2427645] using primers N499 (5'-ataggatcctgtgatctgcctcaaacccac) and N169 (5-step using restriction enzymes BamHI and XhoI.

Plasmid pUC18x- (Ser) IFN contains the nucleotide sequence of the structural gene of human interferon alpha-2b in the BamHI / XhoI DNA fragment.

Example 5. Construction of a recombinant plasmid pUC18x-GAL1ppI- (Ser).

Plasmid pUC18x-GAL1ppI- (Ser) is constructed by replacing the NcoI / XhoI DNA fragment of plasmid pUC18x-GAL1ppI-IFN2b [RU 2427645] with a double-stranded synthetic DNA fragment obtained by annealing the corresponding oligonucleotides:

5′-catggaaaaaagagctctc

cttttttctagagagct-5 ′

As a result of cloning, plasmid pUC18x-GAL1ppI- (Ser) is obtained, in which, in the DNA sequence fused to the promoter region of the yeast GAL1 gene and encoding the leader pre-pro region of the yeast α-factor, a BglII restriction enzyme recognition site is constructed, formed by the arginine codon entering to the Keh2 proteinase recognition site, and the serine codon immediately following the arginine codon.

Example 6. Construction of recombinant plasmids p71-81.

The plasmid pPDX3-IFN2b is used, which differs from the plasmid pPDX2-IFN2b [RU 2427645] by a single nucleotide substitution of G by A at position +211 relative to the ATG start codon in the DNA sequence of the yeast URA3 structural gene [in codon 71 (GAG → AAG)] leading to inactivate the NcoI restriction enzyme recognition site.

The design is carried out by simultaneous directional ligation of 4 DNA fragments, which are:

HindIII / BglII DNA fragment of plasmid pUC18x-GAL1ppI- (Ser), comprising the promoter region of the yeast GAL1 gene, fused to a DNA sequence encoding a leader pre-pro region of yeast α-factor;

BglII / BamHI DNA fragment of the plasmid pGS-16 encoding the polypeptide S (G ₄ S) ₁₆ , where S is the residue of serine, and G is the residue of glycine;

BamHI / XhoI DNA fragment of the plasmid pUC18x- (Ser) IFN, comprising the nucleotide sequence of the structural gene of human interferon alpha-2b;

XhoI / HindIII DNA fragment containing the vector part of the plasmid pPDX3-IFN2b.

The result is a recombinant plasmid p71-81 with a size of 9352 bp, which correctly fuses the genetic elements encoding the leader pre-pro region of the yeast α-factor, the amino acid sequence S (G ₄ S) ₁₆ and the sequence of native interferon alpha-2b person.

Example 7. Construction of recombinant plasmids p71-82.

The recombinant plasmid p71-82 was constructed as described in Example 6, but instead of the DNA fragment of the plasmid pGS-16, the BglII / BamHI DNA fragment of the plasmid pGS-20 encoding the S (G ₄ S) ₂₀ polypeptide, where S is the residue of serine, is used for ligation G is the residue of glycine.

The result is a recombinant plasmid p71 - 82 with a size of 9412 bp, which correctly fuses the genetic elements encoding the leader pre-pro region of the yeast α-factor, the amino acid sequence S (G ₄ S) ₂₀ and the sequence of native interferon alpha-2b person.

Example 8. Obtaining a recipient strain of Saccharomyces cerevisiae SCR8G1.

The recipient strain is a plasmid-free derivative of the Saccharomyces cerevisiae VKPM Y-3550 strain containing the plasmid.

To obtain a recipient strain, cells of the strain S. cerevisiae VKPM Y-3550 are freed from the plasmid contained in them by culturing for 4 days at a temperature of 30 ° C on a YPGE agar medium of the following composition, in wt.%: Bactopeptone-2, yeast extract - 1, bactoagar - 2, ethanol - 2, glycerin - 3, water - the rest. On this medium, cells of the VKPM Y-3550 strain carrying the plasmid containing the PGK1 gene and cells of the recipient strain SCR8G1 that have lost this plasmid are also capable of growth. Then the mixture of grown cells is cloned.

Clones that have lost the plasmid are selected for the absence of growth on the YPD agar medium of the following composition, in wt.%: Bactopeptone - 2, yeast extract - 1, bactoagar - 2, glucose - 2, water - the rest. As a result, the recipient strain S. cerevisiae SCR8G1 is obtained, which differs from the strain S. cerevisiae VKPM Y-3550 by the lack of growth ability on a medium with glucose of 20 mg / ml, determined by the absence in the cells of strain SCR8G1 of a plasmid carrying the functional allele of the PGK1 gene.

Example 9. Obtaining a strain VKPM Y-3927.

Strain S. cerevisiae VKPM Y-3927, producer of the GFN80 protein, is obtained by transforming the cells of the recipient strain S. cerevisiae SCR8G1 with recombinant plasmid p71-81.

To prepare for transformation, cells of the original S. cerevisiae strain SCR8G1 were cultured for 18-24 hours at 28 ° C on YPGE agar medium. Transformation of grown cells with plasmid p71-82 is carried out according to the Ito method [Ito et al., 1983], except that before seeding on selective medium, transformed cells are incubated for 3 hours at a temperature of 30 ° C on a shaker at an orbital speed of 250 rpm in liquid medium YPGE. Transformants are selected for their ability to grow at a temperature of 30 ° C on agar medium YPD.

Assess the level of expression of GFN80 protein by the cells of the obtained transformants. For this, 3 independently obtained clones of transformants are grown for 46 hours at a temperature of 30 ° C on a shaker with an orbital speed of 250 rpm in a liquid YPD medium to a stationary growth phase (to an optical density of 45 ± 5 opt. Units). The level of accumulation of the claimed protein is determined in a cell-free culture medium. A clone producing a protein having mobility under electrophoresis of 25 kilodaltons is selected.

The result is a strain of S. cerevisiae VKPM Y-3927 - producer of the protein GFN80.

The producer strain S. cerevisiae VKPM Y-3927 differs from the recipient strain S. cerevisiae SCR8G1 by its ability to grow on a medium with glucose of 20 mg / ml, and from the strain S. cerevisiae VKPM Y-3550 by the ability to produce protein GFN80 determined in the composition of the strain with plasmid p71-81.

Example 10. Obtaining a strain VKPM Y-3928

The strain S. cerevisiae VKPM Y-3928, producer of the GFN100 protein, was prepared as described in Example 9, except that the recombinant plasmid p71-82 was used for transformation.

A clone producing the GFN100 protein having mobility under electrophoresis of 31 kilodaltons is selected.

The result is a strain of S. cerevisiae VKPM Y-3928 - producer of the protein GFN100.

The producer strain S. cerevisiae VKPM Y-3928 differs from the recipient strain S. cerevisiae SCR8G1 by its ability to grow on a medium with glucose of 20 mg / ml, and from the museum strain VKPM Y-3550 by the ability to produce GFN100 protein, determined in the composition of the strain with plasmid p71-82.

Example 11. Microbiological synthesis of the protein GFN8Q using strain VKPM Y-3927.

To obtain seed, the strain S. cerevisiae VKPM Y-3927 is grown in YPD medium on a shaker (250 rpm) at a temperature of 28 ° C for 20-24 hours

50 ml of seed is used for sowing 3 l of Anglicon fermenter, containing 950 ml of medium 223 of the following composition, in wt.%: Bactopeptone - 2, yeast extract - 2, sucrose - 3, water - the rest. Fermentation is carried out at a temperature of 28 ° C, aeration of 1 l / min and a stirring speed of 1000 rpm. 24 hours after inoculation of the fermenter, pH-stating of the culture is carried out at pH 5.9 using solutions of 10% sulfuric acid and 10% NaOH for subtraction. The total fermentation time is 46 hours

The production of the mature secreted protein GFN80 by the strain S. cerevisiae VKPM Y-3927 under these conditions is more than 150 mg / L.

Example 12. Microbiological synthesis of protein GFN100 using strain VKPM Y-3928.

Microbiological synthesis of the GFN100 protein is carried out as described in example 11, but using strain S. cerevisiae VKPM Y-3928.

The production of the mature secreted protein GFN100 by the strain S. cerevisiae VKPM Y-3928 under these conditions is more than 120 mg / L.

Example 13. Purification of the inventive protein GFN80 and determination of its specific activity.

Isolation and purification of GFN80 protein from the culture fluid obtained by microbiological synthesis of interferon using strain VKPM Y-3927 (example 11) is carried out at 4-8 ° C, using the following steps:

1. The culture fluid containing the GFN80 protein is separated from the yeast biomass by centrifugation at 8500g for 20 minutes.

2. Further purification of the GFN80 protein from the obtained centrifugate is carried out using cation exchange chromatography on SP-Sepharose Fast Flow media (GE Healthcare). For this, the solution obtained after separation of the cells is acidified with acetic acid to a pH of 4.3 ± 0.1. The acidified solution was passed through a column of SP-Sepharose balanced with a 50 mM solution of sodium acetate buffer, pH 4.3, containing 1 mM EDTA (buffer A). After the filtrate passed through the column and the column was washed with buffer A, the GFN80 protein was eluted with a solution of 0.5 M NaCl in buffer A.

3. Fine purification of GFN80 protein from the obtained eluate is carried out using preparative reverse phase High Performance Liquid Chromatography (of HPLC). For this, a protein solution is applied to a column with a Vydac C18 sorbent, balanced with a 0.2% solution of trifluoroacetic acid (buffer B). The GFN80 protein is eluted with a gradient of acetonitrile in buffer B (according to the program: from 0 min to 15 min - 0% B; from 15 min to 40 min - from 0% to 45% B; from 40 min to 60 min - 45% B). The eluate is immediately diluted 5 times with 5 mM sodium acetate buffer, pH 4.0 (buffer C).

4. The resulting diluted protein solution is subjected to further purification by ion exchange chromatography on a column with SP-Sepharose sorbent. The column is equilibrated with buffer C, a protein solution is applied, and the column is washed with the same buffer. GFN80 protein is eluted with 0.5 M sodium chloride in buffer C.

The performance characteristics of the stages of isolation and purification of GFN80 protein from the culture fluid are given in table 2.

The specific biological activity of the isolated and purified GFN80 protein is determined by the method of La Bonnardiere & Laude [1981] in a culture of transplantable MDBK cell lines (ATCC No. CCL-22) sensitive to alpha-type interferon in comparison with the international standard sample (MCO) (WHO International Standard INTERFERON ALPHA 2b, (Human rDNA derived) NIBSC code 95/566) against the indicator virus. As an indicator virus, use the virus of vesicular stomatitis (BBC) strain "Indiana" GKV GU Research Institute of Virology named. DI. Ivanovo RAMS (deposit No. 600) with an infectious titer of at least 10 ^-5 TCD ₅₀ / ml or the mouse encephalomyocarditis virus (EMC) STB GU Research Institute of Virology named after DI. Ivanovo RAMS (deposit No. 787) with an infectious titer of at least 10 ^-5 TCD ₅₀ in 1 ml.

table 2 The summary results of the stages of purification of GFN80 protein from the culture fluid of the producer strain VKPM Y-3493 Stage Stage Description Cleaning method Stage Efficiency (%) The output of interferon GFNa-80 (%) 0 Culture fluid - - one hundred one Biomass separation Centrifugation 90 90 2 Capture Cation exchange chromatography on SP-Sepharose 80 72 four Fine cleaning Reverse Phase Chromatography C18 75 54 5 Concentration Cation exchange chromatography on CM-Sepharose 76 41

The specific activity of the obtained GFN80 protein is 1.3 × 10 IU / mg.

Example 14. Purification of the synthesized protein GFN100 and determination of its specific activity.

Isolation from the culture fluid, purification and determination of the specific activity of the GFN100 protein is carried out as in example 13, except that the VKPM strain Y-3928 is used.

The specific activity of the obtained GFN100 protein is 1.1 × 10 IU / mg.

Example 15. Determination of pharmacokinetic parameters of the claimed proteins relative to standard interferon.

Male Balb / C × DBA mice weighing 25-27 g are used, which receive standard granular feed and ad libitum water. The night before the administration of drugs, the food is removed, immediately before the experiment, drinking water is also removed, returning access to it for animals after blood sampling 2 hours after administration of the test drug. Animals are fed on the day of the experiment after blood sampling 6 hours after the administration of the studied drugs.

Solutions of the studied preparations for administration to animals are prepared immediately before use. The preparations are diluted with a sterile 10 mM phosphate buffer pH 7.4 containing NaCl at a concentration of 150 mM to a concentration of 20 μg / ml for iv (intravenous) or 40 μg / ml for iv (intramuscular) administration. For all methods of administration, the dose per animal is 2 mcg. Intravenous drug solutions were injected into the right retroorbital sinus at 100 μl per mouse. When administered intramuscularly, the drug solutions were injected into the thigh muscles of 50 μl per mouse. In the experiment, 10 animals are used.

After the introduction of the animals at the established time points take blood from the left retroorbital sinus of 50 μl. In each experiment, 8 time points are used for selection from the time of administration: 1, 5, 15, 30, 120, 300-360, and 1440 minutes after administration. Blood samples from each animal are taken no more than 5 times according to the scheme (Table 3):

Table 3 Animal blood sampling Mouse number Time after administration, min one 5 fifteen thirty 120 275 1440 one + - + - + - + 2 + - + - - + + 3 + - + - + - + four + - - + - + + 5 - + + - + - + 6 - + + - - + + 7 + - - + + - + 8 - + - + - + + 9 - + - + + - + 10 - + - + - + +

Blood samples were taken in eppendorf tubes, incubated at room temperature until a clot formed, after which the serum was separated by centrifugation and frozen at -20 ° C until the level of the target protein was determined.

Analysis of the target protein content in the obtained serum samples is carried out using an enzyme-linked immunosorbent assay system specific for interferon alpha-2 (alpha-INTERFERON-IFA-BEST kit, A-8758, manufactured by Vector-Best CJSC).

As a standard for enzyme-linked immunosorbent assay (ELISA) use the preparation of the protein that was administered to animals in the experiment. Before analysis, serum samples are diluted to the working concentration with the standard buffer attached to the test system.

As a standard interferon, which serves as a reference model, use the drug "Interferal" produced by the State Research Institute of Occupational Health and Safety (St. Petersburg, Russia).

The data obtained is subjected to mathematical processing. The analysis of pharmacokinetic parameters is performed on the basis of experimentally obtained values of the concentration of the studied drugs in blood serum, measured at different times after administration of the drug. To describe the pharmacokinetics, the following standard indicators are used and determined [Guide, ed. Khabrieva, 2005].

D - the entered dose (ng / individual)

C (t _i ) - concentration at time t _i (ng / ml)

C _max - maximum concentration (ng / ml)

T _max - time to reach maximum concentration (min)

T _half - drug _half -life (min)

AUC _∝ - total area under the concentration curve (min · ng / ml)

AUCM _∝ - total area under a 1-moment concentration curve (min ² · ng / ml)

MRT = AUCM _∝ / AUCM _∝ - average retention time (min)

Cl = D / AUC _∝ - total clearance (ml / ng / min)

F% = Cl _iv / Cl = AUC * D _iv / AUC _iv * D - bioavailability relative to intravenous (iv) administration.

The indicators are evaluated in a model-independent way that is not based on the agreement of experimental data with any pharmacological model (1-, 2-, ... private), i.e. not suggesting a specific type of function of time (sum of 1, 2, .. exponentials), the values of which should be experimentally measured concentrations.

When calculating the main indicator AUS _∝ (as well as AUCM _∝ ), knowing which it is easy to determine the remaining indicators, the piecewise-linear curve connecting the experimental points C (t _i ,) (t · C (t _i ) for AUCM _∝ ) is taken as the concentration curve , with infinity continuing through the exponent B · exp (-βt) drawn through the last two experimental points and, in the case of intravenous administration, by adding to zero the exponent A · exp (-αt) drawn through the first two experimental points. The area under such a curve is the sum of the areas of the trapezoid plus the area under one or two single-exponential sections.

Calculation of parameters is carried out according to average values for each time point (“function of average”).

The averaged measurement results (Table 4) show that after iv administration to mice of 2 μg interferon-alpha, a rapid exponential decrease in its concentration is observed; after 2 hours, the level in serum is about 2 ng / ml, and after 6 reaches almost undetectable values. After the intramuscular administration of 2 μg of interferon-alpha, the maximum concentration is about 30 ng / ml and is observed 15-30 minutes after administration. A day after the / m administration of this drug in the serum of mice, its traces are not determined.

The inventive proteins demonstrate obvious differences from interferon-alpha in the profile of the concentration of the drug from time to time.

After the iv administration of the GFN80 protein preparations, a decrease in the protein concentration with time is significantly slowed down compared to interferon-alpha, and a certain amount of protein is determined in the blood of animals even 24 hours after administration.

After the i / m administration of the GFN80 or GFN100 protein preparations, the maximum level is observed approximately 2 hours after the administration, and the next day the trace amounts are determined.

Table 4 The dynamics of the concentrations of the studied protein preparations in the blood serum of experimental animals (ng / ml, mean ± standard deviation) A drug Route of administration Time after administration, min one 5 fifteen thirty 120 300-360 1440 Interferon alfa in / in 952 ± 367 288.6 ± 74.0 83.0 ± 22.0 42.6 ± 8.4 2.4 ± 0.6 0.02 ± 0.04 0.00 ± 0.00 Gfn-80 in / in 910 ± 107 654.8 ± 90.5 212.0 ± 30.6 95.2 ± 35.8 17.6 ± 8.5 17.4 ± 8.5 15.0 ± 15.9 Interferon alfa in / m 4,5 ± 1,7 12.8 ± 4.1 30.7 ± 3.3 30.5 ± 1.6 21.1 ± 6.8 2.0 ± 0.7 0.5 ± 0.5 Gfn80 in / m 2.7 ± 1.0 12.8 ± 5.3 26.4 ± 6.3 28.6 ± 6.0 39.9 ± 14.3 8.8 ± 3.3 1.0 ± 0.4 Gfn100 in / m 5.2 ± 0.2 18.9 ± 4.8 30.6 ± 6.2 42.8 ± 15.5 62.0 ± 9.9 18.1 ± 4.4 3.1 ± 0.8

Calculation of pharmacokinetic parameters (Table 5) shows that the bioavailability of interferon-alpha (F%) with i / m administration is about 72%. It should be noted that in view of the relatively rapid elimination of this drug, the total area under the concentration curve (AUG _∝ ) with iv administration of 2 μg interferon-alpha is about 10 μg / ml per minute. The half-life (Thaif) of interferon-alpha after i / v administration is about 8 minutes, after i / m administration - about 2 hours.

Table 5 Pharmacokinetic parameters of interferon alfa with iv and v / m administration Indicator iv introduction v / m introduction D (ng / individual) 2000 2000 T _max (min) 0 22.41 C _max (ng / ml) 1282 34.66 T _half (min) 7.87 124.6 AUC _∝ (min · ng / ml) 8682 6258 AUCM _∝ (min ² · ng / ml) 142417 1116782 Cl (ml / ng / min) 0.23 0.32 MRT (min) 16,4 178 F% one hundred 71.88

Calculation of pharmacokinetic parameters for iv administration of the GFN80 protein preparation confirms significantly delayed elimination of mice from the body compared to interferon-alpha (Table 6). Ground clearance (Cl) GFNa80 - an indicator that determines the rate of protein excretion from blood serum, according to calculations is about 0.05 ml / ng / min, while the clearance of interferon-alpha after iv administration to mice is 0.23 ml / ng / min The total area under the concentration curve for GFN80 protein is about 40 μg / ml per minute, which is 4 times higher than the level for the corresponding indicator for interferon-alpha. The half-life of the GFN80 protein is about 5 hours, whereas for interferon-alpha, this figure does not exceed 8 minutes.

Table 6 Comparative pharmacokinetic parameters of interferon-alpha and protein GFN-80 with intravenous administration of drugs Indicator Interferon alfa Gfn80 D (ng / individual) 2000 2000 T _max (min) 0 0 C _max (ng / ml) 1282 988.1 T _half (min) 7.87 288.5 AUC _∝ (min · ng / ml) 8682 37505 AUCM _∝ (min ² · ng / ml) 142417 16358720 Cl (ml / ng / min) 0.23 0.05 MRT (min) 16,4 436.18

After the intramuscular injection (Table 7) of the GFN80 protein preparation, the maximum serum concentration of the drug is about 40 ng / ml, which is comparable to the corresponding indicator for interferon-alpha, but due to the much slower elimination (half-life is about 4 hours) the total area under the concentration curve is about 14 μg / ml per minute, which is more than 2 times higher than this figure, determined after the on / in the introduction of interferon-alpha.

A comparison of the pharmacokinetic parameters of GFN80 or GFN100 protein preparations with i / m administration (Table 7) shows obvious signs of a longer circulation of the GFN100 protein. Despite the relatively small differences in half-life, due to slower excretion (clearance (Cl) of the GFN100 protein is 0.08 ml / ng / min, GFNa80 is 0.14 ml / ng / min) the total area under the curve of GFN100 protein concentrations almost 2 times higher than this indicator for GFN80 protein.

Table 7 Comparative pharmacokinetic parameters of interferon-alpha and the claimed proteins, calculated for i / m administration of drugs Indicator Interferon alfa Gfn80 Gfn100 D (ng / individual) 2000 2000 2000 T _max (min) 22.41 137.8 140.0 C _max (ng / ml) 34.66 40.25 62.65 T _half (min) 124.6 223.0 281.9 AUC _∝ (min · ng / ml) 6258 13984 24980 AUCM _∝ (min ² · ng / ml) 1116782 3362843 7258855 Cl (ml / ng / min) 0.32 0.14 0.08 MRT (min) 178 240.5 290.6 F% 71.88 37.06 66.25 * * The bioavailability calculation for the GFN100 protein preparation after i / m administration was made in comparison with the i / v administration of the GFN80 protein preparation, which is not entirely correct.

In this way,

- based on human interferon alpha-2, variants of a hybrid protein have been obtained that have a specific antiviral activity exceeding 75% of the activity of standard unmodified interferon and at the same time 2-4 times greater than its lifetime in animal organisms, while currently used prolonged PEG-IFN variants have significantly reduced specific activity;

- for the first time, polypeptides consisting of 81 or 101 amino acid residues of glycine and serine were used for the preparation of human interferon alpha-2 based on human interferon alpha-2, while a polypeptide containing more than 200 amino acid residues represented by proline, alanine and serine;

- the claimed protein has potential therapeutic value, as it allows you to offer a lightweight regimen compared to standard interferon, for example 2 times instead of 3 times a week, while the cost of the claimed protein is expected to remain at the level of the cost of standard unmodified interferon;

- producer strains of variants of the claimed protein are designed based on the yeast Saccharomyces cerevisiae, secreting this protein into the culture fluid, in contrast to the bacterial producer of the protein - the closest analogue that synthesizes this protein intracellularly;

- the developed method for producing the claimed protein, including its microbiological synthesis and subsequent isolation, is simpler and more economical than the method for producing the closest analogue, since it does not require the stage of destruction of producer cells, and allows to simplify the procedure for isolating the structurally complete claimed protein due to the use of a eukaryotic organism as a producer forming bacterial toxins. The level of production of the claimed protein according to the claimed method is almost 30 times higher than the level of production of the method for producing the protein closest analogue;

- the expression of the claimed protein was carried out using the expression system of the yeast Saccharomyces cerevisiae, included in the list of safe organisms for humans, which opens up the possibility of obtaining on the basis of these yeast and other medical proteins with prolonged action.

Information sources

Guidelines for the experimental (preclinical) study of new pharmacological substances (under the editorship of Khabriev R.U.), - M .: "Medicine". - 2005. - 832 p.]

Therapeutic Proteins: Strategies to Modulate Their Plasma Half-Lives, First Edition. Edited by Roland Kontermann. © 2012 Wiley-VCH Verlag GmbH & Co. KGaA

Bain VG, Kaita KD, Yoshida EM, et al. (2006) A phase 2 study to evaluate the antiviral activity, safety, and pharmacokinetics of recombinant human albumin-interferon alfa fusion protein in genotype 1 chronic hepatitis C patients. J Hepatol; 44: 671-678

Binder U., Skerra A. (2012) Half - Life Extension of Therapeutic Proteins via Genetic Fusion to Recombinant PEG Mimetics. Therapeutic Proteins: Strategies to Modulate Their Plasma Half-Lives, First Edition. Edited by Roland Kontermann. © 2012 Wiley-VCH Verlag GmbH & Co. KGaA

Clark V., Nelson D.R. (2009) Novel Interferons for Creation of Hepatitis C Virus. Clin Liver Dis 13: 351-363

Fried MW, Shiffman ML, Reddy KR, et al. (2002) Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl JMed; 347: 975-82

Geething NC, To W., Spink BJ, Scholle MD, Wang CW, Yin Y., Yao Y., Schellenberger V., Cleland J. L. Stemmer WPC, Silverman J. (2010) Gcg-XTEN: an improved glucagon capable of preventing hypoglycemia without increasing baseline blood glucose. PLOS ONE, 5: el0175

Hadziyannis S.J. (2004) Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med; 140: 346-355

Ito H., Fukuda Y, Murata K, Kimura A. (1983) Transformation of intact yeast cells treated with alkali cations. J. Bacteriol 153: 163-168

Jones TD, Hanlon M, Smith BJ, Heise CT, Nayee PD, Sanders DA, Hamilton A, Sweet C, Unitt E, Alexander G, Lo KM, Gillies SD, Carr FJ, Baker MP. (2004) The development of a modified human IFN-alpha2b linked to the Fc portion of human IgGl as a novel potential therapeutic for the treatment of hepatitis C virus infection. J Interferon Cytokine Res. 24 (9): 560-72

Manns MP, McHutchison JG, Gordon SC, et al. (2001) Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomized trial. Lancet; 358: 958-65

Nelson DR, Rustgi V, Balan V, et al. (2009a) Safety and antiviral activity of albinterferon alfa-2b in prior interferon nonresponders with chronic hepatitis C. Clin Gastroenterol Hepatol; 7: 212-218

Nelson D, Benhamou Y, Chuang WL, et al. (2009b) Efficacy and safety results of albinterferon alfa-2b in combination with ribavirin in treatment-nai ^.. ve patients with chronic hepatitis C genotype 2 or 3 [oral presentation]. 44th Annual Meeting of the European Association for the Study of the Liver

Pasut G. (2009) PEGylated interferons: two different strategies to achieve increased efficacy. In PEGylated Protein Drugs: Basic Science and Clinical Applications. Edited by F.M. Veronese. Birkhauser verlag / switzerland

Subramanian GM, Fiscella M, Lamouse-Smith A, et al. (2007) Albinterferon [alpha] -2b: a genetic fusion protein for the treatment of chronic hepatitis C. Nat Biotechnol; 25: 1411-9

Zeuzem S, Yoshida EM, Benhamou Y, et al. (2008) Albinterferon alfa-2b dosed every two or four weeks in interferon-nai ^.. ve patients with genotype 1 chronic hepatitis C. Hepatology 2008; 48: 407-417

Zeuzem S, Sulkowski M, Lawitz E, et al. (2009) Efficacy and safety of albinterferon alfa-2b in combination with ribavirin in treatment-naf ^.. ve patients with chronic hepatitis C genotype 1 [oral presentation]. 44th Annual Meeting of the European Association for the Study of the Liver

Walker A., Dunlevy G., Rycroft D., Topley P., Holt L.J., Herbert T., Davies M., Cook F., Holmes S., Jespers L., Herring C. (2010). Anti-serum albumin domain antibodies in the development of highly potent, efficacious and long-acting interferon. Protein Engineering. Design & Selection, 23 (4): 271-278

Reddy KR. (2004) Development and pharmacokinetics and pharmacodynamics of pegylated interferon alfa-2a (40 kD). Semin Liver Dis; 24 (Suppl 2): 33-38

Schellenberger V., Wang C.W., Geething N.C., Spink B.J., Campbell A., To W., Scholle M.D., Yin Y., Yao Y., Bogin O. et al. (2009) A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat Biotechnol, 27: 1186-1190

Skerra A. (2010) ′ PASylation ′: a superior technology to extend the plasma half-life of biologicals http://www.ideas-exchange.org/Upload/Content/Documents/Skerra_ASylation_13-10-10.pdf

Schlapschy M., Theobald I., Mack H., Schottelius M., Wester HJ, Skerra A. (2007) Fusion of a recombinant antibody fragment with a homo-amino-acid polymer: effects on biophysical properties and prolonged plasma half-life . Protein Engineering, Design & Selection, 20: 273-284

Claims (5)

1. The GFN80 fusion protein, which has a prolonged action and is a recombinant human interferon alpha-2, fused from the N-terminus with the amino acid sequence of the S (G ₄ S) ₁₆ polypeptide. 2. GFN100 fusion protein, which has a prolonged action and is a recombinant human interferon alpha-2, fused from the N-terminus with the amino acid sequence of the S (G ₄ S) ₂₀ polypeptide. 3. The method of producing the hybrid protein according to claim 1 or 2 by culturing under suitable conditions Saccharomyces cerevisiae yeast transformed with an expression vector that contains a replication initiation region of the endogenous 2-μm Saccharomyces cerevisiae yeast plasmid, as well as a yeast GAL1 promoter that controls expression of a gene including the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 2, respectively, followed by isolation of the fusion protein from the culture fluid. 4. The strain Saccharomyces cerevisiae VKPM Y-3927, designed to implement the method according to claim 3 and obtained by introducing the nucleotide sequence of SEQ ID NO: 1 as part of plasmid p71-81 in the cells of the recipient strain, which is a plasmid-free derivative of the Saccharomyces cerevisiae strain VKPM Y- 3550. 5. The strain Saccharomyces cerevisiae VKPM Y-3928, designed to carry out the method according to claim 3 and obtained by introducing the nucleotide sequence of SEQ ID NO: 2 as part of plasmid p71-82 in the cells of the recipient strain, which is a plasmid-free derivative of the Saccharomyces cerevisiae strain VKPM Y- 3550.

Images