RU2515095C1 - Bacteria of escherichia kind - producer of l-threonine and method of microbiological synthesis of l-threonine with its usage - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention represents a method of microbiological synthesis of L-threonine with usage of a bacteria that belongs to the Escherichia kind, in which the gene fumA is inactivated.

EFFECT: invention makes it possible to produce L-threonine with high extent of efficiency.

2 cl, 1 tbl, 3 ex

Description

The present invention relates to the microbiological industry, in particular to a method of microbiological synthesis of L-threonine using bacteria of the genus Escherichia, in which the fumA gene is inactivated.

Description of the Related Art

Traditionally, L-amino acids on an industrial scale can be obtained by fermentation using strains of microorganisms isolated from natural sources, or their mutants, specially modified in order to increase the production of L-amino acids.

Many methods have been described to increase the production of L-amino acids, for example, by transforming a microorganism of recombinant DNA (see, for example, US patent 4,278,765). These methods are based on increasing the activity of enzymes involved in the biosynthesis of amino acids and / or reducing the sensitivity of the target enzyme to reverse inhibition by the produced L-amino acid (see, for example, Japanese Patent Application No. 56-18596 (1981), WO 95/16042 or patents U.S. 5661012 and 6040160).

Various strains are known that are used to produce L-threonine by fermentation. These are strains with increased activity of enzymes involved in the biosynthesis of L-threonine (U.S. Pat. European application 301572A2, US patent 5661012), strains resistant to compounds such as L-threonine and its analogues (international application WO 0114525 A1, European patent 301572A2, US patent 5376538), strains in which the sensitivity of the target enzyme to the inhibition of the produced amino acid or its obochnymi products feedback type (U.S. Patents 5,175,107 and 5,661,012), strains with inactivated threonine degradation system enzyme (US patents 5,939,307 and 6,297,031).

Known strain producing L-threonine VKPM B-3996 (US patents 5175107 and 5705371) is the best strain producing L-threonine today. To create the VKPM B-3996 strain, several mutations and the plasmid described below were introduced into the parent E. coli K-12 strain (VKPM B-7). The mutant thrA gene (thrA442 mutation) encodes a protein aspartokinase-homoserine dehydrogenase I, which is resistant to threonine inhibition by feedback. The mutant ilvA gene (ilvA442 mutation) encodes a threonine deaminase protein that has reduced activity, which is expressed in a reduced level of isoleucine biosynthesis and in the leaky-type isoleucine deficient phenotype. In bacteria with the ilvA442 mutation, transcription of the thrABC operon is not repressed by isoleucine, which has a positive effect on threonine production. Inactivation of the tdh gene prevents threonine degradation. The genetic determinant of sucrose assimilation (scrKYABR genes) was introduced into this strain. To increase the expression of genes that control threonine biosynthesis, plasmid pVIC40 containing the thrA442BC mutant threonine operon was introduced into the intermediate strain TDH6. The amount of threonine accumulated during the fermentation of this strain reached 85 g / l.

Previously, the authors of the present invention obtained, based on E. coli K-12, a mutant containing the thrR mutation (referred to hereinafter as rhtA23), which confers resistance to high concentrations of threonine and homoserine in a minimal nutrient medium (Astaurova O.V. et al., Appl Bioch. And Microbiol., 21, 611-616 (1985)). Phenotypically, the mutation is expressed in an increase in the production of L-threonine (USSR patent No. 974817), homoserine and glutamate (Astaurova OV et al., Appl. Bioch. And Microbiol., 27, 556-561.1991, European patent application 1013765A) appropriate E. coli producer strain, such as VKPM-3996 strain. Moreover, the authors of this invention showed that the rhtA gene is located at the 18th minute of the E. coli chromosome, next to the glnHPQ operon encoding the components of the glutamine transport system, and that the rhtA gene is identical to the open reading frame of ORF1 (ybiF gene, 764 nucleotide numbers 1651 in sequence with accession number AAA2218541 in GenBank, gi: 440181), located between the pXB and ompX genes. The gene expressing the protein encoded by ORF1 was called the rhtA gene (rht: resistance to homoserine and threonine - resistance to homoserine and threonine). In addition, it was found that the rhtA23 mutation is a substitution of G for A at position 1 relative to the start of the ATG codon (ABSTRACTS of 17 th International Congress of Biochemistry and Molecular Biology in conjugation with 1997 Annual Meeting of the American Society for Biochemistry and Molecular Biology, San Francisco, California August 24-29, 1997, abstract No. 457; European Patent Application 1013765).

Fumarase (fumarate hydratase, L-malate hydro-lyase), a lyase class enzyme that catalyzes the reversible addition of water to the fumaric acid dianion with the formation of malate malic dianion malic acid. In E. coli, three enzymes encoded by the fumA, fumB, and fumC genes have fumarase activity. Of these, under aerobic cultivation conditions, such as under the conditions of L-threonine production, the fumarase activity encoded by the fumA gene provides the basis for fumarase activity. Thus, under aerobic conditions, inactivation of the fumA gene leads to the inability of the E. coli strain to grow on a medium with fumarate as the sole carbon source (Guest JR, Roberts RE (1983). "Cloning, mapping, and expression of the fumarase gene of Escherichia coli K -12. "J Bacteriol 153 (2); 588-96). In a strain with an inactivated fumA gene, depending on culture conditions, fumarase activity may be reduced or absent (Woods SA, Guest JR (1987). "Differential roles of the Escherichia coli fumarases and fnr-dependent expression of fumarase B and aspartase." FEMS Microbiol Lett 48: 219-24). There are currently no reports describing the use of fumA gene inactivation to produce L-threonine.

Description of the invention

The objective of this group of inventions is to increase the productivity of strains of the genus Escherichia - producers of L-threonine and the development of a method of microbiological synthesis of L-threonine using these strains.

The problem was solved by obtaining a bacterium-producer of L-threonine belonging to the genus Escherichia and modified in such a way that the fumA fumarase gene is inactivated in it, as well as the development of a method for microbiological synthesis of L-threonine using such a bacterium.

In more detail, the present invention will be described below.

1. The bacterium according to the present invention.

The bacterium according to the present invention is a bacterium producing L-threonine of the genus Escherichia, modified in such a way that the activity of fumarase is reduced or absent due to inactivation of the fumA gene.

According to the present invention, “a bacterium producing L-threonine” means a bacterium having the ability to accumulate L-threonine in a culture medium when said bacterium is grown in a culture medium. The ability to produce L-threonine can be imparted or improved by selection. As used herein, the term “L-threonine-producing bacterium” also means a bacterium that is capable of producing L-threonine and causes the accumulation of L-threonine in a fermentation medium in large quantities compared to a natural or parent E. coli strain such as E. coli K-12, and preferably means that the microorganism is capable of accumulating in the medium L-threonine in an amount of not less than 0.5 g / l, more preferably not less than 1.0 g / l.

The term "bacterium belonging to the genus Escherichia" means that the bacterium belongs to the genus Escherichia in accordance with the classification known to the person skilled in the field of microbiology. As an example of a microorganism belonging to the genus Escherichia used in the present invention, the bacterium E. coli may be mentioned.

The range of bacteria belonging to the genus Escherichia that can be used in the present invention is not limited in any way, however, for example, the bacteria described in Neidhardt, F.C. et al. (Escherichia coli and Salmonella typhimurium, American Society for Microbiology, Washington D.C., 1208, Table 1), can be included in the number of bacteria according to the present invention.

The term "fumarase activity" refers to the catalysis activity of the reaction of converting fumaric acid to malic. Fumarase activity can be measured using the method described previously (Guest JR, Roberts RE (1983). "Cloning, mapping, and expression of the fumarase gene of Escherichia coli K-12." J Bacteriol 153 (2); 588-96 )

The term "fumarase activity is reduced" means that the specified specific activity is lower than the activity of this enzyme in an unmodified strain, for example, natural. Examples of such a modification include a decrease in the number of fumarase molecules per bacterial cell, a decrease in the specific activity of a fumarase molecule, and so on. The term "fumarase activity is absent" means that in a modified strain, said activity is not detected. The lack of fumarase activity is one example of a decrease in this activity. In addition, the natural strain used for comparison may be, for example, a strain of Escherichia coli K-12. According to the present invention, as a result of a decrease or absence of intracellular activity of fumarase, the amount of accumulated L-threonine in the medium can be increased.

A decrease in the activity of fumarase in a bacterial cell can be achieved by attenuating the expression of the gene encoding fumaraz.

As a gene encoding a fumarase from Escherichia coli, the nucleotide sequence of the fumA gene is known (nucleotide numbers 1686401 to 1684755 in sequence with accession number U00096.2 in the GenBank database). The fumA gene is located on the chromosome of E. coli K-12 strain between the fumC and manA genes. Therefore, the fumA gene can be obtained using the polymerase chain reaction (PCR) (White, T.J. et al., Trends Genet., 5, 185 (1989)) using primers synthesized based on the nucleotide sequence of this gene. The fumA gene also has other names: EG10356, b1612, ECK1607. Genes encoding fumarase in other microorganisms can be obtained in a similar way.

The terms "fumA gene is inactivated" means that the target gene is modified in such a way that such a modified gene encodes a mutant protein with reduced activity or that such a modified gene encodes a completely inactive protein. It is also possible that natural expression of the modified DNA region is not possible due to deletion of the target gene or part of it, shift of the reading frame of this gene or introduction of missense / nonsense mutation or modification of regions adjacent to the gene that include sequences that control gene expression, such as a promoter ( s), enhancer (s), attenuator (s), ribosome binding site (s), etc.

Inactivation of the indicated gene can be performed by traditional methods, such as mutagenesis using UV radiation or treatment with nitrosoguanidine (N-methyl-N'-nitro-N-nitrosoguanidine), site-directed mutagenesis, gene inactivation by homologous recombination and / or insertion deletion mutagenesis (Yu, D. et al., Proc. Natl. Acad. Sci. USA, 2000, 97:12: 5978-83); (Datsenko K.A. and Wanner B.L., Proc. Natl. Acad. Sci. USA, 2000, 97:12: 6640-45), also called "Red-Dependent Integration".

Methods for obtaining plasmid DNA, cutting and ligation of DNA, transformation, selection of oligonucleotides as primers and the like can be conventional methods well known to those skilled in the art. These methods are described, for example, in Sambrook, J., Fritsch, E.F., and Maniatis, T., "Molecular Cloning A Laboratory Manual, Second Edition", Cold Spring Harbor Laboratory Press (1989).

Bacteria producing L-threonine.

The bacterium of the present invention can be obtained by inactivating the fumA gene in a bacterium hereditarily capable of producing L-threonine. On the other hand, the bacterium of the present invention can be obtained by imparting the ability to produce L-threonine to a bacterium in which the fumA gene is already inactivated.

Examples of the parent strain used to produce the L-threonine producing bacterium according to the present invention include, but are not limited to, threonine producing strains belonging to the genus Escherichia, such as E. coli strain TDH-6 / pVIC40 (VKPM B-3996) ( US patents 5175107 and 5705371), E. coli strain NRRL-21593 (US patent 5939307), E. coli strain FERM BP-3756 (US patent 5474918), E. coli strains FERM BP-3519 and FERM BP-3520 (US patent 5376538), E. coli strain MG442 (Gusyatiner et al., Genetics, 14, 947-956 (1978)), E. coli strains VL643 and VL2055 (European patent application EP1149911 A) and the like.

The strain VKPM B-3996 is thrC deficient, is able to assimilate glucose and contains the ilvA gene with a leaky mutation. The specified strain contains a mutation in the rhtA gene, which causes resistance to high concentrations of threonine and homoserine. Strain VKPM B-3996 contains the plasmid pVIC40, which was obtained by introducing into the vector derived from the RSF1010 vector the thrA442BC operon including the thrA mutant gene. This mutant thrA gene encodes aspartokinase-homoserine dehydrogenase I, which has a significantly reduced feedback sensitivity to threonine inhibition. Strain VKPM B-3996 was deposited on November 19, 1987 at the All-Union Scientific Center for Antibiotics (Russia, 113105 Moscow, Nagatinskaya St., 3-A) with inventory number RIA 1867. The strain was also deposited in the All-Russian Collection of Industrial Microorganisms (VKPM) (Russia, 113545 Moscow, 1st Dorozhniy passage, 1) with inventory number VKPM B-3996.

Preferably, the bacterium of the present invention is further modified in order to have increased expression of one or more of the following genes:

- mutant thrA gene encoding aspartokinase-homoserine dehydrogenase I, resistant to threonine inhibition by feedback type;

- thrB gene encoding homoserine kinase;

- thrC gene encoding threonine synthase;

- rhtA gene, presumably encoding a transmembrane protein;

- asd gene encoding aspartate-P-semialdehyde dehydrogenase; and

- aspC gene encoding aspartate aminotransferase (aspartate transaminase).

The sequence of the thrA gene encoding aspartokinase-homoserine dehydrogenase I from E. coli is known (nucleotide numbers 337 to 2799 in sequence with accession number NC_000913.2 in the GenBank database, gi: 49175990). The thrA gene is located on the chromosome of E. coli K-12 strain between the thrL and thrB genes. The sequence of the thrB gene encoding homoserine kinase from E. coli is known (nucleotide numbers 2801 to 3733 in sequence with accession number NC 000913.2 in the GenBank database, gi: 49175990). The thrB gene is located on the chromosome of E. coli K-12 strain between the thrA and thrC genes. The sequence of the thrC gene encoding a threonine synthase from E. coli is known (nucleotide numbers 3734 to 5020 in sequence with accession number NC_000913.2 in the GenBank database, gi: 49175990). The thrC gene is located on the chromosome of E. coli K-12 strain between the thrB gene and the open uaaX reading frame. All three of these genes function as one threonine operon.

The mutant thrA gene encoding aspartokinase-homoserine dehydrogenase I, resistant to threonine inhibition by feedback type, as well as the thrB and thrC genes, can be obtained as a single operon from the well-known plasmid pVIC40, which is represented in the producer strain E. coli VKPM B-3996. Plasmid pVIC40 is described in detail in US Pat. No. 5,705,371.

The rhtA gene is located at the 18th minute of the E. coli chromosome next to the glnHPQ operon encoding the components of the glutamine transport system, so the rhtA gene is identical to the open reading frame ORF1 (ybiF gene, nucleotide numbers 764 to 1651 in sequence with accession number AAA2218541 in GenBank, gi: 440181), located between the genes exp and bmp. The region expressing the protein encoded by ORFT was called the rhtA gene (rht: resistance to homoserine and threonine - resistance to homoserine and threonine). In addition, it was found that the rhtA23 mutation is a substitution of G for A at position 1 relative to the start of the ATG codon (ABSTRACTS of the 17th International Congress of Biochemistry and Molecular Biology in conjugation with 1997 Annual Meeting of the American Society for Biochemistry and Molecular Biology, San Francisco, California August 24-29, 1997, abstract No.457; European Patent Application 1013765).

The nucleotide sequence of the asd gene from E. coli is already known (nucleotide numbers 3572511 to 3571408 in sequence with accession number NC_000913.1 in the GenBank database, gi: 16131307), and this gene can be obtained by PCR (polymerase chain reaction; link White, TJ et al., Trends Genet., 5, 185 (1989)) using primers synthesized based on the nucleotide sequence of the gene. Asd genes from other microorganisms can be obtained in a similar way.

Also, the nucleotide sequence of the aspC gene from E. coli is already known (nucleotide numbers 983742 to 984932 in the sequence with accession number NC_000913.1 in the GenBank database, gi: 16128895), and this gene can be obtained by PCR. AspC genes from other microorganisms can be obtained in a similar way.

2. The method according to the present invention.

The method according to the present invention is a method for microbiological synthesis of L-threonine, which includes the steps of growing the bacteria according to the present invention in a nutrient medium in order to produce and accumulate L-threonine in a nutrient medium.

According to the present invention, the cultivation, isolation and purification of L-threonine from a culture or similar liquid can be carried out in a manner similar to traditional fermentation methods in which the amino acid is produced using bacteria.

The nutrient medium used for growing can be either synthetic or natural, provided that the medium contains sources of carbon, nitrogen, mineral additives and, if necessary, the appropriate amount of nutrient additives necessary for the growth of microorganisms. Carbon sources include various carbohydrates such as glucose and sucrose, as well as various organic acids. Depending on the nature of the assimilation of the microorganism used, alcohols such as ethanol and glycerin may be used. Various inorganic ammonium salts, such as ammonia and ammonium sulfate, other nitrogen compounds, such as amines, natural nitrogen sources, such as peptone, soybean hydrolyzate, microorganism fermentolizate, can be used as a nitrogen source. As mineral additives, potassium phosphate, magnesium sulfate, sodium chloride, iron sulfate, manganese sulfate, calcium chloride and the like can be used. Thiamine and yeast extract can be used as vitamins. If necessary, additional components can also be added to the medium. For example, if a microorganism requires an L-amino acid for growth (L-amino acid auxotrophy), the required amount of the indicated L-amino acid can be added to the nutrient medium.

The cultivation is preferably carried out under aerobic conditions, such as mixing the culture fluid on a rocking chair, shaking with aeration, at a temperature in the range from 20 to 40 ° C, preferably in the range from 30 to 38 ° C. The pH of the medium is maintained in the range of 5 to 9, preferably 6.5 to 7.2. The pH of the medium is regulated by ammonia, calcium carbonate, various acids, bases or buffer solutions. Cultivation is carried out within 1-5 days.

Examples.

The present invention will be described in more detail below with reference to the following non-limiting Examples.

Example 1. Construction of a strain with an inactivated fumA gene.

The fumA deleted gene strain is obtained using a method originally developed by Datsenko K.A. and Warmer B.L. (Proc. Natl. Acad. Sci. USA, 2000, 97 (12), 6640-6645), known as "Red-dependent Integration". In accordance with the specified procedure, the primers are synthesized:

AACACCCGCCCAGAGCATAACCAAACCAGGCAGTAAGTGAGAGAACAATGCCGAATAA

ATACCTGTGACGG

and

AAAAAAACCGCCCCGAAGGGCGGCTCTGTTTATTTCACACAGCGGGTGCATGTAGGCTGGAGCTGCTTCGCGCCCCGCCCTGCCACTCAT

homologous to both regions of the chromosome adjacent to the fumA gene and the gene that confers antibiotic resistance on the plasmid used as the template. As such a matrix for PCR, plasmid pACYC184 (NBL Gene Sciences Ltd., UK) is used (accession number X06403 in the GenBank / EMBL database). Use the following temperature profile for PCR: denaturation at 95 ° C for 3 min; the first two cycles: 1 min at 95 ° C, 30 s at 50 ° C, 40 s at 72 ° C; and the next 25 cycles: 30 s at 95 ° C, 30 s at 54 ° C, 40 s at 72 ° C; and final polymerization: 5 min at 72 ° C. The resulting PCR product is a fragment of 967 bp in length. purified on an agarose gel and used for electroporation into E. coli strain MG1655 (ATCC 700926) containing the plasmid pKD46 with a heat-sensitive replicon. Plasmid pKD46 (Datsenko K.A. and Wanner, BL, Proc. Natl. Acad. Sci. USA, 2000, 97: 12: 6640-45) contains a phage DNA fragment (sequence number J02459 in the GenBank database) of 2.154 nucleotides (31088-33241), and also contains the Red genes of a homologous recombination system (β, γ, exo genes) under the control of the promoter Para-B; induced by arabinose. Plasmid pKD46 is required for integration of the PCR product into the chromosome of strain MG1655.

Electrocompetent cells are prepared as follows: an overnight culture of E. coli strain MG1655 is grown at 30 ° C in LB medium supplemented with ampicillin (100 mg / L), diluted 100 times with 5 ml of SOB medium (Sambrook et al, Molecular Cloning A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989)) containing ampicillin (100 mg / L) and L-arabinose (1 mM). The resulting culture was grown with stirring at 30 ° C until OD ₆₀₀ 0.6 was reached, after which the cells were electro-competent by concentration of 100 times and three times washing with ice-cold deionized H ₂ O. Electroporation was carried out using 70 μl of cells and 100 ng of PCR product. After electroporation, cells are incubated with 1 ml of SOC medium (Sambrook et al, "Molecular Cloning A Laboratory Manual, Second Edition", Cold Spring Harbor Laboratory Press (1989)) at 37 ° C for 2.5 hours, and then plated on L plates agar and grown at 37 ° C for the selection of chloramphenicol-resistant recombinants. Then, to remove plasmid pKD46, 2 passages were performed on L-agape with chloramphenicol (30 μg / ml) at 42 ° C and the obtained colonies were tested for sensitivity to ampicillin.

The resulting mutants with the deleted fumA gene and containing the chloramphenicol resistance gene are checked by PCR. Locus-specific primers:

AAAAGTGTGTAGGATATTGTTAC

and

ACTTTTAGCTCACTTATTATTTAC

used to confirm the presence of deletion by PCR. Use the following temperature profile for PCR testing: denaturation at 94 ° C for 3 min; profile for 30 cycles: 30 s at 94 ° C, 30 s at 54 ° C, 1 min at 72 ° C; final step: 7 min at 72 ° C. The length of the PCR product obtained by the reaction using the parental strain fumA ⁺ MG1655 as a matrix of cells is 1827 bp The length of the PCR product obtained by the reaction using a mutant strain as a matrix of cells is 1071 bp. The result is a strain MG1655 fumA :: cat carrying a deletion of the fumA gene.

Example 2. Cloning of the aspA gene from E. coli.

The complete nucleotide sequence of E. coli K-12 strain has been determined (Science, 277, 1453-1474, 1997). Based on the given nucleotide sequence, primers are synthesized:

AAAGGTCTCAAGCTAAAAAGAAGGTTCACATGTCAAAC and

AAAGGATCCGTTACTGCTCACAAGAAAAAAAGG.

Chromosomal DNA of E. coli strain MG1655 is obtained by a standard method. PCR is carried out under the following conditions: 40 seconds at 95 ° C, 40 seconds at 55 ° C, 40 seconds at 72 ° C, 30 cycles using Taq polymerase (Fermentas). The resulting 1542 bp DNA fragment containing the aspA gene was treated with BamHI and Eco31I restriction enzymes and introduced into pUC19 (Fermentas) multi-copy vector, which was pretreated with BamHI and HindIII restriction enzymes. Thus, the plasmid pUC-aspA is obtained.

Example 3. Production of L-threonine by E. coli strain B-3996MumA.

To test the effect of the deletion of the fumA gene on the production of threonine, a DNA fragment from the chromosome of the E. coli MG1655 fumA :: cat strain described above was transferred to the E. coli threonine producing strain VKPM B-3996 (the closest analogue) by means of phage PI transduction (Miller JH ( 1972) Experiments in Molecular Genetics, Cold Spring Harbor Lab. Press, Plainview, NY).

Both strains, the parent VKPM B-3996 and the resulting B-3996AfumA, were transformed with the plasmid pUC-aspA. The stimulating effect of aspA gene expression on L-threonine production has been shown previously (international application WO03008607). Transformants were grown for 18-24 hours at 32 ° C on L-agar plates containing ampicillin (100 mg / L). To obtain a seed culture, each strain was grown on a rotary shaker (250 rpm) at 32 ° C for 18 hours in 20 × 200 mm tubes containing 2 ml of L-broth with 2% sucrose. Then, 0.21 ml (10%) of seed is added to the fermentation medium. Fermentation is carried out in 2 ml of minimal fermentation medium in 20 × 200 mm tubes. Cells are cultured for 24 hours at 32 ° C on a rotary shaker - 250 rpm.

The composition of the fermentation medium (wt.%):

Glucose 2.0 (NH4) 2SO4 2.2 NaCl 0.08 KH2PO 4 0.2 MgSO4.7H2O 0.08 FeSO4.7H2O 0.002 MnSO4.5H2O 0.002 Thiamine HCl 0.00002 Yeast extract 0.1 CaCO3 3.0 Water rest

Glucose and manganese sulfate are sterilized separately. CaCO3 is sterilized by dry heat at 180 ° C for 2 hours. The pH was adjusted to 7.0. The antibiotic ampicillin (100 mg / l) is added to the medium after sterilization.

After growing, the amount of L-threonine accumulated in the medium is determined by paper chromatography, using the following composition of the mobile phase: butanol: acetic acid: water = 4: 1: 1 (v / v). A solution (2%) of ninhydrin in acetone is used for visualization. Spots containing L-threonine are excised, L-threonine is eluted with a 0.5% aqueous solution of CdCl2, after which the amount of L-threonine is estimated spectrophotometrically at a wavelength of 540 nm.

The results of five independent in vitro fermentations are shown in Table 1.

Table 1 Strain Threonine production, g / l VKPM B-3996 / pUC-aspA 6.5 ± 0.5 B-3996ΔfumA / pUC-aspA 7.2 ± 0.3

As can be seen from Table 1, the strain B-3996ΔfumA / pUC-aspA containing the deletion of the fumA gene accumulates a greater amount of L-threonine compared to the control strain VKPM B-3996 / pUC-aspA.

Claims (2)

1. The bacterium-producer of L-threonine, belonging to the genus Escherichia, characterized in that the bacterium is modified so that the fumAra gene fumA is inactivated in it. 2. The method of microbiological synthesis of L-threonine by culturing the bacteria according to claim 1.