RU2507736C2 - Method of creation of transgenic plants with high level of expression of transgenic proteins - Google Patents

Abstract

FIELD: agriculture.

SUBSTANCE: invention relates to the field of biochemistry and in particular to the method of creation of transgenic plant lines that produce protein with high level of expression, comprising transformation of plants with an expression vector comprising the plasmid comprising the gene encoding β-glucuronidase, 35S promoter, nos transcription terminator. At that the transcription terminator is inserted above the promoter of the gene, which has the ability to break effectively the genomic transcripts in the plant genome and to protect effectively the expression of the transgene in the plant genome from the subsequent repressions.

EFFECT: invention enables to create transgenic plant lines that produce protein with high levels of expression.

1 dwg, 3 tbl, 5 ex

Description

FIELD OF THE INVENTION

The present invention relates to the field of plant genetic engineering and biotechnology. It can be used to create transgenic plants with a high level of expression of the target gene. This, in turn, can be used both for improving important features of a number of crops and for biotechnological production of specific proteins.

State of the art

Plants whose properties are altered through genetic transformation are finding increasing application in the biotechnological and agricultural industries. Effective plant transformation systems are known at present that can be used to create plants with the necessary traits. Of all these methods, the agrobacterial and biolistic methods for delivering DNA to the plant genome have currently received the greatest practical application. The agrobacterial method of plant transformation is the use of A.tumefaciens bacteria as vectors (DNA carriers). It is based on the ability of the pathogenic organism Agrobacterium to transfer certain DNA fragments from its Ti plasmid to plant cells. The essence of the biolistic method is that metal particles with a diameter of 1-4 microns coated with DNA are given a certain speed, due to which they penetrate the walls of intact cells and introduce DNA molecules into them. In both cases, the target gene and its associated sequences are introduced into the plant cell and stably integrated into the plant genome. From this cell, a whole, fully functioning plant with the necessary properties is subsequently formed.

However, the production and subsequent use of transgenic plants is faced with the problem of achieving effective expression of proteins in plants due to the unstable, low expression of a heterologous gene when it is integrated into the genome. Such repression is the result of the negative influence of the surrounding chromatin and regulatory elements, which can be considered a consequence of the protective reaction of the plant genome on the integration of foreign information, the expression of which must be suppressed. The main cause of unstable transgene expression and its attenuation over generations is repression at the post-transcriptional level (post-transcriptional gene silencing, PTGS). The mechanism of this phenomenon is due to the fact that if there are two complementary RNAs, one of which can be in extremely low concentration, then the resulting double-stranded RNA triggers both the degradation of dsRNA itself and the induction of repression of the gene responsible for the synthesis of this RNA. The variability of transgenic expression and its decrease are also affected by many other factors, such as different numbers of copies inserted into the genome, and transgene insertion sites. The variability of transgenic expression greatly complicates both the analysis of phenotypic traits and the creation of commercially viable cultures with predictable characteristics. Thus, an extremely urgent task is to obtain plants with high and stable transgene expression. However, to date, there are no known universal combinations of regulatory elements and a method of transformation that would work effectively in a variety of plant cultures, with different types of promoters and, in addition, there are no clear algorithms for creating regulatory elements that can make the expression of the gene flanked by them independent of the place of integration in the plant genome.

It is widely known that the production of transgenic plants by artificial gene transfer (e.g., by the biolistic method) leads to the appearance of a large number of transgenic copies in a plant, whereas transformation by Agrobacterium tumefaciens leads to the insertion of a significantly smaller number of copies and the appearance of a large number of single-copy transgenic clones. Thus, it is preferable to use agrobacterial transformation, since multicopy is often associated with a low level of expression due to the launch of RNA silencing. However, on the other hand, the low copy number of the transgene does not allow to obtain a significant level of protein production.

It is known that to reduce the influence of the effect of RNA silencing when creating constructs, some viral genes encoding proteins that suppress RNA silencing are often used. The use of a specific viral suppressor of silencing, an auxiliary component of the HC-Pro proteinase virus of tobacco engraving, increases the level of protein expression in the leaves of adult tobacco plants (Mallory et al., 2002), and a transient expression system based on co-expression of the transgene and suppressor of the p19 gene bushy virus suppressor dwarf tomato, significantly increases the level of GFP expression by preventing the silencing of this gene in protransformed tissues (Voinnet et al., 2003). To increase the level of expression, the 5 'proximal region of potivirus containing the coding region P1, an auxiliary component of proteinase, and a small part of P3 are also used (US Patent 5939541, 1999). In addition, in order to stabilize and increase the expression level, A. thaliana plants mutated in the sgs2 and sgs3 genes involved in the RNA silencing mechanism were transformed (Butaye et al. 2004). However, all these approaches are difficult for practical implementation, since in many cases it is necessary to have either a mutant recipient plant or express viral proteins in a plant, which, in turn, is undesirable in the subsequent use of the resulting transgenic plant in food industry or medicine.

The choice of promoter, under the control of which a heterologous gene is placed, is another important factor determining the level and stability of its expression in the recipient's genome. This is especially important when using tissue-specific plant promoters, which are much weaker than the currently prevalent viral ones.

Promoters can be of various types, constitutive and specific for tissue or expression time. Selected promoters can be combined with additional sequences to increase expression of the target sequence in a particular plant tissue or organ. To date, viral CaMV p35S promoters, octopin and nopalin synthase and plant actin, ubiquitin and RuBISCo promoters are widely used. In addition to selecting the promoter that is optimal for the purpose, in the expression vectors created for transformation, it is necessary to use additional regulatory elements that can support the efficient operation of the gene encoding the target protein. An increase in transgenic expression is observed when using expression cassettes regulated by optimized 5'- and 3'-regulatory sequences. The 5'-UTR sequence from TMV (strain U1), now known as the Ω sequence, greatly increases the expression level of the reporter gene (Gallie et al., 1987). 5'-UTR sequences of higher plants also have an enhancer effect. The regulatory sequences of proteins stored in the seeds of common bean (Phaseolus vulgaris), the β-phaseolin promoter in combination with the arcelin 5-1 gene terminator, increase the expression of the heterologous protein in dicotyledonous seeds to 36% of the total soluble protein, instead of 1% when using the 35S promoter (De Jaeger et al., 2002). Using the rbcS1 cassette, the level of transgenic expression in tobacco leaves reached 10% of the total soluble protein (Outchkourov et al. 2003). Using the GUS reporter gene, it was shown that the use of the 5'-UTR of the alcohol dehydrogenase (NtADH) gene sequence increases the level of transgenic expression by 30-100 times in the case of BY-2 cell culture and 30-60 times in the case of T87 Arabidopsis cell culture (Satoh et al., 2004). The 5'-non-coding sequence of genes encoding heat shock proteins also increases expression in plants when present in chimeric genes (US Patent 5362865, 1994). In addition, a high level of transgenic expression is observed when using intron-containing genes in comparison with constructs that do not contain such. Both the position of the intron in the gene and its sequence have a significant effect on the level of expression. The use of the intron 5'-UTR of the rice rubi3 gene sequence provided a 26-fold increase in the expression level of the GUS reporter gene in the Oruza sativa rice cell culture (Samadder et al., 2008). Monsanto used the intron HSP70, which encodes corn heat shock protein, in the untranslated leader region of the chimeric gene to increase production (US Patent 5424412, 1995; US Patent 5593874, 1997; US Patent 5859347, 1999). However, the application of these approaches is limited to certain types of plants and currently there are no universal elements that would effectively increase the level of expression of any transgene in different plants. Another problem with the use of transgenic plants is the high probability of subsequent repression of the initially efficiently expressed heterologous gene in the genome of the recipient plant. In order to prevent such repression and increase the stability level of transgene expression, DNA sequences are often used, usually A / T-rich, which, as shown in vitro experiments, are able to interact with the nuclear matrix fraction (MAR, matrix attachment region). The existing model suggests that due to the interaction with the proteins of the nuclear skeleton, the expression of genes flanked by MAR decreases the negative effect of surrounding chromatin. To achieve higher levels of expression, MAR elements isolated from various sources are used, such as humans, chicken, yeast, soybeans, tobacco, Arabidopsis, petunia, corn and synthetic elements. A system was created for identifying such elements by a portion of a sequence consisting of at least twenty closely spaced nucleotides, 90% of which are A or T residues (US Patent 6245974, 2001). The greatest increase in expression, 60 times (Allen et al., 1996) and 36 times (Odell and Krebbers, 1998), was obtained by biolistic transformation using MAR from tobacco and chicken, respectively. However, the study was conducted on a cell culture, and not on the whole plant, and the fact that the extrapolation of the results obtained from the cell culture to an entire organism is inadmissible is not well known. An increase in expression by five to ten times in the whole tobacco plant was obtained using MAR elements of Arabidopsis (Liu and Tabe, 1998). For rice plants, the same values were achieved by combining MAR elements from tobacco and using the ubiquitin promoter (Xue et al., 2005). Known patents include the use of RB7 MAR elements isolated from tobacco plants (US Patent 5773689, 1998 and US Patent 5773695, 1998) and the 5x region of the Bx7 gluten gene of the endosperm specific storage protein Triticum aestivum (US Patent 6117612, 2001) . However, using MAR sequences in vector constructs, stable results have not yet been obtained that would allow us to state that the problem of constant expression of a heterologous gene in plants has been solved. So, it turned out that only a few MARs have a positive effect on transgene expression, which, however, largely depends on the particular system of selected promoters, the place of integration of the heterologous gene into the plant genome, the type of plant used, and the method of embedding the construct in the genome. Moreover, the ability to efficiently bind the components of the nuclear matrix in vitro does not directly correlate with the detectable MAR activity in transgenic lines. In some cases, it was shown that MAR is a direct stimulator of gene transcription in the construct, and not a neutral boundary, as previously assumed, in addition, two studies (Breyne et al., 1992; Holmes-Davis and Comai, 2002) showed a negative effect MAR for transgene expression. That is why it is extremely urgent to identify universal regulatory elements that can effectively protect transgene expression in the plant genome from subsequent repression. Thus, in order to create a transgenic plant with the desired phenotype and a high level of protein production from an extensive list of regulatory sequences, it is necessary to carefully select an element that, depending on the genus and type of plant, and the method of transformation, most fully meets the goals, because a universal element that gives a 100% guarantee of achieving the assigned tasks is not yet open.

There is a method of obtaining a foreign protein in E. coli cells using an expression cassette flanked by terminators (RU 2201455), however, the vector used in this case is, firstly, intended for transformation of prokaryotes in which the transcription system differs from eukaryotic. Secondly, during protein expression in E. coli cells, linearization and integration of the plasmid into the cell genome does not occur, therefore, in this case, there is no negative effect of the genomic environment. Finally, the termination sequences in RU 2201455 are used to prevent transcription through the expression cassette from the promoter elements prior to induction, since this can impair the efficiency of induction, while there are problems of possible repression of transcription triggered by promoter or RNA interference in this case simply does not exist.

A well-known article is Grummt et al., 1986, which describes the case of the location of the termination sequence above the promoter of the ribosomal gene. In this case, this transcription terminator enhances the initiation of transcription from the underlying promoter. However, it is worth noting that the transcription of ribosomal RNA uses the enzyme system of RNA polymerase I, which is very different in its component composition and mechanism of action from RNA polymerase II, which is responsible for the synthesis of messenger RNAs. In addition, in the case of RNA polymerase I, transcriptional interference is not observed, and the terminator does not act as a protective regulatory element that terminates negative transcripts, but as a site that binds a special protein factor that enhances the work of the gene promoter.

Thus, it is an object of the present invention to provide vectors for transforming plant crops in which the expression cassette is isolated by eukaryotic transcription terminators to maintain a high and stable level of production of the target protein.

SUMMARY OF THE INVENTION

We have proposed a method for creating transgenic plant lines that produce a protein with a high level of expression, including transforming plants with an expression vector including a plasmid containing a gene encoding β-glucuronidase, a 35S promoter, nos transcription terminator, characterized in that a transcription terminator is inserted above the gene promoter, with the ability to effectively break off genomic transcripts in the plant genome and to effectively protect transgene expression in the plant genome from subsequent repression.

We have proposed a method of using regulatory elements with the ability to break off genomic transcripts in the plant genome and affect the level of protein expression in the direction of its increase and stabilization.

We also proposed vector constructs that contain a gene encoding β-glucuronidase or another target protein, 35S promoter, nos transcription terminator, and one of the synthetic regulatory elements inserted above the 35S promoter sequence (Figure 1).

To achieve the result, the optimal transformation method was chosen to create transgenic plant lines producing proteins with a stable and high expression level.

The implementation of the proposed method is illustrated in the drawing, which shows the design diagrams for testing DNA elements in the test culture of tobacco plants, where

A - control pBI121, in which the tested DNA elements are absent;

B - construction of pBI1tod2 with a new synthetic element II, built above the 35S promoter.

B is the construction of pBI1tod3 with a new synthetic element III embedded above the 35S promoter.

The present invention can be used to construct transgenic constructs containing efficient regulatory elements in biotechnology, molecular biology, is of interest for large-scale production of recombinant proteins that can be used for medical and research purposes and for using plants with this design for the agricultural industry.

Thus, we have proposed a method for creating transgenic plant lines producing a protein with a high level of expression, including transforming plants with an expression vector including a plasmid containing a gene encoding β-glucuronidase, a 35S promoter, a nos transcription terminator, characterized in that the gene is inserted above the promoter a transcription terminator capable of efficiently breaking off genomic transcripts in the plant genome and effectively protecting transgene expression in the plant genome from subsequent replication these.

Example 1

Materials and methods used in obtaining transgenic plants.

Analysis of reporter gene expression was carried out on tobacco plants Nicotiana tabacum, as the most widely used in plant biotechnological practice for testing such regulatory elements.

Construction of vector plasmids.

As the reporter gene, the β-glucuronidase (GUS) gene was used, which was placed in the expression cassette under the 35S promoter. It is known that this promoter provides a high level of transcription of the target gene in most known plant cultures. Synthetic DNA elements with terminating activity in plant cells and contributing to high level transgenic expression were placed in front of the gene promoter.

These DNA elements with the ability to cut off genomic transcripts are assembled by combining the classical polyadenylation signal (AATAAA) surrounded by a T-rich zone with a sequence with ribozyme activity and capable of self-cutting. Ribozyme is an RNA sequence with its own enzymatic activity. This approach makes it possible to strengthen the classical termination / polyadenylation system by introducing an additional gap into the newly synthesized RNA molecule.

To evaluate the effectiveness of the use of these elements while maintaining a high level of production of the target protein, the following plasmids were used:

The commercial vector pBI121 (Clontech) containing the β-glucuronidase gene (GUS) gene under the control of the 35S promoter was used as a negative control. This plasmid contains the neomycin phosphotransferase II gene of resistance to kanamycin, which was used as a marker for subsequent selection of recombinant clones.

Vector plasmids for transferring the reporter gene with elements II and III to plant cells were constructed using well-known molecular cloning methods (Sambrook et al., 1989).

Plasmid pBI1tob2, containing synthetic sequence II in front of the GUS gene above the 35S promoter, was obtained by inserting this DNA fragment 714 bp long. restriction site KpnI.

Plasmid pBI1tod3, containing synthetic sequence III in front of the GUS gene above the 35S promoter, was obtained by inserting this DNA fragment 585 bp long. restriction site KpnI.

Preparation of bacterial suspension.

For the genetic transformation with the binary vectors pBI121, pBI1tob2 and pBI1tob3, a supervirulent strain of Agrobacterium tumefaciens CBE21 (Revenkova et al. 1994), constructed on the basis of the wild A. tumefaciens strain with Ti-plasmid pTiBo542, was used.

Bacterial suspensions of strains CBE21 / pB1, CBE21 / pBI1tob2 and CBE21 / pBI1tob3 for inoculation of explants were grown overnight at 28 ° C in 50 ml of LB medium (see Table 1) containing 100 mg / l of the antibiotic kanamycin. Before inoculation, the cell suspension was centrifuged at 5 thousand rpm for five minutes. The precipitate was washed twice with 50 ml of MS liquid (Murashige and Skoog, 1962), the sucrose content of which was 30 g / l, to remove residual LB medium. The washed precipitate was resuspended in 50 ml of liquid MS, then the density of the suspension was adjusted to OD600 equal to 1.

Table 1 Agrobacterial culture medium LB Component Concentration Sodium chloride 10 g / l Bactotryptone 10 g / l Yeast extract 5 g / l pH 7.5

Preparation of uterine plants

As used uterine plants Nicotiana tabacum Petite Havana SRI variety of culture in vitro, are for medium _^1/2 MS supplemented with MS vitamins, in an appropriate amount, with 10% sucrose and 0.8% agar. Plants were cultivated at 23 ° C and daylight 16 hours / 8 hours (day / night) and were transplanted once every two months. For the experiment, plants were used for the second or third week after the next passage.

Leaf collection and preparation

Young, fully unfolded leaves were cut off from the mother plants of tobacco of two to three weeks of age, contained in an in vitro culture, immediately before the genetic transformation was established. To reduce leaf drying during subsequent operations, they were kept in closed Petri dishes with a small amount (20 ml) of distilled water. 20-25 chopped leaf fragments, approximately 0.5 × 2 cm in size, fall on one cup. Transformation

The preparation, inoculation and cocultivation of explants is carried out in a known manner, based on the work of Horsch et al. (1985) and McCormick (1991). Leaf explants were regenerated on MS medium containing vitamins, sucrose 30 g / l and hormones BAP (benzylaminopurin) 1 mg / l, IAA (indolylacetic acid) 0.1 mg / l.

Selection of transgenic tissue, selection of transformants and elimination of agrobacteria.

After inoculation and co-cultivation with agrobacteria, the explants are placed in Petri dishes on the surface of the MS medium for regeneration. The cups are wrapped with parafilm and incubated in a thermostat in the dark at a temperature of 23-25 ° C. Three days later, the explants for regeneration are transferred to a medium supplemented with antibiotics Cefotoxime 500 mg / L and kanamycin 100 mg / L. Cefotoxime is used to eliminate the remnants of agrobacteria on explants. Kanamycin acts as a selective agent, since the vector constructs use the nptII neomycin phosphotransferase gene as a selective marker.

Animation and rooting of transformants.

In the process of pre-pressure, the hormone content was gradually reduced, after two months the concentration of BAP was reduced to 0.3 mg / l, and IAA was removed completely, and then completely removed. The concentration of cefotoxime is changed during the passages: with each monthly passage, the level is reduced by 100 mg / l from the initial 500 mg / l to the final 0 mg / l. Shoots the size of one or two centimeters were already placed on a completely hormone-free environment. For rooting, explants were transferred to MS medium with a reduced sucrose content, gradually bringing its concentration to 10 mg / L. In the last passage, an antibiotic-free MS medium was used. Rooted plants underwent pre-green adaptation and were planted in greenhouse soil.

Example 2

Isolation of total plant DNA from tobacco

In vivo plant material was used to extract genomic DNA. The third leaf of the shoot was cut from greenhouse plants. Isolation was carried out according to a protocol modified by us. The methodology was adopted by Rogers et al. (1994) using 2 ^x CTAB buffer.

In contrast to the protocol, Rogers et al. (1994) homogenized tissue is resuspended in 1 ml wash buffer: 100 mM potassium acetate, pH 4.5, 20 mM EDTA, 1% PVP, 1% 2-ME. The resulting suspension is centrifuged for 5 min at 4.5, i.e., the supernatant is removed. The pellet was resuspended again in 600 μl of CTAB extraction buffer of the following composition: 100 mM Tris-HCl, pH 8, 2.5. M NaCl, 20 mM EDTA, 2% CTAB, 40 mM 2-ME.

PCR analysis of transgenic lines

The lines obtained using any of the used vector constructs are analyzed by two pairs of primers: on the insertion of a selective marker (nptII, Nos / nptII, 742), the insertion of the reporter gene (uidA, GUSA1 / GUSA2,1812) and on the absence of viral contamination, checking for virulence genes of the vir series (virA / virB, 670). Lines containing new synthetic elements were checked for the presence of element II or element III (2-1 / 2-2, 715 and 3-1 / 3-2, 597, respectively).

PCR analysis of the integration of various heterologous elements into the tobacco genome is carried out in a reaction mixture that contains 67 mM Tris-HCl, pH 9.0, 16 mM (NH ₄ ) ₂ SO ₄ , 2 mM MgCl ₂ , 0.01% BSA, 200 µM of each dNTP. Concentrations of primers and polymerase, as well as the temperature regime are selected for each specific case. To amplify the nptII fragment, primers up to 0.6 μM final concentration and 0.05 U / μl Taq polymerase are added to the reaction mixture. Amplification mode: 5 min denaturation at 94 ° C (hot start), 30 s denaturation at 93 ° C, annealing - 45 s 62 ° C, elongation 45 s 72 ° C, amplification cycles 30. The expected amplified fragment size is 742 bp .

The insertion of the uidA reporter gene was determined under conditions that were for the most part similar to those for nptII, only the concentration of primers was 0.15 μM each, 0.1 U / μl Taq, and the temperature regime was changed as follows: hot start 2 min at 94 ° C, denaturation 30 s 93 ° C, annealing 40 s 60 ° C, elongation 55 s 72 ° C, 30 amplification cycles. The expected size of the amplified fragment is 1812 bp The insert of element II was determined under conditions that were for the most part similar to those for uidA, only the concentration of primers was 0.25 μM each, and the temperature regime was changed as follows: hot start 2 min at 94 ° C, denaturation 30 s 93 ° C, annealing - 40 s 60 ° C, elongation 35 s 72 ° C, amplification cycles 30. The expected size of the amplified fragment is 715 bp

The insert of element III was determined under conditions that were for the most part similar to those for uidA and element II, only the concentration of primers was 0.25 μM each, and the temperature regime was changed as follows: hot start 2 min at 94 ° C, denaturation 30 s 93 ° C, annealing - 40 s 60 ° C, elongation 35 s 72 ° C, amplification cycles 30. The expected size of the amplified fragment is 597 bp

Histochemical analysis of GUS activity.

Histochemical determination of GUS activity was carried out according to the method of Jefferson (1987). Histochemical determination of GUS activity was carried out using 5-bromo-4-chloro-3-indolyl glucuronide (X-GLUC, Duchefa). For this, plant tissue was placed in a buffer of 50 mM NaPO ₄ , pH 7.0, 10 mM Na ₂ EDTA, 0.1% Triton X-100, containing 1 mg / L X-GLUC, and incubated for six hours at 37 ° C. Then several times washed with 50% ethanol and stored stained tissue at 4 ° C in 70% ethanol.

Fluorimetric analysis of GUS activity.

The measurement was carried out using 4-MUG reagent (4-methylumbelliferyl glucuronide), which, when cleaved with β-glucuronidase to 4-MU, has the excitation optimums at 365 nm and radiation at 455 nm. For this, the proteins were extracted from the plant tissue in an extraction solution of the composition: 50 mM NaPO ₄ , pH 7.0, 10 mM Na ₂ EDTA, 0.1% Triton X-100 0.1% sarcosyl, 10 mM β-mercaptoethanol, as follows: 200 mg of tissue was triturated in a mortar with liquid nitrogen and the powder was lowered into the extraction buffer. Subsequently, centrifugation was carried out at 10,000 g, and the supernatant containing proteins was transferred to a separate eppendorf. For each sample, 100 μl of GUS extraction buffer was preincubated with the addition of 1 mM 4-MUG reagent. 10 μl of protein extract was added to the reaction mixture and after 10 s, 900 μl 0.2 M Na ₂ CO ₃ to stop the reaction. Subsequently, the measurement was carried out on a fluorimeter calibrated using freshly prepared standard 4-MU solutions in extraction buffer with the addition of 0.2 M Na ₂ CO ₃ in a 1: 9 ratio. The amount of reporter protein was estimated relative to the total protein of the extract, the determination of the concentration of which was carried out according to the Bradford reaction. The final concentration was obtained in the dimension nmol 4-MU / h per 1 μg of total protein.

Example 3

PCR data from transgenic tobacco plants obtained by transformation with expression vectors.

Based on the results of PCR analysis, four clones containing an element II insert and eight clones with an element III insert were selected from the obtained transgenic tobacco lines for further analysis (see Table 2). 14 control lines were also selected.

table 2 Results of PCR analysis of transgenic tobacco plants Nos / nptII 742 virA / virB 670 2-1 / 2-2 715 3-1 / 3-2 597 Gus 1t2 1 + - + + 1t2 2 + - + 1t2 3 + - + + 1t2 4 + - + 1t2 5 + - + 1t2 6 + - + 1t2 7 + - + + 1t2 8 + - + 1t2 9 + - + 1t2 10 + - + 1t2 13 + - + + 1t3 1 + - + + 1t3 3 + - + + 1t3 4 + - + 1t3 6 + - + + 1t3 7 + - + + 1t3 9 + - + + 1t3 10 + - + 1t3 12 + - + + 1t3 13 + - + 1t3 14 + - + 1t3 15 + - + + 1t3 17 + - + + G 1 + - + G 2 + - + G 3 + - + G 4 + - + G 6 + - + G 7 + - + G 10 + - + G 11-2 + - + G 12 + - + G 13b + - + G 15 + - + G 16 + - + G 17 + - + G 19 + - +

Primers

VirB1 GGCTACATCGAAGATCGTATGAATG

VirB2 GACTATAGCGATGGTTACGATGTTGAC

NOS CGCGGGTTTCTGGAGTTTATAGAGCTAAG

nptII-2 GCATGCGCGCCTTGAGCCTGG

CaMV35S-R TGAATCTTTTGACTGCATCTTTAACCTTCTT

nptII-F ACGACGGGCGTTCCTTGCG

3-1 TCATAGTGTTACCATCAACCACCTTAACTtc

3-2 TTCCGCAAAAATCACCAGTCTCTCTCTCTAC

2-1 CATAGTGTTACCATCAACCACCTTAACTTC

2-2 TCCTGTCACCGGATGTGTTTTCC

Example 4

Data of histochemical analysis of GUS activity

To assess the effect of new regulatory elements on the level of expression of the repoter protein, a histochemical analysis of the GUS activity of tobacco tissues was carried out at the stage of in vitro propagation of transgenic lines. Such an analysis made it possible to quickly assess the presence of protein expression in plant tissues (see Table 3).

Table 3 The ratio of lines with the presence of the GUS gene and lines expressing protein The number of lines with the presence of all necessary elements confirmed by PCR reaction Histochemical analysis of GUS activity Percentage ratio Control G fourteen 6 42.865% pBIItob2 four four one hundred% pBIItob3 8 5 62.5%

Example 5

The effect of regulatory elements on stable GUS expression in tobacco plant tissues.

For a complete analysis of the influence of synthetic elements II and III, a fluorimetric analysis of GUS activity in plants protransformed with expression vectors containing, among other things, these regulatory elements was carried out. For analysis, 200 mg of the young tissue of plants in the greenhouse was taken (as a rule, it was 3-4 leaves). Samples were taken from five individual plants of each line. The measurement was carried out on a fluorimeter calibrated using freshly prepared standard 4-MU rats. The amount of reporter protein was estimated relative to the total protein of the extract, the determination of the concentration of which was carried out according to the Bradford reaction. The final concentration was obtained in the dimension nmol 4-MU / h per µg of total protein. Statistical processing of the data was carried out in Microsoft Excel and the results are summarized in the following table (see table 4). Since the values of the expression level obtained by us deviate from the normal distribution (according to the tests of Lilifor and Shapiro-Wilk), it is impossible to apply further statistical analysis calculated for the normal distribution to them.

Table 4 General statistics of three populations Population ^a Average ^b SD ^c CV ^d Median pBIG 44,49962 48,56882 1,091444 20.40245 pBI1tob2 113.6581 104.6094 0.920386 66.97014 pBI1tob3 271,427 427,3305 1,574385 79,13611 ^a Populations named for the T-DNA they contain;
^b nmol 4-MU / h per µg of total protein;
^c Standard deviation;
^d coefficient of variation;

Based on these data, it can be seen that when the termination elements are located above the reporter gene promoter, the total level of transgene expression increases by three to four times, which allows us to mark these elements as possible components for creating expression cassettes aimed at obtaining high and stable levels of expression of the target gene in various plant objects. These elements can be used to create transgenic plants for almost all branches of their application, such as biotechnology and the agricultural industry.

Literature

1. Kwaks, T.H. J., Barnett, P., Hemrika, W. et al. Identification of anti-repressor elements that confer high and stable protein production in mammalian cells Nature Biotechnology, 2003, 21: 553-558.

2. Allen G.C., Hall G., Michalowski S., Newmann W., Spiker S., Weissinger A.K., Thompson W.F. (1996). High-Level Transgene Expression in Plant Cells: Effects of a Strong Scaffold Attachment Region from Tobacco. Plant Cell. 8: 899-913.

3. Breyne P, van Montagu M, Depicker N, Gheysen G. (1992). Characterization of a plant scaffold attachment region in a DNA fragment that normalizes transgene expression in tobacco. Plant Cell. 4: 463-471.

4. Butaye K.M., Goderis I.J., Wouters P.F., Pues J.M., Delaure S.L., Broekaert W.F., Depicker A., Cammue B.P., De Bolle M.F. (2004). Stable high-level transgene expression in Arabidopsis thaliana using gene silencing mutants and matrix attachment regions. Plant J. 39: 440-449.

5. Gailie D.R., David E. Sleat, John W. Watts, Philip C. Turner, T. Michael A. Wilson (1987). The 5'-Leader Sequence of Tobacco Mosaic Virus RNA Enhances the Expression of Foreign Ene Transcripts in Vitro and in Vivo. Nucleic Acids Res. 15: 3257-3273.

6. Geert De Jaeger, Stanley Scheffer, Anni Jacobs, Mukund Zambre, Oliver Zobell, Alain Goossens, Ann Depickerl & Geert Angenon. (2002). Boosting heterologous protein production in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences. Nature Biotechnol. 20: 1265-1268.

7. Grummt Ingrid, Kuhn Anne, Bartsch Ingrid, Rosenbauer Horst. (1986). A transcription terminator located upstream of the mouse rDNA initiation site affects rRNA synthesis. Cell. 47: 901-911.

8. Holmes-Davis R, Comai L. (2002). The matrix attachment regions (MARs) associated with the Heat Shock Cognate 80 gene (HSC80) of tomato represent specific regulatory elements. Mol Genet Genomics. 266: 891-898.

9. Horsch, R. B., Fry, J. E., Hoffmann, N. L., Eichholtz, D., Rogers, S. G., Fraley, R. T. (1985). A simple and general method for transferring genes into plants. Science. 227: 1229-1231.

10. Jefferson R.A., Kavanagh T.A., Bevan M.W. (1987). GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6: 3901-3907.

11. Liu, J.W. and L.M. Tabe (1998). The influences of two plant nuclear Matrix Attachment Regions (MARs) on gene expression in transgenic plants. Plant Cell Physiol. 39: 115-123.

12. Mallory, A.C., Reinhart, B.J., Battel, D., Vance, V.B. & Bowman, L.H. (2002). A viral suppressor of RNA silencing differentially regulates the accumulation of short interfering RNAs and micro-RNAs in tobacco. Proc Natl Acad Sci USA. 99: 15228-15233.

13. McCormick, S. (1991) Transformation of tomato with Agrobacterium tumefaciens. Plant Tissue Culture Manual B6: 1-9. Kluwer Academic Publishers.

14. Murashige T. and Skoog F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant. 15: 473-497.

15. Odell, J.T. and Krebbers, E. (1998). Enhanced transgene expression in a population of monocot cells employing scaffold attachment regions. World Patent Office.

16. Outchkourov, N.S., Peters, J., de Jong, J., Rademakers, W. and Jongsma, M.A. (2003). The promoter-terminator of chrysanthemum rbcSl directs very high foreign gene expression levels in plants. Planta. 216: 1003-1112.

17. Rogers S., Bendich A. (1994). Extraction of DNA from plant, fungal and algal tissues. In: Gelvin SB, Schilperoort RA (eds) Plant Molecular Biology Manual. Boston, MA: Kluwer Academic Publishers, D 1: 1-8.

18. Samadder P, Sivamani E, Lu J, Li X, Qu R. (2008). Transcriptional and post-transcriptional enhancement of gene expression by the 5 'UTR intron of rice rubi3 gene in transgenic rice cells. Mol Genet Genomics. 279: 429-39.

19. Sambrook, J., E. F. Fritsch, and T. Maniatis. (1989). Molecular cloning: a laboratory manual. Second edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA.

20. Satoh J., Kato K., Shinmyo A.J. (2004). The 5'-untranslated region of the tobacco alcohol dehydrogenase gene functions as an effective translational enhancer in plant. Biosci Bioeng. 98: 1-8.

21. Voinnet O., Rivas S., Mestre P., Baulcombe D.C. (2003). An enhanced transient expression system in plants based on suppression of gene silencing by the pl9 protein of tomato bushy stunt virus. Plant J. 33: 949-956

22. Xue, H., Yang, Y.T., Wu, C.A., Yang, G. D., Zhang, M.M., Zheng, C.C. (2005). TM2, a novel strong matrix attachment region, isolated from tobacco, increases transgene expression in transgenic rice calli and plants. Theor. Appl. Genet. 110: 620-627

23. Revenkova E.B., Bagyan I.L., Pozmogova G.E., Kraev A.S. (1994) Development of a new vector system based on the Agrobacterium tumefaciens A281 strain. Molecule, genet., Microbiol. and viral. - T 5. - P.36.

Claims (1)

The method of creating transgenic lines of plants producing a protein with a high level of expression, comprising transforming plants with an expression vector including a plasmid containing a gene encoding β-glucuronidase, a 35S promoter, a nos transcription terminator, characterized in that a transcription terminator is inserted above the gene promoter with the ability effectively cut off genomic transcripts in the plant genome and effectively protect transgene expression in the plant genome from subsequent repression.

Images