RU2489488C1 - Method to determine virulent and pathogenic forms of flu viruses - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: method to determine virulent and pathogenic forms of flue viruses is based on collection of an initial sample of a tissue/physiological fluid from patients who are possibly sick with flu, extraction and treatment of RNA preparations from the initial sample, synthesis of cDNA on the RNA matrix, analysis of a nucleotide sequence of the produced cDNA with the purpose to identify the mutation status of specific positions of flu virus segments, and calculation of two scoring-factors, by the value of which they decide on extent of virulence and pathogenicity of a flu virus.

EFFECT: method may be used to determine virulent and pathogenic forms of flu virus.

5 tbl, 4 ex

Description

The present invention relates to the field of medicine and molecular biology, in particular, to virology, and can be used to detect virulent and pathogenic forms of influenza viruses.

The invention is known in which an antibody is proposed, the use of which allows for the rapid detection of a pandemic influenza A virus of subtype H1N1 of 2009, and a device that allows for the rapid detection of a pandemic influenza A virus of subtype H1N1 of 2009, as well as a method for detecting a pandemic influenza A virus of subtype H1N1 2009 [WO / 2011/087092].

The disadvantage of this solution is the relatively narrow scope, since it allows you to detect influenza virus that belongs to only one group of pandemic strains, but does not allow you to identify others, including pandemic influenza viruses, or to determine the degree of their danger to humans.

Also known is an invention that can be used to detect highly pathogenic avian influenza A / H5N1 virus, in particular, a method and kit for immunological analysis that allows for quick, convenient detection of highly pathogenic strains of avian influenza virus subtype H5N1 with a high degree of specificity, as well as immunochromatographic a kit for quick, convenient detection of highly pathogenic strains of avian influenza virus subtype H5N1 with a high degree of specificity, moreover, it is shown that monoclonal 4G6 antibodies obtained using the H5N1 virus as an immunogen (antigen) do not interact with influenza viruses of the H5N2 and H5N3 subtypes, coming into contact exclusively with the virions of the H5N1 subtype, and the use of the claimed immunochromatographic kit based on 4G6 antibodies allows specific detection of the virus subtype H5N1, moreover, the sensitivity of the performed immunochromatography can be increased by adding non-ionic surfactants and water-soluble vinyl polymers with a polar group, which includes oxygen and nitrogen atoms, in the developing solution used in immunochromatography [WO / 2010/103583].

The disadvantage of this solution is also the relatively narrow scope, because it allows you to detect highly pathogenic avian influenza A / H5N1 virus, but does not allow you to detect other influenza viruses, nor to assess their degree of virulence and pathogenicity.

In addition, methods based on the use of oligonucleotide primers and samples for detecting influenza viruses (as well as pathogens of many other diseases) and their discrimination on types (A / B) and subtypes are known, in particular, methods for detecting influenza virus are described, as well as methods differentiation into the declared subtypes and types (90% of swine and bird flu strains, including all H5N1 strains), according to which a sample with suspected influenza virus content is screened for the presence or absence of a characteristic sequence these nucleic acids, and the presence of this sequence in the sample indicates the presence of influenza virus in the sample, and the screening process is carried out by hybridization of the nucleic acid fragments contained in the sample with samples (for example, microarray samples) specific for all influenza viruses , so for a specific type (A / B) of the virus and for a specific subtype of the virus. Primers and probes for such detection and typing, as well as microchips containing such probes are also claimed [WO / 2007/095155].

This solution also has a relatively narrow scope, since it can detect the highly pathogenic avian influenza A / H5N1 virus, but it also does not allow the detection of influenza viruses of other strains or an assessment of their virulence and pathogenicity.

A known method for determining the virulence of microbes, based on the preparation of a tissue suspension in a 0.9% sodium chloride solution, dividing it into 3 parts, one part of a suspension of 0.8-1.2 ml is investigated by polymerase chain reaction (PCR) (0.3- 0.4 ml) to detect the sequence of the pFra, pCad, pPst genes, the second part of 0.1-0.15 ml of the suspension is sown on a dense Jackson-Burroughs nutrient medium with gentian violet (0.02-0.03 μg / ml) for detecting the Pgm ⁺ trait (determined by the chromosome sequence of genes), a third of 0.1-0.15 ml of the suspension is sown on Hottinger agar with gentian violet (0.02-0.03 μg / ml) to determine the sensitivity to antibiotics by the method of paper disks [RU 2160781, C1, C12Q 1/04, G01N 33/53, 12.20.2000].

The disadvantage of this method is the relatively narrow scope, since the method can be used for the epidemiological significance of plague microbes, as well as relatively low accuracy, because it does not allow to determine, in particular, the degree of virulence, as a quantitative measure.

The closest in essence to the proposed one is a method based on obtaining a genetically modified influenza virus and viral proteins by introducing mutations, deletions, inserts into parts of the viral genome encoding caspase or granzyme sites or their motives, or creating additional caspase sites and their motives for viral proteins through the implementation of site-directed mutagenesis and the process of reverse genetics, moreover, the resulting modified influenza virus has increased virulent properties, and modi itsirovannye viral proteins are associated with increased toxicity to the organism [RU 2366710, C1, C12N 7/04, 10.09.2009].

The disadvantage of this method is the relatively narrow scope, since the method can be used to obtain enhanced or weakened by the virulence and pathogenicity of influenza viruses, but it does not allow to determine the degree of virulence and pathogenicity of pathogens, including as a quantitative measure.

The desired result is to expand the scope on the basis of a quantitative determination of the degree of virulence and pathogenicity of influenza viruses.

The desired result is achieved by the fact that, according to a method based on obtaining an initial tissue / physiological fluid sample from patients presumably suffering from influenza, isolating and purifying RNA preparations from an initial tissue / physiological fluid sample and synthesizing single-stranded or double-stranded cDNA on an RNA matrix using random oligonucleotide primers, additionally carry out the reaction of amplification of fragments using cDNA synthesized on a matrix of viral RNA and a number of sets of alleles b-specific primers, determine the mutational status of influenza virus segments and calculate the scoring factor of virulence

$$V=\frac{{\displaystyle {\sum }_{i=\mathrm{one}}^S\left({\left({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}}\right)}^2\sqrt{H_i}/{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}}\right)}+W_{HA}{M}_{HA}}{{\displaystyle {\sum }_{i=\mathrm{one}}^S\sqrt{H_i}+W_{HA}}},$$

the magnitude of which is judged on the degree of virulence of the influenza virus, and the scoring factor of pathogenicity

$$P=\frac{{\displaystyle {\sum }_{i=\mathrm{one}}^S\left({\left({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}}\right)}^2({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}-{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}+\mathrm{one}}}\right)}\sqrt{H_i}/{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}})\cdot W_S+W_{HA}{M}_{HA}}{{\displaystyle {\sum }_{i=\mathrm{one}}^S\sqrt{H_i}+W_{HA}}}$$

the magnitude of which judges the degree of pathogenicity of the influenza virus,

where M _{i, j} is the mutation status for the amino acid position number j in the polypeptide chain synthesized by segment number i (the value of M _{i, j} is equal to one if the amino acid residue in this position is characteristic of viruses that are purely human virulence is zero - for animals); characteristic amino acid residues are shown in table 1; the value of M _{i, j} is 0.5, if such a classification cannot be made in accordance with the stated conditions;

M _HA is the mutational status of hemagglutinin; equal to one if the hemagglutinin segment can be assigned to the class of human, and zero - to the class of non-human; the correlation of the hemagglutinin segment to one of these classes is carried out according to the data on amino acid substitutions at characteristic positions in the hot spots given in tables 2 and 3; M _HA is 0.5 if such a classification cannot be made in accordance with the stated conditions;

W _{i, j} - weight, relative significance of the amino acid substitution at position j of the polypeptide chain synthesized by segment i, which determines the virulent virus genotype for humans (the most suitable values of the coefficients W _{i, j} are shown in table 4); applicable for segments of matrix proteins M1, M2, non-structural proteins NS1, NS2, polymerase subunits PA, PB1, PB2, nucleoprotein NP;

W _S is the total relative importance of amino acid substitutions in the polypeptide chains of segments M1, M2, NS1, NS2, PA, PB1, PB2, NP; the most suitable value of the coefficient W _S is 0.17;

W _HA - weight, relative importance of amino acid substitutions in the hemagglutinin polypeptide chain; the most suitable value for the coefficient W _HA is 2.45;

S is the number of analyzed segments / polypeptide chains;

H _i - the number of analyzed positions of amino acid substitutions in the polypeptide chain synthesized by segment i.

The method for determining virulent and pathogenic forms of influenza viruses is based on allele-specific PCR and identification of characteristic replacements in segments of influenza viruses, based on which a quantitative assessment of the degree of virulence and pathogenicity is performed.

The method includes sequentially performing the following operations (stages):

a) obtaining an initial tissue / physiological fluid sample from patients suspected of having influenza;

b) isolation and purification of RNA preparations from the initial sample;

c) synthesis of single-stranded or double-stranded cDNA on an RNA template using random oligonucleotide primers and / or segment-specific primers;

g) carrying out the amplification reaction of the fragments using the cDNA obtained in stage c);

d) evaluation of amplification results - determination of the mutational status of influenza virus segments;

e) calculation of the virulence scoring factor

$$V=\frac{{\displaystyle {\sum }_{i=\mathrm{one}}^S\left({\left({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}}\right)}^2\sqrt{H_i}/{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}W{}_{i,j}}\right)}+W_{HA}{M}_{HA}}{{\displaystyle {\sum }_{i=\mathrm{one}}^S\sqrt{H_i}+W_{HA}}},$$

the magnitude of which is judged on the degree of virulence of the influenza virus;

g) calculation of the scoring factor of pathogenicity

$$P=\frac{{\displaystyle {\sum }_{i=\mathrm{one}}^S\left({\left({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}}\right)}^2({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}-{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}+\mathrm{one}}}\right)}\sqrt{H_i}/{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}})\cdot W_S+W_{HA}{M}_{HA}}{{\displaystyle {\sum }_{i=\mathrm{one}}^S\sqrt{H_i}+W_{HA}}},$$

the magnitude of which is judged on the degree of pathogenicity of the influenza virus.

In the formulas for calculating scoring factors:

M _{i, j} is the mutation status for the amino acid position of the number in the polypeptide chain synthesized by segment number j (the value of M _{i, j} is equal to one if the amino acid residue in this position is characteristic of viruses that are virulent especially for humans, is equal to zero - for animals); characteristic amino acid residues are shown in table 1; the value of M _{i, j} is 0.5, if such a classification cannot be made in accordance with the stated conditions;

M _HA is the mutational status of hemagglutinin; equal to one if the hemagglutinin segment can be assigned to the class of human, and zero - to the class of non-human; the correlation of the hemagglutinin segment to one of these classes is carried out according to the data on amino acid substitutions at characteristic positions in the hot spots given in tables 2 and 3; M _HA is 0.5 if such a classification cannot be made in accordance with the stated conditions;

W _{i, j} - weight is the relative importance of the amino acid substitution at the position of the polypeptide chain synthesized by segment g, which determines the virulent genotype of the virus for humans (the most suitable values of the coefficients W _{i, j} are shown in table 4); applicable for segments of matrix proteins M1, M2, non-structural proteins NS1, NS2, polymerase subunits PA, PB1, PB2, nucleoprotein NP;

W _S is the total relative importance of amino acid substitutions in the polypeptide chains of segments M1, M2, NS1, NS2, PA, PB1, PB2, NP; the most suitable value of the coefficient W _S is 0.17;

W _HA - weight, relative importance of amino acid substitutions in the hemagglutinin polypeptide chain; the most suitable value for the coefficient W _HA is 2.45;

S is the number of analyzed segments / polypeptide chains;

H _i - the number of analyzed positions of amino acid substitutions in the polypeptide chain synthesized by segment i.

table 2 Hot spots of substitutions (HT) in the polypeptide chain synthesized by the hemagglutinin segment, which discriminates hemagglutinin into the human / non-human classes. Type ON GT №1 GT №2 GT No. 3 GT №4 GT №5 GT №6 H1 240 242 262 382 390 391 H2 236 238 258 378 386 387 H3 241 243 263 383 391 392 H4 239 241 261 381 389 390 H5 238 240 260 384 392 393 H6 239 241 261 382 390 391 H7 235 237 257 379 387 388 H8 239 241 261 382 390 391 H9 234 236 256 376 384 385 H10 236 238 258 378 386 387 H11 238 240 260 380 388 389 H12 238 240 260 380 388 389 H13 238 240 260 380 388 389 H14 243 245 265 385 393 394 H15 235 237 257 387 395 396 H16 239 241 261 380 388 389

Table 3 Amino acid residues, the presence of which in the corresponding hot spots No. 1-6 discriminates hemagglutinin on the human / non-human classes. GT№1 GT №2 GT No. 3 GT №4 GT №5 GT №6 human class Q G N Q N G V S T L N Q I S T L D Q I S T L N Q L S T L D Q L S N L D Q Q G N Q D G L S T TO D G inhuman class Q G T L D E Q G N K D G Q G N L D Q Q G T L D K Q G N Y D Q Q G T Q D G Q G I L D Q Q G N R D G s G N Y D Q L G N R D K Q G T K D G Q G N K D Q Q G N R D K Q G T R D G N G N Y D Q Q G N R D N

After calculating the scoring factor P, the decision on the virulence and pathogenicity of the studied influenza viruses is made according to the following criteria:

If the value of the scoring factor P is less than the threshold value of 0.4, then a decision is made to assign an insignificant degree of pathogenicity to humans of this strain - most likely, this strain belongs to the class of influenza of animals that are not transmitted to humans. If the scoring factor P is in the range 0.4-0.8, then a decision is made to assign the average degree of pathogenicity for a person of this strain - most likely, representatives of this strain can be attributed to the group of seasonal influenza viruses that are not harmful to humans. If the value of the scoring factor P exceeds 1.0, then a decision is made to assign a high degree of pathogenicity of this strain to humans - most likely, this strain can be classified as pandemic, most likely resulting from mutations in the genome of animal influenza virus. If the scoring factor P is in the range of 0.8-1.0, the solution is ambiguous - this strain cannot be classified as pandemic, but its appearance in the human population can lead to serious epidemics with a relatively high mortality rate during the course of the disease.

The degree of virulence of this strain for humans can also be estimated: if the value of V exceeds 0.22, then the viruses of this strain can be transmitted quite well from person to person. If the value of V is less than the declared value, then the transmission of the virus from person to person, as well as from animal to person, is difficult or impossible.

This invention was made possible thanks to the bioinformation study conducted by the authors of changes in the nucleotide and amino acid sequences of influenza A and B viruses and the discovery of the existence of a number of characteristic mutations, the presence of which allows us to judge the belonging of this virus to groups of pathogenic and virulent to humans.

Methods of isolating RNA from virus samples are well known and, as a rule, include the following stages: lysis of virions, isolation of RNA and its purification, checking (with sufficient material) the quality of RNA by electrophoresis in 1% agarose gel in the presence of dye ethidium bromide or in denaturing polyacrylamide gel, as well as spectrophotometric determination of the amount of RNA. For the direct isolation of RNA, various protocols commonly known to those skilled in the art can be used. Classical RNA isolation methods employ strong chaotropic agents, such as guanidine chloride and guanidinisothiocyanate, which dissolve proteins, and sequential extraction with phenol and chloroform to denature and remove proteins [Sambrook J., Fritsch E.F., Maniatis T. 1989. Molecular Cloning. A laboratory manual. 2nd Edition ed. Cold Spring Harbor: CSHL Press]. The Trizol reagent method (GIBCO / Life Technologies) is also widely used. In order to prevent RNA degradation by RNases, inhibitors such as an RNAsin inhibitor of placental or recombinant origin or, for example, a vanadyl-riboside complex, a non-specific broad-spectrum RNAse inhibitor, can be used.

Rapid and high-quality RNA isolation can be performed using a number of commercially available kits (Klonogen, St. Petersburg; RNeasy kits (Qiagen); SV Total RNA Isolation System, Promega (USA), etc.). The use of various devices, for example, QuickGene-810 (Life Science, Japan), eliminates the work with aggressive agents, accelerate and simplify the isolation of RNA. For extraction of RNA, this device uses an 80-micron porous membrane, which is 12.5 times thinner than the glass filter traditionally used in such devices (1000 μm), which allows to reduce RNA degradation and increase its yield.

Then the fragments amplification reaction is carried out using cDNA obtained at the stage of RNA isolation from the initial tissue samples, i.e. reverse transcription reaction: cDNA synthesis on an RNA matrix isolated from tissue samples.

The reverse transcription reaction, as a result of which a single-stranded DNA chain is synthesized on an RNA matrix, if necessary, with the completion of the second chain, allows us to switch from unstable RNA molecules to more stable DNA molecules. Further PCR amplification allows the use of very small amounts of starting RNA (at the level of several nanograms), and, consequently, the amount of sample material from which virus RNA is isolated.

The reverse transcription reaction can be carried out using commercially available reverse transcriptase preparations, such as Moloney mouse leukemia virus (M-MLV), avian myeloblastosis virus (AMV) reverse transcriptase, PowerScript (M-MLV-RT point mutation), C. Therm Polymerase and etc., with which you can get amplification products up to several thousand and even several tens of thousands of nucleotide pairs. Thermus thermophilus thermostable DNA polymerase (Tth), which has reverse transcriptase activity in the presence of Mn ions, can be used.

For reverse transcription, various primers can be used, for example:

1) Random hexanucleotide primers (“statistical primers”) hybridize with RNA in numerous sites. When reverse transcription with these primers receive short cDNA. Random hexamers are used to overcome difficulties associated with the secondary structure of RNA, they are more effective in reverse transcription of 5'-regions of mRNA;

2) Hexamers or other short oligonucleotides (10-12 nucleotides) of random composition can also be used in combination with oligot-containing primers (in the case of reverse transcription and obtaining cDNA for human mRNA genes);

3) Specific oligonucleotide primers are used to transcribe the RNA segments of viruses or regions of human mRNA that are of interest for research. These primers are successfully used for diagnostic purposes. However, due to the significant variability of the genome of the influenza virus, the use of such primers must be carefully justified.

There are also specialized kits focused on the isolation of viral RNA, which are part of the complex of diagnostic test systems, for example, a set of reagents for the isolation and subsequent detection of influenza A virus RNA subtype H5N1 by PCR by DNA technology (Moscow). With a lack of initial test material, such methods can be used to significantly increase the DNA / cDNA content in the analyzed sample, both full-genome or full-transcriptome amplification (both enriched with polyadenylated fragments and total cDNA amplification suitable for generating the studied genetic material of the influenza virus).

Also, for the preliminary amplification of influenza virus cDNA (for subsequent analysis using the microarray method), primers specific to a wide range of influenza virus strains described in the biomedical literature can be used [S.N. Chang, K.L. Lin, Y. Chan, Y.L. Wang, Y.T. Chi, H.L. Tu, H.K. Shieh, W.T. Liu. 2006. Amplification of the entire genome of influenza A vims H1N1 and H3N2 subtypes by reverse-transcription polymerase chain reaction, J Virol Methods. 136, 38-43].

The selection of primers specific for a specific RNA region of the influenza virus containing characteristic mutations, in the general case, is a difficult task due to the pronounced variability of its genome. In the process of selecting primers, not only the localization of characteristic mutations and nucleotide substitutions reflecting the virulent and pathogenic characteristics of the strain, but also the location of the conservative sections of the virus should be taken into account - in this case, the diagnostic coverage of influenza virus strains can be maximum.

In the general case, the choice of primers for allele-specific PCR should meet the criteria for the location of the nucleotide, the mutational status of which is to be determined, in the 3'-terminal region of one of the primers. In another case, TaqMan or another specific sample (or probes such as Molecular beacon) can be located directly at the location of the mutation.

In general, existing programs are used to select specific primers and probes (TaqMan, molecular beacon, etc.), many of which are freely available on the Internet. Among such programs are Oligo, PrimerSelect (www.dnastar.com). Primer Express (Applied Biosystems, (USA), Primer Designer (IMB RAS), FastPCR (http://www.biocenter.helsinki.fi/bi/Programs/fastpcr.htm), PrimerQuest (http: //scitools.idtdna. com / Primerquest /), Primer3, etc. There are well-known web services for the selection of primers and samples; among them, we can mention the NCBI Primer BLAST, which allows automated selection of primers with a minimum probability of nonspecific binding, both with respect to other parts of the virus genome and the human genome Given the complexity of the analyzed fragments, the length of the primers can be selected in the range from 16 to 25 bp

There are various approaches that are well known to those skilled in the art for the chemical synthesis of oligonucleotide primers, for example, the phospho-diester method, the hydrophosphoryl method, etc., but the phosphoramidite method is currently the most widely used. The synthesis of primers is carried out using automatic DNA / RNA synthesizers, for example, manufactured by Applied Biosy stems (USA).

Determination of the mutational status of influenza virus segments, which are used to calculate scoring factors V and P and further assess the degree of virulence and pathogenicity of this strain for humans, can be carried out using allele-specific PCR.

Carrying out allele-specific PCR is as follows.

Various protocols for assessing the presence of mutations by allele-specific PCR are well known in the art, in particular, such PCR can be performed as described previously [S. Tanaka, A. Taniue, N. Nagao, S. Ohnoki, H. Shibata, Y. Okubo, H. Yamaguchi. 1995. Simultaneous DNA typing of human platelet antigens 2, 3 and 4 by an ancle-specific PCR method, Vox Sang. 68, 225-230]. To study the mutational status of several nucleotide positions in a single experiment, multiplex PCR, both traditional and real-time PCR, is usually used. In the case of traditional PCR, mutations at various positions of the virus genome are recorded by measuring the intensity of the DNA bands in the gel after electrophoretic separation of amplification products. Such products - amplicons - should vary significantly in length for different positions of the mutations. In the case of real-time multiplex PCR, two variants of the arrangement of primers and samples are allowed: a) different oligonucleotide samples correspond to different positions of the mutations, and in the case of mutations, the sample is perfectly bound to the cDNA matrix, after which the corresponding fluorescent signal can be detected; b) the positions for which mutations can be observed correspond to the 3'-terminal regions of the primers (by analogy with traditional allele-specific PCR), and only in the presence of mutations will a highly efficient amplification of the product occur, its exponential increase with each reaction cycle the recorded fluorescent signal is directly proportional to its concentration. In this case, DNA-intercalating nonspecific samples, for example, SYBR Green, EVA Green [J. Evans, H. Segal. 2010. Novel multiplex allele-specific PCR assays for the detection of resistance to second-line drugs in Mycobacterium tuberculosis, J Antimicrob Chemother. 65, 897-900]. It is preferable to use the technique of conducting allele-specific PCR according to claim 6). In this case, several sets of primers are used, each of which will selectively amplify the sequence of a particular allele with maximum efficiency. Moreover, the achievement of the threshold level of fluorescence, significantly different from the background level, is the first to occur for a set of primers corresponding to the analyzed allele, on the so-called threshold cycle C _T.

To implement this experimental approach to registration of mutations, there are also a number of specialized sets; Among them, AmpHFlash and AmpliFlash + kits (GenExpert, Moscow), which involve the use of highly specific Scorpions fluorescent probes of the Molecular beacon type, can be noted. Thus, since at present in clinical practice not only traditional PCR with subsequent electrophoretic separation of amplification products, but real-time PCR is actively used, this provides additional opportunities for the practice of the present invention.

As a result of the operations of the method described above, M _{i, j} - mutational statuses of amino acid positions in segments M1, M2, NS1, NS2, PA, PB1, PB2, NP and M _HA - mutational status of hemagglutinin segment can be calculated. This allows the calculation of the virulence scoring factor.

$$V=\frac{{\displaystyle {\sum }_{i=\mathrm{one}}^S\left({\left({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}}\right)}^2\sqrt{H_i}/{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}}\right)}+W_{HA}{M}_{HA}}{{\displaystyle {\sum }_{i=\mathrm{one}}^S\sqrt{H_i}+W_{HA}}}$$

the magnitude of which is judged on the degree of virulence of the influenza virus, and the scoring factor of pathogenicity

$$P=\frac{{\displaystyle {\sum }_{i=\mathrm{one}}^S\left({\left({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}}\right)}^2({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}-{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}+\mathrm{one}}}\right)}\sqrt{H_i}/{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}})\cdot W_S+W_{HA}{M}_{HA}}{{\displaystyle {\sum }_{i=\mathrm{one}}^S\sqrt{H_i}+W_{HA}}}$$

the magnitude of which is judged on the degree of pathogenicity of the influenza virus.

After calculating the scoring factors P and V, the decision on the virulence and pathogenicity of the studied influenza viruses is made according to the following criteria:

If the value of the scoring factor P is less than the threshold value of 0.4, then a decision is made to assign an insignificant degree of pathogenicity for a person of this strain - most likely, this strain belongs to the class of animal flu that is not transmitted to humans. If the scoring factor P is in the range 0.4-0.8, then a decision is made to assign the average degree of pathogenicity for a person of this strain - most likely, representatives of this strain can be attributed to the group of seasonal influenza viruses that are not harmful to humans. If the value of the scoring factor P exceeds 1.0, then a decision is made to assign a high degree of pathogenicity of this strain to humans - most likely, this strain can be classified as pandemic, most likely resulting from mutations in the genome of animal influenza virus. If the value of the scoring factor P is in the range of 0.8-1.0, the solution is ambiguous - this strain cannot be classified as pandemic, but its appearance in the human population can lead to serious epidemics with a relatively high mortality rate during the course of the disease.

The degree of virulence of this strain for humans can also be estimated: if the value of V exceeds 0.22, then the viruses of this strain can be transmitted quite well from person to person. If the value of V is less than the declared value, then the transmission of the virus from person to person, as well as from animal to person, is difficult or impossible.

Using the calculation of scoring factor P to assess the degree of potential danger of a viral strain to humans makes it possible to implement the concept of an integrated approach to the analysis of mutations in the virus genome and the corresponding amino acid substitutions in protein polypeptide chains. The scoring factor reflects a balance between mutations and substitutions that are characteristic of viruses of the ordinary, human flu, as well as the usual flu of various animals. Low scoring factor P values are observed for seasonal viruses (amino acid residues in the corresponding positions are characteristic of viruses that are virulent especially for humans), the maximum - for pandemic viruses that contain characteristics of both human and animal viruses, zero and close to zero - for animal influenza viruses that cannot be transmitted to humans.

Further, the present invention is illustrated by specific examples of the implementation of the operations of the method.

Example 1. Isolation of RNA from test samples of RNA from human sputum was isolated using the RNeasy Mini Kit reagent kit (Qiagen, Germany) according to the protocol. The main stages included: 1) destruction of viral membranes and other cellular structures using a micro-desmembrator (Sartorius, Germany) and homogenization of the destroyed sample in RLT lysis buffer per 600 μl per 30 μg of tissue. 2) centrifugation for 3 minutes at 14000 rpm (4 ° C); 2) adding an equal volume of aqueous 70% ethyl alcohol to the supernatant; 3) application to the column; 4) washing the column after sorption of RNA once with RW1 buffer with a volume of 700 μl and twice with RPE buffer with a volume of 500 μl; 5) RNA elution with RNase-free water. RNA concentration was determined on a NanoDrop ND1000 spectrophotometer (NanoDrop Technologies Inc., USA) at a wavelength of 260 nm. The quality of the isolated RNA was checked by electrophoresis on a 1% agarose gel, in the presence of ethidium bromide, as well as on a Bioanalyser Agilent 2100 instrument (Agilent Technologies, USA).

Example 2. The reaction of reverse transcription

For the reverse transcription reaction, 1 μg of RNA obtained by the above method was taken, pretreated with RNase-free DNase I (Invitrogene), 100 ng of hexanucleotide primers, 1 mM dNTP, 1x reaction buffer (Fermentas, Lithuania) containing 250 mM Tris -HCl (pH 8.3, 25 ° С), 250 mM KCl, 20 mM MgCl ₂ , 50 mM DTT, and 200 M-MuLV reverse transcriptase units (Fermentas, Lithuania). The reaction was carried out in a volume of 20 μl at the following temperature conditions: 25 ° С - 10 min, 42 ° С - 60 min, 50 ° С - 10 min, 70 ° С - 10 min.

Example 3. Allele-specific real-time PCR to detect nucleotide and amino acid substitutions in segments of the influenza virus A / chicken / Moscow / 2/2007 (H5N1).

At the first stage, the conditions for PCR were selected, the results of amplification carried out at various concentrations of primers and magnesium chloride MgCl ₂ were evaluated. The most significant differences in the threshold cycles were achieved with the following component concentrations: 4 mM MgCl ₂ , 300 nM of each of the primers (direct and reverse for each reaction), 5 ng of cDNA obtained from the influenza virus strain A / chicken / Moscow / 2/2007 (H5N1), 1 × Power SYBR Green PCR Master Mix (Applied Biosystems). Such a composition of the reaction mixture was adopted for allelic analysis of influenza virus segments. The total volume of the reaction mixture is 25 μl. The PCR thermal conditions were as follows: initial denaturation and activation of the enzyme at 95 ° C for 10 min; 45 cycles of amplification followed: denaturation at 95 ° C for 5 sec, annealing of the primers and polymerization at 62 ° C for 60 sec. Each reaction was carried out in a double replica. For quantitative measurements, an ABI PRISM 7000 Sequence Detection System, Applied Biosystems, USA was used. Primer sets were used for the 4 different most common alleles of the analyzed region of the RA segment, which corresponds to position 225 of the polypeptide chain. Applied Biosystems software was used in allelic discrimination mode.

The nucleotide sequences of the forward and reverse primers used to discriminate against influenza virus alleles are presented in table 5.

Table 5 The sequence of primers and samples used for allelic discrimination of sections of influenza segments. Set No. Type of Sequence SEQ ID NO: T _m , ° C Length Amplicon length one PA, allele 1 (noted in 1171 strain), corresponds to a. about. cysteine (C) at position 225, in the presence of this allele, the corresponding coefficient. M _{i, j} = 1 straight CTCCCACCGAACTTCTCCT one 58.3 19 69 back GCAGCCGTTCGGTTCG 2 58.0 16 2 RA, allele 2 (observed in 6825 strains), corresponds to aa serine (S) at position 225, in the presence of this allele, the corresponding coefficient. M _{i, j} = 0 straight CTCCCACCGAACTTCTCCA 3 58.3 19 69 back CCGTTCGGTTCGAATCCAT four 58.0 19 3 PA, allele 3 (observed in 1046 strains), corresponds to aa cysteine (C) at position 225, in the presence of this allele, the corresponding coefficient. M _{i, j} = 1 straight CCCGCCGAACTTCTCCT 5 60.1 17 63 back CCGTTCGGTTCGAATCCAT four 59.3 19 four PB2, allele 1 (observed in 3082 strains), corresponds to aa alanine / threonine (A / T) at position 588, in the presence of this allele, the corresponding coefficient. M _{i, j} = 0 straight CAGTCTCTTGTCCCTAAGGCAAC 6 58.3 23 97 back CAGTGTCAAATGTCCCAAGCA 7 58.1 21 5 PB2, allele 2 (observed in 1162 strains), corresponds to aa isoleucine (I) at position 588, in the presence of this allele, the corresponding coefficient. M _{i, j} = 1 straight AATCTTTAGTCCCCAAGGCCAT 8 59.2 22 94 back GTGTCAAATGTCCCAAGTACGTCT 9 58.4 24 6 PB2, allele 3 (observed in 819 strains), corresponds to aa isoleucine (I) at position 588, in the presence of this allele, the corresponding coefficient. M _{i, j} = 1 straight TTCAATCTTTAGTTCCTAAGGCCAT 10 58.2 25 89 back TGTCCCAAGTACATCTCTCATTTGT eleven 58.1 25 7 PB2, allele 4 (observed in 641 strains), corresponds to aa alanine / threonine (A / T) at position 588, in the presence of this allele, the corresponding coefficient. M _{i, j} = 0 straight CAATCCTTGGTACCTAAAGCTGC 12 58.4 23 93 back ATCAAATGTCCCCAGTACGTCA 13 58.0 22

According to real-time PCR data obtained using the Applied Biosystems software, the values of C _T , the threshold cycle at which the threshold level of fluorescence was reached, were 4.9 ± 0.3 less cycles when using the reaction mixture, which included primers of set 2, than for the reaction mixture, which includes the primers from kit 1 and 3.5 ± 0.4 less than for the mixture with primers of kit 3. Thus, we can conclude that at position 225 of the polypeptide chain of the subunit of the RA polymerase of the influenza virus of strain A / chicken / Mosco w / 2/2007 (H5N1) is the residue of serine (S), which, in accordance with the data in Table 1, allows us to consider this amino acid substitution as characteristic of viruses of purely animal flu. Thus, the coefficient M _{i, j} for this position is zero.

For another segment, PB2, the threshold level of fluorescence was achieved most quickly when using set of primers 7 - the value of C _T was 6.2 ± 0.2 cycles lower than for set 4, by 5.8 ± 0.5 cycles for set 6, while when using set 5, the value of C _T was 7.4 ± 0.4 cycles higher. Thus, the coefficient M _{i, j} for position 588 of the PB2 polypeptide chain is also zero.

Example 4. Calculation of scoring factors of virulence and pathogenicity for a number of strains of pandemic, seasonal flu, as well as animal flu.

In accordance with the above formulas, scoring factors P, V were calculated based on data on the nucleotide sequence of chains of various segments. Segment nucleotide sequence data was obtained from the NCBI server [http://www.ncbi.nlm.nih.gov/nuccore]. The virtual translation of the coding regions of the segments M1, M2, NS1, NS2, NP, PA, PB1, PB2, HA was carried out. The results of the calculation of scoring factors in accordance with the claimed formulas are shown below.

Strains of pandemic viruses:

1. Influenza A virus (A / USSR / 90/1977 (H1N1)), P = 2.58, V = 7.75

2. Influenza A virus (A / USSR / 46/1979 (H1N1)) P = 2.77, V = 7.16

3. Influenza A virus (A / Hong Kong / I-9-MA21-1 / 1968 (H3N2)), P = 2.19, V = 7.57

4. Influenza A virus (A / Albany / 6/1970 (H3N2)), P = 2.19, V = 7.57

5. Influenza A virus (A / Leningrad / 134/17/1957 (H2N2)), P = 2.10, V = 7.02

6. Influenza A virus (A / Hong Kong / 483/1997 (H5N1)), P = 1.20, V = 1.00

Seasonal influenza virus strains:

1. Influenza A virus (A / Moscow / IIV01 / 2009 (H1N1)), P = 0.46, V = 0.24

2. Influenza A virus (A / Moscow / WR1866N / 2009 (H1N1)), P = 0.46, V = 0.25

3. Influenza A virus (A / Moscow / IIV-33/2010 (H1N1)), P = 0.47, V = 0.24

4. Influenza A virus (A / Moscow / IIV-83/2011 (H1N1)), P = 0.45, V = 0.24

5. Influenza A virus (A / Moscow / WRAIR4316T / 2011 (H1N1)), P = 0.46, V = 0.24

5. Influenza A virus (A / New York / 345/2001 (HlNl)), P = 0.57, V = 3.45

6. Influenza A virus (A / Ekaterinburg / 01/2009 (HlNl)), P = 0.55, V = 0.37

7. Influenza A virus (A / Paris / 2709/2009 (H1N1)), P = 0.47, V = 0.25

8. Influenza A virus (A / Beijing / 080302/2009 (H3N2)), P = 0.71, V = 4.3

Animal influenza virus strains:

1. Influenza A virus (A / equine / Califomia / 103/1982 (H3N8)), P = 0.33, V = 0.17

2. Influenza A virus (A / chicken / India / IVRI-0004/2010 (H9N2)), P = 0.10, V = 0.04

3. Influenza A virus (A / avian / Japan / 8KI0040 / 2008 (H3N5)), P = 0.35, V = 0.18

4. Influenza A virus (A / equme / Jilin / l / 1989 (H3N8)), P = 0.00, V = 0.00

5. Influenza A virus (A / swine / Italy / 526/1985 (H3N2)), P = 0.06, V = 0.03

6. Influenza A virus (A / swine / Italy / 671/1987 (H1N1)), P = 0.34, V = 0.14

7. Influenza A virus (A / duck / France / 080032/2008 (H5N2)), P = 0.35, V = 0.17

8. Influenza A virus (A / duck / France / 06436/2006 (H5N3)), P = 0.33, V = 0.18

As can be seen from the results obtained, the degree of pathogenicity, determined by the value of scoring factor P, is valid, while the assessment of virulence by the value of V allows us to draw the correct conclusions about whether the virus of this strain can be transmitted from animal to human.

Thus, due to the improvement of the known method, the desired result is achieved, since the introduction of new operations of the method, in particular the analysis of the nucleotide sequence of the obtained cDNA and determination on this basis of the mutational status of the characteristic positions in the segments of the influenza virus, allows us to quantify the degree of virulence and pathogenicity of influenza viruses.

Claims (1)

A method for determining virulent and pathogenic forms of influenza viruses, based on obtaining an initial tissue / physiological fluid sample from patients suspected of having influenza, isolating and purifying RNA preparations from an initial tissue / physiological fluid sample, further cDNA synthesis, characterized in that they additionally carry out nucleotide analysis the sequence of the obtained cDNA in order to determine the mutational status of characteristic positions in the segments of the influenza virus, on the basis of which the scoring factor in rulentnosti
$$V=\frac{{\displaystyle {\sum }_{i=\mathrm{one}}^S\left({\left({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}}\right)}^2\sqrt{H_i}/{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}}\right)}+W_{HA}{M}_{HA}}{{\displaystyle {\sum }_{i=\mathrm{one}}^S\sqrt{H_i+W_{HA}}}}$$

,
the magnitude of which is judged on the degree of virulence of the influenza virus, and the scoring factor of pathogenicity
$$P=\frac{{\displaystyle {\sum }_{i=\mathrm{one}}^S\left({\left({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}}\right)}^2({\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}-{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}{M}_{i,j}+\mathrm{one}}}\right)}\sqrt{H_i}/{\displaystyle {\sum }_{j=\mathrm{one}}^{H_i}{W}_{i,j}})\cdot W_S+W_{HA}{M}_{HA}}{{\displaystyle {\sum }_{i=\mathrm{one}}^S\sqrt{H_i+W_{HA}}}},$$

the magnitude of which is judged on the degree of pathogenicity of the influenza virus,
where M _{i, j} is the mutation status for the amino acid position number j in the polypeptide chain synthesized by segment number i (the value of M _{i, j} is equal to one if the amino acid residue in this position is characteristic of viruses that are purely human virulence is zero - for animals, equal to 0.5, if such a classification cannot be made in accordance with the stated conditions);
M _HA - mutational status of hemagglutinin (equal to one if the segment of hemagglutinin can be assigned to the class of human, and zero to the class of non-human, equal to 0.5 if such a classification cannot be made in accordance with the stated conditions);
W _{i, j} - weight, relative significance of the amino acid substitution at position j of the polypeptide chain synthesized by segment i, which determines the virulent genotype of the virus for humans;
W _S - total relative importance of amino acid substitutions in the polypeptide chains of segments M1, M2, NS1, NS2, PA, PB1, PB2, NP;
W _HA - weight, relative importance of amino acid substitutions in the hemagglutinin polypeptide chain;
S is the number of analyzed segments / polypeptide chains;
H _i - the number of analyzed positions of amino acid substitutions in the polypeptide chain synthesized by segment i,
at the same time, if the value of the virulence scoring factor V exceeds 0.22, then the decision is made that the viruses of this strain can be transmitted quite well from person to person, if the V value is less than the declared value of 0.22, then a decision is made that the transmission of the virus of this strain from person to person, as well as from animal to person, is difficult or impossible, if the value of the pathogenicity scoring factor P is less than the threshold value of 0.4, then a decision is made to assign an insignificant degree of pathogenicity for person of this strain, if the values of the scoring factor of pathogenicity P is in the range of 0.4-0.8, then a decision is made to assign the average degree of pathogenicity for a person of this strain, if the value of the scoring factor of pathogenicity P exceeds 1.0, then the decision to assign a high degree of pathogenicity of this strain to humans, if the value of the pathogenicity scoring factor P is in the range of 0.8-1.0, then the decision is ambiguous - this strain cannot be classified as pandemic, but its appearance in the population uu humans can cause severe epidemics with a relatively high degree of lethality at course of the disease.