RU2478706C1 - Method of producing suspensions of hydrogel microparticles with given dimensions based on recombinant cobweb protein and use thereof - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention provides a method of producing a suspension of hydrogel microparticles with given dimensions based on recombinant cobweb protein. The method involves obtaining a protein solution which is freed from a solvent, obtaining a hydrogel and obtaining a microgel suspension, determining the size of the gel particles and obtaining gel microparticles with given dimensions. Recombinant cobweb protein of orb-weaver spiders is used, which is dissolved in lithium chloride solution in formic acid. The solution undergoes dialysis against a potassium phosphate buffer and then centrifuged. The protein solution is exposed to ultrasound. The solution is settled at room temperature until a gel forms. The gel is passed through a sieve, 96% ethyl alcohol is added, shaken and then aged. The microparticles are separated by differential centrifuging. The invention also relates to use of a suspension of hydrogel microparticles obtaining using the described method for adhesion and proliferation of human or animal cells onto the surface of the hydrogel microparticles or implantation of hydrogel microparticles into the human or animal body.

EFFECT: high efficiency of producing suspensions of hydrogel microparticles with given dimensions.

2 cl, 6 dwg, 14 ex

Description

The technical field to which the invention relates.

The invention relates to the field of biotechnology and is directed to a method for producing suspensions of gel microparticles with predetermined sizes based on a recombinant web protein and their use.

State of the art

The web is a unique biomaterial that combines amazing strength and elasticity. According to these indicators, it has no analogues both in nature and among materials created by man. So, for example, the skeleton web of the Nephila clavipes spider-web spider is superior to steel in terms of tensile strength and comparable to Kevlar, and exceeds Kevlar in terms of burst energy; at the same time, it can stretch up to 35% of its length [Gosline J.M. et al. Endeavor, 1986, v. 10, 37-43].

Obtaining industrial quantities of such materials is possible only with the help of genetic engineering and biotechnological methods. To date, several genes encoding web proteins have been isolated and quite fully characterized [Xu M. & Lewis R. Proc. Natl. Acad. Sci, USA, 1990, v. 87, 7120-7124; HinnmanM. & Lewis R. J. Biol. Chem, 1992, v. 267, 19320-19324; Guerette P. et al. J.Science, 1996, v. 272, 112-115; Hayashi C.Y. & Lewis R.V. J. Mol. Biol., 1998, v. 275, 773-784]. These genes are among the longest known cistrons (mRNA sizes range from 7.5 to 15.5 so-called) and consist of a large number of tandem repeating extended sequences that differ markedly between different genes. The most studied skeleton thread of the Nephila clavipes orbiting spider consists of two proteins - speedroin 1 and speedroin 2 (MaSp1 and MaSp2, respectively) synthesized by the large ampulla gland [Hinnman M. & Lewis R.J. Biol. Chem., 1992, v. 267, 19320-19324; Guerette P. et al. Science, 1996, v. 272, 112-115]. The repeating element of speedroin 1 can be represented as the following consensus sequence:

[GGAGQGGYGGLGSQGAGRGGLGGQGAG (A) _4-7 ],

and the repeating sequence of speedroin 2 is in the form

[GPGGYGPGQQGPGGYAPGQQPSGPGS (A) _6-10 ].

The fundamental difference between these proteins is that in the case of speedroin 1, the elementary repeat is the GGX tripeptide (X = A, S or Y), and in the case of speedroin 2, the pentapeptides GPGGY and GPGQQ. At the same time, speedroin 1 is characterized by increased strength, and speedroin 2, which is capable of forming (β-helices [Hayashi et al., 1999, Int. J. Biol. Macromol., V.24, 271-275]), is characterized by high elasticity. The interaction of these proteins in the composition of the frame of the web and provides a unique combination of its properties.

The MiSp1 and MiSp2 proteins, synthesized by the small ampulla gland, and the Flag protein of the hunting strand of the spider-spider also have a repeating structure. The repeating regions are enriched with alanine and glycine. GGX and GA motifs are presented along the entire length of the amino acid sequence of both the MiSpl protein and MiSp2 protein [K. Vasanthavada et al. Cell. Mol. Life Sci, 2006, v. 63, 1986-1999]. In the sequence of the flag protein of the hunting strand, dominant repeating motifs are represented by the pentapeptide GPGG1X and the tripeptide GGX.

The results of the study of the proteins of the skeleton of the spider-weaver Nephila clavipes, as well as the protein of the hunting thread and the proteins synthesized by the small ampulla gland [KohlerT. & VollrathF. J. Exp. ZooL, 1995, v. 271, 1-17; Colgin MA & Lewis R., Protein Sci., 1998, v. 7, 667-672], allowed to put forward a modular hypothesis of the structure of web proteins [Hinman at al., 2000, TIBTECH, V.1, 374-379]. Structural analysis of web proteins indicates the presence of crystalline regions in them formed by β-folded structures (it is believed that they are formed by blocks (A) _n and (GA) _n ), which provide strength of the web threads and which are immersed in a less structured Gly-enriched matrix responsible for elasticity. At the ends of the molecules there are unique (NR) unique conserved sequences that are believed to be necessary to increase the solubility of proteins in a concentrated solution within the gland, as well as to properly adjust the molecules during spinning.

In the first case, more than 80% of the target protein was found in the water-insoluble fraction, and the average yield was 6-8 mg of protein per 1 liter of yeast fermentation culture. In Pichia pastoris yeast, the average yield of pure 1F9 protein was approximately 70 mg per kg of wet cell mass (approximately 23 mg / L fermentation culture). The recombinant protein sequences were as close as possible to the sequences of natural proteins, in particular, the repeating region of the 1F9 protein contained 9 repetitions of the “monomer” consisting of five variants of the primary repeats found in natural speedroin 1. In order to increase the level of synthesis of recombinant protein in yeast cells, the gene structure 1F9 and 2E12 were modified by replacing “rare” triplets with codons characteristic of efficiently expressed yeast genes, and the number of internal repeats is nucleotide x sequences are minimized. DNA fragments encoding the corresponding monomers of both proteins were obtained by chemical-enzymatic synthesis and then amplified. The final 1F9 protein gene encoded nine repeats of the corresponding “monomer,” constituting a protein with a molecular weight of 94 kDa; protein 2E12 (molecular weight 113 kDa), contained 12 "monomeric" repeats.

In solutions of 1F9 and 2E12 proteins purified using cation exchange chromatography, structural transitions arising under certain influences were studied [Bogush V.G. & Debabov V.G., 2009, J. Neuroimmune PharmacoL, v.4, 17-27]. Despite the absence of hydrophilic N- and C-terminal unique sequences (NR), which, as previously assumed, are necessary for the formation of nanofibrils and micelles, both proteins spontaneously formed nanofibrils 100 nm - 1 μm long and micelles with a diameter of about 1 μm in an aqueous solution. Moreover, nanofibrils had a spiral structure with a period of 40 nm.

The prior art method for producing a hydrogel from an analogue of spider speedroin 1, which was taken as the closest analogue [Rammensee S, Huemmerich D, Hermanson KD, Scheibel T, Bausch AR (2006) Rheological characterization of hydrogels formed by recombinantly produced spider silk. Appl Phys A Mater Sci Process 82: 261-264].

To obtain a hydrogel, the article used an analogue of the spider speedroin 1-ADF-4 with 16 repetitions of the consensus sequence (C ₁₆ ):

(GSSAAAAAAAASGPGGYGPENQGPSGPGGYGPGGP), with a molecular weight of 48 kDa.

The protein was expressed in E. coli BLR (DE3). The purified protein was washed in 8 M urea, dissolved in 6 M GdmSCN and dialyzed against 10 mM NH ₄ HCO ₃ . Insoluble fragments were removed by CF at 50,000 g, 30 min. The remaining protein solution was lyophilized.

The lyophilized protein was dissolved in 6M GdmSCN and dialyzed against 5 mM potassium phosphate pH 8.0. Insoluble fragments were removed by CF at 125000 g, 30 min. The precipitate was discarded.

Methanol was added to a concentration of 10%. In this case, the protein was collected in nanofibrils at a concentration of 5 to 30 mg / ml.

Depending on the concentration, nanofibrils formed a hydrogel over a period of several days to 1 week.

This hydrogel was easily destroyed by shaking and flowing.

For hardening, the hydrogel was crosslinked with ammonium peroxodisulfate (APS) and Tris (2,2'-bipiridyl) dichlororuthenium (II) (Rubpy). The amount of reagents was calculated so that the final concentration was 10 mM APS and 100 μm Rubpy. Reagents were added to the hydrogel and allowed to soak overnight. Then the hydrogel was exposed to visible light under a tungsten lamp for 1 min and the remaining liquid was removed from the surface of the hydrogel.

The difference between the proposed methodology and the well-known:

- used other protein sequences;

- two proteins - analogs of speedroins 1 and 2, and not one;

- more diverse sequences (closer to natural ones);

- proteins have high molecular weights - 94 and 113 kD, which should give more dense hydrogels;

- gene expression - in yeast cells, and not in E. coli.

- gels were obtained during the night, and not several days;

- suspensions of hydrogel microparticles with predetermined size ranges and different densities were obtained.

The ability to obtain hydrogels in the form of a suspension of hydrogel microparticles has a great advantage compared to unmilled hydrogels: the particles can be coated with a monolayer of cells (this has already been shown by the authors) and injected into the body with a syringe. The claimed method allows the use of a significantly larger number of cells per unit volume of material and contributes to better cell survival due to a more efficient delivery of nutrients. A suspension of microgels can be used for applying to the surface of wounds, which has certain advantages compared to films (no need to select the size, better gas exchange and access of medicinal substances). In addition, suspensions of hydrogel microparticles with specified sizes make it possible to use them in medicine in cases where it is necessary to achieve a uniform and programmable rate of biodegradation of microparticles.

Disclosure of invention

The inventors of the present invention have for the first time proposed a method for producing recombinant spider web spider proteins (Araneidae) in yeast cells, providing for production of recombinant proteins in amounts ten times greater than the amount of recombinant web proteins produced in accordance with methods known from the prior art, and a method for obtaining suspensions of hydrogel microparticles with specified sizes based on a recombinant web protein and their medical use.

According to the proposed method, recombinant spider web spider proteins are expressed in yeast cells as a hybrid with a ubiquitin-like protein occupying an N-terminal position in the composition of the hybrid and containing a processing site recognized by natural yeast proteinases, preferably ubiquitin-specific DUB or SUMO proteases yeast proteinases, as a result of which, during expression, fusion proteins are processed by proteinases, which ensures the accumulation of matured yeast cells of a cobweb protein that does not contain a hybrid component, the protein accumulating in the water-insoluble fraction of yeast cells.

Preferably, the method according to the invention provides for the production of a recombinant web protein, the consensus sequences of which come from the framework proteins of the large ampulla gland and / or the proteins of the small ampulla gland or the protein of the hunting thread of the spider-spider.

In one preferred embodiment, the method according to the invention provides for the production of recombinant web proteins whose consensus sequences are derived from the framework proteins of the large ampulliform gland Nephila clavipes and / or Nephila madagascariensis, and the ubiquitin-like protein is selected from the group consisting of ubiquitin and Saccharomyces yeast SUMO protein cerevisiae.

In one of the most preferred embodiments, the method according to the invention is directed to the production of a recombinant protein 2E12 of the Nephila madagascariensis skeleton spider yarns in Saccharomyces cerevisiae cells under the control of the yeast GAL1 gene promoter, the recombinant protein gene being fused to the sequence encoding the ubiquitin Sarcemes cereum protein.

In yet another most preferred embodiment, the method according to the invention is directed to the expression of the recombinant gene 1F9 protein of the skeleton spider Nephila clavipes in Saccharomyces cerevisiae cells under the control of the yeast GAL1 gene promoter, and the recombinant protein gene is fused to the sequence coding for ubiquitin Sarcece cereus protein.

In accordance with yet another aspect, the invention provides host yeast cells producing recombinant spider-web spider web proteins. The most preferred host cells according to the invention are Saccharomyces cerevisisae yeast cells. In yet another aspect, the invention provides strains producing recombinant proteins 1F9 and 2E12 of a skeleton of a spider-spider.

Brief Description of the Drawings

Figure 1. Electrophoresis in 12% PAG with DDS-Na fractions 1F9 after chromatography on a HiPrep 16/10 SP FF cation exchange column. Lanes: 1 — stock solution before application to the column; 2 - slip; 3-6 - fractions containing 1F9 protein; 7 - sample of standard 1F9.

Figure 2. Electrophoresis in 12% SDS page with DDS-Na fractions 2E12 after chromatography on a HiPrep 16/10 SP FF cation exchange column. Lanes: 1 — stock solution before application to the column; 2 - slip; 3 - molecular weight standards (top to bottom, in kDa): 170, 130, 95, 72, 55, 43, 34, 26, 17; 4 - fraction containing 2E12; 5 - sample of standard 2E12.

Figure 3. Vector Map pPDX3-HUB-1F9.

Designations: SPIDROIN - synthetic gene of the recombinant protein 1F9 (spidroin-1 spider N.clavipes); HUB - S.cerevisiae yeast ubiquitin gene; GAL1 - promoter region of the GAL1 gene of S. cerevisiae yeast; URA3 and PGK1 are the structural genes URA3 and PGK1 of S. cerevisiae yeast, respectively; cus1T is the sequence of the transcriptional terminator of the CYC1 gene of S. cerevisiae yeast; 2 mkm is a fragment of the endogenous 2-micron plasmid of S. cerevisiae yeast containing the region of origin of replication; pUC18 is a fragment of the plasmid pUC18 containing the beta-lactamase gene (ApR) and the region of origin of replication, providing selective amplification of the vector in E. coli cells.

Figure 4. Vector map pPDX3-SUMO-1F9.

Designations: SPIDROIN - a synthetic gene of the recombinant protein 1F9 (recombinant spidroin-1 spider N.clavipes); SUMO - S.cerevisiae yeast SMT3 gene encoding the SUMO protein; GAL1 - promoter region of the GAL1 gene of S. cerevisiae yeast; URA3 and PGK1 are the structural genes URA3 and PGK1 of S. cerevisiae yeast, respectively; cus1T is the sequence of the transcriptional terminator of the CYC1 gene of S. cerevisiae yeast; 2 mkm is a fragment of the endogenous 2-micron plasmid of S. cerevisiae yeast containing the region of the onset of replication of yeast; pUC18 is a fragment of the plasmid pUC18 containing the beta-lactamase gene (ApR) and the region of origin of replication to ensure selective amplification of the vector in E. coli cells.

Figure 5. Scheme of the vector pPDX3-HUB-2E12.

Legend: SPIDROIN - DNA sequence encoding the recombinant protein 2E12; HUB — DNA sequence encoding S.cerevisiae yeast ubiquitin; GAL1 - promoter region of the GAL1 gene of S. cerevisiae yeast; URA3 and PGK1 are the structural genes URA3 and PGK1 of S. cerevisiae yeast, respectively; cyc1T is the sequence of the transcriptional terminator of the CYC1 gene of S. cerevisiae yeast; 2 mkm is a fragment of the endogenous 2-micron plasmid of S. cerevisiae yeast containing the region of origin of replication; pUC18 is a fragment of the plasmid pUC18 containing the beta-lactamase gene (ApR) and the region of origin of replication, providing selective amplification of the vector in E. coli cells.

6. Photograph of an artificial 1F9 protein filament in a vessel with ethanol.

The implementation of the invention

The present invention is based on the unexpected discovery that the expression of the recombinant spider-web spider protein in yeast cells as a fusion protein with a ubiquitin-like protein occupying the N-terminal position of the hybrid allows tens of times the production of the recombinant web protein, moreover, the recombinant protein expressed as a fusion protein accumulates in yeast cells in a water-insoluble fraction as a processed protein that does not contain a fusion component.

Therefore, in one aspect, the present invention provides a method for producing a recombinant orbiting spider web protein in yeast cells, comprising constructing an expression vector, transforming the yeast cells with the resulting expression vector, and expressing, in transformed cells, a recombinant orbiting spider web protein gene, characterized in that use an expression vector that includes a DNA sequence encoding a recombinant spider web spider protein fused to a an identity encoding a ubiquitin-like protein, occupying the N-terminal position of the recombinant web protein in the fusion protein, and containing a processing site recognized by natural yeast proteinases, preferably ubiquitin-specific proteinases DUB or SUMO-specific yeast proteinases, resulting in during expression, the hybrid proteins are processed by proteinases, which ensures the accumulation in the yeast cells of the water-insoluble fraction of the recombinant web protein in as a processed protein that does not contain a hybrid component.

The recombinant proteins obtained by the method according to the invention have a pronounced periodic structure, which can be represented as a series of consensus sequences derived by aligning the repeating units of the natural proteins of the web of spider spiders. Recombinant proteins according to the invention are proteins whose sequences contain both repeats of one consensus sequence and combinations of repeats of various types of consensus sequences derived from large ampulliform gland framework proteins and / or small ampulloid gland proteins and / or Flag proteins of spider stalk -orders, in particular, selected from the group consisting of consensus sequences:

where MaSpl and MaSpl are proteins of the carcass filament of the large ampuloid gland Latrodectus hesperus [Lawrence B.A. et al., 2004, Biomacromolecules, v.5, 689-695];

MiSp1 and MiSp1 are proteins of the small ampuloid gland Nephila clavipes [Colgin M.A. & Lewis R.V., 1998, Protein ScL, v. 7, 667-672];

Flag is a trap protein of Nephila madagascariensis [Hayashi, C. & Lewis, R.V., 1998, J. Mol. Biol, v. 275, 773-784].

Preferably, according to the proposed method, consensus sequences are used that are derived from the repeating sequences of proteins of the large ampuloid gland Nephila clavipes and Nephila madagascariensis and selected from the group:

Конструирование искусственных генов, кодирующих рекомбинантные белки большой и/или малой ампуловидных желез, или белки Flag ловчей нити паука-кругопряда включает реконструкцию последовательности ДНК, кодирующей консенсусную последовательность или комбинации повторов консенсусных последовательностей различного типа, происходящие из повторяющихся последовательностей указанных выше белков; конструирование и химический синтез серии праймеров к консенсусной последовательности/последовательностям; единовременный отжиг смеси всех синтезированных праймеров, необходимых для образования двухцепочечной молекулы ДНК, и последующую обработку их лигазой для удаления однонитевых разрывов ДНК или реакцию ПЦР с последовательным использованием необходимых праймеров и поэтапным достраиванием растущего фрагмента ДНК, причем образуемый фрагмент («мономер») затем подвергается поэтапному удвоению в составе плазмиды до получения гена необходимой длины [Богуш В.Г. с соавт., 2001, Биотехнология, т.2, 11-22; Богуш В.Г. с соавт., 2006, Биотехнология, т.4, 3-12; Bogush V.G. & Debabov V.G., 2009, J. Neuroimmune PharmacoL, v.4, 17-27].

The construction of artificial genes encoding the recombinant proteins of the large and / or small ampulliform glands, or Flag proteins of the spinning-spider spider strand includes the reconstruction of a DNA sequence encoding a consensus sequence or combinations of repeats of consensus sequences of various types derived from repeating sequences of the above proteins; design and chemical synthesis of a series of primers for consensus sequence / sequences; simultaneous annealing of the mixture of all synthesized primers necessary for the formation of a double-stranded DNA molecule, and their subsequent ligase treatment to remove single-stranded DNA breaks or PCR reaction with sequential use of the necessary primers and step-by-step completion of the growing DNA fragment, and the resulting fragment ("monomer") is then subjected to stepwise doubling the composition of the plasmid to obtain the gene of the required length [Bogush V.G. et al., 2001, Biotechnology, vol. 2, 11-22; Bogush V.G. et al., 2006, Biotechnology, vol. 4, 3-12; Bogush VG & Debabov VG, 2009, J. Neuroimmune PharmacoL, v.4, 17-27].

The sequences of the corresponding cDNA can be derived based on the sequence of the natural protein, taking into account the degeneracy of the code and the frequency of occurrence of codons in yeast. In particular, when constructing a gene encoding the 1F9 protein and containing 9 copies of the "monomer", fragments encoding the most typical primary repeats were selected from the sequence of the natural protein and differed from each other in a set of deletions. The reconstructed DNA sequence included approximately 400 bp and encoded a polypeptide corresponding to 134 amino acid residues. The “rare” codons in the artificial gene sequence have been replaced by those most commonly used in yeast. "Monomer" was obtained using chemical-enzymatic synthesis, and the multimeric form was obtained by stepwise multiplication of the monomer in the recombinant plasmid [Bogush V.G. et al., 2001, Biotechnology, vol. 2, 11-22].

When constructing the 2E12 gene, we used the sequence of speedroins of type 2 large ampuloid gland contained in the NCBI protein sequence database and including more than 200 amino acid residues. Based on the mathematical analysis of all sequences, block sequences were developed (each consisting of 3-5 primary repeats) and a complete artificial gene formula was compiled [Bogush V.G. et al., 2009, J. Neuroimmune PharmacoL, v.4, 17-27].

In one preferred embodiment, the proposed method for producing a recombinant spider-web spider protein in yeast cells involves fusion of a recombinant web protein gene with a DNA sequence encoding a acubitin or SUMO yeast SUMcharomyces cerevisiae protein.

In one of the most preferred embodiments of the invention, recombinant protein 1F9 of the Nephila clavipes spider web spider web framework protein is produced in Saccharomyces cerevisiae cells, wherein the structural gene of the 1F9 protein is fused to the DNA sequence encoding Saccharomyces cerevisiae ubiquitin. In yet another most preferred embodiment of the invention, recombinant Nephila madagascariensis skeleton spider web 2E12 protein is produced in Saccharomyces cerevisiae cells, wherein the 2E12 protein gene is fused to the DNA sequence encoding the ubiquitin Saccharomyces cerevisiae.

In yet another most preferred embodiment of the invention, a fusion protein containing the recombinant 1F9 protein sequence is expressed in Saccharomyces cerevisiae yeast cells, the 1F9 protein sequence being fused to the SACcharomyces cerevisiae yeast SUMO sequence. Recombinant proteins obtained according to the proposed method were isolated from the water-insoluble fraction of the host cells of Saccharomyces cerevisiae using chromatography on a cation exchange column (examples 9 and 11). Electrophoretic analysis of the fractions (Figs. 1 and 2) showed that the recombinant proteins 1F9 and 2E12 accumulate in the fraction of water-insoluble yeast cell proteins (in the water-soluble fraction, the recombinant proteins are practically absent) and do not contain a ubiquitin-like protein component. This is indicated by the electrophoretic mobility of the analyzed proteins and the absence in the gel of bands corresponding to the mobility of the fused proteins (ubiquitin-1F9 and ubiquitin-2E12). Similar results were obtained for recombinant proteins isolated and purified from a water-insoluble fraction of the host cells of Saccharomyces cerevisiae producing recombinant web proteins fused to the SUMO protein. The production of recombinant proteins by Saccharomyces cerevisiae cells is at least 100 mg / l of fermentation culture.

The absence of recombinant proteins obtained in accordance with the proposed invention, in the water-soluble fraction allows you to practically avoid protein loss during isolation and purification, in contrast to the known method [Bogush V.G. et al., 2001, Biotechnology, v.2, 11-22], according to which only about 80% of the target protein was found in the water-insoluble fraction.

Thus, in the method for producing the recombinant web protein according to the invention, the recombinant protein synthesized in Saccharomyces cerevisiae cells accumulates in the fraction of water-insoluble proteins as a processed protein that does not contain a hybrid component, and cells expressing the recombinant web protein accumulate tens of times more recombinant protein than in accordance with methods known from the prior art.

The purified recombinant spider-web spider proteins according to the invention are capable of forming supramolecular structures of various types, in particular, the analyzed proteins form water-insoluble filaments (Example 12, FIG. 6).

In one aspect, the invention provides yeast host cells producing recombinant spider web proteins. As suitable host cells for producing recombinant web proteins, yeast cells are used which are selected from the group consisting of Saccharomyces cerevisiae, Kluyveromyces lactis, Hansenula polymorpha, Pichia pastoris and Schizosaccharomyces pombe. Preferred host cells are Saccharomyces cerevisisae cells. Most preferably, the recipient strain Saccharomyces cerevisiae D702, which is diploid, which provides increased stability of its expression characteristics, is used as host cells. Saccharomyces cerevisiae D702 contains homozygous mutations in the chromosomal alleles of the PGK1 structural gene, which encodes a phosphoglycerate kinase, which ensures stable maintenance of the vector on media containing any single carbon source, digested by Saccharomyces cerevisiae yeast, and the GAL80 gene, which encodes a promoter protein also a mutation leading to a change in the regulation of the GAL4 gene encoding the protein activator of the GAL1 promoter, as a result of which galactose-regulated expression of genes under the control of motor GAL1.

In one of the most preferred embodiments of the invention, the cells of the recipient strain of Saccharomyces cerevisiae D702 are transfected with the expression vector pPDX3-HUB-1F9. The resulting strain SCR-702-1F9, producing the recombinant protein 1F9 of the skeleton of the spider-web spider Nephila clavipes, was deposited in the All-Russian Collection of Industrial Microorganisms (VKPM) as the Saccharomyces cerevisiae strain VKPM Y-3583.

In another of the most preferred embodiments of the invention, the cells of the recipient strain of Saccharomyces cerevisiae D702 are transfected with the expression vector pPDX3-HUB-2E12. The resulting strain SCR-702-2E12, producing the recombinant protein 2E12 of the skeleton of the spider-web spider Nephila madagascariensis, was deposited in the All-Russian Collection of Industrial Microorganisms (VKPM) as a strain of Saccharomyces cerevisiae VKPM Y-3584.

In another of the most preferred embodiments of the invention, the cells of the recipient strain of Saccharomyces cerevisiae D702 are transfected with the expression vector pPDX3-SUMO-1F9.

Characterization of producer strains. Genotype:

Морфологические признаки:

Morphological features:

When cultivated at a temperature of 28 ° C for 48 hours on an agarized YPD medium of the following composition (in wt.%): Peptone-2, yeast extract - 1, glucose - 2, agar - 2, water - the rest, cells of Saccharomyces-producing strains cerevisiae are oval, 3-7 microns in diameter. Cells are budded. The budding is true, many-sided. True mycelium is not formed. Colonies are as follows:

1) on an agarized YPD medium, colonies of white color with a smooth edge, a matte surface, a lenticular profile and a creamy consistency;

2) on an agar medium with starch (composition in wt.%: Peptone - 2, yeast extract - 1, starch - 1, agar - 2, water - the rest) of a white colony with a patterned edge, matte surface, lenticular profile and crumbly consistency .

Growth in a liquid medium with starch: at 28 ° C during the first 24 hours of cultivation, the liquid is cloudy, the precipitate is white, does not clump, does not form wall films.

Physico-chemical signs:

Both strains are facultative anaerobes. The growth temperature is 20-33 ° C (optimum is 28 ° C). The pH of the cultivation is 3.8-7.4 (optimum is 5.0).

Assimilation of carbon sources:

Both strains ferment glucose, fructose, maltose, sucrose, dextrins, and starch. Do not ferment lactose, galactose, inulin, xylose, arabinose. Assimilation of nitrogen sources:

Both strains absorb amino acids, ammonium sulfate, ammonium nitrate.

Storage:

The strains are stored at a temperature of -70 ° C in a 20% aqueous solution of glycerol. Storage on an agarized rich medium with glucose is possible for 3 months at + 4 ° C.

Stability:

The stability of the claimed strains is maintained at 20 consecutive transfers in agarized YPD medium at a temperature of 28 ° C.

Pathogenicity:

They are not pathogenic.

The invention is illustrated by the following examples presented to confirm, but not limit the scope of claims.

Another aspect of the invention is a method for producing suspensions of gel microparticles with predetermined sizes based on a recombinant web protein.

Another aspect of the invention is the use of suspensions of gel microparticles with specified sizes based on a recombinant web protein for medical purposes.

Examples

Example 1. Construction of the vector pPDX3-HUB

The structural gene of yeast ubiquitin is amplified in a PCR reaction using the laboratory strain S. cerevisiae Y618 as a chromosomal DNA template [Kartasheva et al, 1996, Yeast, v.l2, 1297-13], isolated by the Sidoruk method [Sidoruk et al., 2008 , Collection of abstracts and reports “Actual issues of genetics, radiobiology and radioecology”, Dubna, JINR, p.100]. The amplification primers are N513 (5'-ataccatggaacatcatcatcatcatcatcatggaggcatgcagatcttcgtcaagactttga) and N514 (5'-actggatccacctcttagccttagcacaac). A 510 bp DNA fragment obtained as a result of amplification elute from agarose gel using the Qiagen kit (Qiagen, cat. No. 28706), digest with restriction enzymes NcoI and BamHI and clone in the pUC18x-GALl-NcoI laboratory plasmid cleaved at the same sites, carrying the HindIII / Ncol DNA fragment encoding the promoter region of the GAL1 gene yeast. S. cerevisiae. The result is the plasmid p101-25, containing the nucleotide sequence encoding the S. cerevisiae yeast ubiquitin fused to the nucleotide sequence of the S. cerevisiae yeast GAL1 promoter region. Plasmid p101-25 contains the XhoI restriction enzyme recognition site in the polylinker region following the BamHI cloning site.

The HindIII / XhoI DNA fragment of plasmid p101-25, including the promoter region of the GAL1 gene and the nucleotide sequence encoding ubiquitin, is cloned in the laboratory vector pPDX3, the DNA of which is cleaved at the same sites. Cloning yields the pPDX3-HUB vector, which is used to clone genes of recombinant web proteins.

Example 2. Construction of the expression vector pPDX3-HUB-1F9

The expression vector pPDX3-HUB-1F9 (Figure 3) is obtained by cloning BgIIIXhoI of a 3.6 kb laboratory plasmid pUC21-1F9 DNA fragment containing the 1F9 protein gene in the pPDX3-HUB vector, the DNA of which is split at BamHI sites and xhoi. Cloning yields the expression vector pPDX3-HUB-1F9, in which the structural gene of the 1F9 protein is fused in the same reading frame as the structural gene encoding ubiquitin. The vector is used to express 1F9 protein in S. cerevisiae yeast cells.

Example 3. Construction of the expression vector pPDX3-HUB-2E12

The expression vector pPDX3-HUB-2E12 is obtained by cloning a BgIII / XhoI DNA fragment of the laboratory plasmid pUC21-2E12 with a size of 4.2 kb, including the 2E12 protein gene, in the pPDX3-HUB vector, the DNA of which is split at the BamHI and XhoI sites. Cloning yields the expression vector pPDX3-HUB-2E12, in which the structural gene of the 2E12 protein is fused in the same reading frame as the structural gene encoding ubiquitin. The vector is used to express 2E12 protein in S. cerevisiae yeast cells.

Example 4. Construction of the vector pPDX3-SUMO.

The S.cerevisiae yeast structural gene SMT3 encoding the SUMO protein is amplified in a PNR reaction using the laboratory strain S. cerevisiae as the chromosomal DNA template, as in Example 1. The amplification is carried out in two stages. First, two overlapping DNA fragments are amplified, for which the following pairs of primers are used:

Fragment 1 with a size of 129 bp:

N450 (5'-atatccatggaaaagagatctgactcagaagtcaatcaagaa)

N454 (5'-cttgaagaaaatctctgaa)

Fragment 2, size 230 bp:

N453 (5'-ttcagagattttctttcaag)

N452 (5'atatcaattggatccaccaatctgttctctgtga).

Amplified DNA fragments are eluted from the agarose gel and used for PCR ligation. For this, a mixture of fragments 1 and 2 is used as a template for PCR, N450 and N452 serve as primers. The resulting 290 bp DNA fragment of PCR elute from the agarose gel, digest with restriction enzymes BgIII and BamHI and clone into the BamHI site of the laboratory plasmid pUC18x-GAL1-BamHI carrying the HindIII / BamHI DNA fragment encoding the promoter region of the S. cerevisiae yeast GAL1 gene at the ATGH codon and the Bam site is underlined with the BamHam site ATGCATGGATCC sequences. As a result, the sequence of the S. cerevisiae yeast SMT3 gene is fused to the sequence encoding the promoter region of the S. cerevisiae yeast GAL1 gene. The result is the plasmid p101-18, in which the cloned SMT3 gene is sequenced.

The resulting plasmid p101-18 contains a DNA fragment in which the yeast SMT3 gene is fused to the promoter region of the yeast GAL1 gene. In the polylinker part of plasmid p101-18, following the BamHI cloning site, is the XhoI restriction enzyme recognition site. The HindIII / XhoI DNA fragment of plasmid p101-18, including the promoter region of the GAL1 gene and the cloned SMT3 gene, is cloned in the laboratory vector pPDX3, the DNA of which is cleaved at the same sites. Cloning yields the pPDX3-SUMO vector, which is used to clone genes of recombinant web proteins.

Example 5. Construction of the expression vector pPDX3-SUMO-1F9.

The expression vector pPDX3-SUMO-1F9 (Figure 4) is obtained by cloning a BgIII / XhoI DNA fragment of laboratory plasmid pUC21-1F9 with a size of 3.6 kb, including the 1F9 protein gene, in the pPDX3-SUMO vector, the DNA of which is digested BamHI and XhoI sites. Cloning yields the expression vector pPDX3-HUB-1F9, in which the structural gene of the 1F9 protein is fused in the same reading frame as the structural gene encoding ubiquitin. The vector is used to express 1F9 protein in S. cerevisiae yeast cells.

Example 6. Construction of strain SCR-702-1F9 - producer of protein 1F9 (VKPM Y-3583).

Strain SCR-702-1F9 is obtained by transforming laboratory strain D702 with the expression vector pPDX3-HUB-1F9. To carry out the transformation, cells of strain D702 are grown for 18-24 hours at a temperature of 28 ° C on YPGE agarized medium of the following composition in wt.%: Bactopeptone - 2, yeast extract - 1, bactoagar - 2, ethanol - 2, glycerin - 3, water is the rest. The transformation of the grown cells of strain D702 is carried out according to the method of Ito et al. [Ito et al., 1983, J. BacterioL, v. 153, 163-168]. Transformants are selected according to their ability to grow on YPD medium of the following composition in wt.%: Bactopeptone - 2, yeast extract - 1, glucose - 2, bactoagar - 2, water - the rest. One of the obtained transformants is called SCR-702-1F9.

Example 7. Construction of strain SCR-702-2E12 - producer of protein 2E12.

Strain SCR-702-2E12 is obtained by transforming laboratory strain D702 with the expression vector pPDX3-HUB-2E12. The transformation is carried out as in example 6. The strain SCR-702-2E12 was deposited in the All-Russian Collection of Industrial Microorganisms as a strain of Saccharomyces cerevisiae VKPM Y-3584.

Example 8. Construction of strain D702-SUMO-1F9 - producer of protein 1F9.

Strain D702-SUMO-1F9 is obtained by transforming the laboratory strain D702 with the expression vector pPDX3-SUMO-1F9. The transformation is carried out as in example 4, except that the plasmid pPDX3-SUMO-1F9 is used.

Example 9. Analysis of the expression of recombinant proteins 1F9 and 2E12 in cells of Saccharomyces cerevisiae strains.

The cells of S. cerevisiae VKPM Y-3583, VKPM Y-3584 or D702-SUMO-1F9 were cultured in flasks at 30 ° C on a rotary shaker at a speed of 250 rpm on a liquid medium YPD composition, in wt.%: Bactopeptone - 2, yeast extract - 1, glucose - 2, water - the rest, inoculating in a titer of 5 × 10 ⁵ -5 × 10 ⁶ ml ^-1 . Samples for analysis were taken after 46 hours of culture growth. The final optical density of the culture is OD ₆₀₀ = 40-45. Cells are separated from the culture medium by sedimentation by centrifugation at 10,000 g for 1 min and are used for subsequent analysis of the expression of 1F9 and 2E12 proteins by a 1.5-ml micromethod in vitro. For this, the cell pellet is suspended in a “disruption buffer” (0.05 M sodium phosphate, 2.5 mM EDTA, 5% glycerol) at the rate of 100 μl of buffer per 100 μl of wet cell pellet. Cell destruction is carried out using glass beads (d = 0.45-0.65 mm) on a vortex tube shaker. To do this, 570 mg of beads are mixed with 200 μl of a cell suspension, the mixture is shaken at 0 ° C for 90 seconds, 250 μl of “destruction buffer” is added to the contents of the tubes, and shaking is repeated for another 60 seconds. 500 μl of “destruction buffer” was added to the tubes, the contents of the tubes were mixed, after which the samples were centrifuged for 10 min at 16,000 g. In a supernatant containing water-soluble proteins of yeast cells, the pH is adjusted to 4.0 with a 1M sodium acetate solution and the precipitated material is removed by centrifugation for 5 min at 16 thousand rpm; the supernatant is then heated at 65 ° C for 20 minutes and the precipitated ballast proteins are removed by centrifugation; the resulting solution was dialyzed for 40 minutes against 10 mm sodium acetate, pH 4.0. The precipitate of water-insoluble proteins is suspended in 750 μl of "destruction buffer", transferred to new tubes and centrifuged for 15 min at 16,000 g. The resulting pellet (100 μl) containing the desired proteins was suspended in 400 μl of 6.5 G buffer (6.5 M solution of guanidine hydrochloride or guanidine thiocyanate in a buffer containing 0.1 M sodium phosphate, 0.01 M Tris-HCl, pH 6.5) and the target proteins are extracted overnight on a magnetic stirrer at a temperature of + 4 ° C. Then the suspension is centrifuged for 15 min at 16,000 g, the supernatant with the target protein transferred into it is dialyzed against 300 ml of 5 mM sodium acetate for 1.5 hours. The resulting sample was centrifuged for 15 min at 16,000 g and the supernatant was used for electrophoretic analysis of the level of production of the target protein.

Electrophoretic analysis of the target protein is carried out with 12% PAG-DDS-Na according to the standard Laemmli procedure [Laemmli, 1970, Nature, v.227, 680-685]. For analysis, the solution was diluted approximately 500-1000 times with “sample buffer” (0.0625 M Tris-HCl, pH 6.8, 2 wt.% DDS-Na, 0.0025 wt.% Bromphenol blue). And boil in a water bath for 5 minutes. Aliquots of 3-15 μl are applied to 12% PAG and electrophoresed on a Bio Rad MiniPROTEAN apparatus, while the dye front is 1 cm from the end of the gel. The gels are washed in water and stained in a 0.2% solution of Coomassie R-250 (Fermentas). Electrophoretic analysis shows that proteins 1F9 and 2E12 accumulate in the fraction of water-insoluble proteins of S. cerevisiae yeast cells and do not contain SUMO or ubiquitin components (Figures 1 and 2). This is indicated by the electrophoretic mobility of the analyzed proteins and the absence in the gel of protein bands corresponding to the mobility of the 1F9 and 2E12 fusion proteins fused to the SUMO protein or ubiquitin.

The purity of the preparations was quantified using the Sorbfil 1.0 Video Densitometer program, for which the stained gels after electrophoresis were scanned, the resulting image was entered into a computer, and the amount of protein in the spot was estimated and determined on each track using the indicated program. As reference standards, highly purified preparations of the studied proteins were used, a known amount of which was applied to neighboring tracks in the same gel. The purity of protein preparations evaluated in this way was 96% and higher.

Example 10. Production of proteins 1F9 and 2E12 by strains of Saccharomyces cerevisiae VKPM Y-3583 and VKPM Y-3584

To obtain seed, the VKPM Y-3583 and VKPM Y-3584 strains were grown in YPD medium on a rotary shaker at a speed of 250 rpm at a temperature of 28 ° C for 20-24 hours. 50 ml of seed is used to seed a 3 liter Anglicon fermenter containing 950 ml of YPD medium. Fermentation is carried out at a temperature of 28 ° C, aeration of 1 l / min and a stirring speed of 1000 rpm. 24 hours after inoculation of the fermenter, they begin feeding the culture medium with a 50% glucose solution at a rate of 2 ml / h and set the pH-statization of the culture at a pH of 6.8 ± 0.1 using solutions of 10% sulfuric acid and 10% NaOH for subtraction. The average total fermentation time is 72 hours. According to electrophoretic analysis, the production of 1F9 protein under these conditions is at least 200 mg / l of culture fluid, and the production of 2E12 protein under these conditions is at least 100 mg / l of culture fluid.

Example 11. Isolation and purification of recombinant proteins 1F9 and 2E12 from a water-insoluble fraction of Saccharomyces cerevisiae cells.

Isolation and purification of proteins 1F9 and 2E12 from the water-insoluble fraction of cells of the producer strains VKPM Y-3583 and VKPM Y-3583 is carried out using the methods described by Bogush et al. [Bogush V.G. et al., 2001, Biotechnology, vol. 2, 11-22; Bogush V.G. et al., 2006, Biotechnology, vol. 4, 3-12; Bogush V.G. et al., 2009, J. Neuroimmune Pharmacol., v.4, 17-27]. When the biomass of S. cerevisiae yeast is increased in a 3-liter fermenter on YPD medium without replenishment in the presence of 2% glucose in the starting medium with one fermentation, an average of 400-500 g of wet cell biomass is obtained. 1 kg of washed wet biomass is suspended in a “destruction buffer” and the cells are destroyed using glass beads in a flow mill for 1.5 hours, the resulting suspension is centrifuged and the precipitate is collected. The target protein is extracted from the precipitate using a solution of 10% lithium chloride in 90% formic acid for 16-18 hours, followed by centrifugation. The precipitate is discarded, and the supernatant is ultrafiltered, followed by diafiltration through an M50 membrane to transfer to 10 mM sodium acetate, pH 4.0 and remove host cell proteins with a molecular weight below 50 kDa.

The final purification is carried out using ion-exchange chromatography on a HiPrep 16/10 SP FF cation exchange column (GE Healthcare) in the FPL system. After the filtrate passed through the column and the column was washed with 10 mM Na-phosphate buffer, pH 7.0 and then 10 mM sodium acetate buffer, pH 4.0, proteins 1F9 and 2E12 were eluted from the column with a 10% NaCl solution in the same buffer and identified electrophoretically in 12% PAG-DDS-Na, the fractions with the target protein are combined, dialyzed against deionized water, frozen at

-70 ° C and freeze-dried. A lyophilized preparation is a white substance similar to cotton wool.

Example 12. Characterization of proteins 1F9 and 2E12

To analyze the resulting preparation of pure recombinant protein, pre-dissolve a sample of the preparation in 90% formic acid with 10% lithium chloride for at least 2 hours, dialyze against deionized water (1-1.5 hours) and analyze using SDS electrophoresis in 12% SDS page. The presence of one strip in the gel, corresponding to the molecular weight of the recombinant protein, confirms the homogeneity of the resulting preparation. The resulting preparations of both proteins are characterized by an extinction coefficient equal to approximately 0.48 ± 0.02 OE ₂₈₀ / mg. This value corresponds to the theoretically calculated, based on the amino acid composition of these proteins (0.49 OE ₂₈₀ / m), and indicates a high purity of the obtained preparations.

To analyze the ability of purified recombinant proteins of the spider web to form supramolecular structures of various types, these proteins were tested for their ability to form water-insoluble filaments. Filaments are obtained by spinning (spinning) a concentrated protein solution through a narrow hole. For this, a sample of the purified lyophilized dried protein preparation is dissolved in 90% formic acid with 10% lithium chloride for at least 2 hours, dialyzed against deionized water for 1-1.5 hours and the insoluble material is removed by centrifugation. The protein solution is passed through a specially designed microspinner with an internal diameter of about 50 μm at a rate of 5-10 μl / min into a coagulation bath with 96% ethanol. In this case, a water-insoluble thread is formed, which freely falls to the bottom of the vessel. The newly formed artificial yarns in a vessel with ethanol are presented in Fig.6. The newly formed thread is kept in a vessel with 96% alcohol for 20 minutes, then stretched to the maximum in 75% ethanol, annealed, kept in deionized water and dried in air. The threads subjected to all stages of exposure are characterized by the values of the relative breaking load of 10-15 cN / tex (13 mPa).

The above results show that when implementing the proposed method for producing recombinant proteins of the spider-web spiderwebs, a significant increase in the yield of recombinant proteins was achieved, and the resulting recombinant proteins are characterized by high purity and physicochemical properties characteristic of natural web proteins. The proposed method for producing recombinant web protein allows one to obtain recombinant protein preparations with a very high degree of purification on an industrial scale, to develop microspinning methods for producing artificial fibers based on it, as well as methods for forming films, hydrogels, microgels and microcapsules based on recombinant web proteins for use in biotechnology, medicine, cosmetology, automotive and aviation industries and other fields.

Example 12. Obtaining microgel particles with a given size.

1. Obtaining a protein solution.

The recombinant web protein (10-20 mg) is dissolved 12-18 hours in 250 μl of 10% lithium chloride in 90% formic acid.

2. Release from solvent.

2.1. Dialysis of the solution against 1 liter of potassium phosphate buffer (KPB), pH 8.0).

2.2. Dialysis is carried out for 3 hours with two shifts of the dialysis buffer (shift interval - 1 hour).

2.3. CF (20 min).

2.4. Determination of protein concentration by SF (λ = 280 nm).

3. Getting the gel.

3.1. 200 μl of the protein solution is sonicated by ultrasound for 10 seconds (ultrasound).

3.2. The solution is left at room temperature until gel formation (20-25 hours).

4. Obtaining a microgel suspension.

4.1. 50 mg of gel is wiped through a sieve with a mesh size of 200 μm.

4.2. Microgel particles are collected with a spatula into a test tube, 300 μl of 96% ethanol are added, shaken and incubated for 5 minutes.

4.3. Particles precipitate CF 5 minutes

4.4. 300 μl of water are added to the precipitate and shaken.

5. Determination of the size of microgel particles. Particle size is monitored under a microscope using a Goryaev camera. Particles with sizes of 50-200 microns prevailed in the suspension.

6. Obtaining microgel particles with sizes of 10-100, 50-200, 150-300, 200-400 microns.

6.1. Differential DF Method.

- 600 μl of water is added to the precipitate of microgel particles, shaken manually;

- CF 5 sec and take 300 μl of particles in another tube;

- 300 μl of water are again added to the first test tube, shaken;

- CF 5 sec and take 300 μl of particles in a second tube;

- a second test tube CF (10 min, 14500 rpm);

- the precipitate is suspended in the desired volume of water.

6.2. Sieving method.

As in claim 4, but using a sieve with a mesh size of 100, 200, 300, 400 microns, particles with sizes of 10-100, 50-200, 150-300, 200-400 microns, respectively, prevail in the suspension.

Example 13. Adhesion and proliferation of murine fibroblasts on the surface of hydrogel microparticles from recombinant spidroin.

Cell cultivation

A 400 μm hydrogel microparticle suspension was placed in the wells of a 24-well cell culture plate, and 1000 μl of a suspension of mouse 3T3 fibroblasts at a concentration of 24,000 cells in 1 ml of DMEM culture medium (Sigma) containing 10% fetal bovine serum was added. After 2 hours, cells that did not adhere to the substrate were washed and incubated at 37 ° C in the presence of 6.1% CO ₂ . The culture medium was changed every 2 days. The adhesion and growth of the cell culture were studied by laser scanning confocal microscopy.

Laser confocal microscopy

An Axiovert 200M LSM510 META microscope (Carl Zeiss, Jena, Germany) with a Plan-Neofluar 10x / 0.3 objective was used for scanning laser confocal microscopy. A series of optical slices for obtaining high-resolution images was obtained from one or simultaneously from two channels with pinhole size set according to the recommendations of manufacturers. The pinhole diameter was 1 Airy unit, giving the optimum signal to noise ratio. Set up Example 13. Adhesion and proliferation of murine fibroblasts on the surface of hydrogel microparticles from recombinant spidroin.

The study of cell adhesion and growth on the surface of hydrogel microparticles

To determine the number of attached cells, samples were studied by confocal microscopy 24 hours after inoculation. A change in the number of cells was observed after 4, 7 and 14 days of incubation. Samples were fixed with formalin and cells were detected with SYTOX® Green nucleic acid stain fluorescent dye (Invitrogen, Carlsbadam, USA), a nuclear dye with high affinity for nucleic acids. Hydrogel microparticles with cells were incubated in solution for 20 minutes with constant stirring. After binding of SYTOX Green to DNA, a 500-fold increase in its fluorescence is observed (according to the manufacturer's instructions). On the 4th, 7th and 14th day of cultivation, an increase in the number of fibroblasts was observed, indicating active cell proliferation

Example 14. The implantation of hydrogel microparticles under the skin of mice. To study the local effect after implantation and the ability to degrade, a hydrogel from the analogue of spidroin 1 was implanted subcutaneously with four-month-old Balb / c laboratory mice. Before the operation, the animals were kept in the vivarium for acclimatization for 7 days. The keeping of animals and the conditions of the in vivo experiments corresponded to GOST R ISO 10993-2-2009 "Requirements for the treatment of animals" and GOST R ISO 10993-6-2009 "Study of local action after implantation".

Surgical and Experimental Conditions

Before the implantation procedure, wool was removed from the surface of the skin of mice with depilation cream. Carprofen was premedicated: Rimadil (Pfizer Animal Health, USA) (with the active substance carprofen) was administered at a rate of 5 mg per 1 kg according to the manufacturer's recommendations.

The operation was performed under sterile conditions under general anesthesia with Zoletil 100 (Virbac Sante Animale, Kappoc, France) at a dose of 5 mg per 100 g. Administration of the drug was intraperitoneal. Before implantation, the skin at the incision site was disinfected with a 0.05% chlorhexidine solution (Biogen, RF), and excess antiseptic was removed with sterile wipes. For implantation, a 5 mm long incision was made on the back of the animal abaxially relative to the midline; a subcutaneous pocket was formed using a pointed spatula, separating the subcutaneous tissue from the muscle layer. 200 μl of a sample in the form of a suspension of microparticles in a phosphate-saline sterile buffer was placed in the resulting cavity using sterile tweezers. The incision was closed with non-absorbable polypropylene thread, applying simple nodular surgical sutures. The wound was treated with an antiseptic and covered with medical glue BF-6 (Verteks ZAO, RF).

After awakening, the animals were active and showed no signs of discomfort. After 2 months, the implanted samples were removed for histological examination.

Implant extraction and tissue sample preparation

The studies were carried out in accordance with GOST R ISO 10993-6-2009 "Study of local action after implantation."

Implanted samples with adjacent tissue were removed, washed with phosphate-buffered saline and fixed in a Buen mixture according to standard procedures. Samples were dehydrated in ethanol solutions of increasing concentration (ethanol solutions 50%, 60%, 70%, 80%, 96%, 100%) for 2 hours each, the alcohol was removed by incubation in a mixture of isopropanol and O-xylene (1: 1) in for 2 hours and in two shifts of pure O-xylene for 30 minutes. Dehydrated samples were prepared for pouring into paraffin by sequential incubation in a molten mixture of Histomix® (BioVitrum, RF) and O-xylene (1: 1) for 1 hour and then in three shifts of molten Histomix® at 52 ° C for 30 minutes each. Prepared tissue samples were placed in block molds and poured with molten Histomix®.

Preparation of sections for histological examination

To prepare sections with a thickness of 5 μm from samples embedded in paraffin, the Rotmik-1 microtome was used (Orion Medic, RF). Slices were glued to the surface of the slides. Sections before histological examination were dewaxed by sequential incubation in two shifts of O-xylene and in 100% ethanol, rinsed in 100% ethanol, two shifts of 96% alcohol and two shifts of distilled water.

Deparaffined sections were stained with a mixture of hematoxylin and eosin according to standard methods. Before staining, the sections were washed with distilled water. Next, the section was incubated in a solution of alum hematoxylin according to Ehrlich, washed in tap water, incubated in a 1% aqueous solution of eosin and washed in tap water. After removing excess water, the sections were sequentially incubated in 96% ethanol and xylene, and then enclosed in a balm.

Implant microscopy

Microscopic studies to study local effects after implantation were carried out in accordance with GOST R ISO 10993-6-2009. Histological sections were examined using a Zeiss Imager Al (Zeiss) microscope with Zeiss EC Plan-Neofluar 40x / 0.75 Ph2 and A-plan 20x / 0.45 Ph2 lenses. Images were obtained using an AxioCam MRc 5 camera (Zeiss), images were processed using Axio Vision 4.7.2 software (Zeiss). Slices were also studied using a Leica DM 1000 microscope (Leica Microsystems, Inc., Banokburn, USA) with Leica Hi-Plan 40x / 0.65 and 10x / 0.25 lenses and a Leica DFC 295 camera and the images were processed using Leica software Application Suite Version 3.4.0.

As a result, it was found that during hydrogel implantation, the implant is integrated into the surrounding tissue and tissue neoplasm. A histological study of the implants showed no phenotypic changes in the tissues growing in the implant, which could indicate physiological disturbances in the cells in contact with the hydrogel: adipocytes and fibroblasts have a morphology and size characteristic of cells of this type. The detected high level of neovascularization confirms the absence of toxic effects on endothelial cells. No signs of unfavorable conditions for cell growth were found at the sites of active destruction of the implant; active tissue growth occurred at the sites of hydrogel destruction and young fibroblasts were detected.

Claims (5)

1. A method of obtaining a suspension of hydrogel microparticles with predetermined sizes based on a recombinant web protein, comprising obtaining a protein solution, liberating from a solvent, obtaining a hydrogel, obtaining a microgel suspension, determining the size of gel microparticles, obtaining gel microparticles with predetermined sizes, characterized in that recombinant a spider-web spider web protein, the consensus sequences of which are derived from the repeating sequences of the MaSp1 and / or skeleton yarn proteins MaSp2 of the large ampulla gland, MiSp1 and / or MiSp2 proteins of the small ampulla gland or Flag protein of the spinning-spider spider filament, which is dissolved in lithium chloride solution in formic acid, the dialysis of the solution is carried out against potassium phosphate buffer (KPB), centrifuged, the protein solution is subjected under the influence of ultrasound, the solution is left at room temperature until the gel forms for 20-25 hours, the gel is wiped through a sieve with the desired mesh size, placed in 96% ethanol, shaken, incubated for 5 minutes, the microparticles are separated by diff differential centrifugation. 2. The method according to claim 1, in which the sequence of the recombinant spider-web spider web protein comprises consensus sequences derived from the repeating sequences of the framework filament proteins MaSp1 and MaSp2 of the large ampuloid gland of spiders Nephila clavipes and Nephila madagascariensis selected from the group:
AGQGGYGGLGSQGAGRGGLGGQGAGAAAAAAAGGAGQGGLGGQG
AGQGAGASAAAAGGAGQGGYGGLGSQG
AGRGGLGGQGAGAVAAAAGGAGQGGYGGLGSQG
AGRGGQGAGAAAAAAGGAGQRGYGGLGNQG
GPGGYGPGQQGPGAAAAASA
GRGPGGYGPGQQGPGGSGAAAAAA
GSGPGGYGPGQQGPGGPGAAAAAAA
GRGPGGYGPGQQGPGQQGPGGSGAAAAAA
GRGPGGYGPGQQGPGGPGAAAAAA
GPGGYGPGQQGPGAAAAAAAA
GSGAGGYGPGQQGPGGPGAAAAAA
GSGPGGYGPGQQGPGGSSAAAAAA
GSGPGGYGPGQQGPGGSGAAAAAAAA
GRGPGGYGQGQQGPGGPGAAAAAA 3. The method according to claim 1, characterized in that it contains the sequence of the recombinant protein 1F9 skeleton yarn spider-spinning Nephila clavipes. 4. The method according to claim 1, characterized in that it contains the sequence of the recombinant protein of the frame thread 2E12 spider-spinning nephila nephila madagascariensis. 5. The use of a suspension of hydrogel microparticles obtained by the method according to claim 1, for adhesion and proliferation of human or animal cells on the surface of hydrogel microparticles or implantation of hydrogel microparticles into a human or animal body.

Images