RU2472859C1 - Method for formation of dna methylation marker systems - Google Patents
Method for formation of dna methylation marker systems Download PDFInfo
- Publication number
- RU2472859C1 RU2472859C1 RU2011119871/10A RU2011119871A RU2472859C1 RU 2472859 C1 RU2472859 C1 RU 2472859C1 RU 2011119871/10 A RU2011119871/10 A RU 2011119871/10A RU 2011119871 A RU2011119871 A RU 2011119871A RU 2472859 C1 RU2472859 C1 RU 2472859C1
- Authority
- RU
- Russia
- Prior art keywords
- dna
- methyl
- sensitive
- hydrolysis
- peaks
- Prior art date
Links
Abstract
Description
Настоящее изобретение относится к биомедицине, в частности к онкологии.The present invention relates to biomedicine, in particular to oncology.
Одним из основных генетических событий, необходимых для развития любого типа опухоли, является системное нарушение процессов метилирования/деметилирования ДНК. Аномалии метилирования ДНК играют причинную роль и выявляются задолго до появления атипичных белков, используемых в качестве биохимических маркеров опухоли. Гиперметилирование генов, вовлеченных в канцерогенез, является одним из наиболее ранних событий опухолеобразования и часто обнаруживается во многих предраковых состояниях. В то же время такой механизм инактивации генов-супрессоров опухолевого роста не проявляется при острых и хронических воспалительных заболеваниях. Гиперметилирование участков генома может служить молекулярным маркером ранней диагностики, мониторинга и клинического прогноза опухолей. Однако на сегодняшний день сертифицированных тест-систем и способов ДНК-диагностики маркеров метилирования не существует.One of the main genetic events necessary for the development of any type of tumor is a systemic violation of DNA methylation / demethylation processes. DNA methylation abnormalities play a causal role and are detected long before the appearance of atypical proteins used as biochemical markers of the tumor. Hypermethylation of genes involved in carcinogenesis is one of the earliest events of tumor formation and is often found in many precancerous conditions. At the same time, such a mechanism of inactivation of tumor suppressor genes does not appear in acute and chronic inflammatory diseases. Hypermethylation of genome regions can serve as a molecular marker for early diagnosis, monitoring and clinical prognosis of tumors. However, to date, certified test systems and DNA diagnostic methods for methylation markers do not exist.
Различают два принципиальных подхода к анализу нарушений метилирования в различных типах опухолей. Первый подразумевает изучение статуса метилирования уже известных генов, вовлеченных в канцерогенез, на основе информации о структуре их промоторных областей и CpG-островков. Подобные исследования абсолютно необходимы для характеристики эпигенетического портрета того или иного типа опухолей и обычно охватывают ограниченный круг хорошо охарактеризованных генов, вовлеченных в канцерогенез (р16, р14, р15, RB1, HIC, ECAD и ряд других), что позволяет унифицировать результаты исследований метилотипов опухолей. Подобный стандартизированный подход имеет определенные преимущества, поскольку позволяет сравнивать результаты десятков исследований, что значительно повышает их статистическую достоверность и практическую ценность. В то же время ограниченность круга генов, включенных в такие системы маркеров по изучению метилирования, не позволяет решить одну из главных задач онкогенетики по созданию наборов молекулярных, в том числе эпигенетических, диагностических маркеров, позволяющих эффективно дифференцировать различные типы злокачественных новообразований, в том числе, в зависимости от их тканевого происхождения. Решение этой задачи сопряжено с идентификацией новых генов, вовлеченных в канцерогенез, путем выявления аномалий их эпигенетической регуляции в опухолях, точнее, скрининга дифференциального метилирования геномов нормальных и опухолевых клеток.There are two principal approaches to the analysis of methylation disorders in various types of tumors. The first involves the study of the methylation status of already known genes involved in carcinogenesis, based on information about the structure of their promoter regions and CpG islands. Such studies are absolutely necessary to characterize the epigenetic portrait of a particular type of tumor and usually cover a limited range of well-characterized genes involved in carcinogenesis (p16, p14, p15, RB1, HIC, ECAD, and several others), which makes it possible to unify the results of studies of tumor methylotypes. Such a standardized approach has certain advantages, since it allows you to compare the results of dozens of studies, which significantly increases their statistical reliability and practical value. At the same time, the limited circle of genes included in such systems of markers for the study of methylation does not allow one of the main tasks of oncogenetics to create sets of molecular, including epigenetic, diagnostic markers to efficiently differentiate various types of malignant neoplasms, including depending on their tissue origin. The solution to this problem is associated with the identification of new genes involved in carcinogenesis by identifying abnormalities in their epigenetic regulation in tumors, more specifically, screening for differential methylation of the genomes of normal and tumor cells.
Описано несколько способов формирования систем маркеров метилирования ДНК.Several methods for the formation of DNA methylation marker systems have been described.
Метод метилчувствительного репрезентативно-дифференциального анализа (МЧ-РДА) заключается в сравнении характера метилирования образцов ДНК, выделенных из опухолевой и нормальной тканей, путем многократного повторения циклов рестрикции, дотирования, амплификации и вычитательной гибридизации со сменой адаптеров, различающихся последовательностями свободных концов (Ushijima T., Morimura K., Hosoya Y., Okonogi H., Tatematsu M., Sugimura T., Nagao M. Establishment of methylation-sensitive-representational difference analysis and isolation of hypo- and hypermethylated genomic fragments in mouse liver tumors // 1997. PNAS, 94, 2284-2289). Для вычитательной гибридизации используется набор не менее чем из трех различных адаптеров. Конечные продукты МЧ-РДА подвергаются клонированию с последующим секвенированием для идентификации фрагментов дифференциально метилированных CpG-островков. Огромное количество производимых операций требует соблюдения высокой точности на каждом этапе и катастрофически снижает воспроизводимость результатов, поэтому метод МЧ-РДА широкого распространения не получил.The method of methyl-sensitive representative differential analysis (MCH-RDA) is to compare the methylation pattern of DNA samples isolated from tumor and normal tissues by repeatedly repeating restriction, subsidizing, amplification and subtractive hybridization cycles with changing adapters that differ in sequences of free ends (Ushijima T. , Morimura K., Hosoya Y., Okonogi H., Tatematsu M., Sugimura T., Nagao M. Establishment of methylation-sensitive-representational difference analysis and isolation of hypo- and hypermethylated genomic fragments in mouse liver tumors // 1997. PNAS, 94, 2284-2289). For subtractive hybridization, a set of at least three different adapters is used. The final MCH-RDA products are cloned, followed by sequencing, to identify fragments of differentially methylated CpG islands. A huge number of operations performed requires the observance of high accuracy at each stage and catastrophically reduces the reproducibility of the results, so the MCH-RDA method is not widely used.
Вычитательную гибридизацию проводят также для хроматографически изолированных пулов CpG-островков (Brock G.J.R., Huang T.H., Chen C., Johnson KJ. A novel technique for the identification of CpG islands exhibiting altered methylation patterns (ICEAMP) // 2001. Nucleic Acids Res., 29, el 23). Метод не менее трудоемок, чем МЧ-РДА, и требует наличия дополнительного оборудования и специальных навыков, не типичных для лабораторий, занимающихся геномными исследованиями. Кроме того, первичные результаты исследования лишены наглядности, а окончательная идентификация интересующих CpG-островков сопряжена с необходимостью скрининга огромного количества клонов, что само по себе значительно повышает стоимость и трудоемкость работы.Subtractive hybridization is also carried out for chromatographically isolated pools of CpG islands (Brock GJR, Huang TH, Chen C., Johnson KJ. A novel technique for the identification of CpG islands exhibiting altered methylation patterns (ICEAMP) // 2001. Nucleic Acids Res., 29, el 23). The method is no less laborious than MCH-RDA, and requires additional equipment and special skills that are not typical for laboratories involved in genomic research. In addition, the primary results of the study are not clear, and the final identification of the CpG islands of interest is associated with the need to screen a huge number of clones, which in itself greatly increases the cost and laboriousness of the work.
Альтернативный способ анализа результатов метил-CpG-иммунопреципитации предложен в патенте США (Esteller, M. Methylation detection. United States Patent Application 2009/0176655). В этой модификации вычитательная гибридизация метилированной и общей фракций генома заменена гибридизацией на биологических микрочипах, несущих на себе зонды, соответствующие фрагментам 44 тысяч промоторных CpG-островков генома человека. Такой подход позволяет стандартизировать и значительно упростить процедуру скрининга дифференциально метилированной ДНК, однако значительным его недостатком становится утрата непредвзятого характера исследований и ограниченность тестируемой фракции генома. Эффективность метода в плане выхода научной продукции также оказалась невысокой: на примере анализа клеточной линии рака толстого кишечника НСТ116 продемонстрирована идентификация всего лишь пяти аномально метилированных промоторов.An alternative method for analyzing the results of methyl CpG immunoprecipitation is proposed in US Patent (Esteller, M. Methylation detection. United States Patent Application 2009/0176655). In this modification, the subtractive hybridization of methylated and total fractions of the genome is replaced by hybridization on biological microarrays carrying probes corresponding to fragments of 44 thousand promoter CpG islands of the human genome. Such an approach makes it possible to standardize and greatly simplify the screening procedure for differentially methylated DNA, however, a significant drawback is the loss of the unbiased nature of the studies and the limitations of the tested genome fraction. The effectiveness of the method in terms of the yield of scientific products also turned out to be low: by the example of the analysis of the HCT116 colon cancer cell line, the identification of only five abnormally methylated promoters was demonstrated.
Метод метилчувствительного рестрикционно-ориентированного геномного сканирования (МЧ-РОГС) теоретически позволяет одновременно анализировать статус метилирования нескольких тысяч CpG-островков в геноме. Суть его заключается в разделении двумерным электрофорезом радиоактивно меченых фрагментов, полученных обработкой геномной ДНК несколькими рестриктазами (Costello J.F., Hong C., Plass C., Smiraglia D.J. Restriction landmark genomic scanning: analysis of CpG islands in genomes by 2D gel electrophoresis // 2009. Methods Mol. Biol., 507, 131-148). Метод МЧ-РОГС не получил широкого распространения по ряду причин. Прежде всего, он излишне трудоемок, как методически, так и с точки зрения анализа результатов. Результаты исследований не всегда воспроизводимы, в частности, вследствие неполного гидролиза геномной ДНК редкощепящей рестриктазой NotI. Кроме того, для идентификации аномально метилированных CpG-островков в образце опухоли того или иного тканевого происхождения необходимо предварительно охарактеризовать нормальный метилотип соответствующей ткани, что представляет собой отдельное трудоемкое исследование. Наконец, изоляция интересующих CpG-островков из геля затруднена вследствие невозможности непосредственного визуального контроля.The method of methyl-sensitive restriction-oriented genomic scanning (MCH-ROGS) theoretically allows you to simultaneously analyze the methylation status of several thousand CpG islands in the genome. Its essence is the separation by two-dimensional electrophoresis of radioactively labeled fragments obtained by treating genomic DNA with several restrictase enzymes (Costello JF, Hong C., Plass C., Smiraglia DJ Restriction landmark genomic scanning: analysis of CpG islands in genomes by 2D gel electrophoresis // 2009. Methods Mol. Biol., 507, 131-148). The MCH-ROGS method is not widely used for a number of reasons. First of all, it is unnecessarily laborious, both methodologically and from the point of view of analyzing the results. The research results are not always reproducible, in particular, due to incomplete hydrolysis of genomic DNA with the NotI restriction enzyme. In addition, in order to identify abnormally methylated CpG islands in a sample of a tumor of one or another tissue origin, it is necessary to first characterize the normal methylotype of the corresponding tissue, which is a separate laborious study. Finally, isolation of the CpG islands of interest from the gel is difficult due to the impossibility of direct visual control.
Задачей изобретения является повышение воспроизводимости формируемых систем маркеров метилирования ДНК, упрощения процедуры характеристики нормальных тканевых метилотипов, сокращения времени цикла скрининга, высокой производительности метода и совершенствования способа визуализации результатов.The objective of the invention is to increase the reproducibility of the generated systems of markers of DNA methylation, simplify the procedure for characterizing normal tissue methylotypes, reduce the screening cycle time, high productivity of the method and improve the method of visualizing the results.
Поставленная задача решается тем, что проводят выделение геномной ДНК, гидролиз метилчувствительным и неметилчувствительным изошизомерами эндонуклеаз рестрикции, лигируют с универсальными адаптерами, проводят полимеразную цепную реакцию с универсальным флуоресцентно меченым праймером с последующим капиллярным электрофорезом, которая приводит к формированию систем маркеров в виде пиков электрофореграммы.The problem is solved by the fact that genomic DNA is isolated, hydrolysis by methyl-sensitive and non-methyl-sensitive isoshisomers of restriction endonucleases is ligated with universal adapters, a polymerase chain reaction is carried out with a universal fluorescently labeled primer, followed by capillary electrophoresis in the form of electrophores of markers.
Под универсальным адаптером в настоящем изобретении подразумевается молекулярная конструкция, состоящая из олигонуклеотидов CCGGTCAGAGCTTTGCGAAT и ATTCGCAAAGCTCTGA, имеющая следующую структуру:By the universal adapter in the present invention is meant a molecular structure consisting of the oligonucleotides CCGGTCAGAGCTTTTGCGAAT and ATTCGCAAAGCTCTGA, having the following structure:
Способ основан на патогенетическом факторе канцерогенеза - нарушении процессов метилирования без нарушения структуры ДНК.The method is based on the pathogenetic factor of carcinogenesis - violation of methylation processes without violating the structure of DNA.
Способ осуществляется следующим образом.The method is as follows.
Выделение геномной ДНКGenomic DNA Isolation
Для получения ДНК из ткани опухоли используют следующий метод выделения ДНК:To obtain DNA from tumor tissue, use the following DNA isolation method:
1. Ткань опухоли измельчают глазными ножницами и затем гомогенизируют, растирая со стеклом.1. Tumor tissue is crushed with eye scissors and then homogenized by trituration with glass.
2. Гомогенизат переносят в пробирку и добавляют экстракционный буфер (10 мМ Tris-HCl, 2 мМ ЭДТА, 4 мМ NaCl, pH=8,0).2. The homogenizate was transferred to a test tube and extraction buffer (10 mM Tris-HCl, 2 mM EDTA, 4 mM NaCl, pH = 8.0) was added.
3. Добавляют протеиназу К до концентрации 50 мкг/мл и SDS до 0.5%. Образец тщательно перемешивают.3. Add proteinase K to a concentration of 50 μg / ml and SDS to 0.5%. The sample is thoroughly mixed.
4. Инкубируют 2 часа при 37°C.4. Incubate for 2 hours at 37 ° C.
5. Доводят объем образца до 5 мл раствором ТЕ, pH 8.0 и последовательно проводят экстракцию ДНК равными объемами фенола, смеси фенол-хлороформ и хлороформом.5. Bring the sample volume to 5 ml with a TE solution, pH 8.0, and sequentially carry out DNA extraction with equal volumes of phenol, a mixture of phenol-chloroform and chloroform.
6. К образцу добавляют 1/10 объема 5М ацетата натрия, pH 5,3, перемешивают и осаждают ДНК 2,5 объемами холодного 96% этанола, выдерживают образец 30 мин при температуре - 70°C.6. 1/10 volume of 5M sodium acetate, pH 5.3, is added to the sample, stirred and DNA is precipitated with 2.5 volumes of cold 96% ethanol, the sample is kept for 30 minutes at a temperature of -70 ° C.
7. Пробу центрифугируют при 0°C 15 мин с ускорением 12000 g. Высушивают осадок ДНК на воздухе и растворяют в 200 мкл ТЕ pH 8.0.7. The sample is centrifuged at 0 ° C for 15 minutes with an acceleration of 12000 g. Dry the DNA pellet in air and dissolve in 200 μl of TE pH 8.0.
Гидролиз ДНК, полученной из образца, рестриктазами SmaI и XmaI (CCCGGG).Hydrolysis of DNA obtained from the sample by restriction enzymes SmaI and XmaI (CCCGGG).
Для создания пула GC-богатых фрагментов образцы ДНК подвергаются поэтапному гидролизу. На первом этапе ДНК гидролизуют метилчувствительной рестриктазой SmaI, формирующей фрагменты ДНК с тупыми концами (CCC/GGG). Затем продукты реакции подвергают гидролизу нечувствительным к метилированию изошизомером рестриктазы SmaI - ферментом XmaI, формирующим липкие концы (C/CCGGG).To create a pool of GC-rich fragments, DNA samples undergo stepwise hydrolysis. At the first stage, DNA is hydrolyzed with methyl-sensitive restriction enzyme SmaI, forming blunt-ended DNA fragments (CCC / GGG). Then, the reaction products are hydrolyzed by the SmaI restriction enzyme insensitive to methylation, the XmaI enzyme, which forms sticky ends (C / CCGGG).
В рестрикционную смесь с общим объемом 20 мкл добавляют 2-10 мкг нативной ДНК, 2 мкл соответствующего 10-кратного буфера и 20 единиц рестриктазы Smal. Смесь инкубируют 16 часов при температуре 25°C, после чего в нее добавляют 20 единиц рестриктазы XmaI и инкубируют 6 часов при температуре 37°C. Для инактивации ферментов перед процедурой дотирования продуктов гидролиза ДНК с адаптерами смесь термостатируют в течение 20 минут при 65°C.In a restriction mixture with a total volume of 20 μl, 2-10 μg of native DNA, 2 μl of the corresponding 10-fold buffer and 20 Smal restriction enzymes are added. The mixture is incubated for 16 hours at a temperature of 25 ° C, after which 20 units of XmaI restrictase are added and it is incubated for 6 hours at a temperature of 37 ° C. To inactivate enzymes, before the procedure for subsidizing DNA hydrolysis products with adapters, the mixture is thermostated for 20 minutes at 65 ° C.
Для приготовления полной репрезентации системы маркеров (всего набора фрагментов, получаемых при конкретных условиях эксперимента) из протокола исключают этап гидролиза метилчувствительной рестриктазой SmaI.To prepare a complete representation of the marker system (the entire set of fragments obtained under specific experimental conditions), the stage of hydrolysis with methyl-sensitive restriction enzyme SmaI is excluded from the protocol.
Лигирование с универсальными адаптерами.Ligation with universal adapters.
Адаптеры готовят путем инкубации равных объемов олигонуклеотидов следующего состава: CCGGTCAGAGCTTTGCGAAT и ATTCGCAAAGCTCTGA в течение 6 минут при температуре 65°C, с последующим охлаждением при комнатной температуре в течение 60 минут.Adapters are prepared by incubating equal volumes of oligonucleotides of the following composition: CCGGTCAGAGCTTTTGCGAAT and ATTCGCAAAGCTCTGA for 6 minutes at 65 ° C, followed by cooling at room temperature for 60 minutes.
Продукты гидролиза ДНК лигируют с 2 нмоль адаптеров при помощи ДНК-лигазы Т4 в реакционной смеси следующего состава: 20 мкл адаптера в концентрации 100 мкмоль, 100 ед. акт. ДНК-лигазы Т4, 8 мкл 10× SE-буфера для ДНК-лигазы, 25 мкл деионизованной воды. Конечный объем реакции составлял 80 мкл. Время инкубации - 1 час при 16°C.DNA hydrolysis products are ligated with 2 nmol of adapters using T4 DNA ligase in the reaction mixture of the following composition: 20 μl of the adapter at a concentration of 100 μmol, 100 units Act. T4 DNA ligase, 8 μl of 10 × SE ligase buffer, 25 μl of deionized water. The final reaction volume was 80 μl. The incubation time is 1 hour at 16 ° C.
Полимеразная цепная реакция (ПЦР).Polymerase chain reaction (PCR).
ПЦР проводят в общем объеме 25 мкл по следующей схеме: К 3 мкл смеси лигированных рестриктов добавляют 1 мМ олигопраймера, по 200 мкМ каждого дезоксинуклеотидтрифосфата, 3% формамида, 2,5 мкл 10-кратного буфера для ПЦР следующего состава: 500 мМ KCl, 100 мМ трис-HCl pH 8,4; 15 мМ MgCl2, деионизованной воды до 25 мкл. Начальную денатурацию проводят при 98°C в течение 5 минут, затем в смесь добавляют 1 ед. акт. термофильной ДНК-полимеразы и проводят 33 цикла ПЦР при следующих условиях: денатурация: 95°C - 25 секунд, отжиг: 70°C - 45 секунд, элонгация: 72°C - 90 секунд. ПЦР завершают инкубацией смеси при 72°C в течение 10 мин. В качестве праймера используют олигонуклеотид ATTCGCAAAGCTCTGACCGGGN, конъюгированный по 5'-концу с флуоресцентным красителем FAM. N соответствует любой последовательности нуклеотидов в количестве от 1 до 3. Эта последовательность является дискриминирующим удлинителем универсального праймера.PCR is carried out in a total volume of 25 μl according to the following scheme: 1 mM oligoprimer, 200 μM each deoxynucleotide triphosphate, 3% formamide, 2.5 μl 10-fold PCR buffer of the following composition are added to 3 μl of the ligated restriction mixture: 500 mM KCl, 100 mM Tris-HCl pH 8.4; 15 mM MgCl 2 , deionized water up to 25 μl. Initial denaturation was carried out at 98 ° C for 5 minutes, then 1 unit was added to the mixture. Act. thermophilic DNA polymerase and carry out 33 PCR cycles under the following conditions: denaturation: 95 ° C - 25 seconds, annealing: 70 ° C - 45 seconds, elongation: 72 ° C - 90 seconds. PCR was completed by incubating the mixture at 72 ° C for 10 minutes. The primer used is the ATTCGCAAAGCTCTGACCGGGN oligonucleotide conjugated at the 5'end with the fluorescent dye FAM. N corresponds to any nucleotide sequence in an amount of from 1 to 3. This sequence is a discriminative extension of the universal primer.
Разделение продуктов ПЦР в 8%-ном полиакриламидном геле (ПААГ) методом вертикального электрофореза.Separation of PCR products in an 8% polyacrylamide gel (PAAG) by vertical electrophoresis.
Контроль эффективности ПЦР осуществляют путем разделения продуктов реакции в 8%-ном неденатурирующем полиакриламидном геле следующего состава: 8.4 мл 30%-го раствора акриламида, 0.6 мл 10%-го персульфата аммония, 26 мкл ТЕМЕД, до 30 мл разведенного буфера ТВЕ. Персульфат аммония и ТЕМЕД вносят после всех остальных компонентов и тщательно перемешивают полученную смесь. Электрофорез проводят при напряжении 400 В с использованием камеры для вертикального электрофореза («Хеликон», Москва) в течение 2.0-3.0 часов.The effectiveness of PCR is controlled by separating the reaction products in an 8% non-denaturing polyacrylamide gel of the following composition: 8.4 ml of a 30% solution of acrylamide, 0.6 ml of 10% ammonium persulfate, 26 μl of TEMED, up to 30 ml of diluted TBE buffer. Ammonium persulfate and TEMED are added after all other components and the resulting mixture is thoroughly mixed. Electrophoresis is carried out at a voltage of 400 V using a camera for vertical electrophoresis (Helikon, Moscow) for 2.0-3.0 hours.
В качестве контроля молекулярной массы ДНК используют ДНК стандартной молекулярной массы pUC19/Msp1. Визуальный контроль пробега проб ДНК проводят по ксиленцианолу и бромфеноловому синему. Окрашивание геля нитратом серебра для визуализации продуктов ПЦР проводят по приведенной ниже методике.As a control of the molecular weight of DNA, DNA of standard molecular weight pUC19 / Msp1 is used. Visual control of the mileage of DNA samples is carried out on xylencyanol and bromphenol blue. Gel staining with silver nitrate to visualize PCR products is carried out according to the following procedure.
Ультратонкое окрашивание нитратом серебра.Ultrafine silver nitrate staining.
Окрашивание гелей проводят по усовершенствованной методике Liberman. После электрофореза гель инкубируют в растворе 0,011 М AgNO3 в течение 10-15 минут, затем трижды промывают в дистиллированной воде. Проявление проводят в модифицированном растворе проявителя (увеличена концентрация НСНО) следующего состава: 0,75 М NaOH; 0,5 М НСНО; 2,3 mM Na(BH4) около 10-15 минут, в зависимости от интенсивности проявления геля.Gel staining is carried out according to an advanced Liberman technique. After electrophoresis, the gel is incubated in a solution of 0.011 M AgNO 3 for 10-15 minutes, then washed three times with distilled water. The manifestation is carried out in a modified developer solution (increased concentration of HCNO) of the following composition: 0.75 M NaOH; 0.5 M HCNO; 2.3 mM Na (BH 4 ) for about 10-15 minutes, depending on the intensity of gel manifestation.
Капиллярный электрофорез.Capillary electrophoresis.
Продукты реакции разделяют методом капиллярного электрофореза при постоянной температуре 60°C в денатурирующем геле на автоматическом генетическом анализаторе ABI PRISM 3100 (Applied Biosystems, США) по протоколам фирмы-производителя в режиме фрагментного анализа. В качестве маркера молекулярной массы ДНК используют LIZ500 (Applied Biosystems). Для анализа результатов используют компьютерную программу GeneMapper или аналогичную.The reaction products are separated by capillary electrophoresis at a constant temperature of 60 ° C in denaturing gel on an ABI PRISM 3100 automatic genetic analyzer (Applied Biosystems, USA) according to the manufacturer's protocols in the fragment analysis mode. As a marker of the molecular weight of DNA, LIZ500 (Applied Biosystems) is used. To analyze the results using a computer program GeneMapper or similar.
Оптимальные критерии интерпретация результатов исследования.Optimal criteria are the interpretation of research results.
Если в опухолевой ДНК присутствует аномальное метилирование, то цитозины в составе CpG-динуклеотидов заменены на 5-метилцитозины, в том числе, в сайтах узнавания SmaI. В этом случае рестриктаза SmaI не в состоянии гидролизовать геномную ДНК в сайтах узнавания, и матрица для адаптер-опосредованной метилчувствительной ПЦР остается интактной. В результате на электрофореграмме капиллярного электрофореза видны фрагменты, отсутствующие при анализе контрольной ДНК нормальных клеток. При отсутствии аномального метилирования происходит гидролиз геномной ДНК в сайтах узнавания SmaI. Матрица для ПЦР разрушается и соответствующий ПЦР-продукт не нарабатывается. Отрицательный контроль не должен содержать ПНР-продуктов, в положительном контроле должны присутствовать ПНР-продукты, соответствующие участкам генома, облигатно метилированным в исследуемой ткани.If abnormal methylation is present in the tumor DNA, then the cytosines in the composition of CpG dinucleotides are replaced by 5-methylcytosines, including SmaI recognition sites. In this case, the SmaI restrictase is not able to hydrolyze genomic DNA at recognition sites, and the template for adapter-mediated methyl-sensitive PCR remains intact. As a result, fragments absent in the analysis of control DNA of normal cells are visible on the electrophoregram of capillary electrophoresis. In the absence of abnormal methylation, genomic DNA is hydrolyzed at SmaI recognition sites. The matrix for PCR is destroyed and the corresponding PCR product is not produced. The negative control should not contain PNR products; in the positive control, PNR products corresponding to regions of the genome obligate methylated in the test tissue should be present.
На фигуре 1 показан пример выявления аномально метилированного фрагмента генома (указан стрелками). В левой части электрофореграммы - фрагменты константно метилированных генов. Использован удлинитель универсального праймера CCG. Двоение сигналов объясняется различиями в электрофоретической подвижности комплементарных цепей фрагмента ДНК в денатурирующих условиях.The figure 1 shows an example of the detection of an abnormally methylated fragment of the genome (indicated by arrows). On the left side of the electrophoregram are fragments of constant methylated genes. Used extension cable universal primer CCG. Signal doubling is explained by differences in electrophoretic mobility of complementary chains of a DNA fragment under denaturing conditions.
На фигуре 2 показан пример выявления аномально метилированного фрагмента генома (указан стрелками). В левой части электрофореграммы - фрагменты константно метилированных генов. Использован удлинитель универсального праймера GCG.Figure 2 shows an example of the detection of an abnormally methylated fragment of the genome (indicated by arrows). On the left side of the electrophoregram are fragments of constant methylated genes. Used universal primer extension GCG.
Полный набор фрагментов ДНК, состояние метилирования которых оценивается с использованием конкретной системы, визуализируется капиллярным электрофорезом полной репрезентации. На фигуре 3 показан пример визуализации полной репрезентации системы маркеров при использовании в реакции удлинителя универсального праймера CCG. Пики, указанные стрелками, соответствуют фрагментам облигатно метилированных локусов генома.A complete set of DNA fragments, the methylation state of which is evaluated using a specific system, is visualized by capillary electrophoresis of complete representation. The figure 3 shows an example of visualization of the complete representation of the marker system when using the universal extension primer CCG in the reaction. The peaks indicated by arrows correspond to fragments of obligate methylated genome loci.
Задача повышения воспроизводимости формируемых систем маркеров метилирования ДНК, упрощения процедуры характеристики нормальных тканевых метилотипов, сокращения времени цикла скрининга и повышения производительности метода решена разработкой способа формирования систем маркеров метилирования ДНК, заключающегося в том, что проводят выделение геномной ДНК, гидролиз метилчувствительным и неметилчувствительным изошизомерами эндонуклеаз рестрикции, лигируют продукты гидролиза ДНК с универсальными адаптерами, проводят полимеразную цепную реакцию с универсальным флуоресцентно меченым праймером, образующую после капиллярного электрофореза систему маркеров в виде пиков электрофореграммы.The task of increasing the reproducibility of the formed systems of DNA methylation markers, simplifying the procedure for characterizing normal tissue methylotypes, reducing the screening cycle time and increasing the productivity of the method has been solved by developing a method for the formation of DNA methylation marker systems, which involves the isolation of genomic DNA, hydrolysis of methyl-sensitive and non-methyl-sensitive restriction endonucleases isoshisomers , ligated DNA hydrolysis products with universal adapters, polymerase chain reaction with a universal fluorescently labeled primer, which forms a system of markers in the form of electrophoregram peaks after capillary electrophoresis.
Claims (1)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2011119871/10A RU2472859C1 (en) | 2011-05-18 | 2011-05-18 | Method for formation of dna methylation marker systems |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2011119871/10A RU2472859C1 (en) | 2011-05-18 | 2011-05-18 | Method for formation of dna methylation marker systems |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| RU2011119871A RU2011119871A (en) | 2012-11-27 |
| RU2472859C1 true RU2472859C1 (en) | 2013-01-20 |
Family
ID=48806536
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2011119871/10A RU2472859C1 (en) | 2011-05-18 | 2011-05-18 | Method for formation of dna methylation marker systems |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2472859C1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2625012C2 (en) * | 2015-12-18 | 2017-07-11 | федеральное государственное автономное образовательное учреждение высшего образования Первый Московский государственный медицинский университет имени И.М. Сеченова Министерства здравоохранения Российской Федерации (Сеченовский университет) | Method for preparation of genomic libraries of limited selections of locuses from degraded dna |
| RU2635964C1 (en) * | 2016-10-20 | 2017-11-17 | федеральное государственное автономное образовательное учреждение высшего образования Первый Московский государственный медицинский университет имени И.М. Сеченова Министерства здравоохранения Российской Федерации (Сеченовский университет) (ФГАОУ ВО Первый МГМУ им. И.М. Сеченова Минздрава России (Се | Method for detection of molecular-genetic markers associated with barrett esophagus progression |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0097683A1 (en) * | 1981-12-30 | 1984-01-11 | ROSENBERG, Hartmut | Method and device for reducing the noise of combustion engines |
| US20070231800A1 (en) * | 2006-03-28 | 2007-10-04 | Agilent Technologies, Inc. | Determination of methylated DNA |
| US20090176655A1 (en) * | 2007-11-16 | 2009-07-09 | Oncomethylome Sciences Sa | Methylation detection |
| RU2405837C1 (en) * | 2009-07-06 | 2010-12-10 | Государственное образовательное учреждение высшего профессионального образования Московская медицинская академия им. И.М. Сеченова Федерального агентства по здравоохранению и социальному развитию (ГОУВПО ММА им. И.М. Сеченова Росздрава) | Early dna-diagnostic technique of prostate cancer |
-
2011
- 2011-05-18 RU RU2011119871/10A patent/RU2472859C1/en not_active IP Right Cessation
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0097683A1 (en) * | 1981-12-30 | 1984-01-11 | ROSENBERG, Hartmut | Method and device for reducing the noise of combustion engines |
| US20070231800A1 (en) * | 2006-03-28 | 2007-10-04 | Agilent Technologies, Inc. | Determination of methylated DNA |
| US20090176655A1 (en) * | 2007-11-16 | 2009-07-09 | Oncomethylome Sciences Sa | Methylation detection |
| RU2405837C1 (en) * | 2009-07-06 | 2010-12-10 | Государственное образовательное учреждение высшего профессионального образования Московская медицинская академия им. И.М. Сеченова Федерального агентства по здравоохранению и социальному развитию (ГОУВПО ММА им. И.М. Сеченова Росздрава) | Early dna-diagnostic technique of prostate cancer |
Non-Patent Citations (3)
| Title |
|---|
| COSTELLO J.F. ЕТ AL., Restriction landmark genomic scanning: analysis of CpG islands in genomes by 2D gel electrophoresis, Methods Mol Biol., 2009, v.507, pp.131-148. * |
| COSTELLO J.F. ЕТ AL., Restriction landmark genomic scanning: analysis of CpG islands in genomes by 2D gel electrophoresis, Methods Mol Biol., 2009, v.507, pp.131-148. GARCIA-CANAS V. ЕТ AL., Simultaneous confirmatory analysis of different transgenic maize (zea mays) lines using multiplex polymerase chain reaction-restriction analysis and capillary gel electrophoresis with laser induced fluorescence detection, J Agric Food Chem., 2008, v.56, no.18, pp.8280-8286. * |
| GARCIA-CANAS V. ЕТ AL., Simultaneous confirmatory analysis of different transgenic maize (zea mays) lines using multiplex polymerase chain reaction-restriction analysis and capillary gel electrophoresis with laser induced fluorescence detection, J Agric Food Chem., 2008, v.56, no.18, pp.8280-8286. * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2625012C2 (en) * | 2015-12-18 | 2017-07-11 | федеральное государственное автономное образовательное учреждение высшего образования Первый Московский государственный медицинский университет имени И.М. Сеченова Министерства здравоохранения Российской Федерации (Сеченовский университет) | Method for preparation of genomic libraries of limited selections of locuses from degraded dna |
| RU2635964C1 (en) * | 2016-10-20 | 2017-11-17 | федеральное государственное автономное образовательное учреждение высшего образования Первый Московский государственный медицинский университет имени И.М. Сеченова Министерства здравоохранения Российской Федерации (Сеченовский университет) (ФГАОУ ВО Первый МГМУ им. И.М. Сеченова Минздрава России (Се | Method for detection of molecular-genetic markers associated with barrett esophagus progression |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2011119871A (en) | 2012-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Thompson et al. | An overview of DNA typing methods for human identification: past, present, and future | |
| Liu et al. | CpG methylation patterns of human mitochondrial DNA | |
| McKiernan et al. | Molecular diagnostic applications in forensic science | |
| CN103717750B (en) | The quantitation of minority nucleic acid substances | |
| ES2577017T3 (en) | Procedures and kits to identify aneuploidy | |
| Haas et al. | RNA/DNA co-analysis from human skin and contact traces–results of a sixth collaborative EDNAP exercise | |
| Drew et al. | Intramitochondrial location and dynamics of Crithidia fasciculata kinetoplast minicircle replication intermediates | |
| EP3885448B1 (en) | Analysis of chromatin using a nicking enzyme | |
| WO2014197607A1 (en) | Detection of tick-borne diseases | |
| US20130296328A1 (en) | Epigenetic portraits of human breast cancers | |
| AU2014373622A1 (en) | Nucleic acid detection method and kit | |
| WO2008089280A2 (en) | Selective lysis of sperm cells | |
| CN102703595A (en) | STR (short tandem repeat) sequence high-throughput detection method with base selective controllable extension and detection reagent thereof | |
| CN110904231A (en) | Reagent for auxiliary diagnosis of liver cancer and application of reagent in preparation of kit | |
| McDonald et al. | Forensic DNA analysis | |
| Chen et al. | Determination of the heterogeneity of DNA methylation by combined bisulfite restriction analysis and capillary electrophoresis with laser-induced fluorescence | |
| Ma et al. | Microdroplet-based one-step RT-PCR for ultrahigh throughput single-cell multiplex gene expression analysis and rare cell detection | |
| Iozzi et al. | Forensic genetics in NGS era: New frontiers for massively parallel typing | |
| Watanabe et al. | Development of a Real‐Time PCR‐Based Method for Analyzing Semen‐Specific Unmethylated DNA Regions and Methylation Status in Aged Body Fluid Stains | |
| RU2472859C1 (en) | Method for formation of dna methylation marker systems | |
| CN108707697A (en) | The LAMP detection primer pair and detection method of Sai Nika paddy viruses | |
| Sivapragasam et al. | A recommended workflow for DNase I footprinting using a capillary electrophoresis genetic analyzer | |
| CN103074438A (en) | Multi-gene detection kit for guiding administration of warfarin and detection method of multi-gene detection kit | |
| CN107988334A (en) | The method that buccal swab Direct PCR carries out SNP partings | |
| Nie et al. | A simple and rapid method for fish sex identification based on recombinase-aided amplification and its use in Cynoglossus semilaevis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PD4A | Correction of name of patent owner | ||
| PC41 | Official registration of the transfer of exclusive right |
Effective date: 20161025 |
|
| MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20170519 |