RU2430740C2 - Polyconjugates for polynucleotide introduction in vivo - Google Patents

Abstract

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to compositions which can be applied to introduce polynucleotides or other molecules which are not characterised by ability to penetrate into cells of mammal molecules. The offered composition intended for molecule introduction in a cell, contains a conjugate of formula: N-L¹-P-(L²-M)_y in which N means a molecule not characterised by ability to penetrate through membranes or a molecule having low ability to penetrate through the membrane; L¹ means a first reversible bond containing a bond labile in a physiological environment; P means a polymer exhibiting activity on the membrane; L² means a second reversible bond containing an orthogonal bond labile in the physiological environment; M means a masking agent selected from the group including steric stabilisers transferring the group directly, and charge-modifying agents, and y means an integer exceeding 0.

EFFECT: polyconjugate systems are characterised by types of activity which provide the directed transfer, exhibit antiopsonising, antiaggregation and transfection action, in small biocompatible carriers intended for introduction in vivo.

18 cl, 26 ex, 36 dwg

Description

Cross reference to related applications

This application claims priority to provisional application for US patent No. 60/822833, registered August 18, 2006, and provisional application for US patent No. 60/91868, registered May 3, 2007

BACKGROUND OF THE INVENTION

The efficiency of introducing polynucleotides and others that do not have the ability to penetrate through the membranes of compounds into living cells is largely limited by the complex of cell membrane systems. The drugs used for antisense and gene therapy are relatively large hydrophilic polymers, and they often also carry a large negative charge. Both of these physical characteristics prevent their direct diffusion across the cell membrane. For this reason, the main problem with the introduction of polynucleotides is the penetration of the polynucleotide into the cell. Numerous transfection reagents designed to introduce polynucleotides into cells in vitro have been developed. However, in vivo administration of polynucleotides is complicated by toxicity, interactions with serum, and insufficient directed transfer efficiency provided by transfection reagents that have in vitro activity. Reagents for transfection that work well in vitro, cationic polymers and lipids, as a rule, have a destabilizing effect on cell membranes and form large particles. The positive (cationic) charge of the transfection reagent facilitates the introduction of nucleic acid binding, as well as its binding to the cell. Membrane destabilization facilitates the administration of non-penetrating polynucleotides through the cell membrane. These properties make the transfection reagents ineffective or toxic in vivo. The cationic charge leads to interaction with the components of the serum, which leads to the destabilization of the interaction of the polynucleotide reagent for transfection and insufficient bioavailability, and the effectiveness of directional transfer. The cationic charge can also lead to in vivo toxicity. Membrane activity of a transfection reagent, which may be in vitro effective, often leads to in vivo toxicity.

For in vivo administration, the transfection complex (transfection reagent in combination with the nucleic acid to be administered) should be small, i.e. with a diameter of less than 100 nm, and preferably less than 50 nm. More effective complexes may be even smaller, less than 20 nm, or even less than 10 nm. Complexes for transfection larger than 100 nm have very little ability to penetrate into cells other than blood vessel cells in vivo. Used in vitro complexes also carry a positive charge. This positive charge is necessary for attachment of the complex to the cell and fusion with the membrane, its destabilization or destruction. The positive charge of the in vivo complexes for transfection leads to undesirable interactions with serum and, as a result, to insufficient bioavailability. Practically neutral or negatively charged complexes should have in vivo better distribution characteristics and the ability to carry out directed transfer. However, in vitro complexes for transfection are associated with nucleic acids via charge-charge (electrostatic) interactions. Negatively charged polymers and lipids do not interact with negatively charged nucleic acids. In addition, these electrostatic complexes tend to aggregate or precipitate upon contact with physiological concentrations of salts or serum components. Finally, transfection complexes that are effective in vitro are often toxic in vivo. The polymers and lipids used for transfection destroy or destabilize cell membranes. The balance between this activity and the efficiency of introducing nucleic acids is easier to achieve in vitro than in vivo.

Although several research groups have been able to achieve significant improvements in introducing genes into cells in vivo, there remains a need to create a form that provides for the effective introduction of a polynucleotide into a target cell in combination with an administration agent and does not have toxicity, usually associated with the introduction of in vivo reagents for transfection. The present invention provides compositions and methods for introducing into a cell and releasing a polynucleotide in a cell based on the use of administration systems including biologically labile conjugates.

Summary of the invention

A preferred embodiment of the features of the invention is a composition for introducing a polynucleotide into an in vivo cell that contains a reversibly masked membrane-active polymer that is reversibly conjugated to the polynucleotide. The polymer is attached via one or more first reversible covalent bonds to one or more masking agents and is additionally attached via one or more second reversible covalent bonds to one or more polynucleotides. The first and second reversible covalent bonds can be reversible bridges that can split under the same or similar conditions or which can split under different conditions, i.e. they may contain orthogonal reversible bridges. The polynucleotide-polymer conjugate is administered to a mammal in a pharmaceutically acceptable carrier or diluent.

A preferred embodiment of the invention are membrane active polymers, which are random polyvinyl ether copolymers. Polyvinyl ether copolymers can be synthesized from two, three or more different monomers. Monomers can be selected from the group consisting of: protected aminovinyl ethers such as phthalimide-containing vinyl ethers, butyl vinyl ether, dodecyl vinyl ether, octadecyl vinyl ether. Preferred random polyvinyl ether copolymers contain three monomers: an amine-containing monomer, vinyl butyl ether, and octadecyl vinyl ether.

In a preferred embodiment, one or more biophysical characteristics of a membrane-active polymer is reversibly protected or modified with a masking agent. Masking agents can be selected from the group comprising sterilizing stabilizers, providing directional transfer of the group, or charge modifying agents. A masking agent can improve biodistribution or targeted transfer of the polymer-polynucleotide conjugate by inhibiting non-specific polymer interactions with serum components or non-target cells. The masking agent may also reduce the aggregation of the polymer or polymer-polynucleotide conjugate. Masking agents containing targeted group transfer can enhance cell-specific targeted transfer or internalization in the cell by targeted transfer of the conjugate system to the cell surface receptor. The masking agent can be conjugated to a membrane-active polymer before or after conjugation of the polymer with a polynucleotide.

In a preferred embodiment, the polynucleotide can be introduced into cells using the described conjugate systems, which can be selected from the group consisting of: DNA, RNA, blocking polynucleotides, antisense oligonucleotides, plasmids, expression vectors, oligonucleotides, siRNA, miRNA, mRNA, shRNA and ribozymes .

In a preferred embodiment, the masking agent (s) and polynucleotide (s) are covalently coupled to a membrane-active polymer via reversible bonds. Although masking the polymer and attaching the polynucleotide to the polymer are important, these attachments may affect the transfection activity of the polymer or the activity of the polynucleotide. By attaching the masking agent and the polynucleotide to the polymer via reversible bonds that cleave at the appropriate point in time, the polymer activity is restored and the polynucleotide is released. Reversible covalent bonds contain reversible or labile bridges, which can be selected from the group including: labile bridges under physiological conditions (physiologically labile bridges), labile bridges under physiological cellular conditions, labile bridges at certain pH values (pH labile bridges), very labile at certain pH values, bridges, extremely labile at certain pH values, bridges, enzyme-cleaved bridges and disulfide bridges. The presence of two reversible bonds connecting the polymer with the polynucleotide and the masking agent allows for the simultaneous administration of the polynucleotide with the introduction of the polymer and selective directional transfer, and the inactivation of the introduction of the polymer with a masking agent. The reversibility of the bonds ensures the release of the polynucleotide from the membrane-active polymer and the selective activation of the membrane-active polymer.

A preferred embodiment of the invention is a composition which comprises: an administration polymer covalently bonded to: a) one or more directed transfer groups, steric stabilizers or charge modifying agents via one or more reversible bonds; and b) one or more polynucleotides via one or more reversible bonds. In one embodiment, the reversible covalent bond of the targeted transfer agent, steric stabilizer or charge modifying agent is orthogonal to the covalent reversible polynucleotide bond.

A preferred embodiment of the invention is a system comprising a polymer conjugate for introducing a polynucleotide into a cell and releasing a polynucleotide in a cell, which comprises: a polynucleotide reversibly conjugated to a membrane-active polymer that is itself reversibly conjugated to a masking agent. The conjugation linkages may be the same or different. In addition, conjugation linkages can be cleaved under the same or different conditions.

A preferred embodiment of the invention is a system comprising a polymer conjugate intended to be administered that is not capable of penetrating the membrane of a molecule into the cell and releasing the molecule in the cell. A system comprising a polymer conjugate contains a membrane-impaired molecule reversibly coupled to a membrane-active polymer, with several masking agents linked via a membrane-active polymer through reversible covalent bonds. Membrane-active polymers may be toxic or may not provide targeted transfer when used in vivo. Reversible addition of a masking agent reversibly inhibits or alters interactions with the membrane, interactions with the serum, interactions with the cell, toxicity or charge of the polymer. A preferred reversible covalent bond is a labile bridge, a physiologically labile bridge, or a bridge that cleaves in the intracellular environment of a mammalian cell. A preferred labile bridge is a labile bridge at certain pH values. The preferred labile bridge at certain pH values is the maleate bridge. Another preferred labile bridge is a disulfide bridge. Molecules that do not have the ability to penetrate through the membrane include (but are not limited to) polynucleotides, proteins, antibodies, and drugs that do not have the ability to penetrate the membrane.

In a preferred embodiment, the polynucleotide is attached to the polymer in the presence of an excess of polymer. Excess polymer may facilitate the preparation of a polynucleotide-polymer conjugate formulation. Excess polymer may reduce aggregation during preparation of the conjugate formulation. The polynucleotide-polymer conjugate can be separated from the excess polymer before the conjugate is introduced into the cell or organism. In another embodiment, the polynucleotide-polymer conjugate may be administered together with an excess of polymer into the cell or organism. The excess polymer taken may be the same or a different polymer.

In a preferred embodiment of the invention, the polymer-containing conjugates of the invention can be used to introduce in vitro a polynucleotide or other molecule that does not penetrate the membrane. For in vitro administration, reversible masking of the polymer increases the transfection activity of some otherwise ineffective polyamines, such as polylysine. Reversible masking can also increase the applicability of other membrane active polymers by reducing their toxicity or limiting their ability to destroy the endosome membrane.

A preferred embodiment of the invention is a system for introducing a polynucleotide into an in vivo cell, the use of which comprises: covalently bonding a targeted transfer of a group to a polynucleotide, covalently bonding a second targeted transfer of a group to a membrane-active polymer and introduced by injections of a polynucleotide and having activity against polymer membranes in the body.

Other objects, features, and advantages of the invention should become apparent after reading the following detailed description of the invention in conjunction with the accompanying drawings.

Brief Description of the Drawings

The drawings show:

figure 1 - reaction scheme for the polymerization of polymers of simple polyvinyl ether;

figure 2 is an illustration of several variants of masking agents proposed in the invention;

figure 3 is an illustration of the formation of reversible polynucleotide-polymer conjugates and reversible masking of the conjugate by maleamates;

4 is a photomicrograph showing a targeted introduction into the liver hepatocytes of a PBAVE polymer masked A) CDM-PEG (left) or B) CDM-PEG plus CDM-Pip-LBA;

5 is a micrograph showing the introduction of a masked conjugate polynucleotide-polymer in hepatocytes in vivo;

6 is a graph illustrating the "shutdown" of the target gene in vivo after mediated by the polyconjugate introduction with activity against the ppara siRNA gene (siRNA ppara);

7 is a micrograph showing the introduction of dsDNA into the liver in vivo using (A) DNA-DW1360-CDM-PEG / NAG, (B) DNA + DW1360-CDM-PEG / NAG (polynucleotide, not conjugated to the polymer), (B) DNA-DW1360-CDM-PEG / glucose; and (D) DNA-DW1360-CBM-PEG / mannose. Data for Cy3-labeled DNA is presented in the upper left square on each panel, for actin stained with the ALEXA ^® -488 phalloidin fluorescent label, in the upper right square, for nuclei in the lower left square and the combined image in the lower right square ;

on Fig - graphs and blots illustrating the "shutdown" of the expression of the target gene in the liver of mice after intravenous administration of siRNA polyconjugates. (A) Decrease in apoB mRNA levels in the liver after treatment with polyconjugates containing siRNA (siRNA apoB) gene with activity against apoB gene. (B) Serum levels of apoB-100 protein in mice treated with siRNA-containing apoB polyconjugates. (B) Decreased levels of ppara mRNA in the liver after intravenous administration of siRNA ppara polyconjugates;

Fig.9 is a graph illustrating the dose dependence of siRNA-containing apoB-1 polyconjugate. (A) “Shutdown” of apoB mRNA after injection of serial dilutions of siRNA-containing apoB-1 polyconjugate. (B) “Shutdown” of apoB mRNA after injection of various amounts of siRNA;

10 is a graph illustrating cholesterol levels in mice treated with siRNA-containing apoB-1 polyconjugate;

11 is a micrograph showing the accumulation of lipids in the liver of mice after administration of a polyconjugate containing (A) siPHK apoB or (B) siPHK GL3, used as a negative control, or (C) physiological saline only;

12 is a graph illustrating the inhibition of gene expression (A) and a decrease in cholesterol (B) as a result 2-15 days after the administration of siRNA-containing apoB-1 conjugate to mice on day 0;

13 is a photomicrograph showing in vivo administration of antibodies to hepatocytes by administration of an antibody reversibly conjugated to DW1360 and masked by CDM-PEG and CDM-NAG. Data for labeled antibodies are presented in the upper left square, actin in the upper right square, nuclei in the lower left square, and the combined image in the lower right square;

on Fig is a graph illustrating the "shutdown" of the gene in primary hepatocytes transfected with siRNA ApoB, which was introduced using a commercially available transfection reagent for in vitro transfusion or using various amounts of a polyconjugate containing siRNA apoB;

on Fig is a graph illustrating the transfection of conjugates containing siRNA, cells of the line Hepa-1c1c7 in vitro: "conjugate only" means masked siRNA-PLL;

on Fig is a graph illustrating the fluorescence of DPH in the presence of PBAVE;

17 is a graph illustrating A) elution profiles of PEG standards on a Shodex SB-803 column; B) a calibration curve for the Shodex SB-803 column; and C) a calibration curve for calculating the molecular weight of the PBAVE polymer;

Fig. 18 is a graph illustrating A) elution profiles of Su3-labeled nucleic acid standards and a masked polynucleotide-polymer conjugate. B) a calibration curve for gel filtration on a Sephacryl S-500 column; and C) a calibration curve for calculating the molecular weight of the masked polynucleotide-polymer conjugate;

on Fig - microphotographs demonstrating the introduction of in vivo polynucleotide in positive for galactose receptor tumors (AB) or negative for galactose receptor tumors (BG) using oligonucleotide-polymer-CDM / PEG / NAG conjugates (A, B ) or conjugates of oligonucleotide-polymer-CDM / PEG / glucose (B, D).

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to compounds, compositions and methods suitable for introducing polynucleotides or other molecules that do not penetrate into the cell into mammalian cells. In the present description, a polyconjugate system for introducing polynucleotides or other molecules lacking the ability to penetrate through the membrane of molecules into cells in vivo is provided. The polyconjugate system includes agents with the ability to provide targeted transfer, the ability to counteract opsonization, aggregation, and transfection activity, concentrated in a small, less than 50 nanometers, carrier intended for administration. A crucial component of the system is the reversibility of the bonds connecting the components of the system.

The first component of the described conjugates intended for the introduction of in vivo polynucleotides is a physiologically reversible covalent bond of the polynucleotide with a membrane-active polymer. The covalent attachment of a polynucleotide to a membrane-active polymer ensures that the polynucleotide will not be easily cleaved by dissociation from the polymer when introduced in vivo or ex vivo in the presence of serum, and as a result allows co-administration of the polynucleotide with the membrane-active polymer into the cell -target. However, covalent attachment of a polynucleotide to a polymer may render the polynucleotide inactive. Thus, the attachment of a polynucleotide to a membrane-active polymer is via a physiologically reversible link or bridge. Through the use of a physiologically reversible bond, the polynucleotide can be cleaved from the polymer, releasing the polynucleotide, which enters into functional interaction with the components of the cell. By selecting the appropriate reversible bond, it is possible to create a conjugate from which the polynucleotide is released only after its introduction into the desired region, such as a cell cytoplasm.

The second component of the described described in vivo conjugates intended for the introduction of polynucleotides contains a reversible modification of the activity with respect to the membrane of the polymer. A reversible modification of a membrane-active polymer reduces unproductive interactions with serum and non-target cells and reduces toxicity. The masking agent may also confer additional desired conjugate function, such as increasing interaction with the target cell or enhancing conjugate endocytosis. The polymer is masked by covalently attaching a masking agent to the polymer via a physiologically reversible covalent bond. The masking agent may be a stabilizer of steric configuration, providing directional transfer group or charge modifying agent. A masking agent can protect the polymer from non-specific interactions, increase the residence time in the bloodstream, increase specific interactions, inhibit toxicity or change the charge of the polymer. Each of these modifications can change the activity of the polymer in relation to the membrane, resulting in the fact that the modified polymer may be unable to facilitate the introduction of the polynucleotide. Therefore, the attachment of the masking agent to the membrane-active polymer is via a physiologically reversible bond. Through the use of a physiologically reversible bond, the masking agent can be cleaved from the polymer, leaving the polymer unmasked, and this leads to the restoration of the activity of the unmasked polymer. As a result of the selection of an appropriate reversible bond, it is possible to create a conjugate, by using which the activity of the polymer having activity against the membranes is restored after it is introduced into or the desired type of cells or cell region is reached.

The invention relates to administration systems based on a conjugate of the general formula:

NL ¹ -P- (L ² -M) _y ,

in which N is a polynucleotide or other molecule lacking the ability to penetrate into the cell, L ¹ is a reversible bond, P is a polymer, L ² is a second reversible bond and M is a masking agent. Masking agent M protects or modifies the properties or interaction of P, y denotes an integer greater than 0. A preferred polymer is a membrane-active polymer. Another preferred polymer is a transfection polymer. One polymer can be associated with several masking agents. Several masking agents can be coupled to the polymer via several reversible bonds. After cleavage of the reversible bond L ^{2, the} masked property or interaction ability of polymer P is restored. Masking agent M may confer an additional function to polymer P, such as binding to a cell receptor. The reversible link L ¹ may be the same or may differ from the reversible link L ² (be orthogonal to it). Reversible linkage of the reversible link L ¹ or L ^{2 is} chosen so that cleavage occurs in the desired physiological environment, such as is present in the desired tissue, organ and subcellular region, or in response to the addition of a pharmaceutically acceptable exogenous agent. Polynucleotide N and masking agent M can be attached to polymer P anywhere on polymer P.

Polymers

A polymer is a molecule consisting of repeating interconnected smaller elements (units), which are called monomers. The polymer may be linear, branched, branched mesh, star, comb or ladder. The main chain of the polymer consists of atoms whose bonds are necessary to increase the length of the polymer. For example, poly-L-lysine, carbonyl carbon, α-carbon and α-amino groups are required to extend the polymer and therefore are atoms in the main chain. The side chain of the polymer consists of atoms whose bonds are not required to increase the length of the polymer.

The polymer may be a homopolymer for which the same monomers are used, or the polymer may be a copolymer for which two or more different types of monomers are used. The copolymers can be alternating, random (random) copolymers, block copolymers and grafted (comb) copolymers.

Alternating polymers contain monomers in a different repeating order, such as - [AB] _n -. The monomers of alternating polymers, as a rule, do not homopolymerize, but are reacted with each other to form an alternating copolymer.

Monomers in random copolymers do not have a specific order or arrangement in any particular chain, i.e. have the following structure: -A _n -B _m -. The general compositions of such polymers reflect the ratio of the (loaded) monomers included in it. However, the exact ratio of one and the other monomer may be different in different chains. The distribution of monomers may also be different in each polymer. In addition, the chemical properties of the monomer can affect the level of its incorporation into the random copolymer and its distribution in the polymer. Thus, although the ratio of monomers in a random copolymer depends on the ratio of loaded monomers, the degree of loading may not correspond exactly to the ratio of included monomers.

The block polymer has a segment or block of one polymer (polyA), followed by a segment or block of a second polymer (polyA): i.e. -polyA-polyB-. As a result, various polymer chains are connected in a head-to-tail configuration. Thus, the block polymer has a linear arrangement of blocks of different composition of monomers. Typically, although not necessarily, the polymer blocks are homopolymers, and polymer A may consist of monomers other than the monomers of which polymer B. The diblock copolymer is polyA-polyB, and the triblock copolymer is polyA-polyB- polyA. If A represents a hydrophilic group and B represents a hydrophobic group, then the resulting block copolymer may be a polymeric surfactant. A grafted polymer is a type of block copolymer in which the chains of one polymer are grafted into the side chains of another monomer, for example, as shown below (where n, m, x, y and z are integers):

Monomers

A wide variety of monomers can be used in polymerization processes. Monomers can be cationic, anionic, zwitterionic, hydrophilic, hydrophobic, lipophilic, amphipathic or amphoteric. Monomers themselves can be polymers. Monomers may contain chemical groups that can be modified before or after polymerization. Such monomers have reactive groups selected from the series consisting of: amine (primary, secondary and tertiary), amide, carboxylic acid, ester, hydrazine, hydrazide, hydroxylamine, haloalkyl, aldehyde and ketone. Preferably, the reactive group can be modified after conjugation of the polynucleotide or in an aqueous solution.

As is known to those skilled in the art of polymerization, there are several categories of polymerization processes. For example, the polymerization may be chain or stepwise.

Step polymerization

In stepwise polymerization, the polymerization is carried out in stages. To extend the polymer, a reaction is used between monomers, oligomers and polymers. In this case, no initiation is required, since the same reaction takes place throughout and does not have a chain termination stage, since the end groups are still reactive. The polymerization rate decreases depending on the absorption of functional groups.

The polymer can be created using stepwise polymerization using monomers that have two reactive groups (A and B) in the same monomer (heterobifunctional), while A contains a reactive group and B contains a reactive group with respect to A (reactive group, which forms a covalent bond with A). Polymerization AB allows you to get - [AB] _n -. Reactive groups A and B can be joined by a covalent bond or by a plurality of covalent bonds to obtain a polymer consisting of monomers. The polymer can also be created by stepwise polymerization using homobifunctional monomers, such as A-A + B-B, getting - [A-A-B-B] _n -. Typically, these reactions may include acylation and alkylation. Two reactive monomer groups can be joined by one covalent bond or by multiple covalent bonds.

If reactive group A is an amine, then B is an amine reactive group that can be selected from the group consisting of: isothiocyanate, isocyanate, acylazide, N-hydroxysuccinimide, sulfonyl chloride, aldehyde (including formaldehyde and glutaraldehyde), ketone, epoxide, carbonate, imido ester, carbodiimide activated carboxylate, alkyl phosphate, haloaryls (difluoridinitrobenzene), anhydride, halide, para-nitrophenyl ester, ortho-nitrophenyl ester, foam tachlorophenyl ether, pentafluorophenyl ether, carbonylimidazole, carbonylpyridinium and carboryldimethylaminopyridinium. In other words, if reactive group A is an amine, then B may be an acylating or alkylating agent or an amination agent.

If reactive group A is sulfhydryl (thiol), then B is a thiol-reactive group that can be selected from the group consisting of: iodoacetyl derivative, maleimide, aziridine derivative, acryloyl derivative, fluorobenzene derivative and disulfide derivative (such as pyridyl disulfide or derivatives of 5-thio-2-nitrobenzoic acid (TNB)).

If reactive group A is a carboxylate, then reactive group B is a carboxylate reactive group that can be selected from the group consisting of diazoacetate and an amine, which is carbodiimide. Other additives such as carbonylimidazole, dimethylaminopyridine (DMAP), N-hydroxysuccinimide or alcohol may be used if carbodiimide and DMAP are used.

If reactive group A is hydroxyl, then reactive group B is a hydroxyl reactive group that can be selected from the group consisting of: epoxide, oxirane, activated carbamate, activated ester, and haloalkyl.

If reactive group A is an aldehyde or ketone, then reactive group B is an aldehyde or ketone reactive group that can be selected from the group consisting of hydrazine, a hydrazide derivative, an amine (to obtain a Schiff base, which may not be reduced, or recover using a reducing agent such as NaCNBH ₃ ) and a hydroxyl-containing compound.

The polymer can be created using stepwise polymerization using bifunctional. We are forced to admit the correctness of the examination, a sign related to food intake characterizes the method of treatment and is not related to the use for the preparation of a medicinal product. It seems to us that it would be possible to substantiate that this symptom is essential for the claimed use only if it is proved that taking the drug with food affects its production. Monomers and other agents, such as, for example, AA plus another agent, to give - [AA] _n -.

If reactive group A is a sulfhydryl (thiol) group, then it can then be converted to disulfide bridges using oxidizing agents such as iodine (I ₂ ), sodium periodate (NaIO ₄ ) or oxygen (O ₂ ). If reactive group A is an amia, then it can be converted to thiol by reaction with 2-iminothiolate (Trout reagent), which is then subjected to oxidation and the formation of disulfide. Disulfide derivatives (such as pyridyl disulfide or TNB derivatives) can also be used to catalyze the formation of a disulfide bridge.

Reactive groups A or B in any of the above examples may also be a photoreactive group, such as an arylazide (including halogenated arylazide), a diazo group, benzophenone, alkine or a diazirin derivative.

Reactions involving an amine, hydroxyl, sulfhydryl or carboxylate provide chemical bonds that are described as amides, amidines, disulfides, ethers, esters, enamipes, imines, ureas, isothioureas, isoureas, sulfonamides, carbamates, alkylamine bonds (secondary amines) and simple carbon-nitrogen bonds in which carbon contains a hydroxyl group, a thioether, a diol, a hydrazone, a diazo group, or a sulfone.

Chain polymerization

In the chain reaction of polymerization, polymer growth occurs as a result of successive addition of monomer units until a certain length of the growing chains is reached. The mechanisms of initiation and growth are different and, as a rule, include the stage of chain termination. Polymerization chain reactions can be radical, anionic or cationic. Monomers for chain polymerization can be selected from such groups as: vinyl, vinyl ether, acrylate, methacrylate, acrylamide and methacrylamide groups. Chain polymerization can also be carried out by cyclic polymerization or ring opening polymerization. Several different types of free radical inhibitors can also be used, including (but not limited to) peroxides, hydroxyperoxides and azo compounds such as dihydrochloride 2,2′-azobis (amidinopropane) (AAP).

Transfection Efficiency

The concept of transfection refers to the transfer of a polynucleotide or other biologically active compound from the outside of the cell into the cell, so that the polynucleotide or biologically active compound is functional. Examples of transfection reagents for introducing polynucleotides into t vitro cells include, but are not limited to: liposomes, lipids, polyamines, calcium phosphate precipitates, histone proteins, polyethyleneimine and polyampholytic complexes, and combinations thereof. Many of the reagents intended for in vitro transfection are cationic, which allows the reagent to associate or complex with negatively charged nucleic acids through electrostatic interaction.

Membrane-active polymers

Membrane-active polymers are amphipathic polymers that can induce one or more of the following effects on a biological membrane: modify or destroy the membrane, which allows molecules that cannot penetrate through the membrane to enter the cell or cross the membrane, pore formation in the membrane, cleavage membranes or destruction or dissolution of the membrane. In the context of the present description, the membrane or cell membrane contains a lipid bilayer. Membrane-active polymers of the invention include those that facilitate the administration of a polynucleotide or other molecule that does not penetrate the membrane from the outside of the cell into the cell, and preferably into the cell cytoplasm. Functional activity with respect to a change or destruction of a polymer membrane or compound can be determined by their role in at least one of the following processes: blood cell lysis (hemolysis), fusion, leakage of contents from liposomes, fusion with liposomes, cell fusion, cell lysis and release endosomes. Membrane-active polymers that can cause lysis of cell membranes are called membranolytic polymers. Membrane-active polymers that can destroy endosomes or lysosomes are endosomolytic polymers. The effects of membrane active polymers on the cell membrane can be short-lived. The activity of the polymer with respect to the membrane is determined on the basis of its affinity for the membrane, which causes denaturation or deformation of the bilayer structure. Membrane-active polymers may be synthetic or non-naturally occurring amphipathic polymers. Membrane-active polymers may have in vitro transfection activity. Membrane-active polymers can be cationic, anionic, amphipathic, amphoteric, surfactant, or combinations thereof.

The introduction of a polynucleotide or other membrane-free molecule into the cell is mediated by the destruction of the plasma membrane or the membrane of the internal vesicles (such as the endosome or lysosome) induced by the membrane-active polymer, including the formation of pores in the membrane or dysfunction of the endosomes or lysosomes.

In the context of the present description, membrane-active polymers differ from the class of polymers designated as cell-penetrating peptides or polymers, which are compounds such as the arginine-rich peptide derived from the HIV TAT protein, the antennapedia peptide (causing the development of legs instead of the head in Drosophila), VP22 peptide, transpan, arginine-rich artificial peptides, small guanidium-rich artificial polymers, or the like. Although cell-penetrating compounds are likely to transport certain molecules across the membrane from one side of the lipid bilayer to the other side of the lipid bilayer, probably without the need for endocytosis and without destroying the integrity of the membrane, their mechanism of action is not yet known and discussion is underway about their activity.

Endosomolytic Polymers

Endosomolytic polymers are polymers that, in response to a change in pH, can cause destruction or lysis of the endosomes or serve to exit a normally inactive membrane-penetrating compound, such as a polynucleotide or protein, from a vesicle enclosed in an internal cell membrane, such as an endosome or lysosome. Release from the endosome is important for introducing a wide variety of molecules that penetrate through endocytosis but do not have the ability to diffuse across cell membranes. In endosomolytic polymers, a shift in their physicochemical properties occurs at physiologically acceptable pH values (usually pH 5.5-8). This shift can lead to a change in the solubility of the polymer, its ability to interact with other compounds, and a change in hydrophobicity or hydrophilicity. Representative endosomolytic polymers can carry pH titratable groups or pH labile groups or bonds. In the context of the present description, under pH-titratable groups are meant groups which are reversible acceptors or proton donors in water depending on the pH value under physiological conditions, i.e. at pH values from 4 to 8. pH-titratable groups are characterized by pK _a values ranging from 4 to 8, and they act as buffers at the indicated pH values. Thus, pH-titratable groups acquire or lose charge at lower pH values of the environment surrounding the endosome. Groups titrated at physiological pH values can be determined experimentally by performing acid-base titration and experimentally determining whether a group has a buffering effect at pH values of 4 to 8. Examples of groups that may have buffering properties at such pH values are, but , but not limited to: carboxylic acids, imidazole, N-substituted imidazole, pyridine, phenols and polyamines. Polymers bearing pH-titratable groups can destroy internal bubbles using the so-called “proton sponge” effect. Thus, a reversibly masked membrane-active polymer, where masking agents are attached to the polymer via pH-labile bonds, can be considered an endosomolytic polymer.

A subgroup of endosomolytic compounds are fusogenic compounds, including fusogenic peptides. Fusogenic peptides can facilitate the release of agents from the endosome, such as oligomeric compounds, into the cytoplasm. Probably, fusogenic peptides change conformation at acidic pH values, effectively destabilizing the endosomal membrane, thereby increasing the content of endosomes in the cytoplasm. Examples of fusogenic peptides are peptides derived from polymyxin B, influenza virus HA2, GALA, KALA, EALA, melittin and peptides derived from melittin, β-amyloid peptide associated with Alzheimer's disease, etc.

Polyampholytes

Polyampholytic is a polymer containing both anionic and cationic monomer units. More specifically, in the context of the present description, the polyampholyte contains many anionic monomers and many cationic monomers. The polyampholytic polymer may optionally contain non-ionic monomer units. In aqueous solutions, the deposition of polyampholytes occurs near their isoelectric point. Polyampholyte can be obtained by polymerization of anionic and cationic monomers, including polymer monomers. In another embodiment, the polyampholyte can be obtained by modifying more than one, but not all charged polymer groups. If the charged groups are reversibly modified, a reversible polyampholyte is obtained.

Amphipathic Polymers

Amphipathic or amphiphilic polymers are well known and recognized in the art, they have both hydrophilic (polar, water-soluble) and hydrophobic (non-polar, lipophilic, water-insoluble) groups or fragments. Hydrophilic groups in qualitative terms are chemical fragments that “give preference” to water. Typically, these chemical groups are water soluble and are donors or acceptors of hydrogen bonds in water. The hydrophilic group may be charged or uncharged. Charged groups can be positively charged (anionic) or negatively charged (cationic) or carry both charges. The amphipathic compound may be a polyanion, a polycation, a zwitterion or a polyampholyte. Examples of hydrophilic groups are compounds bearing the following chemical moieties: carbohydrates, polyoxyethylene, certain peptides, oligonucleotides and groups containing amines, amides, alkoxyamides, carboxylic acids, sulfur atoms or hydroxyl radicals. Hydrophobic groups in qualitative terms are chemical fragments that “avoid” water. As a rule, such chemical groups are not water soluble and do not tend to form hydrogen bonds. Lipophilic groups are soluble in fats, oils, lipids and non-polar solvents and have a low ability or not at all capable of forming hydrogen bonds. Hydrocarbons (containing 2 or more carbon atoms), certain substituted hydrocarbons, cholesterol, cholesterol derivatives and some peptides are examples of hydrophobic groups. In the context of the present description, amphipathic polymers include, in particular, a molecule obtained by cleaving a covalent bond and replacing it with hydrogen. For example, in butylamine, the cleavage of bonds between carbon and nitrogen replaced by hydrogen atoms results in ammonia (a hydrophilic compound) and butane (a hydrophobic compound). However, if 1,4-diaminobutane is cleaved at nitrogen-carbon bonds and replaced with hydrogen atoms, then the molecules formed in this case are ammonia (2 ×) and butane. However, 1,4, -diaminobutane is not considered an amphipathic compound, since splitting of two bonds is required for the formation of a hydrophobic fragment.

A naturally occurring polymer is a polymer that can be found in nature. Their examples are polynucleotides, proteins, collagen and polysaccharides (starches, cellulose, glycosamine glycans, chitin, agar, agarose). The naturally occurring polymer may be isolated from a biological source, or it may be synthetic. A synthetic polymer can be made or obtained by a chemical process carried out by man, and not created using naturally occurring biological processes. A non-naturally occurring polymer is a synthetic polymer that is not made from naturally occurring materials (animal or plant origin) or monomers (such as amino acids, nucleotides and saccharides). The polymer may be fully or partially natural, synthetic or non-natural.

The polymer may have one or more labile or cleavable bonds. If the labile bonds are cleavable in physiological conditions or in physiological cellular media, then the polymer is biodegradable. The cleavable bond can be either in the main chain or in the side chain. If the cleavable bond is in the main chain, then cleavage of the bond leads to a decrease in the length of the polymer and the formation of two or more molecules. For example, smaller polyvinyl ether polymers can be combined via labile bonds to form larger polyvinyl ether polymers. If the cleavable bond is in the side chain, then cleavage of the bond leads to the loss of atoms of the side chain of the polymer.

The present description provides a class of amphipathic polyvinyl random copolymers. Polyvinyl copolymers can be synthesized from two, three or more different monomers.

Preferred monomers can be selected from the range including: a charged vinyl ether, a vinyl ether containing a protected ionic group, a vinyl ether with a protected phthalimide amine, an acyl vinyl ether, an alkyl vinyl ether, a simple (lower) alkyl vinyl ether, a simple (higher) vinyl vinyl ether .) alkyl vinyl ether, butyl vinyl ether, dodecyl vinyl ether, octadecyl vinyl ether, cholesterol vinyl ether and other hydrocarbon-containing hydrophobic vinyl ethers.

The class of polymers of interest is: amine-containing random polyvinyl ether copolymers obtained by polymerization with three monomers: phthalimide monomers, small hydrophobic monomers and large hydrophobic monomers. Deprotection of the phthalimide monomer allows the production of an amine monomer. Small hydrophobic monomers contain carbon-hydrogen chains with 2-6 carbon atoms. Large hydrophobic monomers contain carbon-hydrogen chains comprising from about 10 to about 22 carbon atoms or from about 12 to about 18 carbon atoms. Medium-sized hydrophobic monomers contain carbon-hydrogen chains containing from about 6 to about 10 carbon atoms. Preferred aminopolyvinyl ether polymers are: amino / butyl / octadecyl polyvinyl ether polymer or amino / butyl / dodecyl polyvinyl ether polymer.

The biophysical properties of random copolymers of poly (vinyl) ether are determined by the particular monomers selected, the ratio in which they are included in the polymer, and the size of the polymer. Various polymers can be obtained by varying the degree of loading of the monomers in the polymerization reaction. Although the ratio of monomers incorporated into the polymer may be the same as the monomer loading ratio, the ratios may vary. Regardless of whether the inclusion of monomers corresponds to the degree of loading or corresponds to a different ratio, the degree of loading of monomers can be changed to achieve the desired ratio of inclusion of monomers. A preferred aminopolyvinyl ether is a water-soluble membrane active amine / butyl / octadecyl or amine / butyl / dodecyl statistical tripolymer. Polymers with a similar content of similar amine and hydrophobic polymers from polyamines, such as polyethyleneimine, polylysine, polyvinylamine and polyallylamine, or other polymers such as polyvinyl alcohol, can be synthesized by modifying the side chains of these polymers.

Preferred membrane active polymers of the invention have a solubility in water of 1 mg / ml or more. Preferred membrane active polymers of the invention are surfactants. The membrane active polymers of the invention preferably have a molecular weight of from about 5 to about 100 kDa, more preferably from about 7 to about 50 kDa, and most preferably from about 10 to about 30 kDa.

Masking agent

Polymers that can allow polynucleotide to be introduced outside the cell into the cytoplasm often have toxicity or poor in vivo biodistribution. As a result, it is necessary to mask the properties of the polymer, which is characterized by toxicity or poor biodistribution. Since, by modifying the polymer in order to mask these properties, it is also possible to inactivate transfection activity or activity with respect to the polymer membranes, masking agents are connected to the polymer via physiologically reversible bonds. Cleavage of the bond restores the protected or masked property of the polymer.

In the context of the present description, it is understood that the masking agent is a molecule that, when bound to a polymer, protects, inhibits or inactivates one or more of the properties (biophysical or biochemical characteristics) of the polymer. The masking agent may also impart additional activity or function to the polymer, which is absent in the polymer without a masking agent. Properties of polymers that can be masked include membrane activity, endosomolytic activity, charge, effective charge, transfection activity, serum interactions, cell interactions, and toxicity. Masking agents can also inhibit or prevent aggregation of the polynucleotide-polymer conjugate under physiological conditions. The masking agents of the invention can be selected from the group consisting of: steric stabilizers, directed transfer groups, and charge modifiers. Multiple masking agents can be reversibly bound to a single polymer. To inactivate a particular property of the polymer, it may be necessary to bind more than one masking agent to the polymer. To achieve the desired level of inactivation, a sufficient amount of masking agents is bound to the polymer. The required level of polymer modification achieved by attaching the masking agent (s) is readily determined using appropriate polymer activity assays. For example, if the polymer has membrane activity in this assay, a sufficient amount of masking agent is coupled to the polymer to achieve the desired level of inhibition of membrane activity in this assay. To inhibit polymer aggregation under physiological conditions, a sufficient amount of a masking agent can be reversibly bound to the polymer. More than one type of masking agent may be used. For example, both stabilizers of a steric configuration and those providing directional transfer of a group can be coupled to the polymer. Steric stabilizers and groups that provide directional transfer can also function as charge modifiers, but they may not have such a function. The masking agents of the invention are reversibly bound to the polymer. In the context of the present description, it is understood that the masking agent is reversibly bound to the polymer if reversal of the bond restores the masked activity of the polymer. Masking agents bind to the polymer by forming reversible covalent bonds with the reactive groups of the polymer. Reactive groups can be selected from a series including: amines, alcohols, thiols, hydrazides, aldehydes, carboxyls, etc. From one to all reactive groups or charged groups in the polymer can be reversibly modified. In one embodiment, the at least two masking agents are reversibly bound to the polymer. In another embodiment, masking agents reversibly bind to about 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the polymer reactive groups. In another embodiment, masking agents reversibly bind to about 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the charged polymer groups. In a further embodiment, the amount (in percent) of masking agents reversibly linking the polymer to charged polymer groups is about 20%, 30%, 40%, 50%, 60%, 70%, or 80%.

In the context of the present description, it is understood that the polymer is masked if one or more of the properties of the polymer is inhibited or inactivated by the addition of one or more masking agents. The polymer is reversibly masked if the cleavage of bonds connecting the masking agents to the polymer restores the masked properties of the polymer.

Preferred masking agents of the invention have the ability to modify the polymer (to form a reversible bond with the polymer) in an aqueous solution. A specific example of a compound that can be used is a maleic anhydride derivative in which R ¹ is methyl (—CH ₃ ) and R ² is a propionic acid group (- (CH ₂ ) ₂ CO ₂ H) or acid esters / amides.

In the context of the present description, it is understood that the stabilizer of the steric configuration is a natural, synthetic or non-naturally occurring non-ionic hydrophilic polymer that interferes with the intramolecular or intermolecular interactions of the polymer to which it is attached, relative to a polymer that does not contain a steric configuration stabilizer. The sterilizing stabilizer prevents the participation of the polymer in electrostatic interactions. Electrostatic interactions are a non-covalent association of two or more substances due to the attractive forces between positive and negative charges. Steric stabilizers can inhibit the interaction with blood components and, as a result, opsonization, phagocytosis and absorption by the endoplasmic reticulum system. Thus, steric stabilizers can increase the residence time of the molecules to which they are attached. Steric stabilizers can also inhibit polymer aggregation. Preferred sterilizing stabilizers are polyethylene glycol (PEG) and PEG derivatives. In the context of the present description, it is understood that a preferred PEG may contain about 1-500 ethylene glycol monomers, 2-20 ethylene glycol monomers, 5-15 ethylene glycol monomers, or about 10 ethylene glycol monomers. In the context of the present description, it is understood that the preferred PEG may also have an average molecular weight of about 85-20000 Daltons (Yes), about 200-1000 Yes, about 200-750 Da, or about 550 Da. Other suitable steric stabilizers can be selected from the group consisting of polysaccharides, dextran, cyclodextrin, poly (vinyl alcohol), polyvinylpyrrolidone, 2-hydroxypropylmethacrylate (HPMA) and water soluble cellulose ethers.

Directed transfer groups or ligands are used for targeted transfer or insertion of a polymer into a target cell or tissue or into specific types of cells. Directed transfer groups increase the association of molecules with the target cell. Thus, directed transfer groups can improve the pharmacokinetic properties or biodistribution of the conjugate to which they are attached, improving cell distribution and cell uptake of the conjugate. One or more directional transfer groups can be linked to a membrane-active polymer either directly or through communication with a spacer. Binding of a targeted transfer group, such as a ligand, to a cell or cellular receptor can initiate endocytosis. The groups providing directional transfer can be monovalent, divalent, trivalent, tetravalent or have a higher valency. The groups providing targeted transfer can be selected from the range including: compounds having affinity for a cell surface molecule, cell receptor ligands and antibodies, antibody fragments and antibody mimetics having affinity for cell surface molecules. A preferred directional transfer group comprises a cell receptor ligand. A variety of ligands are used for targeted transfer of drugs and genes to cells and to specific cellular receptors. Cell receptor ligands can be selected from the group including: carbohydrates, glycans, saccharides, including, but not limited to: galactose, galactose derivatives, mannose and mannose derivatives), vitamins, folate, biotin, aptamers and peptides (including, but not limited to only them: RGD-containing peptides, insulin, EGF and transferrin). Examples of targeted transfer groups are groups targeted by the azialoglycoprotein (ASGP) receptor due to the presence of azialoglycoproteins or galactose residues. For example, liver cells contain ASGP receptors. Thus, groups containing galactose providing targeted transfer can be used for targeted transfer to hepatocytes. Groups containing galactose providing targeted transfer include, but are not limited to: galactose, N-acetylgalactosamine, oligosaccharides and saccharide clusters (such as: Tyr-Clu-Clu- (aminohexyl-CalNAc) ₃ , galactose clusters based on lysine, and galactose clusters, the basis of which is the cholan). Other suitable conjugates may include oligosaccharides that can bind to carbohydrate recognition domains (CRD), which are found in the azialoglycroprotein receptor (ASGP-R). Examples of fragments of conjugates containing oligosaccharides and / or carbohydrate complexes are presented in US 6525031.

In the context of the present description, it is understood that the charge modifier is a group that changes the ionic group of the polymer. The charge modifier can neutralize a charged polymer group or change the charge of a polymer ion from positive to negative or from negative to positive. Modification of the charge of the polyion leads to the formation of a polyion of opposite charge or leads to the formation of polyampholyte. Charge modification can also be used to produce a polymer with the desired net charge or zeta potential. Conjugates with a substantially neutral net charge or zeta potential are preferred for in vivo administration of polynucleotides. A preferred charge modifier reversibly modifies a charged or ionic group. Reversible charge modifiers can be selected from the group consisting of: carboxy dimethyl maleic anhydride (CDM), dimethyl maleic anhydride (DM), CDM thioester, CDM masking agent, sterile configuration CDM stabilizer, CDM ligand, CDM PEG and CDM galactose.

The zeta potential is a physical property that any particle in suspension has, and this indicator is close to the surface charge. In aqueous media, the pH of the sample is one of the most important factors affecting the zeta potential. When a charge is based on protonation / deprotonation of bases / acids, the charge depends on the pH value. Thus, the value of the zeta potential should reflect the conditions of the solution, first of all, the main role is played by the pH value. For ordinary particles, the zeta potential indicates the possible stability of the colloidal system. If all particles in suspension have a large negative or positive zeta potential, then they should tend to repel each other, and as a result, the particles do not tend to combine. However, if the particles have a low zeta potential, then there is no force to prevent their association and flocculation. The main dividing line between stable and unstable suspensions for ordinary particles passes at the level of either +30 or -30 mV. Particles having a positive zeta potential greater than +30 mV, or a negative potential lower than -30 mV, are generally considered stable. When creating the invention, it was found that polynucleotide-polymer conjugates masked with CDM can form small particles <20 nm or <10 im in size (as determined by dynamic light scattering, analytical ultracentrifugation, or atomic force microscopy), which are stable despite pa that have a zeta potential between +30 and -30 mV in physiological saline and a pH of 9.

The net charge or zeta potential of the polynucleotide-polymer conjugates of the invention can be controlled by the addition of masking agents or charge modifiers. A polymer charge, especially a positive charge, can lead to undesirable interactions with serum components or non-target cells. By protecting the charge with stabilizers of a steric configuration or by modifying the charge, conjugates can easily be obtained whose visible surface charge is close to neutral. By modifying the charged polymer groups, it is possible to create particles that are stable in serum, whose zeta potential, measured at pH 9, is in the range from +30 to -30 mV, between +20 and -20 mV, between +10 and -10 mV or between +5 and -5 mV. At pH 7, it is likely that the net charge of the conjugate should have a greater positive value than at pH 9. Net charge or surface charge is an important factor in the introduction of polynucleotide complexes in vivo.

Labile (unstable) connection

A bond or linker is a connecting element between two atoms that bonds one chemical group of interest or segment to another chemical group or segment of interest via one or more covalent bridges. For example, a bond may combine a polynucleotide or masking agent with a polymer. In the formation of a bond, two separate molecules can combine to form one molecule, or it can connect two atoms of the same molecule. The bond may be neutral or may carry a positive or negative charge. A reversible or labile link contains a reversible or labile link. The bond may optionally include a spacer that increases the distance between the two atoms to be joined. The spacer may provide additional flexibility and / or increase the length of the connection. Spacers may include, but are not limited to: alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, aralkynyl groups, each of which may contain one or more heteroatoms, and heterocycles. Spacer groups are well known in the art and the above series should not be construed as limiting the scope of the invention.

) касательно расщепления связи или времени, которое необходимо для расщепления половины связей. Ортогональные связи представляют собой связи, которые расщепляются в условиях, при которых происходит расщепление одной из них, но не другой. Две связи считаются ортогональными, если времена их полужизни касательно расщепления в конкретной среде отличаются друг от друга в 10 или более раз. Таким образом, к обратимым или лабильным связям относятся связи, которые можно избирательно расщеплять быстрее, чем другие связи в молекуле.A reversible or labile bond (bridge) is a covalent bond other than a covalent bond with a hydrogen atom that can be selectively broken or cleaved under conditions in which other covalent bonds in the same molecule are not broken or cleaved. More specifically, a reversible or labile bond is a covalent bond that is less stable (thermodynamically) or cleaves faster (kinetically) under appropriate conditions than other unstable covalent bonds in the same molecule. The cleavage of a labile bond in a molecule can lead to the formation of two or more molecules. Specialists in this field, the ability to split or lability of communication, as a rule, express in terms of half-life (

) regarding bond cleavage or the time it takes to split half of the bonds. Orthogonal bonds are bonds that break down under conditions in which one of them splits, but not the other. Two bonds are considered orthogonal if their half-lives with respect to cleavage in a particular medium differ from each other by 10 or more times. Thus, reversible or labile bonds include bonds that can be selectively cleaved faster than other bonds in the molecule.

Groups representing electron donors and acceptors can be present in the molecule directly near the cleavable bond; as a result, the electronic effects of donor groups and electron acceptor groups affect the rate of bond cleavage. Electron acceptor groups (EWGs) are atoms or parts of molecules that attract (accept) the electron density of another atom, bond, or part of a molecule, and the electron density of the bond of interest (donor) decreases. Electron donor groups (EDGs) are atoms or parts of molecules that donate electrons to another atom, bond or part of a molecule, and the electron density of the bond of interest (acceptor) increases. Groups representing electron acceptors / donors must be in sufficient proximity, typically within about 3 bonds, from the bond to be cleaved in order to exert an effect.

Another strategy for increasing the rate of bond cleavage involves the inclusion of functional groups in the same molecule in which a labile bond is present. The proximity of the functional groups to each other in the molecule should be such that the intramolecular reaction prevails over the intermolecular reaction. The proximity of functional groups to each other can lead to higher concentrations of functional groups. In general, intramolecular reactions are significantly faster than intermolecular reactions. Reactive groups separated by 5 and 6 atoms can form extremely labile bonds due to the formation of 5- and 6-membered ring transition states. Examples are molecules including derivatives of carboxylic acids (acids, esters, amides) and alcohols, thiols, carboxylic acids or amines in the same molecule, which interact with the formation of esters, carboxylic and carbonate esters, phosphate esters, thiol ethers, acid anhydrides or amides. Steric interactions can also change the rate of bond cleavage.

The corresponding conditions are determined by the type of labile bond, and they are well known in organic chemistry. A labile bond may be sensitive to pH, oxidizing or reducing conditions or agents, temperature, salt concentration, the presence of an enzyme, or the presence of an additional agent. For example, certain peptide, ester or saccharide linkers can be cleaved in the presence of an appropriate enzyme. In another example, higher or lower pH values may be appropriate conditions for a pH labile bond. In yet another example, oxidative conditions may be appropriate conditions for labile under oxidative conditions. And in yet another example, the reducing conditions may be appropriate conditions for labile under reducing conditions of communication. For example, a disulfide bridge of two alkylthiols can be cleaved by reduction in the presence of thiols without cleaving carbon-carbon bonds. In this example, carbon-carbon bonds are not labile under reducing conditions.

The rate of transformation of the labile group can be controlled by changing the chemical components of the molecule containing the labile group. For example, the addition of specific chemical fragments (e.g., acceptors or electron donors) in the vicinity of the labile group can affect specific conditions (e.g., pH) in which chemical transformation can take place.

Molecules may contain one or more reversible or labile bonds. If there is more than one reversible or labile bond in the molecule, and all reversible or labile bonds are of the same type (split at approximately the same speed under the same conditions), then the molecule contains many reversible or labile bonds. If more than one reversible or labile bond is present in the molecule and reversible or labile bonds are of different types (based on either the corresponding conditions required for lability or the chemical functional group of labile bonds), then the molecule contains orthogonal reversible or labile bonds. Orthogonal reversible or labile bonds provide the ability to cleave a reversible or labile bond of one type, leaving a reversible bond of the second type without cleavage or destruction. In other words, two labile bonds are orthogonal to each other, if one can split under conditions in which the other bond remains intact. Orthogonal protecting groups are well known in the field of organic chemistry and contain orthogonal bonds.

In the context of the present description, it is understood that a physiologically labile bond is a labile bond that can be cleaved under conditions that typically occur or are similar to those found in a mammalian organism. Physiologically labile linkage groups are selected from bonds that undergo chemical transformation (e.g., cleavage) when they are in physiological conditions.

In the context of the present description, it is understood that the physiologically labile cell bond is a bond that can cleave in the intracellular environment of mammals. Intracellular environments of mammals include chemical conditions such as pH, temperature, oxidizing or reducing conditions or agents, and salt concentration found or similar to those found in mammalian cells. Intracellular environments of mammals also include the presence of enzymatic activity, which is normally characteristic of a mammalian cell, for example, associated with proteolytic or hydrolytic enzymes. A physiologically labile cell bond can also cleave in response to the administration of a pharmaceutically acceptable exogenous agent. Physiologically labile bonds, the cleavage of which is characterized by a half-life of less than 45 minutes, are considered very labile. Physiologically labile bonds, the cleavage of which is characterized by a half-life of less than 15 minutes, are considered extremely labile

Chemical transformation (cleavage of the labile bond) can be initiated by adding a pharmaceutically acceptable agent to the cell, or it can occur spontaneously when the molecule containing the labile bond reaches the corresponding intra- and / or extracellular environment. For example, a pH labile bond can cleave when a molecule enters the acidic environment of endosomes. Thus, a pH-labile bond can be considered as a bond cleaved in the endosome. Enzymatically cleaved bonds can cleave upon contact with enzymes that are present in the endosome or lysosome, or in the cytoplasm. The disulfide bridge can cleave when the molecule penetrates the cell cytoplasm, which has a higher reducing ability. Thus, disulfide can be regarded as a cleavable bond in the cytoplasm.

“Labile bond at certain pH values” (“pH labile bond”): As used herein, it is intended that pH labile bonds are labile bonds that selectively break down under acidic conditions (pH <7). Such bonds can also be referred to as labile under endosome conditions, since the pH value in endosomes and lysosomes is less than 7. The term “pH-labile bonds” includes pH-labile bonds (labile at certain pH values of the bond), very labile at certain pH values bonds and are extremely labile at certain pH values of the bond. PH labile bonds can be selected from the group including:

a) ketals, labile in acidic environments (pH less than 7, above 4), forming a diol and ketone,

b) acetals, labile in acidic environments (pH less than 7, above 4), forming diol and aldehyde,

c) imines or iminiums labile in acidic environments (pH less than 7, above 4), forming an amine and an aldehyde or ketone,

d) silicon-oxygen-carbon bonds, labile in acidic media,

e) silicon-nitrogen bonds (silazanes), and

f) silicon-carbon bonds (arylsilanes, vinylsilanes and allylsilanes),

g) maleamate amide bonds that are synthesized from derivatives of maleic anhydride and amines,

h) ortho-esters,

i) hydrazones,

j) activated derivatives of carboxylic acids (esters, amides) designed so that they undergo acid catalyzed hydrolysis,

k) simple vinyl ethers.

Organosilanes have been used for a long time as oxygen protective groups in organic synthesis due to the fact that they are easy to obtain (a silicon-oxygen-carbon bond) and it is easy to remove the protective group under acidic conditions. For example, both silyl ethers and silylenol ethers carry the indicated bond. Silicon-oxygen-carbon bonds are sensitive to hydrolysis under acidic conditions with the formation of silanyls and alcohol (or enol). Replacing both a silicon atom and carbon alcohol can affect the rate of hydrolysis due to steric and electronic effects. This makes it possible to change the rate of hydrolysis of the silicon-oxygen-carbon bond by making a substitution either in organosilane or alcohol, or in organosilane and alcohol, facilitating the desired effect. In addition, charged or reactive groups, such as amines or carboxylate, can be bonded to a silicon atom, which gives the labile compound a charge and / or reactivity.

Hydrolysis of silazane leads to the formation of silanol and amine. Silazans are more sensitive to hydrolysis than silicon-oxygen-carbon bonds, but the rate of hydrolysis increases under acidic conditions. Replacing both the silicon atom and the amine can affect the rate of hydrolysis due to steric and electronic effects. This makes it possible to change the rate of hydrolysis of silazane by replacing either silicon or amine in order to facilitate the desired action.

Another example of a pH-labile bond is the use of an enol ether type labile bond under acidic conditions. The rate of cleavage of this labile bond depends on the structures of the resulting carbonyl derivative and the liberated alcohol. For example, analogs of ethyl isopropenyl ether that can be synthesized from β-halide ethers have a half-life of about 2 minutes at pH 5. Analogs of ethylcyclohexenyl ether that can be synthesized from phenol ethers have a half-life of about 14 minutes at pH 5.

By reacting the anhydride with an amine, an amide and an acid can be obtained. As a rule, the reverse reaction (formation of anhydride and amine) is very slow and energetically impractical. However, if the anhydride is cyclic anhydride, then a reaction with an amine allows one to obtain a molecule in which the amide and acid are in the same molecule, i.e. amide acid. The presence of both reactive groups (amide and carbolic acid) in the same molecule facilitates the reverse reaction. In particular, the product of the interaction of primary amines with maleic anhydride and maleic anhydride derivatives, maleamic acids, is converted back to the amine and anhydride from 1 × 10 ⁹ to 1 × 10 ¹³ times faster than their non-cyclic analogues (Kirby, 1980).

The interaction of amine with anhydride with the formation of amide and acid

The interaction of the amine with cyclic anhydride to form an acid amide.

The cleavage of the acid amide with the formation of amine and anhydride depends on the pH value and accelerates sharply at acidic pH. This pH-dependent reactivity can be used to form reversible pH-sensitive bonds and linkers. Cis-aconitic acid was used as such a pH-sensitive linker molecule. First, γ-carboxylate was crosslinked with the molecule. In the second step, either the α- or β-carboxylate was crosslinked with the second molecule to give a pH-sensitive combination of the two molecules. The half-life regarding the cleavage of this linker at pH 5 ranged from 8 to 24 hours.

Structures of cis-aconitic anhydride and maleic anhydride

The pH at which cleavage takes place is controlled by adding chemical components to the labile moiety. The rate of conversion of maleamic acids to amines and maleic anhydrides largely depends on the substitution (R ² and R ³ ) of the maleic anhydride system. When R ² is methyl, the conversion rate is 50 times higher than when R ² and R ³ are hydrogen. When alkyl substituents are present in both R ² and R ³ (for example, 2,3-dimethyl maleic anhydride), the rate increases very sharply, the reaction proceeds 10,000 faster than the reaction in which unsubstituted maleic anhydride is involved. The maleamate bond resulting from the modification of the amine with 2,3-dimethylmaleic anhydride is cleaved with the reduction of the anhydride and amine, whose half-lives are from 4 to 10 minutes at pH 5. This suggests that if R ² and R ³ are more than larger than hydrogen, then the rate of conversion of the acid amide to amine and anhydride should be faster than when R ² and / or R ³ are hydrogen.

Very labile at certain pH values: The half-life is very labile at certain pH values at pH 5 is less than 45 minutes. The creation of a very labile at certain pH values of bonds is known in the field of chemistry.

Extremely labile at certain pH linkages: The half-life is extremely labile at certain pH linkages at pH 5 is less than 15 minutes. The creation of extremely labile bonds at certain pH values is known in the field of chemistry.

The connection of the polynucleotide with the polymer

Most of the previously developed methods for introducing a polynucleotide into cells are based on the formation of a complex of anionic nucleic acid with a cationic agent intended for introduction, such as a cationic polymer or cationic lipid. Electrostatic complexes with larger polynucleotides, for example plasmids, tend to aggregate and increase in size (> 500 nm) in physiological solutions. Smaller polynucleotides, oligonucleotides, due to their small size form unstable electrostatic complexes with possible agents intended for administration. A more effective method for packaging polynucleotides is the covalent binding of a polynucleotide to an administration vehicle. However, attachment to the polymer can inhibit polynucleotide activity in the cell. When creating the invention, it was found that by attaching the polynucleotide to the polymer through a reversible linker, which cleaves after the introduction of the polynucleotide into the cell, a functionally active polynucleotide can be introduced into the cell in vivo. The reversible linker is chosen so that it undergoes chemical transformation (for example, cleavage) when it is in certain physiological conditions (for example, in the reducing medium of the cell cytoplasm). The attachment of a polynucleotide to a polymer intended for administration or having activity against membranes increases the efficiency of introducing the polynucleotide into the cell in vivo. The release of the polynucleotide from the polymer by cleavage of the reversible bond facilitates the interaction of the polynucleotide with the corresponding cellular components with the manifestation of activity.

In addition to polynucleotides, it is possible to introduce in vivo cells using the described polyconjugates as carriers also other molecules that cannot penetrate the membrane or molecules with a low ability to penetrate the membranes. Molecules suitable for reversible addition to a membrane-active polymer include: proteins, antibodies, antibody fragments, transcription factors, low molecular weight drugs, anti-cancer drugs, and other synthetic molecules, including molecules that affect transcription.

Addition of a membrane-incompetent molecule to a membrane-active polymer allows a carrier having a suitable size for in vivo administration. The described molecular conjugates are mainly composed of a polymer and are sized and provide directional transfer properties, the same as those known for other polymers. For vascular administration (systemic administration), the carrier must be able to cross the endothelial barrier to achieve parenchymal cells of interest. The largest endothelial “windows” (openings in the endothelial barrier) are in the liver and have an average diameter of about 100 nm. Transepithelial pores in other organs are significantly smaller. For example, it is known that muscle epithelium has a structure in which a large number of small pores with a radius of 4 nm and a smaller number of larger pores with a radius of 20-30 nm are present. The size of the carrier for introducing the polynucleotide is also important for the process of penetration into the cell. It is believed that cellular internalization through endocytosis is limited to complexes with a diameter of not more than about 100 nm, i.e. the size of endocytotic vesicles. The conjugates of the invention have a size of less than 100 nm, more preferably less than 50 nm, and most preferably less than 20 nM or less than 10 nm.

Renal ultrafiltration is one of the main ways of eliminating hydrophilic proteins, polymers and polymer-protein conjugates from the blood. Among the parameters affecting this process, it should be noted the chemical composition, size, charge. Globular proteins with a molecular weight of over 70 kDa, as a rule, do not undergo clearance through renal ultrafiltration. Thus, conjugation with stabilizers of a steric configuration, such as PEG, reduces renal clearance by increasing the effective molecular size of the polymers to which they are attached. Ultrafiltration of PEG with a molecular weight of less than 8 kDa is not limited, while ultrafiltration of PEG with a mass of 8-30 kDa is regulated by molecular size. Elimination of PEG with a molecular mass exceeding 30 kDa decreases sharply. For this reason, polymer-polynucleotide conjugates carrying a masking agent are preferred, the total mass of which exceeds about 10 kDa, exceeds about 20 kDa, or exceeds about 30 kDa. In addition to less exposure to renal ultrafiltration, a polymer with a high molecular weight can accumulate to a greater extent in permeable tissues, such as tumors, as a result of passive increased permeability and retention mechanism.

Polynucleotide

The term polynucleotide or nucleic acid or polynucleic acid in this field refers to a polymer containing at least two nucleotides. Nucleotides are monomeric units of polynucleotide polymers. Polynucleotides having less than 120 monomer units are often referred to as oligonucleotides. Naturally occurring nucleic acids have a deoxyribose or ribose phosphate backbone. A non-naturally occurring or synthetic polynucleotide is a polynucleotide that is polymerized in vitro or in a cell-free system and contains the same or similar bases, but may have a type of scaffold different from the naturally occurring ribose or deoxyribose phosphate scaffold. Polynucleotides can be synthesized using any methods known in the art. Polynucleotide scaffolds known in the art include: PNA (peptide nucleic acids), phosphorothioates, phosphorodiamidates, morpholines, and other variants of the phosphate scaffold of native nucleic acids. The bases are purines and pyrimidines, which in turn include naturally occurring compounds such as adenine, thymine, guanine, cytosine, uracil, inosine, and analogues of naturally occurring bases. Synthetic derivatives of purines and pyrimidines include, but are not limited to, modifications that lead to the appearance of new reactive groups in the nucleotide, such as, but not limited to, amines, alcohols, thiols, carboxylates and haloalkyls. This concept also includes all known analogues of DNA and RNA. The term polynucleotide includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) and combinations of DNA, RNA and other naturally occurring and synthetic nucleotides.

DNA may take the form of cDNA, in vitro polymerized DNA, plasmid DNA, fragments of plasmid DNA, genetic material derived from virus, linear DNA, vectors (P1, PAC, BAC, YAC and artificial chromosomes), expression vectors, expression cassettes, chimeric sequences , recombinant DNA, chromosomal DNA, oligonucleotide, aptisense DNA or derivatives of these groups. RNA can take the form of template RNA (mRNA), in vitro polymerized RNA, recombinant RNA, oligonucleotide RNA, transport RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), chimeric sequence, antisense RNA, interfering RNA, small interfering RNA (siPHK), microRNA (siRNA), ribozyme, external guide sequences, small non-matrix RNAs (snmPHK), untranslated RNA (utPHK), snoPHK (24-measures modified by snmPHK that act by antisense mechanism), tiny non-coding RNAs (tncPHK), small RNA spike bk (shRNA) or derivatives of these groups. In addition, DNA and RNA can have one, two, three or four chains. A two-, three- and four-stranded polynucleotide can contain both RNA and DNA or other combinations of naturally occurring and / or synthetic nucleic acids.

A blocking polynucleotide is a polynucleotide that affects the function or expression of DNA or RNA. Blocking polynucleotides are not translated into the protein, but their presence or expression in the cell alters the expression or function of cell genes or RNA. Blocking polynucleotides cause degradation or inhibit the function or translation of a particular cellular RNA, typically mRNA, in a sequence-specific manner. Thus, inhibition of RNA can effectively inhibit the expression of a gene from which RNA is transcribed. In the context of the present description, it is understood that the blocking polynucleotide can be selected from a number including elements such as: an antisense oligonucleotide interacting with an RNA polynucleotide, dsRNA, siRNA, miRNA, hRNA, ribozyme, hammerhead ribozyme (hammerhead type ribozyme), external guide sequence (US 5962426), snoRNA forming a triple helix transcribed with oligonucleotide RNA polymerase II DNA that encodes a blocking polynucleotide, DNA transcribed with RNA polymerase III that encodes ie blocking polynucleotide. The blocking polynucleotide may be DNA, RNA, a combination of RNA and DNA, or may contain non-naturally occurring or synthetic nucleotides.

Blocking polynucleotides can be polymerized in vitro, they can be recombinant, contain chimeric sequences or derivatives of these groups. The blocking polynucleotide may comprise ribonucleotides, deoxyribonucleotides, synthetic nucleotides, or any suitable combination that inhibits an RNA or target gene.

A polynucleotide involved in RNA interference (PHKi) (a PHKi polynucleotide) is a molecule that can induce RNA interference by affecting the mechanism of the RNA interference pathway in mammalian cells, resulting in disruption or inhibition of translation of matrix RNA transcripts (mRNA) of the transgene in a sequence-specific manner. The two main PHKi polynucleotides are small (or short) interfering RNAs (siRNAs) and miRNAs (siRNAs). However, it has been found that other polynucleotides can also mediate RNA interference. PHKi polynucleotides can be selected from the group consisting of: siRNA, miRNA, double-stranded RNA (dsRNA), short RNA hairpin (shRNA) and expression cassettes encoding RNA, if they are capable of inducing RNA interference. siRNA contains a double-stranded structure, typically consisting of 15-50 base pairs and preferably 21-25 base pairs, and having a nucleotide sequence that is identical (fully complementary) or almost identical (partially complementary) to the coding sequence in the expressed target gene or RNA inside the cell. siRNA can have two nucleotides of 3'-protruding ends. siRNA can consist of two renatured polynucleotides or one polynucleotide that forms a hairpin-like structure. The siRNA molecule of the invention contains a sense region and an antisense region. In one embodiment, the siRNAs included in the conjugate are composed of two oligonucleotide fragments, one fragment containing the nucleotide sequence of the antisense strand of the siRNA molecule, and the second fragment containing the nucleotide sequence of the sense region of the siRNA molecule. In another embodiment, the sense strand is connected to the antisense strand via a linker molecule, such as a polynucleotide linker or non-nucleotide linker. MicroRNAs (miRNAs) are gene products in the form of small non-coding RNAs, consisting of approximately 22 nt (nucleotides), which cause the destruction or suppression of translation of their target mRNAs. If the complementarity between the siRNA and the target mRNA is partial, then the translation of the target mRNA is suppressed, and if the complementarity is more complete, the target mRNA is cleaved. In the case of siRNA, the complex binds to target sites, usually localized in 3 ′ UTR mRNA, which, as a rule, has only partial homology with siRNA. "Seed area", i.e. the site, consisting of about 7 consecutive nucleotides at the 5′-end of the siRNA, which performs exact base pairing with its target, plays a major role in siRNA specificity. The binding of the RISC complex (RNA-induced gene shutdown complex) / siRNA to mRNA can lead to either inhibition of protein translation or to cleavage and degradation of mRNA. According to current data, mRNA cleavage mainly occurs if there is exact homology along the entire length of the siRNA and its target, and not only in the seed region important for base pairing (Pillai et al., 2007).

An antisense oligonucleotide is a polynucleotide containing a sequence that is complementary to the sequence present in the target mRNA. The antisense oligonucleotide binds (mates) to the mRNA in a sequence-specific manner. This binding may interfere with the binding of other cellular enzymes to mRNA, resulting in inhibition of mRNA translation or mRNA cleavage.

External guide sequences are antisense oligoribonucleotides that induce RNAse P-mediated cleavage of the target RNA by forming the precursor of the RNA-like complex (US 5624824).

Ribozymes are typically RNA oligonucleotides that contain a sequence complementary to the target RNA transcript and an RNA sequence that acts as an enzyme by cleaving the RNA transcript. Cleavage of mRNA inhibits translation.

An oligonucleotide that forms a blocking polynucleotide may include an end cap at the 5′-end, 3′-end, or both at the 5′- and 3′-ends. The copying fragment can be, but not limited to, an inverted ribose residue in a DNA molecule lacking a nitrogenous base, an inverted deoxythymidine residue, a thymidine residue, or a 3′-glyceryl modification.

DNA transcribed with the participation of RNA polymerase II and III can be transcribed in the cell to form small RNA hairpins that can function as siRNAs, individual sense and antisense siRNAs with linear chains or linear RNAs that can function as antisense RNA. DNA transcribed with the participation of RNA polymerase III contains promoters selected from the series including: U6 promoters, H1 promoters, and tRNA promoters. RNA polymerase II promoters include U1, U2, U4, and U5 promoters, mRNA promoters, miRNA promoters, and mRNA promoters.

A list of known siRNA sequences can be obtained from databases maintained by, inter alia, research organizations such as the Wellcome Trust Sanger Institute, Penn Center for Bioinformatics, Memorial Sloan Kettering Cancer Center, and European Molecule Biology Laboratory. Data on the effectiveness of siRNA sequences and conjugate binding sites are also described in detail in the relevant literature. PHKi molecules can easily be created and prepared using techniques known in the art. In addition, computer tools exist to increase the chance of detecting effective and specific sequence motifs (Pei et al., 2006, Reynolds et al., 2004, Khvorova et al., 2003, Schwarz et al., 2003, Ui-Tei et al. 2004, Heale et al. 2005; Chalk et al. 2004; Amarzguioui et al. 2004).

The polynucleotides of the invention can be chemically modified. The use of chemically modified polynucleotide can improve various properties of the polynucleotide, including, but not limited to: resistance to in vivo degradation by nucleases, cell uptake, activity, and sequence specific hybridization. Examples of such chemical modifications include, but are not limited to: phosphorothioate internucleotide bonds, 2′-O-methylribonucleotides, 2′-deoxy-2′-fluorribonucleotides, 2′-deoxyribonucleotides consisting of “universal bases” nucleotides, 5-C- methyl nucleotides and the inclusion of an inverted ribose residue in a DNA molecule lacking a nitrogenous base. It has been established that these chemical modifications, when applied to various polynucleotide constructs, retain polynucleotide activity in cells, while at the same time sharply increasing the stability in serum of these compounds. Chemically modified siRNA can also reduce the ability to activate interferons in humans to the lowest possible level.

In one embodiment of the invention, the chemically modified PHKi polynucleotide of the invention comprises a duplex that has two strands, wherein one or both strands may be modified, where each strand contains from about 19 to about 29 (for example, about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29) nucleotides. In one embodiment, the PHKi polynucleotide of the invention contains one or more modified nucleotides, while retaining the ability to mediate the PHKi process within a cell or in vitro reconstructed system. A PHKi polynucleotide can be modified, with a chemical modification affecting one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) nucleotides. The PHKi polynucleotide of the invention may contain a certain percentage of modified nucleotides relative to the total number of nucleotides present in the PHKi polynucleotide. The PHKi polynucleotide of the invention itself may generally contain modified nucleotides at about 5-100% of the nucleotide positions (e.g., at 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucleotide positions). The actual percentage of modified nucleotides present in a given PHKi polynucleotide depends on the total number of nucleotides present in a PHKi polynucleotide. If the PHKi polynucleotide is single stranded, then the percentage of modified nucleotides can be determined depending on the total number of nucleotides present in the single stranded PHKi polynucleotide. Similarly, if the PHKi polynucleotide is double stranded, the percentage of modified nucleotides can be determined depending on the total number of nucleotides present in the sense strand, antisense strand, or both sense and antisense strands. In addition, the actual percentage of modified nucleotides present in a given PHKi polynucleotide may also depend on the total number of purine and pyrimidine nucleotides present in the PHKi polynucleotide. For example, all pyrimidine nucleotides and / or all purine nucleotides present in the PHKi polynucleotide can be modified.

The PHKi polynucleotide modulates RNA expression encoded by the gene. Since many genes can have a certain level of homology of their sequences, the PHKi polynucleotide can be created so that its target is a class of genes with sufficient sequence homology. Thus, a PHKi polynucleotide may contain a sequence complementary to sequences that are characteristic of different target genes, or are unique to a specific target gene. Thus, it is possible to create a PHKi polynucleotide whose target will be conservative regions of the RNA sequence that have homology with several genes, thereby exerting a targeted effect on several genes in gene families (for example, various isoforms of a gene, variants resulting from splicing, mutant genes etc.). In another embodiment, the PHKi polynucleotide can be designed so that its target is a sequence that is unique to a specific RNA sequence of an individual gene.

The concept of complementarity refers to the ability of a polynucleotide to form hydrogen (s) link (s) with another polynucleotide sequence, either according to the traditional type proposed by Watson-Crick or according to another non-traditional type. Regarding the polynucleotide molecules of the present invention, the free binding energy of the polynucleotide molecule to its target (effector binding site) or complementary sequence is sufficient for processing of the corresponding function of the polynucleotide, for example, enzymatic cleavage of mRNA or inhibition of translation. The determination of free binding energy for nucleic acid molecules is well known in the art (Frier et al., 1986; Turner et al., 1987). The percentage of complementarity indicates the percentage of bases in the chain of adjacent nucleotides in the first polynucleotide molecule that can form hydrogen bonds (for example, base pairing according to the Watson-Crick model), with the second polynucleotide sequence (for example, 5, 6, 7, 8, 9 , 10 out of 10 correspond to 50%, 60%, 70%, 80%, 90% and 100% complementarity). Complete complementarity means that all bases in a chain of a polynucleotide sequence consisting of adjacent nucleotides are hydrogen bonded to the same number of adjacent bases in the second polynucleotide sequence.

By inhibiting, down-regulating, or “turning off” gene expression, it is meant that gene expression estimated by the level of RNA transcribed from the gene, or the level of the polypeptide, protein, or subunit of the protein translated from RNA, is reduced compared to when the conjugates containing blocking polynucleotide are proposed in the invention are absent. Inhibition, down regulation, or “shutting down” of gene expression using a polynucleotide introduced using the compositions of the invention is preferably lower than that found in the presence of a control inactivating nucleic acid with a reorganized (scrambled) sequence or inactivating mismatches, or in the absence of conjugation of the polynucleotide with a masking polymer.

The introduced polynucleotide may be located in the cytoplasm or nucleus outside the endogenous genetic material. In another embodiment, the DNA can recombine with (become part of) endogenous genetic material. Recombination can lead to the incorporation of DNA into chromosomal DNA by either homologous or non-homologous recombination.

A polynucleotide can be introduced into a cell to express an exogenous nucleotide sequence, to inhibit, eliminate, increase or alter the expression of an endogenous nucleotide sequence or to affect specific physiological characteristics that are not normally associated with the cell.

Polynucleotides may contain an expression cassette designed to express all or part of a protein or RNA. The term “expression cassette” refers to a naturally occurring or recombinantly produced polynucleotide that has the ability to express a sequence. The term recombinant in the context of the present description refers to a polynucleotide molecule, which consists of segments of polynucleotides connected using methods known in the field of molecular biology. The cassette contains the coding region of the gene of interest along with any other sequences that affect the expression of the sequence of interest. The expression cassette typically includes a promoter (providing transcription initiation) and a transcribed sequence. Optionally, an expression cassette may include, but is not limited to: transcription enhancers, non-coding sequences, splicing signals, transcription termination signals, and polyadenylation signals. An RNA expression cassette typically includes a translation initiation codon (providing translation initiation) and a sequence encoding one or more proteins. Optionally, an expression cassette may include, but is not limited to, translation termination signals, a polyadenosine sequence, internal ribosomal entry sites (IRES), and non-coding sequences.

A polynucleotide may contain sequences that do not have a specific function in the target cell, but which are used to produce the polynucleotide. Such sequences include, but are not limited to, sequences that are necessary for replication or selection of a polynucleotide in a host organism.

The term gene usually refers to a polynucleotide sequence that contains the coding sequences necessary to obtain a therapeutic polynucleotide (e.g., ribozyme) or polypeptide or precursor. A polypeptide can be encoded by a full-sized coding sequence or any part of a coding sequence if it retains the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction) of a full-sized polypeptide or fragment. The concept also encompasses the coding region of a gene and includes sequences localized in the vicinity of the coding region at both the 5 ′ and 3 ′ ends at a distance of about 1 kb. or more at either end, as a result, the gene corresponds to the length of the unprocessed mRNA. Sequences that are localized at the 5′-end of the coding region and which are present in mRNA are referred to as 5′-untranslated sequences. Sequences that are localized at the 3′-end or in the course of transcription of the coding region and which are present in the mRNA are referred to as 3′-untranslated sequences. The concept of a gene includes both cDNA and genomic forms of the gene. The genomic form or clone of a gene contains a coding region interrupted by non-coding sequences, which are called introns, interrupt regions or interrupt sequences. Introns are segments of a gene that are transcribed into nuclear RNA. Introns may contain regulatory elements, such as enhancers. Introns are removed or removed by splicing from a nuclear or primary transcript; Intron results are absent in the mature RNA transcript. Matrix RNA (mRNA) functions during translation to give specificity to a sequence or to order amino acids in the resulting polypeptide. The gene may also include other regions or sequences, including, but not limited to, promoters, enhancers, transcription factor binding sites, polyadenylation signals, internal ribosomal penetration sites, silencer, isolation sequences, matrix attachment regions. These sequences can be adjacent to the coding region of the gene (within 10,000 nucleotides) or located at remote sites (more than 10,000 nucleotides). These non-coding sequences affect the level or rate of transcription and / or translation of a gene. Covalent modification of a gene can affect transcription rate (e.g. methylation of genomic DNA), mRNA stability (e.g. polyadenosine 3′-tail length), translation rate (e.g. 5′-cap), nucleic acid repair, nuclear transport, and immunogenicity. One example covalent modification of nucleic acid is exposure LABELIT ^® type reagents (manufactured by Mirus Corporation, Madison, Wis.).

In the context of the present description, the concept of gene expression refers to the process of converting genetic information encoded in a gene into RNA (e.g., small RNA, siRNA, mRNA, rRNA, tRNA or snRNA) by transcription of a deoxyribonucleic gene (e.g., due to the enzymatic action of an RNA polymerase) , and for protein-encoding genes - into a protein through translation of mRNA. Gene expression can be regulated at many stages of this process. The term upregulation or activation refers to a regulation that enhances the production of gene expression products (i.e., RNA or protein), and the term upregulation or inhibition refers to a regulation that reduces production. Molecules (e.g., transcription factors) that are involved in up-regulation or down-regulation are often called activator and repressors, respectively.

The polynucleotide can be used for research purposes or for making changes in the cell, which can be used for therapeutic purposes. The administration of a polynucleotide for therapeutic purposes is commonly referred to as gene therapy. The introduction of a polynucleotide can lead to modification of the genetic material present in the target cell. The term stable transfection or stably transfected generally refers to the introduction and integration of an exogenous polynucleotide into the genome of a transfected cell. The term stable transfectant refers to a cell in which a polynucleotide is stably integrated into genomic DNA. For stable transfection, episomal vectors that replicate during the division of a eukaryotic cell (for example, plasmid DNA vectors containing the papilloma virus replication initiation site, artificial chromosomes) can also be used. The term short-term transfection or short-term transfected refers to the introduction of a polynucleotide into a cell in which the polynucleotide does not integrate into the genome of the transfected cell. If the polynucleotide contains an expression-capable gene, then the expression cassette is subjected to regulatory control, which controls the expression of endogenous genes on the chromosomes. The term “short-term transfectant” refers to a cell in which polynucleotide uptake occurred, but the polynucleotide did not integrate into its genomic DNA.

Creating Preparative Forms

A polynucleotide-polymer conjugate is prepared by covalently linking a polynucleotide to a polymer. The polymer is polymerized or modified so that it contains reactive group A. The polynucleotide is also polymerized or modified so that it contains reactive group B. Reactive groups A and B are selected so that they can be linked by a reversible covalent bond using methods known in the art. in this area.

The conjugation of the polynucleotide with the polymer can be carried out in the presence of an excess of polymer. Since the polynucleotide and the polymer can carry opposite charges during the conjugation process, the presence of excess polymer can reduce or eliminate the aggregation of the conjugate. Alternatively, an excess of a carrier polymer, such as a polycation, can be used. Excess polymer can be removed from the conjugated polymer prior to administration of the conjugate to the animal or to the cell culture. In yet another embodiment, the excess polymer can be introduced along with the conjugate to an animal or into a cell culture.

The polymer can also be conjugated to a masking agent in the presence of an excess of polymer or masking agent. Since the polynucleotide and the polymer can carry opposite charges during the conjugation process, the presence of excess polymer can reduce or eliminate the aggregation of the conjugate. Alternatively, an excess of carrier polymer may be used. Excess polymer can be removed from the conjugated polymer prior to administration of the conjugate to the animal or to the cell culture. In yet another embodiment, the excess polymer can be introduced along with the conjugate to an animal or into a cell culture. The polymer can be modified before or after conjugation of the polynucleotide with the polymer.

Transfection Reagent

The process of introducing a polynucleotide into a cell is commonly referred to as transfection or a transfection process. The concept of transfection in the context of the present description refers to the introduction of a polynucleotide or other biologically active compound from the outside of the cell into the cell so that the polynucleotide has biological activity. The polynucleotide can be used for research purposes or for making changes in the cell, which can be used for therapeutic purposes. The introduction of a polynucleotide can lead to modification of the genetic material present in the target cell. A transfection reagent or an administration vehicle is a compound or compounds that binds (s) or forms (s) complex (s) with oligonucleotides and polynucleotides and mediates (s) penetration into cells. In vitro transfection reagents or carriers intended for administration are compounds or compositions of compounds that bind or complex with oligonucleotides and polynucleotides and mediate their entry into cells. Examples of transfection reagents include, but are not limited to, protein and polymer complexes (polyplexes), lipids and liposomes (lipoplexes), combinations of polymers and lipids (lipolyplexes), precipitates obtained using calcium phosphate, and dendrimers. Typically, the transfection reagent has a component with a net positive charge that binds to the negative charge of the oligonucleotide or polynucleotide. Cationic transfection agents can also be condensed with large nucleic acids. Transfection agents can also be used to associate functional groups with a polynucleotide. Functional groups include directed signals into the cell, nuclear localization signals, compounds that increase the release of the contents of endosomes or other intracellular vesicles (for example, having activity against the membranes of the compound) and other compounds that alter the behavior or interactions of the compound or complex to which they are attached (interaction modifiers).

The conjugated polynucleotides of the present invention are valuable reagents, and they can be used in therapeutic, diagnostic methods, for target validation, genome studies, genetic engineering, and pharmacogenomic studies. The conjugated polynucleotide has improved cell uptake characteristics compared to the same unconjugated polynucleotide.

Parenteral routes of administration include intravascular (intravenous, intra-arterial), intramuscular, intra-parenchymal, intradermal, subdermal, subcutaneous, intratumoral, intraperitoneal, intratracheal, subdural, epidural and intralymphatic injections that use a syringe and needles or catheters. In the context of the present description, the term "intravascular" means "located inside a tubular structure, which is called a vessel connected to a tissue or organ in the body." Inside the cavity of the tubular structure, the body’s total water flows into or out of the body. Examples of total body water are blood, cerebrospinal fluid (CSF), lymphatic fluid, or bile. Examples of vessels include arteries, arterioles, capillaries, venules, sinusoidal capillaries, veins, lymphatic, bile ducts, and ducts of the salivary or other exocrine glands. The intravascular pathway involves administration through blood vessels such as an artery or vein. The circulatory system provides systemic distribution of pharmaceutical agents. It is understood that the route of administration through the mucous membrane includes nasal administration, administration to the bronchi, inhalation into the lungs, or administration through the eyes. The intra-parenchymal route includes direct injection into tissue such as the liver, lung, heart, muscle (skeletal muscle or diaphragm), spleen, pancreas, brain (including intraventricular injection), spinal cord, ganglia, lymph nodes, adipose tissue, thyroid tissue glands, adrenal glands, kidneys, prostate gland and tumors. For transdermal routes of administration, plasters and iontophoresis are used. Other epithelial routes include the oral, nasal, respiratory, rectal, and vaginal routes of administration.

The conjugates can be injected in a pharmaceutically acceptable carrier in the form of a solution. The term "pharmaceutically acceptable" refers to properties and / or substances acceptable to a mammal from a pharmacological / toxicological point of view. The phrase "pharmaceutically acceptable" refers to molecular substances, compositions and properties that are physiologically tolerable and, as a rule, do not cause an allergic or other undesirable reaction when administered to a mammal. Preferably, in the context of the present description, the term "pharmaceutically acceptable" refers to a substance approved by a regulatory agency of the Federal or state government or authorized by the United States Pharmacopeia or other accepted pharmacopeia for use in animals and more specifically in humans.

Therapeutic effect

The invention provides for the introduction of a polynucleotide leading to gene expression or inhibition of gene expression of reporter genes and endogenous genes in specific tissues. The expression levels of reporter (marker) genes determined after the introduction of the polynucleotide indicate that the same levels of gene expression can be expected that are observed with the introduction of other polynucleotides. The treatment indicator, which is considered by a person of ordinary skill in the art as favorable, differs from disease to disease, for example, hemophilia A and B is associated with deficiency of X-linked factors of the blood coagulation system VIII and IX, respectively. Their clinical picture is mainly affected by the percentage relative to the levels in the serum of healthy people of factor VIII or IX: <2%, serious; 2-5%, moderate; and 5-30% is weak. Thus, an increase in the factor content from 1% to 2% relative to the level in the bloodstream of a healthy person in patients with severe hemophilia should be considered as a beneficial effect. Levels in excess of 6% prevent spontaneous bleeding, but not bleeding that is secondary to surgery or damage. Similarly, gene inhibition does not have to be 100% for a beneficial effect. A person of ordinary skill in the field of genetic engineering can confidently determine the expression levels of a disease-specific gene based on sufficient marker gene levels. For example, in the case of hemophilia, if, as a result of the expression of marker genes, the level of the formed protein is comparable to 2 vol.% Relative to the levels of factor VIII in a healthy person, then we can more confidently expect that the gene encoding factor VIII should be expressed with similar levels. Thus, reporter or marker genes, such as luciferase and β-galactosidase genes, serve as valuable examples of the expression of intracellular proteins in general. Similarly, reporter or marker genes secreting alkaline phosphatase (SEAP) provide valuable examples of the secreted proteins in general.

The therapeutic effect of the protein expressed from the introduced polynucleotide in relation to the weakening or prevention of the disease, condition or symptom can be determined by the protein, either present in the cell, preserved in the attached state to the cell membrane, or secreted and dissociated from the cell, while it can penetrate into general circulatory system and blood. Secreted proteins that may be therapeutic include hormones, cytokines, growth factors, blood coagulation factors, antiprotease proteins (e.g., alpha antitrypsin), and other proteins that are present in the blood. Membrane proteins have a therapeutic effect, representing a receptor for the cell with which the protein or lipoprotein binds. For example, a low density liprotein receptor (LDL) can be expressed in hepatocytes and lower cholesterol levels and thereby prevent atherosclerotic lesions that can cause a “stroke” or myocardial infarction. Therapeutic proteins that can remain inside the cell can be enzymes that cleave toxic metabolites in the bloodstream, such as phenylketonuria. They can also cause lower proliferation of cancer cells or their malignancy (for example, reduce metastatic effect). The protein inside the cell can also affect the replication of the virus.

The liver is one of the most important target tissues for gene therapy because it plays a major role in metabolism (e.g., lipoprotein metabolism in various hypercholesterolemia) and secretion of blood flow proteins (e.g., blood coagulation factors in hemophilia). At least one hundred different genetic disorders can potentially be corrected with liver-oriented gene therapy. In addition, acquired disorders such as chronic hepatitis and cirrhosis are widespread and can also be treated with liver-oriented therapies based on the use of polynucleotides. Gene therapies involving heterotropic gene expression can also expand the range of disorders that can be treated with targeted gene transfer to the liver. For example, diabetes mellitus can be treated by expressing the insulin gene in hepatocytes, which, according to physiological indications, can carry out glucose-regulated secretion of insulin.

In addition to increasing or decreasing the expression level of genes involved in metabolism or disease, the introduction of polynucleotides into cells in vivo can also be used to stimulate the immune system, stimulate the immune system in relation to the destruction of cancer cells, inactivation of oncogenes, or the introduction of tumor suppressor genes. Polynucleotides can also be administered to induce immunity to pathogens or to block the expression of pathogenic genes.

Various definitions

In the context of the present description, in vivo refers to a process carried out internally and more particularly to a process carried out in living tissue of a whole living multicellular organism (animal), such as a mammal, as opposed to a part of an organism or a dead organism.

In the context of the present description, in vitro refers to a process carried out in an artificial environment created outside a living multicellular organism (for example, in a laboratory test tube or culture plate), which is used in experimental studies to study a disease or process. In the context of the present description, in vitro includes processes carried out in intact cells that are grown in culture.

In the context of the present description, in situ refers to processes that are carried out in intact tissue. However, the tissue may be in a living organism or removed from the body.

As used herein, ex vivo refers to a process carried out in an artificial environment outside the body on living cells or tissues that are removed from the body and then returned to the body.

Crosslinking agents are bifunctional molecules that are used to bond two molecules together, i.e. they form a bond between two molecules. Bifunctional molecules can be homo- or heterobifunctional.

In the context of the present description, the surface-active polymer reduces the surface tension of water and / or interfacial tension with other phases and is therefore positively absorbed at the liquid / vapor interface.

An antibody is any immunoglobulin, including antibodies and fragments thereof, that bind to a specific epitope. The concept includes polyclonal, monoclonal and chimeric antibodies. The antigen-binding center of an antibody is the structural region of an antibody molecule that contains the variable regions and hypervariable regions of the heavy and light chains that specifically bind the antigen. Under the concept of an antibody molecule and its various grammatical forms in the context of the present description, both the intact immunoglobulin molecule and the immunologically active part of the immunoglobulin molecule are included. Examples of antibody molecules are intact immunoglobulins, practically intact immunoglobulins, and those portions of immunoglobulins that contain a paratope, including those known in the art as Fab, Fab, F (ab) ₂ and F (v ) fragments that are preferred for use in the therapeutic methods of the present invention. Fab and F (ab ′) ₂ fragments of antibody molecules are obtained by a proteolytic reaction using papain and pepsin, respectively, to which practically intact antibody molecules are subjected using methods well known in the art. The term monoclonal antibody and its various grammatical forms refers to an antibody that carries only one type of antigen-binding centers of an antibody that has immunoreactivity against a particular antigen. Thus, a monoclonal antibody, as a rule, is characterized by a single affinity for binding to any antigen in relation to which it has immunoreactivity. Therefore, a monoclonal antibody can be an antibody molecule containing several antigen-binding centers of the antibody, each of which is immunospecific for different antigens; for example, it may be a bispecific (chimeric) monoclonal antibody.

Examples

Example 1. Synthesis and assembly of polynucleotides. The following synthetic RNA oligonucleotides were used (Dharmacon, Lafayette, Colorado). The sense strands of RNA contained a primary amine with six carbon spacers at the 5′-end, which allowed conjugation with the carrier intended for administration. The 2 ′ ACE-protected oligonucleotides were deprotected before the repatriation step according to the manufacturer’s instructions. SiPHK had the following sequences:

apoB (Ensembl # ENSMUST00000037520);

siPHK apoB-1

semantic 5′-NH ₄ -GAAmUGmUGGGmUGGmCAAmCmUmUmUmA * G, SEQ ID 1,

antisense 5′-P-AmAAGUUGCCACCCACAUUCmA * G, SEQ ID 2;

siPHK apoB-2

semantic 5′-NH ₄ -GGAmCAmUGGGmUmUCCAAAmUmUAmC * G, SEQ ID 3,

antisense 5′-P-UmAAUUUGGAACCCAUGUCCmC * G, SEQ ID 4;

ppara (GenBank # NM_011144);

siPHK ppara-1,

semantic 5′-NH ₄ -mUmCAmCGGAGmCmUmCAmCAGAAmUmUmC * U-3 ′, SEQ ID 5,

antisense 5′-P-AmAUUCUGUGAGCUCCGUGAmC * U-3 ′, SEQ ID 6;

siPHK ppara-2

semantic 5′-NH ₄ -mUmCCCAAAGCmUCCmUmUmCAAAAmU * U-3 ′, SEQ ID 7,

antisense 5′-P-mUmUUUGAAGGAGCUUUGGGAmA * G-3 ′, SEQ ID 8;

control siRNA (GL-3 luciferase reporter gene),

semantic 5′-NH ₄ -mCmUmUAmCGmCmUGAGmUAmCmUmUmCGAmU * U-3 ′; SEQ ID 9,

antisense 5′-P-UmCGAAGUACUCAGCGUAAGmU * U; SEQ ID 10;

m = substitution 2′-O-CH ₃ ,

* = phosphorothioate bond and

P = PO ₄ .

The sense and antisense oligonucleotides for each target sequence were renatured, for which they were mixed in equimolar amounts and heated to 94 ° C for 5 min, cooled to 90 ° C for 3 min, then the temperature was gradually decreased by 0.3 ° C 250 times, keeping each time for 3 s.

Example 2. Statistical vinyl ether copolymers

A. Synthesis of vinyl ether monomer

2-Vinyloxyethylphthalimide was prepared by reacting 2-chloroethyl vinyl ether (25 g, 0.24 mol) and potassium phthalimide (25 g, 0.135 mol) at 100 ° C in DMF (75 ml) using tetra-n-butylammonium bromide (0, 5 g) as an interphase catalyst. This solution was heated for 6 hours and then poured into water and filtered. Said solid was then recrystallized twice from methanol to give white crystals.

B. Polymers amine + alkylpolyvinyl ether.

A series of copolymers were synthesized from vinyl ether monomers with different ratios of alkyl and amino groups and using alkyl groups that contained from 1 to 4 carbon atoms (FIG. 1, R and R ′ may be the same or different). Membrane activity depended on size (alkyl chain length) and the ratio of hydrophobic monomers (Wakefield 2005). On liposome models, it was found that propyl and butyl polymers had lytic activity against membranes, while methyl and ethyl polymers did not have such an effect. In the context of the present description, these polymers are designated as methyl, ethyl, propyl or butylamino ethers (PMAVE, PEAVE, PPAVE or PBAVE, respectively). These polymers carry a charge high enough to form complexes with DNA at physiological concentrations of salts. In contrast, small cationic peptides with lytic activity against membranes, such as melittin, turned out to be too weak and did not at all possess the ability to condense DNA in isotonic saline solutions. The larger size of synthetic amphipathic polymers not only led to an increase in the ability to bind DNA, but also caused their higher lytic activity compared to melittin at the molar level. The ability to cause lysis of membranes using fewer polymer molecules should facilitate in vivo administration of nucleic acids. When creating the invention, the charge density of the synthesized polymers was determined using fluorophore-labeled DNA and their stability in saline solutions was confirmed.

B. Synthesis of water-soluble, amphipathic, membrane-active ternary vinyl ether-polyamine copolymers.

X mol% of a vinyl amine-containing protected amine (e.g., 2-vinyloxyethylphthalimide) was added to a kiln-dried round bottom flask in a nitrogen blanket in anhydrous dichloromethane. To this solution was added Y mol.% Simple alkyl- (for example, ethyl-, propyl- or butyl-) vinyl ether, and then Z mol.% Simple alkyl- (dodecyl-, octadecyl-) vinyl ether (figure 1). Although the exemplary polymers consisted of 2-3 different monomers, the invention is not limited to the specific composition of vinyl ether monomers. Polymers containing more monomers or various monomers also fall within the scope of the invention. The solution was adjusted to −78 ° C. in a dry ice / acetone bath. To this solution, 10 mol% of BF ₃ EtOEt was added and the reaction was allowed to proceed for 2-3 hours at -78 ° C and then quenched with a methanolic solution of ammonium hydroxide. The polymer was dried to dryness under reduced pressure and then added to 30 ml of a 1,4-dioxane / methanol mixture (2/1). Added 20 mol. equivalents of hydrazine to phthalimide to remove the amine protecting group. The solution was refluxed for 3 hours, then dried to dryness under reduced pressure. The solid product was added to 20 ml of 0.5 M HCl, refluxed for 15 min, diluted with 20 ml of distilled water and refluxed for another 1 h. Then the solution was neutralized with NaOH, cooled to room temperature, transferred to cellulose a tubular dialysis device, cutting off compounds with a molecular weight of 3500, was dialyzed for 24 hours (2 × 20 L) in countercurrent with distilled water and freeze dried. The molecular weight of the polymers was determined using gel filtration analytical columns according to standard procedures. Although these examples describe polymers containing the indicated vinyl ether monomers, the invention is not limited to specific monomers.

After phthalimide groups were removed by sequential treatment with hydrazine and HCl, the polymers were transferred to a cellulose tubular dialysis device, cutting off compounds with a molecular weight of 3,500, dialyzed for 24 hours (2 × 20 L) in countercurrent with distilled water, and freeze dried. Then the polymers were dissolved in water and introduced into a column filled with Sephadex G-15. The polymers obtained after chromatography on Sephadex G-15 were isolated and concentrated by lyophilization. The molecular weights of the polymers were then determined using GPC using Eprogen Inc. column series. CATSEC100, CATSEC300 and CATSEC1000. The mobile buffer contained 50 mM NaCl, 0.1% TFA and 10% MeOH. Polyvinylpyridine standards were used as calibration curves. The molecular weight of the polymers was 10,000-100,000 Yes, while for most polymer preparations, the molecular weight exceeded 20,000 Da.

G. Synthesis of DW1360.

The amine / butyl / octadecyl polyvinyl ether triple copolymer was synthesized from monomers of 2-vinyloxyethylphthalimide (3.27 g, 15 mmol), butyl vinyl ether (0.40 g, 4 mmol) and octadecyl vinyl ether (0.29 g, 1 mmol) . Monomers were dissolved in 30 ml of anhydrous dichloromethane. Then these solutions were added to a dry ice / acetone bath at -78 ° C. After 2 min, BF ₃ · OEt ₂ (0.042 g, 0.3 mmol) was added and the reaction was allowed to proceed for 3 hours at -78 ° C. Then the polymerization was stopped by adding a mixture of 50/50 ammonium hydroxide in methanol or a solution of lithium borohydride. Then the solvents were removed using a rotary evaporator. Then the polymer was dissolved in 30 ml of a mixture of 1,4-dioxane / methanol (2/1). Hydrazine (0.44 g, 138 mmol) was added to this solution and the mixture was heated to reflux for 3 hours. Then, the solvents were removed using a rotary evaporator and the resulting solid was taken up in 20 ml of 0.5 M HCl and refluxed. for 15 min, 20 ml of distilled water was diluted and refluxed for another 1 h. Then this solution was neutralized with NaOH, cooled to CT, transferred to a cellulose tubular dialysis device, cutting off compounds with a molecular weight of 3500, under Yergali dialyzed for 24 hours (2 × 20 L) of distilled water in countercurrent and lyophilized.

Other polymers containing different ratios of amino groups, butyl and octadecyl groups can be synthesized similarly. In addition, other monomers may be included. In particular, tert-butyl vinyl ether, dodecyl vinyl ether and olein vinyl ether can be included in the polymers.

According to one embodiment of the invention, it is possible to synthesize ternary amine / lower alkyl / higher alkyl polyvinyl ether copolymers using monomers at a loading level of 15 amine monomers: 4 (lower) alkyl monomers: 1 (higher) alkyl monomer . Under the above conditions, it was found that the inclusion level was approximately 5.4-7.5 amine monomers: 3-3.5 (lower) alkyl monomers: 1 (higher) alkyl monomer. According to another embodiment of the invention, amine / (lower) alkyl / (higher) alkyl polyvinyl ether ternary copolymers are synthesized using monomers with a loading level of 4-8 amine monomers: 3-5 (lower) alkyl monomers: 1 (higher) alkyl monomer. In a preferred embodiment, the polymers are water soluble (about 1 mg / ml or more at 25 ° C) and have surface activity.

In one embodiment, the polymers are fractionated to give polymers with a molecular weight of from about 5 to about 50 kDa, and more preferably from about 10 to about 30 kDa.

D. Other ternary copolymers.

Similar polymers can be synthesized by modifying various polymer frameworks, including, but not limited to: poly-L-lysine (PLL), polyvinylamine (PVA) and polyallylamine (PAA). By attaching alkyl groups to the various main chains of these polymers, it is possible to create ternary polymers with an amine: (lower) alkyl: (higher) alkyl ratio of about 6: 3: 1.

E. Lysis of liposomes.

10 mg of chicken egg phosphatidylcholine was hydrogenated with 1 ml of buffer containing 100 mM carboxyfluorescein (CF) and 10 mM HEPES, pH 7.5. Then the liposomes were extruded through polycarbonate filters with a pore size of 100 im (Nucleopore, Pleasanton, Calif.) Unbound CF was removed by gel filtration on 4B-200 Sepharose, eluting with 10 mM HEPES, pH 8, 0.1 M NaCl . Aliquots of 200 μl of loaded CF liposomes were added in 1.8 ml of isotonic buffer. Fluorescence (λ _ex = 488, λ _em = 540) was determined 30 minutes after the addition of 0.25 μg of polymers or melittin in a suspension of bubbles. At the end of each experiment, the bubbles were destroyed by adding 40 μl of a 1% solution of Triton X-100 to determine the maximum lysis.

Example 3. Masking agents

A. Synthesis of 2-propionic-3-methyl-maleic anhydride (hydroxymethyl-maleic anhydride or CDM).

To a suspension of sodium hydride (0.58 g, 25 mmol) in 50 ml of anhydrous tetrahydrofuran was added triethyl-2-phosphoropropionate (7.1 g, 30 mmol). After the evolution of hydrogen gas ceased, dimethyl-2-oxoglutarate (3.5 g, 20 mmol) in 10 ml of anhydrous tetrahydrofuran was added and stirred for 30 minutes. Then 10 ml of water was added and tetrahydrofuran was removed using a rotary evaporator. The resulting mixture of solid and water was extracted with 3 × 50 ml of ethyl ether. The ether extracts were combined, dried over magnesium sulfate and concentrated to give a yellow oil. The oil was purified by gel filtration on silica gel using a 2: 1 ether: hexane mixture to elute, whereby 4 g (82% yield) of pure ester was obtained. Then, 2-propiono-3-methylmaleic anhydride was obtained by dissolving this triester in 50 ml of a 50/50 mixture of water and ethanol containing 4.5 g (5 equiv.) Of potassium hydroxide. This solution was heated to reflux for 1 h. Then, ethanol was removed using a rotary evaporator and the solution was acidified to pH 2 with hydrochloric acid. This aqueous solution was then extracted with 200 ml ethyl acetate, isolated, dried over magnesium sulfate and concentrated to give a white solid. This solid was then recrystallized from dichloromethane and hexane to give 2 g (80% yield) of 2-propionic-3-methyl-maleic anhydride.

Thioesters, esters and amides can be synthesized based on CDM by converting CDM to acid chloride using oxalyl chloride followed by addition of thiol, ester or amine and pyridine. CDM and its derivatives can be modified using standard methods known in the art, adding targeted transfer ligands, steric stabilizers, charged groups and other reactive groups. The resulting molecules can be used for reversible modification of amines.

B. Containing galactose providing directional transfer of the group.

The basis of the most widely studied ligands providing targeted transfer to hepatocytes is galactose, which binds to the azialoglycoprotein receptor (ASGPr) on hepatocytes. It has been established that the addition of galactose facilitates the targeted transfer of several water-soluble uncharged polymers into hepatocytes, including: chitosan oligosaccharide, polystyrene derivative and HPMA polyacrylamide. Galactose groups providing directional transfer are easy to obtain using lactose, galactose-glucose disaccharides by modifying the glucose fragment. Lactobionic acid (LBA, a lactose derivative in which glucose is oxidized to gluconic acid) can be included in the maleic anhydride derivative using standard amide coupling techniques. Figure 2 shows the structure of two derivatives of LBA, which were obtained by combining galactose with maleic anhydride CDM.

The maleamate modification leads to the conversion of a positively charged amine group into a negatively charged one. This modification of the charge can reduce the non-specific interactions of the polymer with negatively charged cells and serum components. However, too high a negative charge can enhance interactions with scavenger receptors (scavenger receptors). Having a pure neutral charge, a galactose-containing derivative of maleic anhydride can be obtained by inserting a positively charged tertiary amine group into a masking agent, resulting in the formation of zwitterion. Such a connection, i.e. CDM-Pip-LBA, can be created from the following components: CDM, propylaminopiperazine and lactobionic acid (figure 2).

B. Synthesis of a stabilizer of the sterile configuration of CDM-PEG and targeted transfer of the CDM-NAG (N-acetylgalactosamine) group (FIG. 2).

To a solution of CDM (Rozema 2003) (300 mg, 0.16 mmol) in 50 ml of methylene chloride was added oxalyl chloride (2 g, 10 wt. Equiv.) And dimethylformamide (5 μl). The reaction was allowed to proceed overnight, after which the excess oxalyl chloride and methylene chloride were removed using a rotary evaporator to give CDM chloride. The acid chloride was dissolved in 1 ml of methylene chloride. To this solution was added 1.1 molar equivalents of polyethylene glycol monomethyl ether (average MM 450) for CDM-PEG or (aminoethoxy) ethoxy-2- (acetylamino) -2-deoxy-β-D-glucopyranoside (i.e., aminobisethoxyethyl NAG ) for CDM-NAG, and pyridine (200 μl, 1.5 equiv.) in 10 ml of methylene chloride. Then, the solution was stirred for 1.5 hours. Then, the solvent was removed and the resulting solid was dissolved in 5 ml of water and purified using reverse phase HPLC using a gradient of 0.1% TFA in water / acetonitrile (Fig. 2).

Example 4. Reversible attachment of a polynucleotide to a polymer.

Modification of amino siRNA oligonucleotides by S-acetyl groups resulted in stably protected thiols that could be released into the stock solution (pH≥9) in the presence of an amine-containing polycation. Standard deprotection conditions for removing a thioester group include incubation with hydroxylamine. However, these deprotection conditions result in the formation of significant quantities of siRNA dimers bound by a disulfide bridge. As a rule, the interaction between the alkylamine and the thioester is relatively slow, but in the complex between the polyanionic siRNA and the polycationic amine, the reaction between the functional groups becomes significantly intramolecular and significantly accelerated (see step 2a in FIG. 3). In addition to accelerating the removal of the protective group, the reaction of the released thiol groups with activated disulfide groups at the polycation is significantly accelerated (stage 2b). Activated disulfide pyridylthiol (PD) guarantees the selective formation of disulfide, and it is easy to attach to the polycation using commercially available reagents. The result of these interactions within the particles was> 90% conjugation of the disulfide with the polycation.

Example 5. Reversible conjugation of a polynucleotide with a polymer

A. SATA-modified polynucleotide.

Modified N-succinimidyl-3-acetylthioacetate (SATA) polynucleotides were synthesized by reacting a 5′-amine modified siRNA with 1 mass equivalent (wt. Equivalent) of SATA reagent (Pierce) and 0.36 wt. eq. NaHCO ₃ in water at 4 ° C for 16 hours. Thiol-protected modified siRNA precipitated by adding 9 volumes of ethanol and incubated at -78 ° C for 2 hours. The precipitate was isolated, dissolved in 1 × siRNA buffer (Dharmacon) and Absorbance at a wavelength of 260 nm was quantified.

The polymer, in this example PBAVE or DW1360 (30 mg / ml in 5 mM TAPS, pH 9), was modified by adding 1.5 wt.% 4-succinimidyloxycarbonyl-α-methyl-α- [2-pyridyldithio] toluene (SMPT, firm Pierce). One hour after the addition of SMPT, 0.8 mg of SMPT polymer was added to 400 μl of an isotonic glucose solution containing 5 mM TAPS, pH 9. To this solution, 50 μg of SATA-modified siRNA was added. For dose-dependent experiments in which the concentration of PBAVE remained constant, various amounts of siRNA were added. The mixture was then incubated for 16 hours. In this way, the polynucleotide was conjugated to the polymer via a reversible disulfide bridge. The use of a disulfide bridge for conjugation between the polymer and siRNA is necessary for reversibility in the reducing environment of the cytoplasm. The siRNA polymer conjugate was masked by adding to a solution containing 5.6 mg of free base HEPES, followed by a mixture comprising 3.7 mg of CDM-NAG and 1.9 mg of CDM-PEG. The solution was then incubated for 1 h at room temperature (CT) before injection.

B. Quantification of conjugated polynucleotide.

To determine the amount of conjugated siRNA an aliquot of 10 μl of the conjugate, the siRNA polymer containing 1 μg of siRNA was treated with 2 μl of 1M DTT at RT for 16 h or not treated with DTT. 100 μg of polyacrylic acid and 300 μg of NaCl were added to the samples to neutralize electrostatic interactions. After incubation for 2 h, the samples were subjected to electrophoresis on a 2% agarose gel and siRNA was visualized by staining with ethidium bromide. Bands corresponding to siRNA were quantified using the Kodak Molecular Imaging Software, version 4.0. The amount of unconjugated siRNA was standardized relative to the amount released after DTT treatment to determine the percentage of conjugated product. The amount of conjugated siRNA, as a rule, was 70-90%.

You can apply other variants of chemistry based on disulfide conjugation when the thiol is protected as disulfide or not protected at all. In addition, the polymer can be modified with other activated disulfide groups, thiol groups or protected thiol groups.

Example 6. Reversible attachment of CDM masking agents to conjugates of polynucleotide polymers.

The polynucleotide-polymer conjugates can be modified, for example, using maleic acid derivatives, with the goal of reversibly modifying the polymer (FIG. 3, step 4.). The siRNA-polymer conjugate was masked, added to a solution containing 5.6 mg of HEPES as a free base, followed by a mixture containing 3.7 mg of CDM-NAG and 1.9 mg of CDM-PEG. The solution was then incubated for 1 h at room temperature (CT) before in vivo injection.

Example 7. Providing directional transfer activity of masked conjugates.

To demonstrate the ability of CDM-Pip-LBA (galactose-containing) agents to provide targeted liver transfer of amphipathic polyvinyl ether 25/75 (25:75 butyl: amine) PBAVE, the polymer methyl fluorophore Cy3, followed by modification with CDM-PEG with or without addition add CDM-Pip-LBA. 100 μg of masked polymer in 400 μl of an isotonic glucose solution was injected into the tail vein of mice. Liver samples were obtained 1 h after injection and frozen sections of the liver were prepared, which were processed for immunohistochemical analysis (Fig. 4). As can be seen from figure 4, a pronounced localization of the polymer was found, for the directional transfer of which CDM-Pip-LBA was used, in hepatocytes (B), while for a polymer that did not provide directional transfer agents, localization was mainly found in macrophages of the liver (BUT).

Modified by CDM-LBA PBAVE is highly anionic and has been found to be found mainly in macrophages (data not shown). The polymers modified with CDM-Pip-LBA (zwitterionic masking agent) had a charge close to neutral and were characterized by an increase in the amount of polymer directed to the liver in general and, more importantly, to hepatocytes in particular (Fig. 4B). A charge, such as a negative charge, can also be protected with steric stabilizers, including masking agents CDM-PEG.

Example 8. Directed transfer of a polynucleotide to hepatocytes.

An oligonucleotide-polymer conjugate was created according to the method described above and masked with CDM-Pip-LBA. 20 μg of SATA / Cy3-modified siRNA was conjugated to 1.8 mg of PD-modified PLL and modified using CDM-Pip-LBA. Masked conjugate was injected into 400 μl of saline into the tail vein of mice. The same injection solution contained 100 μg modified with CDM-Pip-LBA 25/75-PBAVE labeled with Oregon Green. The conjugates dissolved and did not form aggregates under physiological conditions. One hour after the injection, liver samples were prepared and frozen sections of the liver were prepared, which were processed for immunohistochemical analysis. To stain cell nuclei, TO-PRO-3 ^{® was used} . After injection into the tail vein of mice, labeled oligonucleotides and PBAVE were detected in hepatocytes (upper left panel in FIG. 5).

Example 9. The activity of conjugates in vivo.

The ability of masked polynucleotide-polymer conjugates to administer siRNA to inhibit the endogenous gene in the liver of mice was evaluated using an alpha receptor activated by peroxisome proliferators (PPARa). C57B mice (n = 4) were injected into the tail vein of a CDM-Pip-LBA modified PPARa siPHK-PLL conjugate (20 μg siRNA, 1.8 mg PD-PLL) and 25/75-PBAVE (100 μg) in 400 μl isotonic glucose solution. RNA was obtained from the liver 48 hours after injection. PPARa mRNA levels were determined using real-time quantitative PCR (qRT-PCR). MRNA levels were standardized relative to levels in animals that were injected with antiluciferase siRNA. Changes in mRNA levels were standardized relative to endogenous GAPDH. Three independent experiments were performed. As can be seen from FIG. 6, a 20% inhibition of PPARa mRNA levels was detected.

Example 10. The introduction / activity of conjugates in vivo.

Male mice 6-8 weeks old (C57BL / 6 line, 20-25 g) were obtained from Harlan Sprague Dawley (Indianapolis, Indiana). Mice were incubated for at least 10 days before injection. Animals had free access to food for rodents such as Harlan Teklad Rodent Diet (Harlan, Madison, Wisconsin). Mice were injected by infusion into the tail vein with a total volume of 0.4 ml of buffered HEPES (5 mM, pH 7.5) isotonic glucose solution. Mice were injected with conjugates of either DNA or siRNA.

Mice were not fed for 4 hours until serum samples were obtained by taking blood from the orbital plexus and obtaining liver samples. The serum was used for Western blot analysis and added to an equal volume of a mixture of a complete Protease Inhibitor Cocktail) containing EDTA (Roche, Indianapolis, Indiana) and stored at -20 ° C. Total RNA was isolated from the liver immediately after obtaining samples using TRI-REAGENT ^® according to the manufacturer's protocol (Molecular Research Center, Cincinnati, Ohio).

To analyze targeted transfer to hepatocytes, a polyconjugate containing 10 μg of Cy3-labeled 21-dimensional dsDNA was prepared according to the method described above in a total volume of 0.2 ml and was administered to male ICR mice (20-25 g, Harlan Sprague Dawley) by iv injection. 1 h after injection, the mice were sacrificed and liver samples were obtained. In some experiments, tissue samples from the lung, kidney, spleen, brain, and pancreas were also obtained. Tissue samples were fixed in a mixture of 4% paraformaldehyde / PBS for 6 h and placed in a solution of 30% sucrose / PBS, which was kept overnight at 4 ° C. The fixed tissue samples were then transferred to a block holder containing OST freezing medium (Fisher Scientific, Pittsburgh, PA) and quickly frozen in liquid nitrogen. Frozen tissue sections (8-10 μm) were obtained using a Microm HM 505N type cryostat (Carl Zeiss, Thornwood, NY) and placed on Superfrost-Plus microscope slides (Fisher Scientific). Tissue sections were contrast stained with ALEXA ^® -488-phalloidin (13 nM, Invitrogen, Carlsbad, Calif.) And TO-PRO-3 ^® (40 nM, Invitrogen) in PBS for 20 minutes. Slides were kept in Vectashield reagent (Vector Laboratories, Burlingame, Calif.) And analyzed using a LSM510 type confocal microscope (Carl Zeiss).

Micrographs of slices of mouse liver obtained using a confocal microscope 1 h after injection of a polynucleotide-polymer conjugate containing 21-dimensional double-stranded DNA labeled with Cy3 are shown in Fig. 7 (upper left square on each panel). The data obtained for actin are presented in the upper right squares to indicate cell contours. Data for cores are presented in the lower left squares. The merged images are shown in the lower right squares. The accumulation of Cy3-labeled dsDNA in hepatocytes was detected when the polymer contained a directed NAG residue, while minimal uptake by Kupffer cells or accumulation in sinusoidal capillaries of the liver was detected (Fig. 7A). The distribution was almost uniform in different lobes of the liver. Evaluation of other organs revealed the presence of a low level of Cy3 fluorescence in the spleen and kidney, the detected levels were at least 20 times lower than in the liver. Injection of the unconjugated polynucleotide + polymer or replacement of CDM-NAG on the carrier intended for administration with CDM-glucose led to a sharp decrease in hepatocyte uptake and an increased level of absorption by the spleen and kidney (Figs. 7B and C, respectively), which is consistent with low glucose affinity for azialoglycoprotein receptor. Replacing CDM-NAG on a carrier intended for administration with CDM-mannose led to an increase in targeted transfer to macrophages and liver endothelial cells (Fig. 7G).

Quantitative PCR and analysis using the INVADER ^® system (analysis of implementation).

When preparing preparations for quantitative PCR analysis, total RNA (500 ng) was reverse transcribed using SUPERSCRIPT III ^® (Invitrogen) and oligo-dT primers according to the manufacturer's protocol. Quantification was performed using a system for fast real-time PCR, model 7500 (firm Applied Biosystems, Foster City, Calif.). The TAQMAN ^{® system} for analysis of gene expression in the case of apoB and ppara was used to carry out biplex reactions in triplicate using mRNA primers and the GAPDH probe, which are used in the universal master-mix for PCR in the TAQMAN ^® system (Universal PCR Master Mix) (Applied Biosystems). Below are the sequences of primers and GAPDH probe (IDT, Coralville, Iowa):

GAPDH- “direct” primer 5′-AAATGGTGAAGGTCGGTGTG-3 ′, SEQ ID 11;

GAPDH- “reverse” primer 5′-CATGTAGTTGAGGTCAATGAAGG-3 ′, SEQ ID 12;

GAPDH probe 5′-Hex / CGTGCCGCCTGGAGAAACCTGCC / BHQ-3 ′, SEQ ID 13.

The ppara mRNA levels were directly measured using the custom-made INVADER ^® mRNA analysis system according to manufacturer's instructions (Third Wave Technologies, Madison, Wisconsin). The biplex reaction was carried out in triplicate using a set of probes for ubiquitin according to the manufacturer's instructions.

ApoB Western blot analysis, cytokine and liver toxicity and metabolic panel analyzes.

To separate whey proteins (0.1 μl), electrophoresis was used in 3-8% polyacrylamide gels in the presence of SDS. The isolated proteins were transferred electrophoretically to a PVDF membrane and then incubated with a dilution of 1: 5000 rabbit polyclonal anti-ApoB antibody (Biodesign International, Saco, Maine). The blot was then incubated with a dilution of 1: 80,000 goat anti-rabbit antibody conjugated to horseradish peroxidase (Sigma), antibody binding was detected using the chemiluminescence accelerated detection kit (Amersham Biosciences, Piskataway, NJ). Serum levels of murine cytokines TNF-α and IL-6 were determined using a divalent ("sandwich") ELISA using reagents proposed in the manufacturer's instructions (R&D Systems, Minneapolis, Minnesota). Serum levels of murine IFN-α were evaluated using a sandwich ELISA kit according to the manufacturer's instructions (PBL Biomedical, Piskataway, NJ). Serum levels of ALT, ACT, cholesterol and triglycerides were determined using the Marshfield Clinic Laboratories Veterinary Diagnostic Division automated system (Marshfield, Wisconsin).

Serum levels of cytokines and liver enzymes in mice treated with siRNA conjugate

Treatment TNF-α (pg / ml) IL-6 (pg / ml) IFN-α (pg / ml) ALT (u / l) ACT (u / l) Saline 6 h <6 <2 206 ± 51 48 h <6 <2 321 ± 77 60 ± 21 149 ± 21 control siRNA 6 h 7.9 ± 2.9 60.2 ± 2.4 207 ± 86 48 h <6 4.0 ± 1.3 211 ± 16 97 ± 26 176 ± 62 siPHK apoB-1 b h 57.9 ± 7.2 48.6 ± 2.5 494 ± 165 48 h <6 <2 257 ± 70 71 ± 30 144 ± 34 n = 5, data are presented as mean values ± S.K.O.

Example 11. "Shutdown" of target genes in the liver of mice.

To demonstrate the ability of the system to introduce siRNA and “turn off” the expression of the target gene in vivo, a conjugate containing apoB-1 siRNA (800 μg polymer, 50 μg siRNA) was injected into C57 B1 / 6 mice. As in the in vivo directed transfer experiments, the conjugate containing siRNA was introduced by infusion into the tail vein. Mice liver samples were obtained 2 days after injection and apoB mRNA levels were analyzed by quantitative reverse transcriptase PCR (RT-qPCR). ApoB mRNA levels were evaluated relative to the level of GAPDH mRNA and total RNA introduced (in μg) in order to reduce the likelihood of any differences in relative apoB mRNA levels associated with non-specific effects on the expression of constitutive genes. As can be seen in FIG. 8A, when evaluated 2 days after injection in mice treated with siRNA-containing apoB-1 conjugate, apoB mRNA levels were significantly reduced compared with levels found in mice that were given control siRNA not associated with apoB. or in mice that were treated only with saline (n = 5, p <0.00001). In particular, the average level of apoB mRNA in mice injected with the siRNA-containing apoB-1 conjugate decreased by 76 ± 14% compared with the saline-treated group compared to the levels of GAPDH mRNA, and the apoB mRNA levels in mice injected with the control siRNA not changed. Similar results were obtained when evaluating apoB mRNA levels relative to total RNA. Western blot analysis of serum apoB-100 protein levels reflected a decrease in liver apoB mRNA levels (FIG. 8B).

To confirm the specificity of “off” apoB, a separate group of mice was treated with siRNA, the target of which was a different region of apoB mRNA. A significant decrease in apoB mRNA levels was also found in mice that were injected with siRNA-containing apoB-2 conjugate (decrease by 60 ± 6%, n = 5, p <0.00001, Fig. 8A). Western blot analysis of serum apoB-100 protein levels reflected a decrease in liver apoB mRNA levels (Fig. 8A). The expression of apoB mRNA did not decrease in the jejunum, another tissue in which the apoB gene is expressed, suggesting that this tissue is not a target for the conjugate. Tissue-specific activity is consistent with targeted transfer to hepatocytes.

Conjugates containing siRNAs, the target of which is the alpha receptor activated by peroxisome proliferators (ppara), an important gene for controlling the metabolism of fatty acids in the liver (Kersten 1999, Schoonjans 1996), have also been prepared. The introduction of two different siRNAs targeted by ppara led to a pronounced decrease ("off") of ppara mRNA levels, which was analyzed by two independent methods for quantifying mRNA levels (Fig. 8B). Compared to levels in mice treated with control siRNA, ppara mRNA levels in mice treated with siRNA ppara-1 decreased from 40 ± 9% to 64 ± 9% according to data obtained using IINVADER ^® or RT-qPHP, respectively. A similar decrease in ppara mRNA levels was found in mice injected with an administration vehicle containing siRNA ppara-2, the target of which is another region of the ppara mRNA sequence.

The potential toxicity of the administration system was evaluated by serum levels of hepatic enzymes and cytokines. 48 hours after injection, a slight increase in ALT and ACT levels was found in mice that were injected with conjugates containing control siRNA or siRNA apoB-1, compared with levels in mice treated with saline. However, elevated levels were not significant (p <0.05) and histological evaluation of liver sections did not confirm signs of liver toxicity. Similarly, analysis of serum TNF-α and IL-6 levels using ELISA showed that both of these levels increased slightly 6 hours after injection of the siPHK-polymer conjugate, but returned to the baseline after 48 hours. An increase observed after 6 hours it is expected that it cannot cause significant stimulation of the immune system and is at least 4 orders of magnitude lower than levels found during stimulation with lipopolysaccharide (Matsumoto 1998, Matsuzaki 2001), and 1-3 orders of magnitude lower than levels after injection of adenovirus (Lieber 1997 , Benihoud 2007). No significant differences were found in serum levels of INF-α at any time, with the exception of a slight increase 6 hours after injection of siRNA-containing apoB-1 conjugate. These results indicate good tolerance for a targeted transfer system.

Example 12. Dose dependence analysis and phenotypic analysis.

When creating the invention, the dose dependence was studied in two ways: by lowering the amount of siRNA-containing conjugate administered to mice and by keeping the polymer at a constant level, but by reducing the amount of conjugated siRNA. By comparing the results of these experiments, when creating the invention, an attempt was made to determine which of the two components intended for the introduction of the media limited the introduction: endosomolytic polymer or siRNA itself.

Injection of simple serial dilutions of siRNA-containing apoB-1 conjugate to mice led to a progressive decrease in the amount of “turned off” apoB mRNA in the liver (Fig. 9A). When using the highest injection dose (800 μg polymer, 50 μg siRNA, i.e. 2.5 mg / kg), apoB mRNA levels in the liver decreased by 84 ± 5% relative to GAPDH mRNA 2 days after injection compared with mice that were injected only with saline. Similar results were obtained when apoB mRNA levels were evaluated relative to total RNA. Injection of a 2 times lower amount of siRNA-containing conjugate (400 μg of polymer, 25 μg of siRNA) led to a decrease of 50 ± 8% in the relative levels of apoB mRNA. Injection of a 4 times lower amount did not lead to “shutdown” of apoB compared with the control group treated with physiological saline. Maintaining a constant amount of polymer, but reducing the amount of conjugated siRNA apoB-1 in the vehicle intended for administration, led to quantitatively the same results as those obtained using serial dilutions (Fig. 9B). These data suggest that the amount of endosomolytic polymer present in the vehicle intended for administration is not a limiting factor for the “shutdown,” but rather the amount or effectiveness of siRNA conjugated to it is more likely to influence this factor.

The criterion for apoB deficiency is the presence of lowered levels of serum cholesterol due to impaired VLDL assembly (very low density lipoproteins) and cholesterol transport from the liver (Burnett Zimmermann 2006, 02). To solve the question of whether the level of “off” apoB, which is shown in Fig. 10, is sufficient to induce a physiological response in mice, the total serum cholesterol levels were estimated when creating the invention. At the highest dose of siRNA administered (50 μg), a significant decrease in mean serum cholesterol levels (30 ± 7%, n = 5, p <0.001) was found compared to levels in mice that were given the control siRNA or saline alone (Fig. 10). Similar results were obtained for animals treated with siRNA-containing apoB-2 conjugate. A decrease in the amount of siRNA introduced led to a progressive decrease in the amount of low density cholesterol, which is consistent with a decrease in the level of “off” apoB mRNA found in these animals.

Disruption of VLDL assembly in the liver and, as a consequence, a decrease in VLDL export can also lead to a change in hepatic triglycerides, since triglycerides are also included in VLDL particles (Gibbons 2004). Indeed, transgenic mice expressing a shortened form of apoB, which is similar to the shortened version found in patients with familial hypobetalipoproteinemia, also showed a reduced ability to transport hepatic triglycerides (Chen, 2000). To assess the effect of “turning off” apoB on triglyceride transport, the invention was stained with oil red liver sections obtained from mice that were injected with siRNA-containing apoB-1 conjugate. Assessment of liver sections showed a very sharp decrease in the lipid content in the liver compared to control mice (Fig. 11). Panel A shows the results obtained for a mouse treated with siRNA apoB. Panel B shows the results obtained by processing the siRNA GL3 used as a negative control. Panel B shows the results obtained for a mouse that was injected only with saline. These mice also showed reduced levels of serum triglycerides, which is additional evidence of a reduced ability to export hepatic triglycerides. Combined, these results indicate that a simple i.v. injection of siRNA-containing apoB-1 conjugate led to the functional introduction of the polynucleotide into the hepatocyte and, as a result, to “shutdown” the expression of apoB in the liver, which led to the expected phenotypic signs.

To analyze the accumulation of fat in the liver, liver samples obtained from treated with siRNA conjugate and control mice were frozen in OCT freezing medium and sections of frozen tissue (8-10 μm) were obtained according to the method described above. Air-dried tissue sections were fixed in a 4% formaldehyde / PBS mixture for 20 minutes, washed with several replacements with distilled water, and then washed quickly with 60% isopropanol. A stock solution of oil red O was prepared by mixing 0.5 g of oil red O in 100 ml of isopropanol overnight and filtering through Whatman No. 1 filter paper. A working solution of oil red O was prepared by mixing 20 ml of water with 30 ml of a mother solution of oil red O and filtering using a 0.2 μm filter device of the Nalgene type (Fisher Scientific). Fixed sections were stained with a freshly prepared working solution of oil red O for 15 min, quickly washed with 60% isopropanol. For contrast staining of nuclei, a 7-fold immersion of glass slides in a Harris-modified hematoxylin solution (Sigma, St. Louis, Missouri) and washing in distilled water were used. The washed glass slides were then poured onto the medium using Mount gel (Biomedia Corp., Foster City, Calif.). Stained glass slides were analyzed using a Zeiss Axioplan 2 type microscope equipped with a digital camera (Axiocam type, Carl Zeiss). Digital images were recorded using the Axio Vision software (Carl Zeiss).

Example 13. The introduction of siRNA through conjugation with a membrane-active polymer using CDM or a disulfide labile bond.

Disulfide-linked conjugate: 50 ng siRNA, the target of which is the luciferase gene, which has an amino group at the 5′-end of the sense strand, was reacted with 1 μg of N-succinimidyl-S-acetylthioacetate in the presence of a HEPES base, pH 7.5. Separately, 50 μg of polyvinyl ether synthesized from a mixture of 50/50 monomers of vinyl ether with protected amine and butyl vinyl ether was separately synthesized, which was reacted with 5 μg of 3- (2-pyridyldithio) propionic acid N-hydroxysuccinimide ester, pH 7.5. Then, the modified siRNA and the modified polymer were combined, allowing covalent attachment of the siRNA to the polymer. After 6-24 hours, the polymer-siRNA conjugate was reacted with 200 μg of 2-propionic-3-methyl-maleic anhydride in the presence of a HEPES base. Particles were added to murine hepatocytes of the HEPA line, which stably expressed the luciferase gene. As a control, a CDM-modified polymer (without siRNA) was added to the cells. In cells treated with the polymer-polynucleotide conjugate, luciferase expression was inhibited by 75% relative to cells treated with the polymer alone, indicating the introduction of functional siRNA into the cells.

CDM-linked conjugate: 50 ng siRNA, the target of which is the luciferase gene, which has an amino group at the 5′-end of the sense strand, is reacted with 2 μg of CDM thioester in the presence of HEPES pH 7.9. 50 μg of polyvinyl ether synthesized from a mixture of 50/50 protected vinyl amine monomers and butyl vinyl ether was added to siRNA. After 6-24 hours, the polymer-siRNA conjugate was reacted with 200 μg of 2-propionic-3-methyl-maleic anhydride in the presence of a HEPES base. Particles were added to murine hepatocytes of the HEPA line, which stably expressed the luciferase gene. As a control, a CDM-modified polymer (without siRNA) was added to the cells. In cells treated with the polymer-polynucleotide conjugate, luciferase expression was suppressed by 86% relative to cells treated with the polymer alone, indicating the introduction of functional siRNA into the cells.

Percentage of Inhibition of Luciferase Activity after Transfection of HEPA-Luc Cells with Conjugates: Polymer-siRNA Membrane-Active

Disulfide-linked conjugation CDM conjugation 75% 86%

Example 14. The duration of "off" apoV and its phenotypic effect.

When creating the invention, a lengthy experiment was carried out with the aim of determining the duration of “shutdown” of apoB and lowering the cholesterol level in mice after injection of a dose containing siRNA apoB-1 conjugate. In accordance with the results described in the previous examples, injection of siRNA-containing apoB-1 conjugate (800 μg polymer, 50 μg siRNA) after 2 days resulted in a decrease in average apoB mRNA levels of 87 ± 8% relative to control mice (Fig. 12A). The decrease in apoB expression was accompanied by a decrease of 42 ± 5% in total serum cholesterol levels (Fig. 12B). The decrease in the expression of apoB mRNA persisted to a significant extent for 10 days and returned to the level close to the control one by the 15th day. The decrease in serum cholesterol levels remained at a reliable level for 4 days (n = 5, p <0.01) and did not completely return to control levels until day 10. These results indicate a long-term “shutdown” of apoB and the creation of a phenotype that can be obtained after a single injection of siRNA-containing conjugate, and that the phenotype can be reversed over time when the expression of apoB returns to normal.

Example 15. The introduction of phosphorodiamidate morpholino oligonucleotide (PMO) into cells using polymer-PMO conjugates.

Using the main cross-linking agent CDM-thioether used to couple siRNA and polymer, reversible conjugates of other types of oligonucleotides and polymers can also be obtained. In particular, when creating the invention, the introduction of PMO into cells was studied. 5 nmoles of amino-PMO (which blocks the mutant splicing site in the mutant luciferase transcript), either native (naked) or hybridized with a complementary DNA strand, was reacted with 2 μg of CDM thioether in the presence of HEPES pH 7.9 or not subjected to the specified interaction. 200 μg of polyvinyl ether synthesized from 50% aminovinyl ether, 45% butyl vinyl ether and 5% dodecyl vinyl ether (DW550) was added to carry out the reaction. After 3 or more hours, the polymer + PMO or polymer-PMO conjugate was reacted with 500 μg CDM in the presence of HEPES to maintain a pH> 7.5. In addition to CDM, the conjugates were reacted with CDM PEG esters, which were prepared from CDM chlorides and PEG monomethyl ethers of different molecular weights. Then the conjugates were added to HeLa Luc / 705 cells (Gene Tools, Filomat, Oregon) grown under the conditions adopted for HeLa cells. Cells were seeded in 24-well culture plates with a density of 3 × 10 ⁶ cells / well and incubated for 24 hours. The media was replaced with 1.0 ml of DMEM containing 2.5 nmoles of amino-PMO complexes. Cells were incubated for 4 hours in a humidifying 5% CO ₂ incubator at 37 ° C. Then the medium was replaced with DMEM medium containing 10% fetal bovine serum. Cells were incubated for another 48 hours. Then the cells were collected and lysed and luciferase expression was analyzed in lysates. The results demonstrate an increase in the administration of an uncharged polynucleotide when the transfection agent is a conjugate of a polymer comprising a DW550 polyvinyl ether and PMO.

Introduction of uncharged polynucleotides into cells Transfection carrier Multiplicity of luciferase induction lack of communication DW550 + “naked” RMO 2 DW550 + PMO DNA hybridized 2 polymer-RMO conjugate DW550-CDM- “naked” RMO 7.5 DW550-CDM Hybridized PMO 10

Example 16. The introduction of the conjugate containing siRNA in the muscle. 40 μg siRNA PPARa or control (GL3) siRNA conjugated with a PBAVE polymer and masking groups were introduced according to the method described above. 250 μl of conjugate was injected into the gastrocnemius muscle of mice (n = 3). The injection rate was approximately 25 μl / s. PPARa expression levels were determined as described above.

Inhibition of PPARa in muscle after direct injection of masked conjugate

SiPHK conjugate PPARa mRNA levels relative to: GAPDH mRNA total mRNA GL3 1.00 ± 0.26 1.00 ± 0.15 PPARa 0.62 ± 0.07 0.54 ± 0.13

Example 17. In vivo administration of siRNA expression cassettes. 20 μg of the linear siPHK SEAP expression cassette created by PCR, which expresses siRNA SEAP under the control of the U6 promoter, was combined with 400 μg of membrane-active DW1453 polymer (which was obtained by polymerization of 75 mol% amino, 21 mol% ( lower.) alkyl (butyl) and 4 mol.% (higher) alkyl (C18, octadecyl) groups and modified with galactose using lactobionic acid (LBA)). Lactobionylation was carried out by adding 43 mg of LBA to 60 mg of polymer followed by 34 mg of EDC and 24 mg of NHS. As a control, a cassette expressing siRNA of luciferase (GL3) was also created. DNA was conjugated to the polymer by adding 0.65 wt. glutaraldehyde equivalents. After conjugation overnight, the complexes were modified with 40 mol% NHS acetate to restore polymer charge.

500 μg of lactotionylated DW1453 was modified using 7 wt. equivalents of the masking agent CDM-PEG (average 10 units) in the presence of 14 wt. equivalents of HEPES base and were injected into the tail vein of mice expressing secreted alkaline phosphatase (SEAP). 10 minutes after the injection of the masked polymer, DNA-polymer conjugates DW1453 intended for co-targeted administration were injected. Blood samples were taken on day 1 and 14 and SEAP levels were analyzed.

siPHK SEAP activity after 14 days relative to activity on day 1 siPHK SEAP 48 ± 13 siPHK GL3 87 ± 17

Activity is presented as the average value for 4 animals ± standard deviation.

Example 18. The introduction of antibodies.

35 μg of rabbit IgG antibody (Sigma) modified 2 wt.% SPDP (Pierce). DW1360 (30 mg / ml in 5 mM TAPS, pH 9) was modified by adding 2 wt.% Iminothiolan. 530 μg of imminothiolan-PBAVE was added to 400 μl of an isotonic glucose solution containing 5 mM TAPS, pH 9. To this solution, 35 μg of SPDP-modified antibody was added. After 16 hours, the antibody-polymer conjugate was modified with 7 wt. eq. 2: 1 mixtures of CDM-NAG and CDM-PEG. The conjugate was injected into the tail vein of the mouse. 20 minutes after the injection, the mouse was sacrificed and the liver was seized and processed for microscopic analysis. Evaluation of liver tissue showed significant accumulation of antibodies in hepatocytes (Fig.13). The upper left square shows the results for labeled antibodies, the upper right square - for actin, the lower left square - for nuclei and the combined image is shown in the lower right square.

Example 19. A masked polynucleotide-polymer conjugate as an in vitro transfection reagent.

Primary hepatocytes were obtained from adult mice (C57BL / 6 line) using the previously described two-stage collagenase perfusion procedure (Klaunig 1981). The viability of hepatocytes was 85-90% according to the trypan blue exclusion method. Hepatocytes were plated at a density of 1.5 × 10 ⁵ cells per well in collagen-coated 12-well plates in 1 ml of medium containing 10% fetal calf serum. Twenty four hours after plating, cells in triplicate wells were transfected without replacing siRNA medium using TRANSIT-SIQUEST ^® (Mirus Bio, Madison, Wisconsin) according to the manufacturer's protocol or using different amounts of siRNA conjugate. Hepatocytes were harvested 24 hours after transfection and total RNA was isolated using TRIREAGENT ^® reagent (manufactured by Molecular Research Center, Cincinnati,. OH).

To demonstrate the ability to transfect in vitro the described masked polynucleotide-polymer conjugates specific for apolipoprotein B (apoB) siRNA was introduced into primary hepatocytes using commercially available siRNA transfection reagents or the described polynucleotide conjugates. Transfection of primary hepatocytes with the conjugate was highly effective, leading to "shutdown" of approximately 80% of apoB mRNA (Fig. 14). The level of siRNA administration, evaluated by “turning off” the target gene, was compared with the level using the commercially available SIQUEST ^® reagent. As expected, a decrease in the amount of conjugate added to the cells led to a progressive decrease in “shutdown” of apoB.

Example 20. Masked polynucleotide-polymer conjugate as an in vitro transfection reagent.

Hera-1c1c7 cells were transfected with plasmids encoding firefly and sea feather luciferase (Renilla) using TRANSIT LT1 ^® (Minis Bio). Four hours after plasmid transfection, 100 ng of siRNA luciferase conjugated to 9 μg PD-PLL and then modified with CDM-Pip-LBA (45 g) was added to the cells. In some samples, modified CDM-Pip-LBA 25/75-PBAVE (5 μg) was also added to the cells. 48 hours after the addition of siRNA, cells were harvested and analyzed for firefly luciferase and marine feathers. Firefly luciferase expression levels were standardized with respect to marine feather luciferase expression levels for each sample and relative to the level in cells that were not treated with siRNA for each group. Conjugates containing only PLL-siRNA did not possess the ability to introduce siRNA into cells in vitro (white column, FIG. 15). The addition of maleate disguised as a membrane lytic membrane polymer PBAVE led to an activity similar to that of a commercially available transfection reagent (black column). In general, transfection of DNA and siRNA probably requires an excess of reagent. An excess of the release polymer described above necessary for interaction with siRNA can enhance functional in vitro and in vivo administration (release from endosomes). Due to the close size and charge of the siPHK-polymer conjugates and polymers, they can simultaneously carry out targeted transfer to hepatocytes in vivo. In confirmation of this position, it was found during the creation of the invention that when co-injected with Cu3-labeled siRNA conjugated with PLL, and Oregon Green-labeled polymer 25/75-PBAVE did indeed co-localize in hepatocytes (see above).

The in vitro activity of siRNA conjugated to administering polymers is the same as that of unconjugated siRNA, for the transfection of which a commercially available TRANSIT TKO ^® reagent was used (FIG. 15). Parallel experiments using an irreversible bond of siRNA and a polymer based on iodoacetamide alkylation (IA conjugate, indicated by the dots in the column in Fig. 15) showed that the conjugates of the siRNA polymer are not active if the conjugation is not reversible, suggesting that the disulfide bridge must be restored for the functional administration of siRNA (the detected 20% “shutdown” is due to the fact that approximately 10% of the oligonucleotides were not conjugated, which was established by gel analysis). The detected activity of maleamylated conjugates suggests that even if the polymer is no longer positively charged and interacts with the oligonucleotide by electrostatic forces, the siRNA conjugate is resistant to serum cleavage. Modified nuclease-resistant siRNA analogues may also be used.

Example 21. Labile bonds for attaching masking agents and polynucleotides to a membrane-active polymer.

A. pH labile bond with the PEG spacer. One of the variants of the ligand group, the target of which is ASGP-R, can be obtained as follows:

(aminoethoxy) ethyl derivatives

2-acetamido-3,4,6-tri-O-acetyl-2-deoxy-β-D-galactopyranoside

N-acetyl-galactosamine-PEG-methylmaleic anhydride

Compound I was used as a precursor to create a compound II that carries a galactose-containing targeted transfer group of a masking agent that has the ability to reversibly modify amine-containing membrane-active polymers such as PBAVE polymers. The interaction of maleic anhydride with an amino group on polymers leads to the formation of a pH-labile bond between galactose and the polymer. Modification of the PBAVE polymer with compound II results in:

Modification of the PBAVE amino groups by compound III (molar ratio of 0.75: 1 of compound III and the polymer amine) and CDM-PEG ₅₀₀ (molar ratio of 0.25 of CDM-PEG and the polymer amine) resulted in a conjugate that was capable of providing targeted transfer to hepatocytes in vivo. When using spacer ethylene groups of various lengths (n = 1, 2, 3, or 7) in all cases, the introduction of siRNA into hepatocytes in vivo was effective, as evidenced by the "shutdown" of the expression of the target gene.

B. pH-labile bond with an alkyl spacer. The alkyl spacer groups illustrated in compound V can also be used. However, the alkyl spacers increase the hydrophobicity of the masking agent, resulting in less solubility of the masking agent and conjugate.

masking agent, which is an _{N-acetylgalactosamine-6} C -metilmaleinovy anhydride

B. Multivalent directional transfer groups.

Groups with higher valency can also be used that provide directional transfer. Examples of multivalent galactose-containing groups that provide directional transfer groups are given below. Divalent (VI) and trivalent (VII) galactose-containing ligands may have a higher affinity for ASGP-R.

D. Negatively charged directional transfer ligands. Related directed transfer groups that have significantly lower affinity for the target cell can be used as a negative control in determining the effectiveness of preferred directed transfer groups. For example, hepatocyte ASGP-R binds to galactose but does not bind to glucose. Thus, glucose-containing groups that provide directional transfer of group (VIII) can serve as a negative control in assays evaluating directional transfer to cells.

D. A mannose containing directional transfer group.

Kupffer's macrophages and liver cells are known to carry receptors that bind to mannose-containing saccharides. Therefore, providing directional transfer groups with residues of mannose (IX) can be used for directional transfer to these cells.

E. Relations with various lability. Relationships with different lability (from the point of view of cleavage kinetics) can be used to connect a masking agent or polynucleotide with a membrane-active polymer.

To introduce antisense polynucleotides, the “shutdown” duration can be increased by reducing the rate of release of the polynucleotide from the conjugate. You can create disulfide bridges with different kinetic characteristics of cleavage in a reducing environment typical of mammalian cells. Slower release of the masking agent from the polymer can lengthen the in vivo residence time of the conjugate. For example, 5-methyl-2-imminothiolane (M2IT, bond X) is characterized by a 4 times slower cleavage rate than the SMTP bond (compound XI).

It is expected that the cleavage rate of compound XII will be about 30 times slower than disubstituted bonds formed with malenoyl anhydride.

Example 22. Characterization of PBAVE and Polynucleotide-PBAVE Conjugates

A. Analysis of amphipathicity. The fluorescence of 1,6-diphenyl-1,3,5-hexatriene (DPH, Invitrogen) (λ _ex = 350 nm; λ _em = 452 nm) increased in a hydrophobic medium. This fluorophore was used to analyze PBAVE polymer (DW1360). 0.5 μM (final concentration) DPH was added to 10 μg PBAVE in the presence of 40 μg plasmid DNA in 0.5 ml of 50 mM HEPES buffer, pH 8.0 or without plasmid DNA. Then, the accumulation of DPH in a hydrophobic medium was evaluated in solution by determining the fluorescence of DPH. The increase in DPH fluorescence in the presence of conjugates indicated the formation of a hydrophobic medium using a polymer. Adding excess did not lead to a significant change in the fluorescence of DPH (Fig. 16).

B. Molecular mass. The molecular weight of DW1360 was determined using HPLC gel filtration and using a set of polyethylene glycols as standards (American Polymer Standard Corp.). The polymers were separated using GPC GHUR on a Shodec SB-803 HQ column using 0.2 M LiClO ₄ , 5% AcOH in methanol for elution. Elution of the PBAVE polymer from the column revealed that the average molecular weight of the polymer was approximately 12.8 kDa (FIG. 17)

B. Molecular Weight of Polynucleotide-Polymer Conjugate The molecular weight of the masked polynucleotide-polymer conjugate was determined using FPLC- (liquid chromatography fast resolution) gel filtration and using labeled with Cy3 nucleic acids as standards. The conjugate and standards were separated using Shimadzu-FPLC on a 1 × 22 cm Sephacryl S-500 column and eluted with 50 mM HEPES, pH 8.0, at a rate of 1 ml / min. Elution of the conjugate from the column allowed us to establish that the average molecular weight of the polymer was approximately 77 kDa (Fig. 18).

G. Stoichiometry of conjugates. It was experimentally established that the average molecular weight of the PBAVE polymer was approximately 13 kDa. It was experimentally established that the average molecular weight of the masked polynucleotide-polymer conjugate was approximately 77 kDa. It was experimentally established that the average molecular weight per charge (amine) of the PBAVE polymer was approximately 200 Da. It is estimated that the average molecular weight of the CDM masking agent should be approximately 550 Da. It was experimentally established that the average degree of modification of the PBAVE polymer was approximately 75% of the content of available amino groups. It was estimated that the average molecular weight of conjugated siRNA should be approximately 14 kDa. Based on these values, it was calculated that the average molecular weight of the PBAVE polymer masked with a masking agent should be approximately 30 kDa. Thus, it was found that a close to stoichiometric ratio of siRNA and masked polymer was approximately 1: 2.

D. Particle size and zeta potential. In vivo injectable conjugate sizes were determined by scattering light at 532 nm using a 190 Brookhaven Instruments Corporation ZetaPlus Particle Sizer device. Unimodal peak analysis was performed at a wavelength of 100 to 30 nm. Using multimodal analysis, it was found that the peak corresponding to the largest number (> 95%) of particles included particles smaller than 50 nm and more preferably less than 20 nm. The size of the polyconjugates can also be determined by analytical ultracentrifugation or atomic force microscopy. At the same time, the zeta potential of the conjugates was measured using a Brookhaven Instruments Corporation ZetaPALS device. The zeta potential of masked CDM conjugates ranged from 0 and -30 mV and mainly from 0 and -20 mV. Zeta potential was measured in an isotonic glucose solution buffered to pH 9 with 5 mM TAPS. Stable aggregate-forming conjugates were also formed when the zeta potential was from 0 to -10 mV and from 0 to -5 mV under the same conditions. It can be expected that at pH 7 the conjugates will acquire a certain positive charge as a result of protonation of a part of the amines.

Example 23. In vivo administration of the conjugate to athymic mice bearing a human hepatoma xenograft. To demonstrate that the conjugates described can be used for targeted transfer to a target tumor cell, a conjugate containing oligonucleotide-DW1360 modified with CDM-NAG was injected into mice that were implanted subcutaneously (SC) into the side of a HepG2 human hepatocarcinoma cell. Six-week nude female mice were obtained from Harlan Spraque Dawley (Indianapolis, Indiana). 2 million HepG2 cells were inoculated with mice in 300 μl PBS subcutaneously in the left flank. As a control, NT-29 colon carcinoma cells (2 million in 300 μl PBS) were inoculated with SC in the right flank after 2 weeks. The last injection was performed to compensate for a higher growth rate. When SC-introduced tumors reached approximately 8 mm in width and length, a conjugate modified with CDM-NAG or CDM-PEG containing 10 μg of Cy3-labeled 21-dimensional dsDNA in 200 μl of injection buffer was injected through the tail vein.

A high (in%) level of accumulation of NAG-labeled conjugate was found in the mass of SC-hepatoma (30-60%, n = 4, Fig. 19A). A representative area of tumor cells in which uptake is detected is shown in FIG. 19A. A very low level of directional transfer to the tumor was detected when a conjugate was administered to mice in which glucose was used as an agent for directional transfer (Fig. 19B, <5% of the tumor mass, n = 3). In control colon carcinoma tumors that did not have a galactose receptor, no signal was detected in the cells either using modified NAGs or using glucose-modified conjugates (Fig. 19 B-D, n = 2). Similar results were obtained when using a HuH-7 hepatocarcinoma cell to create a xenograft.

Example 24. Modification of the polymer using a reversible PEG-modification before conjugation. 400 μg of DW1360 polymer (when creating, the loading ratio of amine: butyl: octadecyl vinyl ethers 75: 20: 5 was used) was modified using 1.5 wt.% SMPT. After 1 h, 2 wt. the equivalent of a 2: 1 mixture (wt.: wt.) CDM-NAG (N-acetylgalactosamine) and CDM-PEG (average 11 units) in the presence of 5.6 mg of HEPES base. To this solution was added 20 μg of SATA / Cy3-modified 22-dimensional DNA oligonucleotides. After incubation overnight, 5 wt.% Was added to the conjugate. equivalents of a 2: 1 mixture (wt.: wt.) CDM-NAG and CDM-PEG. The masked conjugate was injected into 400 μl of saline into the tail vein of the mouse. It was found that modifying the polymer with CDM-NAG and CDM-PEG before conjugation did not reduce the efficiency of conjugation. After 1 h after injection, the liver was removed and sections of the frozen liver were prepared and processed for immunohistochemical analysis. To stain cell nuclei, TO-PRO-3 ^{® was used} . After injection into the tail vein of mice, a labeled oligonucleotide was found in hepatocytes.

Example 25. Quantification of amino groups in the conjugate after modification using a CDM reagent. The DW1360 oligonucleotide-polymer conjugate was synthesized according to the previously described method, followed by 14 wt. equivalents of HEPES base and 7 wt. equivalents of a 2: 1 mixture (wt.: wt.) CDM-NAG and CDM-PEG (average 11 units). After 1 h, the amine content in the treated maleic anhydride derivative was evaluated using trinitrobenzenesulfonic acid (TNBS) treatment in 100 mM NaHCO ₃ . When compared with a conjugate that was not modified with maleamate, it was found that the number of modified amino groups was approximately 75% of the total. The indicated degree of modification can be changed by changing the amount of maleic anhydride added.

Example 26. Electrophoresis of the conjugate oligonucleotide-polymer and its obtained using maleic anhydride derivatives. Conjugates of the oligonucleotide polymer DW1360 were prepared according to the previously described method. Then the conjugate containing 1 μg of the oligonucleotide was modified with various amounts of CDM-PEG (an average of 11 units) and CDM-NAG. Then the conjugates were added to agarose gels (2 wt.%) And subjected to electrophoresis. When staining with ethidium bromide, it was found that the charge of the conjugates changed depending on the number of equivalents of the maleic anhydride derivative from positive to neutral and negative.

The above description is given only to illustrate the principles of the invention. In addition, since various modifications and changes can be made to the invention that are obvious to those skilled in the art, the invention should not be limited to the particular construction and operation described. Thus, all acceptable modifications and equivalents fall within the scope of the invention.

Claims (18)

1. A composition intended for introducing a molecule into a cell that contains a conjugate of the formula
NL ¹ -P- (L ² -M) _y ,
in which N denotes not having the ability to penetrate through the membrane of a molecule or a molecule with a low ability to penetrate through the membrane,
L ¹ denotes the first reversible coupling containing labile under physiological conditions,
P denotes a polymer having activity against the membrane,
L ² is a second reversible linkage containing an orthogonal physiologically labile bond,
M denotes a masking agent selected from the group comprising steric stabilizers that provide directional transfer of the group and charge modifying agents, and
y is an integer greater than 0. 2. The composition according to claim 1, in which the molecule is selected from the group comprising: polynucleotide, protein, peptide, antibody and not having the ability to penetrate through the membrane of the drug. 3. The composition according to claim 2, in which the polynucleotide is selected from the group comprising: a modified polynucleotide, DNA, RNA, siRNA, siRNA, and expression cassette. 4. The composition according to claim 1, in which the polymer has a mass exceeding 10 kDa. 5. The composition according to claim 4, in which the membrane-active polymer is a polyamine. 6. The composition of claim 5, wherein the membrane-active polyamine consists of a random polyvinyl ether random copolymer. 7. The composition according to claim 6, in which the random copolymer of polyvinyl ether consists of three or more different monomers. 8. The composition according to claim 7, in which three or more different monomers include a monomer comprising an amine-containing vinyl ether monomer, a monomer representing a lower alkyl vinyl ether, and a monomer representing a higher alkyl vinyl ether. 9. The composition of claim 8, in which the monomer in the form of a simple lower alkyl vinyl ether, is a monomer in the form of a simple butyl vinyl ether, and the monomer in the form of a simple higher alkyl vinyl ether, is a monomer in the form of a simple octadecyl vinyl ether or a monomer in the form of a dodecyl vinyl ether ether. 10. The composition according to claim 1, in which the polymer is a biodegradable polymer. 11. The composition of claim 10, in which the first reversible and second reversible linkages contain labile under physiological conditions, bonds that are independently selected from the group including: labile under physiological conditions, labile under physiological conditions of the cell, labile under certain pH values, a bond very labile at certain pH values, extremely labile at certain pH values, a maleate bond, an enzymatically cleavable bond and a disulfide bond. 12. The composition according to claim 1, in which y represents 2 or a number greater than 2. 13. The composition of claim 12, wherein the masking agents are the same or different. 14. The composition according to item 13, in which at least one of the masking agents contains a directional transfer group selected from the group including: a compound that has affinity for a molecule located on the cell surface, a ligand of a cell receptor, an antibody that has affinity to a molecule located on the cell surface, a saccharide, galactose, galactose derivative, N-acetylgalactosamine, mannose, mannose derivative, vitamins, folate, biotin, aptamer, peptide, RGD-containing peptide, insulin and EGF. 15. The composition of claim 14, wherein the masking agents are independently selected from the group consisting of: dimethyl maleic anhydride, carboxy dimethyl maleic anhydride (CDM), CDM thioether, derivatives of CDM, CDM stabilizers of steric configuration, CDM PEG, CDM ligand, CDM β-galactose, CDM-lactobionic acid (LBA), CDM-Pip-LBA and CDM-NAG. 16. The composition according to claim 1, which also contains an excess of polymer. 17. The composition according to claim 1, in which the conjugate has a zeta potential of from +30 to -30 mV at pH 7. 18. The composition according to claim 1, in which the diameter of the conjugate is less than 20 nm.

Images