RU2425149C1 - Method of cell selection in vivo by using lysomustine - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: one or more genetic makers containing a gene of a MGMT enzyme mutant form (O6-methylguanine DNA-methyltransferase) resistant to O6-benzylguanine inhibitor inhibiting action of a MGMT natural form, and also a nucleotide sequence exhibiting therapeutic action are introduced into cells. The cells modified in such a way are transplanted into a body, thereafter said inhibitor, and then lysomustine isomer 2 or mixed lysomustine isomers 1 and 2 which inhibit autologous cell reproduction thereby inducing modified cell selection are introduced in the body.

EFFECT: invention provides more effective selection of the modified cells and allows higher safety and efficiency of the method of cell selection ensured by using lysomustine characterised by lower toxicity.

4 cl, 9 dwg, 1 ex

Description

Gene and cell therapy strategies are promising approaches for the treatment of numerous diseases that are currently difficult to treat with traditional methods or are not curable at all. Nevertheless, the effectiveness of these approaches is currently low, which is due, firstly, to the relatively low efficiency of introducing gene therapeutic constructs into cells in vitro and especially in vivo and, secondly, to the competition of transplanted cells of modified cells on the cell side organism. Of particular interest is gene therapy associated with the use of blood stem cells (CCMs), which is a promising approach for the correction of numerous blood and bone marrow diseases. Numerous works have been devoted to the use of CCM transduction using viral vectors, however, in practice, most of these methods remain complex and unreproducible, and most importantly insufficiently effective. In the current state of technology, one of the most effective ways to increase the efficiency of using gene therapy approaches is the selection of cells containing therapeutic constructs. Such selection can be carried out in vitro during cell culture after the introduction of therapeutic constructs. However, in vivo selection of cells seems to be the most promising, which could significantly increase the proportion of cells bearing therapeutic constructs. Nevertheless, in vivo cell selection is a much more difficult technical task, since the selection procedure must be tolerated by the body and have minimal toxicity. Currently, there are several methods for conducting cell selection in vivo. In particular, selection is applied by introducing into the cells constructs expressing the multidrug resistance gene (MDR1) (Schiedlmeier et al., 2000, Abonour et al., 2000), the dihydrofolate reductase gene (Allay et al., 1998) or the cytidine deaminase gene (Richara et al., 2004). The most promising approach and the closest analogue of the present invention is a method based on the use of a gene encoding the O6-methylguanine DNA methyltransferase (MGMT) enzyme for cell selection in vivo, which provides cell resistance to alkylating agents such as temozolomide or 1,3-bis (2-Chloroethyl) -1-nitrosourea (BCNU), forming O6-DNA alkyl derivatives (Pegg, 2000). For selection, mutant enzyme forms are used that are resistant to certain MGMT inhibitors, such as O6-benzylguanine (BG). The literature describes several MGMT mutants that are resistant to BG due to specific amino acid substitutions (Davis et al., 1999). The possibility of using such mutants for the selection and propagation of HSCs carrying the marker gene in combination with the combined processing of BG recipients and alkylating agents has been shown in a mouse model (Davis et al., 1997, Cai et al., 2008), xenografts (Pollok et al., 2003, Zielske et al., 2003) and on the model of large animals (Neffet al., 2003, Larochelle et al., 2009).

Despite the fact that BCNU / BG treatment leads to effective in vivo amplification of cells carrying the mutant MGMT gene (Cai et al., 2008, Pollok et al., 2003), numerous studies have been devoted to the study of possible side effects and the development of optimal protocols for the administration of alkylating drugs (Sawai et al., 2003, Sorg et al., 2007, Kisby et al., 2009). In particular, there is a problem of toxicity of the used alkylating agents (Larochelle et al., 2009), which urges the development of approaches associated with the use of drugs with minimal toxicity, which can reduce myelosuppression, cytopenia and the risk of oncogenic transformation.

The objective of the invention is the selection of cells in vitro and in vivo using alkylating agents with reduced toxicity.

The problem is solved using the well-known and approved for use in medicine drug lysomustine (2-chloroethylnitrosoureide derivative of the amino acid lysine) (state registration number P No. 000127 / 01-2000) for selection of cells with introduced constructs, one of which expresses a mutant form of the MGMT enzyme that is resistant to the action of inhibitors that suppress the natural form of the enzyme, in particular, resistant to the action of an inhibitor of O6-benzylguanine. After the introduction of an O6-benzylguanine inhibitor into the body, lysomustine inhibits the reproduction of the body's own cells, in particular hematopoietic cells, as a result of which selection of genetically modified cells carrying any nucleotide sequence that has a therapeutic effect occurs. A therapeutic nucleotide sequence can express a protein having a therapeutic effect, or RNA (e.g., antisense RNA, short hairpin RNA, or miRNA) that inhibits the expression of a particular protein. Lysomustine is a mixture of isomers of the position of the nitroso group: A) (S) -2-amino-6- [N-nitroso-N - [[(2-chloroethyl) amino] carbonyl] amino] hexanoic acid; B) (S) -2-amino-6 - [[[N-nitroso-N- (2-chloroethyl) amino] carbonyl] amino] hexanoic acid. Clinical studies have shown that the drug is well tolerated and is highly effective against malignant melanoma, lymphosarcoma, as well as in the treatment of patients with lung cancer. Lysomustine has a proven reduced toxicity in clinical use compared with other alkylating agents, which allows us to consider it appropriate for severe patients, elderly patients and in outpatient settings.

The proposed method for the selection of genetically modified cells can be used to carry out replacement therapy of pathological conditions associated with impaired functioning of cells in the body, in particular with impaired functioning of hematopoietic cells (HA) and the immune system, as well as metabolic diseases associated with cells of the circulatory system. The proposed method is a new use of lysomustine.

The technical result is an expansion of the arsenal of means of this action and a decrease in the toxicity of an alkylating agent.

Application examples

Figure 1 shows the formulas of the two isomers of lysomustine.

Lysomustine is an antitumor drug from the group of nitrosoalkylureas (NAM), which is a mixture of isomers of the position of the nitroso group: (S) -2-amino-6- [N-nitroso-N - [[(2-chloroethyl) amino] carbonyl] amino] hexane acid (1) and (S) -2-amino-6 - [[[N-nitroso-N- (2-chloroethyl) amino] carbonyl] amino] hexanoic acid (2).

The isomers of the position of the nitroso group, 1 and 2, which are part of lysomustine, have different antitumor activity. Isomer 2 has greater antitumor activity. Clinically, a mixture of isomers 1 and 2 is used, which also has significant antitumor activity, but has a wider dose range.

To study the possibility of using lysomustine and its isomers for cell selection, experiments were first conducted on a cell culture, where protocols were worked out and the created expression vectors were checked. For this, a series of genetic constructs containing the mutant form of MGMT (MGMTm) was created. MGMTwt cDNA was obtained using the MGC clone (Opened Biosystems, BC000824) using the oligonucleotides TCATGGATCCAAGCCACCATGGACAAGGATTGTGAA and ATTAGAATTCACATACTCAATTGCGGCCAGCAGG. The mutation encoding the replacement of proline with lysine at position 140 (P140K) was introduced by PCR using oligonucleotides: GGCAATCCTGTCAAGATCCTCATCCCG and CGGGATGAGGATCTTGACAGGATTGCC, after which the mutation was confirmed by sequencing. To create a mutant form of MGMT fused at the C- and N-terminus with the FLAG epitope (DYKDDDDK), the epitope was introduced by PCR. All cDNAs were cloned into pLenti6V5 (Invitrogen, Carlsbad, CA), pMigRI (Pear et al., 1998) or pLeGo-G2 (Weber et al., 2008) vectors to obtain N-terminal cross-linking with FLAG in the pMigRI vector (FM vector ) and C-terminal crosslinking with FLAG in pLeGo-G2 (vector MF). To obtain the G2AMF vector, peptide 2A of the FMDV virus was obtained by paired annealing of two pairs of oligonucleotides: CTGTCAAACAAACTCTTAACTTTGATTT and GTTTGAGTAAATCAAAGTTAAGAGTTTGTT, ACTCAAACTGGCTGGGATGTAGTAGTAGTAGAAGTAG The resulting fragment was cloned into the pEGFP-C1 vector (Clontech) in a common open reading frame with the EGFP gene, which serves at this stage as a model of a therapeutic nucleotide sequence that corrects a hypothetical anomaly in the cell. The fluorescence of the model EGFP protein is an indicator of its amount in the cell, and the percentage of fluorescent cells in the recipient organism is an indicator of the degree of propagation of genetically modified HA in it. After that, the cassette containing EGFP-2A-MGMTm-FLAG was cut out and inserted into the pLeGo-G2 vector in place of the EGFP.

To evaluate the enzymatic activity of mutant variants of MGMT, a wild-type enzyme (MGMTwt), as well as a mutant form insensitive to the action of BG fused to the peptide epitope FLAG, was cloned into pLenti6V5 vector. Next, a series of experiments was performed on transient transfection of cells with the obtained vectors. K562 cells expressing EGFP or MGMTwt were not resistant to the combined action of BG and BCNU, in contrast to the mutant form (Figure 2). In addition, the addition of a short FLAG epitope did not decrease MGMTm activity, which made it possible to determine its presence by flow cytometry using anti-FLAG antibodies.

To obtain lentiviral particles, HEK293FT cells (Invitrogen) were transfected using linear polyethyleneimine with packaging plasmids pMDLg / pRRE, PRSV-Rev (Addgene, Cambridge, MA), a plasmid encoding the envelope pVSV-G (Invitrogen), and a vector carrying the corresponding MGMT form . The conditioned medium containing viral particles was collected 24-72 hours after transfection, filtered and centrifuged at 28,000 rpm of the rotor for 2 hours at + 4 ° C. The pellet was resuspended in 1/100 of the original volume and stored at -70 degrees in aliquots. To obtain retroviral particles, the packaging cells of line 293.1 were transfected with the packaging plasmid, as well as with the FM vector, and the supernatants were collected after 36 hours.

K562 cells or primary mouse bone marrow culture were resuspended in serum-free medium and initially incubated with 0 or 20 μM BG for 1.5 hours at 37 ° C, and then with various concentrations of lysomustine or BCNU for another 1.5 hours. The cultures were then washed from the preparations and plated in triplicate in methylcellulose (StemCells, Vancouver, BC, Canada) containing 20 ng / ml recombinant 3 human interleukin and 50 ng / ml recombinant granulocyte colony stimulating factor (Peprotech, Rocky Hill, NJ). Mouse bone marrow cells were seeded in methyl cellulose containing 20 ng / ml recombinant murine interleukes 3 and 6, as well as murine recombinant stem cell growth factor (50 ng / ml). Colonies containing more than 30 cells were counted and the difference between the samples was evaluated.

BCNU and lysomustine in their chemical structure belong to the class of nitrosoureas. A characteristic feature of nitrosoalkylureas as chemotherapeutic drugs is their ability to hydrolytic decomposition in aqueous solutions with the formation of alkylating particles. In this regard, the ability of the mutant form of MGMT to protect K562 cells from the action of lysomustine was tested.

K562 cells were incubated with lysomustine at a concentration of 0-400 μM alone or in combination with 20 μM BG. Cell survival curves based on the ability of surviving cells to form colonies are shown in FIG. 3. Transduction with the MF vector ensured cell resistance to treatment with lysomustine up to a concentration of 300 μM. The survival of 21% of colony forming cells in a transduced MF culture was shown versus 0.3% in the control population at a concentration of lysomustine at a concentration of 100 μM. BG in this model system increased the toxicity of lysomustine only to a small extent. At 100 μM lysomustine, a decrease in colony formation using BG was from 21 to 18.8%, apparently due to inhibition of the endogenous enzyme. Thus, the drug lysomustine can be used to obtain populations of hematopoietic cells, to one degree or another enriched with genetic constructs carrying MGMTm.

In the next series, the in vitro resistance of mouse bone marrow cells transduced by the MF vector to the action of lysomustine was analyzed. The bone marrow culture was treated with BCNU or lysomustine, alone or in combination with BG, and then a survival analysis of colony forming precursors in methylcellulose was performed. The presence of BG in the incubation medium dramatically increased the sensitivity of colony forming cells to treatment with alkylating agents, reaching 100% at 30 μM BCNU (Figure 4). In contrast, 26.4 ± 2.9% of colony forming cells survived at the same concentration in the absence of BG, which may be explained by a high level of endogenous MGMT.

Preliminary experiments showed that the lethal dose for 50% of the cells (LD50) for lysomustine is about 2-3 times higher compared to BCNU. Bone marrow cells were treated with lysomustine alone or in combination with BG. Colony formation at 50 μM lysomustine in the presence of 20 μM BG was 46.7 ± 4.2% and 15.9 ± 1.1% at 100 μM. The cytotoxic effect of lysomustine was less dependent on the presence of BG compared with BCNU. Given certain problems with the systemic administration of BG when used in animals and humans, this property of lysomustine gives it an advantage over BCNU and other drugs of this class.

In order to find out whether it is possible by means of viral delivery of vectors carrying MGMT to ensure the resistance of bone marrow cells to the action of lysomustine, bone marrow cells were transduced with MF lentiviral and FM retroviral vectors. About 8% of the nuclear cells expressed MGMTm after transduction of MF, according to cytometry with antibodies against FLAG. Survival curves constructed by counting myeloid colony forming units are shown in FIG. 5. Populations transduced with the MF vector had increased resistance to lysomustine and BG (LD50 about 70 μM) compared with the transduced empty vector (LD50 about 35 μM). Treatment with lysomustine alone, in the absence of BG, did not reveal differences in the stability of the two populations, which may be associated with a high level of endogenous MGMT.

The effect of lysomustine isomers on M5 vector cells transduced by the MF vector was also investigated. The results obtained (Figure 6) show that isomer 1 of lysomustine (not having significant anti-cancer effects) has a certain toxic effect on K562 cells, but its toxic activity cannot be suppressed by the mutant MGMT enzyme. At the same time, lysomustine isomer 2 has a powerful toxic effect on cells, and this effect can be suppressed by the activity of the mutant form of MGMT. The clinically used mixture of lysomustine isomers has an intermediate effect that is closer to the action of isomer 2.

Thus, in experiments on cell culture, the possibility of using lysomustine for in vitro enrichment of HAs carrying both MGMTm and used as the model EGFP gene was shown. At the same time, lysomustine isomer 2 is more effective in selection than the isomer mixture used in clinical practice, while lysomustine isomer 1 does not have a selective effect.

To confirm the possibility of using lysomustine to replace the body’s own hematopoietic cells with cells that carry a given gene in the in vivo system, a series of experiments were performed on a mouse model. It is known from the prior art that the MGMT gene can be used as a gene for in vivo enrichment of transgenic HA. Thus, successful mouse therapy of beta-thalassemia and protoporphyria through transplantation of cells carrying the mutant MGMT gene and the corresponding therapeutic gene has recently been demonstrated in a mouse model (Persons et al., 2003, Richard et al., 2004). In these experiments, other nitrosourea derivatives that were different in structure from lysomustine were used.

In experiments, 8-12-week-old recipient mice of the C57 B1 / 6 line were used. Initially, the sensitivity of mice to lysomustine without cell transplantation was analyzed. Lysomustine without BG in amounts up to 160 mg / kg body weight did not affect the survival of mice with the intraperitoneal route of administration. On the contrary, two injections of lysomustine in quantities of 60 mg / kg together with 30 mg / kg of benzylguanine resulted in the death of 40% of recipients (2 out of 5). Based on these data, as well as data from in vitro experiments, doses of lysomustine not exceeding 50-60 mg / kg were used for further work on transplantation of HA carrying the MGMTm and EGFP genes. As a model of the nucleotide sequence having a therapeutic effect, the EGFP gene was used. The fluorescence of the model EGFP protein reflects its amount in the cell, and the percentage of fluorescent cells in the recipient organism is an indicator of the degree of selection of genetically modified HA in it.

The animals were irradiated at 1.5–4 Gy using an X-ray apparatus, after which 3 × 10 ⁶ bone marrow cells modified with the MGMTm and EGFP genes taken as a marker were transplanted into the tail vein. The introduction of chemicals was carried out intraperitoneally. BG was administered in an amount of 30 mg / kg body weight in a pre-heated solution containing 40% PEG400 (AppliChem, Darmstadt, Germany) and 60% PBS. The introduction of alkylating preparations was carried out 2 hours after the introduction of BG in amounts: BCNU - 10 mg / kg, lysomustine - 50 mg / kg in PBS. 5 days before the start of the experiment, the mice were given acidified drinking water containing neomycin (0.5 g / l).

To analyze the amount of product accumulated, which is genetically modified HA, red blood cells or bone marrow were lysed using OptiLyseC reagent (Beckman Coulter). Then the HA was washed in PBS, resuspended in PBS containing 1% FBS, and analyzed using an Epics XL4 flow cytospectrofluorimeter; the data were counted in WinMDI 2.9 software.

The blood of mice was analyzed immediately after selection to assess the level of modified HA. The selective advantage of FM vector transduced cells was observed both after BG treatment with BCNU and after BG treatment with lysomustine (Fig. 7).

One round of selection showed the following average values of the percentage of EGFP-positive cells: 0.046% in the blood of the control group, 0.62% in the BCNU group, 0.26 and 0.79% in the lysomustine groups receiving 25 mg / kg and 60 mg / kg, respectively. Thus, systemic treatment with lysomustine increases the accumulation level of HA containing the MGMTm genes and the model EGFP protein, and if a dose of 60 mg / kg is used, the accumulation level exceeds that for BCNU by an average of 30%.

To further investigate the possibility of obtaining genetically modified HA using lysomustine, we conducted a second model experiment in which more severe myelosuppression of recipient mice was used, after which a blood test was performed 2 weeks later. The average values of the level of modified HA in the peripheral blood for three groups was 1.6; 6.7 and 9.1 for the control, BCNU and lysomustine groups, respectively. The data are shown in Fig. 8.

For further enrichment of genetically modified HA, a second round of HA selection was performed in the same recipient mice using the same reagent concentrations. Further enrichment of the content of modified HA in the lysomustine group (16.2%) was shown, while the average percentage in the BCNU group decreased to 4.9%. At the same time, the control group did not undergo significant changes (1.8%). The data are shown in Fig.9.

Based on the experiments, it can be concluded that treatment of mice with lysomustine as a way of assessing the effect of lysomustine leads to an increase in the peripheral blood of animals of the percentage of cells carrying HA with a genetic construct containing the mutant form of MGMT and some other nucleotide sequence necessary to perform a therapeutic function .

The results of a comparative analysis of lysomustine and BCNU showed a more effective selection of HA using lysomustine. The method of replacing genetically modified HA is described on a linear mouse model, but can be used for autotransplantation, allogeneic transplantation, or xenograft. In addition to introducing into the cells by transduction the retroviral and lentiviral vectors described in the above examples, methods for introducing genetic constructs into cells using adeno-associated vectors (Daya & Berns, 2008), transposons (Mates et al., 2009) and plasmid episomal constructs (Ehrhardt et al., 2008). With the current state of technology, it is therefore also possible to use adeno-associated vectors, transposons and episidic plasmid constructs for use in the proposed method for cell selection using lysomustine.

List of sources

Experimental oncology at the turn of the century. Ed. Davydova M.I., Baryshnikova A.Yu. S.147, p.161. Moscow. 2003.

Abonour R, Williams DA, Einhorn L et al. Efficient retrovirus-mediated transfer of the multidrug resistance 1 gene into autologous human long-term repopulating hematopoietic stem cells. Nat. Med. 2000; 6: 652-658.

Allay JA, Persons DA, Galipeau J et al. In vivo selection of retro virally transduced hematopoietic stem cells. Nat. Med. 1998; 4: 1136-1143.

Cai S, Ernstberger A, Wang H et al. In vivo selection of hematopoietic stem cells transduced at a low multiplicity-of-infection with a foamy viral MGMT (P140K) vector. Exp Hematol. 2008 Mar; 36 (3): 283-92.

Davis BM, Reese JS, Kos ON et al. Selection for G156A O6-methylguanine DNA methyltransferase gene-transduced hematopoietic progenitors and protection from lethality in mice treated with O6-benzylguanine and 1,3-bis (2-chloroethyl) -1-nitrosourea. Cancer Res. 1997; 57 (22): 5093-9.

Davis BM, Roth JC, Lui L et al. Characterization of the P140K, PVP (138-140) MLK, and G156A 06-methylguanine-DNA methyltransferase mutants: implications for drug resistance gene therapy. Human Gene Ther. 1999; 10 (17): 2769-78.

Daya S, Berns K.I. Gene therapy using adeno-associated virus vectors. Clin Microbiol Rev. 2008; 21 (4): 583-89.

Ehrhardt A, Haase R, Schepers A, Deutsch MJ, Lipps HJ, Baiker A. Episomal vectors for gene therapy. Curr Gene Ther. 2008; 8 (3): 147-61.

Kisby GE, Olivas A, Park T et al. DNA repair modulates the vulnerability of the developing brain to alkylating agents. DNA Repair (Amst), 2009; 8 (3): 400-12.

Larochelle A, Choi U, Shou Y et al. In vivo selection ofhematopoietic progenitor cells and temozolomide dose intensification in rhesus macaques through lentiviral transduction with a drug resistance gene. J Clin Invest. 2009; 119 (7): 1952-1963.

Mates L, Chuah MK, Belay E, Jerchow B, Manoj N, Acosta-Sanchez A, Grzela DP, Schmitt A, Becker K, Matrai J, Ma L, Samara-Kuko E, Gysemans C, Pryputniewicz D, Miskey C, Fletcher B, Vandendriessche T, Ivies Z, Izsvak Z. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 2009; 41 (6): 753-61.

Neff T, Horn PA, Peterson LJ et al. Methylguanine methyltransferase-mediated in vivo selection and chemoprotection ofallogeneic stem cells in a large-animal model. J. Clin. Invest. 2003; 112 (10): 1581-1588.

Pear WS, Miller JP, Xu L et al. Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr / abl-transduced bone marrow. Blood. 1998; 92 (10): 3780-92.

Pegg AE. Repair of O (6) -alkylguanine by alkyltransferases. Mutat. Res. 2000; 462: 83-100.

Persons DA, Allay ER, Sawai N et al. Successful treatment of murine beta-thalassemia using in vivo selection of genetically modified, drug-resistant hematopoietic stem cells. Hargrove PW, Brent TP, Hanawa H. Blood. 2003; 102 (2): 506-13.

Pollok KE, Hartwell JR, Braber A. In vivo selection of human hematopoietic cells in a xenograft model using combined pharmacologic and genetic manipulations. Hum. Gene Ther. 2003; 14 (18): 1703-14.

Rattmann I, Kleff V, Sorg UR et al. Gene transfer of cytidine deaminase protects myelopoiesis from cytidine analogs in an in vivo murine transplant model. Blood. 2006; 108 (9): 2965-71.

Richara E, Robert E, Cario-Andre M et al. Hematopoietic stem cell gene therapy of murine protoporphyria by methylguanine-DNA-methyltransferase-mediated in vivo drug selection. Gene Ther. 2004; 11 (22): 1638-47.

Sawai N, Persons DA, Zhou S et al. Reduction in hematopoietic stem cell numbers with in vivo drug selection can be partially abrogated by HOXB4 gene expression. Mol ther. 2003; 8 (3): 376-84.

Schiedlmeier B, Kuhlcke K, Eckert HG et al. Quantitative assessment of retroviral transfer of the human multidrug resistance 1 gene to mobilized peripheral blood progenitor cells engrafted in nonobese diabetic / severe combined immunodeficient mice. Blood. 2000; 95: 1237-1248.

Sorg UR, Kleff V, Fanaei S et al. O6-methylguamne-DNA-methyltransferase (MGMT) gene therapy targeting haematopoietic stem cells: studies addressing safety issues. DNA Repair (Amst). 2007; 6 (8): 1197-209.

Weber K, Bartsch U, Stocking C, Fehse B A multicolor panel of novel lentiviral "gene onthology" (LeGO) vectors for functional gene analysis. Mol. Ther. 2008; 16 (4): 698-706.

Zielske SP and Gerson SL Blood Cells Mol. Dis. 2003; 31 (1): 48-50. SarCNU mediates selection ofP140K methylguanine-DNA-methyltransferase transduced human CD34 (+) cells in vitro.

Zielske SP, Reese JS, Lingas KT et al. In vivo selection of MGMT (PHOK) lentivirus-transduced human NOD (SCID) repopulating cells without pretransplant irradiation conditioning. J. Clin Invest. 2003 Nov; 112 (10): 1561-70.

Claims (4)

1. The method of selection of genetically modified human or animal cells, which consists in the fact that one or more genetic constructs are introduced into the cells, which contain the gene of the mutant form of the MGMT enzyme (O6-methylguanine DNA methyltransferase) resistant to the action of the O6-benzylguanine inhibitor inhibiting the action of the natural form of MGMT, as well as a nucleotide sequence having a therapeutic effect; The cells modified in this way are transplanted into the body, after which the indicated inhibitor is introduced, and then the lysomustine isomer 2 or a mixture of lysomustine isomers 1 and 2, which inhibit the reproduction of the body’s own cells, resulting in the selection of the modified cells. 2. The method according to claim 1, characterized in that the genetic constructs are used integrating into the DNA of the cell constructs selected from the group including retroviral, lentiviral, adeno-associated viral, transposon and plasmid episomally supported constructs. 3. The method according to claim 1, characterized in that the gene of the mutant form of the MGMT enzyme and the nucleotide sequence having a therapeutic effect are part of the same construct. 4. The method according to claim 1, characterized in that before the introduction of the modified cells into the body, the cells are treated in culture with an inhibitor that suppresses the action of the natural form of MGMT, and then lysomustine.

Images