RU2422512C1 - Escherichia coli BL21(DE3)/pAFP11D3 STRAIN - PRODUCER OF 404 TO 609 AMINO ACID FRAGMENT OF HUMAN ALPHA-FETOPROTEIN - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, particularly to recombinant production of human oncofetal proteins, and can be used for producing a 404 to 609 amino acid fragment of human alpha-fetoprotein. The Escherichia coli BL21(DE3)/pAFP11D3 strain - a producer of the 404 to 609 amino acid fragment of human alpha-fetoprotein is produced by Escherichia coli cell transformation of the BL21(DE3) strain of plasmid DNA pAFP11D3.

EFFECT: invention allows reducing potential human viral contamination when using a recombinant method to produce said alpha-fetoprotein fragment exhibiting affinity to an alpha-fetoprotein receptor and exposed to receptor-mediated endocytosis.

2 cl, 7 dwg

Description

The invention relates to biotechnology, in particular to recombinant plasmid DNA encoding a fragment of a human oncofetal protein having an affinity for the alpha-fetoprotein receptor (AFP) and undergoing receptor-mediated endocytosis.

Purified and isolated DNA sequences are known having activity to increase protein production, characterized in that the DNA sequence includes at least one element of curved DNA and at least one DNA binding protein binding site [RU 2375078, C2 , A61K 39/395, 12/10/2009].

The disadvantage of this solution is the relatively narrow scope.

The closest in essence to the proposed is a purified and isolated DNA sequence having activity to increase protein production, which is a) a DNA sequence characterized by a MAR nucleotide sequence selected from the group including SEQ ID NO: 24-27, complementary to it, its part containing at least 70% of the nucleotides in length; or b) a DNA sequence, characterized in that it essentially corresponds to an element or fragment of cLysMAR comprising at least one region selected from B-, K- and F-regions [RU 2375450, C2, C12N 15 / December 11, 2009].

The disadvantage of this solution is the relatively narrow scope, since the known DNA does not have the properties of a recombinant plasmid DNA encoding a fragment of human alpha-fetoprotein, which has affinity for the AFP receptor and undergoes receptor-mediated endocytosis.

In addition, the product obtained by the implementation of the known technical solution has the potential for contamination with human viruses.

The required result is to reduce the possibility of contamination of the final product with human viruses and expand the scope by creating a bacterial strain producing a recombinant fragment of human alpha-fetoprotein, which, in turn, allows one to obtain a target protein with high yield free of contamination with human viruses.

The desired result is achieved in that the bacterial producer strain is characterized in that the cells of the strain carry a plasmid with a gene encoding the target fragment of human alpha-fetopotaine.

In addition, the required technical result is achieved by the fact that cells of the strain BL21 (DE3) are used as the cells of the strain carrying the plasmid with the gene encoding the target fragment of human alpha-fetoprotein.

In addition, the required technical result is achieved by the fact that as a plasmid with the gene encoding the target fragment of human alpha-fetoprotein, use the plasmid pET 11 with a cloned gene encoding the target fragment of human alpha-fetoprotein.

In addition, the desired technical result is achieved in that the gene encoding the target fragment of human alpha-fetoprotein from 404 amino acids to 609 amino acids contains a tandem of two rare AGG AGG codons encoding arginine residues.

In addition, the required technical result is achieved by the fact that as a tandem of two rare codons encoding arginine residues, iso-acceptor codons encoding arginine residues are used.

In addition, the required technical result is achieved by the fact that the tandem of CGT CGC is used as a tandem of iso-acceptor codons encoding residues of arginines.

In addition, the required technical result is achieved in that the level of production of the target protein by the bacterial strain producing the recombinant fragment of alpha-fetoprotein is at least 100 mg per liter of cell culture or 100 mg per 1 gram of cell biomass.

The drawings show:

figure 1 - nucleotide sequence of the AFP;

figure 2 - amplification of gene fragments;

figure 3 is a map of the plasmid;

figure 4 - nucleotide sequence of the designer;

figure 5 is the amino acid sequence of the obtained product;

figure 6 - analysis of the presence of the target protein;

Fig.7 - electrophoretic analysis of cell protein.

Obtaining a bacterial strain producer of a recombinant fragment of human alpha-fetoprotein (AFP) was carried out as follows.

It is known that, first of all, the presence of rare codons located one after another affects the level of expression in bacterial cells. In the AFP nucleotide sequence there is a tandem of two rare AGG codons encoding arginine residues - Arg508 and Arg509 (Fig. 1).

It was found that the replacement of such arginine tandems provides a significant increase in expression level. A fragment of the AFP gene corresponding to the target fragment (404-609 amino acid residues) was obtained, while the indicated tandem of AGG AGG was replaced with codons of arginine CGT CGC, optimal for E. coli. The replacement was carried out by amplification of gene fragments, as indicated in figure 2.

The following primers were used for PCR amplification:

1-5 ′ CCGTAGCTAGCATGTACATCCAGGAGAGCCAAGC 3 ′

2-5 ′ CGCCAACCGTCGCCCATGCTTCAGCAGCTTGG 3 ′

3-5 ′ GGCGACGGTTGGCGTATGAAGAAGTGCAGCACTGG 3 ′

4- ′ AAGAATGTCGACTTAGTGATGGTGATGGTGATGGTGCTCT TCAGCAAAGCAGACTT 3 ′

PCR amplification was performed under standard conditions with thermostable Tag polymerase. For the reaction, 30 cycles were performed. We used a temperature of 72 ° C for amplification, 51 ° C for annealing the primers, and 95 ° C for the separation of DNA chains.

When the gene was modified, the NdeI restriction site was also destroyed for the convenience of subsequent work. These modifications of the gene did not lead to substitutions in the amino acid sequence of the protein. In addition, a sequence encoding 7 histidine residues for subsequent affinity purification of the protein was added to the 3 ′ end of the gene, and NheI and SalI restriction sites were introduced to clone the gene.

The modified AFP gene was cloned into the pET11c plasmid at the NheI and SalI restriction sites for further analytical expression in E. coli.

The cloning procedure consisted of the following steps:

1. The amplified AFP gene fragment and pET11c plasmid (separately) were sequentially treated with restriction enzymes NheI and SalI.

2. The obtained AFP gene fragment and plasmid pET11c were subjected to electrophoretic separation on an agarose gel and then pieces of the gel containing the indicated DNA fragments were cut out. In this case, ultraviolet illumination of a transilluminator with a wavelength of 365 nm was used to visualize DNA bands, because it does not cause DNA damage.

3. The gene and plasmid were isolated from the gel and subjected to a ligation reaction. To do this, they were mixed in a ligation buffer in a weight ratio of 1: 1, T4 DNA ligase was added and incubated at room temperature for 2 ± 0.5 hours.

4. Transformation of E. coli cells of strain MC1061 with an aliquot of the ligation mixture was carried out. For this, 200 ± 30 μl of freshly prepared competent cells was added to 20 ± 5 μl of the ligation mixture. After incubation, the cells were plated on LB agar medium with ampicillin at a concentration of 100 μg / ml in Petri dishes and incubated for 15 ± 2 hours at a temperature of 37 ° C.

5. The grown cell colonies were checked for the presence of the AFP gene by amplification with specific primers for the indicated gene.

6. E. coli colonies carrying the target protein gene were grown on liquid LB medium with ampicillin in test tubes for 15 ± 2 hours at a temperature of 37 ° C with constant shaking in a rocking chair. The resulting biomass was collected by centrifugation in 1.5 ml microtubes.

7. The plasmid was isolated from the obtained biomass by alkaline lysis.

8. Confirmation of the presence of the AFP gene in the plasmid was performed using restriction analysis at the cloning sites of NheI and SalI. A map of the plasmid is presented in figure 3.

To verify the resulting construct pAFP11D3 was determined by its nucleotide sequence (figure 4). The presence of introduced nucleotide substitutions in the AFP gene was confirmed to optimize its codons, which, as indicated above, does not lead to a substitution in the amino acid sequence. The amino acid sequence of the obtained product is shown in FIG. 5.

Expression of a recombinant protein with a chemical inducer.

The resulting plasmid containing the AFP gene fragment was transformed into E. coli cells of strain BL21DE3 (E. coli B F ^- dcm ompT hsdS (r _B - m _B -) gal λ (DE3)). For this, 0.5 μl of the plasmid at a concentration of 0.2 μg / μl was added to 200 μl of freshly prepared competent cells. After incubation, the cells were plated on LB agar medium with ampicillin at a concentration of 100 μg / ml in Petri dishes and incubated for 15 hours at 37 ° C.

The grown cell colonies were checked for the presence of an AFP gene fragment by amplification with specific primers for the indicated gene.

E. coli colonies carrying the target protein gene were grown on liquid LB medium with ampicillin in test tubes for 15 ± 2 hours at a temperature of 37 ° C with constant shaking in a rocking chair. The resulting biomass was collected by centrifugation in 1.5 ml microtubes.

The plasmid was isolated from the obtained biomass by alkaline lysis.

Confirmation of the presence of the AFP gene in the plasmid was performed using restriction analysis at the cloning sites of NheI and SalI.

Analytical expression of the target protein was carried out using a chemical inducer. For this, E. coli colonies carrying the target protein gene were grown on liquid LB medium with ampicillin in test tubes for 15 ± 2 hours at a temperature of 37 ° C with constant shaking in a rocking chair. 0.5 ml was added to 250 ml flasks containing 50 ml of LB ampicillin liquid medium. They were grown at a temperature of 37 ° С with constant shaking to an optical density of 0.5 ± 0.1 (OD600) (incubation time ranged from 1.5 to 2.5 hours). Then a chemical inducer was added - 0.4 mM IPTG (isopropyl-β-D-thiogalactopyranoside) and increased further for 3 hours. Biomass was collected by centrifugation in 50 ml plastic tubes (OPN-8 centrifuge, 4.000 rpm for 8 minutes).

Conducted electrophoretic analysis of cell protein in a polyacrylamide gel under denaturing conditions. For this, 40 μl of water was added to an aliquot of 10 mg cells, mixed on a shaker and 40 μl of 2x sample buffer for protein denaturing electrophoresis was added. The sample was heated at 95 ° C for 4 minutes and applied to a denaturing gel with an acrylamide concentration of 12%. After electrophoretic separation, the gel was washed with distilled water, and then stained with a paint containing Coomassie dye. Excess paint was washed with a solution containing ethanol and acetic acid.

The analysis of the presence of the target protein was carried out visually, comparing the set of cellular proteins in uninduced cells and cells induced by IPTG (Fig.6). To determine the molecular weight of the obtained target protein, a set of proteins with known molecular weights was used.

The amount of the target protein was analyzed in relation to the total cellular protein. For this, the gel was scanned on an Epson 1660 Photo scanner. The resulting image was processed using the Onedscan program.

The distribution of the target protein between the soluble protein fraction and inclusion bodies (aggregated form of the protein) was analyzed. For this, 200 μl of PBS buffer with 300 mM NaCl, an AEBSF protease inhibitor, and lysozyme were added to an aliquot of cells (40 mg) to a final concentration of 2.5 mg / ml. After 10 minutes of incubation in ice, 0.2 μl of DNase and RNase were added to the suspension at a concentration of 10 mg / ml and 1 unit / ml, respectively, and further incubated for 30 minutes in ice. After that, 10% Triton X100 was added to a final concentration of 1%. The cell lysate was centrifuged in 1.5 ml microtubes at a speed of 13,000 rpm for 10 minutes at a temperature of 4 ° C. The supernatant and sediment were separated and the protein composition was analyzed using an acrylamide gel under denaturing conditions. The target protein is almost completely found in the sediment, i.e. in the fraction of insoluble proteins, also called inclusion bodies.

The expression results (Fig.6) show a high level of synthesis of the target protein, the target protein is at least 25% of the total cellular protein (on average 30-35%).

Expression of the target AFP fragment in E. coli by auto-induction.

The essence of the approach is the use of growth media, allowing to achieve sufficiently high cell culture densities during growth. In addition to this, growth media are selected in such a way that, upon initial growth to high densities, the lac promoter inducing the synthesis of T7 polymerase (and hence the synthesis of the target protein) is in a repressed state. In the late stages of growth, the lac promoter is induced under the influence of lactose, which is part of the media.

A plasmid containing the AFP gene fragment was transformed into E. coli cells of strain BL21DE3, as described above. The grown cell colonies were checked for the presence of a gene fragment by amplification with specific primers.

100-200 E. coli colonies carrying the target protein gene were added to 200 ml of liquid TB nutrient medium with 200 μg / ml ampicillin and grown in 1 L flasks for 18-24 hours at 37 ° C with constant shaking in a rocking chair . These conditions are optimal for the studied strain in terms of growth medium, temperature and incubation time. The optical density of the culture at the time of completion of the incubation was at least 10 p.u. OD600 and was usually about 12 pu

The resulting biomass was collected by centrifugation in centrifuge tubes on a JA14 rotor J2-21 Beckman centrifuge at 7000 rpm for 10 minutes.

Conducted electrophoretic analysis of cell protein in a polyacrylamide gel under denaturing conditions (Fig.7).

The analysis of the presence of the target protein was carried out visually, comparing the set of cellular proteins in uninduced cells and cells after auto-induction. To determine the molecular weight of the obtained target protein, a set of proteins with known molecular weights was used.

The amount of the target protein was analyzed in relation to the total cellular protein. The yield of the target protein from the total cellular protein according to the results of densitometry of electrophoretic separation of the total protein preparation is on average 30-35%.

The distribution of the target protein between the soluble protein fraction and inclusion bodies (aggregated form of the protein) was analyzed. The target protein is almost completely found in the sediment, i.e. in the fraction of insoluble proteins, also called inclusion bodies.

A system with auto-induction allows one to achieve a significantly higher optical density of cells than expression in LB medium with an inductor. In this case, the expression begins rather late, at the late logarithmic stage of cell growth, apparently, the expression of the target protein begins when the optical density of the culture reaches about 7.

Characterization of the obtained producer strain.

The final product is a producer strain of the target protein, AFP fragment, in E. coli cells, which is characterized in that:

It is represented by gram-negative rods, giving on an agarized nutrient medium with ampicillin weakly convex colonies with a diameter (2 ± 0.5) mm of gray color, smooth, with a smooth edge.

It has inclusion bodies, which are a hybrid protein having a sequence corresponding to the region of the intended target AFP fragment of a person. Under optimal expression conditions according to SDS-electrophoresis, the hybrid protein accounts for at least 25% of the total cellular protein. The production of the target protein is at least 170-200 mg per 1 liter of culture or 20-25 mg / 1 g of biomass.

Cells contain a plasmid characterized by an appropriate restriction map where a nucleotide sequence encoding a target fusion protein is inserted between the NheI and SalI restriction sites. Protein expression is regulated by the T7 promoter and can be induced either by the IPTG chemical inducer or by the auto-induction effect.

Thus, due to the improvement, the required technical result was achieved, since a bacterial strain producing the recombinant fragment of human alpha-fetoprotein was obtained, which is practically free from contamination with human viruses.

Claims (2)

1. The strain Escherichia coli BL21 (DE3) / pAFP11D3 is the producer of the fragment from 404 to 609 amino acids of human alpha-fetoprotein obtained by transformation of Escherichia coli cells of strain BL21 (DE3) plasmid DNA pAFP11D3, which has the physical map shown in figure 3, and is characterized by the nucleotide sequence shown in figure 4. 2. The strain Escherichia coli BL21 (DE3) / pAFP11D3 is the producer of the fragment from 404 to 609 amino acids of human alpha-fetoprotein according to claim 1, in which the level of production of the target protein is at least 100 mg per liter of cell culture or 100 mg per 1 gram of biomass cells.

Images