RU2396345C1 - Method of obtaining population of neural differentiation induced stromal cells of fat tissue - Google Patents

Abstract

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, specifically to obtaining cell population and can be used in cell transplantology and tissue engineering in order to obtain cell material for restoring nerve tissue damaged due to injury, stroke or neurodegenerative diseases. The method involves isolating a population of stromal cells from fat tissue, immunosorting based on using antibodies against the brain-derived neurotropic factor (BDNF) receptor (TrkB) to obtain an essentially homogeneous sub-population of TrkB-expressing cells for their culturing in a standard medium for mammal cells and differentiation induction through transfer into a medium which contains a neural differentiation inducing substance - BDNF combined with 5-azacytidine or retinoic acid combined with 5-azacytidine.

EFFECT: invention enables to obtain a population of neural differentiation induced stromal cells of fat tissue.

7 cl, 5 dwg, 4 tbl, 6 ex

Description

The present invention relates to the field of cell biology and can be used in cell transplantology and tissue engineering to obtain cellular material for the restoration of nerve tissue damaged as a result of injuries, strokes or neurodegenerative diseases, as well as for testing drugs that affect the functional activity of nerve cells tissue and neural precursors. A method is proposed that allows using immunosorting with antibodies against the receptor for the neurotrophic brain factor BDNF (TrkB) to isolate from the total population of stromal cells of adipose tissue a subpopulation of progenitor cells predisposed to neural differentiation for the subsequent effective induction of neural differentiation of these cells using appropriate factors.

Introduction

Disability due to damage to the central nervous system and peripheral nerve fibers due to injuries, strokes or neurodegenerative diseases is associated with the inability to fully regenerate nerve tissue. Like other somatic human tissues, nerve tissue contains small amounts of so-called stem cells, which in the case of local damage can activate, undergo tissue-specific differentiation and restore the morphofunctional integrity of the tissue. However, in severe injuries, as well as in older patients, the number of such cells is insufficient for a full repair, therefore, stem cell and progenitor transplantation is the most promising approach for treating such patients. These cells can be obtained from the patient’s own tissue, grown in vitro in the required quantity and introduced into the lesion site. In contrast to embryonic stem cells, when used for therapeutic purposes, ethical and religious problems arise, the risk of transmission of infectious diseases and the development of tumors (teratomas), as well as rejection of foreign material, the use of one's own (autologous) cells is not fraught with similar difficulties. Transplantation of autologous stem cells, as well as tissue fragments grown in vitro based on them, is already successfully used to restore the skin after burns, to replace bone and cartilage defects, as well as to restore tissue after removal of cancerous formations.

In recent years, researchers have been attracting more and more attention to the possibility of using stromal cells from adipose tissue as a source of autologous cells, the availability of which is sufficient for almost any patient today allows us to consider it as an optimal resource for cell therapy, including for the regeneration of nerve tissue .

State of the art

It is known that adipose stroma contains poorly differentiated progenitor cells, which in their phenotype and expression profile are similar to bone marrow mesenchymal stem cells [6]. Adipose tissue stromal precursor cells (SSC) under the influence of various inducers are able to differentiate in vitro into different types of cells: osteoblasts, chondroblasts, adipocytes [1], hepatocytes, endothelial cells [16], myoblasts [10], cardiomyocytes [12], epithelial cells [3], as well as neural precursors [4].

Neural differentiation of stem cells of various origins is usually accompanied by an increase in the expression of specific genes and, accordingly, the appearance of cytoskeleton proteins such as nestin (a marker of early neural precursors), neuronal form of tubulin-β3, glial acidic fibrillar protein GFAP (marker of astrocytic glia), and protein interacting with MAP2 microtubules, specific for Eno2 enolase neurons and some other markers of neural differentiation. It is known that it is possible to induce neural differentiation of mesenchymal stem cells, for example, cells originating from sources such as bone marrow, using retinoic acid [7] and neurotrophic factors [8, 15]. As for SCLC, despite the increased interest in this source of progenitor cells, studies regarding their ability to differentiate in the neural direction in response to stimulation by the known inducers of neural differentiation are episodic in nature and do not yet allow any definitive conclusions to be drawn regarding the mechanisms of neural differentiation and optimal conditions for obtaining a population of cells differentiating in this direction. US patent No. 7,078,230 [18] proposes a multistage method for producing a population of stromal cells from adipose tissue intended for transplantation, induced to neural differentiation by retinoic acid, and in [19], as an inducer of neural differentiation, SCLC, along with retinoic acid, is proposed use the neurotrophic factor BDNF. This method involves isolating a population of stromal cells from human adipose tissue, culturing them under standard conditions for 3-5 weeks and inducing neural differentiation in two stages: culturing for 3 days in serum-free medium containing bFGF (20ng / ml) and hEGF (20ng / ml), which is accompanied by the formation of neurospheres, and subsequent 30-day cultivation in the presence of 10 ng / ml BDNF and 0.75 mm retinoic acid (RA). The obvious disadvantages of this method are its duration and lack of effectiveness. According to the authors, after 30-day induction of BDNF and RA, pronounced morphological and immunocytochemical signs of neural differentiation appear in about half of the cells.

Since the known methods for obtaining culture-induced SCJT culture, including those discussed above, closest to the proposed method [19], seem to be unsuitable for practical purposes because of their low efficiency, the present invention was directed to solving the general problem of increasing this indicator .

Disclosure of invention

One of the most probable reasons for the low efficiency of induction of gastrointestinal tract under the influence of neurotrophic factors may be an insufficient level of “sensitivity” of the total cell population to the inducer, therefore, the basis for the development of a new method for obtaining an induction of neural differentiation of the gastrointestinal tract population was the identification of TrkB-positive cells in the total gastrointestinal tract population sensitive to the action of those selected for the induction of neural differentiation of neurotrophic factors, in particular the brain neurotrophic factor (BDNF), and obtaining a homogeneous culture enriched TrkB-positive cells, cells capable of differentiating into neural effectively direction.

It is known that the readiness of cells to receive signals of neurotrophic factors can be judged by the expression of receptors on their surface to these factors, in particular, cells expressing the tyrosine kinase BDNF receptor, TrkB, are sensitive to the action of BDNF. This receptor is expressed on the surface of neurons, as well as on axons and dendrites in many structures of the brain [17], and in embryogenesis, TrkB is found in the cells of the monocytic dendritic fraction during the formation of innervation of one or another organ [5]. It is through interaction with this receptor that BDNF supports the differentiation and survival of neurons.

With this in mind, the task at hand was reduced to an attempt to identify cells containing TrkB neurotrophic brain factor receptor (BDNF) receptors on their surface, to evaluate their content in the population and to propose a suitable method for maximum enrichment of the culture with TrkB-containing cells so that to increase the “susceptibility” of the culture of gastrointestinal tract to subsequent induction using this factor, and when this possibility is established, by other well-known inducers of neural differentiation.

When carrying out the invention, it was first experimentally established the presence in the total population of SCLC of cells carrying a neurotrophic factor factor receptor on their surface. In particular, using PCR analysis, the presence of cells expressing BDNF receptor mRNA was detected (Example 2a, FIG. 1), and cells containing TrkB antigen (Example 2b) were detected by immunofluorescence staining. According to the results of cytometric analysis, the proportion of cells carrying the TrkB receptor in the total population was estimated as equal to about 6%.

Two methods were used to enrich the SCLC population with TkrB-expressing cells: immunomagnetic selection method and flow cytofluorimetry method; in both cases, it was possible to obtain a substantially homogeneous population of cells (more than 90%) of TrkB-containing SCLC.

Analysis of the obtained fraction of TrkB-positive cells for the expression of the corresponding markers, indicating the potential of these cells for neural differentiation, including determining the content of specific marker proteins in mRNA cells, revealed the presence of nestin and tubulin-β3 mRNA, as well as neurotrophic growth factors HGF and BDNF; at the same time, the content of all the mRNAs mentioned in these cells was several times higher than in TrkB-negative SKZhT (example 4, figure 3).

The resulting subpopulation of TrkB-containing cells was induced to neural differentiation by placing cells in a differentiation medium DMEM / 10% FBS containing BDNF (in a comparative experiment, retinoic acid in combination with 5-azacytidine). Evaluation of the effectiveness of induction, which involved the determination of expression at the level of transcription of marker genes for neural differentiation (nestin, tubulin-β3 and neuron-specific enolase Eno2) showed that in 3 days BDNF-induced cells increase the amount of nestin, tubulin and Eno2 mRNA in 3-6 time. 7 days after induction, the content of the corresponding proteins also increased in these cells (Example 5). The induction of TrkB-expressing SCLT with retinoic acid generally showed similar, albeit less pronounced, changes. As a result of a direct experiment on transplantation of a homogeneous population of Trk-expressing gastrointestinal tract, obtained and induced according to the proposed method, into the mouse brain, it was found that during the 10 days of observation the transplanted cells remained viable and showed migration from the area of introduction into the recipient brain parenchyma, whereas control cells of the total population of gastrointestinal tract remained in the region of the track and did not show contact with the patient’s tissue.

Thus, the essence of the present invention is to obtain a total population of SLCT, to identify and isolate from a total population a subpopulation of TrkB-positive cells using immunomagnetic selection or immunosorting using antibodies against the TrkB receptor, and the induction of neural differentiation by neurotrophic factor BDNF or retinoic acid in combination with 5-azacytidine. An advantage (technical result) of the proposed method over previously known methods is an increase in the efficiency of the induction of neural differentiation and a reduction in the general time for preparing the culture for transplantation, the possibility of which is clearly demonstrated by the direct viability of the induced TrkB-positive SLE and their ability to integrate into the recipient tissue.

Brief Description of the Drawings

Figure 1. The content of TrkB mRNA in the total population of SCLC. The amplification product of the TrkB transcript fragment (83 bp) is indicated by the arrow.

Figure 2. Analysis of the content of cells expressing TrkB in the total population of SCLC using flow cytometry. Oblique hatching corresponds to cells incubated with control immunoglobulins, vertical hatching corresponds to cells stained with antibodies against TrkB). R5 is the area of counting positively stained cells.

Figure 3. Comparative analysis of the mRNA content of marker genes for neural differentiation and neurotrophic factors in subpopulations of SQT expressing and not expressing TrkB. On the abscissa axis are abbreviations of the tested genes, on the ordinate axis is the mRNA level of the analyzed genes, normalized by the mRNA content of two household genes (GAPDH, β-actin). Black bars are cells expressing TrkB, white bars are cells not expressing TrkB.

Figure 4. The content of marker proteins of neural differentiation in subpopulations of SCLC expressing and not expressing TrkB before and after induction. Left column of panels - Nestin detection; right column of panels - detection of β3-tubulin. A, B — subpopulations of SCLC not expressing TrkB before induction; C, D - subpopulations of SCLC expressing TrkB before induction; D, E - subpopulations of SLCT expressing TrkB after exposure to BDNF in combination with 5-azacytidine.

Figure 5. Distribution of GFP-labeled cells in the striatum of the brain 10 days after transplantation. The upper panel is the induced (BDNF) subpopulation of gastrointestinal tract, not expressing TrkB; lower panel - induced (BDNF) subpopulation of SQT expressing TrkB.

The implementation of the invention

When carrying out the invention, in addition to the methods described in detail in the following examples, well-known cell culture techniques were used, which are also described in the cited sources.

Example 1

Isolation of stromal cells from adipose tissue

For work, human and mouse SCLC were used. SST were isolated by protocol of Zuk et al. [19]. Subcutaneous fatty tissue was obtained during abdominal operations in non-cancer patients, the average age of which was 40-60 years. Mouse SQWs were isolated from subcutaneous fat of the inguinal region of the Black6 male line. Adipose tissue was chopped with scissors, then treated with enzymes and collagenase (Invitrogen, USA, 30 units per ml of tissue) and protease (Gibco, USA, 200 units per ml of tissue) for 40 min at 37 ° C at a constant stirring. After this time, an equal volume of DMEM medium (Gibco, USA) with 10% fetal bovine serum (FBS, Gibco, USA) was added to the suspension and centrifuged for 5-10 min at 900 rpm. The pellet containing the stromal-vascular cell fraction was resuspended in DMEM with 10% FBS and filtered through a 100 mm cell filter (BD Biosciences, Bedford, MA), then the cells were plated on Petri culture dishes (Costar Corning, USA ) and placed in a CO ₂ incubator at 37 ° C and 5%. The next day, cups changed the environment. Thus, only adherent cells remained in the culture. Upon reaching the monolayer, the cells were removed with trypsin and planted in a ratio of 1: 2.

Example 2

The study of the total population of SZHT for the presence of cells expressing the TrkB receptor

a) Determination of TrkB mRNA Content

Total RNA from cells was isolated using an RNA isolation kit (RNeasy Mini Kit, QIAGEN, USA) according to the manufacturer's protocol. All procedures for RNA isolation and cDNA synthesis were performed on ice in a laminar box. The concentration of total RNA was determined using a Bio Photometer (Eppendorf) spectrophotometer. The quality of the isolated RNA was monitored by electrophoresis on a 1% agarose gel. Then, DNA was synthesized on a matrix according to the standard protocol of the Fermentas company using oligo-dT primers. For this, RNA was mixed with Oligo (dT) ₁₈ primer (Fermentas, 0.5 μg / μl) (for every 10 μl of RNA, 1 μl of Oligo (dT) 18 primer must be added). The mixture was incubated for 5 minutes at 70 ° C. After incubation, 4 μl of 5x reaction buffer (Fermentas) and 2 μl of 10 mM dNTP mix (Fermentas) (for every 10 μl of RNA) were added to the mixture. The mixture was incubated for 5 min at 37 ° C. After incubation, 2 μl of M-Mul V reverse transcriptase (Fermentas, 20 u / μl) was added to the mixture (for every 10 μl of PHK). The resulting mixture was incubated for 60 min at 37 ° C. The reaction was stopped by heating the mixture to 70 ° C for 10 minutes. The synthesized cDNA was frozen and stored at - 20 ° C.

TrkB gene expression analysis was performed by real-time PCR using Sybr Green (Syntol, Russia). In this case, primers and annealing temperatures shown in Table 1 were used.

The results of the electrophoretic analysis of the PCR product (Figure 1) unequivocally indicated that the second passage SCLC contained TrkB mRNA.

b) Cytofluorimetry

The obtained SLCTs were analyzed for the expression of TrkB receptor on the surface of the analyzed cells. For this, a suspension of single cells (0.5-1 X 10 ⁶ cells) of zero passage in 500 μl PBS buffer (phosphate buffered saline) was incubated with primary antibodies against TrkB (Abeam, # ab51190) for 40 minutes at room temperature. After washing three times in PBS, cells were incubated with secondary antibodies against rabbit antibodies (Jacson Immunoresearch, # 111-175-144) labeled with Cy5 for 40 minutes. Fluorescence of cells after staining was evaluated by flow cytometry using a MoFlo instrument (Dako Cytomation) and analyzed using the Summit 4.1 software. In each experiment, an isotypic immunoglobulin control was used to confirm the staining specificity: cells incubated with non-specific immunoglobulins, and then with secondary antibodies. As a result of the analysis of more than 300,000 cells, the presence of cells expressing the TrkB receptor was confirmed among them. According to flow cytometry, the proportion of such cells in the total population of SCLC was 6 ± 2.5%.

c) Evaluation of the ability of the isolated SCZH to neural differentiation by immunofluorescence staining

To assess the ability of the isolated cells to neural differentiation, the content of major marker proteins after in vitro induction was determined. In the experiment used SCZT 2nd passage. Cells in the medium described in Example 1 were plated on 8-well glass plates (Lab-Tek Chamber Slide, Nalge Nunc Int.) And the next day BDNF (20 ng / ml) or retinoic acid (1mM) was added in combination with 5 α-azacytidine (1mM). After 3 days, the inducing medium was changed to fresh, also containing the corresponding inducers, cultured for another 4 days and fixed for analysis by immunofluorescence staining. The cells were fixed in 4% formalin solution (Sigma, USA) for 2 min at room temperature, followed by 3-fold washing with PBS. After washing, the cells were coated with 1% BSA solution (bovine serum albumin) with 10% goat serum for 30 min and incubated at room temperature with rabbit antibodies against nestin (Chemicon, 1: 100), Eno2 (Chemicon, 1:50) and mouse against tubulin (Abcam, 1: 100) for 1 hour. A 1% BSA solution with 10% goat serum was used as a negative control. After washing in PBS, the cells were incubated for 30 min at room temperature in a PBS solution with fluorescently labeled secondary goat antibodies (1: 100) against mouse immunoglobulins (Alexa 488, Molecular Probes, USA) or against rabbit immunoglobulin (Alexa 568, Molecular Probes, USA). At the same time, either the absence of nestin expression or a low level of expression of nestin and β3-tubulin was observed in the isolated SCLTs, and after cell incubation in the presence of BDNF and 5-azacytidine, an increase in the content of both marker proteins was observed, which indicated the potential for the induction of neural differentiation in the resulting cell populations (data not shown).

Example 3

Obtaining a subpopulation of TrkB-containing cells from the total population of SCLC

A fraction of cells carrying TrkB from the total population of SCLC was obtained using immunomagnetic selection or flow cytofluorimetry.

For immunomagnetic cell sorting, 40 nm magnetic particles conjugated with antibodies against rabbit IgG were used (Dynabeads® Pan Rabbit IgG, prod. No 110.41). The magnetic particles were washed from sodium azide and incubated with rabbit antibodies against human TrkB for 40 minutes on ice with constant stirring. After incubation, the tube with magnetic particles was placed in a magnet and washed from unbound antibodies. All manipulations were performed under sterile conditions of the culture box. Then, the prepared magnetic particles were incubated with a suspension of SCLC for 1 hour with constant swaying on ice. After incubation, the cells were placed in a magnet and separated into two fractions: TrkB-positive cells bound to magnetic particles and TrkB-negative cells remaining in suspension. The purity of the obtained TrkB-expressing cell fraction was more than 90%.

Sorting of the cells using flow cytometry was performed as described in Example 26. The cells were sorted into two populations expressing and not expressing the TrkB receptor. The purity of the obtained TrkB-positive cell fraction was 90% -98%.

Example 4

Comparative analysis of marker gene expression in a subpopulation of Trk-positive and a subpopulation of TrkB-negative SZHT

Total RNA was obtained as described in example 2A. Gene expression analysis was performed by real-time PCR using Sybr Green (Syntol, Russia).

For each studied gene, a mixture of forward and reverse primers was prepared in experimentally selected amounts. To prepare one sample, 10 μl of the reaction mixture containing SYBR Green (Synthol), 13 μl of ddH ₂ O (Synthol), 1 μl of the primer mixture and 1 μl of DNA cDNA of the studied cells were used. To prepare NTC (non-template control) samples, 1 μl of ddH ₂ O (Synthol) was added instead of cDNA. Real-time PCR was performed on an IQ5 instrument (BioRad) using the IQ5 2.0 Optical system software (BioRad). The annealing temperature for the primer mixture for each studied gene was also preliminarily selected experimentally.

The primer sequences and annealing temperatures for each of the tested genes are presented in table 1.

Table 1 Sequence primers Primer Name Sequence t ° C annealing primers Product Length (bp) Β-actin for CCTGGCACCCAGCACAAT 60 144 Β-actin rev GGGCCGGACTCGTCATAC 60 Gapdh for TGCACCACCAACTGCTTAGC 60 87 Gapgh rev GGCATGGACTGTGGTCATGAG 60 Tubb for GCCAGACGCGCCCAGTATGAGG 64.4 232 Tubb rev GGTTCCGGGTTCCAGGTCCAC 61.1 MAP-2 for CAACAGGAATTGACTCCCTCTAC 60 80 MAP-2 rev TCACCAGGCTTACTTTGCTTC 60.2 Eno-2 for CCACCGCCACCGCCACTACCA 66.4 162 Eno-2 rev GCACTGCAGCCCGGAAAAGACC 63.6 Nestin for GCAGCTGGCGCACCTCAAGATGTC 65.7 225 Nestin rev GGCAAGGGTGAGGGGAGGGAAGTT 65.1 Gfap for CACCGCAGCCCTGAAAGAGA 57.6 172 Gfap rev CTGGCGCCGGTAGTCGTT 55.9 Trkb for TCAGCACATCAAGCGACATAAC 60 83 Trkb rev AGCATTCAGCTAGGAACACTTTT 60.2

It was found that in the subpopulation of TrkB-positive SLE, mRNA of such marker neural differentiation genes as nestin and β3 tubulin is presented (Figure 3). The analysis of a subpopulation of cells that do not contain a specific BDNF receptor (TrkB) also revealed the presence of mRNA of these genes, however, the number of corresponding mRNA in these cells was several times lower than in cells expressing TrkB (Figure 3). It should be noted that in TrkB-positive cells a higher content of mRNA of neurotrophic growth factors, in particular HGF and BDNF, was also found.

Example 5

Induction of neural differentiation in vitro and study of indicators of neural differentiation of cells expressing TrkB

a) Testing the effectiveness of various differentiation inducers

Neural cell differentiation is accompanied by increased expression of specific genes. In particular, cells that differentiate in the neural direction contain the cytoskeleton protein Nestin (a marker of early neural precursors), the neuronal form of tubulin-β3, the glial acidic fibrillar protein GFAP (a marker of astrocytic glia), a protein that interacts with MAP2 microtubules specific for Enol2 enolase and other markers of neural differentiation.

We analyzed the content of the products of the above marker neural differentiation marker genes in SQT incubated in the presence of various induction factors, including IBMX, P-mercaptoethanol, 5-azacytidine [1, 4, 11], as well as neurotrophic growth factors BDNF and GDNF (table 1 ) The GFAP gene product was not detected either in the control SQT or in the cells incubated in the presence of the inducers listed in Table 1. Analysis of the mRNA content of other marker genes showed that the expression level of Eno2, MAP2, TUBB and Nestin was higher in cells incubated in the presence of retinoic acid or BDNF on the background of 5-azacytidine (table 2).

table 2 Relative level of amplification of marker gene fragments in SCLC induced by various agents. The level of amplification is directly dependent on the level of mRNA of genes in SCL nestin Tubb Eno2 Map2 -control 11.7 3.8 7.3 7.0 aza 4.6 17.1 2.7 60.0 β-merc 0,0 0.7 3.8 2.9 Ibmx 0,0 4.1 2.9 0.7 Bdnf 1.9 7.4 7.6 10.0 Gdnf 0,0 0.7 2,8 1.4 RA 0,0 0.8 2,3 1.4 Cond. Media 9.0 4,5 4.7 5,0 BDNF + aza 60,4 10,2 300,3 170.0 GDNF + aza 5.7 4.1 20.8 19.3 RA + aza 262.1 137.8 48.7 6.2 BDNF, GDNF, RA + aza 17.4 1.4 3.0 3,5

However, in SCLC cultured in the presence of other neural differentiation inducers, no increase in the level of mRTPS marker genes was observed (table 3).

Based on the results, combinations of retinoic acid or BDNF with 5-azacytidine were chosen to induce the neural differentiation of SCLC. By inducing differentiation of SCLC obtained from 8 donors, it was found that upon culturing cells in the presence of retinoic acid in combination with 5-azacytidine, the levels of nestin and tubulin mRNA increase in them. Induction of neural cell differentiation using a combination of BDNF with 5-azacytidine causes an increase in the expression of all 4 analyzed genes (table 3).

Table 3 Relative level of amplification of marker gene fragments in SCLC induced by BDNF and RA against 5-azacytidine. The level of amplification is directly dependent on the level of mRNA of genes in SCL Nestin Tubb Eno2 Map2 -control 0.34 0.63 0,07 0,07 aza 0.04 0.86 0.17 0.05 BDNF + aza 1,02 1,64 2.09 2.11 RA + aza 2.01 2,3 0.41 0.39

These data were confirmed by immunofluorescence staining of induced cells. Thus, it was found that incubation of cells with retinoic acid leads to an increase in the content of nestin and β3-tubulin in them, and in the SCLC cultured in the presence of BDNF, the content of both nestin and β3-tubulin, as well as Eno2-specific enolase, increases.

b) Determination of mRNA content before and after induction

Both subpopulations of passage 2 SCLC cells (TrkB-positive and Thgc-negative) obtained by sorting as described in Example 3 were plated in a 6-well plate at a density of 40-50% monolayer in DMEM supplemented with 10% FBS . The next day, the medium was replaced with DMEM / 3% FBS, to which BDNF was added at a final concentration of 20 ng / ml in combination with 5-azacytidine (1 mM). After 3 days, the inducing medium was changed to fresh, also containing an inducer, cultivated for another 4 days, and then the mRNA content was determined as described in example 4.

Both cell subpopulations were found to demonstrate an increase in mRNA levels of nestin, tubulin, MAP protein and neuron-specific enolase after BDNF induction in vitro. However, the induction of the neural differentiation of TrkB-expressing cells at the level of transcription of these genes was much more pronounced than in cells not expressing this receptor. In a subpopulation of TrkB-positive SLE, after 3 days the amount of mRNA of nestin, tubulin, Eno2 and MAP-2 increased by 3-6 times. 7 days after induction, the content of the corresponding proteins also increased in these cells.

It should be noted that a similar, although somewhat less pronounced, effect was observed upon induction of cells with retinoic acid (1 mM) in combination with 5-azacytidine (1 mM).

c) Determination of the content of specific antigens by immunofluorescence staining

Cells expressing TrkB-expressing and TrkB-non-expressing SCLC of passage 2 were plated on 8-well glass plates (Lab-Tek Chamber Slide, Nalge Nunc Int.) In DMEM supplemented with 3% FBS. The next day, BDNF was added at the same concentration as in Example 5. After 3 days, the inducing medium was changed to fresh, also containing an inducer, cultured for another 4 days and fixed for analysis. Fixation was carried out in a 4% formalin solution (Sigma, USA) for 2 min at room temperature, followed by 3-fold washing with PBS. After washing, the cells were incubated in a 1% solution of BSA (bovine serum albumin) with 10% goat serum for 30 min, then incubated with rabbit antibodies against Nestin (Chemicon, 1: 100), Eno2 (Chenicon, 1:50) and mouse against β3-tubulin (Abeam, 1: 100) for 1 hour at room temperature. After washing in PBS, cells were incubated for 30 min in a PBS solution with fluorescently labeled secondary goat antibodies (1: 100) against mouse immunoglobulin (Alexa 488, Molecular Probes, USA) or against rabbit immunoglobulin (Alexa 568, Molecular Probes, USA) . As a control, cells stained with secondary antibodies only were used. The results showed that in TrkB-expressing SCLC cultured in the presence of BDNF and 5-azacytidine, the content of nestin and β3-tubulin, as well as enolase-specific Enolase Eno2, increase. In TrkB non-expressing cells, there were no significant differences in the contents of nestin, β3-tubulin, and Enol2 enolase before and after induction (data not shown).

In a similar experiment with retinoic acid induction, an increase in the content of two proteins was observed: nestin and β3-tubulin.

Example 6

Transplantation of Induced Murine SLE into Mouse Striatum

The ability of TrkB-positive and TrkB-negative SKJT cells to integrate into brain tissue after transplantation was compared. For this, the freshly isolated SCLC of B16 mice transgenic for the GFP gene were sorted by TrkB expression, obtaining TrkB-positive and TrkB-negative subpopulations of cells, their neural differentiation was induced, as described in Example 5, and then injected into the striatum of B16 mice using syringe.

After 10 days, the mice were perfused with 4% formalin, the brain was removed and fixed for 3-5 hours in 4% formalin, then they were incubated for 10-16 hours in 30% sucrose and frozen. Next, sections were made with a thickness of 20 μm on a cryostat (NM 505 E, Microm, Germany). Finished preparations were stored at + 4 ° C in the dark. The resulting preparations (Figure 5) were analyzed using an Axiovert 200M fluorescence microscope (Zeiss). Image documentation was performed using an Axiocam HRC digital video camera (Zeiss, Germany) and image processing using Axiovision 3.1 software. Induced in vitro SLCT cells that do not express TrkB for a specified time did not show contact with the tissue of the recipient and remained in the region of the track. Over the same period of time, cells expressing TrkB, being induced in the direction of neural differentiation, showed a pronounced migration into the brain parenchyma (Figure 5).

Statistical analysis of all data was performed using the SigmaStat 9.0 software. To compare small groups and abnormal distributions, the Mann-Whitney U-test was used. Differences were considered statistically significant at a significance level of p <0.05.

Literature

1. Ashjian, RN, et al., In vitro differentiation of human processed lipoaspirate cells into early neural progenitors. Plast Reconstr Surg, 2003. 111 (6): p. 1922-31.

2. Balmer, J.E. and R. Blomhoff, Gene expression regulation by retinoic acid. J Lipid Res, 2002.43 (11): p. 1773-808.

3. Brzoska, M., et al, Epithelial differentiation of human adipose tissue-derived adult stem cells. Biochem Biophys Res Commun, 2005.330 (1): p. 142-50.

4. Fujimura, J., et al., Neural differentiation of adipose-derived stem cells isolated from GFP transgenic mice. Biochem Biophys Res Commun, 2005.333 (1): p. 116-21.

5. Garcia-Suarez, O., et al., Expression of the neurotrophin receptor TrkB in the mouse liver. Anat Embryol (Berl), 2006.221 (5): p. 465-73.

6. Gronthos, S., et al., Surface protein characterization of human adipose tissue-derived stromal cells. J Cell Physiol, 2001.189 (1): p. 54-63.

7. Kim, J. J., et al., Differentiation of adult bone marrow stem cells into neuroprogenitor cells in vitro. Neuroreport, 2002.13 (9): p. 1185-8.

8. Lim, J.Y., et al., Brain-derived neurotrophic factor stimulates the neural differentiation of human umbilical cord blood-derived mesenchymal stem cells and survival of differentiated cells through MAPK / ERK and PI3K / Akt-dependent signaling pathways. J Neurosci Res, 2008.

9. Miranville, A., et al, Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation, 2004.110 (3): p. 349-55.

10. Mizuno, H., et al., Myogenic differentiation by human processed lipoaspirate cells. Plast Reconstr Surg, 2002.109 (1): p. 199-209; discussion 210-1.

11. Ning, H., et al., Neuron-like differentiation of adipose tissue-derived stromal cells and vascular smooth muscle cells. Differentiation, 2006.44 (9-10): p. 510-8.

12. Planat-Benard, V., et al., Spontaneous cardiomyocyte differentiation from adipose tissue stroma cells. Circ Res, 2004.94 (2): p.223-9.

13. Planat-Benard, V., et al., Plasticity of human adipose lineage cells toward endothelial cells: physiological and therapeutic perspectives. Circulation, 2004.109 (5): p.656-63.

14. Reichardt, L.F., Neurotrophin-regulated signaling pathways. Philos Trans R Soc bond, Biol Sci, 2006.366 (1473): p. 1545-64.

15. Rivera, F.J., et al., Adult hippocampus derived soluble factors induce a neuronal-like phenotype in mesenchymal stem cells. Neurosci Lett, 2006.406 (1-2): p. 49-54.

16. Seo, M.J., et al., Differentiation of human adipose stromal cells into hepatic lineage in vitro and in vivo. Biochem Biophys Res Commun, 2005.328 (1): p. 258-64.

17. Yan, Q., et al, Immunocytochemical localization of TrkB in the central nervous system of the adult rat. J Comp Neurol, 1997.378 (1): p. 135-57.

18. US 7,078,230; published on July 18, 2006.

19. Anghileri, E., et al., Neuronal differentiation potential of human adipose-derived mesenchymal stem cells. Stem Cells Dev, 2008.17: p.909-916.

Claims (7)

1. A method of obtaining a population of stromal cells of adipose tissue induced to neural differentiation, comprising isolating a population of stromal cells from adipose tissue (SCLC), culturing them in a standard medium for mammalian cells and inducing differentiation by transferring to a medium containing a neural differentiation inducer, and by the fact that after isolating the total population of SCLC, it is subjected to immunosorting based on the use of antibodies against a receptor (TrkB) against neurotrophic brain factor (BDNF) , with obtaining a substantially homogeneous subpopulation of TrkB-expressing cells, which are further cultured and induced in the direction of neural differentiation, using BDNF in combination with 5-azacytidine or retinoic acid in combination with 5-azacytidine as an inducer. 2. The method according to claim 1, characterized in that as an inductor use BDNF in combination with 5-azacytidine. 3. The method according to claim 2, characterized in that the concentration of BDNF and 5-azacytidine in a differentiating medium is 20 ng / ml and 1 mm, respectively. 4. The method according to claim 1, characterized in that retinoic acid in combination with 5-azacytidine is used as an inductor. 5. The method according to claim 4, characterized in that the concentration of retinoic acid and 5-azacytidine in a differentiating medium is 1 mm and 1 mm, respectively. 6. The method according to claim 1, characterized in that the immunosorting is carried out using immunomagnetic selection or flow cytofluorimetry. 7. The method according to any one of claims 1 to 6, characterized in that the cell cultivation is carried out in DMEM medium with 10% fetal bovine serum, and induction in the same medium with the addition of an inducer.

Images