RU2370275C2 - Method of cosmetic and age skin defect treatment (correction) at combined application of fraction photothermolysis technology with bioactive ingredients independently of administration method - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention concerns medicine, particularly cosmetology, dermatology. Method includes fraction photothermolysis combined with administration of "CoffeeBerry" medication. "CoffeeBerry" is administered by 1 capsule twice per day in three days before fraction photothermolysis and in the day of the procedure.

EFFECT: reduced post-laser edema, shorter phase of inflammatory reaction, prevented pain and discomfort after procedure.

2 cl, 4 ex, 4 dwg

Description

FIELD OF THE INVENTION

The invention relates to the field of cosmetology, dermatology, aesthetic medicine, plastic surgery, medicine, and can be used to treat cosmetic defects of the skin of the face and body associated with a violation (change) of collagen metabolism, the formation of new vessels, pigmentation, natural aging, antioxidant protection, moisturizing. In particular, the invention can be used to eliminate scars, scars, striae resulting from surgical treatment, injuries, burns, fluctuations in body weight; deep and fine wrinkles caused by facial expressions or associated with natural aging; hemangiomas, "wine stains", angiomas, telangiectasias, other skin vascular pathologies; hyperpigmentation, including that caused by physiological aging of the skin, pigmentation after previous inflammatory processes (caused by burns, acne, other inflammatory processes), dyschromia, melasma, chloasma, other pigmentations associated with hormonal changes (menopause, pregnancy), enhanced by exposure to sunlight , freckles, layers of eumelanin, pheomelanin, any other manifestations of pigmentation, including also a genetic predisposition, the use of substances with known or unknown mimicheskim "action, systematically taken orally or applied to the skin. In addition, the invention can be recommended for the treatment and elimination of cosmetic skin defects after previous (or chronic, in remission) diseases, such as psoriasis, acne, herpes, dermatitis (allergic, seborrheic, perioral), atopic dermatitis (neurodermatitis), urticaria other skin diseases not limiting the scope of the invention.

The invention can be used to correct age-related signs of aging and aging of the skin, including a decrease in antioxidant protection, a decrease in skin turgor, including the formation of collagen and elastin, the formation of wrinkles; a drop in the level of hydration, a decrease in the rate of regeneration, a weakening of immune defense, oxygen starvation, impaired cellular respiration, other signs of age-related aging and changes in the properties of the skin, not limiting the scope of the invention.

State of the art

Fractional photothermolysis technology is implemented in a Fraxel® laser unit (Reliant Technologies). The principle of laser operation is based on the formation of microthermal zones (MTZ), which damage 20% of the treated surface. In this case, 80% of the skin surface, not exposed to the laser, remain intact. This fabric provides a molecular basis for restructuring and rejuvenating all 100% of the treated surface.

The molecular principles of rejuvenation are based on the mechanisms associated with intracellular stress, the source of which is the laser. The optimal Fraxel wavelength (1500 nm), and the zones of microthermal damage create the conditions under which the activation of intracellular mechanisms to protect cells from death occurs. In this case, the strength of the effect turns out to be just that at which intracellular cascades of anti-apoptotic signaling pathways are launched, the result of which is an increase in the life time of cells with an updated metabolism.

It is known from the literature that weak types of stress, which, in particular, include the energy of light and heat of a certain range, stimulate cell cultures to survive (Rattan, 2004a; Rattan, 2004b). The mechanism of rejuvenation under the influence of "non-fatal" doses of stress is called hormesis. Hormesis is based on the biological activity of specific stress proteins, the so-called heat shock proteins (from the English heat shock proteins - HSP). Hormesis stimulates the expression of HSPs, which take part in deciding the structural fate of other proteins that are important and not important for cell metabolism (i.e., perform the so-called chaperone function). A large amount of non-functional proteins that are not involved in normal cellular metabolism accumulate in the cell during aging. These include proteins with an increased degree of glycosylation, proteins with an irregular structure (with impaired folding), proteins exposed to free radicals. They are subject to degradation, but under normal conditions in the cell, which undergoes chronological aging, there are other priorities, therefore, an additional mechanism for triggering proteolytic degradation of these protein components is necessary. Hormesis stimulates the activation of the proteolytic activity of these protein components, thus accelerating the processes of catabolism. The basis of proteolytic degradation is activation by protest - huge oligomeric protein complexes. HSPs stabilize the structure of proteosomes that promote proteolytic degradation of proteins. As a result of proteolysis of polypeptide chains, amino acids, peptides, oligopeptides are formed; some of them can stimulate the synthesis of new proteins. Under the influence of hormesis induced by the laser, the formation of new skin collagen is stimulated.

The combined use of fractional photothermolysis with biologically active ingredients is expressed in obtaining a more stable result, since a specific correction of cosmetic problems is added to the general stimulation against the background of the “hormesis effect”. Depending on the task, it can be any biologically active ingredients that are approved for use in cosmetic and medical purposes. For example, the combined use of king crab with collagenase allows the normalization of collagen metabolism, which for several reasons turned out to be non-functional. The reasons for this, among others, may be glycosylation, ultraviolet damage, inflammation, and crosslinking. Human collagenase does not "recognize" such a modified collagen, due to which its accumulation and lack of stimulus for its degradation negatively affects the formation of new collagen. The use of king crab collagenase, the bioavailability of which increases against the background of fractional photothermolysis, breaks down such collagen into fragments; some of them stimulate fibroblasts to activation and, therefore, to neocollagenesis.

The introduction of fractional photothermolysis in dermatocosmetology has been known since 2003, when Huzaira and colleagues first proposed the use of the method for treating skin damaged by ultraviolet light (Huzaira et al., 2003). The following years unequivocally determined the use of fractional photothermolysis for the treatment of many other skin defects, including scars, the effects of acne, hyperpigmentation, and other cosmetic defects of the skin of the face and body. For example, in the work of Manstein et al. The clinically significant effect of the correction of wrinkles and general rejuvenation of the facial skin has been demonstrated and convincingly proven (Manstein et al., 2004). Several studies have noted positive dynamics in the elimination of facial skin hyperpigmentation using fractional photothermolysis (Rostan, 2005; Rokhsar & Fitzpatrick, 2005; Geronemus, 2006; Wanner et at., 2007). General rejuvenation of a laser-treated surface is shown, in particular, in Laubach et al (2006). Other authors demonstrate good results in the treatment of postoperative sutures. It was shown that after 2 weeks a significant (75%) improvement in the appearance of the suture (scar) was achieved, and the positive dynamics continued for another 1 month (Behroozan et al., 2006). A recent publication noted the beneficial effects of treating cicatricial changes in skin with post-acne (Hasegawa et al., 2006).

It is known about the successful use of fractional photothermolysis for medical purposes, namely, for the treatment of a special type of skin pigmentation, Sivatt's reticular pigmented poikiloderma (the so-called Riel melanosis) (Behroozan et al., 2006).

Thus, the use of fractional photothermolysis is a relatively safe and easily tolerated procedure. However, in some cases, patients had mild side effects, such as transient erythema, dry skin, superficial scratches, hypersensitivity, rarely acne provocation (Fisher & Geronemus, 2005).

In a recent work, the principle of the action of fractional photothermolysis at the cell level has been deciphered (Hantash et al., 2006). According to the authors, the formation of microthermal zones on the treated skin area creates a temporary transport system through the channels of which the elimination of necrotic debris, dead cells, aging pigments, and other degradation products caused by photothermolysis are eliminated. After 4-14 days there is a complete re-epithelization of the skin and exfoliation of cell debris.

Analysis of patent searches has shown the widespread use of non-ablative skin exposure methods. The most popular among all types of photothermolysis is selective photothermolysis. However, its selectivity causes some limitations in its use: the physicochemical characteristics of lasers operating on the principle of selective photothermolysis, and the choice of chromophore (heme) limits its use mainly at the level of vascular skin pathologies. US patents No. 7066929, 6579284, 6391022, 6214034, 6171301, 5814040, 5766214, 5759200, 5749868, 5746735, 5632741, 5066293, 4829262 confirm its selectivity for action on blood vessels due to the influence of a certain wavelength; the use of selective photothermolysis is not positioned on a wider range of effects.

US Pat. No. 6,986,903 describes a method for using a laser (or chemical peeling) in combination with biologically active ingredients (in particular with coenzyme Q10 and phospholipids) in an oil-in-water lamellar emulsion. The invention relates to methods for treating wound healing and improving the regenerative ability of the skin. US Pat. No. 6,897,238 teaches a laser phototherapy for seborrheic manifestations of the skin, as well as manifestations of acne in combination with 5-aminolevulinic acid. Dosages of applicative application of the drug in combination with energy during photodynamic therapy are discussed.

Patent 6663659 (prototype) discusses a method of photomodulating the metabolism of living cells, aimed at removing or stimulating hair growth, reducing wrinkles, reducing acne, affecting vitiligo, removing sutures, etc. The method involves combined use (applied applicatively or taken per os) with biologically active ingredients such as vitamins C, E, A, K, F, retin A (tretinoin), adapalene, retinol, hydroquinone, kojic acid, echinacea, antibiotics, antifungal, bleaching agents, alpha hydroxy acids, beta hydroxy acids, salicylic acid, antioxidants, algae derivatives, hormones, minerals, enzymes, genetically modified biologically active substances, plant ingredients, cofactors, s anti-aging substances, insulin, microelements, substances that inhibit or stimulate hair growth, natural or synthetic melanin, metalloproteinase inhibitors, proline, hydroxyproline, anesthetic substances, chlorophyll, carotenoids, as well as analogues or derivatives of the above ingredients, both natural and synthetic . Moreover, the prototype does not imply the technology of fractional photothermolysis, there is an applicative effect of biologically active ingredients, and also not a complete set of cosmetic defects that can be corrected is covered.

As for the technology of fractional photothermolysis, only one example of the “non-independent” use of such a laser is published in the literature, namely in combination with cooling (Fisher et al., 2005). It should be noted that this approach is dictated rather by the inevitability of skin analgesia and is an inextricable part of the traditional method of fractional photothermolysis as such, in which, in addition to analgesic agents, no additional biologically active ingredients are used.

The disadvantages of the described methods of cosmetic correction include insufficiently comprehensive coverage of molecular targets involved in the development and formation of cosmetic defects; the impact is not on the cause, but on the consequences, which usually leads to temporary visible improvements and short-term results, as well as complications.

Formulation of the problem

An inventive task is to create a more universal and effective method for the treatment (elimination, correction) of skin defects and signs of skin aging, taking into account the molecular features of rejuvenation, coverage of specific molecular targets involved in the development of cosmetic, including age-related defects of the face and body skin.

Disclosure of the invention.

The inventive task is solved by the fact that a combined use of fractional photothermolysis (Fraxel®, Reliant Technologies) with biologically active ingredients is proposed. Biologically active ingredients can be applied both applicatively and orally (orally, parenterally).

Depending on the intended use, the biologically active ingredients may be presented in the following non-limiting embodiments.

As bleaching agents, white mulberry root extract, arbutin, benzoic acid, glabridin, angelica extract, wild strawberry, kinetin, kojic acid, limet oil, niacinamide, eclonia extract, olive extract, lemon extract, benzoic acid can be used, citric acid, other ingredients with whitening properties of natural and chemical origin, approved for use with cosmetic and therapeutic purposes, as well as to fill the deficiency of nutrients.

As a means of regulating collagen synthesis, noni extract, Centella asiatica extract, collagen, collagen-stimulating peptides, hydrobiont collagenase, other ingredients of natural and chemical origin that are approved for use with cosmetic and therapeutic purposes, as well as to compensate for the deficiency of nutrients, can be used.

Quercetin, coenzyme Q10 (ubiquinone), coffee berry extract, green tea extract, ginkgo biloba extract, ascorbyl palmitate, calendula extract, coffee oil, vitamin E (alpha-tocopherol), L-carnosine, and others can be used as antioxidant agents. ingredients with antioxidant properties of natural and chemical origin, approved for use with cosmetic and therapeutic purposes, as well as to fill the deficiency of nutrients.

Extracts of plants and fruits can be used as moisturizers, including cotton extract, bamboo extract, oat extract, aloe extract, cactus extract, hawthorn extract, lotus extract, orange extract, green apple extract, vanilla extract, melon extract, extract echinacea; yeast extract; seaweed extract, including kelp; beeswax, hydrolyzed collagen, omega-3, -6, (polyunsaturated) fatty acids, including grape seed oil; mink oil, peach oil, lavender oil, liquid paraffin, shea butter, jojoba oil, lanolin, hydrolyzed vegetable proteins, including rice protein, wheat protein, soy protein; nucleic acids of milk and eggs of sturgeon and marine fish, thermal water, glycolic acid, safflower, a natural moisturizing factor, including creatinine; amino acids, including lecithin, serine; chitosan, sorbitol (sorbitol), allantoin, silicones, urea, vitamin B5, vitamin E, hyaluronic acid, glycerin, ceramides, whey, lactic acid and its salts, including sodium lactate; honey, other moisturizing ingredients of natural and chemical origin, approved for use with cosmetic and therapeutic purposes, as well as to fill the deficiency of nutrients.

Allantoin, hydrolyzed silk crotein, oregano extract, ginseng extract, lecithin, vitamin K, ylang-ylang oil, escin, borage oil, blackcurrant, evening primrose (oslinik), oil can be used as agents with a general positive and regenerative effect. avocado, shea, olive, rosehip seeds, wheat germ, rice bran, chamomile extract, aloe, bay tree oil, coconut oil, cocoa butter, comfrey extract, squalene, vitamins, other natural and chemical ingredients roiskhozhdeniya permitted for use with cosmetic and therapeutic purposes, as well as to replenish nutrients deficiency.

Fibroblast growth factors (representatives of the FGF protein family - fibroblast growth factor), epidermal growth factor (EGF - epidermal growth factor), and vascular endothelial growth factors (EGF) can be used as agents with growth-stimulating and biological activity on specific target cells. VEGF - vascular endothelial growth factor), cellular material (human fibroblasts), other ingredients with biological activity of protein or cell origin, approved for use for cosmetic and therapeutic purposes.

The proposed combination of biologically active ingredients with fractional photothermolysis can be used in all cases in which traditional methods of correction of cosmetic defects are unsound.

Inventive evidence

Despite the fact that certain methods of treating skin defects are known, their combination as a rejuvenating and eliminating skin defects method is proposed for the first time, for which the applicant has established a synergism of the target action, not arising from the prior art.

Examples of carrying out the invention

The invention is illustrated by the following examples.

Example 1. Determination of the expression level of type 1 collagen in the skin of mice in combination with Centella asiatica.

The treated skin of the mice was subjected to the applicative effect of Centella Asiatica, both as a mono-exposure and in combination with fractional photothermolysis.

Isolation of total RNA. The level of collagen expression was determined by RT-PCR. For control, total RNA was isolated from mouse skin samples in the treated area and from a healthy skin site. Samples were frozen and stored until RNA was isolated at -70 ° C. RNA isolation was performed using the RNAeasy kit (Promega, USA) using the standard protocol. The resulting RNA was dissolved in 50 μl of H ₂ O DEPC and the amount was determined spectrophotometrically at 260 nm / 320 nm.

Construction of cDNA. The following reagents were used to construct DNA: 100 tM dithiothreitol, 2 mM dNTP, 200 U reverse transcriptase, special buffer. 20 U IRNAsine, 100 U RNAseH, phenol. 3M sodium acetate pH 4.0, isopropyl alcohol, 70% ethyl alcohol, glycogen, TE buffer pH 7.0. Construction of cDNA was carried out according to a standard protocol using an AdT15 primer. T annealed reverse transcriptase = 37 ° C (Sambrook et al., 2001). The resulting cDNA was dissolved in 15 μl of TE buffer.

Polymerase chain reaction. The polymerase chain reaction (PCR) was performed using DNA-specific primers:

straight 5'GCCCAACTGTGAGCAAGGAG 3 ',

reverse 5'CAATGTGGGCTGGAATCCG 3 ',

mActin-S 5'GACCTGACAGACTACCTCATG3 ',

Mastin-A 5'CAGTAASAGTSSGCSTAGAAG3 '.

PCR was performed on a genomic DNA matrix using 10 pmol primers in a buffer containing 50 mM Tris-HCl (pH 9.2), 16 mM (NH ₄ ) ₂ SO ₄ , 1.75 mM MgCl ₂ , 0.2 mM solution of each deoxynucleoside triphosphate, 0.5 unit. Taq polymerase, 2% formaldehyde. 25-35 amplification cycles consisted of pre-denaturation at 95 ° C for 3 min, denaturation at 95 ° C for 40 sec, annealing of primers at 58 ° C (actin), 62 ° C (EGF-R), 60 ° C ( EGF) for 40 sec and chain elongation at 72 ° C for 1 minute.

Electrophoresis of DNA in agarose gel. DNA electrophoresis was performed at a voltage of 5-10 V / cm in a 0.8-2% agarose gel in TAE buffer (composition: 40 mM Tris-acetate, 2 mM EDTA, pH 8.0). Before applying to the gel, a 6-fold buffer containing 0.25% xylencyanol and 30% glycerol was added to the DNA preparation. After electrophoresis, the gel was stained in the presence of 1 μg / ml ethidium bromide for 15 minutes. DNA was visualized in UV light at a wavelength of 254 nm.

The gel was wrapped in a cellophane membrane and photographed with a Kodak DC120 digital camera. The image was processed in the Photoshop editor and GelQuant.

Interpretation of the results was carried out taking into account normal values, indicators noted in healthy mice by us and other authors. Expression was expressed as values of the relative level and was normalized to the β-actin gene of the “housekeeping” (so-called house-keeping gene). The relative level of gene expression (β-actin in donors was taken as unity.

Example 2. Determination of expression of stress proteins.

The material used for the study was skin biopsy samples taken from mice in the area subjected to fractional photothermolysis of the skin, as well as from the site of intact skin. A biopsy was performed under local anesthesia (2% novocaine solution). Fractional photothermolysis was performed according to a standard technique.

Biopsies were fixed in a 10% buffered formalin solution, subjected to standard histological wiring, and embedded in paraffin. Slices with a thickness of 4-5 microns were obtained from paraffin blocks on a microtome, stretched on glasses with a polylysine coating. Stained with hematoxylin-eosin.

An immunomorphological study was carried out according to the following method: after dewaxing in xylene, the antigenic unmasking procedure was carried out by boiling in citrate buffer (pH 6.0) in a microwave oven for three cycles of 5 minutes with 1-minute breaks. After cooling at room temperature, the glasses were washed in a solution of TRIS buffer pH 5.54, a 0.3% solution of hydrogen peroxide on methanol (1: 1) was applied to the sections to prevent endogenous peroxidase activity.

An immunohistochemical reaction was then carried out using monoclonal antibodies from Stressgene (USA). Mouse anti-HSP-70 antibodies were used at a 1: 150 dilution. Serum sections were incubated for 60 minutes at room temperature. For visualization, the Novokastra SuperABC-Kit universal system (Novokastra Laboratories Ltd., Great Britain) was used. In all cases, nuclei were stained with hematoxylin.

The resulting preparations were studied in a light microscope "Nikon eklipse E600"; documented by photographing with a Nikon D100 digital camera. The determination of the number of HSP-70-positive cells in the epidermis was performed per 100 cells of the basal layer. The level of expression of heat shock proteins HSP70 was visually detected (Figure 2). It was shown that the expression of HSP70 in intact skin was significantly lower (Fig. 2A) than in skin subjected to fractional photothermolysis (Fig. 2 B). This mechanism explains the significant difference in stress-induced rejuvenation when using fractional photothermolysis on the skin of patients before and after photothermolysis and is consistent with numerous literature data explaining the physiological role of heat shock proteins in mild stress types. The experiment confirms the direct involvement of anti-apoptotic heat shock proteins (in this case, HSP-70) in post-stress metabolism, which is manifested in the manifestation of signs of skin rejuvenation under the influence of fractional photothermolysis. This molecular mechanism is the biological basis for the activation of intracellular (fibroblastic) metabolism, which makes it possible to achieve background stimulation of skin renewal, without taking into account the specific effects on problem areas. And in combination with biologically active ingredients, the effect is enhanced by adding a specific (target) effect.

Example 3. Evaluation of post-stress pro-inflammatory reaction when using fractional photothermolysis against a background of biologically active ingredients (dietary supplements)

To assess the combined use of fractional photothermolysis and dietary supplements, a study was conducted on a contingent of volunteers. Patients were invited to participate - women aged 45-50 years who do not have any cosmetic skin defects other than age-related wilting; not suffering from chronic diseases. The aim of the patients was to improve the appearance of the skin, rejuvenation, increase turgor elasticity. The treated surface consisted of facial skin, neck and décolleté.

Patients were allowed to participate in the study in accordance with the “Rules for conducting quality clinical trials in the Russian Federation, industry standard OST 42-511-99). All patients were informed about the goals and consequences of the procedure; voluntary consent was obtained from all subjects to participate in the trial.

40 people were invited to participate in the study, which were divided into 4 groups, each of 10 people. The groups were formed as follows: group 1 - participation in the process of fractional photothermolysis (FF) while taking the Coffeberry preparation (KB). This is a biologically active additive (registration certificate number -77.99.23.3. U. 10842.10.06 dated 10/13/2006) containing highly effective antioxidant ingredients. The symbol for group 1 is (+ KB + FF). Group 2 took part in the photothermolysis procedure without taking Coffeberry (-KB + FF); group 3 - taking “Coffeberry” without participating in the photothermolysis procedure (+ KB-FF), and control - without participating in the photothermolysis procedure and without taking the drug (-KB-FF). 3 days before the procedure, as well as on the day of the fractional photothermolysis procedure, the first group received the drug in a dosage of “1 capsule 2 times a day”. After fractional photothermolysis in accordance with the effects of post-laser exposure, all patients in the first two groups developed local edema. However, in the patients of the first group it was short-term (several hours), was not accompanied by pain or other unpleasant sensations, the patients did not notice any manifestations of discomfort. There was a clear shortening of the phases of the inflammatory response. Patients of the second (control) group noted slight discomfort from post-laser exposure, edema lasted from one day to one and a half, some of them required symptomatic therapy (analgesics, NSAIDs). On the second day in the second group, all subjects experienced a complete restoration of their initial general state of health. The results of changes in the skin after laser exposure in both groups, according to the subjects, were good or very good. Edema and inflammatory reaction were completely leveled.

The criterion for differences in the post-stress reaction was the level of pro-inflammatory cytokines - tumor necrosis factor-alpha and interleukin-1 (TNF-a, ILI-b) in the blood serum of patients by the end of 1 day after laser exposure. The level of cytokines was measured by ELISA in accordance with the standard protocol using ProConTNFa and ProConIL-1b reagents (Protein circuit LLC, Russia). As a control, the blood serum of subjects from the 4th group was used.

Statistical analysis was carried out by the Statistica application package. Since the data we obtained do not obey the normal distribution and the sample size is quite small, the nonparametric Wilcoxon rank test for coupled pairs of variables was chosen as a criterion for assessing differences. The following variables were taken in each group as compared variables: levels of TNF-a and IL-1b during administration of Coffeberry and photothermolysis (+ KB + FF), against photothermolysis without administration of Coffeberry (-KB + FF), against receiving "Coffeeberry" without photothermolysis (+ KB-FF), and control (-KB-FF), the total number of variables is eight. Statistically significant differences in the level of the studied cytokines were obtained in all the studied groups compared with the control (significance level p <0.05) (Figure 3). Exceptions were variables “-KB + FF” for TNF-a and IL-1b (p = 0.16), “-KB + FF” and “-KB-FF” for the level of TNF-a (p = 0.068), and the same variables for IL-b (p = 0.57). The absence of statistically significant differences between these pairs of variables once again proves the effect of the “joint participation” of both pro-inflammatory cytokines in the development of the inflammatory post-stress reaction. In addition, the absence of differences in the level of proinflammatory cytokines in groups that did not undergo fractional photothermolysis is explained by their banal absence, which is confirmed by the low average level of cytokines in these groups (52 pkg / ml for TNF-a and 32 pkg / ml for IL-1b )

Example 4. Evaluation of the effectiveness of fractional photothermolysis in combination with biologically active ingredients

This example illustrates the potential of fractional photothermolysis in combination with biologically active ingredients in volunteers (Figure 4). Photothermolysis was carried out according to the standard method; Kamchatka crab collagenase was used as an additional ingredient.

A brief description of the drawings.

Figure 1. The difference in the expression of type 1 collagen in the skin of mice under the influence of Asian centella and in combination with fractional photothermolysis (β-actin gene expression level is not shown).

Figure 2. Immunohistochemical staining for HSP-70 by fractional photothermolysis. A - intact skin, B - after fractional photothermolysis. Increased expression of HSP-70 is indicated by arrows.

Figure 3. Study of the levels of proinflammatory cytokines TNF-a and IL-1b in groups of subjects. Legend: taking "Coffeberry" and participating in the photothermolysis procedure (Group 1, + KB + FF); participation in the photothermolysis procedure without taking Coffeberry (Group 2, -KB + FF); against the background of taking "Coffeberry" without photothermolysis (Group 3, + KB-FF); and control (Group 4, -KB-FF). P is the significance level at which the null hypothesis is rejected (<0.05).

Figure 4. The results of the use of fractional photothermolysis in combination with collagenase of king crab. Figa, 4E, - the appearance of scars before the procedures, Fig.4B and 4F - after; Figs and 4D - elimination of a skin defect after acne (before and after, respectively).

Literature

1. Behroozan D.S., Goldberg L.H., Dai T., Geronemus R.G., Friedman P.M. Fractional photothermolysis for the treatment of surgical scars: a case report. J. Cosmet. Laser. Ther. 2006, Apr .; 8 (1): 35-8.

2. Behroozan D.S., Goldberg L.H., Glaich A.S., Dai T., Friedman P.M. Fractional photothermolysis for treatment of poikiloderma of civatte. Dermatol Surg. 2006 Feb .; 32 (2): 298-301.

3. Fisher G.H., Geronemus R.G. Short-term side effects of fractional photothermolysis. Dermatol. Surg. 2005 Sep .; 31 (9 Pt 2): 1245-9; discussion 1249.

4. Fisher G.H., Kirn K.H., Bernstein L.J., Geronemus R.G. Concurrent use of a handheld forced cold air device minimizes patient discomfort during fractional photothermolysis. Dermatol. Surg. 2005, Sep .; 31 (9 Pt 2): 1242-3; discussion 1244.

5. Geronemus R.G. Fractional photothermolysis: current and future applications. Lasers Surg. Med. 2006 Mar .; 38 (3): 169-76.

6. Hantash B.M., Bedi V.P., Sudireddy V., Struck S.K. Herron G.S., Chan K.F. Laser-induced transepidermal elimination of dermal content by fractional photothermolysis. J. Biomed. Opt. 2006, Jul.-Aug .; 11 (4): 041115.

7. Hasegawa T., Matsukura T., Mizuno Y., Suga Y., Ogawa H., Ikeda S. Clinical trial of a laser device called fractional photothermolysis system for acne scars. J. Dermatol. 2006, Sep .; 33 (9): 623-7.

8. Huzaira M., Anderson R.R., Sink K., Manstein D. Intradermal focusing of nearinfrared optical pulses: a new approach for nonablative laser therapy. Lasers Surg. Med. 2003: 15: (Suppl.): 66.

9. Laubach H.J., Tannous Z. Anderson R.R., Manstein D. Skin responses to fractional photothermolysis. Lasers Surg. Med. 2006, Feb .; 38 (2): 142-9.

10. Manstein D., Herron G.S., Sink R.K., Tanner H., Anderson R.R. Fractional photothermolysis: a new concept for cutaneous remodeling using microscopic patterns of thermal injury. Lasers Surg. Med. 2004; 34 (5): 426-38.

11. Rattan S.I. Hermetic mechanisms of anti-aging and rejuvenating effects of repeated mild heat stress on human fibrobtasts in vitro. Rejuvenation Res. 2004a Spring; 7 (1): 40-8.8:

12. Rattan S.I. Mechanisms of hormesis through mild heat stress on human cells. Ann N. Y. Acad. Sci. 2004b Jun .; 1019: 554-8.

13. Rokhsar C.K., Fitzpatrick R.E. The treatment of melasma with fractional photothermolysis: a pilot study. Dermatol. Surg. 2005, Dec .; 31 (12): 1645-50.

14. Rostan E.F. Laser treatment of photodamaged skin. Facial Plast Surg. 2005, May; 21 (2): 99-109.

15. Sambrook, Russel "Molecular Cloning: A Laboratory Manual (Third Edition)", Cold Spring Harbor Press, 2001.

16. Wanner M., Tanzi E.L., Alster T.S. Fractional photothermolysis: treatment of facial and nonfacial cutaneous photodamage with a 1,550-nm erbium-doped fiber laser. Dermatol. Surg. 2007 Jan .; 33 (1): 23-8.

Claims (2)

1. A method for correcting age-related skin defects by fractional photothermolysis in combination with the administration of the Cofeberri preparation, which is taken 1 capsule 2 times a day three days before fractional photothermolysis and on the day it is performed. 2. The correction method according to claim 1, characterized in that it is used to correct age-related signs of withering and aging of the skin, including reducing antioxidant protection, reducing skin turgor, including the formation of collagen and elastin, the formation of wrinkles; a drop in the level of hydration, a decrease in the rate of regeneration, a weakening of the immune defense, oxygen starvation, impaired cellular respiration, and other signs of age-related aging and withering of the skin.

Images