RU2353653C2 - Biological mocrochip with immobilised oligoribonucleotides, method of its manufacturing and method of analysing rna interaction with rna-binding molecules with its application - Google Patents

Abstract

FIELD: chemistry, biochemistry.

SUBSTANCE: invention relates to molecular biology, chemistry and biological chemistry and can be used for analysing interaction of RNA with RNA-binding molecules. Biological microchip (biochip) represents base, containing immobilised on it oligoribonucleotides, modified in one, several or all 2'-O-positions by silicon-based chemical protective groups. Method of manufacturing such biochip is performed by immobilization on base of oligoribonucleotides, containing in one, several or all 2'-O-positions silicon-based chemical protective groups. In order to remove chemical protective groups, biochip is incubated with solution for chemical protective group removal. Said method of removal of chemical protective groups in 2'-O-positions of oligoribonucleotides immobilised on biochip is performed immediately before the stage of contacting of RNA with RNA-binding molecules in order to obtain biochip for analysis of RNA interaction with RNA-binding molecules and performing method of said analysis.

EFFECT: preserving activity of immobilised molecules of ribonucleic acid.

11 cl, 7 dwg, 4 ex

Description

FIELD OF THE INVENTION

The invention relates to molecular biology, biochemistry, bioorganic chemistry, biotechnology, pharmacology and environmental protection and provides a biological microchip (biochip) designed to analyze the interaction of RNA with RNA-binding molecules, which is a substrate containing oligoribonucleotides immobilized on it, characterized in that that chemical protective groups are attached to one, several or all 2'-O positions of oligoribonucleotides. Chemical protective groups protect oligoribonucleotides from degradation and, if necessary, can be removed from immobilized oligoribonucleotides directly on the biochip immediately before its use. The invention also provides a method for removing chemical protective groups from immobilized oligoribonucleotides, a method for manufacturing biochips containing oligoribonucleotides protected from degradation, and a method for analyzing the interaction of RNA with RNA-binding molecules.

State of the art

A biochip is a matrix of microcells regularly located on a flat substrate. The size of the cells and the distance between them can vary from tens to hundreds of microns. In each cell of the biochip, molecules of the same type (molecular probes) are immobilized, capable of binding a specific type of biomolecules of the test solution applied to the surface of the biochip with a high degree of specificity. The interaction of biomolecules with probes is recorded by various methods, which allows to detect their presence in the analyzed mixture (Kolchinsky, AM, Gryadunov, DA., Lysov, Yu.P., Mikhailovich, V.M., Nasedkina, T.V., Turygin, A .Yu., Rubina, A.Yu., Barsky, V.E. and Zasedatelev, A.S. 2004. Microchips based on three-dimensional gel cells: history and prospects, Molecular Biology, 38: 5-16; Venkatasubbarao, S. 2004. Microarrays-status and prospects. Trends Biotechnol. 22: 630-7).

Currently, biochips with immobilized oligoribonucleotides are used in the following areas:

I. To study the kinetics and thermodynamics of RNA binding of proteins and antibiotics:

Hendrix, M., Priestley, E.S., Joyce, G.F. and Wong, C.H. 1997. Direct observation of aminoglycoside-RNA interactions by surface plasmon resonance. J. Am. Chem. Soc. 119:

3641-3648.

Wong, C.-H., Hendrix, M., Priestley, E.S. and Greenberg, W. 1998. Specificity of aminoglycoside antibiotics for the A-site of the decoding region of ribosomal RNA. Chem. Biol. 5: 397-406.

Van Ryk, D.I. and Venkatesan, S. 1999. Real-time kinetics of HIV-1 Rev-Rev Response Element Interactions. J. Biol. Chem. 274: 17452-17463.

Xavier, K.A., Eder, P.S. and Giordano T. 2000. RNA as a drug target: methods for biophysical characterization and screening. Trends Biotechnol. 18: 349-356

Kwon, M., Chun, S.-M., Jeong, S. and Yu, J. 2001. In Vitro Selection of RNA against Kanamycin B. Mol. Cells 11: 303-311.

Rajendran, K.S. and Nagy, P.D. 2003. Characterization of the RNA-Binding Domains in the Replicase Proteins of Tomato Bushy Stunt Virus. J. Virol. 77: 9244-9258.

Peters, H., Kusov, YY, Meyer, S., Benie, AJ, Bauml, E., Wolff, M., Rademacher, C., Peters, T. and Gauss-Muller, V. 2005. Hepatitis A virus proteinase 3C binding to viral RNA:

correlation with substrate binding and enzyme dimerization. Biochem. J. 385: 363-370.

Verhelst, S.H., Michiels, P.J., van der Marel, G.A., van Boeckel, C.A. and van Boom, J.H. 2004. Surface plasmon resonance evaluation of various aminoglycoside-RNA hairpin interactions reveals low degree of selectivity. Chembiochem. 5: 937-942.

II. To study the spatial structure of RNA:

Kirn, H.D., Nienhaus, G.U., Na, T., Orr, J.W., Williamson, J.R. and Chu, S. 2002. Mg2 + -dependent conformational change of RNA studied by fluorescence correlation and FRET on immobilized single molecules. PNAS 99: 4284-4289.

III. In the study of the catalytic properties of RNA:

Nyholm, T., Andang, M., Bandholtz, A., Maijgren, C., Persson, B., Hotchkiss, G., Fehniger, T.E., Larsson, S. and Ahrlund-Richter, L. 2000. Interaction between hammerhead ribozyme and RNA substrates measured by a surface plasmon resonance biosensor. J. Biochem. Biophys. Methods 44: 41-57.

IV. For highly sensitive determination of point mutations using RNase H:

Goodrich, T.T., Lee, H.J. and Corn, R.M. 2004. Direct detection of genomic DNA by enzymatically amplified SPR imaging measurements of RNA microarrays. J. Am. Chem. Soc. 126: 4086-4087.

Biochips with immobilized oligoribonucleotides can also be used to study the thermodynamics of RNA / RNA duplexes, RNA / DNA hybrids, and unusual nucleic acid structures.

Disadvantages of existing biochips containing immobilized oligoribonucleotides

Oligoribonucleotides that have been enzymatically produced or chemically synthesized are usually immobilized on a biochip. In the latter case, the protective groups are removed from the 2'-0-groups immediately after synthesis, before application to the biochip. RNA molecules to a much greater extent than DNA molecules are susceptible to chemical and enzymatic degradation (Kochetkov, NK and Budovsky, EI 1970. Organic chemistry of nucleic acids. Publishing house "Chemistry", Moscow). In particular, the conditions for the immobilization of oligoribonucleotides used in the manufacture of biochips (temperature, pH, UV irradiation) can lead to partial degradation of oligoribonucleotides. However, a much more general problem that arises in the production and storage of biochips with immobilized RNA molecules is the almost ubiquitous presence in the environment of ribonucleases (RNases) that cleave RNA molecules. RNases are extremely stable enzymes that are resistant, in particular, to thermal inactivation (Makarov, A.A. and Ilinskaya, O.N. 2003. Cytotoxic ribonucleases: molecular weapons and their targets. FEBS Lett. 540: 15-20). This requires the adoption of special measures to prevent the contact of oligoribonucleotides with RNases in the process of their preparation, manipulation with them and the manufacture of biochips, which not only complicates the process, but also leads to a significant increase in cost. In particular, when working with oligoribonucleotides, a set of dosing devices (for example, automatic pipettes) specially designed for manipulating RNA, general laboratory instruments and devices (in particular, scales, chromatographic equipment, electrophoretic equipment, DNA / RNA synthesizers, etc. ), reagent kits, etc. All solutions must be free of RNase, which requires pre-treatment of the water used to prepare the solutions, or, where appropriate, subsequent processing of the prepared solutions with diethyl pyrocarbonate, followed by autoclaving for sterilization and destruction of the reagent residues. Ideally, all work with RNA is carried out in a special box, chamber or separate room designated for these purposes. (Maniatis, T., Fritsch, E., and Sambrook, J. 1984. Methods of Genetic Engineering. Molecular Cloning. Mir Publishing House, Chapter 6, Clauses 3, 4, pp. 188-189).

The basis of the invention is the task of developing such a biochip with immobilized oligoribonucleotides, in the manufacture, storage and use of which the degradation of immobilized oligoribonucleotides would be minimized.

The problem is solved by the invention.

Disclosure of the invention.

The present invention provides a biological microchip designed to analyze the interaction of RNA with RNA-binding molecules, which is a substrate containing oligoribonucleotides immobilized on it, characterized in that at least one of the 2'-O positions of the oligoribonucleotides is attached chemical protective groups that prevent the formation of 2 ', 3'-cyclophosphate and the subsequent decomposition of these oligoribonucleotides. If necessary, chemical protective groups can be removed from immobilized oligoribonucleotides directly on the biochip, immediately before its use.

If necessary, the biochip may additionally contain immobilized oligodeoxyribonucleotides.

Chemical protecting groups can be attached covalently or non-covalently at the 2'-O positions of immobilized oligoribonucleotides.

As chemical protective groups covalently attached at the 2'-O positions of the immobilized oligoribonucleotides, it is preferable to use the / yr / i-butyldimethylsilyl or triisopropylsilyloxymethyl protective groups.

In one of the embodiments of the biochip of the present invention, oligoribonucleotides with protective groups at 2'-O positions are immobilized by copolymerization in the volume of three-dimensional hydrogel cells located regularly on the substrate of the biochip.

The present invention also provides a method for removing chemical protective groups from biochip oligoribonucleotides, carried out directly on the biochip immediately prior to its use and involving incubating the biochip with a solution to remove chemical protective groups for a time sufficient to remove chemical protective groups. Preferably, the deprotection can be carried out in a solution of 0.01M-3M tetrabutylammonium fluoride (TBAF) for 2-48 hours at a temperature of 0-60 ° C.

The present invention also provides a method for manufacturing a biochip of the present invention, comprising providing oligoribonucleotides containing at least one of the 2'-O positions attached chemical protective groups, and then manufacturing a biochip by immobilizing these oligoribonucleotides on a biochip substrate.

If necessary, the method further comprises providing oligodeoxyribonucleotides and immobilizing them on a biochip substrate.

In the manufacture of a biochip, synthesized oligoribonucleotides containing at least one of the 2'-O positions can be covalently or non-covalently attached with chemical protective groups. Protective groups protect oligoribonucleotides from the effects of ribonucleases during postsynthetic processing, during the manufacturing and storage of the biochip.

In one embodiment of the method of manufacturing the biochip of the present invention, the immobilization of oligoribonucleotides is carried out by copolymerization in the volume of three-dimensional hydrogel cells located regularly on the substrate of the biochip.

In another embodiment of the method for manufacturing the biochip of the present invention, a procedure is further carried out for removing chemical protective groups from immobilized oligoribonucleotides on the biochip.

The present invention also provides a method for analyzing the interaction of RNA with RNA-binding molecules, comprising contacting the RNA-binding molecules with a biochip of the present invention.

The present invention will now be described in detail with reference to the drawings.

A brief description of the drawings.

Figure 1. RNA / DNA biochip. (A) An RNA / DNA biochip diagram showing the sequences and concentrations of immobilized oligonucleotides for each hydrogel cell according to the location of the cells on the biochip. (B) Hybridization pattern of fluorescently dye-labeled Texas Red (TR) oligodeoxyribonucleotide d (TTCCAT) -TR with oligoribo- and oligodeoxyribonucleotides immobilized in 3D hydrogel RNA / DNA biochip cells. The image was obtained at -5 ° C after saturation of the fluorescent cell signals for 15 minutes. The sequences of immobilized oligonucleotides are indicated in rows. The bases of immobilized oligonucleotides leading to the formation of single and double mismatches during hybridization of the oligonucleotide d (TTCCAT) -TR are underlined. The oligoribonucleotide sequences are indicated on the left, and the oligodeoxyribonucleotide sequences are indicated on the right, indicating the location of the corresponding cells relative to the middle column of the empty gel hydrogel cells. The concentrations of immobilized oligonucleotides are indicated below the columns of the biochip cells.

Figure 2. Image of a 3D hydrogel RNA / DNA biochip incubated for two hours with a binase ribonuclease solution and then with a fluorescently labeled oligodeoxyribonucleotide d (TTCCAT) -TR solution. The hybridization conditions, sequences and concentrations of immobilized oligonucleotides, as well as their location, are the same as in Fig. 1B.

Figure 3. Studying the thermodynamic characteristics of the formation of oligonucleotide duplexes on an RNA / DNA biochip. (A) Normalized temperature dissociation curves (black symbols) and associations (white symbols) of perfect duplexes formed as a result of hybridization of the fluorescently labeled d (TTCCAT) -TR oligonucleotide with various oligoribo- and oligodeoxyribonucleotides immobilized in 3D hydrogel cells of the biochip. The sequences of immobilized oligonucleotides are indicated in the figure. (B) Normalized equilibrium temperature dissociation curves of perfect duplexes formed as a result of hybridization of the fluorescently labeled d (TTCCAT) -TR oligonucleotide with oligoribo- and oligodeoxyribonucleotides immobilized in 3D hydrogel cells of the biochip. The sequences of immobilized oligonucleotides are indicated in the figure.

The implementation of the invention

The present invention provides a biochip, on the substrate of which oligoribonucleotides containing chemical protective groups at one, several or all 2'-O positions are immobilized. The removal of these groups can be carried out immediately before using the biochip.

As oligoribonucleotides for immobilization, oligoribonucleotides containing one, several, or all 2'-O positions of any covalently or non-covalently attached chemical protecting groups that prevent the formation of 2 ', 3'-cyclophosphate and subsequent decomposition of these oligoribonucleotides can be used. Such groups include silicon-based protecting groups removed by fluorine ions (Wada, T., Tobe, M-, Nagayama, T., Furusawa, K. and Sekine, M. 1993. New strategies for oligonucleotide synthesis by use of 2- trimethylsilylethyl and 2-trimethylsilylethoxymethyl as the phosphate and 2'-hydroxyl protecting groups, respectively. Nucleic Acids Symp. Ser. 29: 9-10; Westman, E. and Stromberg, R. 1994. Removal of t-butyldimethylsilyl protection in RNA- synthesis.Triethylamine trihydrofluoride (TEA, 3HF) is a more reliable alternative to tetrabutylammonium fluoride (TBAF). Nucleic Acids Res. 22: 2430-2431), acetal groups removed under acidic conditions (Griffin, B.E. and Reese, C V. 1964. Oligoribonucleotide synthesis via 2 ', 5'-protected ribonucleoside derivatives. Tetrahedron Lett. 5: 2925-2931; Rastogi, H. and Usher, DA 1995 A new 2'-hydroxyl protecting group for the aut omated synthesis of oligoribonucleotides. Nucleic Acids Res. 23: 4872-4877) or anhydrous basic conditions (Umemoto, T. and Wada, T. 2004. Oligoribonucleotide synthesis by the use of 1- (2-cyanoethoxy) ethyl (CEE) as a 2'-hydroxy protecting group. Nucleic Acids Symposium Series, 48: 9-10), orthoester protecting groups (Scaringe, SA, Wincott, FE and Caruthers, M.H. 1998. Novel RNA Synthesis Method Using 5'-O-Silyl-2'-O-orthoester Protecting Groups. J. Am. Chem. Soc. 120: 11820-11821; Karwowski, B., Seio, K. and Sekine, M., 2005. 4,5-bis (ethoxycarbonyl) - [1,3] dioxolan-2-yl as a new orthoester-type protecting group for the 2'-hydroxyl function in the chemical synthesis of RNA. Nucleosides Nucleotides Nucleic Acids. 24: 1111-1114). Preferably, tert-butyldimethylsilyl (tBDMS) and / or triisopropylsilyloxymethyl (TOM, TOM-Protecting-Group ™) protecting groups can be used as protective groups at the 2'-O positions of the synthesized oligoribonucleotides.

Oligoribonucleotides can be obtained in various ways, for example, chemically synthesized before application to the biochip. Currently, several different chemical approaches to the synthesis of oligoribonucleotides have been developed:

phosphoramidite method (Beaucage, SL 1993. Oligodeoxyribonucleotides synthesis. Phosphoramidite approach. Methods Mol. Biol. 20: 33-61; Damha, MJ and Ogilvie, KK 1993. Oligoribonucleotide synthesis. The silyl-phosphoramidite method. Methods Mol. Biol. 20: 81-114), N-phosphonate (Froehler BC. 1993. Oligodeoxynucleotide synthesis. H-phosphonate approach. Methods Mol. Biol. 20: 63-80), phosphotether (Christodoulou C. 1993. Oligonucleotide synthesis. Phosphotriester approach. Methods Mol. Biol. 20: 19-31), solid phase (Sinha, ND 1993. Large-scale oligonucleotide synthesis using the solid-phase approach. Methods Mol. Biol. 20: 437-463) or carried out in solution (Bonora, GM, Biancotto, G., Maffini, M. and Scremin. CL 1993. Large scale, liquid phase synthesis of oligonucleotides by the phosphoramidite approach. Nucleic Acids Res. 21: 1213-1217). Preferably, the oligoribonucleotides with protective groups are synthesized by solid phase phosphoramidite chemistry from commercially available phosphoramidites containing the corresponding protective groups (GlenResearch, USA).

Oligoribonucleotides can be produced enzymatically, for example, using T7 RNA polymerase during in vitro transcription of a short DNA fragment containing the corresponding promoter (Milligan, JF, Groebe, DR, Witherell, GW and Uhlenbeck OC 1987. Oligoribonucleotide synthesis using T7 RNA polymerase synthetic DNA templates. Nucleic Acids Res. 15: 8783-8798).

Oligoribonucleotides can also be synthesized directly in the process of manufacturing a biochip, for example, by the method of stepwise synthesis of oligonucleotides of a given sequence on a biochip substrate, such as photolithography (Pease A. C., Solas D., Sullivan EJ, Cronin MT, Holmes C. P. and Fodor SPA 1994. Light-generated oligonucleotide arrays for rapid DNA sequence analysis. Proc. Natl. Acad. Sci., 91: 5022-5026).

As biochips, two-dimensional (2D) biochips whose oligoribonucleotides are immobilized on a modified surface of a substrate, or three-dimensional (3D) biochips whose oligoribonucleotides are immobilized in the volume of gel cells deposited on a substrate, can be used. Any platform (glass, plastic, membrane) can be used as a substrate.

In the manufacture of the biochip, various methods for immobilizing oligonucleotides can be used. Oligoribonucleotides can be immobilized to form covalent bonds between oligoribonucleotides chemically modified at the 5 'or 3' end and a layer of monomer, polymer or hydrogel applied to the biochip platform (Joos B., Kuster H. and Cone R. (1997). Covalent Attachment of hybridizable oligonucleotides to glass supports. Analytical biochemistry, vol. 247, pp. 96-101; Goodrich, TT, Lee, HJ, Corn, RM 2004. Direct detection of genomic DNA by enzymatically amplified SPR imaging measurements of RNA microarrays. J Am. Chem. Soc. 126: 4086-4087; Afanassiev, V., Hanemann, V. and Wolfl, S. 2000; Parfett, CL, Zhou, G. and Silverman, F. 2005. End-linked amino-modified 50-mer oligonucleotides as RNA profiling probes on nylon arrays: comparison to UV cross-linked DNA probes. Bi oTechniques 38: 690-694). Oligoribonucleotides can be immobilized on a biochip in a non-covalent manner, for example, by forming a streptavidin-biotin bond, which is usually used in the production of sensory RNA biochips to analyze the interaction of proteins and ligands with RNA by surface plasma resonance (Xavier, KA, Eder, PS and Giordano T . 2000. RNA as a drug target: methods for biophysical characterization and screening. Trends Biotechnol. 18: 349-356; Verhelst, SH, Michiels, PJ, van der Marel, GA, van Boeckel, CA and van Boom, JH 2004. Surface plasmon resonance evaluation of various aminoglycoside-RNA hairpin interactions reveals low degree of selectivity. Chembiochem. 5: 937-942), or, for example, by physical adsorption on the surface of a nitrocellulose or nylon membrane (Jones, K.D. September 2001. Membrane immobilization of nucleic acids, Part 2: Probe Attachment Techniques. IVD Technology).

A large number of methods for manufacturing 2D biochips are known, among which methods for stepwise synthesis of in situ oligonucleotides of a given sequence on the surface of a biochip platform (microarray), such as

- photolithography method,

Pease A.S., Solas D., Sullivan E.J., Cronin M.T., Holmes C.P. and Fodor S.P.A. 1994. Light-generated oligonucleotide arrays for rapid DNA sequence analysis. Proc. Natl. Acad. Sci., 91: 5022-5026;

Fodor, Stephen, P. A., Stryer, Lubert, Read, Leighton, J., Pirrung and Michael, C. Methods of making nucleic acid or oligonucleotide arrays, US Patent 6600031, July 29, 2003;

- method using ink-jet technology,

Hughes TR, Mao M., Jones AR, Burchard J., Marton MJ, Shannon KW, Lefkowitz SM, Ziman M., Schelter JM, Meyer MR, Kobayashi S., Davis C., Dai H., He YD, Stephaniants SB , Cavet G., Walker WL, West A., Coffey E., Shoemaker DD, Stoughton R., Blanchard AP, Friend SH and Linsley P.S. 2001. Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer. Nature Biotechnology, 19: 342-347.

In other methods for manufacturing 2D and 3D biochips useful for implementing the present invention, the synthesized oligonucleotides or mixtures thereof with gel monomers are applied to a modified biochip platform using robots using pins or piezoelectric spray nozzles

Afanassiev, V., Hanemann, V. and Wölfl, S. 2000. Preparation of DNA and protein micro arrays on glass slides coated with an agarose film. Nucl. Acids Res. 28: ebb;

Kumar, A. and Liang, Z. 2001. Chemical nanoprinting: a novel method for fabricating DNA microchips. Nucl. Acids Res. 29: e2;

Rubina, A.Y., Pan'kov, S.V., Dementieva, E.I., Pen'kov, D.N., Butygin, A.V., Vasiliskov, V.A., Chudinov, A.V., Mikheikin, A.L., Mikhailovich, V.M. and Mirzabekov, A.D. 2004. Hydrogel drop microchips with immobilized DNA: properties and methods for large-scale production, AnalBiochem, 325: 92-106.

In the case where the biochip additionally contains immobilized oligodeoxyribonucleotides, they can be obtained and immobilized on the biochip using essentially the same methods as oligoribonucleotides.

As RNA-binding molecules in the framework of the present invention, RNA molecules, DNA molecules, proteins, peptides, dyes, antibiotics, substrates of catalytic RNA molecules (ribozymes), etc. can be used.

The present invention will now be illustrated in detail with reference to specific examples, which are the most preferred embodiments of the present invention. It should be understood that the invention is not limited to these described embodiments. On the contrary, it is intended that it includes any alternatives, modifications, or equivalents that are acceptable given the nature and scope of the invention.

Examples.

Example 1. The design of the RNA / DNA biochip, the interaction of fluorescently labeled oligonucleotide d (TTCCAT) -TR with oligoribo- and oligodeoxyribonucleotides immobilized in the gel cells of the biochip.

Synthesis of oligonucleotides.

Oligoribo- and oligodeoxyribonucleotides with an aminolinker at the 3'-end were synthesized in an amount of 1 μmol using an Applied Biosystems 394 DNA / RNA synthesizer (Applied Biosystems, USA). For the synthesis of oligoribonucleotides, ribophosphoramidites containing, in particular, a 2'-O-tert-butyldimethylsilyl protecting group (tBDMS) were used. Ribofosoforamidites (Ras-A-CE Phosphoramidite, iPr-Pac-G-CE Phosphoramidite, U-CE Phosphoramidite, Ac-C-CE Phosphoramidite), deoxyribophosphoramidites (dA-CE Phosphoramidite, dmf-dG-CE Phosphoramidite, dT-CE Ac-dC-CE Phosphoramidite), 3'-C (7) aminolinker and 2M triethylammonium acetate (TEAA) were purchased from Glen Research (USA).

Protecting groups were removed from oligoribo- and oligodeoxyribonucleotides in accordance with the manufacturer's standard protocol (Glen Research, USA). Oligoribonucleotide r (AUGGAA) * was taken as a control: all protective groups from nucleoside bases (adenine, guanine, cytosine), from phosphate groups (cyanethyl protective group) and from 2'-hydroxyl groups of ribose rings (tBDMS) of this oligoribonucleotide immediately after synthesis. All protective groups were removed from the remaining oligoribonucleotides, with the exception of the tBDMS protective group, which was not removed. All oligonucleotides were purified using reverse HPLC on a Hypersil ODS column (5 μm, 4.6 × 250 mm) at 20 ° C. Oligonucleotides were eluted either in 0.1 M TEAA (pH 7) or in 0.1 M TEAA with an acetonitrile gradient from 0 to 50% (pH 7.0). The flow rate was 1 ml / min. Hexadeoxyribonucleotide d (TTCCAT) used for hybridization with immobilized biochip oligonucleotides was covalently labeled with Texas Red sulfonyl chloride fluorescent dye (Molecular Probes, USA) according to the manufacturer's protocol.

Oligonucleotide concentrations were determined using a Jasco 550 spectrophotometer (Jasco, Japan); when calculating the concentrations, the average extinction coefficient for hexanucleotides was taken equal to 60,000 M ^-1 cm ^-1 .

Production of RNA / DNA biochips.

Three-dimensional hydrogel RNA / DNA biochips were prepared by copolymerization using IMAGEChip technology (Rubina, AY, Pan'kov, SV, Dementieva, EI, Pen'kov, DN, Butygin, AV, Vasiliskov, VA, Chudinov, AV, Mikheikin, AL, Mikhailovich, VM and Mirzabekov, AD 2004. Hydrogel drop microchips with immobilized DNA: properties and methods for large-scale production. Anal Biochem, 325: 92-106), provided by Biochip-IMB (Russia, website: www.biochip .ru) and contained RNA and DNA molecules immobilized in the volume of the corresponding gel cells located on the hydrophobic surface of the glass. The oligonucleotides were immobilized in the gel cells of the biochip in two concentrations: 1 × 10 ^-4 M and 2 × 10 ^-4 M. The diameter of the three-dimensional hemispherical gel cells was 300 μm with an accuracy of 10%, the cell volume was 2 nl. The distance between adjacent cells was 550 μm.

Removal of tBDMS protecting groups from biochip oligoribonucleotides.

The tBDMS protective groups were removed from the oligoribonucleotides on the biochip, immediately before its use, in a 40 μl chamber containing a solution of 0.01 M-3M tetrabutylammonium fluoride (TBAF), for 2-48 hours at a temperature of 0-60 ° C.

Hybridization.

Hybridization of 5'-TTCCAT-TR oligonucleotide at a concentration of 4 · 10 ^-5 M with biochip oligonucleotides and subsequent dissociation of duplex complexes were carried out in sterile buffer containing 1 M NaCl, 10 mM Na-phosphate buffer (pH 7.0), 1 mM EDTA , 0.1% (v / v) Tween 20, in a 40 μl chamber. Hybridization was carried out at -5 ° C for 15 min; under these conditions, the fluorescent signals of the gel cells reached saturation. Fluorescence hybridization signals of a fluorescently labeled oligonucleotide, temperature dissociation curves, and associations were recorded using a biochip imaging analyzer (Fotin, AV, Drobyshev, AL, Proudnikov, DY, Perov, AN and Mirzabekov, AD 1998. Parallel thermodynamic analysis of duplexes on oligode. Nucleic Acids Res. 26: 1515-1521).

On figa shows the layout of RNA / DNA cells of the biochip. RNA / DNA biochip is applied to the hydrophobic surface of glass matrix of three-dimensional hydrogel cells hemispherical shape with immobilized at two concentrations oligoribo- and oligodeoxyribonucleotides: geksaribonukleotidom r (AUGGAA), geksaribonukleotidami with substitutions in one or two bases r (AUG A AA), r ( AU A GAA), r (AU AA AA) (the position of substitutions is underlined) and hexadeoxyribonucleotides of the equivalent sequence: d (ATGGAA), d (ATG A AA), d (AT A GAA), d (AT AA AA). Oligodeoxyribonucleotides were applied to the biochip for subsequent comparison of the thermodynamics of DNA duplexes and RNA / DNA hybrids on one biochip. The immobilized hexaribonucleotides contained a tBDMS protecting group at all 2'-O positions. The tBDMS protecting groups were removed from oligoribonucleotides directly on the biochip, immediately before its use. Hexaribonucleotide r (AUGGAA) * marked with an asterisk in the text was immobilized on the biochip as a control. This oligoribonucleotide was synthesized identically to oligoribonucleotide r (AUGGAA), but all its protective groups, including the tBDMS protective group, were removed immediately after its synthesis, before purification and immobilization in the gel cells of the biochip (see above).

Figure 1B shows the fluorescence pattern of RNA / DNA cells of the biochip, which was first subjected to the procedure of removing the chemical protective groups of tBDMS, and then a solution with fluorescently labeled hexadeoxyribonucleotide d (TTCCAT) -TR was applied to its surface. As can be seen from the fluorescence signals of the cells, the oligonucleotide d (TTCCAT) -TR forms perfect and imperfect duplexes with oligonucleotides immobilized in the volume of the gel cells of the biochip. The largest signals are observed in the case of perfect duplexes, less intense signals are visible in the case of single mismatches. It is seen that binding practically does not occur in the case of double mismatches, as well as the fact that the hybridizable oligonucleotide does not accumulate in cells with an empty gel.

The intensity of fluorescence signals of perfect RNA / DNA hybrid duplexes and perfect DNA duplex formed in the corresponding gel cells with the same oligonucleotide concentrations r (AUGGAA), r (AUGGAA) * and d (ATGGAA) are approximately the same, which indicates the same degree of immobilization of oligoribo- and oligodeoxyribonucleotides. 1B, a fluorescence signal is also dependent on the concentration of immobilized oligonucleotides.

Example 2. The interaction of binase ribonuclease with oligoribonucleotides immobilized in the gel cells of the biochip, and the subsequent hybridization of fluorescently labeled oligonucleotide d (TTCCAT) -TR.

Oligonucleotides immobilized in the gel cells of the biochip were tested for their ability to be destroyed by ribonuclease binase, which is known to catalyze RNA hydrolysis. Binase - extracellular ribonuclease of the bacterium Bacillus intermedius, strain 7P (Yakovlev, GI, Chepurnova NK, Moiseev, GP, Bocharov, AL and Lopatnev, SV 1987. Specificity of Bacillus intermedius RNase 7P in polynucleotide cleavage reactions Bioorganic chemistry 13: 338-343; Okorokov, AL, Panov, KI, Kolbanovskaya, E.Yu., Karpeisky, M.Ya., Polyakov, KM, Wilkinson, AJ and Dodson, GG 1996. Site-directed mutagenesis of the base recognition loop ofribonuclease from. Bacillus intermedius (binase. FEBS Lett. 384: 143-146).

First, the RNA / DNA biochip was subjected to the procedure of removing the chemical protective groups of tBDMS (see Example 1), then the biochip was washed in sterile water, after which the biochip was treated with a binase ribonuclease solution at room temperature (20 ° C) for two hours. For this, a drop of 50 μl was applied to the surface of the biochip, which is a solution of the binase enzyme (2 × 10 ^-5 M) in a buffer containing 0.1 M NaCl, 50 mM Tris HCl, 1 mM EDTA, pH 6.5. The enzyme concentration was measured on a Jasco V-550 spectrophotometer (Jasco, Japan); the binase extinction coefficient was taken equal to 27400 M ^-1 cm ^-1 at a wavelength of 280 nm (Schulga, A., Kurbanov, F., Kirpichnikov, M., Protasevich, I., Lobachov, V., Ranjbar, V., Chekhov , V., Polyakov, K., Engelborghs, Y. and Makarov, A. 1998. Comparative study of binase and barnase: experience in chimeric ribonucleases. Protein Eng. 11: 775-782). After incubation with binase, the biochip was washed in sterile water, and then a solution with a fluorescently labeled d (TTCCAT) -TR oligonucleotide (see Example 1) was applied to its surface to verify the effect of the binase. The hybridization result is shown in FIG. 2.

As can be seen from Figure 2, in the RNA-containing gel cells of RNA / DNA, hybrid duplexes were not formed, which indicates that the binase destroyed oligoribonucleotides immobilized in the cells of the biochip. The fluorescence intensity of these gel cells is comparable to the fluorescence intensity of gel cells containing an empty gel. From Fig.2 it also follows that the enzyme did not affect the immobilized oligodeoxyribonucleotides, since DNA duplexes were formed in the corresponding cells to the same extent as in the case shown in Fig.1B. To do this, it is sufficient to compare the fluorescence intensity of cells containing perfect d duplex DNA (ATGGAA) / d (TTCCAT) -TR, as well as a single mismatch d (AT GA AA) / d (TTCCAT) -TR in both figures.

Thus, RNA biochips obtained by the claimed method retain the activity of immobilized ribonucleic acid molecules and can be used to study the interaction of proteins and low molecular weight compounds with RNA.

Example 3. Thermodynamic characteristics of the RNA / DNA biochip: curves of temperature dissociation of DNA duplexes and RNA / DNA hybrid duplexes on the biochip.

Measurement of temperature dissociation curves.

The temperature dissociation of oligonucleotide duplexes in the biochip cells was carried out with a gradual increase in the rate of temperature increase: 1 ° C / 10 min at low temperatures (from -5 to 15 ° C), 1 ° C / 7 min in the average temperature range (from 15 to 40 ° C) and 1 ° C / 2 min at high temperatures (from 40 to 60 ° C). Association curves were measured in the same temperature ranges, with the same rates (in this case, with decreasing temperature) immediately after dissociation, starting at 60 ° C.

Images were processed using a precision computer program (Biochip-IMB LLC, Russia) according to the algorithm described earlier (Fotin, AV, Drobyshev, AL, Proudnikov, DY, Perov, AN and Mirzabekov, AD 1998. Parallel thermodynamic analysis of duplexes on oligodeoxyribonucleotide microchips Nucleic Acids Res. 26; 1515-1521) with one change: the square frame around the gel cell image of the biochip in this example was replaced with a round one.

The dissociation temperature of duplexes was determined from the corresponding dependences as the temperature at which half of the duplexes dissociate in the biochip cell.

Theoretical calculation of dissociation temperatures of short RNA / DNA hybrids and DNA duplexes on a biochip.

The dissociation temperatures experimentally determined using a biochip were compared with the corresponding values calculated for a solution of the same ionic strength. In the considered examples, the fluorescently labeled d (TTCCAT) -TR oligonucleotide (about 10 ^-9 mol) was hybridized in excess with respect to the total amount of oligonucleotides immobilized in the gel cells of the biochip (about 10 ^-12 mol). Therefore, as previously described (Fotin, AV, Drobyshev, AL, Proudnikov, DY, Perov, AN and Mirzabekov, AD 1998. Parallel thermodynamic analysis of duplexes on oligodeoxyribonucleotide microchips. Nucleic Acids Res. 26: 1515-1521), the equilibrium formation constant duplexes K (T) on the biochip has the following expression:

where T is the temperature (° K), C _bond (T) is the concentration of 5'-TTCCAT-TR bound to oligonucleotides immobilized in the biochip cell, C _immob is the concentration of immobilized oligonucleotides and C _freedom is the concentration of 5'-TTCCAT- hybridizable oligonucleotide TR.

According to the Van Goff equation:

where ΔН and ΔS are the changes in the standard enthalpy and entropy, respectively, R is the universal gas constant.

Since the dissociation temperature of duplexes T _diss is defined as the temperature at which half of the double-stranded complexes in the biochip cell dissociate, then at this temperature C _bond = C _immob / 2. Taking into account formulas (1) and (2), the dissociation temperature of duplexes on a biochip can be determined by the following formula:

The experimental values of dissociation temperatures obtained using a biochip for duplexes of 6 base pairs in length were compared with the corresponding values calculated by formula (3). Changes in standard enthalpy, AN, and entropy, AS, were calculated using the “nearest neighbors” algorithm using the sets of thermodynamic parameters Δh and Δs for dinucleotide duplexes in a solution of 1 M NaCl, indicated by Sugimoto, N., Nakano, S., Katoh, M., Matsumura, A., Nakamuta, H., Ohmichi, T., Yoneyama, M. and Sasaki, M. 1995. Thermodynamic parameters to predict stability of RNA / DNA hybrid duplexes. Biochemistry. 34: 11211-11216; SantaLucia, J., Jr. 1998. A unified view of polymer, dumbbell and oligonucleotide DNA nearest-neighbor thermodynamics. Proc. Natl. Acad. Sci. USA 95: 1460-1465. Note that this calculation of the dissociation temperatures of duplexes on a biochip does not take into account the effect of polyacrylamide gel on the formation and dissociation of duplex complexes.

To study the thermodynamic properties of 3D hydrogel RNA / DNA biochips, the temperature dissociation curves of DNA duplexes and RNA / DNA hybrids were measured on a single biochip and the corresponding dissociation temperatures were determined. As can be seen from Fig. 3A, the dissociation curves of DNA duplexes and RNA / DNA hybrids coincide with the corresponding association curves, therefore, the process of dissociation of duplexes on the biochip was carried out under equilibrium conditions.

On Figb shows the dissociation curves of perfect DNA duplexes and RNA / DNA hybrids. The difference between the RNA / DNA hybrid duplexes r (AUGGAA) * / d (TTCCAT) -TR and r (AUGGAA) / d (TTCCAT) -TR lies in the fact that the chemical protective groups tBDMS of their oligoribonucleotides were removed, respectively, before and after manufacture RNA / DNA biochip. The tBDMS protecting groups were completely removed from the already immobilized hexaribonucleotide r (AUGGAA), directly on the biochip, immediately before the hybridization of oligonucleotide d (TTCCAT) -TR. The dissociation curve of the corresponding hybrid duplex r (AUGGAA) / d (TTCCAT) -TR has a pronounced S-shape. The dissociation temperature of such a hybrid duplex determined from this curve is 27 ° C. All protective groups, including tBDMS, oligoribonucleotide r (AUGGAA) * were removed immediately after its synthesis, before the oligoribonucleotide was immobilized on a biochip. The dissociation curve of the hybrid duplex r (AUGGAA) * / d (TTCCAT) -TR has a less gentle upper plateau and a lower dissociation temperature, 25 ° C. This means that upon immobilization of oligoribonucleotides into a polyacrylamide gel without protective groups at the 2'-O positions, partial degradation of oligoribonucleotide molecules occurs. Partial decomposition of oligoribonucleotides may be due to harsh polymerization conditions for RNA or the result of ribonuclease action. Note that the degradation of oligoribonucleotide r (AUGGAA) * in the described example is not so significant: the duplex dissociation temperature r (AUGGAA) * / d (TTCCAT) is only 2 degrees lower than the duplex dissociation temperature r (AUGGAA) / d (TTCCAT) - TR. However, in the case of oligoribonucleotides of other sequences or lengths, the percentage of destroyed RNA molecules in the gel cell may be more significant. Perfect duplex DNA d (ATGGAA) / d (TTCCAT) -TR was, as expected, less stable than perfect RNA / DNA hybrid. Its dissociation temperature was 20 ° C.

The RNA / DNA hybrid and DNA duplex dissociation temperatures measured on the biochip were compared with theoretical values calculated using the “nearest neighbors” algorithm (see above). The theoretically calculated and measured on a biochip (averaged over ten experiments) values of the RNA / DNA dissociation temperature of the hybrid duplex r (AUGGAA) / d (TTCCAT) were, respectively, (25.7 ± 0.7) ° С and (26.9 ± 0.6) ° C. For d duplex DNA (ATGGAA) / d (TTCCAT), these values were, respectively, (22.0 ± 1.0) ° С and (20.4 ± 0.7) ° С. Thus, the difference between the theoretical and experimental values of the dissociation temperature of duplexes on the biochip is within the measurement error. Note that in the theoretical calculation, the effect of polyacrylamide gel on the formation of duplexes was not taken into account.

This means that the polyacrylamide gel does not significantly affect the thermodynamic parameters that describe the interaction of these biomolecules. Similarity of dissociation of DNA duplexes on polymerization biochips and in solution was noted earlier (Rubina, AY, Pan'kov, SV, Dementieva, EI, Pen'kov, DN, Butygin, AV, Vasiliskov, VA, Chudinov, AV, Mikheikin, AL, Mikhailovich, VM and Mirzabekov, AD 2004. Hydrogel drop microchips with immobilized DNA: properties and methods for large-scale production. Anal Biochem, 325: 92-106).

All patent documents, publications, scientific articles, and other documents and materials cited or referenced herein are hereby incorporated by reference to the extent that each of these documents was individually incorporated by reference or is presented in its entirety.

Although the present invention has been described in detail with reference to specific embodiments, one skilled in the art will appreciate that various changes and modifications can be made without departing from the spirit and scope of the invention, which are defined by the appended claims.

Additional experimental data

Addition to Example 3.

In order to evaluate the effect of tBDMS protective groups on the formation of RNA / DNA duplex, Fig. 3B of the application filed in the originally filed application also additionally shows the temperature dissociation curve of the r (AUGGAA) ^tBDMS / d (TTCCAT) -TR duplex. Before measuring this dissociation curve, the deprotection procedure was not performed on the microchip, and the immobilized oligoribonucleotide r (AUGGAA) ^tBDMS contained ^tBDMS protecting groups at all 2'-O positions. As can be seen in Fig.3B, the dissociation curve of the hybrid duplex d (TTCCAT) -TR / r (AUGGAA) ^tBDMS does not have an upper plateau, and the melting point of such a duplex is less than -5 ° C. Thus, the presence of tBDMS protective groups on RNA significantly destabilizes the RNA / DNA hybrid, and the removal of protective groups from immobilized oligoribonucleotides is necessary for the regeneration of the microchip and subsequent study of the interactions of RNA with RNA-binding molecules on the microchip.

It should be noted that the efficiency of removing protective groups with RNA immobilized on a microchip is 100%. After the deprotection procedure on the microchip, the duplex dissociation temperature r (AUGGAA) / d (TTCCAT) -TR (with r (AUGGAA) the protective groups were removed during this procedure) turned out to be higher than the duplex dissociation temperature r (AUGGAA) * / d ( TTCCAT) -TR (immobilized r (AUGGAA) * did not contain protective groups), and coincided with the theoretically calculated value. We also note that the shorter the oligonucleotides, the greater the sensitivity of the duplex dissociation curve to the presence of modification / degradation in the oligonucleotide. For example, it is difficult to distinguish the dissociation curves for duplexes 39 and 40 base pairs long, and the dissociation curves of duplexes 5 and 6 base pairs in length are significantly different. And if at least one protective group remained on r (AUGGAA) after the removal of protective groups on the microchip, then this would significantly affect the temperature dissociation curve of the r (AUGGAA) / d (TTCCAT) -TR duplex.

Example 4. RNA-DNA biochip, the effect of binase ribonuclease on unprotected at the 2'-O-positions of the RNA sequence in comparison with the action of this enzyme on RNA sequences containing tBDMS protective groups at the 2'-O-positions.

Synthesis of oligonucleotides.

RNA-DNA oligonucleotides with an aminolinker at the 3'-end were synthesized according to the same procedure as described in Example 1 given in the originally filed application description.

All protective groups from nitrogen bases (adenine, guanine, cytosine), from phosphate groups (pianethyl protective group) and from 2'-hydroxyl groups of ribose rings (tBDMS) of the 40-nucleotide RNA insert of 56-dimensional d DNA RNA (CAGGGAAA) r (GAGGGUAUAUGUGCGGGUAUAUGUGCGGGUAUAUGUGCAG) * d (A AAGGGAC) were removed immediately after synthesis. From the 40-nucleotide RNA insert of the 56-dimensional RNA DNA d (CAGGGAAA) r (GAGGGUAUAUGUGCGGGUAUAUGUGCGGGUAUAUGUGCAG) ^tBDMS d (AAAGGGAC) all protective groups were removed, except for the protective group tBDMS, which was not removed. The oligonucleotides were purified according to the procedure described in Example 1. The octadeoxyribonucleotide d (TTTCCCTG) -TR, used for hybridization with immobilized biochip oligonucleotides, was covalently labeled with fluorescent dye Texas Red sulfonyl chloride (Molecular Probes, United States) according to the protocol.

Oligonucleotide concentrations were determined using a Jasco 550 spectrophotometer (Jasco, Japan); when calculating the concentrations, the average extinction coefficient for one RNA or nucleotide DNA was taken equal to 10,000 M ^-1 cm ^-1 .

Production of RNA-DNA biochips.

Three-dimensional hydrogel RNA-DNA biochips were fabricated. the method specified in Example 1. Oligonucleotides were immobilized in the gel cells of the biochip at a concentration of 0.5 · 10 ^-5 M.

Hybridization.

Hybridization of oligonucleotide d (TTTCCCTG) -TR in concentration. 4-10 ^-5 M with biochip oligonucleotides was carried out in sterile buffer A (see Example 1), in a chamber with a volume of 40 μl. Hybridization was carried out at 0 ° C for 30 min; under these conditions, the fluorescent signals of the gel cells reached saturation. Fluorescent hybridization signals of a fluorescently labeled oligonucleotide were recorded according to the procedure described in Example 1.

RNA DNA oligonucleotides

d (CAGGGAAA) r (GAGGGUAUAUGUGCGGGUAUAUGUGCGGGUAUAUGUGCAG) * d (AAAGGGAC) gel (1) and

d (CAGGGAAA) r (GAGGGUAUAUGUGCGGGUAUAUGUGCGGGUAUAUGUGCAG) ^tBDMS d (AAAGGGAC) gel (2),

immobilized in hydrogel cells of the biochip, had the same sequence. The 40-nucleotide RNA insert of the immobilized oligonucleotide (2) contained tBDMS protective groups at all 2'-O positions, and the 40-nucleotide RNA insert of the immobilized oligonucleotide (1) did not contain protective groups. The 40-nucleotide RNA sequences formed double-stranded structures - hairpins, and the terminal deoxy sites were in single-stranded form, according to the calculations (Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids.Ray. 31: 3406 -3415).

FIG. 4A shows a fluorescence pattern of RNA-DNA cells of a biochip that was incubated with a fluorescently labeled octadeoxyribonucleotide d (TTTCCCTG) -TR solution. Oligonucleotide d (TTTCCCTG) -TR is complementary to the 5'-terminating octadeoxynucleotide region, d (CAGGGAAA) of immobilized oligonucleotides. The formation of the d duplex (CAGGGAAA) / d (TTTCCCTG) -TR depends on the integrity of the 40 nucleotide RNA sequence. The fluorescence intensities of cells 16 and 26 are the same, which indicates the absence of visible degradation of the unprotected oligonucleotide (1) during the production of RNA-DNA biochip and its storage.

Another RNA-DNA biochip was initially treated with binase ribonuclease solution at room temperature (20 ° C) for 4 hours. For this, a drop of 50 μl was applied to the surface of the biochip, which is a solution of binase enzyme (4 × 10 ^-5 M) in buffer B. Then, the biochip was incubated with a solution of fluorescently labeled octadeoxyribonucleotide d (TTTCCCTG) -TR. FIG. 4B shows a fluorescence pattern of RNA-DNA biochip cells. Cell fluorescence intensities indicate that the enzyme significantly destroyed unprotected 40-nucleotide RNA (gel cell 26, FIG. 4B) compared to 40-nucleotide RNA containing tBDMS protective groups (gel cell 16, FIG. 4B). Thus, ribonuclease does not exhibit biological activity with respect to the RNA sequence containing protective groups at the 2'-O positions, while native RNA is accessible for the action of the enzyme (see also Example 2 presented in the original application description).

Claims (11)

1. A biological microchip (biochip) designed to produce a biochip for analysis of the interaction of RNA with RNA-binding molecules, which is a substrate containing oligoribonucleotides immobilized on it, characterized in that at least one of the 2'-0 positions oligoribonucleotides covalently attached chemical protective groups based on silicon, preventing the formation of 2 ', 3'-cyclophosphate. 2. The biochip according to claim 1, wherein the substrate further comprises oligodeoxyribonucleotides immobilized thereon. 3. The biochip according to claim 1, wherein a tert-butyldimethylsilyl protective group is used as the chemical protective group at the 2'-O positions of the immobilized oligoribonucleotides. 4. The biochip according to claim 1, wherein a triisopropylsilyloxymethyl protecting group is used as the chemical protective group at the 2'-O positions of the immobilized oligoribonucleotides. 5. A biochip according to any one of claims 1 or 2, in which oligoribonucleotides with protective groups at 2'-O positions are immobilized by copolymerization in a volume of three-dimensional hydrogel cells arranged regularly on a biochip substrate. 6. A method for removing chemical protective groups at the 2'-O positions of oligoribonucleotides immobilized on a biochip, characterized in any one of claims 1-5, carried out directly on the biochip immediately before use, including incubating the biochip with a solution to remove chemical protective groups in the passage of time sufficient to remove chemical protective groups. 7. The method according to claim 6, in which the removal of silicon-based chemical protective groups from immobilized oligoribonucleotides on a biochip is carried out in a solution of 0.01M-3M tetrabutylammonium fluoride (TBAF) for 2-48 hours at a temperature of 0-60 ° C. 8. A method of manufacturing a biochip, characterized in claim 1, comprising the following stages:
a) provide oligoribonucleotides containing at least one of the 2'-O-positions of covalently attached silicon protective chemical groups based on silicon, preventing the formation of 2 ', 3'-cyclophosphate;
b) a biochip is made by immobilizing on the substrate of the biochip the oligoribonucleotides provided in stage a). 9. The method of claim 8, further comprising providing oligodeoxyribonucleotides and immobilizing them on a biochip substrate. 10. The method according to claim 8, in which the immobilization is carried out by copolymerization in the volume of three-dimensional hydrogel cells located regularly on a biochip substrate. 11. A method for analyzing the interaction of RNA with RNA-binding molecules, comprising:
a) removal of silicon-based chemical protective groups from oligoribonucleotides of the biochip, characterized in any one of claims 1-5, to obtain a biochip for analyzing the interaction of RNA with RNA-binding molecules, this step being carried out immediately before the stage of contacting the RNA-binding molecules with the biochip to analyze the interaction of RNA with RNA-binding molecules;
b) contacting RNA-binding molecules with a biochip to analyze the interaction of RNA with RNA-binding molecules.

Images