RU2338789C2 - Method of detection of pathogenic micobacteria in clinical samples - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention reveals a method of detection of pathogenic micobacteria in clinical samples, such as sputum, spinal liquid, samples of a gastric lavage, biopsy material tissues etc. by means of PCR, and used for this agent. The new fragment of DNA which lays in intergene area between gene of synthase of methyl-mycole acids mmaA1 and mmaA2, and flanking area of genes mmaA1 and mmaA2 which is DNA-target for specific amplification of DNA-target in clinical samples with application of a pair of designed oligonucleotide primers is taped, nucleotide which sequence is presented in demand materials.

EFFECT: invention provides detection of micobacteria of tuberculosis in any clinical samples obtained from the patient.

15 cl, 7 dwg, 3 tbl, 7 ex

Description

Field of Invention

The present invention relates to the detection of pathogenic mycobacteria in clinical samples, such as sputum, cerebrospinal fluid, gastric lavage samples, tissue biopsies, etc., where a new DNA fragment lies in the intergenic region between the mmaA1 and mmaA2 methyl micicol acid synthase genes, and according to the invention apply a pair of designed oligonucleotide primers for specific amplification of the target DNA in clinical samples.

BACKGROUND OF THE INVENTION

Tuberculosis is the number one deadly disease. A huge number of people die each year from one infectious disease. According to World Health Organization (WHO) reports, more than 8 million cases of tuberculosis with more than 2.9 million deaths are reported each year (Dolin et al., 1995).

Mortality from tuberculosis gradually decreased until the early 90s due to the advantage of the availability of potent anti-TB drugs. Cases of tuberculosis and deaths from it are on the rise again, mainly due to the synergistic effect of co-infection with human immunodeficiency virus (HIV) (Hopewell, P. C et al., 1992), the emergence of multidrug resistance (MDR) of M. tuberculosis strains (Bloom, B. R, and CL Murray., 1992) and the involvement of so-called non-tuberculous mycobacteria.

About 70 species of mycobacteria are known, most of which are not pathogenic for humans. Tuberculosis is caused by infection with M. tuberculosis , with rare cases caused by M. bovis . These organisms are very close genetically and are called the organisms of the Mycobacterium tuberculosis complex (MTC). There are more than a dozen other pathogenic mycobacteria that cause tuberculosis-like infections in the lungs or other parts of the body. These organisms are called non-tuberculous mycobacteria (MOTT) or non-tuberculous mycobacteria (NTM). As a result of the AIDS epidemic, these so-called non-tuberculous mycobacteria have become significant and are isolated in a large number of tuberculosis patients co-infected with HIV.

Early tuberculosis often remains unrecognized in an otherwise healthy individual. The lack of simple, quick and reliable tests that can specifically detect M. tuberculosis and other pathogens in a clinical specimen is a huge problem both for the management of an individual patient and for the implementation of appropriate infection control and public health measures.

Classical diagnostic methods include the study of acid-resistant mycobacteria in a sputum smear under a microscope and an X-ray of the lungs. However, in the vast majority of cases in the early stages of the disease, sputum smear analysis is negative for mycobacteria and lung changes may not be apparent on x-rays until several months after infection. Although staining acid-resistant bacilli in a smear (AFB) takes less than two hours, its sensitivity is insufficient, and in some cases it may be non-specific (Ebersole, L. L. 1992). In addition, with a positive result, AFB staining does not distinguish between species of mycobacteria.

Currently, the only absolutely reliable diagnostic method is a method based on the cultivation of M. tuberculosis from a clinical sample and its morphological and biochemical identification. The cultivation of M. tuberculosis and other related organisms is sensitive and specific, however time-consuming, and takes 6-12 weeks when cultured on solid media and from three to six weeks on liquid media, during which time the patient can become seriously ill and infect other individuals . Therefore, a quick test that can reliably detect the presence of M. tuberculosis is vital for the early detection, treatment and management of the patient.

Recently, several molecular tests have been developed for the rapid detection and identification of M. tuberculosis . The Gen-Probe commercial test, "Amplified Mycobacterium Tuberculosis Direct Test", was developed by Abe et al and Miller et al. In this test, 16S ribosomal RNA is amplified from respiratory samples and a chemiluminescent probe is used to detect the amplified product with a published sensitivity of approximately 91%. Other commercial tests based on ligase chain reaction (LCR) (Abbott Laboratories), polymerase chain reaction (PCR) (Roche Diagnostics Systems, Eastman Kodak Co., Johnson & Johnson), Q-beta replicase (Gene Trak) and amplification with preemption chains (Becton Dickinson) are discussed in a Forbes review.

Other methods based on the immunological detection of M. tuberculosis infection by non-culturing methods are latex agglutination, radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), etc. The main disadvantage of these methods is their lack of sensitivity and / or specificity (Kandival, GV et al., 1986; 1984; Yenez, MA et al., 1986). Serological methods may be useful in some clinical courses, but this approach is generally limited due to its low sensitivity and / or specificity (Daniel, TM and SM Debanne, 1987).

The development of polymerase chain reaction (PCR) (Saiki et al.), Which allows amplification and detection of DNA from small amounts of nucleic acid samples, has made it possible to detect M. tuberculosis -specific nucleic acids in clinical samples. Some of the early reports are based on the detection of 16S ribosomal RNA or its gene. When detecting M. tuberculosis and related organisms, the DNA fragment is first amplified using primers that are conservative for all bacteria, then species-specific probes are used to detect various types of mycobacteria. The main disadvantage of this method is that it is time-consuming and takes more than 24 hours to complete. The species-specific probes used to detect sequences of various species in the amplified product differ only in a few bases, and subsequent analysis of this amplified DNA, based on hybridization, can lead to a false-positive test when not quite under ideal conditions.

The discovery of the integrated element IS6110 (Cave et al., Thierry et al.) And the assumption that this element can only be present in the complex M. tuberculosis ( M. tuberculosis , M. bovis , M.africanum and M.microti ) gave rise to a whole series of strategies rapid diagnosis (Brisson-Noel et al., Clarridge et al., Forbes et al., Hermans et al., Kolk et al., Kox et al., Zambardi et al.). These tests provide various methods for isolating DNA from sputum. PCR is used to amplify IS6110 DNA sequences from the isolated DNA. Successful amplification of this DNA is considered a sign of the presence of M. tuberculosis infection. U.S. Patent Nos. 5,168,039 and 5,370,998 to Crawford et al. devoted to the detection of tuberculosis based on IS6110. Another U.S. Patent No. 5,731,150 is issued to CIBA CORNING DIAGNOSTICS CORP (Gurpreet S et.al). Guesdon JL published Europatent EP 0461045 for detection of tuberculosis based on IS6110. It is reported that the element IS6110 is present in ten, two, one, five and five copies in M. tuberculosis , M. bovis , M. bovis -BCG, M.africanum and M.microti , respectively (Spargo et al.). In most reports, when using tuberculosis detection based on IS6110 or other PCRs, sensitivities of more than 75% and specificities approaching 100% are reported.

A careful study of the use of this sequence as a target for PCR-based diagnosis of M. tuberculosis revealed several drawbacks. A blind comparison analysis among 7 major laboratories described by Noordhoek et al. Raised great interest when it published a false positive rate of 3 to 77% and a sensitivity of 2 to 90%. This study was indicative because it allowed all participating laboratories to apply their own strategies for identifying IS6110, and the final results clearly demonstrate that the existing protocols have serious flaws in both sensitivity and specificity.

In another study, Lee et al. (1994) reported 62% of false-positive results in the analysis of cerebrospinal fluid samples obtained from patients with tuberculous meningitis. While some false positive results can be attributed to the contamination of a sample of amplified IS6110 DNA originating from samples previously processed in the same laboratory, this is not the main source of error because most laboratories support excellent methods of protecting samples to avoid contamination. Such a large number of false positive results are present due to the presence of sequences like IS6110 in organisms other than M. tuberculosis . IS6110 is a moving built-in element (Calos and Miller), and these DNA fragments have the property of being “mobile”. It appears that IS6110 also probably originates from other organisms (or is transmitted to them), and certain regions of DNA may have remained conservative among these organisms during evolution. A post published by Mariani et al. Also discusses horizontal transmission between organisms of sequences related to M. tuberculosis IS6110. This may explain some false positive tests published in the literature. In addition, Kent et al. succeeded in amplifying IS6110-related sequences from mycobacteria other than M. tuberculosis , confirming the suspicion that similar IS6110 sequences are present in other organisms and can be detected by PCR with IS6110-specific primers designed to detect M. tuberculosis . To investigate this publication, a systematic analysis of the nucleic acid sequences stored in GenBank was performed, and portions of sequences similar to IS6110 were found in organisms other than M. tuberculosis . Many of these organisms are found in clinical specimens.

Another fact that makes IS6110 an inappropriate target for the detection of tuberculosis is that some recent reports have shown that in some M. tuberculosis isolates, the IS6110 sequence in the genome may be completely absent, thus leading to false negative results. Studies of Asian isolates report that this sequence may be absent in at least some isolates (Yuen, LK, et al. 1993).

Another very important aspect for the detection, differentiation and treatment of tuberculosis is the emergence of human immunodeficiency virus (HIV). The epidemiology and etiology of tuberculosis has undergone dramatic changes since the spread of HIV, the causative agent of Acquired Immunodeficiency Syndrome (AIDS). With the advent of AIDS, the number of cases of tuberculosis has increased significantly (Bafica, A. et al.). Among AIDS deaths, more than 30% are due to tuberculosis. Since 1991, the number of HIV-infected tuberculosis patients has increased from 3% to over 10%. Among patients with AIDS, only M. tuberculosis and M. bovis are not the only causative agents of tuberculosis. The so-called non-tuberculous mycobacteria become important pathogens for patients with immunocompromised tuberculosis. In various laboratories, other pathogenic mycobacteria, called non-tuberculous mycobacteria, have been isolated from clinical samples obtained from patients with co-infection with HIV. The most important of them are M.avium and a closely related group of mycobacteria, i.e. M.intracellulare and M.chelonae . These organisms are known as the organisms of the mycobacterium avium-intracellulare complex (MAI complex). The MAI complex of organisms produces symptoms indistinguishable from tuberculosis. They are responsible for pulmonary as well as disseminated forms of the disease in a large number of patients, especially those infected with human immunodeficiency virus (HIV). M.avium alone was isolated from up to 30% of clinical samples from patients with pulmonary tuberculosis and even from a larger number from patients with disseminated tuberculosis. M.kansassi and M.scrofulaceum are other non-tuberculous mycobacteria isolated from a significant number of patients with AIDS and tuberculosis. Other non-tuberculous mycobacteria are also isolated from a clinical sample obtained from a patient with AIDS.

The reason for the lower isolation of non-tuberculous mycobacteria may be the inaccessibility of simple, accurate and reliable tests for the isolation and differentiation of various types of non-tuberculous mycobacteria. These findings suggest that non-tuberculous mycobacteria become important etiological factors in awakening the spread of AIDS.

This information that IS6110 is not specific for M. tuberculosis and may not be present in many isolates, along with the fact that other non-tuberculous mycobacteria are the causative agent of tuberculosis, especially in patients co-infected with HIV. From published reports, it is clear that no existing method based on IS6110 and other target sequences provides the level of reliability required for a clinical diagnostic test.

This reinforces the need to change the method for detecting tuberculosis. This requires the identification of new targets that ensure the detection of all pathogenic mycobacteria in a clinical sample, instead of detecting only a group of organisms of the M. tuberculosis complex. Ideally, there should be a diagnostic method by which, instead of detecting only a group of bacteria of the M. tuberculosis complex, all pathogenic microorganisms, including non-tuberculous mycobacteria, can be detected in a clinical sample. After detecting various pathogenic mycobacteria in a clinical sample, various types of pathogenic mycobacteria can be differentiated by different types of mycobacteria using the PCR-RPLF method, as described in this study. For patients infected with NTM or NTM alone, together with a group of organisms of the M. tuberculosis complex, a quick reference is made to a possible co-infection with HIV, and this can be a good parameter for assessing HIV infection and its spread in the population. There are few such tests available that can detect pathogenic mycobacteria in clinical samples, as well as differentiate them.

" Mycobacterium tuberculosis Direct Test" was developed by Abe et al and Miller et al. In this test, 16S ribosomal M. tuberculosis RNA was amplified from respiratory samples and a chemiluminescent probe was used to detect an amplified product with a published sensitivity of about 91%. This test is complex, takes more than 24 hours to complete, and for identification of various mycobacteria provides samples that differ only in a few bases, which leads to a false-positive result when performed even in slightly less stringent conditions.

The success of PCR-based analysis depends on several factors. The most important of these are the isolation of good quality nucleic acid to be PCR, the design of a primer for pathogen specific PCR, and the PCR conditions in which the target sequence from the isolated DNA can be specifically amplified.

The main disadvantage of currently available PCR-based assays for the detection of mycobacteria is the lack of a method for isolating nucleic acid, which is simple, effective and ensures the safety of the performer. Lysis of mycobacteria and the isolation of nucleic acids from a clinical sample without co-excreted impurities, as is known, present in most clinical samples, is a critical stage of PCR-based analysis. The main disadvantage of the published protocols is that most of the methods used for the isolation of nucleic acids cannot be easily applied to all types of samples. Any nucleic acid isolation that requires laborious and inefficient DNA purification reduces the speed and sensitivity of the test. In addition, the compulsion to carry out different isolation procedures for different types of samples also makes the whole process expensive and slow. Artist safety is also a major concern when processing samples containing live M. tuberculosis . After a thorough analysis of the various DNA isolation methods described previously, it was found that they were not highly effective or were unable to remove impurities, typically present in most clinical samples (Boom, RC). Thus, a simple, efficient, and reliable method for isolating nucleic acid from various clinical samples is required to provide sensitivity and reproducibility based on PCR analysis.

The specific and non-specific amplification of the target sequence is another critical factor for successful PCR based analysis. Under even the slightest optimal conditions, even specific and unique primers can lead to nonspecific amplification of the band of the correct size and, thus, lead to false positive results (Gurpreet, S et al.). It is necessary to direct efforts on this in a practical way with effective costs.

The purpose of the invention

The main objective of the invention is to provide a method for the detection of pathogenic mycobacteria in clinical samples.

Another object of the invention relates to a design and analysis composition for determining infection caused by mycobacteria, detection of a DNA fragment by amplification of a portion of a gene cluster in various clinical samples, such as sputum, cerebrospinal fluid, gastric lavage samples, blood, bone marrow aspirates, tissue biopsy samples, and etc.

Another objective of the invention relates to the development of an effective method for DNA extraction from all types of clinical samples.

Another objective of the invention is the formation of a set of oligonucleotide primers that provide specific amplification of a portion of the gene by polymerase chain reaction.

Another objective of the invention is a polymerase chain reaction method that allows specific amplification of the target.

Another objective of the invention is the provision of a method of differentiation between different types of mycobacteria.

SUMMARY OF THE INVENTION

The present invention relates to the detection of pathogenic mycobacteria in clinical samples such as sputum, cerebrospinal fluid, samples of gastric lavage, tissue biopsies, etc. The novelty of the invention relates to a new DNA fragment lying in the intergenic region between the methylmicolic acid synthase genes mmaA1 and mmaA2 and in the flanking region of the mmaA1 and mmaA2 genes. In this test, a pair of oligonucleotide primers are used that specifically amplify the target DNA from clinical samples. The invention relates to a method for isolating DNA from a clinical sample, which is safer and increases the yield of DNA from clinical samples in comparison with existing methods. The present invention also relates to a method for amplification of DNA, resulting in specific amplification of the target amplicon without the use of expensive reagents, thus leading to an economical test. The present invention relates to a method for differentiating different types of pathogenic mycobacteria in a clinical sample by analysis of restriction fragment length polymorphism (RFLP) of the amplified PCR product.

Brief Description of Related Figures / Drawings

Figure 1. Schematic diagram of the cluster of methyl mycolic acid synthase genes mmaA4-mmaA1 mycobacteria and the position of the forward A and reverse D primers.

Figure 2. The sequence of the mmaA2 and mmaA1 genes with an intergenic region of 166 base pairs (shown in lower case). The position of the forward A, SEQ ID No: 1 and reverse primer D, SEQ ID No: 2. The sequence of both primers is underlined and given in oblique font.

Figure 3. PCR amplification of genomic DNA from various mycobacteria with primers A and D (lines 1-15): 1. M.avium 2. M.bovis 3. 4. M.chelonae M fortuitum 5. M.intracellulare 6. 7. M.kansassi M .phlei 8. 100 bp DNA length marker 9. M.marinum 10. M.scrofulaceum 11. M.smegmatis 12. M.szulgai 13. M. tuberculosis and 14 negative controls. AD stands for 363 bp amplified product.

Figure 4. A line diagram showing a restriction map of HaeI and MspI endonucleases within AD.

Figure 5. A line diagram showing a restriction map of FmuI, CviRI, and TaqI endonucleases within AD.

6. Restriction map of AD showing restriction sites with AcaIV and HaeIII endonucleases.

7. A line chart showing the different stages of the PCR reaction.

DETAILED DESCRIPTION OF THE INVENTION

The aim of this work was to develop an integrated method that allows fast, safe and specific detection of mycobacteria that cause tuberculosis. The limiting stages of any PCR-based diagnostics are the extraction of DNA from a clinical sample, the design of a primer for PCR that provides specific amplification of the target sequence, and the development of PCR conditions that allow only specific amplification of the target sequence. A serious limitation of the available tests is that they detect but cannot differentiate between different types of mycobacteria.

The various available protocols describe various methods for isolating a nucleic acid and a mixture of reagents for lysis of mycobacteria and purification of a nucleic acid from a clinical sample. In various methods, lysis is achieved by treating the sample with alkalis, organic solvents, chaotropic agents, detergents, or a mixture thereof. A few simple methods claim to achieve lysis by simple boiling in alkali, PCR buffer, or even in pure water. Although these methods are simple and, as a rule, work well in a pure culture, they are not so useful for a clinical sample. In general, the prevailing notion that the PCR reaction is reliable, and the nucleic acid released by crude lysis methods, can be used directly in the PCR reaction, is not true. These methods are easy to use, but often unable to kill all those present in the clinical sample of mycobacteria, and thus can be dangerous for the user. It is reported that such preparations contain many impurities that can easily inhibit the PCR reaction. It was found that such preparations may not lead to amplification even when breeding DNA several times. The fact that the isolation of pure DNA is of utmost importance for the success of PCR-based analysis.

The inventors of the present invention carefully optimized all stages of nucleic acid purification and developed a method that is simple, reliable, efficient, and ensures the complete safety of the performer. Further processing of contaminated samples, such as sputum, with an alkali of medium strength and a mucolytic agent, helps to remove a lot of contaminants and leads to the release of cleaner DNA. These steps are also useful for removing other contaminants present in contaminated samples, such as sputum, gastric lavage samples, etc., since sputum is the most commonly collected and recognized clinical sample for pulmonary tuberculosis and is known to contain several pollutants that are potential inhibitors of the PCR reaction. In the modified lysis buffer developed by the present invention, a strong chaotropic agent is used, i.e. guanidine isothiocyanate. This helps to inactivate all mycobacteria present in the clinical sample, hard lyse the mycobacterial cell, denature and remove proteins, which leads to the release of cleaner DNA (table 1) and also ensures the safety of the performer. By heating the sample in a modified lysis buffer, even the strongest cells and objects, such as spores and polyhedra of baculovirus, are easily lysed. An earlier report from the same group showed the use of guanidine isothiocyanate for the lysis and purification of nucleic acids from hard materials such as the polyhedra of baculoviruses and mycobacteria (Das et al) and (Bose M. et al).

Table 1
Serial numbers from one to three are samples obtained as described herein, while serial numbers from four to six are samples obtained by the method of Gurpreet et al. Serial number Power
breeding OD at 260 nm OD at 280 nm 260/280 ratio Concentration Purity one fifty 0.011 0.019 1.82 27.60 mcg / ml No protein contamination 2 fifty 0.010 0.017 1.85 25.00 mcg / ml No protein contamination 3 fifty 0.013 0.024 1.88 33.03 mcg / ml No protein contamination four fifty 0.006 0.011 1,62 17.13 mcg / ml Protein pollution 5 fifty 0.009 0.015 1,66 23.46 mcg / ml Protein pollution 6 fifty 0.008 0.013 1,63 20.37 mcg / ml Protein pollution

Another advantage of using this reagent is that most of the proteins in this buffer are denatured, which leads to complete lysis of the mycobacteria present in the samples. Another method using this reagent (Gurpreet, S et al.) Is also described. The present method differs from them in several ways. The modified lysis buffer of the present method has a composition that provides more complete lysis, provides better deproteinization, and helps to precipitate even a small amount of DNA. This results in a cleaner DNA with improved yield. Instead of using guanidine-tris-phenol isothiocyanate for lysis, the lysis buffer of the present invention contains N-lauryl sarcosyl detergent, 200 mM NaCl and 10 mM 2'-mercaptoethanol along with 4M guanidine isothiocyanate. Since phenol is extremely explosive and thus dangerous, it was not included in the modified lysis buffer. These modifications make the modified lysis buffer of the present invention complete and more efficient. The detergent helps to dissolve the lipid of the cell wall and protein and thus leads to the complete lysis of the cell wall of mycobacteria, rich in various types of complex lipids. The use of NaCl facilitates the precipitation of nucleic acid, which is present in a small amount, and thus provides approximately 1.4-1.5 times better DNA yield than the method described by Gurpreet et al. This is important, especially when working with a clinical sample that has small amounts of mycobacteria per ml sample. Mycobacterial cells were inactivated and lysed by heating the treated and decontaminated sample in a modified lysis buffer at 85 ° C for 20 min. This is safe compared to boiling, as described in several methods, which becomes redundant and can lead to the firing of the lid or rupture of some tubes. The lysate was extracted once with alkaline phenol. It has been observed that alkaline phenol deproteinization is not unnecessary, as stated in many protocols. This simple step results in the removal of all proteins, including those closely linked to DNA, and thus results in a cleaner nucleic acid. This increases the reproducibility of the analysis, especially when working with contaminated samples such as sputum and gastric lavage samples. Nucleic acid was precipitated from the aqueous phase with an equal volume of isopropanol.

In the next stage, a set of oligonucleotide primers specific for pathogenic mycobacteria was constructed. Measures were taken to ensure that this sequence is absent in other pathogenic organisms or in humans, since the presence of such organisms or human cells in clinical samples cannot be ruled out. For this purpose, the gene cluster mmaA1-mmaA4 of mycobacteria was used under the accession numbers MTCY20H10.23c-MTCY20H10.26c (Fig. 1). This gene cluster contains four genes separated by three spacer regions of different lengths (Fig. 1). These genes for methoxyxycolic acid synthases are responsible for the synthesis and modification of the complex of limiting mycolic acids present in pathogenic mycobacteria. These mycolic acids are involved in the pathogenicity of mycobacteria. Direct primer A, SEQ ID: 3, is localized from 1 to 9 bases in the mmaA2 gene, 11 bp of this oligonucleotide primer lies in the spacer region of 167 bp between the mmaA2 and mmaA1 genes. Reverse primer D, SEQ ID No: 4, is located from 688 to 705 bases in the mmaA1 gene of FIG. 1 and FIG. 2. The sequences of these primers are designed using Primer Select software (Lasergene, DNASTAR) and do not show homology with sequences of organisms other than M. tuberculosis and M. bovis .

Another approach was also taken to ensure that this primer sequence is specific for pathogenic mycobacteria. The oligonucleotide sequence was converted to an amino acid (peptide) and compared with a set of genes of many pathogenic organisms and humans using the Genome Calculator software developed at this Institute (Institute for Genomics and Integrative Biology). This software converts a DNA sequence into an amino acid (peptide) and compares it with all the sequences available in the database, translating them into a library of short peptides. This software identified primer sequences as specific for M. tuberculosis and M. bovis and not present in any of the 24 other pathogenic organisms or in humans whose genome sequence is available in the databases. PCR with the genomic DNA of all tested pathogenic mycobacteria led to amplification using these primers, while PCR using the genomic DNA of non-pathogenic mycobacteria did not lead to amplification of Fig. 3 and table 2.

table 2
Amplification of PCR AD from various pathogenic and non-pathogenic species of mycobacteria Types of Mycobacteria Strain Pathogenic / non-pathogenic PCR result M.avium ATCC Pathogenic Positive M. bovis ATCC Pathogenic Positive M.chelonae ATCC Pathogenic Positive M.fortuitum ATCC Pathogenic Positive M.intracellulare ATCC Pathogenic Positive M.kansassi ATCC Pathogenic Positive M.marinum ATCC Pathogenic Positive M.phlei ATCC Non pathogenic Negative M.smegmatis ATCC Non pathogenic Negative M. scrofulaceum ATCC Pathogenic Positive M.szulgai ATCC Pathogenic Positive M.tuberculosis ATCC Pathogenic Positive M.xenopi ATCC Pathogenic Positive

After designing a specific primer, the next critical stage was the design and development of PCR conditions under which only the desired target is specifically amplified. This is very important, since PCR under non-optimal conditions leads to the amplification of another DNA fragment that is closely similar to the desired target in size, Gurpreet et al. This, in turn, leads to less amplification of the desired target sequence and thus reduces specificity and sensitivity. In contrast to the primers used by Gurpreet et al. in their invention, the primers of the authors of the present invention do not lead to amplification of a strip of approximately the same size from non-pathogenic mycobacteria, even under non-optimal conditions (figure 3).

Any non-specific amplification occurs due to non-specific annealing of oligonucleotide primers at the PCR annealing stage. The most common strategy to avoid nonspecific amplification is to perform a PCR hot start. This is achieved by adding a critical component of the reaction when the reaction mixture is hot. For this purpose, an enzyme held in wax beads is used, or a new thermopolymerase enzyme (Thermopolymerase Gold, Perkin Elmer) has recently become available. This enzyme remains bound to the monoclonal antibody obtained against this enzyme and becomes active only after incubation at 95 ° C for 10-15 minutes. However, the application of these measures makes the test more expensive by 10-20%.

Additionally modified the conditions of the cycles, which will interfere with the annealing of the primer with areas other than desired. This was achieved if several initial PCR cycles were performed at a higher annealing temperature than the calculated melting temperature of the oligonucleotide primer, and then the annealing temperature was gradually reduced in each cycle and the remaining 25 cycles were performed at the optimal annealing temperature. After the formation of specific amplicons in the initial cycles, they do not allow non-specific products to compete with them in later cycles. This type of cycle condition is called PCR with decreasing temperature and promotes specific amplification without the use of expensive reagents. This measure helps to make the test more cost effective and convenient.

The next step in the analysis is the detection of the amplified PCR product. The amplified PCR product can be detected in several different ways. The most common and easiest way to detect an amplified PCR product is agarose or polyacrylamide gel electrophoresis. The use of agarose gel is simpler than polyacrylamide gel electrophoresis or ELISA for DNA, which is laborious, requires more time for detection and more skill. Polyacrylamide gels are less sensitive than agarose gels, since polyacrylamide quenches the dye ethidium bromide used for detection. In addition, acrylamide is a potential neurotoxin and is therefore potentially dangerous to the user. A method for horizontal agarose gel electrophoresis was used to separate the PCR product. The amplified product was detected on a shortwave UV transilluminator.

Labeling of a PCR product with biotin or a fluorescent dye has recently been described, followed by detection of the product by ELISA. This method can be easily adapted to any of the PCR-based assays, including those proposed by the authors of the present invention.

This PCR-based detection method is not only designed to detect various types of pathogenic mycobacteria in a clinical sample, but it can be used to differentiate them into different species using restriction fragment length polymorphism analysis (RFLP) of the amplified PCR fragment. RFLP is a very powerful tool for distinguishing between different species and species strains. This is based on the fact that in each DNA there are sites for one or more restriction endonucleases. These sites accurately recognize class II restriction endonucleases derived from various bacteria. In the natural course of the evolution of an organism, one or more of these sites are modified or lost. Thus, restriction of the DNA fragment by the same enzyme leads to polymorphism of the fragment length between different species of organisms and thus serves as an effective tool for differentiation and epidemiology. AD is a suitable candidate for PCR-RFLP analysis of various types of mycobacteria, since this fragment contains part of two genes with an intergenic region of 167 bp This DNA fragment has pairs of sites for several restriction endonucleases, separated by several bases, which gives fragments in a size range suitable for analysis by polyacrylamide gel electrophoresis, see table 3 (figures 4, 5 and 6). These sites lie in the intergenic region, as well as in the mmaA1 gene (Fig. 4, Fig. 5 and Fig. 6). Restricted product can be easily separated in 10-12% polyacrylamide gel for RFLP mapping of various types. The presence of the intergenic region 167 BP in combination with well-planned sites for some commonly used endonuclease, AD is a suitable candidate for differentiating different types of pathogenic mycobacteria through PCR-RFLP analysis.

Table 3
DNA fragment sizes for several restriction endonucleases Enzyme Number of participants Position The number of restriction fragments Fragment Sizes Haei 2 47 bp, 219 bp 3 47 bp, 144 bp and 172 bp Msp i 2 33 bp, 244 bp 3 33 bp, 119 bp and 211 bp Bsmni 3 74 bp, 239 bp and 333 bp four 30, 74, 94 and 165 bp Cviri 3 61, 257 and 334 bp four 29, 61, 77 and 196 bp Mwoi 3 67, 237 and 331 bp four 32, 67, 94 and 170 bp Taqi 3 98, 142 and 337 bp four 26, 44, 98 and 195 bp Aca iv four 45, 120, 217 and 326 bp 5 37, 45, 75, 97 and 109 bp HaaeIII four 47, 122, 219 and 328 bp 5 35, 47, 75, 97 and 109 bp

Reagents for PCR were prepared and dosed in a clean room for the preparation of reagents for PCR. Samples, culture or purified DNA were never brought into the PCR mix room. Target DNA was added to the PCR mix in a separate room, which was never exposed to amplified DNA. Amplification was carried out in an MJ mini thermal cycler (MJ Research) using 200 μl thin-walled tubes with attached individual caps (Axygen). The first solution added to the PCR tube contained 2.0 μl of 10 x PCR buffer (100 mm Tris pH 8.3, 500 mm KCl, 15 mm MgCl ₂ ), 2.0 μl dNTP mixture (2.0 mm each from dATP, dGTP, dTTP and dCTP), 1.0 μl of primer SEQ ID No: 5 = 5 'TGGATCCGTTGACCATGAGGTGTAATG 3' (5 picomoles / μl), 1.0 μl of primer SEQ ID No: 6 = 5 'GGAATTCCACTACGCACGGACTCTC 3' 5 picomol / μl), 0.2 μl of Taq polymerase containing 1 unit of enzyme, and 11.8 μl of water. PCR tubes were transferred to the sample preparation room and 2.0 μl of DNA was added to them. The tubes were well mixed by tapping and a PCR program was performed with decreasing temperature (Fig. 7). This program provides for one initial denaturation at 9 ° C for 3 minutes. The initial denaturation stage was followed by 14 cycles with decreasing temperature, consisting of one denaturation at 94 ° C for 45 seconds, one annealing starting at 70 ° C for 45 seconds with a decrease of 0.8 ° C in each cycle with decreasing temperature and one extension at 72 ° C for 1 min. This was followed by 25 regular cycles consisting of one denaturation at 94 ° C for 45 seconds, one annealing at 58 ° C for 45 seconds and one completion at 72 ° C for 1 min. After completion of the PCR, the tubes were transferred to another room for analysis of the amplified PCR product. 10 μl of the reaction mixture was applied to a 2.0% agarose gel, another 10 μl of the reaction mixture was saved for PCR-RFLP analysis until needed.

A total of 142 clinical samples were used to evaluate this PCR-based analysis for the detection of pathogenic mycobacteria in clinical samples. Of these, 141 were sputum samples, and one was cerebrospinal fluid.

Of the 74 samples positive by the acid-resistant smear method, 68 were also PCR positive. Four of them were smear positive, but PCR negative. The smear results of all these patients had a scant description of acid-resistant microscopy. In addition, repeated samples from these patients were positive for PCR. Two samples from the same patients were smear positive, but PCR negative. When enhancing the reaction mixture containing DNA from these samples, purified DNA, it was found that these samples contained PCR inhibitors. These samples were again treated with modified lysis buffer and precipitated with isopropanol, increasing amplification. Thirty-one patients were negative by acid-resistant microscopy, but positive by PCR. The clinical history of all these patients showed that they were positive for mycobacteria by the smear method, were treated and became negative for the smear due to the low bacterial load in this sample. The remaining thirty-seven samples were negative in both smear and PCR methods. When studying their medical history, they were found to be negative in other clinical parameters and admitted to the hospital based on preliminary symptoms like fever and cough.

Accordingly, a main embodiment of the present invention relates to a method for detecting pathogenic mycobacteria in clinical samples, wherein said method comprises the steps of:

(a) purification of the clinical sample from contaminants, including mucus, by conventional methods,

(b) treating the purified clinical samples obtained in step (a) with a modified lysis buffer to inactivate live pathogenic mycobacteria to make the process safe for the user,

(c) isolating genomic DNA from the treated clinical sample obtained in step (b) using a modified method to increase the yield and quality of DNA,

(d) constructing the sequence of SEQ ID No: 4 from the DNA obtained in step (c) for the specific detection of pathogenic mycobacteria, wherein said engineered sequence contains a selected intergenic region of SEQ ID No: 3, a flanking region containing a portion of the mmaA1 gene, SEQ ID No: 1 and part of the mmaA2 gene, SEQ ID No: 2, from DNA obtained in stage (c),

(e) design and synthesis of a set of specific oligonucleotide primers from SEQ ID No: 5, which is a direct primer, and SEQ ID No: 6, which is a reverse primer, for the polymerase chain reaction (PCR) amplification of SEQ ID No: 4,

(f) the development of a PCR amplification method for the specific amplification of SEQ ID No: 4 from step (d), where the method involves the use of specific oligonucleotide primers designed and synthesized in step (e) to detect the presence of pathogenic mycobacteria in clinical samples, and

(g) analysis of the amplified PCR product by analysis of restriction fragment length polymorphism (RFLP) to differentiate species of pathogenic mycobacteria to quickly identify co-infection with HIV.

In another embodiment, the present invention relates to SEQ ID No: 4, wherein said SEQ ID has the following sequence 5 'GAGGTGTAATGCCTTTCCGGACCCTAGGTGGCCTTTCGGTGCTTGCACGGAACGCACCGATGCTTCCCCCTCCCCGCATGCTCGAGGCATGCTATCCGATACAGGGCCGCCGCACTAAACCGCGATCGAATTTGCCCAGGTCAGGGAACGGATATGAGCGGACGAG 3'.

In yet another embodiment, the present invention relates to clinical samples selected from sputum, samples of gastric lavage, cerebrospinal fluid, blood, tissue biopsy samples or bone marrow aspirates, and other body fluids or tissues.

In yet another embodiment, the present invention relates to the purification of a sample in step (a) from contamination (living organisms other than mycobacteria and mucus), which is carried out by treatment with a decontamination mixture containing medium strength alkali, NaOH, trisodium citrate, mucolytic agent and guanidine isothiocyanate in the range of about 0.4-2.5 M, followed by concentration of the sample by centrifugation.

In yet another embodiment, the present invention relates to a decontamination mixture containing medium strength alkali, NaOH, trisodium citrate, a mucolytic agent and guanidine isothiocyanate in the range of about 0.5-2.0 M.

In yet another embodiment, the present invention relates to such that the DNA in step (c) is isolated from the treated clinical sample using a modified lysis buffer by incorporating ingredients containing guanidine isothiocyanate in the range of about 0.5-8M, Tris-Cl pH 7.6 in the range of about 20-100 mM, N-lauryl sarcosyl in the range of about 0.5-2%, EDTA in the range of about 0.1-20 mM, β-mercaptoethanol in the range of about 1-25 mM and NH ₄ COOH in the range of about 0.3-1M, and DNA purification for improving the yield by complete precipitation with organic solvents.

In another embodiment, the present invention relates to about 4M guanidine isothiocyanate, about 50 mM Tris-Cl pH 7.6, about 1% N-lauryl sarcosyl, about 1 mM EDTA, about 10 mM β-mercaptoethanol, about 0.7 M NH ₄ COOH.

In yet another embodiment, the present invention relates to organic solvents, wherein the organic solvents are selected from the group consisting of phenol / chloroform and chloroform.

In yet another embodiment, the present invention relates to increasing the yield of genomic DNA in the range of about 25% to about 50%.

In another embodiment, the present invention relates to increasing the yield of genomic DNA in the range of about 30 to 40%.

In yet another embodiment, the present invention relates to a modified lysis buffer, wherein the modified lysis buffer provides cleaner DNA.

In another embodiment, the present invention relates to a treatment where treatment with a modified lysis buffer containing 4M guanidine isothiocyanate inactivates live mycobacteria to make the method safer for the performer.

In yet another embodiment, the present invention relates to the achievement of high-yield DNA amplification in step (f) by modified conditions for lowering PCR cycles, wherein said conditions comprise steps with an initial high annealing temperature in the range of about 62-72 ° C subsequent lowering the temperature in the range of about 0.2-1 ° C per PCR cycle for the first 10-25 cycles, which are the stage of lowering the temperature to the optimum annealing temperature of approximately 56-62 ° C for other 30 PCR cycles.

In yet another embodiment, the present invention relates to the achievement of amplification of DNA in high yield through modified conditions for PCR cycles with lowering temperature, where these conditions include stages with an initial high annealing temperature of approximately 70 ° C followed by a decrease in temperature of approximately 0.8 ° C per PCR cycle for the first about 14 cycles to about 58 ° C for the other 25 PCR cycles.

In another embodiment, the present invention relates to oligonucleotide primers providing amplification of the intergenic region from SEQ ID No: 4 for the detection of pathogenic mycobacteria in clinical samples selected from the group

a. 5 'TGGATCCGTTGACCATGAGGTGTAATG 3' (SEQ ID No: 5), which is a direct primer.

b. 5'GGAATTCCACTACGCACGGACTCTC 3 '(SEQ ID No: 6), which is a reverse primer.

In yet another embodiment, the present invention relates to the length of oligonucleotide primers, where the length of the oligonucleotide primers is between 5 and 100 bases.

In another embodiment, the present invention relates to a diagnostic kit for the detection of pathogenic mycobacteria in clinical samples, containing primers selected from the group including:

(a) 5 'TGGATCCGTTGACCATGAGGTGTAATG 3' (SEQ ID No: 5), which is a direct primer, and

(b) 5 'GGAATTCCACTACGCACGGACTCTC 3' (SEQ ID No: 6), which is a reverse primer.

In yet another embodiment, the present invention relates to the use of primers having the sequences SEQ ID No: 5 and SEQ ID No: 6 for the detection of pathogenic mycobacteria, wherein said method comprises the steps of:

a. isolation of genomic DNA from the treated clinical sample using a modified method to increase the yield and quality of DNA,

b. constructing a sequence from SEQ ID No: 4 from DNA obtained in stage (a) for specific detection of pathogenic mycobacteria, where the specified constructed sequence contains the selected intergenic region of SEQ ID No: 3, a flanking region containing a portion of the mmaA1 gene, SEQ ID NO: 1 and a portion of the mmaA2 gene, SEQ ID No: 2, from the DNA obtained in stage (a),

c. development of a PCR amplification method for the specific amplification of SEQ ID NO: 4 from step (b), and

d. analysis of the amplified PCR product by analysis of restriction fragment length polymorphism (RFLP) to differentiate species of pathogenic mycobacteria to quickly identify co-infection with HIV.

In yet another embodiment, the present invention relates to SEQ ID No: 4, wherein the engineered SEQ ID No: 4 has the following sequence 5'GAGGTGTAATGCCTTTCCGGACCCTAGGTGGCCTTTCGGTGCTTGCACGGAACGCACCGATGCTTCCCCCTCCCCGCATGCTCGAGGCATGCTATCCGATACAGGGCCGCCGCACTAAACCGCGATCGAATTTGCCCAGGTCAGGGAACGGATATGAGCGGACGAG 3 '.

In yet another embodiment, the present invention relates to an application where a clinical sample is selected from sputum, gastric lavage samples, cerebrospinal fluid, blood, tissue biopsy samples or bone marrow aspirates, and other body fluids or tissues.

In another embodiment, the present invention relates to the purification of a sample in step (a) from contaminants (living organisms other than mycobacteria and mucus), which is carried out by treatment with a decontamination mixture containing medium strength alkali, NaOH, trisodium citrate, a mucolytic agent and isothiocyanate guanidine in the range of about 0.4-2.5 M, followed by concentration of the sample by centrifugation.

The present invention is illustrated by the following examples, where the following samples are given to illustrate the present invention and should not be construed as limiting the scope of the present invention.

EXAMPLES

Example 1: Reagents

Trizma (Tris base), N-acetyl-L-cysteine (NALC), ethidium bromide, agarose, K ₂ HPO ₄ , KH ₂ PO ₄ , sodium citrate, N-lauryl sarcosyl, EDTA, 2-mercaptoethanol purchased from Sigma Aldrich , USA.

Thermopolymerase and dNTP are purchased from New England Biolabs, USA.

Plastic products purchased from Axygen USA and Corning-Costar USA.

Example 2: Collection and processing of clinical samples

Clinical samples of 142 sputum and one cerebrospinal fluid from patients were collected in sterile sample vials at Ramakrishna Mission Free Tuberculosis Clinic Karol Bagh, New Delhi, India. Samples were processed immediately whenever possible, or stored at 4 ° C overnight before treatment.

Sputum

Sputum samples were treated with a NALC-NaOH method. Approximately 1-3 ml of sputum was transferred into 15 ml screw cap centrifuge tubes (Corning Costar Corp USA). 1-3 ml of decontamination buffer was added to each sample, mixed gently and allowed to stand for 15 minutes at room temperature. Samples were dissolved in 3 volumes of 0.67 M pH 6.8 phosphate buffer and centrifuged at 3500 g for 15 min in a rotor with shaking cups (Remicetrifuge India). Precipitation was resuspended in 300 μl of sterile distilled water. One third of the treated samples were used for cultivation, if required, and the other two thirds for PCR. The portion set aside for PCR was inactivated and lysed by adding 0.5 ml of lysis buffer to the tubes and heating at 85 ° C for 20 minutes.

Cerebrospinal fluid

Cerebrospinal fluid (CSF) is considered mainly sterile and does not require processing and decontamination. 1-2 ml of cerebrospinal fluid (CSF) was transferred to a microcentrifuge tube (MCT) and centrifuged at 12000 g for 3 minutes in a microcentrifuge (Eppendorf, A.G Germany). The precipitate was washed with 0.067M pH 7.0 phosphate buffer and resuspended in 300 μl of sterile distilled water. No treatment was used for PCR.

Example 3: Getting a smear

Acid-resistant staining was carried out using a basic fuchsin dye according to the Zeihl-Neelsen staining method. From the mucous part of sputum, a small part was smeared over an area of 1 × 2 cm. The smear was fixed for a short time by heating, immersed in the main fuchsin dye, and was briefly heated over a Bunsen burner. Staining was removed with acidic alcohol, 3% sulfuric acid in 95% ethanol. The glasses were washed with distilled water and reversed staining with methylene blue (0.3% methylene blue chloride) for 1-2 minutes. Rinsed with water and dried in air. Glasses were examined under oil with an immersion lens at 400x using a binocular microscope (Zeiss, Germany). Smears were evaluated according to WHO recommendations.

Example 4: Isolation of DNA from Treated Clinical Samples Using Modified Lysis Buffer

A portion (200 μl) of the treated and decontaminated sample was transferred to a microcentrifuge tube. There was added 500 μl of a modified lysis buffer containing 4M guanidine isothiocyanate, 50 mM Tris-Cl (pH 8.0), 1% N-lauryl sarcosyl, 1 mM EDTA, 10 mM 2-mercaptoethanol and 0.2 M NaCl and mixed by inversion . Tubes were incubated at 85 ° C with periodic stirring for 20 min to cell lysis. 200 μl of 2.5M ammonium acetate pH 7.6 was added to the lysate, stirring by inversion. The mixture was centrifuged at 12000 g for 5 minutes. The supernatant was extracted once with phenol and chloroform. DNA was precipitated with 0.8 volumes of isopropyl alcohol. The pellet was thoroughly washed with 70% ethanol, briefly dried in air and dissolved in 30 μl of TE buffer (10 mM Tris-Cl pH 8.3 and 0.01 mM EDTA pH 8.0), 2 μl of this was used for PCR amplification.

Example 5: Design primers

A pair of oligonucleotide primers for amplification of a part of the vital gene of pathogenic mycobacteria was constructed using Primer select software (DNASTAR software from LASERGENE INC). Genes for methyl mycolic acid synthase are a cluster of four genes, mmaA1-mmaA4. These genes are involved in the synthesis and modification of mycolic acids, and report that they are present only in pathogenic mycobacteria. 11 bp the forward primer lies in the intergenic region between the mmaA1 and mmaA2 genes, while the reverse primer is localized in methylmicol synthase gene 1 (mmaA1). These primers were tested for specificity for mycobacteria using the GENOME CALCULATOR software developed by the bioinformatics division of this center. Direct oligonucleotide primer, SEQ ID No: 5, has a length of 27 p. The reverse oligonucleotide primer, SEQ ID No: 6, has a length of 25 base pairs. The forward primer is localized from 1 to 9 bases in the mmaA2 gene, 11 bp of this oligonucleotide primer lie in the spacer region of 167 bp between the mmaA2 and mmaA1 genes.

Reverse primer D, SEQ ID No: 2, is located from 688 to 705 bases in the mmaA1 gene (FIGS. 1 and 2). The primer sequence has seven protruding base pairs at the 5'-end containing the site for the restriction endonuclease Bam HI. The oligonucleotide primer D also has seven protruding base pairs at the 5'-end containing the site for Eco RI. With these primers, a 373 base pair site, called AD, is specifically amplified from the vital gene for pathogenic mycobacteria.

Direct primer SEQ ID No: 5

5 'TGGATCCGTTGACCATGAGGTGTAATG 3'

Reverse Primer SEQ ID No: 6

5 'GGAATTCCACTACGCACGGACTCTC 3'

Example 6: Amplification of PCR AD from DNA isolated from clinical samples

The PCR reaction was carried out in a reaction volume of 20 μl containing 2.0 μl of DNA from the above isolation, 50 mM KCI, 10 mM Tris-Cl pH 8.3, 1.5 mM MgCl ₂ , 10 pmol of each oligonucleotide primer and 1 unit of thermopolymerase . The reactions were carried out in duplicate; in the second case, 2.0 μl of a 10-fold dilution of the DNA described above was used.

Several different cycle conditions to obtain a pure PCR product without non-specific amplification. First, the usual conditions of the cycles, involving one initial denaturation at 95 ° C for 3 minutes, followed by 30 cycles of one denaturation at 94 ° C for 45 seconds, one annealing of the primers at 60 ° C for 45 seconds and one completion at 72 ° C for 1 minute. This was followed by final completion at 72 ° C for 5 minutes. This worked well with purified DNA, but led to non-specific amplification with DNA isolated from clinical samples. To overcome this, a new method of polymerase chain reaction was adopted.

PCR with decreasing temperature

The temperature-lowering PCR method is an effective way to eliminate non-specific amplification and thus improves the yield and efficiency of the PCR reaction. In PCR with decreasing temperature, the annealing temperature of the oligonucleotide primer is slightly higher than the calculated (melting temperature) Tm, and the annealing Tm is reduced in each cycle until the desired annealing temperature is reached. This measure prevents the formation of a nonspecific product in the initial cycles and helps to improve specific amplification, as well as many times improves the efficiency of the PCR reaction.

PCR Cycle Conditions with Temperature Reduction

In this program, after one initial denaturation at 95 ° C for 3 min, 14 cycles with a decrease in temperature followed by one denaturation at 94 ° C for 45 sec, with one annealing starting at 70 ° C for 45 sec with a decrease of 0, 8 ° C in each cycle, one completion at 72 ° C for 1 minute. The temperature decrease was followed by 25 cycles with one denaturation at 94 ° C for 45 sec, one annealing at 58 ° C for 45 sec, and one completion at 72 ° C for 1 minute.

Example 7: Detection of amplified PCR products

Amplified PCR products were analyzed by agarose gel electrophoresis. The reaction mixture after PCR was mixed with 1.0 μl of 6x gel buffer, and the complete reaction mixture was loaded onto a 1.8% agarose gel. Gels were prepared and run in them in 1x TAE buffer (0.04 M Tris-acetate and 0.001 M EDTA). After electrophoresis, the gel was stained in a staining solution containing 0.5 μg / ml ethidium bromide. The gel was photographed and documented using the Eagle eye documentation system (Stratagene).

Advantages of the Present Invention

Several methods for PCR-based detection of mycobacteria in clinical samples are available, as described above. However, each method has its own disadvantages, and none of them is complete. The main disadvantages are in the extraction of DNA from clinical samples. Clinical samples delivered to the laboratory for detection contain some impurities that are purified together with DNA using most of the methods described and interfering with the further stages of detection. The inventors' method for DNA isolation eliminates this isolation and provides pure DNA for PCR. Another advantage of this method is the choice of oligonucleotide primers for specific amplification of the target DNA fragment specific for pathogenic mycobacteria. A set of primers was designed in which one of the primers lies in the intergenic region between the vital genes of mycobacteria, while the other is localized in the vital gene. Thus, this pair of primers is extremely unique for pathogenic mycobacteria and provides specific amplification of a DNA region from pathogenic mycobacteria, and not from other mycobacteria, as reported for many available primers. Another advantage of this method is that it does not provide expensive reagents for amplification of the PCR of the target sequence under stringent conditions to achieve specific amplification, which increases the cost of the test. Instead, this method uses unique looping conditions to achieve specific amplification of the target DNA. Thus, the cost of the test is reduced by approximately 10-20%. Another advantage of this method is due to the unique structure of amplified DNA, which contains the intergenic region, and its flanking region falls on two vital mycobacterial genes, which makes it an ideal target for identifying various strains of pathogenic mycobacteria, based on restriction fragment length polymorphism (RFLP). Another advantage of this method is that this method provides a stage at the beginning of the test, in which pathogenic mycobacteria in clinical samples are inactivated, which makes the method safe for the user.

The following is information on the list of sequences of SEQ ID No: 1, 2, 3, 4, 5, 6.

LIST OF SEQUENCES

GENERAL INFORMATION

APPLICANT: CSIR

TITLE OF THE INVENTION: Method for the Detection of Pathogenic Mycobacteria in Clinical Samples

NUMBER OF SEQUENCES: 06

CORRESPONDENCE ADDRESS: Institute of Genomics and integrative Biology (Formerly Center for Biochemical Technology), Mall Road, Delhi-110007, India, Tel. 00-91-11-7666158. Fax 00-91-7667471

INFORMATION FOR SEQUENCE ID No: 1

1. Characteristics of the sequence:

1. Length: 861 bp

2. Type: DNA

3. Organism: M. tuberculosis

4. Source: natural sequence

5. Name / Designation: mmaA1

6. Sequence ID No: 1

SEQUENCE INFORMATION ID No: 2

1. Characteristics of the sequence:

1. Length: 864 bp

2. Type: DNA

3. Organism: M.tuberculosis

4. Source: natural sequence

5. Name / Designation: mmaA2

6. Sequence ID No: 2

SEQUENCE INFORMATION ID No: 3

1. Characteristics of the sequence:

1. Length: 166 bp

2. Type: DNA

3. Organism: M.tuberculosis

4. Source: natural sequence

5. Name / Designation: intergenic region between mmaA1 and mmaA2

6. Sequence ID No: 3

SEQUENCE INFORMATION ID No: 4

1. Characteristics of the sequence:

2. Length: 363 bp

3. Type: DNA

3. Organism: M. tuberculosis

4. Source: natural sequence and artificial sequence

5. Name / Designation: the area between the forward primer (SEQ ID: 5) and the reverse primer (SEQ ID No: 6)

Sequence ID No: 4

SEQUENCE INFORMATION ID No: 5

1. Characteristics of the sequence:

1. Length: 27 bp

2. Type: DNA

5'TGGATCCGTTGACCATGAGGTGTAATG 3 '

3. Organism: artificial sequence

4. Source: synthetic oligonucleotide

5. Name / Designation: direct primer

6. Sequence ID No: 5

SEQUENCE INFORMATION ID No: 6

1. Characteristics of the sequence:

1. Length: 25 bp

2. Type: DNA

5'GGAATTCCACTACGCACGGACTCTC 3 '

3. Organism: artificial sequence

4. Source: synthetic oligonucleotide

5. Name / Designation: reverse primer

6. Sequence ID No: 6

List of literary sources

Bafica A, Scanga CA, Schito ML, Hieny S, Sher A. 2003 J Immunol Aug 1; 171 (3): 1123-7.

Bennedsen., J, Thomson, VO, Pfyffer, G. E, Funke, J, Feldman, K, Beneke, A, Jenkins, PA, Heginbothom, M., Fahr, A., Hengstler, M., Cleator, G. , Clapper, P and Wilkins, EGI 1996. J. Clin Microbiol. 34: 1407-1411.

Boom, R. C. J. A. Sol, M. M. Salimans, C. L. Jansen, P. M. E. Wertheim-Van Dillen, and J. Van der Noorda. 1990. J. Clin. Microbiol. 28: 495-503.

Brisson-Noel, A., C. Aznar, C. Bureau, S. Nguyen, C. Pierre, M. Bartoli, R. Bonte, G. Pialoux. B. Gicquel, and G. Garrigue. 1991. Lancet 338: 364-366.

Clarridge et al. Journal of Clinical Microbiology 31: 2049-2056, 1993.

Daniel, T. M., and SM Debanne, 1987. Am. Rev. Res. Dis. 135: 1137-1151.

Eisenach. KD, MD Cave, J, H. Bates and JT Crawford. 1990 J. Infect. Dis. 161: 997-981.

Hermans, PWM, ARJ Suchitema, DV Soolingen. CPHJ Verstyner, EM Bik, JER Thole, AHJ Kolk, and JDAV Embden. 1990. J. Clin. Microbiol. 28: 1204-1213.

Kadival. GV, TBMS Mazarelo and SD Chaparas 1986. J. Clin. Microbiol. 23: 901-904.

Kolk AHJ, ARJ Suchitema, S. Kuijper, J. Van Leewen, PMW Hermans, JDA Van Embden, and RA Hartskreel. 1992. J. Clin. Microbiol. 30: 2567-2575.

Kent et al, J. Clin. Microbiol. 33: 2290-2293, 1995.

Kolk et al, J. Clin. Microbiol. 30: 2567-2575, 1992.

Kox at al, J. Clin. Microbiol. 32: 672-678, 1994.

Lee et al, J. Neurological Sciences 123: 173-179, 1994.

Noordhoek, G T., AH T. Kaan, S. Mulder, H. Wilke, and AHJ Kolk. 1995. J. Clin. Pathol : 48: 810-814.

Saiki, RK, DH Gelfand, S Stoffel, SJ Scharf, R. Higuichi, GT Horn, KB Mullis and HA Erlich, 1988. Science. 239: 487-491.

Schirm., J., Oosendrop, LAB, and Milder, JG 1995. J. Clin. Microbiol. 33: 3221-3224.

Thierry. D., A. Brisson-Noel, V. Levy-Frebault, S. Nguyen, J. Guedson, and B. Gicquel 199).

Thierry, D., Cave, M. D, Crawford, J. T, Bates, J. S, Gicquel, B. and Geusdon, JL 1989. Nuc. Acid Res. 18: 188.

Yenez, MA, MP Coppola, DA Russo, E. Delaha, SD Chaparas, and H. Yeager Jr. 1986. J. Clin. Microbiol. 23: 822-825.

Yuen, LK W., Ross, BC, Jackson, KM and Dwyer, B. 1993. J. Clin. Microbiol. 31: 1615-1618.

Zambardi et al, Annales de Biologie Clinique 50: 893-897, 1993.

Claims (15)

1. A method for detecting pathogenic mycobacteria in a clinical sample, wherein said method comprises the steps of: but. purification of the clinical sample from contaminants, including mucus, by conventional methods, to obtain a processed clinical sample, b. processing the purified clinical samples obtained in stage (a) with a lysis buffer to inactivate live pathogenic mycobacteria, from. isolation of genomic DNA from a clinical sample from stage (b), d. amplification of the isolated DNA using polymerase chain reaction (PCR) using oligoprimers with the nucleotide sequences shown in SEQ ID No: 5 and 6, to obtain a PCR product with the nucleotide sequence shown in SEQ ID No: 4, e. further amplification by PCR of the product with the nucleotide sequence shown in SEQ ID No: 4 and obtain an amplified PCR product, f. analysis of the amplified PCR product from step (e) by a method selected from gel electrophoresis, restriction fragment length polymorphism (RFLP) to detect the presence of pathogenic mycobacteria in the sample. 2. The method according to claim 1, where the PCR product with the nucleotide sequence shown in SEQ ID No: 4, has the following nucleotide sequence: 5'TGGATCCGTTGACCATGAGGTGTAATGCCTTTCCGGACCCTAGGT GGCCTTTCGGTGCTTGCACGGAACGCACCGATGCTTCCCCCTCCCC GCATGCTCGAGGCATGCTATCCGATACAGGGCCGCCGCACTAAAC CGCGATCGAATTTGCCCAGGTCAGGGAACGGATATGAGCGGACGA GCTACTTGGTCATGGTGAACTGGGCCACGTTGATTAGGCCTCTGCG GAAGCGCTCCGCGCATCCGGTCAGATAGTGCATGAAGTTGTTGTA GACCTCTTCGGACTGTACGGCGATGGCGCGTTCGCGGGCCCCCCTGT AGGTTGGCGGCCATGCATCGAGAGTCCGTGCGTAGTGGGAATTC-3 ' 3. The method according to claim 1, where the clinical sample is selected from sputum, cerebrospinal fluid, a sample of gastric lavage, blood, tissue biopsy samples or bone marrow aspirates and other body fluids or tissues. 4. The method according to claim 1, where the sample at stage (a) is cleaned of contaminants (living organisms other than mycobacteria and mucus) using a decontamination solution, followed by concentration of the sample by centrifugation. 5. The method according to claim 4, where the solution for decontamination contains guanidine isothiocyanate in the range of about 0.5-2.0 M in addition to medium strength alkali and a mucolytic agent. 6. The method according to claim 1, where the lysis buffer contains guanidine isothiocyanate in the range of about 0.5-8.0 M, Tris-Cl pH 7.6 in the range of about 20-100 mM, N-lauryl sarcosyl in the range of about 0.5 -2%, EDTA in the range of about 0.1-20 mM, β-mercaptoethanol in the range of about 1.0-25.0 mM, and ammonium acetate (CH ₃ COONH ₄ ) in the range of about 0.3-1.0 M. 7. The method according to claim 1, where the extracted DNA from clinical samples is free of non-specific DNA and PCR inhibitors. 8. The method according to claim 1, where the amplification of DNA in stage (e) is achieved by means of PCR cycles with decreasing temperature, where these conditions include stages with an initial annealing temperature in the range of 62-72 ° C, followed by a decrease in temperature in the range of approximately 0 , 2-1 ° C per PCR cycle for the first 10-25 cycles, which are the stage of lowering the temperature to the optimum annealing temperature of approximately 56-62 ° C for the other 30 PCR cycles. 9. The method according to claim 1, where the oligonucleotide primers that provide amplification of a DNA fragment for specific detection of pathogenic mycobacteria in clinical samples are selected from the group: but. 5 'TGGATCCGTTGACCATGAGGTGTAATG 3' (SEQ ID No: 5), which is a direct primer. b. 5'GGAATTCCACTACGCACGGACTCTC 3 '(SEQ ID No: 6), which is a reverse primer. 10. The method according to claim 1, where the length of the oligonucleotide primers is between 5 and 100 nucleotides. 11. A diagnostic kit for the detection of pathogenic mycobacteria in a clinical sample, containing: but. direct primer SEQ ID No: 5 and b. reverse primer SEQ ID No: 6. 12. The diagnostic kit according to claim 11, where SEQ ID No: 5 is 5 'TGGATCCGTTGACCATGAGGTGTAATG 3' 13. The diagnostic kit according to claim 11, where SEQ ID No: 6 is 5 'GGAATTCCACTACGCACGGACTCTC 3'. 14. The use of primers having the nucleotide sequences shown in SEQ. ID No: 5 and SEQ ID No: 6 for the detection of pathogenic mycobacteria in a clinical sample. 15. A kit for the detection of pathogenic mycobacteria containing primers having the nucleotide sequences shown in SEQ ID No: 5 and 6, where but. 5 'TGGATCCGTTGACCATGAGGTGTAATG 3' (SEQ ID No: 5), which is a direct primer. b. 5 'GGAATTCCACTACGCACGGACTCTC 3' (SEQ ID No: 6), which is a reverse primer.

Images